Sample records for aeruginosa acinetobacter baumannii

  1. Membrane proteomes of Pseudomonas aeruginosa and Acinetobacter baumannii.


    Dé, E; Cosette, P; Coquet, L; Siroy, A; Alexandre, S; Duncan, A; Naudin, B; Rihouey, C; Schaumann, A; Junter, G A; Jouenne, T


    Acinetobacter baumannii and Pseudomonas aeruginosa are known for their intrinsic resistance to antibiotics. Between mechanisms involved in this resistance, diminished expression of outer membrane proteins and up-regulation of efflux pumps play an important role. The characterization of membrane proteins is consequently necessary because of their importance in the antibiotic resistance but also in virulence. This review presents proteomic investigations aiming to describe the protein content of the membranes of these two bacterial species.

  2. In Vitro Efficacy of Doripenem against Pseudomonas aeruginosa and Acinetobacter baumannii by E-Test.


    Gilani, Mehreen; Munir, Tehmina; Latif, Mahwish; Rehman, Sabahat; Ansari, Maliha; Hafeez, Amira; Najeeb, Sara; Saad, Nadia; Gilani, Mehwish


    To assess the in vitro efficacy of doripenem against Pseudomonas aeruginosa and Acinetobacter baumannii using Epsilometer strips. Cross-sectional study. Department of Microbiology, Army Medical College, Rawalpindi and National University of Sciences and Technology, Islamabad, from May 2014 to September 2014. A total of 60 isolates of Acinetobacter baumannii and Pseudomonas aeruginosa collected from various clinical samples received from Military Hospital were included in the study. The specimens were inoculated onto blood, MacConkey and chocolate agars. The isolates were identified using Gram staining, motility, catalase test, oxidase test and API 20NE (Biomeriux, France). Organisms identified as Acinetobacter baumannii and Pseudomonas aeruginosa were included in the study. Bacterial suspensions equivalent to 0.5 McFarland turbidity standard of the isolates were prepared and applied on Mueller Hinton agar. Epsilometer strip was placed in the center of the plate and incubated for 18-24 hours. Minimum Inhibitory Concentration (MIC) was taken to be the point where the epsilon intersected the E-strip. MIC of all the isolates was noted. For Pseudomonas aeruginosa isolates, MIC(50) was 12 µg/mL and MIC(90) was 32 µg/mL. For Acinetobacter baumannii MIC(50) and MIC(90) was 32 µg/mL. Doripenem is no more effective against Pseudomonas aeruginosa and Acinetobacter baumannii in our setting.

  3. Carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii in the nosocomial setting in Latin America.


    Labarca, Jaime A; Salles, Mauro José Costa; Seas, Carlos; Guzmán-Blanco, Manuel


    Increasing prevalence of carbapenem-resistant Pseudomonas aeruginosa and Acinetobacter baumannii strains in the nosocomial setting in Latin America represents an emerging challenge to public health, as the range of therapeutic agents active against these pathogens becomes increasingly constrained. We review published reports from 2002 to 2013, compiling data from throughout the region on prevalence, mechanisms of resistance and molecular epidemiology of carbapenem-resistant strains of P. aeruginosa and A. baumannii. We find rates of carbapenem resistance up to 66% for P. aeruginosa and as high as 90% for A. baumannii isolates across the different countries of Latin America, with the resistance rate of A. baumannii isolates greater than 50% in many countries. An outbreak of the SPM-1 carbapenemase is a chief cause of resistance in P. aeruginosa strains in Brazil. Elsewhere in Latin America, members of the VIM family are the most important carbapenemases among P. aeruginosa strains. Carbapenem resistance in A. baumannii in Latin America is predominantly due to the oxacillinases OXA-23, OXA-58 and (in Brazil) OXA-143. Susceptibility of P. aeruginosa and A. baumannii to colistin remains high, however, development of resistance has already been detected in some countries. Better epidemiological data are needed to design effective infection control interventions.

  4. In vitro sensitivity of Acinetobacter baumannii and Pseudomonas aeruginosa to carbapenems among intensive care unit patients.


    Guzek, A; Korzeniewski, K; Nitsch-Osuch, Aneta; Rybicki, Z; Prokop, E


    Acinetobacter baumannii and Pseudomonas aeruginosa pathogens are the most common causes of fatal pneumonia among patients treated in Intensive Care Units (ICU). Carbapenems remain a group of antibiotics characterized by the highest effectiveness in treatment of heavy infections of the lower respiratory tract. This study compared in vitro sensitivity of A. baumannii and P. aeruginosa to three carbapenems: imipenem, meropenem and doripenem. The material was collected from 71 patients treated in the ICU from April 2009 to January 2010. Bronchial tree was the predominant source of samples. Fifty-four strains of A. baumannii and 17 strains of P. aeruginosa were analyzed. Sensitivity to carbapenems was interpreted in line with Clinical and Laboratory Standard Institute (CLSI) and European Committee for Antimicrobial Susceptibility Testing (EUCAST) criteria (imipenem and meropenem) or in compliance with the Food and Drug Administration (FDA) and CLSI guidelines (doripenem). We found that A. baumannii was significantly more often sensitive to imipenem than to doripenem and meropenem, but only according to the CLSI and FDA and not EUCAST criteria. The sensitivity of P. aeruginosa was higher to imipenem than to doripenem and meropenem, according to both CLSI and EUCAST criteria (64.7 %). We conclude that the EUCAST criteria demonstrate a higher rigor than those of CLSI and FDA in the determination of carbapenems sensitivity. Imipenem appears more effective than doripenem and meropenem in treatment of A. baumannii and P. aeruginosa infections.

  5. Invitro Apramycin Activity against multidrug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa.


    Kang, Anthony D; Smith, Kenneth P; Eliopoulos, George M; Berg, Anders H; McCoy, Christopher; Kirby, James E


    The in vitro activity of apramycin was compared to that of amikacin, gentamicin, and tobramycin against multidrug-resistant, extensively drug-resistant, and pandrug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa. Apramycin demonstrated an MIC50/MIC90 of 8/32μg/ml for A. baumannii and 16/32μg/ml for P. aeruginosa. Only 2% of A. baumannii and P. aeruginosa had an MIC greater than an epidemiological cutoff value of 64μg/ml. In contrast, the MIC50/MIC90 for amikacin, gentamicin, and tobramycin were ≥64/>256μg/ml for A. baumannii with 57%, 95%, and 74% of isolates demonstrating resistance, respectively, and the MIC50/MIC90 were ≥8/256μg/ml for P. aeruginosa with 27%, 50%, and 57% of strains demonstrating resistance, respectively. Apramycin appears to offer promising in vitro activity against highly resistant pathogens. It therefore may warrant further pre-clinical study to assess potential for repurposing as a human therapeutic and relevance as a scaffold for further medicinal chemistry exploration.

  6. Detection of NDM-2-producing Acinetobacter baumannii and VIM-producing Pseudomonas aeruginosa in Palestine.


    Sjölander, Isabella; Hansen, Frank; Elmanama, Abdelraouf; Khayyat, Rasha; Abu-Zant, Alaeddin; Hussein, Ayman; Taha, Adham Abu; Hammerum, Anette M; Ciofu, Oana


    The aim of this study was to screen for carbapenem-resistant Gram-negative bacteria in Palestine and subsequently to identify and investigate the mechanisms of resistance. For a period of 6 weeks, all Gram-negative isolates were collected from six Palestinian hospital laboratories and were tested for susceptibility using 10μg meropenem disks. Isolates showing resistance to meropenem were further investigated. The presence of carbapenemases was assessed by PCR. In addition, antimicrobial susceptibility testing, an efflux pump inhibitor assay and pulsed-field gel electrophoresis (PFGE) were performed. Isolates producing carbapenemases were further investigated by multilocus sequence typing (MLST). In total, 248 Gram-negative isolates were collected from the six laboratories. Among the 248 tested isolates, 15 Acinetobacter baumannii and 6 Pseudomonas aeruginosa were resistant to meropenem. One A. baumannii from Gaza produced NDM-2 and belonged to ST103. Thirteen of the carbapenem-resistant A. baumannii isolates possessed the intrinsic upregulated blaOXA-66 gene and one isolate carried blaOXA-51. All but one of the OXA-66-producing A. baumannii belonged to ST2; the remaining isolate belonged to ST183. One of the carbapenem-resistant P. aeruginosa was classified as VIM-4-producing and three were VIM-2-producing isolates. The three VIM-2-producing isolates belonged to three new sequences types (ST1562, ST1563 and ST1564). All of the carbapenemase-producing isolates were multiresistant non-fermenters. To the best of our knowledge, this is the first report on NDM-producing A. baumannii and VIM-producing P. aeruginosa from Palestine. Copyright © 2013 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  7. Assessment of antivirulence activity of several d-amino acids against Acinetobacter baumannii and Pseudomonas aeruginosa.


    Rumbo, C; Vallejo, J A; Cabral, M P; Martínez-Guitián, M; Pérez, A; Beceiro, A; Bou, G


    Biofilm formation and bacterial adherence are important requirements for persistence, multidrug resistance and infection. The d-amino acids play a role as modulators of bacterial growth and persistence, though their ability to inhibit biofilms is much debated. In this study, we analysed the effects of 18 different d-amino acids on the pathogens Acinetobacter baumannii and Pseudomonas aeruginosa. In vitro assays were carried out to analyse the effect of d-amino acids on bacterial growth, biofilm formation/disassembly, capacity to attach to eukaryotic cells and cellular death. In addition, in vivo assays were performed in mice, using experimental models of sepsis and pneumonia. Biofilm formation was inhibited in A. baumannii by d-His, d-Cys and d-Trp (35%-86%) at 2 mM and in P. aeruginosa by d-Cys, d-Trp and d-Tyr (10%-30%) at 4 mM. Attachment to the A549 human alveolar cells was reduced in A. baumannii by d-Cys, d-His, d-Met, d-Val and d-Ser, and in P. aeruginosa by d-Arg and d-Trp. Growth was inhibited in A. baumannii by d-Cys and d-Trp, and in P. aeruginosa by d-Trp. In virulence assays, incubation of alveolar cells infected with P. aeruginosa with d-Cys, d-Trp and d-Arg reduced cell death (56%-45%). However, no significant effect of d-amino acids was observed in vivo. Some d-amino acids can inhibit bacterial growth, biofilm formation and adherence to eukaryotic cells in A. baumannii and P. aeruginosa, and showed a protective effect against infection of alveolar cells with P. aeruginosa. Despite the fact that some considerable protection was observed in mice, survival differences between treated and control groups were not statistically significant. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  8. Exploiting Quorum Sensing Inhibition for the Control of Pseudomonas Aeruginosa and Acinetobacter Baumannii Biofilms.


    Castillo-Juarez, Israel; López-Jácome, Luis Esaú; Soberón-Chávez, Gloria; Tomás, María; Lee, Jintae; Castañeda-Tamez, Paulina; Hernández-Bárragan, Iván Ángelo; Cruz-Muñiz, Martha Yumiko; Maeda, Toshinari; Wood, Thomas K; García-Contreras, Rodolfo


    Pseudomonas aeruginosa and Acinetobacter baumannii are two of the main bacteria responsible for nosocomial infections; both organisms are resistant to several classes of antibiotics making their infections very difficult to treat. Moreover, they possess a remarkable ability to form biofilms, which further enhances their antimicrobial resistance. Both organisms coordinate their formation of biofilms and their expression of virulence factors through quorum sensing, a system that regulates gene expression at high cell densities and that plays a key role in the establishment of bacterial infections. Hence, interfering with these quorum-sensing systems has been proposed as an alternative to traditional antibiotics for the eradication of bacterial infections. In this review, we describe the quorum sensing systems of both organisms, the way they coordinate the formation of biofilms, the recent advances in biofilm disruption by quorum sensing interference, and the advantages and limitations of the implementation of these novel therapeutic options in the clinic.

  9. In Vitro Activity of RX-P873 against Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii

    PubMed Central

    Rhomberg, Paul R.; Jones, Ronald N.; Farrell, David J.


    RX-P873 is a novel antibiotic from the pyrrolocytosine series which exhibits high binding affinity for the bacterial ribosome and broad-spectrum antibiotic properties. The pyrrolocytosines have shown in vitro activity against multidrug-resistant Gram-negative and Gram-positive strains of bacteria known to cause complicated urinary tract, skin, and lung infections, as well as sepsis. Enterobacteriaceae (657), Pseudomonas aeruginosa (200), and Acinetobacter baumannii (202) isolates from North America and Europe collected in 2012 as part of a worldwide surveillance program were tested in vitro by broth microdilution using Clinical and Laboratory Standards Institute (CLSI) methodology. RX-P873 (MIC90, 0.5 μg/ml) was >32-fold more active than ceftazidime and inhibited 97.1% and 99.5% of Enterobacteriaceae isolates at MIC values of ≤1 and ≤4 μg/ml, respectively. There were only three isolates with an MIC value of >4 μg/ml (all were indole-positive Protea). RX-P873 (MIC50/90, 2/4 μg/ml) was highly active against Pseudomonas aeruginosa isolates, including isolates which were nonsusceptible to ceftazidime or meropenem. RX-P873 was 2-fold less active against P. aeruginosa than tobramycin (MIC90, 2 μg/ml; 91.0% susceptible) and colistin (MIC90, 2 μg/ml; 99.5% susceptible) and 2-fold more potent than amikacin (MIC90, 8 μg/ml; 93.5% susceptible) and meropenem (MIC90, 8 μg/ml; 76.0% susceptible). RX-P873, the most active agent against Acinetobacter baumannii (MIC90, 1 μg/ml), was 2-fold more active than colistin (MIC90, 2 μg/ml; 97.0% susceptible) and 4-fold more active than tigecycline (MIC90, 4 μg/ml). This novel agent merits further exploration of its potential against multidrug-resistant Gram-negative bacteria. PMID:25645834

  10. Screening of antibiotics resistance to Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii by an advanced expert system.


    Nakamura, Tatsuya; Takahashi, Hakuo


    The VITEK2 advanced expert system (AES) gives information about the antibiotics-resistance mechanisms based on the biological validation derived from the VITEK2 susceptibility result. In this study, we investigated whether or not this system correctly categorized the beta-lactamase resistance mechanism data derived from the VITEK2 susceptibility result using the testing card, AST-N025, with Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii. We used 131 strains, and their phenotypes were determined according to the biological and genetic screening. The AES analysis result matched the phenotype testing in 120 (91.6%) of the 131 strains. Incorrect findings were found in six strains, including three strains of Serratia marcescens. The resistance mechanism could not be determined in five strains, including three strains of Providencia rettgeri. The analysis of those phenotypes agreed in 34 (97.1%) among 35 strains with extended spectrum beta-lactamase (ESBL), and in 27 (96.4%) among 28 strains with high-level cephalosporinase. The agreement ratio in the phenotype was very high as we expected. The incorrect and nondeterminable samples were strains with relatively high cephalosporinase that has variation of outer membrane protein. The AES was able to detect the phenotype for carbapenemase. The AES is a clinically useful system that allows taking prompt measures to treat patients because it can provide information about the resistance mechanism in less than half a day after starting the analysis.

  11. Time-kill effect of levofloxacin on multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii: synergism with imipenem and colistin.


    Safarika, A; Galani, I; Pistiki, A; Giamarellos-Bourboulis, E J


    In the present study, we challenged the concept that levofloxacin should not be used for the management of ventilator-associated pneumonia (VAP) when minimum inhibitory concentrations (MICs) exceed 2 μg/ml. Multidrug-resistant (MDR) and genetically distinct isolates of Pseudomonas aeruginosa (n = 49) and Acinetobacter baumannii (n = 29) from patients with VAP were exposed over time to levofloxacin, imipenem, colistin and their combinations. Synergy between levofloxacin and imipenem was found in 55.3 % and between levofloxacin and colistin in 90.9 % of isolates of P. aeruginosa within the first 4 h of growth. Synergy with imipenem but not with colistin was dependent of the MIC. Synergy between levofloxacin and imipenem was found in 58.6 % of isolates of A. baumannii after 24 h of growth. Considerable synergy was found between levofloxacin and colistin, reaching 84.8 % of isolates of A.baumannii after 6 h of growth. Synergy was independent from the MIC. These results create hopes that levofloxacin can be used as combination therapy for infections by MDR bacteria.

  12. Presence of high-risk clones of OXA-23-producing Acinetobacter baumannii (ST79) and SPM-1-producing Pseudomonas aeruginosa (ST277) in environmental water samples in Brazil.


    Turano, Helena; Gomes, Fernando; Medeiros, Micheli; Oliveira, Silvane; Fontes, Lívia C; Sato, Maria I Z; Lincopan, Nilton


    This study reports the presence of hospital-associated high-risk lineages of OXA-23-producing ST79 Acinetobacter baumannii and SPM-1-producing ST277 Pseudomonas aeruginosa in urban rivers in Brazil. These findings indicate that urban rivers can act as reservoirs of clinically important multidrug-resistant bacteria, which constitute a potential risk to human and animal health.

  13. [Shall we report the carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii strains detected by BD Phoenix system?].


    Oğünç, Dilara; Ongüt, Gözde; Ozen, Nevgün Sepin; Baysan, Betil Ozhak; Günseren, Filiz; Dağlar, Duygu; Demirbakan, Hadiye; Gültekin, Meral


    Imipenem and meropenem are broad spectrum antimicrobial agents that are especially useful in the treatment of nosocomially acquired Pseudomonas aeruginosa and Acinetobacter spp. infections. Previous reports have noted that susceptibility tests could show false resistance to imipenem. For this reason, Centers for Disease Control and Prevention has recommended that all carbapenem resistant or intermediate resistant isolates should be tested with an additional method to verify the results. This study was aimed to evaluate the imipenem and meropenem susceptibilities by disk diffusion, E-test and broth microdilution in P. aeruginosa and Acinetobacter baumannii strains found to be resistant or intermediate to imipenem-meropenem by BD Phoenix automated susceptibility testing system. Between January 2006-January 2007, 85 non-duplicate isolates of A. baumannii and 51 non-duplicate isolates of P. aeruginosa which were determined as resistant or intermediate resistant to imipenem and/or meropenem by BD Phoenix automated identification and susceptibility system (Becton Dickinson, Sparks, MD, USA) were collected in Akdeniz University Hospital Central Laboratory. All strains were tested by E-test (AB Biodisk, Sweden), disk diffusion and reference broth microdilution (BMD) method following CLSI recommendations. All 51 isolates of P. aeruginosa determined as imipenem and/or meropenem resistant or intermediate resistant by BD Phoenix, were found to be imipenem and/or meropenem resistant or intermediate resistant by the reference BMD method. Minor error rates were same for all testing systems (1.9%) except for the meropenem results of BD Phoenix system (5.9%). No major errors were produced by any system. For A. baumannii, only one very major error was detected for meropenem by BD Phoenix system. Number of minor errors determined for meropenem by all testing systems compared to the reference test, ranged from 2 (2.4%) to 3 (3.5%). It was concluded that carbapenem susceptibility test

  14. Detection of the KPC Gene in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii during a PCR-Based Nosocomial Surveillance Study in Puerto Rico▿

    PubMed Central

    Robledo, Iraida E.; Aquino, Edna E.; Vázquez, Guillermo J.


    A 6-month, PCR-based, island-wide hospital surveillance study of beta-lactam resistance in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii was conducted in Puerto Rico. Of 10,507 isolates, 1,239 (12%) unique, multi-beta-lactam-resistant isolates from all geographical regions were identified. The KPC gene was detected in 61 E. coli, 333 K. pneumoniae, 99 P. aeruginosa, and 41 A. baumannii isolates, indicating the widespread dissemination of the KPC gene in clinically significant nosocomial isolates. PMID:21444702

  15. Pharmacodynamic modeling of aminoglycosides against Pseudomonas aeruginosa and Acinetobacter baumannii: identifying dosing regimens to suppress resistance development.


    Tam, Vincent H; Ledesma, Kimberly R; Vo, Giao; Kabbara, Samer; Lim, Tze-Peng; Nikolaou, Michael


    To facilitate optimal dosing regimen design, we previously developed a mathematical model using time-kill study data to predict the responses of Pseudomonas aeruginosa to various pharmacokinetic profiles of meropenem and levofloxacin. In this study, we extended the model to predict the activities of gentamicin and amikacin exposures against P. aeruginosa and Acinetobacter baumannii, respectively. The input data were from a time-kill study with 10(7) CFU/ml of bacteria at baseline. P. aeruginosa ATCC 27853 was exposed to gentamicin (0 to 16x MIC; MIC = 2 mg/liter), and A. baumannii ATCC BAA 747 was exposed to amikacin (0 to 32x MIC; MIC = 4 mg/liter) for 24 h. Using the estimates of the best-fit model parameters, bacterial responses to various fluctuating aminoglycoside exposures (half-life, 2.5 h) over 72 h were predicted via computer simulation. The computer simulations were subsequently validated using an in vitro hollow-fiber infection model with similar aminoglycoside exposures. A significant initial reduction in the bacterial burden was predicted for all gentamicin exposures examined. However, regrowth over time due to resistance emergence was predicted for regimens with a maximum concentration of the drug (C(max))/MIC (dosing frequency) of 4 (every 8 h [q8h]), 12 (q24h), and 36 (q24h). Sustained suppression of bacterial populations was forecast with a C(max)/MIC of 30 (q12h). Similarly, regrowth and suppression of A. baumannii were predicted and experimentally verified with a three-dimensional response surface. The mathematical model was reasonable in predicting extended bacterial responses to various aminoglycoside exposures qualitatively, based on limited input data. Our approach appears promising as a decision support tool for dosing regimen selection for antimicrobial agents.

  16. [Prevalence of Acinetobacter baumannii and Pseudomonas aeruginosa isolates resistant to imipenem by production of metallo-β-lactamases in Rabat Military Teaching Hospital Mohammed V].


    Gildas Comlan Zohoun, Alban; Moket, Danièle; El Hamzaoui, Sakina


    We studied the production of metallo-β-lactamases (MBL) in Acinetobacter baumannii and Pseudomonas aeruginosa strains resistant to imipenem at the Rabat Mohammed V military teaching hospital, according to Yong et al.'s method, using a sterilized solution of EDTA 0.5 M pH 8. One hundred and five bacterial strains (48 A. baumannii and 57 P. aeruginosa) were identified. 45 (42.9%) with 34 A. baumannii and 11 P. aeruginosa were resistant to imipenem. The prevalence of MBL producing strains was 22.2% (10/45). The existence of this isolates resistant to imipenem by producing metallo-β-lactamases is an emerging public health problem. It is necessary to implemente infection control programs to avoid spreading of multidrug resistant bacteria.

  17. An Investigation of Antibacterial Resistance Patterns Among Acinetobacter baumannii and Pseudomonas aeruginosa Isolates Collected from Intensive Care Units of a University-Affiliated Hospital in Ahvaz, Iran

    PubMed Central

    Izadpour, Farrokh; Ranjbari, Nastaran; Aramesh, Mohammad-Reza; Moosavian, Mojtaba; ShahAli, Shiva; Larki, Farzaneh; Tabesh, Hamed; Morvaridi, Afrooz


    Background In recent decades, multidrug-resistant non-fermenting Gram-negative pathogens, particularly Acinetobacter baumannii and Pseudomonas aeruginosa, have been recognized as a major cause of healthcare-associated and nosocomial infections and outbreaks. Objectives The aim of this study was to determine the prevalence and pattern of antibiotic resistance in A. baumannii and P. aeruginosa isolates collected from intensive care units (ICUs). Methods One hundred fifty-five clinical isolates, including 80 (51.6%) isolates of A. baumannii and 75 (48.4%) isolates of P. aeruginosa, from hospitalized patients in the ICUs of a teaching hospital in Ahvaz, Iran, were collected from January 1 to December 30, 2013. The organisms were identified with conventional bacteriological methods, and antimicrobial susceptibility testing was performed on all isolates in accordance with clinical laboratory and standards institute (CLSI) guidelines. Results The maximum resistance rates among A. baumannii isolates were observed for ciprofloxacin and trimethoprim-sulfamethoxazole (96.9% and 95.2%, respectively). For P. aeruginosa isolates, the maximum resistance rates were reported for ceftriaxone and trimethoprim-sulfamethoxazole (97.2% and 92.4%, respectively). Conclusions The majority of A. baumannii and P. aeruginosa isolates were found to be resistant to commonly recommended antibiotics. Therefore, surveillance of antibiotic consumption and proper antibiotic administration guidelines are essential for preventing major outbreaks in the future. PMID:27800136

  18. In vitro efficacy of copper and silver ions in eradicating Pseudomonas aeruginosa, Stenotrophomonas maltophilia and Acinetobacter baumannii: implications for on-site disinfection for hospital infection control.


    Huang, Hsin-I; Shih, Hsiu-Yun; Lee, Chien-Ming; Yang, Thomas C; Lay, Jiunn-Jyi; Lin, Yusen E


    Pseudomonas aeruginosa, Stenotrophomonas maltophilia and Acinetobacter baumannii are major opportunistic waterborne pathogens causing hospital-acquired infections. Copper-silver ionization has been shown to be effective in controlling Legionella colonization in hospital water systems. The objective was to determine the efficacy of copper and silver ions alone and in combination in eradicating P. aeruginosa, S. maltophilia and A. baumannii at the concentration applied to Legionella control. Kill curve experiments and mathematical modeling were conducted at copper and silver ion concentrations of 0.1, 0.2, 0.4, 0.8 and 0.01, 0.02, 0.04, 0.08 mg/L, respectively. The combinations of copper and silver ions were tested at concentrations of 0.2/0.02 and 0.4/0.04 mg/L, respectively. Initial organism concentration was ca. of 3 x 10(6)cfu/mL, and viability of the test organisms was assessed at predetermined time intervals. Samples (0.1 mL) withdrawn were mixed with 10 microL neutralizer solution immediately, serially diluted and plated in duplicate onto blood agar plates. The culture plates were incubated for 48 h at 37 degrees C and enumerated for the cfu (detection limit 10 cfu/mL). The results showed all copper ion concentrations tested (0.1-0.8 mg/L) achieved more than 99.999% reduction of P. aeruginosa which appears to be more susceptible to copper ions than S. maltophilia and A. baumannii. Silver ions concentration of 0.08 mg/L achieved more than 99.999% reduction of P. aeruginosa, S. maltophilia and A. baumannii in 6, 12 and 96 h, respectively. Combination of copper and silver ions exhibited a synergistic effect against P. aeruginosa and A. baumannii while the combination exhibited an antagonistic effect against S. maltophilia. Ionization may have a potential to eradicate P. aeruginosa, S. maltophilia and A. baumannii from hospital water systems.

  19. Pharmacodynamic comparisons of antimicrobials against nosocomial isolates of escherichia coli, klebsiella pneumoniae, acinetobacter baumannii and pseudomonas aeruginosa from the MYSTIC surveillance program: the OPTAMA Program, South America 2002.


    Kiffer, Carlos R V; Mendes, Caio; Kuti, Joseph L; Nicolau, David P


    The OPTAMA (Optimizing Pharmacodynamic Target Attainment using the MYSTIC [Meropenem Yearly Susceptibility Test Information Collection] Antibiogram) Program provides insight into the appropriate antibiotic options for empiric therapy for common nosocomial pathogens. In this report, South America is represented by Brazil, Colombia, Peru, and Venezuela. A 5000-subject Monte Carlo Simulation estimated pharmacodynamic target attainment for meropenem, imipenem, ceftazidime, cefepime, piperacillin/tazobactam, and ciprofloxacin against Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. Pharmacokinetic parameter variability was derived from existing healthy volunteer data, and minimum inhibitory concentration (MIC) data came from the 2002 MYSTIC program. Piperacillin/tazobactam and ciprofloxacin displayed the lowest target attainment against all bacterial species (14% to 24% for A. baumannii, 26% to 37% for P. aeruginosa, and 48% to 66% for the Enterobacteriaceae). Overall, the carbapenems had the highest probabilities of attainment against the Enterobacteriaceae (98% to 100%) and A. baumannii (73% to 74%), whereas cefepime obtained the greatest target attainment against P. aeruginosa (65%). Because no single regimen had high target attainment against A. baumannii and P. aeruginosa, the use of combination therapy to treat these pathogens in South America may be justified. Because of the lack of agreement with percent susceptibility for certain antimicrobial regimens, the use of pharmacodynamic target attainment may be a more accurate predictor of microbiologic success.

  20. Pitfalls associated with evaluating enzymatic quorum quenching activity: the case of MomL and its effect on Pseudomonas aeruginosa and Acinetobacter baumannii biofilms

    PubMed Central

    Zhang, Yunhui; Brackman, Gilles


    Background The enzymatic degradation of quorums sensing (QS) molecules (called quorum quenching, QQ) has been considered as a promising anti-virulence therapy to treat biofilm-related infections and combat antibiotic resistance. The recently-discovered QQ enzyme MomL has been reported to efficiently degrade different N-acyl homoserine lactones (AHLs) of various Gram-negative pathogens. Here we investigated the effect of MomL on biofilms formed by two important nosocomial pathogens, Pseudomonas aeruginosa and Acinetobacter baumannii. Methods MomL was expressed in E.coli BL21 and purified. The activity of MomL on AHLs with hydroxyl substituent was tested. Biofilms of P. aeruginosa PAO1 and Acinetobacter strains were formed in 96-well microtiter plates. Biofilm formation was evaluated by crystal violet staining, plating and fluorescence microscopy. The effect of MomL on biofilm susceptibility to antibiotics was also tested. We further evaluated MomL in dual-species biofilms formed by P. aeruginosa and A. baumannii, and in biofilms formed in a wound model. The effect of MomL on virulence of A. baumannii was also tested in the Caenorhabditis elegans model. Results MomL reduced biofilm formation and increased biofilm susceptibility to different antibiotics in biofilms of P. aeruginosa PAO1 and A. baumannii LMG 10531 formed in microtiter plates in vitro. However, no significant differences were detected in the dual-species biofilm and in wound model biofilms. In addition, MomL did not affect virulence of A. baumannii in the C. elegans model. Finally, the effect of MomL on biofilm of Acinetobacter strains seems to be strain-dependent. Discussion Our results indicate that although MomL showed a promising anti-biofilm effect against P. aeruginosa and A. baumanii biofilms formed in microtiter plates, the effect on biofilm formation under conditions more likely to mimic the real-life situation was much less pronounced or even absent. Our data indicate that in order to obtain a

  1. Pitfalls associated with evaluating enzymatic quorum quenching activity: the case of MomL and its effect on Pseudomonas aeruginosa and Acinetobacter baumannii biofilms.


    Zhang, Yunhui; Brackman, Gilles; Coenye, Tom


    The enzymatic degradation of quorums sensing (QS) molecules (called quorum quenching, QQ) has been considered as a promising anti-virulence therapy to treat biofilm-related infections and combat antibiotic resistance. The recently-discovered QQ enzyme MomL has been reported to efficiently degrade different N-acyl homoserine lactones (AHLs) of various Gram-negative pathogens. Here we investigated the effect of MomL on biofilms formed by two important nosocomial pathogens, Pseudomonas aeruginosa and Acinetobacter baumannii. MomL was expressed in E.coli BL21 and purified. The activity of MomL on AHLs with hydroxyl substituent was tested. Biofilms of P. aeruginosa PAO1 and Acinetobacter strains were formed in 96-well microtiter plates. Biofilm formation was evaluated by crystal violet staining, plating and fluorescence microscopy. The effect of MomL on biofilm susceptibility to antibiotics was also tested. We further evaluated MomL in dual-species biofilms formed by P. aeruginosa and A. baumannii, and in biofilms formed in a wound model. The effect of MomL on virulence of A. baumannii was also tested in the Caenorhabditis elegans model. MomL reduced biofilm formation and increased biofilm susceptibility to different antibiotics in biofilms of P. aeruginosa PAO1 and A. baumannii LMG 10531 formed in microtiter plates in vitro. However, no significant differences were detected in the dual-species biofilm and in wound model biofilms. In addition, MomL did not affect virulence of A. baumannii in the C. elegans model. Finally, the effect of MomL on biofilm of Acinetobacter strains seems to be strain-dependent. Our results indicate that although MomL showed a promising anti-biofilm effect against P. aeruginosa and A. baumanii biofilms formed in microtiter plates, the effect on biofilm formation under conditions more likely to mimic the real-life situation was much less pronounced or even absent. Our data indicate that in order to obtain a better picture of potential

  2. Surveillance for Antimicrobial Susceptibility among Clinical Isolates of Pseudomonas aeruginosa and Acinetobacter baumannii from Hospitalized Patients in the United States, 1998 to 2001

    PubMed Central

    Karlowsky, James A.; Draghi, Deborah C.; Jones, Mark E.; Thornsberry, Clyde; Friedland, Ian R.; Sahm, Daniel F.


    Pseudomonas aeruginosa and Acinetobacter baumannii are the most prevalent nonfermentative bacterial species isolated from clinical specimens of hospitalized patients. A surveillance study of 65 laboratories in the United States from 1998 to 2001 found >90% of isolates of P. aeruginosa from hospitalized patients to be susceptible to amikacin and piperacillin-tazobactam; 80 to 90% of isolates to be susceptible to cefepime, ceftazidime, imipenem, and meropenem; and 70 to 80% of isolates to be susceptible to ciprofloxacin, gentamicin, levofloxacin, and ticarcillin-clavulanate. From 1998 to 2001, decreases in antimicrobial susceptibility (percents) among non-intensive-care-unit (non-ICU) inpatients and ICU patients, respectively, were greatest for ciprofloxacin (6.1 and 6.5), levofloxacin (6.6 and 3.5), and ceftazidime (4.8 and 3.3). Combined 1998 to 2001 results for A. baumannii isolated from non-ICU inpatients and ICU patients, respectively, demonstrated that >90% of isolates tested were susceptible to imipenem (96.5 and 96.6%) and meropenem (91.6 and 91.7%); fewer isolates from both non-ICU inpatients and ICU patients were susceptible to amikacin and ticarcillin-clavulanate (70 to 80% susceptible); and <60% of isolates were susceptible to ceftazidime, ciprofloxacin, gentamicin, or levofloxacin. From 1998 to 2001, rates of multidrug resistance (resistance to at least three of the drugs ceftazidime, ciprofloxacin, gentamicin, and imipenem) showed small increases among P. aeruginosa strains isolated from non-ICU inpatients (5.5 to 7.0%) and ICU patients (7.4 to 9.1%). From 1998 to 2001, rates of multidrug resistance among A. baumannii strains isolated from non-ICU inpatients (27.6 to 32.5%) and ICU patients (11.6 to 24.2%) were higher and more variable than those observed for P. aeruginosa. Isolates concurrently susceptible, intermediate, or resistant to both imipenem and meropenem accounted for 89.8 and 91.2% of P. aeruginosa and A. baumannii isolates, respectively

  3. Detection of Ambler class A, B and D ß-lactamases among Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients.


    Hakemi Vala, M; Hallajzadeh, M; Hashemi, A; Goudarzi, H; Tarhani, M; Sattarzadeh Tabrizi, M; Bazmi, F


    In this study, we evaluated the existence of classes A, B and D ß-lactamases among Pseudomonas aeruginosa (P.aeruginosa) and Acinetobacter baumannii (A.baumannii) strains isolated from burn patients in Tehran during the years 2012 and 2013. From these strains, the frequency of MBL (metallo-beta-lactamase) and ESBL (extended-spectrum beta-lactamase) producers were evaluated using CDDT (Combined Disk Diffusion Tests). The prevalence of some related genes, including blaIMP, blaVIM, blaSPM, blaKPC, blaGIM, blaDIM, blaBIC, blaOXA-48, blaCTX-M-15 and blaNDM genes, was evaluated using PCR and sequencing methods. Of the 75 non-fermenter isolates, 47 P.aeruginosa and 28 A.baumannii were isolated and identified. A high rate of resistance to common antibiotics was detected among A.baumannii isolates in particular, showing 100% resistance to 9 tested antibiotics. CDDT showed that 21 (28%) and 25 (34.25%) of the non-fermenter isolates were ESBL and MBL producers respectively. The prevalence of blaCTX-M-15 and blaIMP genes among the 75 non-fermenter isolates was 7 (9.3%) and 1 (1.3%), respectively. Fortunately, no other genes were detected in either of the non-fermenters. The mortality rate due to MBL-producing isolates was 5 (20%). This study showed specific resistance genes exist among some MBL and ESBL gram-negative non-fermenters which were isolated from burn patients in Tehran.

  4. Assessment of early combination effects of colistin and meropenem against Pseudomonas aeruginosa and Acinetobacter baumannii in dynamic time-kill experiments.


    Tängdén, Thomas; Karvanen, Matti; Friberg, Lena E; Odenholt, Inga; Cars, Otto


    In view of the paucity of clinical evidence, in vitro studies are needed to find antibiotic combinations effective against multidrug-resistant Gram-negative bacteria. Interpretation of in vitro effects is usually based on bacterial growth after 24 h in time-kill and checkerboard experiments. However, the clinical relevance of the effects observed in vitro is not established. In this study we explored alternative output parameters to assess the activities of colistin and meropenem against Pseudomonas aeruginosa and Acinetobacter baumannii. Four strains each of P. aeruginosa and A. baumannii were exposed to colistin and meropenem, alone and in combination, in 8 h dynamic time-kill experiments. Initial (1 h), maximum and 8 h bacterial reductions and the area under the bacterial time-kill curve were evaluated. Checkerboards, interpreted based on fractional inhibitory concentration indices after 24 h, were performed for comparison. In the time-kill experiments, the combination resulted in enhanced 1 h, maximum and 8 h bacterial reductions against 2, 3 and 5 of 8 strains, respectively, as compared to the single drugs. A statistically significant reduction in the area under the time-kill curve was observed for three strains. In contrast, the checkerboards did not identify synergy for any of the strains. Combination effects were frequently found with colistin and meropenem against P. aeruginosa and A. baumannii in time-kill experiments but were not detected with the checkerboard method. We propose that the early dynamics of bacterial killing and growth, which may be of great clinical importance, should be considered in future in vitro combination studies.

  5. “Specificity Determinants” Improve Therapeutic Indices of Two Antimicrobial Peptides Piscidin 1 and Dermaseptin S4 against the Gram-negative Pathogens Acinetobacter baumannii and Pseudomonas aeruginosa

    PubMed Central

    Jiang, Ziqing; Vasil, Adriana I.; Vasil, Michael L.; Hodges, Robert S.


    A new class of antimicrobial agents with lower rates of resistance and different targets is urgently needed because of the rapidly increasing resistance to classical antibiotics. Amphipathic cationic α-helical antimicrobial peptides (AMPs) represent such a class of compounds. In our previous studies, using a 26-residue de novo designed antimicrobial peptide, we proposed the concept of “specificity determinant(s)”: positively charged residue(s) in the center of the non-polar face of AMPs that could decrease hemolytic activity/toxicity but increase or maintain the same level of antimicrobial activity to increase dramatically the therapeutic index. In the current study, we used d-enantiomers of two AMPs, Piscidin 1 isolated from fish and dermaseptin S4 isolated from frog. We substituted different positions in the center of the hydrophobic face with one or two lysine residue(s) (one or two “specificity determinant(s)”). This simple modification not only maintained or improved antimicrobial activity against Gram-negative pathogens Acinetobacter baumannii (11 strains) and Pseudomonas aeruginosa (6 strains), but also dramatically decreased hemolytic activity of human red blood cells, as predicted. Therapeutic indices improved by 55-fold and 730-fold for piscidin 1 (I9K) and dermaseptin S4 (L7K, A14K), respectively, against A. baumannii. Similarly, the therapeutic indices improved 32-fold and 980-fold for piscidin 1 (I9K) and dermaseptin S4 (L7K, A14K), respectively, against P. aeruginosa. PMID:24670666

  6. Investigation of metallo-beta-lactamase producing strains of Pseudomonas aeruginosa and Acinetobacter baumannii by E-test, disk synergy and PCR.


    Aktaş, Zerrin; Kayacan, Ciğdem Bal


    Carbapenem non-susceptible Pseudomonas aeruginosa and Acinetobacter baumannii strains were tested for the presence of metallo-beta-lactamases (MBLs) by EDTA-synergy screening. Imipenem hydrolysis was investigated by a bioassay and IMP-/VIM-encoding genes by PCR. No bla(IMP/VIM) related genes or imipenemase activity were detected although E-test found all strains as MBL-positive. Disk synergy tests with 0.5 M EDTA determined 63.6-100%, while those with 0.1 M EDTA detected 0-7.7% of isolates as MBL producers. Most strains were susceptible to EDTA. In conclusion, for MBL-screening purposes, EDTA-synergy results change with molarity of EDTA, but even if some false positives are encountered, 0.1 M EDTA seems to be acceptable.

  7. Reservoirs of Non-baumannii Acinetobacter Species

    PubMed Central

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie


    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  8. Acinetobacter baumannii in human body louse.


    La Scola, Bernard; Raoult, Didier


    While we were isolating Bartonella quintana from body lice, 40 Acinetobacter baumannii strains were also isolated and genotyped. One clone was unique and the other was ampicillin susceptible. A. baumannii DNA was later detected in 21% of 622 lice collected worldwide. These findings show an A. baumannii epidemic in human body lice.

  9. Clinical implications of glycoproteomics for Acinetobacter baumannii.


    Kinsella, Rachel L; Scott, Nichollas E; Feldman, Mario F


    The opportunistic human pathogen Acinetobacter baumannii persists in the healthcare setting because of its ability to survive exposure to various antimicrobial and sterilization agents. A. baumannii's ability to cause multiple infection types complicates diagnosis and treatment. Rapid detection of A. baumannii infections would likely improve treatment outcomes. Recently published Acinetobacter glycoproteomic data show the prevalence of O-linked glycoproteins, suggesting the possibility for an O-glycan-based detection technology. O-glycan biosynthesis is required for protein glycosylation and capsular polysaccharide production in A. baumannii. Recent publications demonstrate key roles for protein glycosylation and capsular polysaccharide in the pathogenicity of A. baumannii. Targeted antimicrobial development against O-glycan biosynthesis may produce new effective treatment options for A. baumannii infections. Here, we discuss how the data gathered through Acinetobacter glycoproteomics can be used to develop technologies for rapid diagnosis and reveal potential antimicrobial targets. In addition, we consider the efficacy of glycoconjugate vaccine development against A. baumannii.

  10. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel.


    Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A


    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated.

  11. Evaluation of High-Resolution Melting Curve Analysis of Ligation-Mediated Real-Time PCR, a Rapid Method for Epidemiological Typing of ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter Species) Pathogens

    PubMed Central

    Ryberg, Anna; Billström, Hanna; Hällgren, Anita; Nilsson, Lennart E.; Marklund, Britt-Inger; Olsson-Liljequist, Barbro; Schön, Thomas


    A single-tube method, ligation-mediated real-time PCR high-resolution melt analysis (LMqPCR HRMA), was modified for the rapid typing of Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. (ESKAPE) pathogens. A 97% agreement (60/62 isolates) was achieved in comparison to pulsed-field gel electrophoresis (PFGE) results, which indicates that LMqPCR HRMA is a rapid and accurate screening tool for monitoring nosocomial outbreaks. PMID:25232168

  12. Performance of Vitek 2 for Antimicrobial Susceptibility Testing of Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia with Vitek 2 (2009 FDA) and CLSI M100S 26th Edition Breakpoints

    PubMed Central

    Bobenchik, April M.; Deak, Eszter; Hindler, Janet A.; Charlton, Carmen L.


    ABSTRACT The performances of Vitek 2 AST-GN69 and AST-XN06 cards were compared to Clinical and Laboratory Standards Institute (CLSI) reference broth microdilution (BMD) for 99 isolates of Pseudomonas aeruginosa, 26 Acinetobacter baumannii isolates, and 11 Stenotrophomonas maltophilia isolates. In total, 15 antimicrobials were evaluated, with 11 for P. aeruginosa, 14 for A. baumannii, and 2 for S. maltophilia. Categorical agreement (CA) was assessed using both Vitek 2 breakpoints and 2016 CLSI M100S 26th edition breakpoints. The essential agreement values for P. aeruginosa, A. baumannii, and S. maltophilia were 99.5%, 99.2%, and 100%, respectively. The CA values for P. aeruginosa, A. baumannii, and S. maltophilia were 94.1%, 92.7%, and 95.5%, respectively, by the Vitek 2 breakpoints, and 93.4%, 92.3%, and 95.5%, respectively, by the CLSI breakpoints. Overall, the Vitek 2 performance was comparable to that of BMD using both Vitek 2 breakpoints and 2016 CLSI M100S 26th edition breakpoints. Improved performance was noted for the reformulated piperacillin-tazobactam and imipenem found on the AST-GN69 card, with no very major or major errors noted when using the CLSI breakpoints. PMID:27881616

  13. Performance of Vitek 2 for Antimicrobial Susceptibility Testing of Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia with Vitek 2 (2009 FDA) and CLSI M100S 26th Edition Breakpoints.


    Bobenchik, April M; Deak, Eszter; Hindler, Janet A; Charlton, Carmen L; Humphries, Romney M


    The performances of Vitek 2 AST-GN69 and AST-XN06 cards were compared to Clinical and Laboratory Standards Institute (CLSI) reference broth microdilution (BMD) for 99 isolates of Pseudomonas aeruginosa, 26 Acinetobacter baumannii isolates, and 11 Stenotrophomonas maltophilia isolates. In total, 15 antimicrobials were evaluated, with 11 for P. aeruginosa, 14 for A. baumannii, and 2 for S. maltophilia Categorical agreement (CA) was assessed using both Vitek 2 breakpoints and 2016 CLSI M100S 26th edition breakpoints. The essential agreement values for P. aeruginosa, A. baumannii, and S. maltophilia were 99.5%, 99.2%, and 100%, respectively. The CA values for P. aeruginosa, A. baumannii, and S. maltophilia were 94.1%, 92.7%, and 95.5%, respectively, by the Vitek 2 breakpoints, and 93.4%, 92.3%, and 95.5%, respectively, by the CLSI breakpoints. Overall, the Vitek 2 performance was comparable to that of BMD using both Vitek 2 breakpoints and 2016 CLSI M100S 26th edition breakpoints. Improved performance was noted for the reformulated piperacillin-tazobactam and imipenem found on the AST-GN69 card, with no very major or major errors noted when using the CLSI breakpoints. Copyright © 2017 American Society for Microbiology.

  14. Chlorine Dioxide is a Better Disinfectant than Sodium Hypochlorite against Multi-Drug Resistant Staphylococcus aureus, Pseudomonas aeruginosa, and Acinetobacter baumannii.


    Hinenoya, Atsushi; Awasthi, Sharda Prasad; Yasuda, Noritomo; Shima, Ayaka; Morino, Hirofumi; Koizumi, Tomoko; Fukuda, Toshiaki; Miura, Takanori; Shibata, Takashi; Yamasaki, Shinji


    In this study, we evaluated and compared the antibacterial activity of chlorine dioxide (ClO2) and sodium hypochlorite (NaClO) on various multidrug-resistant strains in the presence of bovine serum albumin and sheep erythrocytes to mimic the blood contamination that frequently occurs in the clinical setting. The 3 most important species that cause nosocomial infections, i.e., methicillin-resistant Staphylococcus aureus (MRSA), multidrug-resistant Pseudomonas aeruginosa (MDRP), and multidrug-resistant Acinetobacter baumannii (MDRA), were evaluated, with three representative strains of each. At a 10-ppm concentration, ClO2 drastically reduced the number of bacteria of all MDRP and MDRA strains, and 2 out of 3 MRSA strains. However, 10 ppm of NaClO did not significantly kill any of the 9 strains tested in 60 seconds (s). In addition, 100 ppm of ClO2 completely killed all MRSA strains, whereas 100 ppm of NaClO failed to significantly lower the number of 2 MRSA strains and 1 MDRA strain. A time-course experiment demonstrated that, within 15 s, 100 ppm of ClO2, but not 100 ppm of NaClO, completely killed all tested strains. Taken together, these data suggest that ClO2 is more effective than NaClO against MRSA, MDRP, and MDRA, and 100 ppm is an effective concentration against these multidrug-resistant strains, which cause fatal nosocomial infections.

  15. Evaluation of the in vitro colistin susceptibility of Pseudomonas aeruginosa and Acinetobacter baumannii strains at a tertiary care centre in Western Turkey.


    Ece, Gulfem; Samlioglu, Pinar; Atalay, Sabri; Kose, Sukran


    Multidrug-resistant gram-negative bacteria are an important issue in intensive care units worldwide. Colistin, one of the earliest polymyxin antibiotics, was once widely used for the treatment of gram-negative bacterial infections. However, its use is now limited due to concerns over nephrotoxicity. The appearance of multidrug-resistant species, including A. baumannii and P. aeruginosa, has led to the re-emergence of this class of drugs. The aim of this study was to evaluate the susceptibility of A. baumannii and P. aeruginosa isolates to colistin and other antibiotics. The antimicrobial susceptibility of A. baumannii and P. aeruginosa isolates to colistin and other antibiotics was evaluated between January 2011 and October 2012 at Tepecik Education and Research Hospital in Izmir, Turkey. Clinical isolates were identified using an automatized Vitek 2.0 system. Colistin susceptibility was measured by E-test; the susceptibility profiles of other antibiotics were evaluated using the Kirby Bauer disk-diffusion method. A total of 149 isolates were included in the study, consisting of 98 A. baumannii and 51 P. aeruginosa isolates. The MICs of colistin against A. baumannii were 0.125-2.0 mcg/mL, and 0.25-2.0 mcg/mL against P. aeruginosa; all multidrug-resistant strains examined in this study were susceptible to colistin. Recently, colistin has re-emerged as an effective treatment for infections due to multidrug-resistant A. baumannii, P. aeruginosa, and Klebsiella pneumoniae. All isolates examined in this study were susceptible to colistin, suggesting it could be a viable alternative for the treatment of infections with multidrug-resistant strains.

  16. Rapid identification of carbapenemase-producing Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii using a modified Carba NP test.


    Bakour, S; Garcia, V; Loucif, L; Brunel, J-M; Gharout-Sait, A; Touati, A; Rolain, J-M


    Biochemical tests have been previously developed to identify carbapenemase-producing Enterobacteriaceae, Pseudomonas spp. (Carba NP test) and Acinetobacter spp. (CarbAcineto NP test). We evaluated a modified Carba NP test to detect carbapenemase production in Enterobacteriaceae, Pseudomonas and Acinetobacter species using a single protocol with rapid results and found good reliability and speed.

  17. Rapid identification of carbapenemase-producing Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii using a modified Carba NP test

    PubMed Central

    Bakour, S.; Garcia, V.; Loucif, L.; Brunel, J.-M.; Gharout-Sait, A.; Touati, A.; Rolain, J.-M.


    Biochemical tests have been previously developed to identify carbapenemase-producing Enterobacteriaceae, Pseudomonas spp. (Carba NP test) and Acinetobacter spp. (CarbAcineto NP test). We evaluated a modified Carba NP test to detect carbapenemase production in Enterobacteriaceae, Pseudomonas and Acinetobacter species using a single protocol with rapid results and found good reliability and speed. PMID:26442150

  18. Evaluation of high-resolution melting curve analysis of ligation-mediated real-time PCR, a rapid method for epidemiological typing of ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter Species) pathogens.


    Woksepp, Hanna; Ryberg, Anna; Billström, Hanna; Hällgren, Anita; Nilsson, Lennart E; Marklund, Britt-Inger; Olsson-Liljequist, Barbro; Schön, Thomas


    A single-tube method, ligation-mediated real-time PCR high-resolution melt analysis (LMqPCR HRMA), was modified for the rapid typing of Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. (ESKAPE) pathogens. A 97% agreement (60/62 isolates) was achieved in comparison to pulsed-field gel electrophoresis (PFGE) results, which indicates that LMqPCR HRMA is a rapid and accurate screening tool for monitoring nosocomial outbreaks. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. Acinetobacter baumannii neonatal mastitis: a case report.


    Mohr, Emma L; Berhane, Abeba; Zora, John Gregory; Suchdev, Parminder S


    Neonatal mastitis is a rare infection. When it does occur, infants younger than 2 months of age are typically affected and the majority of cases are caused by Staphylococcus aureus. We present the first reported case of neonatal mastitis caused by Acinetobacter baumannii, an unusual organism for this type of infection. A 15-day-old full-term Caucasian male neonate presented to our emergency room following fever at home and was admitted for routine neonatal sepsis evaluation. After admission, he developed purulent drainage from his right nipple, was diagnosed with mastitis, and was started on empiric therapy with clindamycin and cefotaxime with presumed coverage for S. aureus. Drainage culture identified pan-susceptible Acinetobacter baumannii/haemolyticus and antibiotic therapy was changed to ceftazidime. He was discharged after 5 days of ceftazidime with complete resolution of his symptoms. This case illustrates the importance of obtaining drainage cultures in mastitis cases because of the possibility of organisms besides S. aureus causing infection. Acinetobacter baumannii is considered part of the normal human flora and is associated with serious infections in intensive care units. This is the first case report describing Acinetobacter baumannii as an etiologic agent of neonatal mastitis and highlights the importance of including unusual organisms in the differential for infectious etiologies for general practitioners.

  20. Copper Resistance of the Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Williams, Caitlin L.; Neu, Heather M.; Gilbreath, Jeremy J.; Michel, Sarah L. J.; Zurawski, Daniel V.


    ABSTRACT Acinetobacter baumannii is an important emerging pathogen that is capable of causing many types of severe infection, especially in immunocompromised hosts. Since A. baumannii can rapidly acquire antibiotic resistance genes, many infections are on the verge of being untreatable, and novel therapies are desperately needed. To investigate the potential utility of copper-based antibacterial strategies against Acinetobacter infections, we characterized copper resistance in a panel of recent clinical A. baumannii isolates. Exposure to increasing concentrations of copper in liquid culture and on solid surfaces resulted in dose-dependent and strain-dependent effects; levels of copper resistance varied broadly across isolates, possibly resulting from identified genotypic variation among strains. Examination of the growth-phase-dependent effect of copper on A. baumannii revealed that resistance to copper increased dramatically in stationary phase. Moreover, A. baumannii biofilms were more resistant to copper than planktonic cells but were still susceptible to copper toxicity. Exposure of bacteria to subinhibitory concentrations of copper allowed them to better adapt to and grow in high concentrations of copper; this copper tolerance response is likely achieved via increased expression of copper resistance mechanisms. Indeed, genomic analysis revealed numerous putative copper resistance proteins that share amino acid homology to known proteins in Escherichia coli and Pseudomonas aeruginosa. Transcriptional analysis revealed significant upregulation of these putative copper resistance genes following brief copper exposure. Future characterization of copper resistance mechanisms may aid in the search for novel antibiotics against Acinetobacter and other highly antibiotic-resistant pathogens. IMPORTANCE Acinetobacter baumannii causes many types of severe nosocomial infections; unfortunately, some isolates have acquired resistance to almost every available antibiotic

  1. Bulgecin A as a β-lactam enhancer for carbapenem-resistant Pseudomonas aeruginosa and carbapenem-resistant Acinetobacter baumannii clinical isolates containing various resistance mechanisms

    PubMed Central

    Skalweit, Marion J; Li, Mei


    Genetic screening of Pseudomonas aeruginosa (PSDA) and Acinetobacter baumannii (ACB) reveals genes that confer increased susceptibility to β-lactams when disrupted, suggesting novel drug targets. One such target is lytic transglycosylase. Bulgecin A (BlgA) is a natural product of Pseudomonas mesoacidophila and a lytic transglycosolase inhibitor that works synergistically with β-lactams targeting PBP3 for Enterobacteriaceae. BlgA also weakly inhibits di-Zn2+ metallo-β-lactamases like L1 of Stenotrophomonas maltophilia. We hypothesized that because of its unique mechanism of action, BlgA could restore susceptibility to carbapenems in carbapenem-resistant PSDA (CR-PSDA) and carbapenem-resistant ACB, as well as ACB resistant to sulbactam. A BlgA-containing extract was prepared using a previously published protocol. CR-PSDA clinical isolates demonstrating a variety of carbapenem resistance mechanisms (VIM-2 carbapenemases, efflux mechanisms, and AmpC producer expression) were characterized with agar dilution minimum inhibitory concentration (MIC) testing and polymerase chain reaction. Growth curves using these strains were prepared using meropenem, BlgA extract, and meropenem plus BlgA extract. A concentrated Blg A extract combined with low concentrations of meropenem, was able to inhibit the growth of clinical strains of CR-PSDA for strains that had meropenem MICs ≥8 mg/L by agar dilution, and a clinical strain of an OXA-24 producing ACB that had a meropenem MIC >32 mg/L and intermediate ampicillin/sulbactam susceptibility. Similar experiments were conducted on a TEM-1 producing ACB strain resistant to sulbactam. BlgA with ampicillin/sulbactam inhibited the growth of this organism. As in Enterobacteriaceae, BlgA appears to restore the efficacy of meropenem in suppressing the growth of CR-PSDA and carbapenem-resistant ACB strains with a variety of common carbapenem resistance mechanisms. BlgA extract also inhibits VIM-2 β-lactamase in vitro. BlgA may prove to be

  2. Genome organization of epidemic Acinetobacter baumannii strains

    PubMed Central


    Background Acinetobacter baumannii is an opportunistic pathogen responsible for hospital-acquired infections. A. baumannii epidemics described world-wide were caused by few genotypic clusters of strains. The occurrence of epidemics caused by multi-drug resistant strains assigned to novel genotypes have been reported over the last few years. Results In the present study, we compared whole genome sequences of three A. baumannii strains assigned to genotypes ST2, ST25 and ST78, representative of the most frequent genotypes responsible for epidemics in several Mediterranean hospitals, and four complete genome sequences of A. baumannii strains assigned to genotypes ST1, ST2 and ST77. Comparative genome analysis showed extensive synteny and identified 3068 coding regions which are conserved, at the same chromosomal position, in all A. baumannii genomes. Genome alignments also identified 63 DNA regions, ranging in size from 4 o 126 kb, all defined as genomic islands, which were present in some genomes, but were either missing or replaced by non-homologous DNA sequences in others. Some islands are involved in resistance to drugs and metals, others carry genes encoding surface proteins or enzymes involved in specific metabolic pathways, and others correspond to prophage-like elements. Accessory DNA regions encode 12 to 19% of the potential gene products of the analyzed strains. The analysis of a collection of epidemic A. baumannii strains showed that some islands were restricted to specific genotypes. Conclusion The definition of the genome components of A. baumannii provides a scaffold to rapidly evaluate the genomic organization of novel clinical A. baumannii isolates. Changes in island profiling will be useful in genomic epidemiology of A. baumannii population. PMID:21985032

  3. Characterization of newly isolated lytic bacteriophages active against Acinetobacter baumannii.


    Merabishvili, Maia; Vandenheuvel, Dieter; Kropinski, Andrew M; Mast, Jan; De Vos, Daniel; Verbeken, Gilbert; Noben, Jean-Paul; Lavigne, Rob; Vaneechoutte, Mario; Pirnay, Jean-Paul


    Based on genotyping and host range, two newly isolated lytic bacteriophages, myovirus vB_AbaM_Acibel004 and podovirus vB_AbaP_Acibel007, active against Acinetobacter baumannii clinical strains, were selected from a new phage library for further characterization. The complete genomes of the two phages were analyzed. Both phages are characterized by broad host range and essential features of potential therapeutic phages, such as short latent period (27 and 21 min, respectively), high burst size (125 and 145, respectively), stability of activity in liquid culture and low frequency of occurrence of phage-resistant mutant bacterial cells. Genomic analysis showed that while Acibel004 represents a novel bacteriophage with resemblance to some unclassified Pseudomonas aeruginosa phages, Acibel007 belongs to the well-characterized genus of the Phikmvlikevirus. The newly isolated phages can serve as potential candidates for phage cocktails to control A. baumannii infections.

  4. Iron and Acinetobacter baumannii Biofilm Formation

    PubMed Central

    Gentile, Valentina; Frangipani, Emanuela; Bonchi, Carlo; Minandri, Fabrizia; Runci, Federica; Visca, Paolo


    Acinetobacter baumannii is an emerging nosocomial pathogen, responsible for infection outbreaks worldwide. The pathogenicity of this bacterium is mainly due to its multidrug-resistance and ability to form biofilm on abiotic surfaces, which facilitate long-term persistence in the hospital setting. Given the crucial role of iron in A. baumannii nutrition and pathogenicity, iron metabolism has been considered as a possible target for chelation-based antibacterial chemotherapy. In this study, we investigated the effect of iron restriction on A. baumannii growth and biofilm formation using different iron chelators and culture conditions. We report substantial inter-strain variability and growth medium-dependence for biofilm formation by A. baumannii isolates from veterinary and clinical sources. Neither planktonic nor biofilm growth of A. baumannii was affected by exogenous chelators. Biofilm formation was either stimulated by iron or not responsive to iron in the majority of isolates tested, indicating that iron starvation is not sensed as an overall biofilm-inducing stimulus by A. baumannii. The impressive iron withholding capacity of this bacterium should be taken into account for future development of chelation-based antimicrobial and anti-biofilm therapies. PMID:25438019

  5. Quantitative proteomics to study carbapenem resistance in Acinetobacter baumannii

    PubMed Central

    Tiwari, Vishvanath; Tiwari, Monalisa


    Acinetobacter baumannii is an opportunistic pathogen causing pneumonia, respiratory infections and urinary tract infections. The prevalence of this lethal pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source. Moreover it resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. Resistance against carbapenem has emerged in Acinetobacter baumannii which can create significant health problems and is responsible for high morbidity and mortality. With the development of quantitative proteomics, a considerable progress has been made in the study of carbapenem resistance of Acinetobacter baumannii. Recent updates showed that quantitative proteomics has now emerged as an important tool to understand the carbapenem resistance mechanism in Acinetobacter baumannii. Present review also highlights the complementary nature of different quantitative proteomic methods used to study carbapenem resistance and suggests to combine multiple proteomic methods for understanding the response to antibiotics by Acinetobacter baumannii. PMID:25309531

  6. Extrahuman Epidemiology of Acinetobacter baumannii in Lebanon

    PubMed Central

    Rafei, Rayane; Hamze, Monzer; Pailhoriès, Hélène; Eveillard, Matthieu; Marsollier, Laurent; Joly-Guillou, Marie-Laure; Dabboussi, Fouad


    The presence of Acinetobacter baumannii outside hospitals is still a controversial issue. The objective of our study was to explore the extrahospital epidemiology of A. baumannii in Lebanon. From February 2012 to October 2013, a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed by cultural methods for the presence of A. baumannii. Species identification was performed by rpoB gene sequencing. Antibiotic susceptibility was investigated, and the A. baumannii population was studied by two genotyping approaches: multilocus sequence typing (MLST) and blaOXA-51 sequence-based typing (SBT). A. baumannii was detected in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates showed a susceptible phenotype against most of the antibiotics tested and lacked carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. MLST analysis revealed the presence of 36 sequence types (STs), among which 24 were novel STs reported for the first time in this study. blaOXA-51 SBT showed the presence of 34 variants, among which 21 were novel and all were isolated from animal origins. Finally, 30 isolates had new partial rpoB sequences and were considered putative new Acinetobacter species. In conclusion, animals can be a potential reservoir for A. baumannii and the dissemination of new emerging carbapenemases. The roles of the novel animal clones identified in community-acquired infections should be investigated. PMID:25616788

  7. Rapid detection of Pseudomonas aeruginosa and Acinetobacter baumannii Harboring bla(VIM-2), bla(IMP-1) and bla(OXA-23) genes by using loop-mediated isothermal amplification methods.


    Kim, Hye Jin; Kim, Hyung Sun; Lee, Jae Myun; Yoon, Sang Sun; Yong, Dongeun


    Carbapenem-resistant Pseudomonas aeruginosa (CRPA) and Acinetobacter baumannii (CRAB) are the leading causes of nosocomial infections. A rapid and sensitive test to detect CRPA and CRAB is required for appropriate antibiotic treatment. We optimized a loop-mediated isothermal amplification (LAMP) assay to detect the presence of bla(VIM-2), bla(IMP-1), and bla(OXA-23), which are critical components for carbapenem resistance. Two sets of primers, inner and outer primers, were manually designed as previously described. The LAMP buffer was optimized (at 2mM MgSO₄) by testing different concentrations of MgSO₄. The optimal reaction temperature and incubation time were determined by using a gradient thermocycler. Then, the optimized bla(VIM-2), bla(IMP-1), and bla(OXA-23) LAMP reactions were evaluated by using 120 P. aeruginosa and 99 A. baumannii clinical isolates. Only one strain of the 100 CRPA isolates harbored bla(IMP-1), whereas none of them harbored bla(VIM-2). These results indicate that the acquisition of bla(VIM-2) or bla(IMP-1) may not play a major role in carbapenem resistance in Korea. Fifty two strains of the 75 CRAB isolates contained bla(OXA-23), but none contained bla(VIM-2) and bla(IMP-1) alleles. Our results demonstrate the usefulness of LAMP for the diagnosis of CRPA and CRAB.

  8. Acinetobacter baumannii: Emergence of a Successful Pathogen

    PubMed Central

    Peleg, Anton Y.; Seifert, Harald; Paterson, David L.


    Acinetobacter baumannii has emerged as a highly troublesome pathogen for many institutions globally. As a consequence of its immense ability to acquire or upregulate antibiotic drug resistance determinants, it has justifiably been propelled to the forefront of scientific attention. Apart from its predilection for the seriously ill within intensive care units, A. baumannii has more recently caused a range of infectious syndromes in military personnel injured in the Iraq and Afghanistan conflicts. This review details the significant advances that have been made in our understanding of this remarkable organism over the last 10 years, including current taxonomy and species identification, issues with susceptibility testing, mechanisms of antibiotic resistance, global epidemiology, clinical impact of infection, host-pathogen interactions, and infection control and therapeutic considerations. PMID:18625687

  9. Acinetobacter baumannii: an emerging opportunistic pathogen.


    Howard, Aoife; O'Donoghue, Michael; Feeney, Audrey; Sleator, Roy D


    Acinetobacter baumannii is an opportunistic bacterial pathogen primarily associated with hospital-acquired infections. The recent increase in incidence, largely associated with infected combat troops returning from conflict zones, coupled with a dramatic increase in the incidence of multidrug-resistant (MDR) strains, has significantly raised the profile of this emerging opportunistic pathogen. Herein, we provide an overview of the pathogen, discuss some of the major factors that have led to its clinical prominence and outline some of the novel therapeutic strategies currently in development.

  10. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay.


    Chen, Te-Li; Lee, Yi-Tzu; Kuo, Shu-Chen; Yang, Su-Pen; Fung, Chang-Phone; Lee, Shou-Dong


    Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii are clinically relevant members of the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and important nosocomial pathogens. These three species are genetically closely related and phenotypically similar; however, they differ in their epidemiology, antibiotic resistance and pathogenicity. In this study, we investigated the use of a multiplex PCR-based assay designed to detect internal fragments of the 16S-23S rRNA intergenic region and the gyrB and recA genes. The assay was capable of differentiating A. baumannii, A. nosocomialis and A. pittii in a reliable manner. In 23 different reference strains and 89 clinical isolates of Acinetobacter species, the assay accurately identified clinically relevant Acb complex species except those 'between 1 and 3' or 'close to 13TU'. None of the non-Acb complex species was misidentified. In an analysis of 1034 positive blood cultures, the assay had a sensitivity of 92.4 % and specificity of 98.2 % for Acb complex identification. Our results show that a single multiplex PCR assay can reliably differentiate clinically relevant Acb complex species. Thus, this method may be used to better understand the clinical differences between infections caused by these species.

  11. Characterization of Acinetobacter baumannii biofilm associated components

    NASA Astrophysics Data System (ADS)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  12. Bactericidal activity of herbal volatile oil extracts against multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Intorasoot, Amornrat; Chornchoem, Piyaorn; Sookkhee, Siriwoot; Intorasoot, Sorasak


    Aim: The aim of the study is to investigate the antibacterial activity of 10 volatile oils extracted from medicinal plants, including galangal (Alpinia galanga Linn.), ginger (Zingiber officinale), plai (Zingiber cassumunar Roxb.), lime (Citrus aurantifolia), kaffir lime (Citrus hystrix DC.), sweet basil (Ocimum basilicum Linn.), tree basil (Ocimum gratissimum), lemongrass (Cymbopogon citratus DC.), clove (Syzygium aromaticum), and cinnamon (Cinnamomum verum) against four standard strains of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, and 30 clinical isolates of multidrug-resistant A. baumannii (MDR-A. baumannii). Materials and Methods: Agar diffusion, minimum inhibitory concentration, and minimum bactericidal concentration (MBC) were employed for the determination of bactericidal activity of water distilled medicinal plants. Tea tree oil (Melaleuca alternifolia) was used as positive control in this study. Results: The results indicated the volatile oil extracted from cinnamon exhibited potent antibacterial activity against the most common human pathogens, S. aureus, E. coli, P. aeruginosa, and A. baumannii. Most of volatile oil extracts were less effective against non-fermentative bacteria, P. aeruginosa. In addition, volatile oil extracted from cinnamon, clove, and tree basil possessed potent bactericidal activity against MDR-A. baumannii with MBC90 of 0.5, 1, and 2 mg/mL, respectively. Conclusions: The volatile oil extracts would be useful as alternative natural product for the treatment of the most common human pathogens and MDR-A. baumannii infections. PMID:28512603

  13. Bactericidal activity of herbal volatile oil extracts against multidrug-resistant Acinetobacter baumannii.


    Intorasoot, Amornrat; Chornchoem, Piyaorn; Sookkhee, Siriwoot; Intorasoot, Sorasak


    The aim of the study is to investigate the antibacterial activity of 10 volatile oils extracted from medicinal plants, including galangal (Alpinia galanga Linn.), ginger (Zingiber officinale), plai (Zingiber cassumunar Roxb.), lime (Citrus aurantifolia), kaffir lime (Citrus hystrix DC.), sweet basil (Ocimum basilicum Linn.), tree basil (Ocimum gratissimum), lemongrass (Cymbopogon citratus DC.), clove (Syzygium aromaticum), and cinnamon (Cinnamomum verum) against four standard strains of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, and 30 clinical isolates of multidrug-resistant A. baumannii (MDR-A. baumannii). Agar diffusion, minimum inhibitory concentration, and minimum bactericidal concentration (MBC) were employed for the determination of bactericidal activity of water distilled medicinal plants. Tea tree oil (Melaleuca alternifolia) was used as positive control in this study. The results indicated the volatile oil extracted from cinnamon exhibited potent antibacterial activity against the most common human pathogens, S. aureus, E. coli, P. aeruginosa, and A. baumannii. Most of volatile oil extracts were less effective against non-fermentative bacteria, P. aeruginosa. In addition, volatile oil extracted from cinnamon, clove, and tree basil possessed potent bactericidal activity against MDR-A. baumannii with MBC90 of 0.5, 1, and 2 mg/mL, respectively. The volatile oil extracts would be useful as alternative natural product for the treatment of the most common human pathogens and MDR-A. baumannii infections.

  14. First detection of OXA-24 carbapenemase-producing Acinetobacter baumannii isolates in Bulgaria.


    Todorova, Bozhana; Velinov, Tzvetan; Ivanov, Ivan; Dobreva, Elina; Kantardjiev, Todor


    This report describes the first identification of OXA-24 carbapenemase-producing Acinetobacter baumannii isolates from Bulgaria. According to national surveillance data A. baumannii along with Pseudomonas aeruginosa are the most troublesome microorganisms in hospital environment with high rates of acquired carbapenem resistance. In the present study real-time multiplex PCR was performed to identify the most common carbapenemase genes in 15 non-duplicate carbapenem-resistant A. baumannii isolates collected in 2012. The results showed lack of KPC, GES, VIM, IMP-type enzymes. Four A. baumannii isolates tested positive by PCR for the acquired OXA-24 together with the intrinsic OXA-51 carbapenemase. OXA-24 and OXA-23 were determined as co-existent in one isolate. Two isolates were identified with OXA-23 in addition to the OXA-51 carbapenemase.

  15. Structural Relationship of the Lipid A Acyl Groups to Activation of Murine Toll-Like Receptor 4 by Lipopolysaccharides from Pathogenic Strains of Burkholderia mallei, Acinetobacter baumannii, and Pseudomonas aeruginosa

    PubMed Central

    Korneev, Kirill V.; Arbatsky, Nikolay P.; Molinaro, Antonio; Palmigiano, Angelo; Shaikhutdinova, Rima Z.; Shneider, Mikhail M.; Pier, Gerald B.; Kondakova, Anna N.; Sviriaeva, Ekaterina N.; Sturiale, Luisa; Garozzo, Domenico; Kruglov, Andrey A.; Nedospasov, Sergei A.; Drutskaya, Marina S.; Knirel, Yuriy A.; Kuprash, Dmitry V.


    Toll-like receptor 4 (TLR4) is required for activation of innate immunity upon recognition of lipopolysaccharide (LPS) of Gram-negative bacteria. The ability of TLR4 to respond to a particular LPS species is important since insufficient activation may not prevent bacterial growth while excessive immune reaction may lead to immunopathology associated with sepsis. Here, we investigated the biological activity of LPS from Burkholderia mallei that causes glanders, and from the two well-known opportunistic pathogens Acinetobacter baumannii and Pseudomonas aeruginosa (causative agents of nosocomial infections). For each bacterial strain, R-form LPS preparations were purified by hydrophobic chromatography and the chemical structure of lipid A, an LPS structural component, was elucidated by HR-MALDI-TOF mass spectrometry. The biological activity of LPS samples was evaluated by their ability to induce production of proinflammatory cytokines, such as IL-6 and TNF, by bone marrow-derived macrophages. Our results demonstrate direct correlation between the biological activity of LPS from these pathogenic bacteria and the extent of their lipid A acylation. PMID:26635809

  16. Polymicrobial Chronic Infection Including Acinetobacter Baumannii in a Plated Segmental Defect in the Rat Femur

    DTIC Science & Technology


    Including Acinetobacter baumannii in a Plated Segmental Defect in the Rat Femur PRINCIPAL INVESTIGATOR: Dean T. Tsukayama, MD...FEB 2007 - 31 DEC 2007 4. TITLE AND SUBTITLE Polymicrobial Chronic Infection Including Acinetobacter baumannii 5a. CONTRACT NUMBER in a Plated...bone isolate of Acinetobacter baumannii exhibited very little osteolytic involvement when used alone in the model. Qualitative cultures indicated very

  17. Inactivation of Phospholipase D Diminishes Acinetobacter baumannii Pathogenesis▿ †

    PubMed Central

    Jacobs, Anna C.; Hood, Indriati; Boyd, Kelli L.; Olson, Patrick D.; Morrison, John M.; Carson, Steven; Sayood, Khalid; Iwen, Peter C.; Skaar, Eric P.; Dunman, Paul M.


    Acinetobacter baumannii is an emerging bacterial pathogen of considerable health care concern. Nonetheless, relatively little is known about the organism's virulence factors or their regulatory networks. Septicemia and ventilator-associated pneumonia are two of the more severe forms of A. baumannii disease. To identify virulence factors that may contribute to these disease processes, genetically diverse A. baumannii clinical isolates were evaluated for the ability to proliferate in human serum. A transposon mutant library was created in a strain background that propagated well in serum and screened for members with decreased serum growth. The results revealed that disruption of A. baumannii phospholipase D (PLD) caused a reduction in the organism's ability to thrive in serum, a deficiency in epithelial cell invasion, and diminished pathogenesis in a murine model of pneumonia. Collectively, these results suggest that PLD is an A. baumannii virulence factor. PMID:20194595

  18. Multidrug-Resistant Acinetobacter baumannii Harboring OXA-24 Carbapenemase, Spain

    PubMed Central

    Acosta, Joshi; Merino, María; Viedma, Esther; Poza, Margarita; Sanz, Francisca; Otero, Joaquín R.; Chaves, Fernando


    In February 2006, a patient colonized with a multidrug-resistant sequence type 56 Acinetobacter baumannii strain was admitted to a hospital in Madrid, Spain. This strain spread rapidly and caused a large outbreak in the hospital. Clinicians should be alert for this strain because its spread would have serious health consequences. PMID:21749771

  19. Photodynamic Therapy for Acinetobacter baumannii Burn Infections in Mice

    DTIC Science & Technology


    Acinetobacter baumannii Burn Infections in Mice Tianhong Dai,1,2 George P. Tegos,1,2 Zongshun Lu,1,3 Liyi Huang,1,2,4 Timur Zhiyentayev,1,5 Michael J...Agents Che- mother. 50:1402–1410. 28. Vallenet, D., P. Nordmann, V. Barbe, L. Poirel, S. Mangenot, E. Bataille , C. Dossat, S. Gas, A. Kreimeyer, P

  20. Deciphering the Multifactorial Nature of Acinetobacter baumannii Pathogenicity

    PubMed Central

    Antunes, Luísa C. S.; Imperi, Francesco; Carattoli, Alessandra; Visca, Paolo


    Background Acinetobacter baumannii is an emerging bacterial pathogen that causes a broad array of infections, particularly in hospitalized patients. Many studies have focused on the epidemiology and antibiotic resistance of A. baumannii, but little is currently known with respect to its virulence potential. Methodology/Principal Findings The aim of this work was to analyze a number of virulence-related traits of four A. baumannii strains of different origin and clinical impact for which complete genome sequences were available, in order to tentatively identify novel determinants of A. baumannii pathogenicity. Clinical strains showed comparable virulence in the Galleria mellonella model of infection, irrespective of their status as outbreak or sporadic strains, whereas a non-human isolate was avirulent. A combined approach of genomic and phenotypic analyses led to the identification of several virulence factors, including exoproducts with hemolytic, phospholipase, protease and iron-chelating activities, as well as a number of multifactorial phenotypes, such as biofilm formation, surface motility and stress resistance, which were differentially expressed and could play a role in A. baumannii pathogenicity. Conclusion/Significance This work provides evidence of the multifactorial nature of A. baumannii virulence. While A. baumannii clinical isolates could represent a selected population of strains adapted to infect the human host, subpopulations of highly genotypically and phenotypically diverse A. baumannii strains may exist outside the hospital environment, whose relevance and distribution deserve further investigation. PMID:21829642

  1. Characterization of blaOXA-143 variants in Acinetobacter baumannii and Acinetobacter pittii.


    Zander, Esther; Bonnin, Rémy A; Seifert, Harald; Higgins, Paul G


    The acquired carbapenem-hydrolyzing oxacillinase (OXA) OXA-143 has thus far been detected only in Acinetobacter baumannii isolates from Brazil. The aim of this study was to characterize three OXA-143 variants: OXA-231 and OXA-253 from carbapenem-resistant A. baumannii isolates and OXA-255 in a carbapenem-susceptible Acinetobacter pittii isolate originating from Brazil, Honduras, and the United States, respectively. The 5' rapid amplification of cDNA ends (RACE) technique identified the same transcription initiation site for all blaOXA-143-like genes and revealed differences in the putative promoter regions. However, all cloned OXA-143 variants conferred carbapenem resistance on A. baumannii ATCC 17978 and OXA-255 conferred carbapenem resistance on A. pittii SH024, which was correlated with blaOXA-255 gene expression. This is the first description of OXA-143-like outside A. baumannii. Detection of OXA-143-like in the United States and Honduras indicates its dissemination through the American continent.

  2. Acinetobacter baumannii Infection and IL-17 Mediated Immunity

    PubMed Central

    Yan, Zihe; Yang, Junjun; Hu, Renjing; Hu, Xichi; Chen, Kong


    Acinetobacter baumannii is a significant cause of severe hospital-acquired infections with a recent rise in multidrug-resistant infections involving traumatic wounds of military personnel. The interleukin-17 (IL-17) pathway is essential for neutrophil recruitment in response to a variety of pathogens, while the control of A. baumannii infection is known to be dependent on neutrophils. This suggests that IL-17 may play an important role in A. baumannii infection; however, this has yet to be studied. Here, we summarize the recent advances in understanding the host-pathogen interaction of A. baumannii and propose a potential role of the IL-17 pathway in generating a protective immune response. PMID:26977122

  3. Identification of Ata, a Multifunctional Trimeric Autotransporter of Acinetobacter baumannii

    PubMed Central

    Bentancor, Leticia V.; Camacho-Peiro, Ana; Bozkurt-Guzel, Cagla; Pier, Gerald B.


    Acinetobacter baumannii has recently emerged as a highly troublesome nosocomial pathogen, especially in patients in intensive care units and in those undergoing mechanical ventilation. We have identified a surface protein adhesin of A. baumannii, designated the Acinetobacter trimeric autotransporter (Ata), that contains all of the typical features of trimeric autotransporters (TA), including a long signal peptide followed by an N-terminal, surface-exposed passenger domain and a C-terminal domain encoding 4 β-strands. To demonstrate that Ata encoded a TA, we created a fusion protein in which we replaced the entire passenger domain of Ata with the epitope tag V5, which can be tracked with specific monoclonal antibodies, and demonstrated that the C-terminal 101 amino acids of Ata were capable of exporting the heterologous V5 tag to the surface of A. baumannii in a trimeric form. We found that Ata played a role in biofilm formation and bound to various extracellular matrix/basal membrane (ECM/BM) components, including collagen types I, III, IV, and V and laminin. Moreover, Ata mediated the adhesion of whole A. baumannii cells to immobilized collagen type IV and played a role in the survival of A. baumannii in a lethal model of systemic infection in immunocompetent mice. Taken together, these results reveal that Ata is a TA of A. baumannii involved in virulence, including biofilm formation, binding to ECM/BM proteins, mediating the adhesion of A. baumannii cells to collagen type IV, and contributing to the survival of A. baumannii in a mouse model of lethal infection. PMID:22609912

  4. Acinetobacter baumannii: Evolution of Antimicrobial Resistance—Treatment Options

    PubMed Central

    Doi, Yohei; Murray, Gerald L.; Peleg, Anton Y.


    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  5. Adjuvant role of Pseudomonas flagellin for Acinetobacter baumannii biofilm associated protein

    PubMed Central

    Sefidi, Mozhgan Derakhshan; Rasooli, Iraj; Owlia, Parviz; Talei, Daryush; Astaneh, Shakiba Darvish Alipour; Nazarian, Shahram


    AIM To study immunogenicity of Pseudomonas N terminal flagellin as an adjuvant for Acinetobacter baumannii (A. baumannii) biofilm associated protein (Bap). METHODS The N terminal flagellin gene was amplified. The pET28a (+) and polymerase chain reaction products were digested with HindIII and EcoR I. The ligation of N terminal flagellin into pET28a (‏+) was performed using T4 DNA ligase and was then transformed into Escherichia coli BL21 (DE3) as a suitable expression host. pET28a (‏+) vector harboring a conserved region of Bap from our previous work was used. The recombinant proteins were expressed, analyzed by SDS-PAGE method and was purified by affinity chromatography with His-Tag residues followed by confirmation with western blotting. Mice were immunized with recombinant N terminal flagellin and Bap subunits. The immunized animals were intranasally (i.n) challenged with A. baumannii and Pseudomonas aeruginosa (P. aeruginosa). RESULTS The flagellin enhanced the immunogenicity of Bap causing an increase in specific IgG titers in serum (P < 0.001). Internal organs, i.e., liver, lung and spleen of the Bap-Flagellin immunized group challenged with A. baumannii showed significantly lower bacterial load compared to the control group. The bacterial loads were studied in internal organs. A. baumannii infected immunized animals with Bap-Flagellin exhibited internal organs with minor bacterial load while P. aeruginosa PAO1 infected group showed heavy bacterial load of (4.3 ± 0.12) × 106, (1.1 ± 0.01) × 106 and (2.2 ± 0.22) × 106 per gram of lungs, liver and spleen respectively. Bacterial loads were detected per gram of lungs, liver and spleen of the mice group immunized with Bap were (1.2 ± 0.06) × 107, (11.1 ± 0.041) × 105 and (3.6 ± 0.42) × 106 respectively. In vivo neutralization assay indicated that all experimental mice groups, except for Flagellin administered group was significantly (P < 0.05) protected against A. baumannii. CONCLUSION These

  6. Acinetobacter baumannii: An Emerging and Important Pathogen

    PubMed Central

    Alsan, Marcella; Klompas, Michael


    Objective To review the clinical significance, management, and control of Acinetobacter infections. Methods Literature review. Results Acinetobacter infections have become a major cause of hospital-acquired infections worldwide. Acinetobacter is noted for its ability to survive for long periods on hospital surfaces and equipment, its predilection to develop resistance to multiple antibiotics, its affinity to cause serious infections in critically ill patients, and many well described outbreaks attributable to contamination of a common source. The crude ICU mortality is approximately 40%. Rigorous antibiotic stewardship and infection control measures are critical to prevent the spread of multidrug-resistant Acinetobacter infections. There is also a pressing need for new therapeutic options. Conclusion Acinetobacter is an emerging pathogen of increasing significance. PMID:26966345

  7. Colistin-Resistant Acinetobacter baumannii: Beyond Carbapenem Resistance

    PubMed Central

    Qureshi, Zubair A.; Hittle, Lauren E.; O'Hara, Jessica A.; Rivera, Jesabel I.; Syed, Alveena; Shields, Ryan K.; Pasculle, Anthony W.; Ernst, Robert K.; Doi, Yohei


    Background. With an increase in the use of colistin methansulfonate (CMS) to treat carbapenem-resistant Acinetobacter baumannii infections, colistin resistance is emerging. Methods. Patients with infection or colonization due to colistin-resistant A. baumannii were identified at a hospital system in Pennsylvania. Clinical data were collected from electronic medical records. Susceptibility testing, pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST) were performed. To investigate the mechanism of colistin resistance, lipid A was subjected to matrix-assisted laser desorption/ionization mass spectrometry. Results. Twenty patients with colistin-resistant A. baumannii were identified. Ventilator-associated pneumonia was the most common type of infection. Nineteen patients had received intravenous and/or inhaled CMS for treatment of carbapenem-resistant, colistin-susceptible A. baumannii infection prior to identification of colistin-resistant isolates. The 30-day all-cause mortality rate was 30%. The treatment regimen for colistin-resistant A. baumannii infection associated with the lowest mortality rate was a combination of CMS, a carbapenem, and ampicillin-sulbactam. The colistin-susceptible and -resistant isolates from the same patients were highly related by PFGE, but isolates from different patients were not, suggesting evolution of resistance during CMS therapy. By MLST, all isolates belonged to the international clone II, the lineage that is epidemic worldwide. Phosphoethanolamine modification of lipid A was present in all colistin-resistant A. baumannii isolates. Conclusions. Colistin-resistant A. baumannii occurred almost exclusively among patients who had received CMS for treatment of carbapenem-resistant, colistin-susceptible A. baumannii infection. Lipid A modification by the addition of phosphoethanolamine accounted for colistin resistance. Susceptibility testing for colistin should be considered for A. baumannii identified

  8. Epithelial innate immune response to Acinetobacter baumannii challenge.


    Feng, Zhimin; Jia, Xun; Adams, Mark D; Ghosh, Santosh K; Bonomo, Robert A; Weinberg, Aaron


    Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic antimicrobial peptides (AMPs) that also function to bridge the innate and adaptive immune system. We tested the induction of hBD-2 and -3 by A. baumannii on primary oral and skin epithelial cells and found that A. baumannii induces hBD-3 transcripts to a greater extent than it induces hBD-2 transcripts on both types of cells. In addition, we found that A. baumannii is susceptible to hBD-2 and -3 killing at submicromolar concentrations. Moreover, hBD-3 induction by A. baumannii was found to be dependent on epidermal growth factor receptor (EGFR) signaling. Inhibition of mitogen-activated protein kinase resulted in reduced expression of both hBD-2 and -3. Lastly, a disintegrin and metalloprotease 17 (ADAM17; also known as TACE) was found to be critical for hBD-3 induction, while ADAM10 and dual oxidase 1 (Duox1) were not required for hBD-3 induction. Induction of AMPs is an important component of innate sensing of pathogens and may play an important role in triggering systemic immune responses to A. baumannii infection. Further studies on the interactions between epithelial cells and A. baumannii will help us understand early stages of infection and may shed light on why some individuals are more vulnerable to A. baumannii infection.

  9. Epithelial Innate Immune Response to Acinetobacter baumannii Challenge

    PubMed Central

    Feng, Zhimin; Jia, Xun; Adams, Mark D.; Ghosh, Santosh K.; Bonomo, Robert A.


    Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic antimicrobial peptides (AMPs) that also function to bridge the innate and adaptive immune system. We tested the induction of hBD-2 and -3 by A. baumannii on primary oral and skin epithelial cells and found that A. baumannii induces hBD-3 transcripts to a greater extent than it induces hBD-2 transcripts on both types of cells. In addition, we found that A. baumannii is susceptible to hBD-2 and -3 killing at submicromolar concentrations. Moreover, hBD-3 induction by A. baumannii was found to be dependent on epidermal growth factor receptor (EGFR) signaling. Inhibition of mitogen-activated protein kinase resulted in reduced expression of both hBD-2 and -3. Lastly, a disintegrin and metalloprotease 17 (ADAM17; also known as TACE) was found to be critical for hBD-3 induction, while ADAM10 and dual oxidase 1 (Duox1) were not required for hBD-3 induction. Induction of AMPs is an important component of innate sensing of pathogens and may play an important role in triggering systemic immune responses to A. baumannii infection. Further studies on the interactions between epithelial cells and A. baumannii will help us understand early stages of infection and may shed light on why some individuals are more vulnerable to A. baumannii infection. PMID:25114113

  10. Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii.


    Lázaro-Díez, María; Chapartegui-González, Itziar; Redondo-Salvo, Santiago; Leigh, Chike; Merino, David; Segundo, David San; Navas, Jesús; Icardo, José Manuel; Acosta, Félix; Ocampo-Sosa, Alain; Martínez-Martínez, Luis; Ramos-Vivas, José


    Acinetobacter baumannii is a common cause of health care associated infections worldwide. A. pittii is an opportunistic pathogen also frequently isolated from Acinetobacter infections other than those from A. baumannii. Knowledge of Acinetobacter virulence factors and their role in pathogenesis is scarce. Also, there are no detailed published reports on the interactions between A. pittii and human phagocytic cells. Using confocal laser and scanning electron microscopy, immunofluorescence, and live-cell imaging, our study shows that immediately after bacteria-cell contact, neutrophils rapidly and continuously engulf and kill bacteria during at least 4 hours of infection in vitro. After 3 h of infection, neutrophils start to release neutrophil extracellular traps (NETs) against Acinetobacter. DNA in NETs colocalizes well with human histone H3 and with the specific neutrophil elastase. We have observed that human neutrophils use large filopodia as cellular tentacles to sense local environment but also to detect and retain bacteria during phagocytosis. Furthermore, co-cultivation of neutrophils with human differentiated macrophages before infections shows that human neutrophils, but not macrophages, are key immune cells to control Acinetobacter. Although macrophages were largely activated by both bacterial species, they lack the phagocytic activity demonstrated by neutrophils.

  11. [Evolution of antimicrobial susceptibility of Acinetobacter baumannii clinical isolates].


    López-Hernández, S; Alarcón, T; López-Brea, M


    Acinetobacter baumannii is a microorganism frequently implicated in colonization and infection in hospitalized patients. An increase of resistance has been observed in recent years making these infections difficult to treat. The in vitro activity of 24 antibiotics, 15 betalactam agents and nine nonbetalactams, was studied in 156 A. baumannii clinical isolates. The strains were collected from different clinical samples obtained from inpatients (92%) and 8% were from outpatients. Evolution of susceptibility from January 1995 to December 1997 was studied. MIC of the following antibiotics was determined by the agar dilution method: ampicillin, ticarcillin, piperacillin, ampicillin-sulbactam, amoxicillin- clavulanic acid, ticarcillin-clavulanic acid, piperacillin-tazobactam, cefotaxime, ceftazidime, cefepime, imipenem, meropenem, clavulanic acid, sulbactam, tazobactam, amikacin, gentamicin, tobramycin, ofloxacin, doxycycline, fosfomycin, rifampin, azithromycin and colistin. Low antimicrobial susceptibility was observed in most A. baumannii strains. Colistin, imipenem, meropenem and ampicillin-sulbactam showed the greatest susceptibility (100, 88.4, 88.4 and 84.6%, respectively). A. baumannii strains from inpatients showed a lower antimicrobial susceptibility than strains from outpatients, who showed a high percentage of susceptibility to most antibiotics. Rifampin and azithromycin showed certain in vitro activity against the most susceptible A. baumannii strains. A progressive decrease in susceptibility to most antibiotics was observed during the period studied. Carbapenem-resistant A. baumannii emerged in 1996 and increased in 1997.

  12. Methicillin-resistant Staphylococcus aureus and Acinetobacter baumannii on computer interface surfaces of hospital wards and association with clinical isolates

    PubMed Central


    Background Computer keyboards and mice are potential reservoirs of nosocomial pathogens, but routine disinfection for non-water-proof computer devices is a problem. With better hand hygiene compliance of health-care workers (HCWs), the impact of these potential sources of contamination on clinical infection needs to be clarified. Methods This study was conducted in a 1600-bed medical center of southern Taiwan with 47 wards and 282 computers. With education and monitoring program of hand hygiene for HCWs, the average compliance rate was 74% before our surveillance. We investigated the association of methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and Acinetobacter baumannii, three leading hospital-acquired pathogens, from ward computer keyboards, mice and from clinical isolates in non-outbreak period by pulsed field gel electrophoresis and antibiogram. Results Our results revealed a 17.4% (49/282) contamination rate of these computer devices by S. aureus, Acinetobacter spp. or Pseudomonas spp. The contamination rates of MRSA and A. baumannii in the ward computers were 1.1% and 4.3%, respectively. No P. aeruginosa was isolated. All isolates from computers and clinical specimens at the same ward showed different pulsotypes. However, A. baumannii isolates on two ward computers had the same pulsotype. Conclusion With good hand hygiene compliance, we found relatively low contamination rates of MRSA, P. aeruginosa and A. baumannii on ward computer interface, and without further contribution to nosocomial infection. Our results suggested no necessity of routine culture surveillance in non-outbreak situation. PMID:19796381

  13. Methicillin-resistant Staphylococcus aureus and Acinetobacter baumannii on computer interface surfaces of hospital wards and association with clinical isolates.


    Lu, Po-Liang; Siu, L K; Chen, Tun-Chieh; Ma, Ling; Chiang, Wen-Gin; Chen, Yen-Hsu; Lin, Sheng-Fung; Chen, Tyen-Po


    Computer keyboards and mice are potential reservoirs of nosocomial pathogens, but routine disinfection for non-water-proof computer devices is a problem. With better hand hygiene compliance of health-care workers (HCWs), the impact of these potential sources of contamination on clinical infection needs to be clarified. This study was conducted in a 1600-bed medical center of southern Taiwan with 47 wards and 282 computers. With education and monitoring program of hand hygiene for HCWs, the average compliance rate was 74% before our surveillance. We investigated the association of methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and Acinetobacter baumannii, three leading hospital-acquired pathogens, from ward computer keyboards, mice and from clinical isolates in non-outbreak period by pulsed field gel electrophoresis and antibiogram. Our results revealed a 17.4% (49/282) contamination rate of these computer devices by S. aureus, Acinetobacter spp. or Pseudomonas spp. The contamination rates of MRSA and A. baumannii in the ward computers were 1.1% and 4.3%, respectively. No P. aeruginosa was isolated. All isolates from computers and clinical specimens at the same ward showed different pulsotypes. However, A. baumannii isolates on two ward computers had the same pulsotype. With good hand hygiene compliance, we found relatively low contamination rates of MRSA, P. aeruginosa and A. baumannii on ward computer interface, and without further contribution to nosocomial infection. Our results suggested no necessity of routine culture surveillance in non-outbreak situation.

  14. [Current approaches to explain the virulence of Acinetobacter baumannii].


    Aşık, Gülşah


    Acinetobacter baumannii which is one of the most frequent nosocomial pathogens, has drawn attention in the last years owing to multi-drug resistant strains. A.baumannii may give rise to nosocomial epidemics especially in intensive care units and may lead to treatment failure due to its increasing antimicrobial resistance. These gram-negative non-fermentative coccobacilli may be encountered also in community associated infections. However, they are frequently isolated in pneumonia, urinary tract infection, bacteremia, meningitis and wound infections that develop in patients hospitalized for serious diseases. Although detailed data about the epidemiology and antimicrobial resistance patterns related to this bacteria exist, relatively limited data is present about the virulence factors and environmental physiology of A.baumannii. The role of some bacterial virulence factors in the pathogenesis of Acinetobacter infections have been enlightened by recent investigations. Among these virulence factors, production of extracellular enzymes with lipolytic and cytolytic activities, outer membrane protein (AbOmpA) with apoptotic effects on epithelial cells, adhesion molecules (fimbria and AbOmpA) that function during attachment to epithelial cells, K1 type capsular structure, type-1 pili and AbOmpA induced biofilm formation, siderophore (acinetobactin) or hemin mediated iron acquisition mechanisms, quorum sensing system that functions by the help of N-acyl homoserine lacton signal molecules and cellular components that enable Acinetobacter species to live under inappropriate environmental conditions like dryness, low temperature, restricted nutritional elements, can be counted. New information about the virulence factors will help better understanding of the adaptive response of A.baumannii in the host setting. This review is focused on the current information about the virulence factors of of A.baumannii.

  15. [Ecological aspects and prophylaxis of Acinetobacter baumannii nosocomial infection].


    Boukadida, J


    Acinetobacter Baumannii is an aerobic strit gram negative bacteria cause of epidemic infection in intensive care units this bacteria is isolated from the patient and its environment. The detection of AB infection require the isolation of patients and decontamination of the material despite the virulence of the germ, these measures are necessary due to the rapid extension of epidemic in the absence of adequate means.

  16. First report of OXA-72 producing Acinetobacter baumannii in Romania.


    Georgescu, M; Gheorghe, I; Dudu, A; Czobor, I; Costache, M; Cristea, V-C; Lazăr, V; Chifiriuc, M C


    This is the first report of an OXA-72-producing Acinetobacter baumannii strain in Romania, isolated from chronic leg ulcer samples. Identification of the strain was performed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Presence of carbapenem resistance genes was investigated by PCR and sequencing. Our data support the spread of the bla OXA-72 gene in Eastern Europe.

  17. Stress responses in the opportunistic pathogen Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E; Actis, Luis A


    Acinetobacter baumannii causes a wide range of severe infections among compromised and injured patients worldwide. The relevance of these infections are, in part, due to the ability of this pathogen to sense and react to environmental and host stress signals, allowing it to persist and disseminate in medical settings and the human host. This review summarizes current knowledge on the roles that environmental and cellular stressors play in the ability of A. baumannii to resist nutrient deprivation, oxidative and nitrosative injury, and even the presence of the commonly used antiseptic ethanol, which could serve as a nutrient- and virulence-enhancing signal rather than just being a convenient disinfectant. Emerging experimental evidence supports the role of some of these responses in the pathogenesis of the infections A. baumannii causes in humans and its capacity to resist antibiotics and host response effectors. PMID:23464372

  18. Acinetobacter baumannii: biology and drug resistance - role of carbapenemases.


    Nowak, Pawel; Paluchowska, Paulina


    Acinetobacter baumannii is a Gram-negative, glucose-non-fermenting, oxidase-negative coccobacillus, most commonly associated with the hospital settings. The ability to survive in adverse environmental conditions as well as high level of natural and acquired antimicrobial resistance make A. baumannii one of the most important nosocomial pathogens. While carbapenems have long been considered as antimicrobials of last-resort, the rates of clinical A. baumannii strains resistant to these antibiotics are increasing worldwide. Carbapenem resistance among A. baumannii is conferred by coexisting mechanisms including: decrease in permeability of the outer membrane, efflux pumps, production of beta-lactamases, and modification of penicillin-binding proteins. The most prevalent mechanism of carbapenem resistance among A. baumannii is associated with carbapenem-hydro-lysing enzymes that belong to Ambler class D and B beta-lactamases. In addition, there have also been reports of resistance mediated by selected Ambler class A carbapenemases among A. baumannii strains. Resistance determinants in A. baumannii are located on chromosome and plasmids, while acquisition of new mechanisms can be mediated by insertion sequences, integrons, transposons, and plasmids. Clinical relevance of carbapen-em resistance among strains isolated from infected patients, carriers and hospital environment underlines the need for carbapenemase screening. Currently available methods vary in principle, accuracy and efficiency. The techniques that deserve particular attention belong to both easily accessible unsophisticated methods as well as advanced techniques based on mass spectrometry or molecular biology. While carbapenemases limit the therapeutic options in A. baumannii infections, studies concerning novel beta-lactamase inhibitors offer a new insight into effective therapy.

  19. Identification of Acinetobacter baumannii serum-associated antibiotic efflux pump inhibitors.


    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn; Dunman, Paul M


    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca(2+) channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Identification of Acinetobacter baumannii Serum-Associated Antibiotic Efflux Pump Inhibitors

    PubMed Central

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn


    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca2+ channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. PMID:25114126

  1. Rational Design of α-Helical Antimicrobial Peptides to Target Gram-negative Pathogens, Acinetobacter baumannii and Pseudomonas aeruginosa: Utilization of Charge, ’Specificity Determinants,’ Total Hydrophobicity, Hydrophobe Type and Location as Design Parameters to Improve the Therapeutic Ratio

    PubMed Central

    Jiang, Ziqing; Vasil, Adriana I.; Gera, Lajos; Vasil, Michael L.; Hodges, Robert S.


    The rapidly growing problem of increased resistance to classical antibiotics makes the development of new classes of antimicrobial agents with lower rates of resistance urgent. Amphipathic cationic α-helical antimicrobial peptides have been proposed as a potential new class of antimicrobial agents. The goal of this study was to take a broad-spectrum, 26-residue, antimicrobial peptide in the all-D conformation, peptide D1 (K13) with excellent biologic properties and address the question of whether a rational design approach could be used to enhance the biologic properties if the focus was on Gram-negative pathogens only. To test this hypothesis, we used 11 and 6 diverse strains of Acinetobacter baumannii and Pseudo-monas aeruginosa, respectively. We optimized the number and location of positively charged residues on the polar face, the number, location, and type of hydrophobe on the non-polar face and varied the number of ’specificity determinants’ in the center of the non-polar face from 1 to 2 to develop four new antimicrobial peptides. We demonstrated not only improvements in antimicrobial activity, but also dramatic reductions in hemolytic activity and unprecedented improvements in therapeutic indices. Compared to our original starting peptide D1 (V13), peptide D16 had a 746-fold improvement in hemolytic activity (i.e. decrease), maintained antimicrobial activity, and improved the therapeutic indices by 1305-fold and 895-fold against A. baumannii and P. aeruginosa, respectively. The resulting therapeutic indices for D16 were 3355 and 895 for A. baumannii and P. aeruginosa, respectively. D16 is an ideal candidate for commercialization as a clinical therapeutic to treat Gram-negative bacterial infections. PMID:21219588

  2. Efficacy of Artilysin Art-175 against Resistant and Persistent Acinetobacter baumannii

    PubMed Central

    Defraine, Valerie; Schuermans, Joris; Grymonprez, Barbara; Govers, Sander K.; Aertsen, Abram; Fauvart, Maarten; Michiels, Jan; Lavigne, Rob


    Bacteriophage-encoded endolysins have shown promise as a novel class of antibacterials with a unique mode of action, i.e., peptidoglycan degradation. However, Gram-negative pathogens are generally not susceptible due to their protective outer membrane. Artilysins overcome this barrier. Artilysins are optimized, engineered fusions of selected endolysins with specific outer membrane-destabilizing peptides. Artilysin Art-175 comprises a modified variant of endolysin KZ144 with an N-terminal fusion to SMAP-29. Previously, we have shown the high susceptibility of Pseudomonas aeruginosa to Art-175. Here, we report that Art-175 is highly bactericidal against stationary-phase cells of multidrug-resistant Acinetobacter baumannii, even resulting in a complete elimination of large inocula (≥108 CFU/ml). Besides actively dividing cells, Art-175 also kills persisters. Instantaneous killing of A. baumannii upon contact with Art-175 could be visualized after immobilization of the bacteria in a microfluidic flow cell. Effective killing of a cell takes place through osmotic lysis after peptidoglycan degradation. The killing rate is enhanced by the addition of 0.5 mM EDTA. No development of resistance to Art-175 under selection pressure and no cross-resistance with existing resistance mechanisms could be observed. In conclusion, Art-175 represents a highly active Artilysin against both A. baumannii and P. aeruginosa, two of the most life-threatening pathogens of the order Pseudomonadales. PMID:27021321

  3. Differential Role of the T6SS in Acinetobacter baumannii Virulence

    PubMed Central

    Foucault-Grunenwald, Marie-Laure; Borges, Vitor; Charpentier, Xavier; Limansky, Adriana S.; Gomes, João Paulo; Viale, Alejandro M.; Salcedo, Suzana P.


    Gram-negative bacteria, such as Acinetobacter baumannii, are an increasing burden in hospitals worldwide with an alarming spread of multi-drug resistant (MDR) strains. Herein, we compared a type strain (ATCC17978), a non-clinical isolate (DSM30011) and MDR strains of A. baumannii implicated in hospital outbreaks (Ab242, Ab244 and Ab825), revealing distinct patterns of type VI secretion system (T6SS) functionality. The T6SS genomic locus is present and was actively transcribed in all of the above strains. However, only the A. baumannii DSM30011 strain was capable of killing Escherichia coli in a T6SS-dependent manner, unlike the clinical isolates, which failed to display an active T6SS in vitro. In addition, DSM30011 was able to outcompete ATCC17978 as well as Pseudomonas aeruginosa and Klebsiella pneumoniae, bacterial pathogens relevant in mixed nosocomial infections. Finally, we found that the T6SS of DSM30011 is required for host colonization of the model organism Galleria mellonella suggesting that this system could play an important role in A. baumannii virulence in a strain-specific manner. PMID:26401654

  4. Inverse PCR for subtyping of Acinetobacter baumannii carrying ISAba1.


    Kim, Shukho; Park, Yun-Ju; Kim, Jungmin


    Acinetobacter baumannii has been prevalent in nosocomial infections, often causing outbreaks in intensive care units. ISAba1 is an insertion sequence that has been identified only in A. baumannii and its copy number varies among strains. It has been reported that ISAba1 provides a promoter for bla(OXA-51-like), bla(OXA-23-like), and bla(ampC), which are associated with the resistance of A. baumannii to carbapenems and cephalosporins. The main purpose of this study was to develop a novel inverse PCR method capable of typing A. baumannii strains. The method involves three major steps: cutting of genomic DNA with a restriction enzyme, ligation, and PCR. In the first step, bacterial genomic DNA was digested with DpnI. In the second step, the digested genomic DNAs were ligated to form intramolecular circular DNAs. In the last step, the ligated circular DNAs were amplified by PCR with primers specific for ISAba1 and the amplified PCR products were electrophoresed. Twenty-two clinical isolates of A. baumannii were used for the evaluation of the inverse PCR (iPCR) typing method. Dendrogram analysis revealed two major clusters, similar to pulsed-field gel electrophoresis (PFGE) results. Three ISAba1-associated genes--bla(ampC), bla(OXA-66-like), and csuD--were amplified and detected in the clinical isolates. This novel iPCR typing method is comparable to PFGE in its ability to discriminate A. baumannii strains, and is a promising molecular epidemiological tool for investigating A. baumannii carrying ISAba1.

  5. Molecular Analysis of the Acinetobacter baumannii Biofilm-Associated Protein

    PubMed Central

    Goh, H. M. Sharon; Beatson, Scott A.; Totsika, Makrina; Moriel, Danilo G.; Phan, Minh-Duy; Szubert, Jan; Runnegar, Naomi; Sidjabat, Hanna E.; Paterson, David L.; Nimmo, Graeme R.; Lipman, Jeffrey


    Acinetobacter baumannii is a multidrug-resistant pathogen associated with hospital outbreaks of infection across the globe, particularly in the intensive care unit. The ability of A. baumannii to survive in the hospital environment for long periods is linked to antibiotic resistance and its capacity to form biofilms. Here we studied the prevalence, expression, and function of the A. baumannii biofilm-associated protein (Bap) in 24 carbapenem-resistant A. baumannii ST92 strains isolated from a single institution over a 10-year period. The bap gene was highly prevalent, with 22/24 strains being positive for bap by PCR. Partial sequencing of bap was performed on the index case strain MS1968 and revealed it to be a large and highly repetitive gene approximately 16 kb in size. Phylogenetic analysis employing a 1,948-amino-acid region corresponding to the C terminus of Bap showed that BapMS1968 clusters with Bap sequences from clonal complex 2 (CC2) strains ACICU, TCDC-AB0715, and 1656-2 and is distinct from Bap in CC1 strains. By using overlapping PCR, the bapMS1968 gene was cloned, and its expression in a recombinant Escherichia coli strain resulted in increased biofilm formation. A Bap-specific antibody was generated, and Western blot analysis showed that the majority of A. baumannii strains expressed an ∼200-kDa Bap protein. Further analysis of three Bap-positive A. baumannii strains demonstrated that Bap is expressed at the cell surface and is associated with biofilm formation. Finally, biofilm formation by these Bap-positive strains could be inhibited by affinity-purified Bap antibodies, demonstrating the direct contribution of Bap to biofilm growth by A. baumannii clinical isolates. PMID:23956398

  6. Complete Genome Sequence of Lytic Bacteriophage LZ35 Infecting Acinetobacter baumannii Isolates

    PubMed Central

    Guo, Zhonghe; Huang, Honglan; Wu, Xiaolin; Hao, Yuchong


    Acinetobacter baumannii is a Gram-negative opportunistic pathogen that is frequently associated with nosocomial infections. Bacteriophages infecting A. baumannii can be used as effective agents to control these infections. Here, we announce the complete genome sequence of the lytic bacteriophage LZ35 infecting A. baumannii isolates. PMID:27856573

  7. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons

    PubMed Central

    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia


    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection. PMID:20871867

  8. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons.


    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia


    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection.

  9. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens

    PubMed Central

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa


    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  10. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens.


    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa


    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem.

  11. Blood stream infections caused by Acinetobacter baumannii group in Japan - Epidemiological and clinical investigation.


    Fujikura, Yuji; Yuki, Atsushi; Hamamoto, Takaaki; Kawana, Akihiko; Ohkusu, Kiyofumi; Matsumoto, Tetsuya


    Acinetobacter calcoaceticus-Acinetobacter baumannii complex, especially A. baumannii, Acinetobacter pittii and Acinetobacter nosocomialis, constitutes an important group of nosocomial pathogens; however, epidemiological or clinical characteristics and prognosis is limited in Japan. From 2009 to 2013, 47 blood stream infection cases resulting from A. baumannii group were reviewed at the National Defense Medical College, an 800-bed tertiary hospital. To determine the genospecies, further comparative nucleotide sequence analyses of the RNA polymerase b-subunit (rpoB) gene were performed. Sequence analysis of rpoB gene showed that 25 (49.0%), 17 (33.3%) and 5 (9.8%) cases were caused by A. baumannii, A. pittii and A. nosocomialis, respectively. The 30-day and in-hospital mortality rates of A. baumannii were 8.5% and 25.5%, respectively, and there were no significant differences between Acinetobacter species. Clinical characteristics were statistically insignificant. Multidrug-resistant Acinetobacter species were detected in 3 cases (5.9%) with same pulsed-field gel electrophoresis (PFGE) pattern and A. baumannii was less susceptible to amikacin and levofloxacin. In this study, the mortality and clinical characteristics were similar among A. baumannii group isolate cases despite some showing drug resistance. However, identification of Acinetobacter species helps to initiate appropriate antibiotic therapy in earlier treatment phase, because A. baumannii shows some drug resistance.

  12. Structure and biosynthesis of fimsbactins A-F, siderophores from Acinetobacter baumannii and Acinetobacter baylyi.


    Proschak, Anna; Lubuta, Patrice; Grün, Peter; Löhr, Frank; Wilharm, Gottfried; De Berardinis, Veronique; Bode, Helge B


    Novel chatechol/hydroxamate siderophores (named "fimsbactins") were identified in Acinetobacter baumannii ATCC 17978 and Acinetobacter baylyi ADP1. The major compound, fimsbactin A, was isolated from low-iron cultures of A. baylyi ADP1, and its chemical structure was elucidated by mass spectrometry, and detailed (1)H, (13)C and (15)N NMR spectroscopy. From inverse feeding experiments following HPLC-MS analysis, the structures of five additional derivatives were elucidated. The gene cluster encoding the fimsbactin synthetase (fbs) was identified in both genomes, and mutants in fbs genes in A. baylyi were analyzed, thus allowing prediction of the fimsbactin biosynthesis pathway.

  13. Epidemiologic and Clinical Impact of Acinetobacter baumannii Colonization and Infection

    PubMed Central

    Villar, Macarena; Cano, María E.; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús


    Abstract Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  14. Genetic Mechanisms of Antimicrobial Resistance of Acinetobacter baumannii.


    Esterly, John S; Richardson, Chad L; Eltoukhy, Noha S; Qi, Chao; Scheetz, Marc H


    To summarize published data identifying known genetic mechanisms of antibiotic resistance in Acinetobacter baumannii and the correlating phenotypic expression of antibiotic resistance. MEDLINE databases (1966-July 15, 2010) were searched to identify original reports of genetic mechanisms of antibiotic resistance in A. baumannii. Numerous genetic mechanisms of resistance to multiple classes of antibiotics are known to exist in A. baumannii, a gram-negative bacterium increasingly implicated in nosocomial infections. Mechanisms may be constitutive or acquired via plasmids, integrons, and transposons. Methods of resistance include enzymatic modification of antibiotic molecules, modification of antibiotic target sites, expression of efflux pumps, and downregulation of cell membrane porin channel expression. Resistance to β-lactams appears to be primarily caused by β-lactamase production, including extended spectrum β-lactamases (b/aTEM, blaSHV, b/aTX-M,b/aKPC), metallo-β-lactamases (blaMP, blaVIM, bla, SIM), and most commonly, oxacillinases (blaOXA). Antibiotic target site alterations confer resistance to fluoroquinolones (gyrA, parC) and aminoglycosides (arm, rmt), and to a much lesser extent, β-lactams. Efflux pumps (tet, ade, abe) contribute to resistance against β-lactams, tetracyclines, fluoroquinolones, and aminoglycosides. Finally, porin channel deletion (carO, oprD) appears to contribute to β-lactam resistance and may contribute to rarely seen polymyxin resistance. Of note, efflux pumps and porin deletions as solitary mechanisms may not render clinical resistance to A. baumannii. A. baumannii possesses copious genetic resistance mechanisms. Knowledge of local genotypes and expressed phenotypes for A. baumannii may aid clinicians more than phenotypic susceptibilities reported in large epidemiologic studies. © 2011 SAGE Publications.

  15. Heteroresistance to Cephalosporins and Penicillins in Acinetobacter baumannii

    PubMed Central

    Hung, Kuei-Hsiang; Wang, Ming-Cheng; Huang, Ay-Huey; Yan, Jing-Jou


    Heteroresistance to antimicrobial agents may affect susceptibility test results and therapeutic success. In this study, we investigated heteroresistance to cephalosporins and penicillins in Acinetobacter baumannii, a major pathogen causing nosocomial infections. Two A. baumannii isolates exhibited heteroresistance to ampicillin-sulbactam, ticarcillin-clavulanic acid, cefepime, and cefpirome, showing a distinct colony morphology of circular rings within the inhibition halos. Pulsed-field gel electrophoresis (PFGE) and outer membrane protein (OMP) analysis demonstrated that subpopulations around the disks/Etest strips and the original strains all belonged to the same PFGE type and OMP profile. Population analysis profile (PAP) showed the presence of heteroresistant subpopulations with high cefepime resistance levels in two isolates (008 and 328). Interestingly, A. baumannii 008 contained two peaks: one was grown in the presence of up to 1 μg of cefepime/ml, the other apparently occurred when the concentration of cefepime was raised to 256 μg/ml. After serial passages without exposure to cefepime, the PAP curve maintained the same trend observed for the original strain of A. baumannii 008. However, the PAP curve showed a shift to relatively lower cefepime resistance (from 256 to 64 μg/ml) in A. baumannii 328 after 10 passages in antibiotic-free Mueller-Hinton agar plates. Convergence to a monotypic resistance phenotype did not occur. Growth rate analysis revealed that slower growth in resistant subpopulations may provide a strategy against antibiotic challenge. To our knowledge, this is the first report of heteroresistance to cephalosporins and penicillins in A. baumannii. PMID:22189112

  16. Acinetobacter baumannii Genes Required for Bacterial Survival during Bloodstream Infection

    PubMed Central

    Subashchandrabose, Sargurunathan; Smith, Sara; DeOrnellas, Valerie; Crepin, Sebastien; Kole, Monica; Zahdeh, Carina


    ABSTRACT Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance

  17. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside

    PubMed Central

    Lin, Ming-Feng; Lan, Chung-Yu


    Acinetobacter baumannii (A. baumannii) is undoubtedly one of the most successful pathogens in the modern healthcare system. With invasive procedures, antibiotic use and immunocompromised hosts increasing in recent years, A. baumannii has become endemic in hospitals due to its versatile genetic machinery, which allows it to quickly evolve resistance factors, and to its remarkable ability to tolerate harsh environments. Infections and outbreaks caused by multidrug-resistant A. baumannii (MDRAB) are prevalent and have been reported worldwide over the past twenty or more years. To address this problem effectively, knowledge of species identification, typing methods, clinical manifestations, risk factors, and virulence factors is essential. The global epidemiology of MDRAB is monitored by persistent surveillance programs. Because few effective antibiotics are available, clinicians often face serious challenges when treating patients with MDRAB. Therefore, a deep understanding of the resistance mechanisms used by MDRAB can shed light on two possible strategies to combat the dissemination of antimicrobial resistance: stringent infection control and antibiotic treatments, of which colistin-based combination therapy is the mainstream strategy. However, due to the current unsatisfying therapeutic outcomes, there is a great need to develop and evaluate the efficacy of new antibiotics and to understand the role of other potential alternatives, such as antimicrobial peptides, in the treatment of MDRAB infections. PMID:25516853

  18. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii

    PubMed Central

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  19. Nosocomial Acinetobacter baumannii Infections and Changing Antibiotic Resistance.


    Necati Hakyemez, Ismail; Kucukbayrak, Abdulkadir; Tas, Tekin; Burcu Yikilgan, Aslihan; Akkaya, Akcan; Yasayacak, Aliye; Akdeniz, Hayrettin


    In the intensive care setting, Acinetobacter baumannii causes ventilator-associated pneumonia and other nosocomial infections that are difficult to treat. Objective of this study was to investigate nosocomial A. baumannii infections and its changing antibiotic resistance. A total of 56 patients diagnosed with A.baumannii infections between January 2009 and December 2011 were included in the study. Diagnosis for nosocomial infections was established according to the CDC (Centers for Disease Control and Prevention) criteria. Identification of the agents isolated was carried out using conventional methods and VITEK 2 automated system, while antibiotic sensitivity testing was performed through VITEK 2 AST-N090 automated system. The most common infection was nosocomial pneumonia by 43%, among which 46% were ventilator-associated pneumonia. Considering all years, the most effective antibiotics on the isolated strains were found as colistin, tigecycline, imipenem and meropenem. However resistance to imipenem and meropenem was observed to increase over years. The issue of increased resistance to antibiotics poses difficulty in treatment of A. baumannii infections which in turn increases the rate of mortality and cost. In order to prevent development of resistance, antibiotics must be used in an appropriate way in accompanied with proper guidance.

  20. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii.


    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick


    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol.

  1. In vitro activity of ceftobiprole against Acinetobacter baumannii clinical isolates.


    Marti, Sara; Sánchez-Céspedes, Javier; Espinal, Paula; Vila, Jordi


    Acinetobacter baumannii is a multiresistant opportunistic nosocomial pathogen responsible for outbreaks worldwide. The main infection caused by this microorganism is nosocomial pneumonia, in particular ventilator-associated pneumonia in patients in Intensive Care Units. Treatment of these nosocomial infections is becoming problematic because the level of resistance to antimicrobial agents is rising. Ceftobiprole is a new cephalosporin with activity against Gram-positive and Gram-negative pathogens. This study evaluated the in vitro activity of ceftobiprole against a collection of 58 A. baumannii clinical isolates and showed that the activity of ceftobiprole was superior to ceftazidime and cefepime when the bla(ADC)-like gene was not expressed or was expressed at a low level.

  2. The structure of alanine racemase from Acinetobacter baumannii.


    Davis, Emily; Scaletti-Hutchinson, Emma; Opel-Reading, Helen; Nakatani, Yoshio; Krause, Kurt L


    Acinetobacter baumannii is an opportunistic Gram-negative bacterium which is a common cause of hospital-acquired infections. Numerous antibiotic-resistant strains exist, emphasizing the need for the development of new antimicrobials. Alanine racemase (Alr) is a pyridoxal 5'-phosphate dependent enzyme that is responsible for racemization between enantiomers of alanine. As D-alanine is an essential component of the bacterial cell wall, its inhibition is lethal to prokaryotes, making it an excellent antibiotic drug target. The crystal structure of A. baumannii alanine racemase (AlrAba) from the highly antibiotic-resistant NCTC13302 strain has been solved to 1.9 Å resolution. Comparison of AlrAba with alanine racemases from closely related bacteria demonstrates a conserved overall fold. The substrate entryway and active site of the enzymes were shown to be highly conserved. The structure of AlrAba will provide the template required for future structure-based drug-design studies.

  3. In vitro and in vivo biological activities of iron chelators and gallium nitrate against Acinetobacter baumannii.


    de Léséleuc, Louis; Harris, Greg; KuoLee, Rhonda; Chen, Wangxue


    We investigated the ability of compounds interfering with iron metabolism to inhibit the growth of Acinetobacter baumannii. Iron restriction with transferrin or 2,2-bipyridyl significantly inhibited A. baumannii growth in vitro. Gallium nitrate alone was moderately effective at reducing A. baumannii growth but became bacteriostatic in the presence of serum or transferrin. More importantly, gallium nitrate treatment reduced lung bacterial burdens in mice. The use of gallium-based therapies shows promise for the control of multidrug-resistant A. baumannii.

  4. Acinetobacter baumannii: association between environmental contamination of patient rooms and occupant status.


    Munoz-Price, L Silvia; Namias, Nicholas; Cleary, Timothy; Fajardo-Aquino, Yovanit; Depascale, Dennise; Arheart, Kristopher L; Rivera, Jesabel I; Doi, Yohei


    We aimed to determine the association between the presence of Acinetobacter baumannii in patient rooms and the carrier status of the occupants. Fifty-six (39%) of 143 rooms with A. baumannii-positive patients had results positive for A. baumannii. Only 49 (10%) of 485 rooms with A. baumannii-negative patients were positive (odds ratio, 5.72 [95% confidence interval, 3.66-8.96]; [Formula: see text]). Clinical and environmental isolates shared pulsed-field gel electrophoresis patterns.

  5. Morphine, but not trauma, sensitizes to systemic Acinetobacter baumannii infection.


    Breslow, Jessica M; Monroy, M Alexandra; Daly, John M; Meissler, Joseph J; Gaughan, John; Adler, Martin W; Eisenstein, Toby K


    Acinetobacter baumannii is an important nosocomial pathogen in civilian intensive care units. Recently the incidence has increased in wounded military personnel. Morphine is documented in numerous animal studies to be immunosuppressive and to sensitize to infection. The hypotheses were tested that morphine, administered for analgesia in the battlefield, predisposes to Acinetobacter infection, and that the opioid may have an additive or synergistic effect with trauma. To test these hypotheses, an intraperitoneal infection model was established in mice using several Acinetobacter strains. Morphine administered for 48 h by implantation of a slow-release morphine pellet increased mortality compared to animals receiving a placebo pellet, an effect that was blocked by the mu-opioid receptor antagonist, naltrexone. Acinetobacter burdens in the blood, spleens, livers, and lungs of morphine-treated mice, were significantly higher than those in placebo-treated animals, confirming that mortality was due to potentiated growth of the bacteria. There were also elevated levels of pro-inflammatory cytokines in morphine-treated versus placebo-treated mice. Morphine caused a reduction in the total number of cells in the peritoneal cavity, a decrease in the percentage and total numbers of neutrophils, and a decrease in the total number of macrophages. Morphine treatment also suppressed levels of the neutrophil-inducing molecules, IL-17A and KC/CXCL1. However, IL-17A(-/-) mice given morphine were not sensitized to Acintobacter infection to a greater degree than similarly treated wild-type mice. Trauma alone did not sensitize to Acinetobacter infection, and there was no additive effect between morphine and trauma. These results support the hypothesis that morphine potentiates Acinetobacter infection.

  6. Molecular epidemiology of Acinetobacter baumannii and Acinetobacter nosocomialis in Germany over a 5-year period (2005-2009).


    Schleicher, X; Higgins, P G; Wisplinghoff, H; Körber-Irrgang, B; Kresken, M; Seifert, H


    To investigate the species distribution within the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and the molecular epidemiology of A. baumannii and Acinetobacter nosocomialis, 376 Acinetobacter isolates were collected prospectively from hospitalized patients at 15 medical centres in Germany during three surveillance studies conducted over a 5-year period. Species identification was performed by molecular methods. Imipenem minimum inhibitory concentrations (MIC) were determined by broth microdilution. The prevalence of the most common carbapenemase-encoding genes was investigated by oxacillinase (OXA) -multiplex polymerase chain reaction (PCR). The molecular epidemiology was investigated by repetitive sequence-based PCR (rep-PCR; DiversiLab™). Acinetobacter pittii was the most prevalent Acinetobacter species (n = 193), followed by A. baumannii (n = 140), A. calcoaceticus (n = 10) and A. nosocomialis (n = 8). The majority of A. baumannii was represented by sporadic isolates (n = 70, 50%) that showed unique rep-PCR patterns, 25 isolates (18%) clustered with one or two other isolates, and only 45 isolates (32%) belonged to one of the previously described international clonal lineages. The most prevalent clonal lineage was international clone (IC) 2 (n = 34) and IC 1 (n = 6). According to CLSI, 25 A. baumannii isolates were non-susceptible to imipenem (MIC ≥ 8 mg/L), all of which produced an OXA-58-like or OXA-23-like carbapenemase. The rate of imipenem susceptibility among A. baumannii isolates decreased from 96% in 2005 to 76% in 2009. All other Acinetobacter isolates were susceptible to imipenem. The population structure of carbapenem-susceptible A. baumannii in Germany is highly diverse. Imipenem non-susceptibility was strongly associated with the clonal lineages IC 2 and IC 1. These data underscore the high clonality of carbapenem-resistant A. baumannii isolates.

  7. Imipenem: a potent inducer of multidrug resistance in Acinetobacter baumannii.


    Kuo, Han-Yueh; Chang, Kai-Chih; Kuo, Jai-Wei; Yueh, Hui-Wen; Liou, Ming-Li


    This study investigated the progression of multidrug resistance upon exposure to imipenem in Acinetobacter baumannii. Eighteen A. baumannii strains, including two reference strains (ATCC 19606 and ATCC 17978), four clinical strains (AB56, AB242, AB273 and AB279) and 12 antibiotic-selected mutant strains, were used in this study. Imipenem-selected mutants were generated from imipenem-susceptible strains (ATCC 19606, ATCC 17978 and AB242) by multistep selection resistance. Amikacin-, ciprofloxacin-, colistin-, meropenem- and ceftazidime-selected mutants were also generated from the two reference strains and were used for comparison. Antibiotic susceptibilities in the absence and presence of the efflux pump inhibitors carbonyl cyanide m-chlorophenylhydrazone (CCCP) and 1-(1-naphthylmethyl)-piperazine (NMP) were examined in the three imipenem-selected mutants and the three clinical multidrug-resistant (MDR) isolates. Expression profiles of the antimicrobial resistance genes in the imipenem-selected mutants and their parental strains were also determined. The results showed that imipenem was more likely, compared with the other antibiotics, to induce a MDR phenotype in the two reference strains. Differences in OXA-51-like carbapenemase, efflux pumps or/and AmpC β-lactamase expression were observed in the three imipenem-selected mutants. Moreover, a reduction in imipenem or amikacin resistance was observed when the imipenem-selected mutants and clinical isolates were exposed to NMP and CCCP. This study concluded that imipenem might be a potent inducer of multidrug resistance in A. baumannii strains. OXA-51-like carbapenemase combined with other resistance mechanisms may contribute to the development of multidrug resistance in A. baumannii. Monitoring the use of carbapenems is required to reduce the spread of MDR A. baumannii in hospitals.

  8. Inhaled colistin for treatment of pneumonia due to colistin-only-susceptible Acinetobacter baumannii.


    Choi, Hee Kyoung; Kim, Young Keun; Kim, Hyo Youl; Uh, Young


    Colistin is used for the treatment of pneumonia associated with multidrug- resistant Acinetobacter baumannii and Pseudomonas aeruginosa. However, the best route of administration and dosage is not known. We report our experience with aerosolized colistin in twelve patients with pneumonia caused by colistin-only-susceptible (COS) A. baumannii. We retrospectively reviewed patients' medical records who were treated with aerosolized colistin for the treatment of pneumonia. Ten patients were treated only with aerosolized colistin inhalation and two patients received a 3-day course intravenous colistin, and then switched to colistin inhalation therapy. The median duration of aerosolized colistin therapy was 17 days (5-31 days). Four patients were treated only with aerosolized colistin, whereas 4 patients received concomitant glycopeptides, and 4 received concomitant levofloxacin or cefoperazone/sulbactam. At the end of the therapy, the clinical response rate and bacteriological clearance rate was 83% and 50%, respectively. Colistin-resistant strains were isolated from 3 patients after aerosolized colistin therapy; however, all of them showed favorable clinical response. The median interval between inhalation therapy and resistance was 7 days (range 5-19 days). Acute kidney injury developed in 3 patients. Two patients experienced Clostridium difficile associated diarrhea. One patient developed fever and skin rash after aerosolized colistin therapy. No patient developed neurotoxicity or bronchospasm. Colistin inhalation therapy is deemed tolerable and safe, and could be beneficial as an adjuctive therapy for the management of pneumonia due to COS A. baumannii. However, the potential development of colistin resistance cannot be overlooked.

  9. Imported PER-1 producing Pseudomonas aeruginosa, PER-1 producing Acinetobacter baumanii and VIM-2-producing Pseudomonas aeruginosa strains in Hungary

    PubMed Central

    Szabó, Dora; Szentandrássy, Julia; Juhász, Zsuzsa; Katona, Katalin; Nagy, Károly; Rókusz, László


    Introduction Pseudomonas aeruginosa and Acinetobacter baumanii are important nosocomial pathogens with wide intrinsic resistance. However, due to the dissemination of the acquired resistance mechanisms, such as extended-spectrum beta-lactamase (ESBL) and metallo beta-lactamase (MBL) production, multidrug resistant strains have been isolated more often. Case presentation We report a case of a Hungarian tourist, who was initially hospitalized in Egypt and later transferred to Hungary. On the day of admission PER-1-producing P. aeruginosa, PER-1 producing A. baumannii, SHV-5-producing Klebsiella pneumoniae and VIM-2-producing P. aeruginosa isolates were subcultured from the patient's samples in Hungary. Comparing the pulsed-field gel electrophoresis (PFGE) patterns of the P. aeruginosa strains from the patient to the P. aeruginosa strains occurring in this hospital, we can state that the PER-1-producing P. aeruginosa and VIM-2-producing P. aeruginosa had external origin. Conclusion This is the first report of PER-1-producing P. aeruginosa,and PER-1-producing A. baumanii strains in Hungary. This case highlights the importance of spreading of the beta-lactamase-mediated resistance mechanisms between countries and continents, showing the importance of careful screening and the isolation of patients arriving from a different country. PMID:18513394

  10. Genetic Regulation of Virulence and Antibiotic Resistance in Acinetobacter baumannii.


    Kröger, Carsten; Kary, Stefani C; Schauer, Kristina; Cameron, Andrew D S


    Multidrug resistant microorganisms are forecast to become the single biggest challenge to medical care in the 21st century. Over the last decades, members of the genus Acinetobacter have emerged as bacterial opportunistic pathogens, in particular as challenging nosocomial pathogens because of the rapid evolution of antimicrobial resistances. Although we lack fundamental biological insight into virulence mechanisms, an increasing number of researchers are working to identify virulence factors and to study antibiotic resistance. Here, we review current knowledge regarding the regulation of virulence genes and antibiotic resistance in Acinetobacter baumannii. A survey of the two-component systems AdeRS, BaeSR, GacSA and PmrAB explains how each contributes to antibiotic resistance and virulence gene expression, while BfmRS regulates cell envelope structures important for pathogen persistence. A. baumannii uses the transcription factors Fur and Zur to sense iron or zinc depletion and upregulate genes for metal scavenging as a critical survival tool in an animal host. Quorum sensing, nucleoid-associated proteins, and non-classical transcription factors such as AtfA and small regulatory RNAs are discussed in the context of virulence and antibiotic resistance.

  11. Genetic Regulation of Virulence and Antibiotic Resistance in Acinetobacter baumannii

    PubMed Central

    Kröger, Carsten; Kary, Stefani C.; Schauer, Kristina; Cameron, Andrew D. S.


    Multidrug resistant microorganisms are forecast to become the single biggest challenge to medical care in the 21st century. Over the last decades, members of the genus Acinetobacter have emerged as bacterial opportunistic pathogens, in particular as challenging nosocomial pathogens because of the rapid evolution of antimicrobial resistances. Although we lack fundamental biological insight into virulence mechanisms, an increasing number of researchers are working to identify virulence factors and to study antibiotic resistance. Here, we review current knowledge regarding the regulation of virulence genes and antibiotic resistance in Acinetobacter baumannii. A survey of the two-component systems AdeRS, BaeSR, GacSA and PmrAB explains how each contributes to antibiotic resistance and virulence gene expression, while BfmRS regulates cell envelope structures important for pathogen persistence. A. baumannii uses the transcription factors Fur and Zur to sense iron or zinc depletion and upregulate genes for metal scavenging as a critical survival tool in an animal host. Quorum sensing, nucleoid-associated proteins, and non-classical transcription factors such as AtfA and small regulatory RNAs are discussed in the context of virulence and antibiotic resistance. PMID:28036056

  12. Association of class 1 and 2 integrons with multidrug-resistant Acinetobacter baumannii international clones and Acinetobacter nosocomialis isolates.


    Martins, Natacha; Picão, Renata Cristina; Adams-Sapper, Sheila; Riley, Lee W; Moreira, Beatriz Meurer


    The Acinetobacter baumannii clonal complex 113/79 (CC113/79) and class 2 integrons predominate in Latin America; a relationship between these characteristics was explored. The presence of integrases was determined in successive hospital Acinetobacter isolates (163 A. baumannii isolates and 72 Acinetobacter nosocomialis isolates). Most isolates had integrons, but class 1 and 2 integrons were present significantly more often in CC109/1 and CC113/79, respectively. The high prevalence of CC113/79 in Latin America may account for the predominance of class 2 integrons.

  13. Stereochemical Insignificance Discovered in Acinetobacter baumannii Quorum Sensing

    PubMed Central

    Struss, Anjali Kumari; Watkins, Richard; Feske, Brent D.; Kaufmann, Gunnar F.; Janda, Kim D.


    Stereochemistry is a key aspect of molecular recognition for biological systems. As such, receptors and enzymes are often highly stereospecific, only recognizing one stereoisomer of a ligand. Recently, the quorum sensing signaling molecules used by the nosocomial opportunistic pathogen, Acinetobacter baumannii, were identified, and the primary signaling molecule isolated from this species was N-(3-hydroxydodecanoyl)-l-homoserine lactone. A plethora of bacterial species have been demonstrated to utilize 3-hydroxy-acylhomoserine lactone autoinducers, and in virtually all cases, the (R)-stereoisomer was identified as the natural ligand and exhibited greater autoinducer activity than the corresponding (S)-stereoisomer. Using chemical synthesis and biochemical assays, we have uncovered a case of stereochemical insignificance in A. baumannii and provide a unique example where stereochemistry appears nonessential for acylhomoserine lactone-mediated quorum sensing signaling. Based on previously reported phylogenetic studies, we suggest that A. baumannii has evolutionarily adopted this unique, yet promiscuous quorum sensing system to ensure its survival, particularly in the presence of other proteobacteria. PMID:22629354

  14. Evaluation of Parameters for High Efficiency Transformation of Acinetobacter baumannii

    PubMed Central

    Yildirim, Suleyman; Thompson, Mitchell G.; Jacobs, Anna C.; Zurawski, Daniel V.; Kirkup, Benjamin C.


    Acinetobacter baumannii is an emerging, nosocomial pathogen that is poorly characterized due to a paucity of genetic tools and methods. While whole genome sequence data from several epidemic and environmental strains have recently become available, the functional characterization of genes is significantly lagging. Efficient transformation is one of the first steps to develop molecular tools that can be used to address these shortcomings. Here we report parameters allowing high efficiency transformation of A. baumannii. Using a multi-factorial experimental design we found that growth phase, voltage, and resistance all significantly contribute to transformation efficiency. The highest efficiency (4.3 × 108 Transformants/μg DNA) was obtained at the stationary growth phase of the bacterium (OD 6.0) using 25 ng of plasmid DNA under 100 Ohms resistance and 1.7 kV/cm voltage. The optimized electroporation parameters reported here provide a useful tool for genetic manipulation of A. baumannii. PMID:26911658

  15. Towards the complete proteinaceous regulome of Acinetobacter baumannii

    PubMed Central

    Pérez-Rueda, Ernesto; Antonio Ibarra, J


    The emergence of Acinetobacter baumannii strains, with broad multidrug-resistance phenotypes and novel virulence factors unique to hypervirulent strains, presents a major threat to human health worldwide. Although a number of studies have described virulence-affecting entities for this organism, very few have identified regulatory elements controlling their expression. Previously, our group has documented the global identification and curation of regulatory RNAs in A. baumannii. As such, in the present study, we detail an extension of this work, the performance of an extensive bioinformatic analysis to identify regulatory proteins in the recently annotated genome of the highly virulent AB5075 strain. In so doing, 243 transcription factors, 14 two-component systems (TCSs), 2 orphan response regulators, 1 hybrid TCS and 5 σ factors were found. A comparison of these elements between AB5075 and other clinical isolates, as well as a laboratory strain, led to the identification of several conserved regulatory elements, whilst at the same time uncovering regulators unique to hypervirulent strains. Lastly, by comparing regulatory elements compiled in this study to genes shown to be essential for AB5075 infection, we were able to highlight elements with a specific importance for pathogenic behaviour. Collectively, our work offers a unique insight into the regulatory network of A. baumannii strains, and provides insight into the evolution of hypervirulent lineages. PMID:28663824

  16. Towards the complete proteinaceous regulome of Acinetobacter baumannii.


    Casella, Leila G; Weiss, Andy; Pérez-Rueda, Ernesto; Antonio Ibarra, J; Shaw, Lindsey N


    The emergence of Acinetobacter baumannii strains, with broad multidrug-resistance phenotypes and novel virulence factors unique to hypervirulent strains, presents a major threat to human health worldwide. Although a number of studies have described virulence-affecting entities for this organism, very few have identified regulatory elements controlling their expression. Previously, our group has documented the global identification and curation of regulatory RNAs in A. baumannii. As such, in the present study, we detail an extension of this work, the performance of an extensive bioinformatic analysis to identify regulatory proteins in the recently annotated genome of the highly virulent AB5075 strain. In so doing, 243 transcription factors, 14 two-component systems (TCSs), 2 orphan response regulators, 1 hybrid TCS and 5 σ factors were found. A comparison of these elements between AB5075 and other clinical isolates, as well as a laboratory strain, led to the identification of several conserved regulatory elements, whilst at the same time uncovering regulators unique to hypervirulent strains. Lastly, by comparing regulatory elements compiled in this study to genes shown to be essential for AB5075 infection, we were able to highlight elements with a specific importance for pathogenic behaviour. Collectively, our work offers a unique insight into the regulatory network of A. baumannii strains, and provides insight into the evolution of hypervirulent lineages.

  17. Characterization of the chromosomal cephalosporinases produced by Acinetobacter lwoffii and Acinetobacter baumannii clinical isolates.

    PubMed Central

    Perilli, M; Felici, A; Oratore, A; Cornaglia, G; Bonfiglio, G; Rossolini, G M; Amicosante, G


    The beta-lactamases produced by Acinetobacter lwoffii ULA-501, Acinetobacter baumannii ULA-187, and A. baumannii AC-14 strains were purified and characterized, and their kinetic interactions with several beta-lactam molecules, including substrates and inhibitors, were studied in detail. The three enzymes appeared to be cephalosporinases with different acylation efficiencies (kcat/Km ratio values), and their hydrolytic activities were inhibited by benzylpenicillin, piperacillin, and cefotaxime, which did not behave as substrates. Carbenicillin was a substrate for the beta-lactamase from A. lwoffii ULA-501, whereas it acted as a transient inactivator of the enzymes produced by the two A. baumannii strains. Clavulanic acid was unable to inactivate the three beta-lactamases, whereas sulbactam behaved as an inactivator only at a high concentration (1 mM) which is difficult to achieve during antibiotic therapy. Analysis of the interaction with 6-beta-iodopenicillanic acid also allowed us to better discriminate the three beta-lactamases analyzed in the present study, which can be included in the group 1 functional class (5). PMID:8851599

  18. Regional differences and trends in antimicrobial susceptibility of Acinetobacter baumannii.


    Lob, Sibylle H; Hoban, Daryl J; Sahm, Daniel F; Badal, Robert E


    Acinetobacter baumannii, although representing a small percentage of Gram-negative bacilli isolates in intra-abdominal infections (IAIs) and urinary tract infections (UTIs), is frequently multidrug-resistant (MDR) and can pose difficult therapeutic challenges. From 2011 to 2014, 2337 A. baumannii were collected from IAIs and UTIs at 453 hospital sites in 48 countries as part of the SMART ongoing surveillance initiative. Current susceptibility and multidrug resistance, defined as resistance to at least three of the tested drug classes, were determined in a subset of 1011 isolates from 2013 to 2014. A. baumannii comprised 0.7-4.6% of all aerobic and facultative Gram-negative bacilli isolated in six global regions. MDR rates were lowest in North America (47%) and highest in Europe and the Middle East (>93%), with higher rates in ICUs than in non-ICU wards in almost all regions. Antimicrobial susceptibility profiles varied by region but resistance was high everywhere, with no drug inhibiting >70% of A. baumannii isolates in any region. Susceptibility to imipenem was highest in North America (64%) and lowest in Europe and the Middle East (≤11%). Amikacin overall was the most active of the studied agents, including against MDR isolates (of which 11-38% were susceptible). Trend analysis of only those countries that contributed isolates in each study year (2011-2014) demonstrated an increasing trend in MDR rates in the Middle East as well as decreasing susceptibility to several single antimicrobial agents in Africa, Europe and the Middle East. These patterns and trends can help direct antimicrobial therapy and infection control efforts.

  19. Towards the complete small RNome of Acinetobacter baumannii

    PubMed Central

    Weiss, Andy; Broach, William H.; Lee, Mackenzie C.


    In recent years, the Gram-negative bacterium Acinetobacter baumannii has garnered considerable attention for its unprecedented capacity to rapidly develop resistance to antibacterial therapeutics. This is coupled with the seemingly epidemic emergence of new hyper-virulent strains. Although strain-specific differences for A. baumannii isolates have been well described, these studies have primarily focused on proteinaceous factors. At present, only limited publications have investigated the presence and role of small regulatory RNA (sRNA) transcripts. Herein, we perform such an analysis, describing the RNA-seq-based identification of 78 A. baumannii sRNAs in the AB5075 background. Together with six previously identified elements, we include each of these in a new genome annotation file, which will serve as a tool to investigate regulatory events in this organism. Our work reveals that the sRNAs display high expression, accounting for >50 % of the 20 most strongly expressed genes. Through conservation analysis we identified six classes of similar sRNAs, with one found to be particularly abundant and homologous to regulatory, C4 antisense RNAs found in bacteriophages. These elements appear to be processed from larger transcripts in an analogous manner to the phage C4 molecule and are putatively controlled by two further sRNAs that are strongly antisense to them. Collectively, this study offers a detailed view of the sRNA content of A. baumannii, exposing sequence and structural conservation amongst these elements, and provides novel insight into the potential evolution, and role, of these understudied regulatory molecules. PMID:28348845

  20. Post Neurosurgical Meningitis due to Colistin Heteroresistant Acinetobacter baumannii

    PubMed Central

    Moosavian, Mojtaba; Shoja, Saeed; Nashibi, Roohangiz; Ebrahimi, Nasim; Tabatabaiefar, Mohammad Amin; Rostami, Soodabeh; Peymani, Amir


    Introduction: Recently Acinetobacter baumannii isolates have emerged as a problematic infectious agent that causes meningitis in neurosurgical patients. Colistin has been used successfully for the treatment of A. baumannii meningitis but colistin resistant isolates have been reported worldwide. Case Presentation: Two isolates of A. baumannii were cultured during a five-day period from cerebrospinal fluid (CSF) samples of a 20-year-old man with a gunshot trauma in the abdomen, which had exited from his back. Antimicrobial susceptibility tests of isolates were performed. Multiplex PCR was performed for detection of blaOXA-23-like, blaOXA-24-like and blaOXA-58-like genes. Metallo-β-lactamase genes such as: blaVIM, blaIMP, blaSPM and blaNDM were sought by singleplex PCR. In order to evaluate the genetic relationship, two isolates were examined by the repetitive extragenic palindromic-polymerase chain reaction (REP_PCR) method. Conclusions: E-test results showed that the isolates were sensitive to colistin and tigecycline with minimum inhibitory concentration of (MIC) 0.25 µg/mL and 1.5 µg/mL, respectively. Secondly the isolates were resistant to colistin with MIC > 256 µg/mL but remained sensitive to tigecycline with MIC 1.5 µg/mL. On the basis of the multiplex PCR, both of the isolates were positive for blaOXA-23-like. Other investigated genes such as blaOXA-24-like, blaOXA-58-like, blaVIM, blaIMP, blaSPM and blaNDM were negative. REP-PCR results showed that two isolates were derived from a single strain and both were the same. The results of our study revealed that the firs isolate of A. baumannii was colistin heteroresistant and was changed to completely resistant during therapy. Diagnosis and treatment of A. baumannii meningitis is very important and to avoid treatment failure we suggest that all A. baumannii isolates obtained from CSF should be evaluated properly for colistin heteroresistance. PMID:25632326

  1. Deciphering the function of the outer membrane protein OprD homologue of Acinetobacter baumannii.


    Catel-Ferreira, Manuella; Nehmé, Rony; Molle, Virginie; Aranda, Jesús; Bouffartigues, Emeline; Chevalier, Sylvie; Bou, Germán; Jouenne, Thierry; Dé, Emmanuelle


    The increasing number of carbapenem-resistant Acinetobacter baumannii isolates is a major cause for concern which restricts therapeutic options to treat severe infections caused by this emerging pathogen. To identify the molecular mechanisms involved in carbapenem resistance, we studied the contribution of an outer membrane protein homologue of the Pseudomonas aeruginosa OprD porin. Suspected to be the preferred pathway of carbapenems in A. baumannii, the oprD homologue gene was inactivated in strain ATCC 17978. Comparison of wild-type and mutant strains did not confirm the expected increased resistance to any antibiotic tested. OprD homologue sequence analysis revealed that this protein actually belongs to an OprD subgroup but is closer to the P. aeruginosa OprQ protein, with which it could share some functions, e.g., allowing bacterial survival under low-iron or -magnesium growth conditions or under poor oxygenation. We thus overexpressed and purified a recombinant OprD homologue protein to further examine its functional properties. As a specific channel, this porin presented rather low single-channel conductance, i.e., 28 pS in 1 M KCl, and was partially closed by micro- and millimolar concentrations of Fe(3+) and Mg(2+), respectively, but not by imipenem and meropenem or basic amino acids. The A. baumannii OprD homologue is likely not involved in the carbapenem resistance mechanism, but as an OprQ-like protein, it could contribute to the adaptation of this bacterium to magnesium- and/or iron-depleted environments.

  2. Acinetobacter baumannii Biofilm Formation in Human Serum and Disruption by Gallium.


    Runci, Federica; Bonchi, Carlo; Frangipani, Emanuela; Visaggio, Daniela; Visca, Paolo


    Biofilm-associated infections caused by Acinetobacter baumannii are extremely recalcitrant to antibiotic treatment. We report that A. baumannii develops a mature biofilm when grown in complement-free human serum (HS). We demonstrate that 16 μM gallium nitrate (GaN) drastically reduces A. baumannii growth and biofilm formation in HS, whereas 64 μM GaN causes massive disruption of preformed A. baumannii biofilm. These findings pave the way to the repurposing of GaN as an antibiofilm agent for A. baumannii. Copyright © 2016 American Society for Microbiology.

  3. Validation of a novel murine wound model of Acinetobacter baumannii infection.


    Thompson, Mitchell G; Black, Chad C; Pavlicek, Rebecca L; Honnold, Cary L; Wise, Matthew C; Alamneh, Yonas A; Moon, Jay K; Kessler, Jennifer L; Si, Yuanzheng; Williams, Robert; Yildirim, Suleyman; Kirkup, Benjamin C; Green, Romanza K; Hall, Eric R; Palys, Thomas J; Zurawski, Daniel V


    Patients recovering from traumatic injuries or surgery often require weeks to months of hospitalization, increasing the risk for wound and surgical site infections caused by ESKAPE pathogens, which include A. baumannii (the ESKAPE pathogens are Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species). As new therapies are being developed to counter A. baumannii infections, animal models are also needed to evaluate potential treatments. Here, we present an excisional, murine wound model in which a diminutive inoculum of a clinically relevant, multidrug-resistant A. baumannii isolate can proliferate, form biofilms, and be effectively treated with antibiotics. The model requires a temporary, cyclophosphamide-induced neutropenia to establish an infection that can persist. A 6-mm-diameter, full-thickness wound was created in the skin overlying the thoracic spine, and after the wound bed was inoculated, it was covered with a dressing for 7 days. Uninoculated control wounds healed within 13 days, whereas infected, placebo-treated wounds remained unclosed beyond 21 days. Treated and untreated wounds were assessed with multiple quantitative and qualitative techniques that included gross pathology, weight loss and recovery, wound closure, bacterial burden, 16S rRNA community profiling, histopathology, peptide nucleic acid-fluorescence in situ hybridization, and scanning electron microscopy assessment of biofilms. The range of differences that we are able to identify with these measures in antibiotic- versus placebo-treated animals provides a clear window within which novel antimicrobial therapies can be assessed. The model can be used to evaluate antimicrobials for their ability to reduce specific pathogen loads in wounded tissues and clear biofilms. Ultimately, the mouse model approach allows for highly powered studies and serves as an initial multifaceted in vivo assessment prior to

  4. Validation of a Novel Murine Wound Model of Acinetobacter baumannii Infection

    PubMed Central

    Thompson, Mitchell G.; Black, Chad C.; Pavlicek, Rebecca L.; Honnold, Cary L.; Wise, Matthew C.; Alamneh, Yonas A.; Moon, Jay K.; Kessler, Jennifer L.; Si, Yuanzheng; Williams, Robert; Yildirim, Suleyman; Kirkup, Benjamin C.; Green, Romanza K.; Hall, Eric R.; Palys, Thomas J.


    Patients recovering from traumatic injuries or surgery often require weeks to months of hospitalization, increasing the risk for wound and surgical site infections caused by ESKAPE pathogens, which include A. baumannii (the ESKAPE pathogens are Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species). As new therapies are being developed to counter A. baumannii infections, animal models are also needed to evaluate potential treatments. Here, we present an excisional, murine wound model in which a diminutive inoculum of a clinically relevant, multidrug-resistant A. baumannii isolate can proliferate, form biofilms, and be effectively treated with antibiotics. The model requires a temporary, cyclophosphamide-induced neutropenia to establish an infection that can persist. A 6-mm-diameter, full-thickness wound was created in the skin overlying the thoracic spine, and after the wound bed was inoculated, it was covered with a dressing for 7 days. Uninoculated control wounds healed within 13 days, whereas infected, placebo-treated wounds remained unclosed beyond 21 days. Treated and untreated wounds were assessed with multiple quantitative and qualitative techniques that included gross pathology, weight loss and recovery, wound closure, bacterial burden, 16S rRNA community profiling, histopathology, peptide nucleic acid-fluorescence in situ hybridization, and scanning electron microscopy assessment of biofilms. The range of differences that we are able to identify with these measures in antibiotic- versus placebo-treated animals provides a clear window within which novel antimicrobial therapies can be assessed. The model can be used to evaluate antimicrobials for their ability to reduce specific pathogen loads in wounded tissues and clear biofilms. Ultimately, the mouse model approach allows for highly powered studies and serves as an initial multifaceted in vivo assessment prior to

  5. Osmotic Compounds Enhance Antibiotic Efficacy against Acinetobacter baumannii Biofilm Communities.


    Falghoush, Azeza; Beyenal, Haluk; Besser, Thomas E; Omsland, Anders; Call, Douglas R


    Biofilm-associated infections are a clinical challenge, in part because a hydrated matrix protects the bacterial community from antibiotics. Herein, we evaluated how different osmotic compounds (maltodextrin, sucrose, and polyethylene glycol [PEG]) enhance antibiotic efficacy against Acinetobacter baumannii biofilm communities. Established (24-h) test tube biofilms (strain ATCC 17978) were treated with osmotic compounds in the presence or absence of 10× the MIC of different antibiotics (50 μg/ml tobramycin, 20 μg/ml ciprofloxacin, 300 μg/ml chloramphenicol, 30 μg/ml nalidixic acid, or 100 μg/ml erythromycin). Combining antibiotics with hypertonic concentrations of the osmotic compounds for 24 h reduced the number of biofilm bacteria by 5 to 7 log (P < 0.05). Increasing concentrations of osmotic compounds improved the effect, but there was a trade-off with increasing solution viscosity, whereby low-molecular-mass compounds (sucrose, 400-Da PEG) worked better than higher-mass compounds (maltodextrin, 3,350-Da PEG). Ten other A. baumannii strains were similarly treated with 400-Da PEG and tobramycin, resulting in a mean 2.7-log reduction in recoverable bacteria compared with tobramycin treatment alone. Multivariate regression models with data from different osmotic compounds and nine antibiotics demonstrated that the benefit from combining hypertonic treatments with antibiotics is a function of antibiotic mass and lipophilicity (r(2) > 0.82; P < 0.002), and the relationship was generalizable for biofilms formed by A. baumannii and Escherichia coli K-12. Augmenting topical antibiotic therapies with a low-mass hypertonic treatment may enhance the efficacy of antibiotics against wound biofilms, particularly when using low-mass hydrophilic antibiotics.IMPORTANCE Biofilms form a barrier that protects bacteria from environmental insults, including exposure to antibiotics. We demonstrated that multiple osmotic compounds can enhance antibiotic efficacy against

  6. Platelet-activating Factor Receptor Initiates Contact of Acinetobacter baumannii Expressing Phosphorylcholine with Host Cells

    PubMed Central

    Smani, Younes; Docobo-Pérez, Fernando; López-Rojas, Rafael; Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo


    Adhesion is an initial and important step in Acinetobacter baumannii causing infections. However, the exact molecular mechanism of such a step between A. baumannii and the host cells remains unclear. Here, we demonstrated that the phosphorylcholine (ChoP)-containing outer membrane protein of A. baumannii binds to A549 cells through platelet-activating factor receptor (PAFR), resulting in activation of G protein and intracellular calcium. Upon A. baumannii expressing ChoP binding to PAFR, clathrin and β-arrestins, proteins involved in the direction of the vacuolar movement, are activated during invasion of A. baumannii. PAFR antagonism restricts the dissemination of A. baumannii in the pneumonia model. These results define a role for PAFR in A. baumannii interaction with host cells and suggest a mechanism for the entry of A. baumannii into the cytoplasm of host cells. PMID:22689572

  7. Multidrug resistant Acinetobacter baumannii reaches a new frontier: prosthetic hip joint infection.


    Hischebeth, G T R; Wimmer, M D; Molitor, E; Seifert, H; Gravius, S; Bekeredjian-Ding, I


    Acinetobacter baumannii is an emerging nosocomial pathogen primarily in countries with a high prevalence of multidrug resistance. Here we report the detection of a bla OXA23 carbapenemase-producing A. baumannii strain in a German patient with prosthetic hip joint infection following several hip joint surgeries but no history of foreign travel.

  8. First Genome Sequence of a Mexican Multidrug-Resistant Acinetobacter baumannii Isolate

    PubMed Central

    Graña-Miraglia, Lucía; Lozano, Luis; Castro-Jaimes, Semiramis; Cevallos, Miguel A.; Volkow, Patricia


    Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide. Here, we present the draft genome of the first multidrug-resistant A. baumannii isolate, sampled from a tertiary hospital in Mexico City. This genome will provide a starting point for studying the genomic diversity of this species in Mexico. PMID:27013043

  9. Prevalence of antibiotic resistance among Acinetobacter baumannii isolates from Aleppo, Syria.


    Hamzeh, Abdul Rezzak; Al Najjar, Mona; Mahfoud, Maysa


    This study describes and analyzes Acinetobacter baumannii antibiotic susceptibly profile in Aleppo, Syria, thus providing vital information for guiding treatment of A baumannii infections. Two hundred sixty nonrepetitive A baumannii isolates were studied over 3.5 years. Resistance rates are at the higher end of globally reported levels. Newer cephalosporins and β-lactamase-resistant agents are becoming practically ineffective. Better activity is limited to carbapenems and colistin, which elicited the highest susceptibility levels.

  10. Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis.


    Dexter, Carina; Murray, Gerald L; Paulsen, Ian T; Peleg, Anton Y


    Community-acquired Acinetobacter baumannii (CA-Ab) is a rare but serious cause of community-acquired pneumonia in tropical regions of the world. CA-Ab infections predominantly affect individuals with risk factors, which include excess alcohol consumption, diabetes mellitus, smoking and chronic lung disease. CA-Ab pneumonia presents as a surprisingly fulminant course and is characterized by a rapid onset of fever, severe respiratory symptoms and multi-organ dysfunction, with a mortality rate reported as high as 64%. It is unclear whether the distinct clinical syndrome caused by CA-Ab is because of host predisposing factors or unique bacterial characteristics, or a combination of both. Deepening our understanding of the drivers of overwhelming CA-Ab infection will provide important insights into preventative and therapeutic strategies.

  11. Crystal Structure of Carbapenemase OXA-58 from Acinetobacter baumannii

    PubMed Central

    Antunes, Nuno Tiago; Toth, Marta


    Class D β-lactamases capable of hydrolyzing last-resort carbapenem antibiotics represent a major challenge for treatment of bacterial infections. Wide dissemination of these enzymes in Acinetobacter baumannii elevated this pathogen to the category of most deadly and difficult to treat. We present here the structure of the OXA-58 β-lactamase, a major class D carbapenemase of A. baumannii, determined to 1.30-Å resolution. Unlike two other Acinetobacter carbapenemases, OXA23 and OXA-24, the OXA-58 enzyme lacks the characteristic hydrophobic bridge over the active site, despite conservation of the residues which participate in its formation. The active-site residues in OXA-58 are spatially conserved in comparison to those in other class D β-lactamases. Lys86, which activates water molecules during the acylation and deacylation steps, is fully carboxylated in the OXA-58 structure. In the absence of a substrate, a water molecule is observed in the active site of the enzyme and is positioned in the pocket that is usually occupied by the 6α-hydroxyethyl moiety of carbapenems. A water molecule in this location would efficiently deacylate good substrates, such as the penicillins, but in the case of carbapenems, it would be expelled by the 6α-hydroxyethyl moiety of the antibiotics and a water from the surrounding medium would find its way to the vicinity of the carboxylated Lys86 to perform deacylation. Subtle differences in the position of this water in the acyl-enzyme complexes of class D β-lactamases could ultimately be responsible for differences in the catalytic efficiencies of these enzymes against last-resort carbapenem antibiotics. PMID:24468777

  12. Transcriptome Remodeling of Acinetobacter baumannii during Infection and Treatment

    PubMed Central

    Wright, Meredith S.; Jacobs, Michael R.; Bonomo, Robert A.


    ABSTRACT Acinetobacter baumannii is an increasingly common multidrug-resistant pathogen in health care settings. Although the genetic basis of antibiotic resistance mechanisms has been extensively studied, much less is known about how genetic variation contributes to other aspects of successful infections. Genetic changes that occur during host infection and treatment have the potential to remodel gene expression patterns related to resistance and pathogenesis. Longitudinal sets of multidrug-resistant A. baumannii isolates from eight patients were analyzed by RNA sequencing (RNA-seq) to identify differentially expressed genes and link them to genetic changes contributing to transcriptional variation at both within-patient and population levels. The number of differentially expressed genes among isolates from the same patient ranged from 26 (patient 588) to 145 (patient 475). Multiple patients had isolates with differential gene expression patterns related to mutations in the pmrAB and adeRS two-component regulatory system genes, as well as significant differences in genes related to antibiotic resistance, iron acquisition, amino acid metabolism, and surface-associated proteins. Population level analysis revealed 39 genetic regions with clade-specific differentially expressed genes, for which 19, 8, and 3 of these could be explained by insertion sequence mobilization, recombination-driven sequence variation, and intergenic mutations, respectively. Multiple types of mutations that arise during infection can significantly remodel the expression of genes that are known to be important in pathogenesis. PMID:28270585

  13. Triclosan resistance in clinical isolates of Acinetobacter baumannii.


    Chen, Yagang; Pi, Borui; Zhou, Hua; Yu, Yunsong; Li, Lanjuan


    The susceptibility to triclosan of 732 clinical Acinetobacter baumannii isolates obtained from 25 hospitals in 16 cities in China from December 2004 to December 2005 was screened by using an agar dilution method. Triclosan MICs ranged between 0.015 and 16 mg l(-1), and the MIC(90) was 0.5 mg l(-1), lower than the actual in-use concentration of triclosan. Twenty triclosan-resistant isolates (MICs >or=1 mg l(-1)) were characterized by antibiotic susceptibility, clonal relatedness, fabI mutation, fabI expression, and efflux pump phenotype and expression to elucidate the resistance mechanism of A. baumannii to triclosan. The resistance rates of triclosan-resistant isolates to imipenem, levofloxacin, amikacin and tetracycline were higher than those of triclosan-sensitive isolates. Triclosan resistance was artificially classified as low level (MICs 1-2 mg l(-1)) or high level (MICs >or=4 mg l(-1)). High-level triclosan resistance could be explained by a Gly95Ser mutation of FabI, whilst wild-type fabI was observed to be overexpressed in low-level resistant isolates. Active efflux did not appear to be a major reason for acquired triclosan resistance, but acquisition of resistance appeared to be dependent on a background of intrinsic triclosan efflux.

  14. Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.


    Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li


    This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

  15. Antibiotic modulation of capsular exopolysaccharide and virulence in Acinetobacter baumannii.


    Geisinger, Edward; Isberg, Ralph R


    Acinetobacter baumannii is an opportunistic pathogen of increasing importance due to its propensity for intractable multidrug-resistant infections in hospitals. All clinical isolates examined contain a conserved gene cluster, the K locus, which determines the production of complex polysaccharides, including an exopolysaccharide capsule known to protect against killing by host serum and to increase virulence in animal models of infection. Whether the polysaccharides determined by the K locus contribute to intrinsic defenses against antibiotics is unknown. We demonstrate here that mutants deficient in the exopolysaccharide capsule have lowered intrinsic resistance to peptide antibiotics, while a mutation affecting sugar precursors involved in both capsule and lipopolysaccharide synthesis sensitizes the bacterium to multiple antibiotic classes. We observed that, when grown in the presence of certain antibiotics below their MIC, including the translation inhibitors chloramphenicol and erythromycin, A. baumannii increases production of the K locus exopolysaccharide. Hyperproduction of capsular exopolysaccharide is reversible and non-mutational, and occurs concomitantly with increased resistance to the inducing antibiotic that is independent of the presence of the K locus. Strikingly, antibiotic-enhanced capsular exopolysaccharide production confers increased resistance to killing by host complement and increases virulence in a mouse model of systemic infection. Finally, we show that augmented capsule production upon antibiotic exposure is facilitated by transcriptional increases in K locus gene expression that are dependent on a two-component regulatory system, bfmRS. These studies reveal that the synthesis of capsule, a major pathogenicity determinant, is regulated in response to antibiotic stress. Our data are consistent with a model in which gene expression changes triggered by ineffectual antibiotic treatment cause A. baumannii to transition between states of low

  16. Antibiotic Modulation of Capsular Exopolysaccharide and Virulence in Acinetobacter baumannii

    PubMed Central

    Geisinger, Edward; Isberg, Ralph R.


    Acinetobacter baumannii is an opportunistic pathogen of increasing importance due to its propensity for intractable multidrug-resistant infections in hospitals. All clinical isolates examined contain a conserved gene cluster, the K locus, which determines the production of complex polysaccharides, including an exopolysaccharide capsule known to protect against killing by host serum and to increase virulence in animal models of infection. Whether the polysaccharides determined by the K locus contribute to intrinsic defenses against antibiotics is unknown. We demonstrate here that mutants deficient in the exopolysaccharide capsule have lowered intrinsic resistance to peptide antibiotics, while a mutation affecting sugar precursors involved in both capsule and lipopolysaccharide synthesis sensitizes the bacterium to multiple antibiotic classes. We observed that, when grown in the presence of certain antibiotics below their MIC, including the translation inhibitors chloramphenicol and erythromycin, A. baumannii increases production of the K locus exopolysaccharide. Hyperproduction of capsular exopolysaccharide is reversible and non-mutational, and occurs concomitantly with increased resistance to the inducing antibiotic that is independent of the presence of the K locus. Strikingly, antibiotic-enhanced capsular exopolysaccharide production confers increased resistance to killing by host complement and increases virulence in a mouse model of systemic infection. Finally, we show that augmented capsule production upon antibiotic exposure is facilitated by transcriptional increases in K locus gene expression that are dependent on a two-component regulatory system, bfmRS. These studies reveal that the synthesis of capsule, a major pathogenicity determinant, is regulated in response to antibiotic stress. Our data are consistent with a model in which gene expression changes triggered by ineffectual antibiotic treatment cause A. baumannii to transition between states of low

  17. Genome Sequence of an Acinetobacter baumannii Strain Carrying Three Acquired Carbapenemase Genes

    PubMed Central

    Oinuma, Ken-Ichi; Suzuki, Masato; Sato, Kanako; Nakaie, Kiyotaka; Niki, Makoto; Takizawa, Etsuko; Niki, Mamiko; Shibayama, Keigo; Yamada, Koichi; Kakeya, Hiroshi


    The emergence of multiple-carbapenemase-producing Acinetobacter strains has been a serious concern during the past decade. Here, we report the draft genome sequence of an Acinetobacter baumannii strain isolated from a Japanese patient with three acquired carbapenemase genes: blaNDM-1, blaTMB-1, and blaOXA-58. PMID:27856588

  18. Genomic sequencing of a strain of Acinetobacter baumannii and potential mechanisms to antibiotics resistance.


    Zhao, Lei; Li, Hongru; Zhu, Ziwen; Wakefield, Mark R; Fang, Yujiang; Ye, Ying


    Acinetobacter baumannii has been becoming a great challenge to clinicians due to their resistance to almost all available antibiotics. In this study, we sequenced the genome from a multiple antibiotics resistant Acinetobacter baumannii stain which was named A. baumannii-1isolated from China by SMRT sequencing technology to explore its potential mechanisms to antibiotic resistance. We found that several mechanisms might contribute to the antibiotic resistance of Acinetobacter baumannii. Specifically, we found that SNP in genes associated with nucleotide excision repair and ABC transporter might contribute to its resistance to multiple antibiotics; we also found that specific genes associated with bacterial DNA integration and recombination, DNA-mediated transposition and response to antibiotics might contribute to its resistance to multiple antibiotics; Furthermore, specific genes associated with penicillin and cephalosporin biosynthetic pathway and specific genes associated with CHDL and MBL β-lactamase genes might contribute to its resistance to multiple antibiotics. Thus, the detailed mechanisms by which Acinetobacter baumannii show extensive resistance to multiple antibiotics are very complicated. Such a study might be helpful to develop new strategies to control Acinetobacter baumannii infection.

  19. Paradoxical Effect of Polymyxin B: High Drug Exposure Amplifies Resistance in Acinetobacter baumannii

    PubMed Central

    Landersdorfer, Cornelia B.; Lenhard, Justin R.; Cheah, Soon-Ee; Thamlikitkul, Visanu; Rao, Gauri G.; Holden, Patricia N.; Forrest, Alan; Bulitta, Jürgen B.; Nation, Roger L.; Li, Jian


    Administering polymyxin antibiotics in a traditional fashion may be ineffective against Gram-negative ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens. Here, we explored increasing the dose intensity of polymyxin B against two strains of Acinetobacter baumannii in the hollow-fiber infection model. The following dosage regimens were simulated for polymyxin B (t1/2 = 8 h): non-loading dose (1.43 mg/kg of body weight every 12 h [q12h]), loading dose (2.22 mg/kg q12h for 1 dose and then 1.43 mg/kg q12h), front-loading dose (3.33 mg/kg q12h for 1 dose followed by 1.43 mg/kg q12h), burst (5.53 mg/kg for 1 dose), and supraburst (18.4 mg/kg for 1 dose). Against both A. baumannii isolates, a rapid initial decline in the total population was observed within the first 6 h of polymyxin exposure, whereby greater polymyxin B exposure resulted in greater maximal killing of −1.25, −1.43, −2.84, −2.84, and −3.40 log10 CFU/ml within the first 6 h. Unexpectedly, we observed a paradoxical effect whereby higher polymyxin B exposures dramatically increased resistant subpopulations that grew on agar containing up to 10 mg/liter of polymyxin B over 336 h. High drug exposure also proliferated polymyxin-dependent growth. A cost-benefit pharmacokinetic/pharmacodynamic relationship between 24-h killing and 336-h resistance was explored. The intersecting point, where the benefit of bacterial killing was equal to the cost of resistance, was an fAUC0–24 (area under the concentration-time curve from 0 to 24 h for the free, unbound fraction of drug) of 38.5 mg · h/liter for polymyxin B. Increasing the dose intensity of polymyxin B resulted in amplification of resistance, highlighting the need to utilize polymyxins as part of a combination against high-bacterial-density A. baumannii infections. PMID:27067330

  20. Paradoxical Effect of Polymyxin B: High Drug Exposure Amplifies Resistance in Acinetobacter baumannii.


    Tsuji, Brian T; Landersdorfer, Cornelia B; Lenhard, Justin R; Cheah, Soon-Ee; Thamlikitkul, Visanu; Rao, Gauri G; Holden, Patricia N; Forrest, Alan; Bulitta, Jürgen B; Nation, Roger L; Li, Jian


    Administering polymyxin antibiotics in a traditional fashion may be ineffective against Gram-negative ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogens. Here, we explored increasing the dose intensity of polymyxin B against two strains of Acinetobacter baumannii in the hollow-fiber infection model. The following dosage regimens were simulated for polymyxin B (t1/2 = 8 h): non-loading dose (1.43 mg/kg of body weight every 12 h [q12h]), loading dose (2.22 mg/kg q12h for 1 dose and then 1.43 mg/kg q12h), front-loading dose (3.33 mg/kg q12h for 1 dose followed by 1.43 mg/kg q12h), burst (5.53 mg/kg for 1 dose), and supraburst (18.4 mg/kg for 1 dose). Against both A. baumannii isolates, a rapid initial decline in the total population was observed within the first 6 h of polymyxin exposure, whereby greater polymyxin B exposure resulted in greater maximal killing of -1.25, -1.43, -2.84, -2.84, and -3.40 log10 CFU/ml within the first 6 h. Unexpectedly, we observed a paradoxical effect whereby higher polymyxin B exposures dramatically increased resistant subpopulations that grew on agar containing up to 10 mg/liter of polymyxin B over 336 h. High drug exposure also proliferated polymyxin-dependent growth. A cost-benefit pharmacokinetic/pharmacodynamic relationship between 24-h killing and 336-h resistance was explored. The intersecting point, where the benefit of bacterial killing was equal to the cost of resistance, was an fAUC0-24 (area under the concentration-time curve from 0 to 24 h for the free, unbound fraction of drug) of 38.5 mg · h/liter for polymyxin B. Increasing the dose intensity of polymyxin B resulted in amplification of resistance, highlighting the need to utilize polymyxins as part of a combination against high-bacterial-density A. baumannii infections. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. Galleria mellonella as a model system to study Acinetobacter baumannii pathogenesis and therapeutics.


    Peleg, Anton Y; Jara, Sebastian; Monga, Divya; Eliopoulos, George M; Moellering, Robert C; Mylonakis, Eleftherios


    Nonmammalian model systems of infection such as Galleria mellonella (caterpillars of the greater wax moth) have significant logistical and ethical advantages over mammalian models. In this study, we utilize G. mellonella caterpillars to study host-pathogen interactions with the gram-negative organism Acinetobacter baumannii and determine the utility of this infection model to study antibacterial efficacy. After infecting G. mellonella caterpillars with a reference A. baumannii strain, we observed that the rate of G. mellonella killing was dependent on the infection inoculum and the incubation temperature postinfection, with greater killing at 37 degrees C than at 30 degrees C (P = 0.01). A. baumannii strains caused greater killing than the less-pathogenic species Acinetobacter baylyi and Acinetobacter lwoffii (P < 0.001). Community-acquired A. baumannii caused greater killing than a reference hospital-acquired strain (P < 0.01). Reduced levels of production of the quorum-sensing molecule 3-hydroxy-C(12)-homoserine lactone caused no change in A. baumannii virulence against G. mellonella. Treatment of a lethal A. baumannii infection with antibiotics that had in vitro activity against the infecting A. baumannii strain significantly prolonged the survival of G. mellonella caterpillars compared with treatment with antibiotics to which the bacteria were resistant. G. mellonella is a relatively simple, nonmammalian model system that can be used to facilitate the in vivo study of host-pathogen interactions in A. baumannii and the efficacy of antibacterial agents.

  2. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection.


    Noto, Michael J; Boyd, Kelli L; Burns, William J; Varga, Matthew G; Peek, Richard M; Skaar, Eric P


    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9(-/-) mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9(-/-) mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii.

  3. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection

    PubMed Central

    Noto, Michael J.; Boyd, Kelli L.; Burns, William J.; Varga, Matthew G.; Peek, Richard M.


    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9−/− mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9−/− mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii. PMID:26238713

  4. Worldwide dissemination of acquired carbapenem-hydrolysing class D β-lactamases in Acinetobacter spp. other than Acinetobacter baumannii.


    Zander, Esther; Fernández-González, Ana; Schleicher, Xenia; Dammhayn, Cathrin; Kamolvit, Witchuda; Seifert, Harald; Higgins, Paul G


    The aim of this study was to identify acquired OXA-type carbapenemases in Acinetobacter spp. other than Acinetobacter baumannii. From a total of 453 carbapenem-susceptible and -resistant Acinetobacter isolates collected worldwide, 23 were positive for blaOXA genes by multiplex PCR. These isolates were identified as Acinetobacter pittii (n=18), Acinetobacter nosocomialis (n=2), Acinetobacter junii (n=1) and Acinetobacter genomic species 14TU/13BJ (n=2). The blaOXA genes and associated insertion sequence (IS) elements were sequenced by primer walking. In 11 of these isolates, sequencing of the PCR products revealed that they were false-positive for blaOXA. The remaining 12 isolates, originating from Europe, Asia, South America, North America and South Africa, harboured OXA-23 (n=4), OXA-58 (n=5), OXA-40-like (n=1) and OXA-143-like (n=1); one A. pittii isolate harboured both OXA-23 and OXA-58. IS elements were associated with blaOXA in 10 isolates. OXA multiplex PCR showed a high degree of false-positive results (47.8%), indicating that detection of blaOXA in non-baumanniiAcinetobacter spp. should be confirmed using additional methods.

  5. Efficacy of the small molecule inhibitor of Lipid II BAS00127538 against Acinetobacter baumannii

    PubMed Central

    de Leeuw, Erik PH


    Objective To test the activity of a small molecule compound that targets Lipid II against Acinetobacter baumannii. Methods Susceptibility to small molecule Lipid II inhibitor BAS00127538 was assessed using carbapenem- and colistin-resistant clinical isolates of A. baumannii. In addition, synergy between colisitin and this compound was assessed. Results Small molecule Lipid II inhibitor BAS00127538 potently acts against A. baumannii and acts synergistically with colistin. Conclusion For the first time, a compound that targets Lipid II is described that acts against multi-drug resistant isolates of A. baumannii. The synergy with colistin warrants further lead development of BAS00127538. PMID:25143710

  6. In Vitro and In Vivo Biological Activities of Iron Chelators and Gallium Nitrate against Acinetobacter baumannii

    PubMed Central

    Harris, Greg; KuoLee, Rhonda; Chen, Wangxue


    We investigated the ability of compounds interfering with iron metabolism to inhibit the growth of Acinetobacter baumannii. Iron restriction with transferrin or 2,2-bipyridyl significantly inhibited A. baumannii growth in vitro. Gallium nitrate alone was moderately effective at reducing A. baumannii growth but became bacteriostatic in the presence of serum or transferrin. More importantly, gallium nitrate treatment reduced lung bacterial burdens in mice. The use of gallium-based therapies shows promise for the control of multidrug-resistant A. baumannii. PMID:22825117

  7. Inhaled Colistin for Treatment of Pneumonia due to Colistin-Only-Susceptible Acinetobacter baumannii

    PubMed Central

    Choi, Hee Kyoung; Kim, Young Keun; Kim, Hyo Youl


    Purpose Colistin is used for the treatment of pneumonia associated with multidrug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa. However, the best route of administration and dosage is not known. We report our experience with aerosolized colistin in twelve patients with pneumonia caused by colistin-only-susceptible (COS) A. baumannii. Materials and Methods We retrospectively reviewed patients' medical records who were treated with aerosolized colistin for the treatment of pneumonia. Results Ten patients were treated only with aerosolized colistin inhalation and two patients received a 3-day course intravenous colistin, and then switched to colistin inhalation therapy. The median duration of aerosolized colistin therapy was 17 days (5-31 days). Four patients were treated only with aerosolized colistin, whereas 4 patients received concomitant glycopeptides, and 4 received concomitant levofloxacin or cefoperazone/sulbactam. At the end of the therapy, the clinical response rate and bacteriological clearance rate was 83% and 50%, respectively. Colistin-resistant strains were isolated from 3 patients after aerosolized colistin therapy; however, all of them showed favorable clinical response. The median interval between inhalation therapy and resistance was 7 days (range 5-19 days). Acute kidney injury developed in 3 patients. Two patients experienced Clostridium difficile associated diarrhea. One patient developed fever and skin rash after aerosolized colistin therapy. No patient developed neurotoxicity or bronchospasm. Conclusion Colistin inhalation therapy is deemed tolerable and safe, and could be beneficial as an adjuctive therapy for the management of pneumonia due to COS A. baumannii. However, the potential development of colistin resistance cannot be overlooked. PMID:24339296

  8. Longitudinal Characterization of Acinetobacter baumannii-calcoaceticus Complex, Klebsiella pneumoniae, and Methicillin-Resistant Staphylococcus aureus Colonizing and Infecting Combat Casualties

    DTIC Science & Technology


    Brief report Longitudinal characterization of Acinetobacter baumannii-calcoaceticus complex, Klebsiella pneumoniae , and methicillin-resistant...resistant Acinetobacter baumannii-calcoaceticus complex Klebsiella pneumoniae Methicillin-resistant Staphylococcus aureus MRSA Drug-resistant...Acinetobacter baumannii-calcoaceticus complex, Klebsiella pneumoniae , and methicillin- resistant Staphylococcus aureus colonize and infect combat casualties

  9. Community-Acquired Bacteremic Acinetobacter Pneumonia in Tropical Australia Is Caused by Diverse Strains of Acinetobacter baumannii, with Carriage in the Throat in At-Risk Groups

    PubMed Central

    Anstey, Nicholas M.; Currie, Bart J.; Hassell, Marilyn; Palmer, Didier; Dwyer, Brian; Seifert, Harald


    Acinetobacter isolates from eight subjects with community-acquired Acinetobacter pneumonia (CAAP), a major cause of fatal community-acquired pneumonia in tropical Australia, were phenotypically and genotypically confirmed by pulsed-field gel electrophoresis analysis to be broadly diverse Acinetobacter baumannii strains. Wet-season throat carriage of A. baumannii was found in 10% of community residents with excess levels of alcohol consumption, the major at-risk group for CAAP. PMID:11825997

  10. Enhanced Antibacterial Activity of Acinetobacter baumannii Bacteriophage ØABP-01 Endolysin (LysABP-01) in Combination with Colistin

    PubMed Central

    Thummeepak, Rapee; Kitti, Thawatchai; Kunthalert, Duangkamol; Sitthisak, Sutthirat


    Endolysins are lytic enzymes produced by bacteriophages with their ability to degrade the cell wall of bacterial hosts. Endolysin (LysABP-01) from Acinetobacter baumannii bacteriophage ØABP-01 was cloned, overexpressed and characterized. Endolysin LysABP-01 has a globular structure consisting of lysozyme-like (N-acetyl-β-D-muramidase) catalytic domain. It contains 185 amino acids which correspond to a 21.1 kDa protein. The lytic activity of the recombinant endolysin protein was determined by a plate lysis assay for its ability to lyse the autoclaved cell (crude cell wall) of the different bacterial species. LysABP-01 can degrade the crude cell wall of A. baumannii strains, Escherichia coli and Pseudomonas aeruginosa but not of Staphylococcus aureus. The antibacterial activity of LysABP-01 and its synergism with various antibiotics were tested. The results exhibited elevated antibacterial activity in a combination of the sub-MIC LysABP-01 and colistin. The checkerboard assay for measuring antibiotic synergy of LysABP-01 and colistin was performed. This combination was synergistic against various drug-resistant strains of A. baumannii (FIC index < 0.5). In summary, our study highlights the ability of LysABP-01 endolysin to hydrolyze the A. baumannii cell wall and its synergistic interaction with colistin. PMID:27656173

  11. Acinetobacter seifertii sp. nov., a member of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from human clinical specimens.


    Nemec, Alexandr; Krizova, Lenka; Maixnerova, Martina; Sedo, Ondrej; Brisse, Sylvain; Higgins, Paul G


    This study aimed to define the taxonomic status of a phenetically distinct group of 16 strains that corresponds to Acinetobacter genomic species 'close to 13TU', a provisional genomic species of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex recognized by Gerner-Smidt and Tjernberg in 1993. These strains have been isolated in different countries since the early 1990s and were mostly recovered from human clinical specimens. They were compared with 45 reference strains representing the known taxa of the ACB complex using taxonomic methods relevant to the genus Acinetobacter. Based on sequence analysis of the concatenated partial sequences (2976 bp) of seven housekeeping genes, the 16 strains formed a tight and well-supported cluster (intracluster sequence identity of ≥98.4 %) that was clearly separated from the other members of the ACB complex (≤94.7 %). The species status of the group was supported by average nucleotide identity values of ≤91.7 % between the whole genome sequence of representative strain NIPH 973(T) (NCBI accession no. APOO00000000) and those of the other species. In addition, whole-cell matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) MS analyses indicated the distinctness of the group at the protein level. Metabolic and physiological tests revealed several typical features of the group, although they did not allow its reliable differentiation from the other members of the ACB complex. We conclude that the 16 strains represent a distinct novel species, for which we propose the name Acinetobacter seifertii sp. nov. The type strain is NIPH 973(T) ( = CIP 110471(T) = CCUG 34785(T) = CCM 8535(T)).

  12. Assessment of Minocycline and Polymyxin B Combination against Acinetobacter baumannii

    PubMed Central

    Bowers, Dana R.; Cao, Henry; Zhou, Jian; Ledesma, Kimberly R.; Sun, Dongxu; Lomovskaya, Olga


    Antimicrobial resistance among Acinetobacter baumannii is increasing worldwide, often necessitating combination therapy. The clinical utility of using minocycline with polymyxin B is not well established. In this study, we investigated the activity of minocycline and polymyxin B against 1 laboratory isolate and 3 clinical isolates of A. baumannii. Minocycline susceptibility testing was performed with and without an efflux pump inhibitor, phenylalanine-arginine β-naphthylamide (PAβN). The intracellular minocycline concentration was determined with and without polymyxin B (0.5 μg/ml). Time-kill studies were performed over 24 h using approximately 106 CFU/ml of each strain with clinically relevant minocycline concentrations (2 μg/ml and 8 μg/ml), with and without polymyxin B (0.5 μg/ml). The in vivo efficacy of the combination was assessed in a neutropenic murine pneumonia model. Infected animals were administered minocycline (50 mg/kg), polymyxin B (10 mg/kg), or both to achieve clinically equivalent exposures in humans. A reduction in the minocycline MIC (≥4×) was observed in the presence of PAβN. The intracellular concentration and in vitro bactericidal effect of minocycline were both enhanced by polymyxin B. With 2 minocycline-susceptible strains, the bacterial burden in lung tissue at 24 h was considerably reduced by the combination compared to monotherapy with minocycline or polymyxin B. In addition, the combination prolonged survival of animals infected with a minocycline-susceptible strain. Polymyxin B increased the intracellular concentration of minocycline in bacterial cells and enhanced the bactericidal activity of minocycline, presumably due to efflux pump disruption. The clinical utility of this combination should be further investigated. PMID:25712362

  13. Outbreak of multidrug-resistant Acinetobacter baumannii in an intensive care unit.


    Dettori, Marco; Piana, Andrea; Deriu, Maria Grazia; Lo Curto, Paola; Cossu, Andrea; Musumeci, Rosario; Cocuzza, Clementina; Astone, Vito; Contu, Maria Antonietta; Sotgiu, Giovanni


    Acinetobacter baumannii is a ubiquitous microrganism often able to colonize and survive in different environments. Currently it is one of the most common pathogens responsible for nosocomial infections, including outbreaks, especially in long-term care facilities. The aim of this study was to show the results of an environmental investigation and genotyping analysis of multidrug-resistant Acinetobacter baumannii associated with an outbreak in an intensive care unit of a tertiary hospital located in Northern Sardinia, Italy. Positive cultures of MDR Acinetobacter baumannii were reported during the month of June 2012, after the collection of biological samples from ten patients. Acinetobacter baumannii was isolated during the following environmental investigation from the headboard of two beds. All the strains were genotyped by performing multiplex PCR to identify the presence of genes encoding carbapenemases. The results showed specific bands of bla(OXA-51-like) gene and of the bla(OXA-23-like) gene. PFGE highlighted minimal differences in genomic fingerprints, while the cluster analysis grouped the isolated microorganisms into two closely related clusters, characterized by Dice's similarity coefficient equal to 95.1%. MLST showed that the strains belonged to ST31. The results of the study highlight the need, especially in high-risk areas, to adopt strict hygiene practices, particularly hand hygiene, and to ensure an appropriate turnover of personal protective equipment, which could be responsible for the spread of biological agents, such as MDR Acinetobacter baumannii.

  14. Potential of a lytic bacteriophage to disrupt Acinetobacter baumannii biofilms in vitro.


    Liu, Yannan; Mi, Zhiqiang; Niu, Wenkai; An, Xiaoping; Yuan, Xin; Liu, Huiying; Wang, Yong; Feng, Yuzhong; Huang, Yong; Zhang, Xianglilan; Zhang, Zhiyi; Fan, Hang; Peng, Fan; Li, Puyuan; Tong, Yigang; Bai, Changqing


    The ability of Acinetobacter baumannii to form biofilms and develop antibiotic resistance makes it difficult to control infections caused by this bacterium. In this study, we explored the potential of a lytic bacteriophage to disrupt A. baumannii biofilms. The potential of the lytic bacteriophage to disrupt A. baumannii biofilms was assessed by performing electron microscopy, live/dead bacterial staining, crystal violet staining and by determining adenosine triphosphate release. The bacteriophage inhibited the formation of and disrupted preformed A. baumannii biofilms. Results of disinfection assay showed that the lytic bacteriophage lysed A. baumannii cells suspended in blood or grown on metal surfaces. These results suggest the potential of the lytic bacteriophage to disrupt A. baumannii biofilms.

  15. Bacteremic nosocomial pneumonia caused by Acinetobacter baumannii and Acinetobacter nosocomialis: a single or two distinct clinical entities?


    Lee, Y-T; Kuo, S-C; Yang, S-P; Lin, Y-T; Chiang, D-H; Tseng, F-C; Chen, T-L; Fung, C-P


    The phenotypically indistinguishable Acinetobacter baumannii and Acinetobacter nosocomialis have become leading pathogens causing nosocomial pneumonia in critically ill patients. A. baumannii and A. nosocomialis nosocomial pneumonias were grouped as a single clinical entity previously. This study aimed to determine whether they are the same or a different clinical entity. A total of 121 patients with A. baumannii and 131 with A. nosocomialis bacteremic nosocomial pneumonia were included during an 8-year period. Despite the similar Charlson co-morbidity scores at admission, patients with A. baumannii pneumonia were more likely to have abnormal haematological findings, lobar pneumonia, significantly higher Acute Physiology and Chronic Health Evaluation II scores and higher frequency of shock at the onset of bacteraemia than those with A. nosocomialis pneumoni. A. baumannii isolates were resistant to more classes of antimicrobials, except colistin, and therefore the patients with A. baumannii pneumonia were more likely to receive inappropriate antimicrobial therapy. The 14-day mortality was significantly higher in patients with A. baumannii pneumonia (34.7% vs. 15.3%, p 0.001). A. baumannii was an independent risk factor for mortality (OR, 2.03; 95% CI, 1.05-3.90; p 0.035) in the overall cohort after adjustment for other risk factors for death, including inappropriate antimicrobial therapy. The results demonstrated the difference in clinical presentation, microbial characteristics and outcomes between A. baumannii and A. nosocomialis nosocomial pneumonia, and supported that they are two distinct clinical entities.

  16. [Emerging Acinetobacter baumannii infections and factors favouring their occurrence].


    Eveillard, M; Joly-Guillou, M-L


    During the last decade, Acinetobacter baumannii (AB) has been increasingly responsible for infections occurring in three particular contexts (in terms of patients and environment). Community AB pneumonia is severe infections, mainly described around the Indian Ocean, and which mainly concern patients with major co-morbidities. AB is also responsible for infections occurring among soldiers wounded in action during operations conducted in Iraq or Afghanistan. Lastly, this bacterium is responsible for infections occurring among casualties from natural disasters like earthquakes and tsunamis. Those infections are often due to multidrug-resistant strains, which can be implicated in nosocomial outbreaks when patients are hospitalized in a local casualty department or during their repatriation thereafter. The source of the contaminations which lead to AB infections following injuries (warfare or natural disasters) is still poorly known. Three hypotheses are usually considered: a contamination of wounds with environmental bacteria, a wound contamination from a previous cutaneous or oropharyngeal endogenous reservoir, or hospital acquisition. The implication of telluric or agricultural primary reservoirs in human AB infections is a common hypothesis which remains to be demonstrated by further specifically designed studies.

  17. Diverse responses to UV light exposure in Acinetobacter include the capacity for DNA damage-induced mutagenesis in the opportunistic pathogens Acinetobacter baumannii and Acinetobacter ursingii.


    Hare, Janelle M; Bradley, James A; Lin, Ching-li; Elam, Tyler J


    Error-prone and error-free DNA damage repair responses that are induced in most bacteria after exposure to various chemicals, antibiotics or radiation sources were surveyed across the genus Acinetobacter. The error-prone SOS mutagenesis response occurs when DNA damage induces a cell's umuDC- or dinP-encoded error-prone polymerases. The model strain Acinetobacter baylyi ADP1 possesses an unusual, regulatory umuD allele (umuDAb) with an extended 5' region and only incomplete fragments of umuC. Diverse Acinetobacter species were investigated for the presence of umuDC and their ability to conduct UV-induced mutagenesis. Unlike ADP1, most Acinetobacter strains possessed multiple umuDC loci containing either umuDAb or a umuD allele resembling that of Escherichia coli. The nearly omnipresent umuDAb allele was the ancestral umuD in Acinetobacter, with horizontal gene transfer accounting for over half of the umuDC operons. Despite multiple umuD(Ab)C operons in many strains, only three species conducted UV-induced mutagenesis: Acinetobacter baumannii, Acinetobacter ursingii and Acinetobacter beijerinckii. The type of umuDC locus or mutagenesis phenotype a strain possessed was not correlated with its error-free response of survival after UV exposure, but similar diversity was apparent. The survival of 30 Acinetobacter strains after UV treatment ranged over five orders of magnitude, with the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and haemolytic strains having lower survival than non-Acb or non-haemolytic strains. These observations demonstrate that a genus can possess a range of DNA damage response mechanisms, and suggest that DNA damage-induced mutation could be an important part of the evolution of the emerging pathogens A. baumannii and A. ursingii.

  18. Diverse responses to UV light exposure in Acinetobacter include the capacity for DNA damage-induced mutagenesis in the opportunistic pathogens Acinetobacter baumannii and Acinetobacter ursingii

    PubMed Central

    Bradley, James A.; Lin, Ching-li; Elam, Tyler J.


    Error-prone and error-free DNA damage repair responses that are induced in most bacteria after exposure to various chemicals, antibiotics or radiation sources were surveyed across the genus Acinetobacter. The error-prone SOS mutagenesis response occurs when DNA damage induces a cell’s umuDC- or dinP-encoded error-prone polymerases. The model strain Acinetobacter baylyi ADP1 possesses an unusual, regulatory umuD allele (umuDAb) with an extended 5′ region and only incomplete fragments of umuC. Diverse Acinetobacter species were investigated for the presence of umuDC and their ability to conduct UV-induced mutagenesis. Unlike ADP1, most Acinetobacter strains possessed multiple umuDC loci containing either umuDAb or a umuD allele resembling that of Escherichia coli. The nearly omnipresent umuDAb allele was the ancestral umuD in Acinetobacter, with horizontal gene transfer accounting for over half of the umuDC operons. Despite multiple umuD(Ab)C operons in many strains, only three species conducted UV-induced mutagenesis: Acinetobacter baumannii, Acinetobacter ursingii and Acinetobacter beijerinckii. The type of umuDC locus or mutagenesis phenotype a strain possessed was not correlated with its error-free response of survival after UV exposure, but similar diversity was apparent. The survival of 30 Acinetobacter strains after UV treatment ranged over five orders of magnitude, with the Acinetobacter calcoaceticus–A. baumannii (Acb) complex and haemolytic strains having lower survival than non-Acb or non-haemolytic strains. These observations demonstrate that a genus can possess a range of DNA damage response mechanisms, and suggest that DNA damage-induced mutation could be an important part of the evolution of the emerging pathogens A. baumannii and A. ursingii. PMID:22117008

  19. Critical role of bacterial isochorismatase in the autophagic process induced by Acinetobacter baumannii in mammalian cells

    PubMed Central

    Wang, Yang; Zhang, Kaiyu; Shi, Xiaochen; Wang, Chao; Wang, Feng; Fan, Junwen; Shen, Fengge; Xu, Jiancheng; Bao, Wanguo; Liu, Mingyuan; Yu, Lu


    A recent study reported that Acinetobacter baumannii could induce autophagy, but the recognition and clearance mechanism of intracytosolic A. baumannii in the autophagic process and the molecular mechanism of autophagy induced by the pathogen remains unknown. In this study, we first demonstrated that invading A. baumannii induced a complete, ubiquitin-mediated autophagic response that is dependent upon septins SEPT2 and SEPT9 in mammalian cells. We also demonstrated that autophagy induced by A. baumannii was Beclin-1 dependent via the AMPK/ERK/mammalian target of rapamycin pathway. Of interest, we found that the isochorismatase mutant strain had significantly decreased siderophore-mediated ferric iron acquisition ability and had a reduced the ability to induce autophagy. We verified that isochorismatase was required for the recognition of intracytosolic A. baumannii mediated by septin cages, ubiquitinated proteins, and ubiquitin-binding adaptor proteins p62 and NDP52 in autophagic response. We also confirmed that isochorismatase was required for the clearance of invading A. baumannii by autophagy in vitro and in the mouse model of infection. Together, these findings provide insight into the distinctive recognition and clearance of intracytosolic A. baumannii by autophagy in host cells, and that isochorismatase plays a critical role in the A. baumannii–induced autophagic process.—Wang, Y., Zhang, K., Shi, X., Wang, C., Wang, F., Fan, J., Shen, F., Xu, J., Bao, W., Liu, M., Yu, L. Critical role of bacterial isochorismatase in the autophagic process induced by Acinetobacter baumannii in mammalian cells. PMID:27432399

  20. Early dissemination of OXA-72-producing Acinetobacter baumannii strain in Colombia: a case report.


    Saavedra, Sandra Yamile; Cayô, Rodrigo; Gales, Ana Cristina; Leal, Aura Lucia; Saavedra, Carlos Humberto


    Nosocomial infections caused by carbapenem-resistant Acinetobacter baumannii isolates have reached epidemic levels in past decades. Currently this microorganism is responsible for outbreaks of difficult eradication and with high mortality rates worldwide. We herein report a rare case of an OXA-72-producing A. baumannii isolate colonizing a 47-year-old male patient with peritonitis due to abdominal stab wound, four years earlier than the first report of this carbapenemase in Acinetobacter pittii in Colombia. Although OXA-72 presents a low prevalence compared with OXA-23, our study demonstrated that A. baumannii isolates carrying the blaOXA-72 gene were present in the hospital environment in Colombia and could act as a reservoir for further spread to other Acinetobacter species, like A. pittii, causing carbapenem-resistance. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  1. The complete genome and phenome of a community-acquired Acinetobacter baumannii.


    Farrugia, Daniel N; Elbourne, Liam D H; Hassan, Karl A; Eijkelkamp, Bart A; Tetu, Sasha G; Brown, Melissa H; Shah, Bhumika S; Peleg, Anton Y; Mabbutt, Bridget C; Paulsen, Ian T


    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections.

  2. Analysis on distribution features and drug resistance of clinically isolated Acinetobacter baumannii.


    Ren, Guangming; Zhou, Min; Ding, Ning; Zhou, Ning; Li, Qingling


    The aim of the present study was to examine the clinical distribution and drug resistance of Acinetobacter baumannii infection, and provide evidence of clinical medication as well as the prophylaxis for the treatment of drug resistance bacteria. In total, 306 Acinetobacter baumanniis selected from routine culture were collected between January 2012 and December 2013, to analyze the distributions among clinical specimens and wards and their drug resistance state. Of the 306 Acinetobacter baumanniis, the main distribution of specimens was sputum, accounting for 77.78%. The distribution of administrative office was dominated by intensive care unit with a proportion of 40.0% in 2012, which rapidly increased to 60.9% in 2013, followed by neurosurgery, respiration medicine and orthopedics with proportions of 23, 12 and 9.0% in 2012 and 9.71, 8.74 and 3.88% in 2013, respectively. The Acinetobacter baumannii's drug resistance rate of Tazobactam and Piperacillin was increased from 68.0% in 2012 to 71.36% in 2013. At the same time, the drug resistance rate of imipenem was enhanced from 66.0% in 2012 to 72.81% in 2013. By 2013, the drug resistance rates of penbritin, ceftizoxime, cefotetan and macrodantin reached ≤100%. In conclusion, Acinetobacter baumannii mainly causes respiratory tract infection with severe drug resistance. The drug resistance of Acinetobacter baumannii was mainly manifested as multidrug resistance or even pan-drug resistance with an obvious increasing trend of tolerance. Thus, it is necessary to prevent and treat nosocomial infection, to minimize usage of antibiotics and to standardize medical operating, to reduce the increase in persistence.

  3. First report of NDM-1-producing Acinetobacter baumannii sequence type 25 in Brazil.


    Pillonetto, Marcelo; Arend, Lavinia; Vespero, Eliana Carolina; Pelisson, Marsileni; Chagas, Thiago Pavoni Gomes; Carvalho-Assef, Ana Paula D'Alincourt; Asensi, Marise Dutra


    New Delhi metallo-β-lactamase 1 (NDM-1) was first identified in Brazil in Enterobacter hormaechei and Providencia rettgeri in 2013. Here, we describe the first case of NDM-1-producing Acinetobacter baumannii sequence type 25 isolated from the urinary tract of a 71-year-old man who died of multiple complications, including A. baumannii infection. The NDM-1 gene was detected by quantitative PCR, and its sequence confirmed its presence in an ∼ 100-kb plasmid.

  4. Draft Genome Sequence of the Biofilm-Hyperproducing Acinetobacter baumannii Clinical Strain MAR002

    PubMed Central

    Álvarez-Fraga, Laura; López, María; Merino, María; Rumbo-Feal, Soraya; Tomás, María


    We report the draft genome sequence of Acinetobacter baumannii strain MAR002, a biofilm-hyperproducing clinical strain isolated during the study CP/09/0033 (GEIH/REIPI-Ab2010, Spain). The genome of A. baumannii MAR002 has an approximate length of 3,717,929 bp and 3,300 protein-coding sequences, with a C+G content of 39.09%. PMID:26205868

  5. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii

    PubMed Central

    Fàbrega, Anna; Roca, Ignasi; Sánchez-Encinales, Viviana; Vila, Jordi; Pachón, Jerónimo


    Acinetobacter baumannii has emerged as a nosocomial pathogen with an increased prevalence of multidrug-resistant strains. The role of the outer membrane protein A (OmpA) in antimicrobial resistance remains poorly understood. In this report, disruption of the ompA gene led to decreased MICs of chloramphenicol, aztreonam, and nalidixic acid. We have characterized, for the first time, the contribution of OmpA in the antimicrobial resistance phenotype of A. baumannii. PMID:24379205

  6. Draft Genome Sequence of an Extensively Drug-Resistant Acinetobacter baumannii Indigo-Pigmented Strain

    PubMed Central

    Traglia, German; Vilacoba, Elisabet; Almuzara, Marisa; Diana, Leticia; Iriarte, Andres; Centrón, Daniela


    Last year in 2013, we reported an outbreak due to indigo-pigmented Acinetobacter baumannii strains in a hospital from Buenos Aires, Argentina. Here, we present the draft genome sequence of one of the strains (A. baumannii A33405) involved in the outbreak. This isolate was categorized as extensively drug-resistant (XDR) and harbors different genetic elements associated with horizontal genetic transfer and multiple antibiotic resistances. PMID:25395633

  7. Draft Genome Sequence of an International Clonal Lineage 1 Acinetobacter baumannii Strain from Argentina

    PubMed Central

    Vilacoba, Elisabet; Déraspe, Maxime; Traglia, German M.; Roy, Paul H.; Centrón, Daniela


    In the last few years Acinetobacter baumannii has emerged worldwide as an important nosocomial pathogen in medical institutions. Here, we present the draft genome sequence of the international clonal lineage 1 (ICL1) A. baumannii strain A144 that was isolated in a hospital in Buenos Aires City in the year 1997. The strain is susceptible to carbapenems and resistant to trimethoprim and gentamicin. PMID:25428965

  8. Iron acquisition functions expressed by the human pathogen Acinetobacter baumannii.


    Zimbler, Daniel L; Penwell, William F; Gaddy, Jennifer A; Menke, Sharon M; Tomaras, Andrew P; Connerly, Pamela L; Actis, Luis A


    Acinetobacter baumannii is a gram-negative bacterium that causes serious infections in compromised patients. More recently, it has emerged as the causative agent of severe infections in military personnel wounded in Iraq and Afghanistan. This pathogen grows under a wide range of conditions including iron-limiting conditions imposed by natural and synthetic iron chelators. Initial studies using the type strain 19606 showed that the iron proficiency of this pathogen depends on the expression of the acinetobactin-mediated iron acquisition system. More recently, we have observed that hemin but not human hemoglobin serves as an iron source when 19606 isogenic derivatives affected in acinetobactin transport and biosynthesis were cultured under iron-limiting conditions. This finding is in agreement with the observation that the genome of the strain 17978 has a gene cluster coding for putative hemin-acquisition functions, which include genes coding for putative hemin utilization functions and a TonBExbBD energy transducing system. This system restored enterobactin biosynthesis in an E. coli ExbBD deficient strain but not when introduced into a TonB mutant. PCR and Southern blot analyses showed that this hemin-utilization gene cluster is also present in the 19606 strain. Analysis of the 17978 genome also showed that this strain harbors genes required for acinetobactin synthesis and transport as well as a gene cluster that could code for additional iron acquisition functions. This hypothesis is in agreement with the fact that the inactivation of the basD acinetobactin biosynthetic gene did not affect the growth of A. baumannii 17978 cells under iron-chelated conditions. Interestingly, this second iron uptake gene cluster is flanked by perfect inverted repeats and includes transposase genes that are expressed transcriptionally. Also interesting is the observation that this additional cluster could not be detected in the type strain 19606, an observation that suggests some

  9. Acinetobacter baumannii and A. pittii clinical isolates lack adherence and cytotoxicity to lung epithelial cells in vitro.


    Lázaro-Díez, María; Navascués-Lejarza, Teresa; Remuzgo-Martínez, Sara; Navas, Jesús; Icardo, José Manuel; Acosta, Felix; Martínez-Martínez, Luis; Ramos-Vivas, José


    The molecular and genetic basis of Acinetobacter baumannii and Acinetobacter pittii virulence remains poorly understood, and there is still lack of knowledge in host cell response to these bacteria. In this study, we have used eleven clinical Acinetobacter strains (A. baumannii n = 5; A. pittii n = 6) to unravel bacterial adherence, invasion and cytotoxicity to human lung epithelial cells. Our results showed that adherence to epithelial cells by Acinetobacter strains is scarce and cellular invasion was not truly detected. In addition, all Acinetobacter strains failed to induce any cytotoxic effect on A549 cells.

  10. Characterization and identification of newly isolated Acinetobacter baumannii strain serdang 1 for phenol removal

    NASA Astrophysics Data System (ADS)

    Yadzir, Z. H. M.; Shukor, M. Y.; Nazir, M. S.; Abdullah, M. A.


    A new indigenous bacterial strain from Malaysian soil contaminated with petroleum waste had been successfully isolated, characterized and identified for phenol removal. The gram negative bacteria showed 98% identity with Acinetobacter baumannii based on Biolog{trade mark, serif} Identification System and the determination of a partial 16S ribosomal RNA (rRNA) sequence. The isolate clustered with species belonging to Acinetobacter clade in a 16S rDNA-based neighbour-joining phylogenetic tree.

  11. Candida albicans Airway Colonization Facilitates Subsequent Acinetobacter baumannii Pneumonia in a Rat Model.


    Tan, Xiaojiang; Chen, Ruilan; Zhu, Song; Wang, Huijun; Yan, Dongxing; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios


    The objective of the study was to determine the effects of Candida albicans respiratory tract colonization on Acinetobacter baumannii pneumonia in a rat model. Rats were colonized with C. albicans by instillation of 3 × 10(6) CFU into their airways, while sterile saline was instilled in the control group. The colonized rats were further divided into two groups: treated with amphotericin B or not. The rats were subsequently infected with A. baumannii (10(8) CFU by tracheobronchial instillation). A. baumannii lung CFU counts, cytokine lung levels, and rates of A. baumannii pneumonia were compared between groups. In vitro expression of A. baumannii virulence genes was measured by reverse transcription (RT)-PCR after 24-hour incubation with C. albicans or with Mueller-Hinton (MH) broth alone. Rats with Candida colonization developed A. baumannii pneumonia more frequently and had higher A. baumannii CFU burdens and heavier lungs than controls. After A. baumannii infection, lung interleukin 17 (IL-17) concentrations were lower and gamma interferon (IFN-γ) concentrations were higher in Candida-colonized rats than in controls. Candida-colonized rats treated with amphotericin B had a decreased rate of A. baumannii pneumonia and lower IFN-γ levels but higher IL-17 levels than untreated rats. Expression of basC, barB, bauA, ptk, plc2, and pld2 was induced while expression of ompA and abaI was suppressed in A. baumannii cultured in the presence of C. albicans C. albicans colonization facilitated the development of A. baumannii pneumonia in a rat model. Among Candida-colonized rats, antifungal treatment lowered the incidence of A. baumannii pneumonia. These findings could be due to modification of the host immune response and/or expression of A. baumannii virulence genes by Candida spp. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Species identification within Acinetobacter calcoaceticus-baumannii complex using MALDI-TOF MS.


    Toh, Benjamin E W; Paterson, David L; Kamolvit, Witchuda; Zowawi, Hosam; Kvaskoff, David; Sidjabat, Hanna; Wailan, Alexander; Peleg, Anton Y; Huber, Charlotte A


    Acinetobacter baumannii, one of the more clinically relevant species in the Acinetobacter genus is well known to be multi-drug resistant and associated with bacteremia, urinary tract infection, pneumonia, wound infection and meningitis. However, it cannot be differentiated from closely related species such as Acinetobacter calcoaceticus, Acinetobacter pittii and Acinetobacter nosocomialis by most phenotypic tests and can only be differentiated by specific, time consuming genotypic tests with very limited use in clinical microbiological laboratories. As a result, these species are grouped into the A. calcoaceticus-A. baumannii (Acb) complex. Herein we investigated the mass spectra of 73 Acinetobacter spp., representing ten different species, using an AB SCIEX 5800 MALDI-TOF MS to differentiate members of the Acinetobacter genus, including the species of the Acb complex. RpoB gene sequencing, 16S rRNA sequencing, and gyrB multiplex PCR were also evaluated as orthogonal methods to identify the organisms used in this study. We found that whilst 16S rRNA and rpoB gene sequencing could not differentiate A. pittii or A. calcoaceticus, they can be differentiated using gyrB multiplex PCR and MALDI-TOF MS. All ten Acinetobacter species investigated could be differentiated by their MALDI-TOF mass spectra. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Clinical and Epidemiological Significance of Carbapenem Resistance in Acinetobacter baumannii Infections

    PubMed Central

    Tal-Jasper, Ruthy; Katz, David E.; Amrami, Nadav; Ravid, Dor; Avivi, Dori; Zaidenstein, Ronit; Lazarovitch, Tsilia; Dadon, Mor; Kaye, Keith S.


    Carbapenems are considered the treatment of choice for Acinetobacter baumannii infections. Many facilities implement preventive measures toward only carbapenem-resistant A. baumannii (CRAB). However, the independent role of the carbapenem resistance determinant on patient outcomes remains controversial. In a 6-year analysis of adults with A. baumannii bloodstream infection (BSI), the outcomes of 149 CRAB isolates were compared to those of 91 patients with carbapenem-susceptible A. baumannii. In bivariable analyses, CRAB BSIs were significantly associated with worse outcomes and with a delay in the initiation of appropriate antimicrobial therapy (DAAT). However, in multivariable analyses, carbapenem resistance status was no longer associated with poor outcomes, while DAAT remained an independent predictor. The epidemiological significance of A. baumannii should not be determined by its resistance to carbapenems. PMID:26883694

  14. Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options.


    Lee, Chang-Ro; Lee, Jung Hun; Park, Moonhee; Park, Kwang Seung; Bae, Il Kwon; Kim, Young Bae; Cha, Chang-Jun; Jeong, Byeong Chul; Lee, Sang Hee


    Acinetobacter baumannii is undoubtedly one of the most successful pathogens responsible for hospital-acquired nosocomial infections in the modern healthcare system. Due to the prevalence of infections and outbreaks caused by multi-drug resistant A. baumannii, few antibiotics are effective for treating infections caused by this pathogen. To overcome this problem, knowledge of the pathogenesis and antibiotic resistance mechanisms of A. baumannii is important. In this review, we summarize current studies on the virulence factors that contribute to A. baumannii pathogenesis, including porins, capsular polysaccharides, lipopolysaccharides, phospholipases, outer membrane vesicles, metal acquisition systems, and protein secretion systems. Mechanisms of antibiotic resistance of this organism, including acquirement of β-lactamases, up-regulation of multidrug efflux pumps, modification of aminoglycosides, permeability defects, and alteration of target sites, are also discussed. Lastly, novel prospective treatment options for infections caused by multi-drug resistant A. baumannii are summarized.

  15. Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options

    PubMed Central

    Lee, Chang-Ro; Lee, Jung Hun; Park, Moonhee; Park, Kwang Seung; Bae, Il Kwon; Kim, Young Bae; Cha, Chang-Jun; Jeong, Byeong Chul; Lee, Sang Hee


    Acinetobacter baumannii is undoubtedly one of the most successful pathogens responsible for hospital-acquired nosocomial infections in the modern healthcare system. Due to the prevalence of infections and outbreaks caused by multi-drug resistant A. baumannii, few antibiotics are effective for treating infections caused by this pathogen. To overcome this problem, knowledge of the pathogenesis and antibiotic resistance mechanisms of A. baumannii is important. In this review, we summarize current studies on the virulence factors that contribute to A. baumannii pathogenesis, including porins, capsular polysaccharides, lipopolysaccharides, phospholipases, outer membrane vesicles, metal acquisition systems, and protein secretion systems. Mechanisms of antibiotic resistance of this organism, including acquirement of β-lactamases, up-regulation of multidrug efflux pumps, modification of aminoglycosides, permeability defects, and alteration of target sites, are also discussed. Lastly, novel prospective treatment options for infections caused by multi-drug resistant A. baumannii are summarized. PMID:28348979

  16. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii.


    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs-antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics.

  17. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride.


    Narayanan, Amoolya; Nair, Meera S; Karumathil, Deepti P; Baskaran, Sangeetha A; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni


    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections.

  18. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride

    PubMed Central

    Narayanan, Amoolya; Nair, Meera S.; Karumathil, Deepti P.; Baskaran, Sangeetha A.; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni


    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections. PMID:27375572

  19. Identification and Characterization of a Glycosyltransferase Involved in Acinetobacter baumannii Lipopolysaccharide Core Biosynthesis▿

    PubMed Central

    Luke, Nicole R.; Sauberan, Shauna L.; Russo, Thomas A.; Beanan, Janet M.; Olson, Ruth; Loehfelm, Thomas W.; Cox, Andrew D.; St. Michael, Frank; Vinogradov, Evgeny V.; Campagnari, Anthony A.


    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  20. Combination therapy with polymyxin B and netropsin against clinical isolates of multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Chung, Joon-hui; Bhat, Abhayprasad; Kim, Chang-Jin; Yong, Dongeun; Ryu, Choong-Min


    Polymyxins are last-resort antibiotics for treating infections of Gram-negative bacteria. The recent emergence of polymyxin-resistant bacteria, however, urgently demands clinical optimisation of polymyxin use to minimise further evolution of resistance. In this study we developed a novel combination therapy using minimal concentrations of polymyxin B. After large-scale screening of Streptomyces secondary metabolites, we identified a reliable polymixin synergist and confirmed as netropsin using high-pressure liquid chromatography, nuclear magnetic resonance, and mass spectrometry followed by in vitro assays using various Gram-negative pathogenic bacteria. To evaluate the effectiveness of combining polymixin B and netropsin in vivo, we performed survival analysis on greater wax moth Galleria mellonella infected with colistin-resistant clinical Acinetobacter baumannii isolates as well as Escherichia coli, Shigella flexineri, Salmonella typhimuruim, and Pseudomonas aeruginosa. The survival of infected G. mellonella was significantly higher when treated with polymyxin B and netropsin in combination than when treated with polymyxin B or netropsin alone. We propose a netropsin combination therapy that minimises the use of polymyxin B when treating infections with multidrug resistant Gram-negative bacteria. PMID:27306928

  1. Nosocomial Infections Caused by Acinetobacter baumannii: Are We Losing the Battle?


    Protic, Dragana; Pejovic, Aleksa; Andjelkovic, Dragana; Djukanovic, Nina; Savic, Dragana; Piperac, Pavle; Markovic Denic, Ljiljana; Zdravkovic, Marija; Todorovic, Zoran


    The incidence of nosocomial infections caused by multi-drug- and extended-drug resistant strains of Acinetobacter is constantly increasing all over the world, with a high mortality rate. We analyzed the in-hospital data on the sensitivity of Acinetobacter baumannii isolates and correlated them with antibiotic treatment and clinical outcomes of nosocomial infections over a 17-mo period. Retrospective analysis was performed at the Clinical Center "Bezanijska kosa," Belgrade, Serbia. Microbiologic data (number and sensitivity of A. baumannii isolates) and clinical data (medical records of 41 randomly selected patients who developed nosocomial infection caused by A. baumannii) were matched. Acinetobacter baumannii, detected in 279 isolates and obtained from 19 patients (12% of all samples), was resistant to almost all antibiotics tested, including carbapenems, with the exception of colistin and tigecycline. It was obtained most often from the respiratory tract samples. Empiric treatment of the nosocomial infections (pneumonia in 75% of cases) involved cephalosporins, metronidazole, and carbapenems (80%, 66%, and 61% of patients, respectively), whereas tigecyclin and colistin were used primarily in targeted therapy (20% and 12% of patients, respectively). The mortality rate of patients treated empirically was significantly higher (p < 0.01), reaching 100% in the elderly. Nosocomial A. baumannii infections represent a significant clinical problem because of their high incidence, lack of susceptibility to the most commonly used antibiotics, and the often inappropriate treatment, which favors the development of multi-drug-resistant strains.

  2. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool

    PubMed Central

    Diancourt, Laure; Passet, Virginie; Nemec, Alexandr; Dijkshoorn, Lenie; Brisse, Sylvain


    Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections. PMID:20383326

  3. The Impact of Antibiotic Consumption on Development of Acinetobacter Baumannii Resistance

    PubMed Central

    Granov, Djana; Ljubovic, Amela Dedeic; Zec, Svjetlana Loga; Granov, Nermir; Hukic, Mirsada


    Aim: The aim of this study was to examine the impact of antibiotic consumption on development of antimicrobial resistance in Acinetobacter baumannii. Material and Methods: The study was conducted in University Clinical Center of Sarajevo. In our retrospective study Acinetobacter baumannii isolated in period from July 1st 2009 to December 31st 2012. Isolates were detected from different clinical samples including urine, wound swab, blood, bronchial aspirate and other samples which were collected from patients situated on various hospital wards. Clinical isolates belonged to one per patient in a given period of time. Results: Antimicrobial resistance was interpreted according to CLSI breakpoints. Consumption of antibiotics was analyzed according to recommendations of the ESAC-Net and current Acinetobacter baumannii classification. Pearson’s correlation showed a positive correlation between gentamicin consumption and emerging of resistance (p = 0.023). Conclusion: Increase in the antimicrobial use was followed with an increase in resistance of Acinetobacter baumannii isolates. Monitoring of antibiotic resistance and consumption is of a great importance in order to reduce the emergence and spread of antimicrobial resistant organisms in the health care settings. PMID:28144198

  4. Meta-analysis of colistin for the treatment of Acinetobacter baumannii infection.


    Chen, Zhijin; Chen, Yu; Fang, Yaogao; Wang, Xiaotian; Chen, Yanqing; Qi, Qingsong; Huang, Fang; Xiao, Xungang


    Multidrug resistant among Acinetobacter baumannii infection is associated with a high mortality rate and limits the therapeutic options. The aim of this study was to assess the safety and efficacy of colistin monotherapy vs. other single antibiotic therapy AND colistin-based combination therapy (with other antibiotics) vs. colistin alone for the treatment of Acinetobacter baumannii infection. Online electronic database were searched for studies evaluating colistin with or without other antibiotics in treatment of patients with drug-resistant Acinetobacter baumannii infection. Totally, twelve studies met the inclusion criteria. For colistin-based combination therapy, six articles including 668 patients were included. Our results showed that the overall clinical response did not differ significantly between colistin-based combination therapy and monotherapy (OR = 1.37, 95% CI = 0.86-2.19, P = 0.18). This insignificance was also detected in ICU mortality, length of stay and nephrotoxicity (P > 0.05). However, the colistin-based combination therapy was shown increasing the microbiological response (OR = 2.14, 95% CI = 1.48-3.07, P < 0.0001). For colistin monotherapy, six studies involving 491 patients were analyzed. The results were in concordance with the findings of the colistin-based combination therapy group. Our results suggest that colistin may be a promising therapy as safe and efficacious as standard antibiotics for the treatment of drug-resistant Acinetobacter baumannii infection.

  5. Meta-analysis of colistin for the treatment of Acinetobacter baumannii infection

    PubMed Central

    Chen, Zhijin; Chen, Yu; Fang, Yaogao; Wang, Xiaotian; Chen, Yanqing; Qi, Qingsong; Huang, Fang; Xiao, Xungang


    Multidrug resistant among Acinetobacter baumannii infection is associated with a high mortality rate and limits the therapeutic options. The aim of this study was to assess the safety and efficacy of colistin monotherapy vs. other single antibiotic therapy AND colistin-based combination therapy (with other antibiotics) vs. colistin alone for the treatment of Acinetobacter baumannii infection. Online electronic database were searched for studies evaluating colistin with or without other antibiotics in treatment of patients with drug-resistant Acinetobacter baumannii infection. Totally, twelve studies met the inclusion criteria. For colistin-based combination therapy, six articles including 668 patients were included. Our results showed that the overall clinical response did not differ significantly between colistin-based combination therapy and monotherapy (OR = 1.37, 95% CI = 0.86–2.19, P = 0.18). This insignificance was also detected in ICU mortality, length of stay and nephrotoxicity (P > 0.05). However, the colistin-based combination therapy was shown increasing the microbiological response (OR = 2.14, 95% CI = 1.48–3.07, P < 0.0001). For colistin monotherapy, six studies involving 491 patients were analyzed. The results were in concordance with the findings of the colistin-based combination therapy group. Our results suggest that colistin may be a promising therapy as safe and efficacious as standard antibiotics for the treatment of drug-resistant Acinetobacter baumannii infection. PMID:26597507

  6. Colistin methanesulfonate against multidrug-resistant Acinetobacter baumannii in an in vitro pharmacodynamic model.


    Kroeger, Lisa A; Hovde, Laurie B; Mitropoulos, Isaac F; Schafer, Jeremy; Rotschafer, John C


    Using an in vitro pharmacodynamic model, a multidrug-resistant strain of Acinetobacter baumannii was exposed to colistin methanesulfonate alone and in combination with ceftazidime. Pre- and postexposure colistin sulfate MICs were determined. A single daily dose of colistin methanesulfonate combined with continuous-infusion ceftazidime prevented regrowth and postexposure MIC increases.

  7. Whole-Genome Sequencing Elucidates Epidemiology of Nosocomial Clusters of Acinetobacter baumannii

    PubMed Central

    Willems, Stefanie; Kampmeier, Stefanie; Bletz, Stefan; Kossow, Annelene; Köck, Robin; Kipp, Frank


    We characterized two epidemiologically similar Acinetobacter baumannii clusters from two separate intensive care units (ICU) using core genome multilocus sequence typing. Clonal spread was confirmed in ICU-1 (12 of 14 isolates shared genotypes); in ICU-2, all genotypes (13 isolates) were diverse, thus excluding transmissions and enabling adequate infection control measures. PMID:27358465

  8. Draft Genome Sequences of Clinical Isolates of Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Erickson, Keesha E.; Madinger, Nancy E.


    ABSTRACT We report here the draft genome sequences of two clinically isolated Acinetobacter baumannii strains. These samples were obtained from patients at the University of Colorado Hospital in 2007 and 2013 and encode an estimated 20 and 13 resistance genes, respectively. PMID:28153899

  9. Draft Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Strain from Chile

    PubMed Central

    Lopes, Bruno S.; García, Patricia; Domínguez Yévenes, Mariana; Lima, Celia; Bello-Toledo, Helia; González-Rocha, Gerardo; Amyes, Sebastian G. B.


    Acinetobacter baumannii strain Ab5 was isolated in the year 2007 in Chile, being one of the first multidrug-resistant (MDR) cases reported in the country. Here, we present the very first draft genome sequence of an MDR Chilean strain, which shows the presence of diverse resistance and acquired virulence genes. PMID:26139713

  10. Draft Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Strain from Chile.


    Opazo, Andrés; Lopes, Bruno S; García, Patricia; Domínguez Yévenes, Mariana; Lima, Celia; Bello-Toledo, Helia; González-Rocha, Gerardo; Amyes, Sebastian G B


    Acinetobacter baumannii strain Ab5 was isolated in the year 2007 in Chile, being one of the first multidrug-resistant (MDR) cases reported in the country. Here, we present the very first draft genome sequence of an MDR Chilean strain, which shows the presence of diverse resistance and acquired virulence genes. Copyright © 2015 Opazo et al.

  11. Evaluation of the Trimeric Autotransporter Ata as a Vaccine Candidate against Acinetobacter baumannii Infections

    PubMed Central

    Bentancor, Leticia V.; Routray, Abhisek; Bozkurt-Guzel, Cagla; Camacho-Peiro, Ana; Pier, Gerald B.


    Acinetobacter baumannii is a multidrug-resistant (MDR) nosocomial pathogen for which immunotherapeutic alternatives are needed. We previously identified a surface autotransporter of A. baumannii, Ata, that bound to various extracellular matrix/basal membrane proteins and was required for full virulence, biofilm formation, and the adhesion of A. baumannii to collagen type IV. We show here that Ata binding to collagen type IV was inhibited by antibodies to Ata. In addition, in the presence of complement and polymorphonuclear cells (PMNs), antibodies to Ata were highly opsonic against A. baumannii ATCC 17978 and showed low to moderate killing activity against four heterologous A. baumannii strains, whereas in the absence of PMNs, antibody to Ata efficiently promoted complement-dependent bactericidal killing of all of the tested A. baumannii isolates. Using a pneumonia model of infection in both immunocompetent and immunocompromised mice, we found that, compared to normal rabbit sera, antisera to Ata significantly reduced the levels of A. baumannii ATCC 17978 and two MDR strains in the lungs of infected mice. The ability of Ata to engender anti-adhesive, bactericidal, opsonophagocytic, and protective antibodies validates its potential use as an antigenic target against MDR A. baumannii infections. PMID:22825448

  12. Multidrug resistant Acinetobacter baumannii in veterinary medicine--emergence of an underestimated pathogen?


    Müller, Stefanie; Janssen, Traute; Wieler, Lothar H


    The proportion of multidrug resistant bacteria causing infections in animals has continuously been increasing. While the relevance of ESBL (extended spectrum beta-lactamase)-producing Enterobacteriaceae spp. and MRSA (methicillin resistant Staphylococcus aureus) is unquestionable, knowledge about multidrug resistant Acinetobacter baumannii in veterinary medicine is scarce. This is a worrisome situation, as A. baumannii are isolated from veterinary clinical specimens with rising frequency. The remarkable ability of A. baumannii to develop multidrug resistance and the high risk of transmission are known in human medicine for years. Despite this, data regarding A. baumannii isolates of animal origin are missing. Due to the changing role of companion animals with closer contact between animal and owner, veterinary intensive care medicine is steadily developing. It can be assumed that the number of "high risk" patients with an enhanced risk for hospital acquired infections will be rising simultaneously. Thus, development and spread of multidrug resistant pathogens is envisioned to rise. It is possible, that A. baumannii will evolve into a veterinary nosocomial pathogen similar to ESBL-producing Enterobacteriaceae and MRSA. The lack of attention paid to A. baumannii in veterinary medicine is even more worrying, as first reports indicate a transmission between humans and animals. Essential questions regarding the role of livestock, especially as a potential source of multidrug resistant isolates, remain unanswered. This review summarizes the current knowledge on A. baumannii in veterinary medicine for the first time. It underlines the utmost significance of further investigations of A. baumannii animal isolates, particularly concerning epidemiology and resistance mechanisms.

  13. Role of Fibronectin in the Adhesion of Acinetobacter baumannii to Host Cells

    PubMed Central

    Smani, Younes; McConnell, Michael J.; Pachón, Jerónimo


    Adhesion to host cells is an initial and important step in Acinetobacter baumannii pathogenesis. However, there is relatively little information on the mechanisms by which A. baumannii binds to and interacts with host cells. Adherence to extracellular matrix proteins, such as fibronectin, affords pathogens with a mechanism to invade epithelial cells. Here, we found that A. baumannii adheres more avidly to immobilized fibronectin than to control protein. Free fibronectin used as a competitor resulted in dose-dependent decreased binding of A. baumannii to fibronectin. Three outer membrane preparations (OMPs) were identified as fibronectin binding proteins (FBPs): OMPA, TonB-dependent copper receptor, and 34 kDa OMP. Moreover, we demonstrated that fibronectin inhibition and neutralization by specific antibody prevented significantly the adhesion of A. baumannii to human lung epithelial cells (A549 cells). Similarly, A. baumannii OMPA neutralization by specific antibody decreased significantly the adhesion of A. baumannii to A549 cells. These data indicate that FBPs are key adhesins that mediate binding of A. baumannii to human lung epithelial cells through interaction with fibronectin on the surface of these host cells. PMID:22514602

  14. Evaluation of the trimeric autotransporter Ata as a vaccine candidate against Acinetobacter baumannii infections.


    Bentancor, Leticia V; Routray, Abhisek; Bozkurt-Guzel, Cagla; Camacho-Peiro, Ana; Pier, Gerald B; Maira-Litrán, Tomás


    Acinetobacter baumannii is a multidrug-resistant (MDR) nosocomial pathogen for which immunotherapeutic alternatives are needed. We previously identified a surface autotransporter of A. baumannii, Ata, that bound to various extracellular matrix/basal membrane proteins and was required for full virulence, biofilm formation, and the adhesion of A. baumannii to collagen type IV. We show here that Ata binding to collagen type IV was inhibited by antibodies to Ata. In addition, in the presence of complement and polymorphonuclear cells (PMNs), antibodies to Ata were highly opsonic against A. baumannii ATCC 17978 and showed low to moderate killing activity against four heterologous A. baumannii strains, whereas in the absence of PMNs, antibody to Ata efficiently promoted complement-dependent bactericidal killing of all of the tested A. baumannii isolates. Using a pneumonia model of infection in both immunocompetent and immunocompromised mice, we found that, compared to normal rabbit sera, antisera to Ata significantly reduced the levels of A. baumannii ATCC 17978 and two MDR strains in the lungs of infected mice. The ability of Ata to engender anti-adhesive, bactericidal, opsonophagocytic, and protective antibodies validates its potential use as an antigenic target against MDR A. baumannii infections.

  15. Improvement of MALDI-TOF MS profiling for the differentiation of species within the Acinetobacter calcoaceticus-Acinetobacter baumannii complex.


    Šedo, Ondrej; Nemec, Alexandr; Křížová, Lenka; Kačalová, Magdaléna; Zdráhal, Zbyněk


    MALDI-TOF MS is currently becoming the method of choice for rapid identification of bacterial species in routine diagnostics. Yet, this method suffers from the inability to differentiate reliably between some closely related bacterial species including those of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex, namely A. baumannii and Acinetobacter nosocomialis. In the present study, we evaluated a protocol which was different from that used in the Bruker Daltonics identification system (MALDI BioTyper) to improve species identification using a taxonomically precisely defined set of 105 strains representing the four validly named species of the ACB complex. The novel protocol is based on the change in matrix composition from alpha-cyano-4-hydroxycinnamic acid (saturated solution in water:acetonitrile:trifluoroacetic acid, 47.5:50:2.5, v/v) to ferulic acid (12.5mgml(-1) solution in water:acetonitrile:formic acid 50:33:17, v/v), while the other steps of sample processing remain unchanged. Compared to the standard protocol, the novel one extended the range of detected compounds towards higher molecular weight, produced signals with better mass resolution, and allowed the detection of species-specific signals. As a result, differentiation of A. nosocomialis and A. baumannii strains by cluster analysis was improved and 13 A. nosocomialis strains, assigned erroneously or ambiguously by using the standard protocol, were correctly identified.

  16. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity

    PubMed Central

    Richards, A.M.; Kwaik, Y. Abu; Lamont, R.J.


    SUMMARY Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of ‘Iraqibacter’. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. PMID:25052812

  17. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity.


    Richards, A M; Abu Kwaik, Y; Lamont, R J


    Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of 'Iraqibacter'. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. CpaA a novel protease from Acinetobacter baumannii clinical isolates deregulates blood coagulation.


    Tilley, Derek; Law, Robert; Warren, Sarah; Samis, John A; Kumar, Ayush


    Acinetobacter baumannii is an important nosocomial pathogen that displays high antibiotic resistance. It causes a variety of infections including pneumonias and sepsis which may result in disseminated intravascular coagulation. In this work, we identify and characterize a novel secreted, zinc-dependent, metallo-endopeptidase CpaA (coagulation targeting metallo-endopeptidase of Acinetobacter baumannii) which deregulates human blood coagulation in vitro and thus is likely to contribute to A. baumannii virulence. Three quarters of the clinical isolates tested (n = 16) had the cpaA gene; however, it was absent from two type strains, A. baumannii ATCC 17978 and A. baumannii ATCC 19606. The CpaA protein was purified from one clinical isolate and was able to cleave purified factor (F) V and fibrinogen and reduce the coagulation activity of FV in human plasma. CpaA-treated plasma showed reduced clotting activity in contact pathway-activated partial thromboplastin time (aPTT) assays, but increased clotting activity in tissue factor pathway prothrombin time (PT) assays. A significant portion of clinically relevant A. baumannii isolates secrete a protease which targets and deregulates the coagulation system.

  19. Candida spp. airway colonization: A potential risk factor for Acinetobacter baumannii ventilator-associated pneumonia.


    Tan, Xiaojiang; Zhu, Song; Yan, Dongxing; Chen, Weiping; Chen, Ruilan; Zou, Jian; Yan, Jingdong; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios


    This retrospective study was conducted to identify potential risk factors for Acinetobacter baumannii (A. baumannii) ventilator-associated pneumonia (VAP) and evaluate the association between Candida spp. airway colonization and A. baumannii VAP. Intensive care unit (ICU) patients who were on mechanical ventilation (MV) for ≥48 hours were divided into the following groups: patients with and without Candida spp. airway colonization; colonized patients receiving antifungal treatment or not; patients with A. baumannii VAP and those without VAP. Logistic regression analysis and propensity score matching were used to identify factors independently associated with A. baumannii VAP. Among 618 eligible patients, 264 (43%) had Candida spp. airway colonization and 114 (18%) developed A. baumannii VAP. Along with MV for ≥7 days (adjusted odds ratio [aOR] 8.9, 95% confidence intervals [95% CI] 4.9-15.8) and presence of a central venous catheter (aOR 3.2, 95% CI 1.1-9), Candida spp. airway colonization (aOR 2.6, 95% CI 1.6-4.3) was identified as an independent risk factor for A. baumannii VAP. Patients with Candida spp. airway colonization were more likely to develop A. baumannii VAP than non-colonized patients (23% vs 15%, P=.01 and 34% vs. 15%, P<.001 in propensity score-matched subgroups). Administration of antifungal agents was not associated with A. baumannii VAP (29% vs. 21%, P=.153) but with higher in-hospital mortality (53% vs. 39%, P=.037). Candida spp. airway colonization (43%) and A. baumannii VAP (18%) were common in ICU patients who were on mechanical ventilation for at least 48 hours. Candida spp. airway colonization was an independent risk factor for subsequent A. baumannii VAP. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail:

  20. Acinetobacter baumannii skin and soft-tissue infection associated with war trauma.


    Sebeny, Peter J; Riddle, Mark S; Petersen, Kyle


    Acinetobacter baumannii is usually associated with nosocomial pneumonia or bacteremia. Reports of A. baumannii skin and soft-tissue infection (SSTI) are uncommon. We performed a retrospective review of 57 inpatients admitted to a naval hospital ship and identified 8 patients with A. baumannii-associated SSTI. Demographic and clinical characteristics were compared between these patients and 49 patients with A. baumannii infections that were not SSTIs. We also reviewed 18 cases of A. baumannii-associated SSTI from the literature. Our 8 cases of A. baumannii-associated SSTI were associated with combat trauma wounds. The median age of the patients was 26 years. Although not statistically significant, A. baumannii-associated SSTIs were more likely to be associated with gunshot wounds (75% vs. 55%) or external fixators (63% vs. 29%), compared with A. baumannii infections that were not SSTIs. Use of a central venous catheter and total parenteral nutrition was also more common for patients with SSTI. Our cases of A. baumannii-associated SSTI presented as cellulitis with a "peau d'orange" appearance with overlying vesicles and, when untreated, progressed to necrotizing infection with bullae (hemorrhagic and nonhemorrhagic). In our case series, all isolates were multidrug resistant, and clinical success was achieved for 7 of 8 patients with debridement and carbapenem therapy. A. baumannii-associated SSTI is an emerging infection in patients who experience trauma. Clinicians should be aware of the potential role of A. baumannii as a multidrug-resistant pathogen causing hospital-acquired SSTI, particularly when associated with previous trauma or use of invasive devices. It should be suspected in patients who experience trauma and have edematous cellulitis with overlying vesicles. Early empirical coverage for drug-resistant species (e.g., with carbapenem therapy), combined with debridement, is usually curative.

  1. Outcomes of critically ill cancer patients with Acinetobacter baumannii infection

    PubMed Central

    Ñamendys-Silva, Silvio A; Correa-García, Paulina; García-Guillén, Francisco J; González-Herrera, María O; Pérez-Alonso, Américo; Texcocano-Becerra, Julia; Herrera-Gómez, Angel; Cornejo-Juárez, Patricia; Meneses-García, Abelardo


    AIM: To describe the intensive care unit (ICU) outcomes of critically ill cancer patients with Acinetobacter baumannii (AB) infection. METHODS: This was an observational study that included 23 consecutive cancer patients who acquired AB infections during their stay at ICU of the National Cancer Institute of Mexico (INCan), located in Mexico City. Data collection took place between January 2011, and December 2012. Patients who had AB infections before ICU admission, and infections that occurred during the first 2 d of ICU stay were excluded. Data were obtained by reviewing the electronic health record of each patient. This investigation was approved by the Scientific and Ethics Committees at INCan. Because of its observational nature, informed consent of the patients was not required. RESULTS: Throughout the study period, a total of 494 critically ill patients with cancer were admitted to the ICU of the INCan, 23 (4.6%) of whom developed AB infections. Sixteen (60.9%) of these patients had hematologic malignancies. Most frequent reasons for ICU admission were severe sepsis or septic shock (56.2%) and postoperative care (21.7%). The respiratory tract was the most frequent site of AB infection (91.3%). The most common organ dysfunction observed in our group of patients were the respiratory (100%), cardiovascular (100%), hepatic (73.9%) and renal dysfunction (65.2%). The ICU mortality of patients with 3 or less organ system dysfunctions was 11.7% (2/17) compared with 66.6% (4/6) for the group of patients with 4 or more organ system dysfunctions (P = 0.021). Multivariate analysis identified blood lactate levels (BLL) as the only variable independently associated with in-ICU death (OR = 2.59, 95%CI: 1.04-6.43, P = 0.040). ICU and hospital mortality rates were 26.1% and 43.5%, respectively. CONCLUSION: The mortality rate in critically ill patients with both HM, and AB infections who are admitted to the ICU is high. The variable most associated with increased mortality was

  2. Evaluation of CHROMagar Acinetobacter for Detection of Enteric Carriage of Multidrug-Resistant Acinetobacter baumannii in Samples from Critically Ill Patients▿

    PubMed Central

    Gordon, N. C.; Wareham, D. W.


    CHROMagar Acinetobacter was used to screen stool and perineal swabs for enteric carriage of multidrug-resistant Acinetobacter baumannii in samples from critically ill patients. Results were compared with a molecular assay resulting in sensitivity and specificity of culture compared to PCR of 91.7% and 89.6%, respectively. PMID:19439546

  3. Phosphoproteomics as an emerging weapon to develop new antibiotics against carbapenem resistant strain of Acinetobacter baumannii.


    Tiwari, Vishvanath; Tiwari, Monalisa


    Acinetobacter baumannii causes pneumonia, bloodstream infections, urinary tract infections, respiratory infections and meningitis. A. baumannii has developed resistance against most of the antibiotics including carbapenem. Therefore, to battle carbapenem resistance, there is a need to develop antimicrobial drugs with new modes of action. Phosphoproteomics will help identify the differentially phosphorylated protein and its crucial phosphosites which facilitate the elucidation of molecular mechanism of signaling and regulation of carbapenem resistant strain of A. baumannii as compared to carbapenem sensitive strain. This understanding might be useful for the development of new antibiotics against kinases involved in the phosphorylation of identified phosphosites in carbapenem resistant strain of A. baumannii. The proposed antibiotics selectively inhibit carbapenem resistant strain which further avoids its excessive use against carbapenem sensitive strain and thereafter reduces emergence of resistance.

  4. Biofilm Formation and Colistin Susceptibility of Acinetobacter baumannii Isolated from Korean Nosocomial Samples.


    Kim, Hyun Ah; Ryu, Seong Yeol; Seo, Incheol; Suh, Seong-Il; Suh, Min-Ho; Baek, Won-Ki


    Biofilm formation, a virulence factor of Acinetobacter baumannii, is associated with long-term survival in hospital environments and provides resistance to antibiotics. Standard tests for antibiotic susceptibility involve analyzing bacteria in the planktonic state. However, the biofilm formation ability can influence antibiotic susceptibility. Therefore, here, the biofilm formation ability of A. baumannii clinical isolates from Korea was investigated and the susceptibility of biofilm and planktonic bacteria to colistin was compared. Of the 100 clinical isolates examined, 77% exhibited enhanced biofilm formation capacity relative to a standard A. baumannii strain (ATCC 19606). Differences between the minimal inhibitory concentrations and minimal biofilm-inhibitory concentrations of colistin were significantly greater in the group of A. baumannii that exhibited enhanced biofilm formation than the group that exhibited less ability for biofilm formation. Thus, the ability to form a biofilm may affect antibiotic susceptibility and clinical failure, even when the dose administered is in the susceptible range.

  5. Screening and deciphering antibiotic resistance in Acinetobacter baumannii: a state of the art.


    Bonnin, Rémy A; Nordmann, Patrice; Poirel, Laurent


    Acinetobacter baumannii, recognized as a serious threat in healthcare facilities, has the ability to develop resistance to antibiotics quite easily. This resistance is related to either gene acquisition (horizontal gene transfer) or mutations in the genome, leading to gene disruption, over- or down-expression of genes. The clinically relevant antibiotic resistances in A. baumannii include resistance to aminoglycosides, broad-spectrum cephalosporins, carbapenems, tigecycline and colistin, which are the last resort antibiotics. The intrinsic and acquired resistance mechanisms of A. baumannii are presented here, with special focus on β-lactam resistance. The most up-to-date techniques for identification, including phenotypical and molecular tests, and screening of those emerging resistance traits are also highlighted. The implementation of early detection and identification of multidrug-resistant A. baumannii is crucial to control their spread.

  6. Distribution of AdeABC efflux system genes in genotypically diverse strains of clinical Acinetobacter baumannii.


    Wieczorek, Piotr; Sacha, Paweł; Czaban, Sławomir; Hauschild, Tomasz; Ojdana, Dominika; Kowalczuk, Oksana; Milewski, Robert; Poniatowski, Bogusław; Nikliński, Jacek; Tryniszewska, Elżbieta


    Acinetobacter baumannii has emerged as a highly problematic hospital-associated pathogen. Different mechanisms contribute to the formation of multidrug resistance in A. baumannii, including the AdeABC efflux system. Distribution of the structural and regulatory genes encoding the AdeABC efflux system among genetically diverse clinical A. baumannii strains was achieved by using PCR and pulsed-field gel electrophoresis techniques. The distribution of adeABRS genes is extremely high among our A. baumannii strains, except the adeC gene. We have observed a large proportion of strains presenting multidrug-resistance phenotype for several years. The efflux pump could be an important mechanism in these strains in resistance to antibiotics.

  7. Complete Genome Sequence of a blaOXA-58-Producing Acinetobacter baumannii Strain Isolated from a Mexican Hospital

    PubMed Central

    Pérez-Oseguera, Ángeles; Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Silva-Sanchez, Jesus; Garza-González, Elvira; Castillo-Ramírez, Santiago


    ABSTRACT In this study, we present the complete genome sequence of a blaOXA-58-producing Acinetobacter baumannii strain, sampled from a Mexican hospital and not related to the international clones. PMID:28883144

  8. Complete Genome Sequence of a blaOXA-58-Producing Acinetobacter baumannii Strain Isolated from a Mexican Hospital.


    Pérez-Oseguera, Ángeles; Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Silva-Sanchez, Jesus; Garza-González, Elvira; Castillo-Ramírez, Santiago; Cevallos, Miguel Ángel


    In this study, we present the complete genome sequence of a blaOXA-58-producing Acinetobacter baumannii strain, sampled from a Mexican hospital and not related to the international clones. Copyright © 2017 Pérez-Oseguera et al.

  9. Identification of OXA-23 carbapenemases: novel variant OXA-239 in Acinetobacter baumannii ST758 clinical isolates in Mexico

    PubMed Central

    Tamayo-Legorreta, E M; Garza-Ramos, U; Barrios-Camacho, H; Sanchez-Perez, A; Galicia-Paredes, A; Meza-Chavez, A; Silva-Sanchez, J


    A collection of 15 carbapenem-resistance Acinetobacter baumannii clinical isolates was analysed on two tertiary hospitals in Mexico. The OXA-51 was identified in all isolates, followed by OXA-239 and OXA-58; OXA-239 is described as a new OXA-23-like allele. These carbapenemases were identified on four clonal groups, distributed between two neighbouring hospitals. Acinetobacter baumannii is poorly studied in Mexico; this situation urges the implementation of strategies to prevent its dissemination. PMID:25566396

  10. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.


    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  11. The Complete Genome and Phenome of a Community-Acquired Acinetobacter baumannii

    PubMed Central

    Farrugia, Daniel N.; Elbourne, Liam D. H.; Hassan, Karl A.; Eijkelkamp, Bart A.; Tetu, Sasha G.; Brown, Melissa H.; Shah, Bhumika S.; Peleg, Anton Y.; Mabbutt, Bridget C.; Paulsen, Ian T.


    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections. PMID:23527001

  12. Acinetobacter baumannii Infection Inhibits Airway Eosinophilia and Lung Pathology in a Mouse Model of Allergic Asthma

    PubMed Central

    Qiu, Hongyu; KuoLee, Rhonda; Harris, Greg; Zhou, Hongyan; Miller, Harvey; Patel, Girishchandra B.; Chen, Wangxue


    Allergic asthma is a dysregulation of the immune system which leads to the development of Th2 responses to innocuous antigens (allergens). Some infections and microbial components can re-direct the immune response toward the Th1 response, or induce regulatory T cells to suppress the Th2 response, thereby inhibiting the development of allergic asthma. Since Acinetobacter baumannii infection can modulate lung cellular and cytokine responses, we studied the effect of A. baumannii in modulating airway eosinophilia in a mouse model of allergic asthma. Ovalbumin (OVA)-sensitized mice were treated with live A. baumannii or phosphate buffered saline (PBS), then intranasally challenged with OVA. Compared to PBS, A. baumannii treatment significantly reduced pulmonary Th2 cytokine and chemokine responses to OVA challenge. More importantly, the airway inflammation in A. baumannii-treated mice was strongly suppressed, as seen by the significant reduction of the proportion and the total number of eosinophils in the bronchoalveolar lavage fluid. In addition, A. baumannii-treated mice diminished lung mucus overproduction and pathology. However, A. baumannii treatment did not significantly alter systemic immune responses to OVA. Serum OVA-specific IgE, IgG1 and IgG2a levels were comparable between A. baumannii- and PBS-treated mice, and tracheobronchial lymph node cells from both treatment groups produced similar levels of Th1 and Th2 cytokines in response to in vitro OVA stimulation. Moreover, it appears that TLR-4 and IFN-γ were not directly involved in the A. baumannii-induced suppression of airway eosinophilia. Our results suggest that A. baumannii inhibits allergic airway inflammation by direct suppression of local pulmonary Th2 cytokine responses to the allergen. PMID:21789200

  13. Isolation and Characterization of Antimicrobial Compounds in Plant Extracts against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Miyasaki, Yoko; Rabenstein, John D.; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M.; Kittell, Patricia Emmett; Morgan, Margie A.; Nichols, Wesley Stephen; Van Benschoten, M. M.; Hardy, William David; Liu, George Y.


    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii. PMID:23630600

  14. Acinetobacter baumannii-associated skin and soft tissue infections: recognizing a broadening spectrum of disease.


    Guerrero, Dubert M; Perez, Federico; Conger, Nicholas G; Solomkin, Joseph S; Adams, Mark D; Rather, Philip N; Bonomo, Robert A


    Acinetobacter baumannii is gaining importance as a cause of nosocomial infections, but its role in skin and soft tissue infection (SSTI) is not well defined. As a result of the outbreak of A. baumannii occurring in military personnel in Iraq and Afghanistan, reports of severe wound infections and SSTI caused by this pathogen are increasing in frequency. We describe four cases of monomicrobial and polymicrobial A. baumannii-associated necrotizing SSTI accompanied by A. baumannii bacteremia and offer a review of similar experiences published in the literature. Our comparative analysis reveals four unique features associated with necrotizing SSTI associated with A. baumannii: i) Occurs in hosts with underlying comorbidities (e.g., trauma, cirrhosis); ii) is often accompanied by bacteremia; iii) multiple drug resistance and the presence of co-pathogens frequently complicated treatment (64% of cases); iv) the cases reported here and in our review required surgical debridement (84% of cases) and led to substantial mortality (approximately 30%). As the prevalence of A. baumannii continues to increase in our health care system, SSTIs caused by this organism may become more common. Clinicians must be aware that the spectrum of disease caused by A. baumannii could include severe necrotizing SSTI and that vigilance for potential complications is necessary.

  15. Therapeutic Efficacy of Lysophosphatidylcholine in Severe Infections Caused by Acinetobacter baumannii

    PubMed Central

    Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo


    Due to the significant increase in antimicrobial resistance of Acinetobacter baumannii, immune system stimulation to block infection progression may be a therapeutic adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC), a major component of phospholipids in eukaryotic cells, is involved in immune cell recruitment and modulation. The aim of this study was to show if LPC could be useful for treating infections caused by A. baumannii. A. baumannii ATCC 17978 was used in this study. Levels of serum LPC and levels of the inflammatory cytokines tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), IL-1β, and IL-10 were determined by spectrophotometric assay and enzyme-linked immunosorbent assay (ELISA), respectively, using a murine peritoneal sepsis model in which mice were inoculated with 5.3 log CFU/ml of A. baumannii. The therapeutic efficacy of LPC against A. baumannii in murine peritoneal sepsis and pneumonia models was assessed for 48 h after bacterial infection. At early time points in the murine model of peritoneal sepsis caused by A. baumannii, LPC was depleted and was associated with an increase of inflammatory cytokine release. Preemptive therapy with LPC in murine peritoneal sepsis and pneumonia models markedly enhanced spleen and lung bacterial clearance and reduced the numbers of positive blood cultures and the mouse mortality rates. Moreover, treatment with LPC reduced proinflammatory cytokine production. These data demonstrate that LPC is efficacious as a preemptive treatment in experimental models of peritoneal sepsis and pneumonia caused by A. baumannii. PMID:25896698

  16. Joint Transcriptional Control of Virulence and Resistance to Antibiotic and Environmental Stress in Acinetobacter baumannii

    PubMed Central

    Gallagher, Larry A.; Jacobson, Rachael K.; Usacheva, Elena A.; Peterson, Lance R.; Zurawski, Daniel V.; Shuman, Howard A.


    ABSTRACT The increasing emergence of antibiotic-resistant bacterial pathogens represents a serious risk to human health and the entire health care system. Many currently circulating strains of Acinetobacter baumannii exhibit resistance to multiple antibiotics. A key limitation in combating A. baumannii is that our understanding of the molecular mechanisms underlying the pathogenesis of A. baumannii is lacking. To identify potential virulence determinants of a contemporary multidrug-resistant isolate of A. baumannii, we used transposon insertion sequencing (TnSeq) of strain AB5075. A collection of 250,000 A. baumannii transposon mutants was analyzed for growth within Galleria mellonella larvae, an insect-based infection model. The screen identified 300 genes that were specifically required for survival and/or growth of A. baumannii inside G. mellonella larvae. These genes encompass both known, established virulence factors and several novel genes. Among these were more than 30 transcription factors required for growth in G. mellonella. A subset of the transcription factors was also found to be required for resistance to antibiotics and environmental stress. This work thus establishes a novel connection between virulence and resistance to both antibiotics and environmental stress in A. baumannii. PMID:26556274

  17. Antimicrobial Resistance of Acinetobacter baumannii to Imipenem in Iran: A Systematic Review and Meta-Analysis.


    Pourhajibagher, Maryam; Hashemi, Farhad B; Pourakbari, Babak; Aziemzadeh, Masoud; Bahador, Abbas


    Imipenem-resistant multi-drug resistant (IR-MDR) Acinetobacter baumannii has been emerged as a morbidity successful nosocomial pathogen throughout the world.To address imipenem being yet the most effective antimicrobial agent against A. baumannii to control outbreaks and treat patients, a systematic review and meta-analysis was performed to evaluate the prevalence of IR-MDR A. baumannii. We systematically searched Web of Science, PubMed, MEDLINE, Science Direct, EMBASE, Scopus, Cochrane Library, Google Scholar, and Iranian databases to identify studies addressing the antibiotic resistance of A. baumannii to imipenem and the frequency of MDR strains in Iran. Out of 58 articles and after a secondary screening using inclusion and exclusion criteria and on the basis of title and abstract evaluation, 51 studies were selected for analysis. The meta-analysis revealed that 55% [95% confidence interval (CI), 53.0-56.5] of A. baumannii were resistant to imipenem and 74% (95% CI, 61.3-83.9) were MDR. The MDR A. baumannii population in Iran is rapidly changing toward a growing resistance to imipenem. Our findings highlight the critical need for a comprehensive monitoring and infection control policy as well as a national susceptibility review program that evaluates IR-MDR A. baumannii isolates from various parts of Iran.

  18. Molecular detection of aminoglycoside-modifying enzyme genes in Acinetobacter baumannii clinical isolates.


    Heidary, Mohsen; Salimi Chirani, Alireza; Khoshnood, Saeed; Eslami, Gita; Atyabi, Seyyed Mohammad; Nazem, Habibollah; Fazilati, Mohammad; Hashemi, Ali; Soleimani, Saleh


    Acinetobacter baumannii is a major opportunistic pathogen in healthcare settings worldwide. In Iran, there are only few reports on the prevalence of aminoglycoside resistance genes among A. baumannii isolates. The aim of this study was to investigate the existence of aminoglycoside-modifying enzyme (AME) genes from A. baumannii strains collected at a university teaching hospital in Iran. One hundred A. baumannii strains were collected between 2014 and 2015 from hospitalized patients at Loghman Hakim Hospital, Tehran, Iran. Antimicrobial susceptibility was determined by disk diffusion method according to the Clinical and Laboratory Standards Institute recommendations. The DNA was extracted using a kit obtained from Bioneer Co. (Korea) and was used as a template for polymerase chain reaction. The most active antimicrobial agent against these strains was colistin. The rate of extended-spectrum cephalosporin resistance was 97%. The aadA1, aadB, aac(6')-Ib, and aac(3)-IIa genes were found in 85%, 77%, 72%, and 68% of A. baumannii isolates, respectively. This study showed a high prevalence rate of AME genes in A. baumannii. This prevalence rate has explained that further aminoglycoside resistance genes may have role in the resistance of clinical isolates of A. baumannii. Therefore, control and treatment of serious infections caused by this opportunistic pathogen should be given more consideration.

  19. Therapeutic efficacy of lysophosphatidylcholine in severe infections caused by Acinetobacter baumannii.


    Smani, Younes; Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo


    Due to the significant increase in antimicrobial resistance of Acinetobacter baumannii, immune system stimulation to block infection progression may be a therapeutic adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC), a major component of phospholipids in eukaryotic cells, is involved in immune cell recruitment and modulation. The aim of this study was to show if LPC could be useful for treating infections caused by A. baumannii. A. baumannii ATCC 17978 was used in this study. Levels of serum LPC and levels of the inflammatory cytokines tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), IL-1β, and IL-10 were determined by spectrophotometric assay and enzyme-linked immunosorbent assay (ELISA), respectively, using a murine peritoneal sepsis model in which mice were inoculated with 5.3 log CFU/ml of A. baumannii. The therapeutic efficacy of LPC against A. baumannii in murine peritoneal sepsis and pneumonia models was assessed for 48 h after bacterial infection. At early time points in the murine model of peritoneal sepsis caused by A. baumannii, LPC was depleted and was associated with an increase of inflammatory cytokine release. Preemptive therapy with LPC in murine peritoneal sepsis and pneumonia models markedly enhanced spleen and lung bacterial clearance and reduced the numbers of positive blood cultures and the mouse mortality rates. Moreover, treatment with LPC reduced proinflammatory cytokine production. These data demonstrate that LPC is efficacious as a preemptive treatment in experimental models of peritoneal sepsis and pneumonia caused by A. baumannii.

  20. Acinetobacter baumannii Outer Membrane Vesicles Elicit a Potent Innate Immune Response via Membrane Proteins

    PubMed Central

    Jun, So Hyun; Lee, Jung Hwa; Kim, Bo Ra; Kim, Seung Il; Park, Tae In


    Acinetobacter baumannii is increasingly becoming a major nosocomial pathogen. This opportunistic pathogen secretes outer membrane vesicles (OMVs) that interact with host cells. The aim of this study was to investigate the ability of A. baumannii OMVs to elicit a pro-inflammatory response in vitro and the immunopathology in response to A. baumannii OMVs in vivo. OMVs derived from A. baumannii ATCC 19606T induced expression of pro-inflammatory cytokine genes, interleukin (IL)-1β and IL-6, and chemokine genes, IL-8, macrophage inflammatory protein-1α, and monocyte chemoattractant protein-1, in epithelial cells in a dose-dependent manner. Disintegration of OMV membrane with ethylenediaminetetraacetic acid resulted in low expression of pro-inflammatory cytokine genes, as compared with the response to intact OMVs. In addition, proteinase K-treated A. baumannii OMVs did not induce significant increase in expression of pro-inflammatory cytokine genes above the basal level, suggesting that the surface-exposed membrane proteins in intact OMVs are responsible for pro-inflammatory response. Early inflammatory processes, such as vacuolization and detachment of epithelial cells and neutrophilic infiltration, were clearly observed in lungs of mice injected with A. baumannii OMVs. Our data demonstrate that OMVs produced by A. baumannii elicit a potent innate immune response, which may contribute to immunopathology of the infected host. PMID:23977136

  1. The sensor kinase BfmS mediates virulence in Acinetobacter baumannii.


    Liou, Ming-Li; Soo, Po-Chi; Ling, Siao-Ru; Kuo, Han-Yueh; Tang, Chuan Yi; Chang, Kai-Chih


    BfmR, the response regulator component of the two-component system BfmRS, has important roles in biofilm formation and cellular morphology of Acinetobacter baumannii. Until now, the contribution of the sensor kinase BfmS to the virulence of this bacterium remains unknown. In this study, a bfmS knockout and complementation studies were performed to clarify the role of BfmS in A. baumannii virulence. We constructed a bfmS knockout mutant in the A. baumannii 17978 type strain by transposon inactivation. To clarify the role of bfmS in A. baumannii virulence, the biofilm formation, adherence ability to eukaryotic cells, serum resistance, and antibiotic susceptibility tests were performed in A. baumannii 17978 and its derivative knockout and complementation strains. The bfmS knockout displayed a reduction in biofilm formation, loss of adherence to eukaryotic cells, and greater sensitivity to serum killing compared with the parent strain. Proteomic analysis of culture supernatants revealed that the release of outer membrane proteins (Omps), including CarO and outer membrane protein A (OmpA), was associated with the inactivation of BfmS in A. baumannii. This study is the first to demonstrate that the pathway regulated by the sensor kinase BfmS is associated with biofilm formation, adherence to biotic surfaces, serum resistance, and antibiotic susceptibility, which may be associated with the release of Omps in A. baumannii. Copyright © 2013. Published by Elsevier B.V.

  2. Synergistic effects of ethnomedicinal plants of Apocynaceae family and antibiotics against clinical isolates of Acinetobacter baumannii.


    Chusri, Sasitorn; Siriyong, Thanyaluck; Na-Phatthalung, Pinanong; Voravuthikunchai, Supayang Piyawan


    To investigate the efficacy of 17 ethnomedicinal plants belonging to Apocynaceae family used in combination with 16 conventional antibiotics against non-multidrug resistant-, multidrug resistant (MDR)-, and extensive drug resistant (XDR) Acinetobacter baumannii (A. baumannii). Antibacterial activity and resistance modifying ability of 272 combinations were determined by growth inhibition assays and further confirmed by time-kill assay. Among the combinations of the antibiotics with Apocynaceae ethanol extracts on this pathogen, 15 (5%) had synergistic effects, 23 (8%) had partial synergistic effects and 234 (86%) had no effects. Synergistic activity was observed mostly when the Apocynaceae extracts were combined with rifampicin or cefazolin. Interestingly, 10 out of 17 combinations between the extracts and rifampicin displayed synergistic or partial synergistic behaviors. Holarrhena antidysenterica extract was additionally tested to restore rifampicin activity against clinical isolates of MDR and XDR A. baumannii. With respect to total or partial synergy, 70% was XDR A. baumannii isolates and 66% was MDR A. baumannii isolates. Holarrhena antidysenterica extract clearly demonstrated the ability to restore rifampicin activity against both A. baumannii ATCC19606 and clinically isolated A. baumannii. Additional studies examining its active principles as well as mechanisms of actions such as the effects on efflux pumps and outer membrane permeability alterations are recommended. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  3. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.


    Miyasaki, Yoko; Rabenstein, John D; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M; Kittell, Patricia Emmett; Morgan, Margie A; Nichols, Wesley Stephen; Van Benschoten, M M; Hardy, William David; Liu, George Y


    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii.

  4. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

    PubMed Central

    Durn, Goran; Goic-Barisic, Ivana; Kovacic, Ana


    Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol. PMID:24584245

  5. Emergence of extensively drug-resistant OXA-72-producing Acinetobacter baumannii in Recife, Brazil: risk of clonal dissemination?


    de Sá Cavalcanti, Felipe Lira; Almeida, Anna Carolina Soares; Vilela, Marinalda Anselmo; de Morais Junior, Marcos Antonio; de Morais, Marcia Maria Camargo; Leal-Balbino, Tereza Cristina


    Two new examples of OXA-72-producing Acinetobacter baumannii isolate resistant to a broad spectrum of antimicrobials, but not polymyxin B, have been identified in Recife, Brazil. Molecular typing indicated a close genetic link with the OXA-72-producing A. baumannii previously isolated in São Paulo, suggesting the possibility of clonal dissemination within the country.

  6. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422)

    PubMed Central

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago


    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  7. Comparative Activities of Ciprofloxacin, Clinafloxacin, Gatifloxacin, Gemifloxacin, Levofloxacin, Moxifloxacin, and Trovafloxacin against Epidemiologically Defined Acinetobacter baumannii Strains

    PubMed Central

    Heinemann, Barbara; Wisplinghoff, Hilmar; Edmond, Michael; Seifert, Harald


    In vitro activities of seven fluoroquinolones against 140 clinical Acinetobacter baumannii isolates representing 138 different strain types were determined. The rank order of activity was clinafloxacin > gatifloxacin > levofloxacin > trovafloxacin > gemifloxacin = moxifloxacin > ciprofloxacin. The 31 outbreak-related A. baumannii strains were significantly more resistant than were 109 sporadic strains. PMID:10898706

  8. Rapid discrimination of Acinetobacter baumannii international clone II lineage by pyrosequencing SNP analyses of bla(OXA-51-like) genes.


    Matsui, Mari; Suzuki, Satowa; Suzuki, Masato; Arakawa, Yoshichika; Shibayama, Keigo


    We found that Acinetobacter baumannii international clone II generally possesses unique GTA sequence at nucleotide positions 106-108 in the bla(OXA-51-like) genes. We exploited this to develop an easy and rapid method for discrimination of international clone II from other A. baumannii by employing pyrosequencing analyses of single nucleotide polymorphisms.

  9. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Ramage, Elizabeth; Weiss, Eli J.; Radey, Matthew; Hayden, Hillary S.; Held, Kiara G.; Huse, Holly K.; Zurawski, Daniel V.; Brittnacher, Mitchell J.; Manoil, Colin


    ABSTRACT Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCE Acinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains. PMID:25845845

  10. Prevalence of digestive tract colonization of carbapenem-resistant Acinetobacter baumannii in hospitals in Saudi Arabia.


    Aljindan, Reem; Bukharie, Huda; Alomar, Amer; Abdalhamid, Baha


    Carbapenem-resistant Acinetobacter baumannii is a major health problem worldwide, especially in intensive care units (ICUs). This study aimed to detect the prevalence of A. baumannii colonization of the gastrointestinal tract of patients admitted to the ICU in two hospitals in Saudi Arabia. In addition, it aimed to characterize the molecular mechanisms of carbapenem resistance in these isolates. From January to June 2014, 565 rectal swab specimens were screened for Acinetobacer strains and carbapenem resistance using CHROMagar Acinetobacter and CHROMagar KPC agar plates, respectively. Organism identification and susceptibility were detected using the Vitek 2 system. A total of 47 Acinetobacter spp. were detected, and 35 were resistant to carbapenem, making the prevalence of Acinetobacter spp. 8.3% (47/565) and carbapenem resistance (6.2%, 35/565). The 47 strains showed remarkable clonal diversity as revealed by PFGE. Using PCR, OXA-51, a chromosomal marker for A. baumannii, was detected in 46 strains. OXA-23 β-lactamase was detected in all 35 carbapenem-resistant A. baumannii. No IMP, VIM, SPM, SIM, GIM, KPC or NDM β-lactamases were detected in these isolates. Thus, OXA-23 was the main mechanism of carbapenem resistance in these isolates. To the best of our knowledge, this is the first study to detect the prevalence of Acinetobacter colonization in the digestive tract of ICU patients in Saudi Arabia. This study revealed the importance of having well-established protocols for early identification of these multidrug-resistant organisms, optimizing infection-control strategies and having active surveillance studies to reduce morbidity, mortality and cost.

  11. In vitro and in vivo activities of E-101 solution against Acinetobacter baumannii isolates from U.S. military personnel.


    Denys, G A; Davis, J C; O'Hanley, P D; Stephens, J T


    We evaluated the in vitro and in vivo activity of a novel topical myeloperoxidase-mediated antimicrobial, E-101 solution, against 5 multidrug-resistant Acinetobacter baumannii isolates recovered from wounded American soldiers. Time-kill studies demonstrated rapid bactericidal activity against all A. baumannii strains tested in the presence of 3% blood. The in vitro bactericidal activity of E-101 solution against A. baumannii strains was confirmed in a full-thickness excision rat model. Additional in vivo studies appear warranted.

  12. High Frequency of OXA-253-Producing Acinetobacter baumannii in Different Hospitals in Recife, Brazil.


    de Sá Cavalcanti, Felipe Lira; Mendes-Marques, Carina Lucena; Vasconcelos, Crhisllane Rafaele Dos Santos; de Lima Campos, Túlio; Rezende, Antonio Mauro; Xavier, Danilo Elias; Leal, Nilma Cintra; de-Melo-Neto, Osvaldo Pompilio; de Morais, Marcia Maria Camargo; Leal-Balbino, Tereza Cristina


    Here, we report the isolation of 31 Acinetobacter baumannii strains producing OXA-253 in a single large Brazilian city. These strains belonged to five different sequence types (STs), including 4 STs not previously associated with blaOXA-253 In all strains, the blaOXA-253 gene was located in a plasmid within a genetic environment similar to what was found previously in Brazil and Italy. The reported data emphasize the successful transmission of the blaOXA-253 gene through a large area and the tendency for this resistance determinant to remain in the A. baumannii population.

  13. The effect of terminal cleaning on environmental contamination rates of multidrug-resistant Acinetobacter baumannii.


    Strassle, Paula; Thom, Kerri A; Johnson, J Kristie; Johnsonm, J Kristie; Leekha, Surbhi; Lissauer, Matthew; Zhu, Jingkun; Harris, Anthony D


    We evaluated the prevalence of multidrug-resistant Acinetobacter baumannii environmental contamination before and after discharge cleaning in rooms of infected/colonized patients. 46.9% of rooms and 15.3% of sites were found contaminated precleaning, and 25% of rooms and 5.5% of sites were found contaminated postcleaning. Cleaning significantly decreased environmental contamination of A baumannii; however, persistent contamination represents a significant risk factor for transmission. Further studies on this and more effective cleaning methods are needed.

  14. High Frequency of OXA-253-Producing Acinetobacter baumannii in Different Hospitals in Recife, Brazil

    PubMed Central

    de Sá Cavalcanti, Felipe Lira; Mendes-Marques, Carina Lucena; Vasconcelos, Crhisllane Rafaele dos Santos; de Lima Campos, Túlio; Rezende, Antonio Mauro; Xavier, Danilo Elias; Leal, Nilma Cintra; de-Melo-Neto, Osvaldo Pompilio; de Morais, Marcia Maria Camargo


    ABSTRACT Here, we report the isolation of 31 Acinetobacter baumannii strains producing OXA-253 in a single large Brazilian city. These strains belonged to five different sequence types (STs), including 4 STs not previously associated with blaOXA-253. In all strains, the blaOXA-253 gene was located in a plasmid within a genetic environment similar to what was found previously in Brazil and Italy. The reported data emphasize the successful transmission of the blaOXA-253 gene through a large area and the tendency for this resistance determinant to remain in the A. baumannii population. PMID:27855080

  15. Inhibition of LpxC Increases Antibiotic Susceptibility in Acinetobacter baumannii

    PubMed Central

    García-Quintanilla, Meritxell; Caro-Vega, José M.; Pulido, Marina R.; Moreno-Martínez, Patricia; Pachón, Jerónimo


    LpxC inhibitors have generally shown poor in vitro activity against Acinetobacter baumannii. We show that the LpxC inhibitor PF-5081090 inhibits lipid A biosynthesis, as determined by silver staining and measurements of endotoxin levels, and significantly increases cell permeability. The presence of PF-5081090 at 32 mg/liter increased susceptibility to rifampin, vancomycin, azithromycin, imipenem, and amikacin but had no effect on susceptibility to ciprofloxacin and tigecycline. Potentiating existing antibiotics with LpxC inhibitors may represent an alternative treatment strategy for multidrug-resistant A. baumannii. PMID:27270288

  16. Complexity of Complement Resistance Factors Expressed by Acinetobacter baumannii Needed for Survival in Human Serum.


    Sanchez-Larrayoz, Amaro F; Elhosseiny, Noha M; Chevrette, Marc G; Fu, Yang; Giunta, Peter; Spallanzani, Raúl G; Ravi, Keerthikka; Pier, Gerald B; Lory, Stephen; Maira-Litrán, Tomás


    Acinetobacter baumannii is a bacterial pathogen with increasing impact in healthcare settings, due in part to this organism's resistance to many antimicrobial agents, with pneumonia and bacteremia as the most common manifestations of disease. A significant proportion of clinically relevant A. baumannii strains are resistant to killing by normal human serum (NHS), an observation supported in this study by showing that 12 out of 15 genetically diverse strains of A. baumannii are resistant to NHS killing. To expand our understanding of the genetic basis of A. baumannii serum resistance, a transposon (Tn) sequencing (Tn-seq) approach was used to identify genes contributing to this trait. An ordered Tn library in strain AB5075 with insertions in every nonessential gene was subjected to selection in NHS. We identified 50 genes essential for the survival of A. baumannii in NHS, including already known serum resistance factors, and many novel genes not previously associated with serum resistance. This latter group included the maintenance of lipid asymmetry genetic pathway as a key determinant in protecting A. baumannii from the bactericidal activity of NHS via the alternative complement pathway. Follow-up studies validated the role of eight additional genes identified by Tn-seq in A. baumannii resistance to killing by NHS but not by normal mouse serum, highlighting the human species specificity of A. baumannii serum resistance. The identification of a large number of genes essential for serum resistance in A. baumannii indicates the degree of complexity needed for this phenotype, which might reflect a general pattern that pathogens rely on to cause serious infections. Copyright © 2017 by The American Association of Immunologists, Inc.

  17. Acinetobacter baumannii Coordinates Urea Metabolism with Metal Import To Resist Host-Mediated Metal Limitation.


    Juttukonda, Lillian J; Chazin, Walter J; Skaar, Eric P


    During infection, bacterial pathogens must adapt to a nutrient metal-limited environment that is imposed by the host. The innate immune protein calprotectin inhibits bacterial growth in vitro by chelating the divalent metal ions zinc (Zn(2+), Zn) and manganese (Mn(2+), Mn), but pathogenic bacteria are able to cause disease in the presence of this antimicrobial protein in vivo. One such pathogen is Acinetobacter baumannii, a Gram-negative bacterium that causes pneumonia and bloodstream infections that can be complicated by resistance to multiple antibiotics. A. baumannii inhibition by calprotectin is dependent on calprotectin Mn binding, but the mechanisms employed by A. baumannii to overcome Mn limitation have not been identified. This work demonstrates that A. baumannii coordinates transcription of an NRAMP family Mn transporter and a urea carboxylase to resist the antimicrobial activities of calprotectin. This NRAMP family transporter facilitates Mn accumulation and growth of A. baumannii in the presence of calprotectin. A. baumannii is found to utilize urea as a sole nitrogen source, and urea utilization requires the urea carboxylase encoded in an operon with the NRAMP family transporter. Moreover, urea carboxylase activity is essential for calprotectin resistance in A. baumannii Finally, evidence is provided that this system combats calprotectin in vivo, as deletion of the transporter impairs A. baumannii fitness in a mouse model of pneumonia, and this fitness defect is modulated by the presence of calprotectin. These findings reveal that A. baumannii has evolved mechanisms to subvert host-mediated metal sequestration and they uncover a connection between metal starvation and metabolic stress.

  18. Acinetobacter baumannii Coordinates Urea Metabolism with Metal Import To Resist Host-Mediated Metal Limitation

    PubMed Central

    Juttukonda, Lillian J.; Chazin, Walter J.


    ABSTRACT During infection, bacterial pathogens must adapt to a nutrient metal-limited environment that is imposed by the host. The innate immune protein calprotectin inhibits bacterial growth in vitro by chelating the divalent metal ions zinc (Zn2+, Zn) and manganese (Mn2+, Mn), but pathogenic bacteria are able to cause disease in the presence of this antimicrobial protein in vivo. One such pathogen is Acinetobacter baumannii, a Gram-negative bacterium that causes pneumonia and bloodstream infections that can be complicated by resistance to multiple antibiotics. A. baumannii inhibition by calprotectin is dependent on calprotectin Mn binding, but the mechanisms employed by A. baumannii to overcome Mn limitation have not been identified. This work demonstrates that A. baumannii coordinates transcription of an NRAMP family Mn transporter and a urea carboxylase to resist the antimicrobial activities of calprotectin. This NRAMP family transporter facilitates Mn accumulation and growth of A. baumannii in the presence of calprotectin. A. baumannii is found to utilize urea as a sole nitrogen source, and urea utilization requires the urea carboxylase encoded in an operon with the NRAMP family transporter. Moreover, urea carboxylase activity is essential for calprotectin resistance in A. baumannii. Finally, evidence is provided that this system combats calprotectin in vivo, as deletion of the transporter impairs A. baumannii fitness in a mouse model of pneumonia, and this fitness defect is modulated by the presence of calprotectin. These findings reveal that A. baumannii has evolved mechanisms to subvert host-mediated metal sequestration and they uncover a connection between metal starvation and metabolic stress. PMID:27677795

  19. Role of macrophages in early host resistance to respiratory Acinetobacter baumannii infection.


    Qiu, Hongyu; KuoLee, Rhonda; Harris, Greg; Van Rooijen, Nico; Patel, Girishchandra B; Chen, Wangxue


    Acinetobacter baumannii is an emerging bacterial pathogen that causes nosocomial pneumonia and other infections. Although it is recognized as an increasing threat to immunocompromised patients, the mechanism of host defense against A. baumannii infection remains poorly understood. In this study, we examined the potential role of macrophages in host defense against A. baumannii infection using in vitro macrophage culture and the mouse model of intranasal (i.n.) infection. Large numbers of A. baumannii were taken up by alveolar macrophages in vivo as early as 4 h after i.n. inoculation. By 24 h, the infection induced significant recruitment and activation (enhanced expression of CD80, CD86 and MHC-II) of macrophages into bronchoalveolar spaces. In vitro cell culture studies showed that A. baumannii were phagocytosed by J774A.1 (J774) macrophage-like cells within 10 minutes of co-incubation, and this uptake was microfilament- and microtubule-dependent. Moreover, the viability of phagocytosed bacteria dropped significantly between 24 and 48 h after co-incubation. Infection of J774 cells by A. baumannii resulted in the production of large amounts of proinflammatory cytokines and chemokines, and moderate amounts of nitric oxide (NO). Prior treatment of J774 cells with NO inhibitors significantly suppressed their bactericidal efficacy (P<0.05). Most importantly, in vivo depletion of alveolar macrophages significantly enhanced the susceptibility of mice to i.n. A. baumannii challenge (P<0.01). These results indicate that macrophages may play an important role in early host defense against A. baumannii infection through the efficient phagocytosis and killing of A. baumannii to limit initial pathogen replication and the secretion of proinflammatory cytokines and chemokines for the rapid recruitment of other innate immune cells such as neutrophils.

  20. Characterisation and genome sequence of the lytic Acinetobacter baumannii bacteriophage vB_AbaS_Loki.


    Turner, Dann; Wand, Matthew E; Briers, Yves; Lavigne, Rob; Sutton, J Mark; Reynolds, Darren M


    Acinetobacter baumannii has emerged as an important nosocomial pathogen in healthcare and community settings. While over 100 of Acinetobacter phages have been described in the literature, relatively few have been sequenced. This work describes the characterisation and genome annotation of a new lytic Acinetobacter siphovirus, vB_AbaS_Loki, isolated from activated sewage sludge. Sequencing revealed that Loki encapsulates a 41,308 bp genome, encoding 51 predicted open reading frames. Loki is most closely related to Acinetobacter phage IME_AB3 and more distantly related to Burkholderia phage KL1, Paracoccus phage vB_PmaS_IMEP1 and Pseudomonas phages vB_Pae_Kakheti25, vB_PaeS_SCH_Ab26 and PA73. Loki is characterised by a narrow host range, among the 40 Acinetobacter isolates tested, productive infection was only observed for the propagating host, A. baumannii ATCC 17978. Plaque formation was found to be dependent upon the presence of Ca2+ ions and adsorption to host cells was abolished upon incubation with a mutant of ATCC 17978 encoding a premature stop codon in lpxA. The complete genome sequence of vB_AbaS_Loki was deposited in the European Nucleotide Archive (ENA) under the accession number LN890663.

  1. Characterisation and genome sequence of the lytic Acinetobacter baumannii bacteriophage vB_AbaS_Loki

    PubMed Central

    Wand, Matthew E.; Briers, Yves; Lavigne, Rob; Sutton, J. Mark; Reynolds, Darren M.


    Acinetobacter baumannii has emerged as an important nosocomial pathogen in healthcare and community settings. While over 100 of Acinetobacter phages have been described in the literature, relatively few have been sequenced. This work describes the characterisation and genome annotation of a new lytic Acinetobacter siphovirus, vB_AbaS_Loki, isolated from activated sewage sludge. Sequencing revealed that Loki encapsulates a 41,308 bp genome, encoding 51 predicted open reading frames. Loki is most closely related to Acinetobacter phage IME_AB3 and more distantly related to Burkholderia phage KL1, Paracoccus phage vB_PmaS_IMEP1 and Pseudomonas phages vB_Pae_Kakheti25, vB_PaeS_SCH_Ab26 and PA73. Loki is characterised by a narrow host range, among the 40 Acinetobacter isolates tested, productive infection was only observed for the propagating host, A. baumannii ATCC 17978. Plaque formation was found to be dependent upon the presence of Ca2+ ions and adsorption to host cells was abolished upon incubation with a mutant of ATCC 17978 encoding a premature stop codon in lpxA. The complete genome sequence of vB_AbaS_Loki was deposited in the European Nucleotide Archive (ENA) under the accession number LN890663. PMID:28207864

  2. Translation Elongation Factor Tuf of Acinetobacter baumannii Is a Plasminogen-Binding Protein

    PubMed Central

    Koenigs, Arno; Zipfel, Peter F.; Kraiczy, Peter


    Acinetobacter baumannii is an important nosocomial pathogen, causing a variety of opportunistic infections of the skin, soft tissues and wounds, urinary tract infections, secondary meningitis, pneumonia and bacteremia. Over 63% of A. baumannii infections occurring in the United States are caused by multidrug resistant isolates, and pan-resistant isolates have begun to emerge that are resistant to all clinically relevant antibiotics. The complement system represents the first line of defense against invading pathogens. However, many A. baumannii isolates, especially those causing severe bacteremia are resistant to complement-mediated killing, though the underlying mechanisms remain poorly understood. Here we show for the first time that A. baumannii binds host-derived plasminogen and we identify the translation elongation factor Tuf as a moonlighting plasminogen-binding protein that is exposed on the outer surface of A. baumannii. Binding of plasminogen to Tuf is at least partly dependent on lysine residues and ionic interactions. Plasminogen, once bound to Tuf can be converted to active plasmin and proteolytically degrade fibrinogen as well as the key complement component C3b. Thus, Tuf acts as a multifunctional protein that may contribute to virulence of A. baumannii by aiding in dissemination and evasion of the complement system. PMID:26230848

  3. Unique Structural Modifications Are Present in the Lipopolysaccharide from Colistin-Resistant Strains of Acinetobacter baumannii

    PubMed Central

    Pelletier, Mark R.; Casella, Leila G.; Jones, Jace W.; Adams, Mark D.; Zurawski, Daniel V.; Hazlett, Karsten R. O.; Doi, Yohei


    Acinetobacter baumannii is a nosocomial opportunistic pathogen that can cause severe infections, including hospital-acquired pneumonia, wound infections, and sepsis. Multidrug-resistant (MDR) strains are prevalent, further complicating patient treatment. Due to the increase in MDR strains, the cationic antimicrobial peptide colistin has been used to treat A. baumannii infections. Colistin-resistant strains of A. baumannii with alterations to the lipid A component of lipopolysaccharide (LPS) have been reported; specifically, the lipid A structure was shown to be hepta-acylated with a phosphoethanolamine (pEtN) modification present on one of the terminal phosphate residues. Using a tandem mass spectrometry platform, we provide definitive evidence that the lipid A isolated from colistin-resistant A. baumannii MAC204 LPS contains a novel structure corresponding to a diphosphoryl hepta-acylated lipid A structure with both pEtN and galactosamine (GalN) modifications. To correlate our structural studies with clinically relevant samples, we characterized colistin-susceptible and -resistant isolates obtained from patients. These results demonstrated that the clinical colistin-resistant isolate had the same pEtN and GalN modifications as those seen in the laboratory-adapted A. baumannii strain MAC204. In summary, this work has shown complete structure characterization including the accurate assignment of acylation, phosphorylation, and glycosylation of lipid A from A. baumannii, which are important for resistance to colistin. PMID:23877686

  4. OmpW is a potential target for eliciting protective immunity against Acinetobacter baumannii infections.


    Huang, Weiwei; Wang, Shijie; Yao, Yufeng; Xia, Ye; Yang, Xu; Long, Qiong; Sun, Wenjia; Liu, Cunbao; Li, Yang; Ma, Yanbing


    Acinetobacter baumannii (A. baumannii) is an important conditioned pathogen that causes nosocomial and community-associated infections. In this study, we sought to investigate whether outer membrane protein W (OmpW) is a potential target for eliciting protective immunity against A. baumannii infections. Mice immunized with the fusion protein thioredoxin-OmpW generated strong OmpW-specific IgG responses. In a sepsis model, both active and passive immunizations against OmpW effectively protected mice from A. baumannii infections. This protection was demonstrated by a significantly improved survival rate, reduced bacterial burdens within organs, and the suppressed accumulation of inflammatory cytokines and chemokines in sera. Opsonophagocytic assays with murine macrophage RAW264.7 cells indicated that the bactericidal effects of the antisera derived from the immunized mice are mediated synergistically by specific antibodies and complement components. The antisera presented significant opsonophagocytic activities against homologous strains and clonally distinct clinical isolates in vitro. Protein data analysis showed that the sequence of OmpW, which has a molecule length of 183 amino acids, is more than 91% conserved in reported A. baumannii strains. In conclusion, we identified OmpW as a highly immunogenic and conserved protein as a valuable antigen candidate for the development of an effective vaccine or the preparation of antisera to control A. baumannii infections.

  5. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.


    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi


    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates.

  6. Impact of Acinetobacter baumannii superoxide dismutase on motility, virulence, oxidative stress resistance and susceptibility to antibiotics.


    Heindorf, Magdalena; Kadari, Mahendar; Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried


    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii.

  7. Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

    PubMed Central

    Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried


    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii. PMID:25000585

  8. The contribution of nutrient metal acquisition and metabolism to Acinetobacter baumannii survival within the host

    PubMed Central

    Mortensen, Brittany L.; Skaar, Eric P.


    Acinetobacter baumannii is a significant contributor to intensive care unit (ICU) mortality causing numerous types of infection in this susceptible ICU population, most notably ventilator-associated pneumonia. The substantial disease burden attributed to A. baumannii and the rapid acquisition of antibiotic resistance make this bacterium a serious health care threat. A. baumannii is equipped to tolerate the hostile host environment through modification of its metabolism and nutritional needs. Among these adaptations is the evolution of mechanisms to acquire nutrient metals that are sequestered by the host as a defense against infection. Although all bacteria require nutrient metals, there is diversity in the particular metal needs among species and within varying tissue types and bacterial lifecycles. A. baumannii is well-equipped with the metal homeostatic systems required for the colonization of a diverse array of tissues. Specifically, iron and zinc homeostasis is important for A. baumannii interactions with biotic surfaces and for growth within vertebrates. This review discusses what is currently known regarding the interaction of A. baumannii with vertebrate cells with a particular emphasis on the contributions of metal homeostasis systems. Overall, published research supports the utility of exploiting these systems as targets for the development of much-needed antimicrobials against this emerging infectious threat. PMID:24377089

  9. [Prevalence of Acinetobacter baumannii carriage in patients of 53 French intensive care units on a given day].


    Chatellier, D; Burucoa, C; Pinsard, M; Frat, J-P; Robert, R


    This study was made to evaluate multiresistant Acinetobacter baumannii colonization in French intensive care units. We conducted a prevalence study on the carriage of A. baumannii for a one-day period in various French ICUs. On December 10, 2003, one nasal and/or rectal swab sampling was performed in 506 patients of 53 ICUs. Sixteen patients (3.16%) from 7 centers (13%) were colonized by A. baumannii. None of the known risk factors for colonization by multiresistant A. baumannii were identified in these patients. Overall, A. baumannii colonization is limited except during epidemic situations. Our study reflects the carriage of A. baumannii in ICUs on a given day. This study showed that there was no multiresistant A. baumannii epidemic clone, potentially responsible for outbreaks, present in the tested French ICUs.

  10. Factors associated with recovery of Acinetobacter baumannii in a combat support hospital.


    Griffith, Matthew E; Gonzalez, Russell S; Holcomb, John B; Hospenthal, Duane R; Wortmann, Glenn W; Murray, Clinton K


    A retrospective review of hospital records for Acinetobacter baumannii infection at a US Army combat support hospital revealed a monthly infection rate ranging from 20.5 to 0 cases per 1,000 patients admitted. The rate correlated with the mean census of host-nation patients in the intensive care unit, the mean census of host-nation patients on the wards, and length of stay in the intensive care unit.

  11. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi


    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  12. Multidrug resistant Acinetobacter baumannii: a descriptive study in a city hospital

    PubMed Central


    Background Multidrug resistant Acinetobacter baumannii, (MRAB) is an important cause of hospital acquired infection. The purpose of this study is to determine the risk factors for MRAB in a city hospital patient population. Methods This study is a retrospective review of a city hospital epidemiology data base and includes 247 isolates of Acinetobacter baumannii (AB) from 164 patients. Multidrug resistant Acinetobacter baumannii was defined as resistance to more than three classes of antibiotics. Using the non-MRAB isolates as the control group, the risk factors for the acquisition of MRAB were determined. Results Of the 247 AB isolates 72% (177) were multidrug resistant. Fifty-eight percent (143/247) of isolates were highly resistant (resistant to imipenem, amikacin, and ampicillin-sulbactam). Of the 37 patients who died with Acinetobacter colonization/infection, 32 (86%) patients had the organism recovered from the respiratory tract. The factors which were found to be significantly associated (p ≤ 0.05) with multidrug resistance include the recovery of AB from multiple sites, mechanical ventilation, previous antibiotic exposure, and the presence of neurologic impairment. Multidrug resistant Acinetobacter was associated with significant mortality when compared with sensitive strains (p ≤ 0.01). When surgical patients (N = 75) were considered separately, mechanical ventilation and multiple isolates remained the factors significantly associated with the development of multidrug resistant Acinetobacter. Among surgical patients 46/75 (61%) grew a multidrug resistant strain of AB and 37/75 (40%) were resistant to all commonly used antibiotics including aminoglycosides, cephalosporins, carbepenems, extended spectrum penicillins, and quinolones. Thirty-five percent of the surgical patients had AB cultured from multiple sites and 57% of the Acinetobacter isolates were associated with a co-infecting organism, usually a Staphylococcus or Pseudomonas. As in medical

  13. Synergistic activity of coriander oil and conventional antibiotics against Acinetobacter baumannii.


    Duarte, A; Ferreira, S; Silva, F; Domingues, F C


    In this study we investigated the existence of synergistic antibacterial effect between coriander (Coriandrum sativum L.) essential oil and six different antibacterial drugs (cefoperazone, chloramphenicol, ciprofloxacin, gentamicin, tetracycline and piperacillin). The antibacterial activity of coriander oil was assessed using microdilution susceptibility testing and synergistic interaction by checkerboard assays. The association of coriander essential oil with chloramphenicol, ciprofloxacin, gentamicin and tetracycline against Acinetobacter baumannii showed in vitro effectiveness, which is an indicator of a possible synergistic interaction against two reference strains of A. baumannii (LMG 1025 and LMG 1041) (FIC index from 0.047 to 0.375). However, when tested the involvement between coriander essential oil and piperacillin or cefoperazone, the isobolograms and FIC index showed an additive interaction. The in vitro interaction could improve the antimicrobial effectiveness of ciprofloxacin, gentamicin and tetracycline and may contribute to resensitize A. baumannii to the action of chloramphenicol. Copyright © 2011 Elsevier GmbH. All rights reserved.

  14. VEB-1 Extended-Spectrum β-lactamase–producing Acinetobacter baumannii, France1

    PubMed Central

    Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice


    VEB-1 extended-spectrum β-lactamase–producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were blaVEB-1-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resistance. PMID:16965700

  15. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii

    PubMed Central

    Hasan, Tarik; Choi, Chul Hee


    Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA), L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport. PMID:25873846

  16. Attenuation of quorum sensing-mediated virulence of Acinetobacter baumannii by Glycyrrhiza glabra flavonoids.


    Bhargava, Nidhi; Singh, Sukhvinder P; Sharma, Anupam; Sharma, Prince; Capalash, Neena


    To develop an alternative quorum quenching therapy against multidrug-resistant Acinetobacter baumannii. Activity-guided partially purified fraction (F1) from Glycyrrhiza glabra significantly (p < 0.05) reduced quorum sensing regulated virulence factors of A. baumannii viz. motility, biofilm formation and production of antioxidant enzymes. Mechanistically, F1 downregulated the expression of autoinducer synthase gene, abaI, and consequently reduced (92%) the production of 3-OH-C12-HSL as determined by ESI-MS. Q-TOF and Q-TRAP analyses suggested the presence of flavonoids viz. licoricone, glycyrin and glyzarin as the active ingredients. This is the first report on quorum quenching activity of G. glabra linked to its flavonoids that downregulated the expression of abaI and attenuated quorum sensing regulated virulence of A. baumannii.

  17. Intranasal treatment with bacteriophage rescues mice from Acinetobacter baumannii-mediated pneumonia.


    Wang, Yong; Mi, Zhiqiang; Niu, Wenkai; An, Xiaoping; Yuan, Xin; Liu, Huiying; Li, Puyuan; Liu, Yannan; Feng, Yuzhong; Huang, Yong; Zhang, Xianglilan; Zhang, Zhiyi; Fan, Hang; Peng, Fan; Tong, Yigang; Bai, Changqing


    With the emergence of drug-resistant bacteria, finding alternative agents to treat antibiotic-resistant bacterial infections is imperative. A mouse pneumonia model was developed by combining cyclophosphamide pretreatment and Acinetobacter baumannii challenge, and a lytic bacteriophage was evaluated for its therapeutic efficacy in this model by examining the survival rate, bacterial load in the lung and lung pathology. Intranasal instillation with bacteriophage rescued 100% of mice following lethal challenge with A. baumannii. Phage treatment reduced bacterial load in the lung. Microcomputed tomography indicated a reduction in lung inflammation in mice given phage. This research demonstrates that intranasal application of bacteriophage is viable, and could provide complete protection from pneumonia caused by A. baumannii.

  18. Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii

    PubMed Central

    Penwell, William F.; Shapiro, Adam B.; Giacobbe, Robert A.; Gu, Rong-Fang; Gao, Ning; Thresher, Jason; McLaughlin, Robert E.; Huband, Michael D.; DeJonge, Boudewijn L. M.; Ehmann, David E.


    Sulbactam is a class A β-lactamase inhibitor with intrinsic whole-cell activity against certain bacterial species, including Acinetobacter baumannii. The clinical use of sulbactam for A. baumannii infections is of interest due to increasing multidrug resistance in this pathogen. However, the molecular drivers of its antibacterial activity and resistance determinants have yet to be precisely defined. Here we show that the antibacterial activities of sulbactam vary widely across contemporary A. baumannii clinical isolates and are mediated through inhibition of the penicillin-binding proteins (PBPs) PBP1 and PBP3, with very low frequency of resistance; the rare pbp3 mutants with high levels of resistance to sulbactam are attenuated in fitness. These results support further investigation of the potential clinical utility of sulbactam. PMID:25561334

  19. Molecular mechanisms of sulbactam antibacterial activity and resistance determinants in Acinetobacter baumannii.


    Penwell, William F; Shapiro, Adam B; Giacobbe, Robert A; Gu, Rong-Fang; Gao, Ning; Thresher, Jason; McLaughlin, Robert E; Huband, Michael D; DeJonge, Boudewijn L M; Ehmann, David E; Miller, Alita A


    Sulbactam is a class A β-lactamase inhibitor with intrinsic whole-cell activity against certain bacterial species, including Acinetobacter baumannii. The clinical use of sulbactam for A. baumannii infections is of interest due to increasing multidrug resistance in this pathogen. However, the molecular drivers of its antibacterial activity and resistance determinants have yet to be precisely defined. Here we show that the antibacterial activities of sulbactam vary widely across contemporary A. baumannii clinical isolates and are mediated through inhibition of the penicillin-binding proteins (PBPs) PBP1 and PBP3, with very low frequency of resistance; the rare pbp3 mutants with high levels of resistance to sulbactam are attenuated in fitness. These results support further investigation of the potential clinical utility of sulbactam.

  20. Outbreak of Extensively Drug-Resistant Acinetobacter baumannii Indigo-Pigmented Strains

    PubMed Central

    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Rodriguez, Rocio; Pallone, Elida; Bakai, Romina; Centrón, Daniela


    Acinetobacter baumannii pigmented strains are not common in clinical settings. Here, we report an outbreak caused by indigo-pigmented A. baumannii strains isolated in an acute care hospital in Argentina from March to September 2012. Pan-PCR assays exposed a unique pattern belonging to the recently described regional CC113B/CC79P clonal complex that confirms the relevant relationships among the indigo-pigmented A. baumannii strains. All of them were extensively drug resistant and harbored different genetic elements associated with horizontal genetic transfer, such as the transposon Tn2006, class 2 integrons, AbaR-type islands, IS125, IS26, strA, strB, florR, and the small recombinase ISCR2 associated with the sul2 gene preceded by ISAba1. PMID:23985923

  1. A milk pump as a source for spreading Acinetobacter baumannii in a neonatal intensive care unit.


    Engür, Defne; Çakmak, Bilin Çetinkaya; Türkmen, Münevver Kaynak; Telli, Murat; Eyigör, Mete; Güzünler, Melike


    Acinetobacter baumannii is a Gram-negative coccobacillus that has emerged as a troublesome pathogen causing institutional outbreaks. Environmental contamination is a distinctive characteristic of this microorganism, which brings a further difficulty in infection control. During A. baumannii outbreaks in intensive care units, a common contaminated object can be found as a reservoir. Finding out this source by epidemiological investigations is of particular importance in order to develop effective interventions. We describe an outbreak of A. baumannii and the results of epidemiological investigations in a neonatal intensive care unit. The outbreak strain was isolated from the outer surface of a breastmilk pump. We have successfully controlled the outbreak by careful reviewing of our milk collection process.

  2. Postcraniofacial trauma multidrug resistant Acinetobacter baumannii infection treated with intravenous colistin: a rare complication.


    Rastogi, Sanjay; Gupta, Anurag; Narne, Raja S; Reddy, Mahendra P; Bansal, Mansi; Kumar, Sanjeev


    Nosocomial meningitis is a rare complication of combined craniofacial and neurosurgical procedures. The increase in meningitis caused by multidrug-resistant (MDR) Acinetobacter baumannii has resulted in a significant reduction in available treatment options. We report a case of 52-year-old man who sustained a complex craniofacial trauma, who developed nosocomial MDR infection caused by A. baumannii in the wound. Patient was at significant risk of developing meningitis but, he was successfully treated with intravenous colistin. To conclude, patients with complex maxillofacial trauma are at high risk of MDR A. baumannii meningitis, especially in craniofacial intensive care units, and adequate infection control measures with proper institution of antibiotics, should be used to reduce the risk of this infection.

  3. Control of a Multi-Drug-Resistant Acinetobacter baumannii Outbreak after Orthopedics Department Relocation

    PubMed Central

    Gogou, Vasiliki; Meletis, Georgios; Tsitouras, Dimosthenis


    Acinetobacter baumannii clinical isolates have the ability to survive in the hospital niche for prolonged time periods and to develop resistance against multiple antimicrobial agents. Therefore, A. baumannii has emerged as an important cause of nosocomial outbreaks worldwide, especially in critical-care environments such as intensive care units. In the present communication, we report a multi-drug-resistant A. baumannii outbreak that occurred in an orthopedics department in Greece after the admission of a patient previously hospitalized in the intensive care unit of a Greek tertiary care hospital. Despite the implementation of infection control measures, 29 patients were infected, significantly raising their hospitalization periods and treatment costs. Interestingly, the outbreak was put under control after the department’s previously programmed relocation. PMID:27694769

  4. The secretome of Acinetobacter baumannii ATCC 17978 type II secretion system reveals a novel plasmid encoded phospholipase that could be implicated in lung colonization.


    Elhosseiny, Noha M; El-Tayeb, Ossama M; Yassin, Aymen S; Lory, Stephen; Attia, Ahmed S


    Acinetobacter baumannii infections are compounded with a striking lack of treatment options. In many Gram-negative bacteria, secreted proteins play an important early role in avoiding host defences. Typically, these proteins are targeted to the external environment or into host cells using dedicated transport systems. Despite the fact that medically relevant species of Acinetobacter possess a type II secretion system (T2SS), only recently, its significance as an important pathway for delivering virulence factors has gained attention. Using in silico analysis to characterize the genetic determinants of the T2SS, which are found clustered in other organisms, in Acinetobacter species, they appear to have a unique genetic organization and are distributed throughout the genome. When compared to other T2SS orthologs, individual components of the T2SS apparatus showed the highest similarity to those of Pseudomonas aeruginosa. A mutant of Acinetobacter baumannii strain ATCC 17978 lacking the secretin component of the T2SS (ΔgspD), together with a trans-complemented mutant, were tested in a series of in vitro and in vivo assays to determine the role of T2SS in pathogenicity. The ΔgspD mutant displayed decreased lipolytic activity, associated with attenuated colonization ability in a murine pneumonia model. These phenotypes are linked to LipAN, a novel plasmid-encoded phospholipase, identified through mass spectroscopy as a T2SS substrate. Recombinant LipAN showed specific phospholipase activity in vitro. Proteomics on the T2-dependent secretome of ATCC 17978 strain revealed its potential dedication to the secretion of a number of lipolytic enzymes, among others which could contribute to its virulence. This study highlights the role of T2SS as an active contributor to the virulence of A. baumannii potentially through secretion of a newly identified phospholipase.

  5. Development of a real-time PCR assay for the rapid detection of Acinetobacter baumannii from whole blood samples.


    De Gregorio, Eliana; Roscetto, Emanuela; Iula, Vita Dora; Martinucci, Marianna; Zarrilli, Raffaele; Di Nocera, Pier Paolo; Catania, Maria Rosaria


    Acinetobacter baumannii is a multidrug-resistant pathogen associated with severe infections in hospitalized patients, including pneumonia, urinary and bloodstream infections. Rapid detection of A. baumannii infection is crucial for timely treatment of septicemic patients. The aim of the present study was to develop a specific marker for a quantitative polymerase chain reaction (PCR) assay for the detection of A. baumannii. The target gene chosen is the biofilm-associated protein (bap) gene, encoding a cell surface protein involved in biofilm formation. The assay is specific for A. baumannii, allowing its discrimination from different species of Acinetobacter and other clinically relevant bacterial pathogens. The assay is able to detect one genomic copy of A. baumannii, corresponding to 4 fg of purified DNA, and 20 colony-forming units/ml using DNA extracted from spiked whole blood samples.

  6. In vitro and in vivo antimicrobial activities of gallium nitrate against multidrug-resistant Acinetobacter baumannii.


    Antunes, Luísa C S; Imperi, Francesco; Minandri, Fabrizia; Visca, Paolo


    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO(3))(3), the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO(3))(3) delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO(3))(3) activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO(3))(3) also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO(3))(3) inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO(3))(3) also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii.

  7. In Vitro and In Vivo Antimicrobial Activities of Gallium Nitrate against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Antunes, Luísa C. S.; Imperi, Francesco; Minandri, Fabrizia


    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO3)3, the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO3)3 delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO3)3 activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO3)3 also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO3)3 inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO3)3 also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii. PMID:22964249

  8. Screening of Herbal-Based Bioactive Extract Against Carbapenem-Resistant Strain of Acinetobacter baumannii.


    Tiwari, Monalisa; Roy, Ranita; Tiwari, Vishvanath


    Acinetobacter baumannii is grouped in the ESKAPE pathogens by Infectious Disease Society of America, which is linked to high degree of morbidity, mortality, and increased costs. The high level of acquired and intrinsic resistance mechanisms of these bacteria makes it an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In this study, methanolic extracts of six medicinal plants were subjected to phytochemical screening and their antimicrobial activity was tested against two strains of A. baumannii (ATCC 19606, carbapenem-sensitive strain, and RS 307, carbapenem-resistant strain). Synergistic effect of the plant extracts and antibiotics was also tested. Bael or Aegle marmelos contains tannin, phenol, terpenoids, glycoside, alkaloids, coumarine, steroid, and quinones. Flowers of madar or Calotropis procera possess tannin, phenol, terpenoids, glycoside, quinone, anthraquinone, anthocyanin, coumarin, and steroid. An inhibitory growth curve was seen for both the bacterial strains when treated with A. marmelos, Curcuma longa, and leaves and flowers of C. procera. Antibiotics alone showed a small zone of inhibition, but when used with herbal extracts they exhibited larger zone of inhibition. Synergistic effect of A. marmelos and imipenem was the best against both the strains of A. baumannii. From this study, it can be concluded that extracts from A. marmelos and leaves and flowers of C. procera exhibited the most effective antibacterial activity. These herbal extracts may be used to screen the bioactive compound against the carbapenem-resistant strain of A. baumannii.

  9. CipA of Acinetobacter baumannii Is a Novel Plasminogen Binding and Complement Inhibitory Protein.


    Koenigs, Arno; Stahl, Julia; Averhoff, Beate; Göttig, Stephan; Wichelhaus, Thomas A; Wallich, Reinhard; Zipfel, Peter F; Kraiczy, Peter


    Acinetobacter baumannii is an emerging opportunistic pathogen, responsible for up to 10% of gram-negative, nosocomial infections. The global increase of multidrug-resistant and pan-resistant Acinetobacter isolates presents clinicians with formidable challenges. To establish a persistent infection,A. baumannii must overcome the detrimental effects of complement as the first line of defense against invading microorganisms. However, the immune evasion principles underlying serum resistance inA. baumannii remain elusive. Here, we identified a novel plasminogen-binding protein, termed CipA. Bound plasminogen, upon conversion to active plasmin, degraded fibrinogen and complement C3b and contributed to serum resistance. Furthermore, CipA directly inhibited the alternative pathway of complement in vitro, irrespective of its ability to bind plasminogen. A CipA-deficient mutant was efficiently killed by human serum and showed a defect in the penetration of endothelial monolayers, demonstrating that CipA is a novel multifunctional protein that contributes to the pathogenesis ofA. baumannii.

  10. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen.


    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica


    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control.

  11. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen

    PubMed Central

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica


    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control. PMID:26966582

  12. Structural and bioinformatic characterization of an Acinetobacter baumannii type II carrier protein

    SciTech Connect

    Allen, C. Leigh; Gulick, Andrew M.


    The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented. Microorganisms produce a variety of natural products via secondary metabolic biosynthetic pathways. Two of these types of synthetic systems, the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), use large modular enzymes containing multiple catalytic domains in a single protein. These multidomain enzymes use an integrated carrier protein domain to transport the growing, covalently bound natural product to the neighboring catalytic domains for each step in the synthesis. Interestingly, some PKS and NRPS clusters contain free-standing domains that interact intermolecularly with other proteins. Being expressed outside the architecture of a multi-domain protein, these so-called type II proteins present challenges to understand the precise role they play. Additional structures of individual and multi-domain components of the NRPS enzymes will therefore provide a better understanding of the features that govern the domain interactions in these interesting enzyme systems. The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented here. Comparison with the closest structural homologs of other carrier proteins identifies the requirements for a conserved glycine residue and additional important sequence and structural requirements within the regions that interact with partner proteins.

  13. Phase-Variable Control of Multiple Phenotypes in Acinetobacter baumannii Strain AB5075

    PubMed Central

    Tipton, Kyle A.; Dimitrova, Daniela


    ABSTRACT Acinetobacter baumannii strain AB5075 produces colonies with two opacity phenotypes, designated opaque and translucent. These phenotypes were unstable and opaque and translucent colony variants were observed to interconvert at high frequency, suggesting that a phase-variable mechanism was responsible. The frequency of phase variation both within colonies and in broth cultures increased in a cell density-dependent manner and was mediated by the accumulation of an extracellular factor. This factor was distinct from the known A. baumannii signaling molecule 3-OH C12-homoserine lactone. Opaque and translucent colony variants exhibited a number of phenotypic differences, including cell morphology, surface motility, biofilm formation, antibiotic resistance, and virulence in a Galleria mellonella model. Additional clinical isolates exhibited a similar phase-variable control of colony opacity, suggesting that this may be a common feature of A. baumannii. IMPORTANCE A novel phase-variable mechanism has been identified in Acinetobacter baumannii that results in an interconversion between opaque and translucent colony phenotypes. This phase variation also coordinately regulates motility, cell shape, biofilm formation, antibiotic resistance, and virulence. The frequency of phase variation is increased at high cell density via a diffusible extracellular signal. To our knowledge, this report presents the first example of phase variation in A. baumannii and also the first example of quorum sensing-mediated control of phase variation in a bacterium. The findings are important, as this phase-variable mechanism can be identified only via changes in colony opacity using oblique light; therefore, many researchers studying A. baumannii may unknowingly be working with different colony variants. PMID:26013481

  14. [In vitro tigecycline and carbapenem susceptibilities of clinical Acinetobacter baumannii isolates].


    Nayman Alpat, Saygın; Aybey, Aşkın Derya; Akşit, Filiz; Ozgüneş, Ilhan; Kiremitçi, Abdurrahman; Usluer, Gaye


    Acinetobacter baumannii is a frequent cause of nosocomial infections in most hospitals. Management of infections caused by these strains is difficult, as the strains often display multiple drug resistance, including carbapenem. Tigecycline which is a glycylcycline derivative has antimicrobial activity against many gram-positive and gram-negative organisms. In this study, in vitro activity of tigecycline and carbapenems against clinical isolates of A.baumannii strains were investigated. A total of 100 A.baumannii isolates were collected from hospitalized patients with documented nosocomial infections [pneumonia (n = 39), surgical wound infection (n = 32), bacteremia (n = 16), catheter infection (n = 6), urinary tract infection (n = 5), peritonitis (n = 1), eye infection (n = 1)] between October 2006 and June 2007. Only one isolate per patient was included to the study. Minimum inhibitory concentrations (MIC) of tigecycline were determined by E-test (AB Biodisk, Sweden). Carbapenem resistance of A.baumannii strains were determined by disk diffusion method. All of the 100 A.baumannii isolates (100%) were found susceptible to tigecycline (MIC values ≤ 2 µg/ml; MIC ranges: 0.032-1.5 µg/ml). Imipenem susceptibility test was performed for 95 strains, and 36 (37.9%) were found sensitive, 18 (18.9%) were intermediate sensitive, and 41 (43.2%) were resistant. Meropenem susceptibility test was performed for 87 strains, and 22 (25.3%) were found sensitive, 9 (10.3%) were intermediate sensitive, and 56 (64.4%) were resistant. Since tigecycline is found quite effective on nosocomial A.baumannii isolates, it may be considered as a treatment alternative in infections caused by carbapenem-resistant Acinetobacter spp.

  15. Survival of Acinetobacter baumannii on dry surfaces: comparison of outbreak and sporadic isolates.


    Jawad, A; Seifert, H; Snelling, A M; Heritage, J; Hawkey, P M


    Acinetobacter spp. are important nosocomial pathogens reported with increasing frequency in outbreaks of cross-infection during the past 2 decades. The majority of such outbreaks are caused by Acinetobacter baumannii. To investigate whether desiccation tolerance may be involved in the ability of certain strains of A. baumannii to cause hospital outbreaks, a blind study was carried out with 39 epidemiologically well-characterized clinical isolates of A. baumannii for which survival times were determined under simulated hospital conditions. The survival times on glass coverslips of 22 strains isolated from eight well-defined hospital outbreaks in a German metropolitan area were compared with the survival times of 17 sporadic strains not involved in outbreaks but rather isolated from inpatients in the same geographic area. All sporadic isolates have been shown by pulsed-field gel electrophoresis to represent different strain types. There was no statistically significant difference between the survival times of sporadic strains of A. baumannii and outbreak strains (27.2 versus 26.5 days, respectively; P < or = 0.44) by the Wilcoxon-Mann-Whitney test. All investigated A. baumannii strains, irrespective of their areas of endemicity or epidemic occurrence, have the ability to survive for a long time on dry surfaces. Antimicrobial susceptibility testing showed that A. baumannii outbreak strains were significantly more resistant to various broad-spectrum antimicrobial agents than sporadic strains. Both desiccation tolerance and multidrug resistance may contribute to their maintenance in the hospital setting and may explain in part their propensity to cause prolonged outbreaks of nosocomial infection.

  16. Effect of carbonyl cyanide 3-chlorophenylhydrazone (CCCP) on killing Acinetobacter baumannii by colistin.


    Park, Young Kyoung; Ko, Kwan Soo


    We investigated the effect of cyanide 3-chlorophenylhydrazone (CCCP) and other efflux pump inhibitors (EPIs) on the colistin susceptibility in Acinetobacter baumannii. While minimum inhibitory concentrations (MICs) of colistin in all colistin-resistant strains decreased significantly with 25 μM of CCCP and 2,4-dinitrophenol (DNP), phenyl-arginine-β-naphthylamide (PAβN), and reserpine did not decrease the colistin MICs. However, CCCP and DNP as well as PAβN and reserpine did not have a significant effect on the MICs of the other agents. Efflux pump gene expressions in colistin-resistant strains were not increased compared with those in colistin-susceptible strains. When only 5X MIC of colistin (5 mg/L) was provided to a colistin-susceptible A. baumannii strain, the bacterial cell number was reduced by 9 h after exposure to colistin, but regrowth was observed. When CCCP was added to colistin, bacterial cells were completely killed after 24 to 48 h of incubation, which was not due to the toxicity of CCCP itself. Colistin resistance in A. baumannii may not be due to efflux pumps. Our present study suggests that bacterial cells with reduced metabolic activity by CCCP are more susceptible to colistin in A. baumannii. It may show the possibility that combined therapy with colistin and other antimicrobial agents could effective against A. baumannii infections.

  17. Molecular Epidemiology of Multi-Drug Resistant Acinetobacter baumannii Isolated in Shandong, China

    PubMed Central

    Jiang, Meijie; Liu, Lijuan; Ma, Yunhua; Zhang, Zhijun; Li, Ning; Zhang, Fusen; Zhao, Shuping


    Acinetobacter baumannii is an emerging nosocomial pathogen prevalent in hospitals worldwide. In order to understand the molecular epidemiology of multi-drug resistant (MDR) A. baumannii, we investigated the genotypes of A. baumannii isolated from 10 hospitals in Shandong, China, from August 2013 to December 2013, by pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Antimicrobial resistance genes were analyzed by PCR and DNA sequencing. By PFGE analysis, we discovered 11 PFGE types in these 10 hospitals. By MLST, we assigned these isolates to 12 sequence types (STs), 10 of which belong to the cloning complex CC92, including the prevalent ST369, ST208, ST195, and ST368. Two new STs, namely ST794 and ST809, were detected only in one hospital. All isolates of the MDR A. baumannii were resistant to carbapenem, except 2 isolates, which did not express the blaOXA-23 carbapenemase gene, indicating blaOXA-23 is the major player for carbapenem resistance. We also discovered armA is likely to be responsible for amikacin resistance, and may play a role in gentamicin and tobramycin resistance. aac(3)-I is another gene responsible for gentamicin and tobramycin resistance. In summary, we discovered that the majority of the isolates in Shandong, China, were the STs belonging to the CC92. Besides, two new STs were detected in one hospital. These new STs should be further investigated for prevention of outbreaks caused by A. baumannii. PMID:27818659

  18. Investigations on the genomic diversity of OXA from isolated Acinetobacter baumannii.


    Ma, Z; Zhou, L Q; Wang, H; Luo, L P


    We distinguished the four OXA-type carbapenemase subgroup alleles present in 120 strains of Acinetobacter baumannii by using polymerase chain reaction (PCR) and investigated the distributions of the OXA subgroups in clinically isolated samples. Amplification of the OXA genes blaOXA-23, blaOXA-24, blaOXA-51, and blaOXA-58 was performed by multiplex PCR. Antibiotics susceptibility test was conducted for determine the sensitivity of the A. baumannii to clinical common used antibiotics by Kirby-Bauer method. Results revealed that 46 (51.69%) of the samples were positive for only the blaOXA51 gene and 41 (46.07%) were positive for both the blaOXA51 and blaOXA58 genes in the 89 isolates of A. baumannii. Among these, 45 were carbapenem-resistant and 44 carbapenem-sensitive. Strains containing either blaOXA51 or blaOXA58 showed resistance or sensitivity to carbapenems, respectively. A. baumannii isolated from intensive care units showed significantly higher resistance rate to Cefepime, Piperacillin-tazobactam, Amikacin, Ceftazidime, Cefotaxime, Sulfamethoxazole-trimethoprim, and Gentamicin than those isolated from other departments (P < 0.05). In conclusion, we found that the presence of blaOXA-51 and blaOXA-58 appears to convey a mechanism of resistance or sensitivity to carbapenems, respectively, in A. baumannii clinical isolates.

  19. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar.


    Rolain, J-M; Loucif, L; Al-Maslamani, M; Elmagboul, E; Al-Ansari, N; Taj-Aldeen, S; Shaukat, A; Ahmedullah, H; Hamed, M


    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (bla OXA-23, bla OXA-24, bla OXA-58, bla NDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and bla OXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for bla OXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar.

  20. Prevalence of OXA-type β-lactamases among Acinetobacter baumannii isolates from Northwest of Iran.


    Sohrabi, Nasrollah; Farajnia, Safar; Akhi, Mohammad Taghi; Nahaei, Mohammad Reza; Naghili, Behrooz; Peymani, Amir; Amiri, Zohreh; Rezaee, Mohammad Ahangarzadeh; Saeedi, Nazli


    Carbapenems have been considered as last line antibiotics for treatment of multidrug-resistant (MDR) Acinetobacter baumannii but carbapenem resistant A. baumannii has been increased during the last decade in many parts of the world. OXA-type β-lactamase enzymes are the most common cause of carbapenem resistance in A. baumannii and presence of ISAba1 in upstream of these genes may increase the expression of these OXA genes. The aim of this study was to determine, for the first time, the antibiotic resistance pattern and prevalence of OXA type β-lactamases among nosocomial A. baumannii isolates from northwest of Iran. A total of 100 A. baumannii isolates were recovered from hospitalized patients in a university hospital in northwest of Iran. Sixty-two percent of isolates were resistant to imipenem. All isolates carried bla(OXA-51)-like gene. Among imipenem resistant isolates, 88.7% carried bla(OXA-23)-like, 1.6% carried bla(OXA-40)-like, and 3.2% had bla(OXA-58)-like resistance genes. Ninety percent of isolates contained ISAba1 element and in 74.2% of imipenem resistant isolates, ISAba1 was located in upstream of bla(OXA-23)-like. The results of this study demonstrated high prevalence of OXA-type carbapenemase among MDR A. bumanii in the Northwest of Iran.

  1. Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach.


    Hua, Xiaoting; Liu, Lilin; Fang, Youhong; Shi, Qiucheng; Li, Xi; Chen, Qiong; Shi, Keren; Jiang, Yan; Zhou, Hua; Yu, Yunsong


    Acinetobacter baumannii has emerged as an important opportunistic pathogen due to its ability to acquire resistance to most currently available antibiotics. Colistin is often considered as the last line of therapy for infections caused by multidrug-resistant A. baumannii (MDRAB). However, colistin-resistant A. baumannii strain has recently been reported. To explore how multiple drug-resistant A. baumannii responded to colistin resistance, we compared the genomic, transcriptional and proteomic profile of A. baumannii MDR-ZJ06 to the induced colistin-resistant strain ZJ06-200P5-1. Genomic analysis showed that lpxC was inactivated by ISAba1 insertion, leading to LPS loss. Transcriptional analysis demonstrated that the colistin-resistant strain regulated its metabolism. Proteomic analysis suggested increased expression of the RND efflux pump system and down-regulation of FabZ and β-lactamase. These alterations were believed to be response to LPS loss. In summary, the lpxC mutation not only established colistin resistance but also altered global gene expression.

  2. Contribution of EmrAB efflux pumps to colistin resistance in Acinetobacter baumannii.


    Lin, Ming-Feng; Lin, Yun-You; Lan, Chung-Yu


    Efflux pumps play an important role in antimicrobial resistance for Acinetobacter baumannii. However, the function of the Emr pump system and the relationship between Emr and drug resistance has not been characterized in A. baumannii. In this study, four possible groups of emr-like genes were found by searching a genome database. Among them, A1S_1772 (emrB) and A1S_1773 (emrA) were demonstrated to be co-transcribed as a single operon. Moreover, during osmotic stress, A1S_1772 showed the largest change in gene expression compared to the other emrB-like genes, and deletion of A1S_1772 (AB ΔemrB) significantly slowed cell growth in 20% sucrose. Using a phenotypic microarray analysis, the AB ΔemrB mutant was more susceptible to colistin and nafcillin, paromomycin, spiramycin, and D,L-serine hydroxmate than the wild type. The spot assay, time kill assay and minimal inhibition concentration determination also indicated that the wild type could tolerate colistin better than the AB ΔemrB mutant. Finally, the increased expression levels of all emrB-like genes, including A1S_0775, A1S_0909, A1S_1772, and A1S_1799, in colistin resistance-induced A. baumannii further supported the possible involvement of the emrB genes in A. baumannii colistin resistance. Together, the Emr pump systems in A. baumannii contribute to adaptation to osmotic stress and resistance to colistin.

  3. Widespread dispersion of the resistance element tet(B)::ISCR2 in XDR Acinetobacter baumannii isolates.


    Vilacoba, E; Almuzara, M; Gulone, L; Traglia, G M; Montaña, S; Rodríguez, H; Pasteran, F; Pennini, M; Sucari, A; Gómez, N; Fernández, A; Centrón, D; Ramírez, M S


    Acinetobacter baumannii is a significant nosocomial pathogen often associated with extreme drug resistance (XDR). In Argentina, isolates of A. baumannii resistant to tetracyclines have accounted for more than 40% of drug-resistant isolates in some hospitals. We have previously reported the dispersion of the tet(B) resistance element associated with the ISCR2 transposase in epidemiologically unrelated A. baumannii isolates recovered from 1983 to 2011. This study extends this surveillance to 77 recent (2009-2013) XDR A. baumannii isolates with different levels of minocycline susceptibility. Isolates were examined by a pan-PCR assay, which showed six different amplification patterns, and specific PCRs were used for the confirmation of the the ΔISCR2-tet(B)-tet(R)-ISCR2 element. The tet(B) gene was present in 66 isolates and the ISCR2 element in 68 isolates; the tet(B) gene was associated with ISCR2 in all tet(B)-positive isolates. We conclude that this element is widespread in XDR A. baumannii isolates from Argentina and could be responsible for the emergence of tetracycline resistance in recent years.

  4. Antibiotic Resistance Determinant-Focused Acinetobacter baumannii Vaccine Designed Using Reverse Vaccinology

    PubMed Central

    Ni, Zhaohui; Chen, Yan; Ong, Edison; He, Yongqun


    As one of the most influential and troublesome human pathogens, Acinetobacter baumannii (A. baumannii) has emerged with many multidrug-resistant strains. After collecting 33 complete A. baumannii genomes and 84 representative antibiotic resistance determinants, we used the Vaxign reverse vaccinology approach to predict classical type vaccine candidates against A. baumannii infections and new type vaccine candidates against antibiotic resistance. Our genome analysis identified 35 outer membrane or extracellular adhesins that are conserved among all 33 genomes, have no human protein homology, and have less than 2 transmembrane helices. These 35 antigens include 11 TonB dependent receptors, 8 porins, 7 efflux pump proteins, and 2 fimbrial proteins (FilF and CAM87009.1). CAM86003.1 was predicted to be an adhesin outer membrane protein absent from 3 antibiotic-sensitive strains and conserved in 21 antibiotic-resistant strains. Feasible anti-resistance vaccine candidates also include one extracellular protein (QnrA), 3 RND type outer membrane efflux pump proteins, and 3 CTX-M type β-lactamases. Among 39 β-lactamases, A. baumannii CTX-M-2, -5, and -43 enzymes are predicted as adhesins and better vaccine candidates than other β-lactamases to induce preventive immunity and enhance antibiotic treatments. This report represents the first reverse vaccinology study to systematically predict vaccine antigen candidates against antibiotic resistance for a microbial pathogen. PMID:28230771

  5. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications

    PubMed Central

    Thi Khanh Nhu, Nguyen; Riordan, David W.; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W.; Baker, Stephen; Stabler, Richard A


    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  6. Antibiotic Resistance Determinant-Focused Acinetobacter baumannii Vaccine Designed Using Reverse Vaccinology.


    Ni, Zhaohui; Chen, Yan; Ong, Edison; He, Yongqun


    As one of the most influential and troublesome human pathogens, Acinetobacter baumannii (A. baumannii) has emerged with many multidrug-resistant strains. After collecting 33 complete A. baumannii genomes and 84 representative antibiotic resistance determinants, we used the Vaxign reverse vaccinology approach to predict classical type vaccine candidates against A. baumannii infections and new type vaccine candidates against antibiotic resistance. Our genome analysis identified 35 outer membrane or extracellular adhesins that are conserved among all 33 genomes, have no human protein homology, and have less than 2 transmembrane helices. These 35 antigens include 11 TonB dependent receptors, 8 porins, 7 efflux pump proteins, and 2 fimbrial proteins (FilF and CAM87009.1). CAM86003.1 was predicted to be an adhesin outer membrane protein absent from 3 antibiotic-sensitive strains and conserved in 21 antibiotic-resistant strains. Feasible anti-resistance vaccine candidates also include one extracellular protein (QnrA), 3 RND type outer membrane efflux pump proteins, and 3 CTX-M type β-lactamases. Among 39 β-lactamases, A. baumannii CTX-M-2, -5, and -43 enzymes are predicted as adhesins and better vaccine candidates than other β-lactamases to induce preventive immunity and enhance antibiotic treatments. This report represents the first reverse vaccinology study to systematically predict vaccine antigen candidates against antibiotic resistance for a microbial pathogen.

  7. Management of an Acinetobacter baumannii outbreak in an intensive care unit.


    Tanguy, M; Kouatchet, A; Tanguy, B; Pichard, É; Fanello, S; Joly-Guillou, M-L


    Acinetobacter baumannii is a ubiquitous pathogen resistant to desiccation and responsible for healthcare-associated infections (HAI), especially in intensive care units (ICU) where it is responsible for 5-10% of HAIs. An A. baumannii outbreak occurred in the ICU of the University Hospital of Angers, France. To describe the A. baumannii outbreak and to evaluate the control measures taken. The secondary objective was to evaluate the impact of the electronic alert system on the incidence of multidrug resistance to antibiotics. We performed a descriptive study of A. baumannii carriers during the outbreak. Case contacts and carriers were described using the epidemic curve and a case synopsis table. From August 2011 to September 2013, 49 patients presenting with an extended-spectrum beta-lactamase-producing A. baumannii infection were identified: thirty-four were colonized and 15 were infected. No death was due to the outbreak. Measures taken were: geographical and technical isolation of patients, dedicated team implementation, contact precaution implementation including hand hygiene measures, appropriate use of gloves, and reinforcement of bio-cleaning procedures. Some patients were re-admitted to hospital while still being carriers; this could explain epidemic peaks. The immersion mission of the hygiene nurse contributed to answering healthcare workers' queries and led to a better cooperation between the ICU and the hygiene team. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Characterization of the Acinetobacter baumannii growth phase-dependent and serum responsive transcriptomes.


    Jacobs, Anna C; Sayood, Khalid; Olmsted, Stephen B; Blanchard, Catlyn E; Hinrichs, Steven; Russell, David; Dunman, Paul M


    Acinetobacter baumannii has emerged as a bacterial pathogen of considerable healthcare concern. Yet, little is known about the organism's basic biological processes and the regulatory networks that modulate expression of its virulence factors and antibiotic resistance. Using Affymetrix GeneChips , we comprehensively defined and compared the transcriptomes of two A. baumannii strains, ATCC 17978 and 98-37-09, during exponential and stationary phase growth in Luria-Bertani (LB) medium. Results revealed that in addition to expected growth phase-associated metabolic changes, several putative virulence factors were dramatically regulated in a growth phase-dependent manner. Because a common feature between the two most severe types of A. baumannii infection, pneumonia and septicemia, includes the organism's dissemination to visceral organs via the circulatory system, microarray studies were expanded to define the expression properties of A. baumannii during growth in human serum. Growth in serum significantly upregulated iron acquisition systems, genes associated with epithelial cell adherence and DNA uptake, as well as numerous putative drug efflux pumps. Antibiotic susceptibility testing verified that the organism exhibits increased antibiotic tolerance when cultured in human serum, as compared to LB medium. Collectively, these studies provide researchers with a comprehensive database of A. baumannii's expression properties in LB medium and serum and identify biological processes that may contribute to the organism's virulence and antibiotic resistance.

  9. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii

    PubMed Central

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong


    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs–antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  10. Modeling the impact of interventions against Acinetobacter baumannii transmission in intensive care units.


    Doan, Tan N; Kong, David C M; Marshall, Caroline; Kirkpatrick, Carl M J; McBryde, Emma S


    The efficacy of infection control interventions against Acinetobacter baumannii remains unclear, despite such information being critical for effective prevention of the transmission of this pathogen. Mathematical modeling offers an alternative to clinical trials, which may be prohibitively expensive, unfeasible or unethical, in predicting the impact of interventions. Furthermore, it allows the ability to ask key "what if" questions to evaluate which interventions have the most impact. We constructed a transmission dynamic model to quantify the effects of interventions on reducing A. baumannii prevalence and the basic reproduction ratio (R0) in intensive care units (ICUs). We distinguished between colonization and infection, and incorporated antibiotic exposure and transmission from free-living bacteria in the environment. Under the assumptions and parameterization in our model, 25% and 18% of patients are colonized and infected with A. baumannii, respectively; and R0 is 1.4. Improved compliance with hand hygiene (≥87%), enhanced environmental cleaning, reduced length of ICU stay of colonized patients (≤ 10 days), shorter durations of antibiotic treatment of A. baumannii (≤6 days), and isolation of infected patients combined with cleaning of isolation rooms are effective, reducing R0 to below unity. In contrast, expediting the recovery of the intestinal microbiota (e.g. use of probiotics) is not effective. This study represents a biologically realistic model of the transmission dynamics of A. baumannii, and the most comprehensive analysis of the effectiveness of interventions against this pathogen. Our study provides important data for designing effective infection control interventions.

  11. In Vitro Activity of Tigecycline Against Acinetobacter baumannii: Global Epidemiology and Resistance Mechanisms.


    Pournaras, Spyros; Koumaki, Vasiliki; Gennimata, Vasiliki; Kouskouni, Evangelia; Tsakris, Athanassios


    Acinetobacter baumannii is a pathogen of increasing concern, commonly causing outbreaks in the hospital environment. Of particular concern, A. baumannii strains exhibiting resistance to carbapenems, which were previously considered the treatment of choice for infected patients, have dramatically increased worldwide, leaving a few antibacterial choices. Tigecycline, a broad-spectrum modified minocycline derivative, isconsidered as a last resort drug against multidrug-resistant A. baumannii. Though, resistance to tigecycline has emerged and is growing notably following increasing tigecycline usage. Comparative evaluation of the tigecycline resistance rates reported worldwide is challenging due to the absence of official interpretative criteria for in vitro susceptibility testing and the discrepancies among the different susceptibility methodologies used, with broth microdilution being considered the reference method. Tigecycline resistance is mainly associated with resistance-nodulation-cell division (RND)-type transporters, mainly the AdeABC, AdeFGH and AdeIJK efflux pumps, but other resistance mechanisms have also been implicated. Tigecycline is still an attractive choice for A. baumannii, but further investigations are warranted so that treatment of MDR Α. baumannii could be guided by validated in vitro data.

  12. Novel Engineered Peptides of a Phage Lysin as Effective Antimicrobials against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Thandar, Mya; Lood, Rolf; Winer, Benjamin Y.; Deutsch, Douglas R.; Euler, Chad W.


    Acinetobacter baumannii is a Gram-negative bacterial pathogen responsible for a range of nosocomial infections. The recent rise and spread of multidrug-resistant A. baumannii clones has fueled a search for alternative therapies, including bacteriophage endolysins with potent antibacterial activities. A common feature of these lysins is the presence of a highly positively charged C-terminal domain with a likely role in promoting outer membrane penetration. In the present study, we show that the C-terminal amino acids 108 to 138 of phage lysin PlyF307, named P307, alone were sufficient to kill A. baumannii (>3 logs). Furthermore, P307 could be engineered for improved activity, the most active derivative being P307SQ-8C (>5-log kill). Both P307 and P307SQ-8C showed high in vitro activity against A. baumannii in biofilms. Moreover, P307SQ-8C exhibited MICs comparable to those of levofloxacin and ceftazidime and acted synergistically with polymyxin B. Although the peptides were shown to kill by disrupting the bacterial cytoplasmic membrane, they did not lyse human red blood cells or B cells; however, serum was found to be inhibitory to lytic activity. In a murine model of A. baumannii skin infection, P307SQ-8C reduced the bacterial burden by ∼2 logs in 2 h. This study demonstrates the prospect of using peptide derivatives from bacteriophage lysins to treat topical infections and remove biofilms caused by Gram-negative pathogens. PMID:26856847

  13. A multidrug resistance plasmid contains the molecular switch for type VI secretion in Acinetobacter baumannii

    PubMed Central

    Weber, Brent S.; Ly, Pek Man; Irwin, Joshua N.; Pukatzki, Stefan; Feldman, Mario F.


    Infections with Acinetobacter baumannii, one of the most troublesome and least studied multidrug-resistant superbugs, are increasing at alarming rates. A. baumannii encodes a type VI secretion system (T6SS), an antibacterial apparatus of Gram-negative bacteria used to kill competitors. Expression of the T6SS varies among different strains of A. baumannii, for which the regulatory mechanisms are unknown. Here, we show that several multidrug-resistant strains of A. baumannii harbor a large, self-transmissible resistance plasmid that carries the negative regulators for T6SS. T6SS activity is silenced in plasmid-containing, antibiotic-resistant cells, while part of the population undergoes frequent plasmid loss and activation of the T6SS. This activation results in T6SS-mediated killing of competing bacteria but renders A. baumannii susceptible to antibiotics. Our data show that a plasmid that has evolved to harbor antibiotic resistance genes plays a role in the differentiation of cells specialized in the elimination of competing bacteria. PMID:26170289

  14. Rapid Killing of Acinetobacter baumannii by Polymyxins Is Mediated by a Hydroxyl Radical Death Pathway

    PubMed Central

    Sampson, Timothy R.; Liu, Xiang; Schroeder, Max R.; Kraft, Colleen S.; Burd, Eileen M.


    Acinetobacter baumannii is an opportunistic pathogen that is a cause of clinically significant nosocomial infections. Increasingly, clinical isolates of A. baumannii are extensively resistant to numerous antibiotics, and the use of polymyxin antibiotics against these infections is often the final treatment option. Historically, the polymyxins have been thought to kill bacteria through membrane lysis. Here, we present an alternative mechanism based on data demonstrating that polymyxins induce rapid cell death through hydroxyl radical production. Supporting this notion, we found that inhibition of radical production delays the ability of polymyxins to kill A. baumannii. Notably, we demonstrate that this mechanism of killing occurs in multidrug-resistant clinical isolates of A. baumannii and that this response is not induced in a polymyxin-resistant isolate. This study is the first to demonstrate that polymyxins induce rapid killing of A. baumannii and other Gram-negatives through hydroxyl radical production. This significantly augments our understanding of the mechanism of polymyxin action, which is critical knowledge toward the development of adjunctive therapies, particularly given the increasing necessity for treatment with these antibiotics in the clinical setting. PMID:22908157

  15. Class 2 Integrons Dissemination Among Multidrug Resistance (MDR) Clones of Acinetobacter baumannii

    PubMed Central

    Ramírez, María Soledad; Morales, Amanda; Vilacoba, Elisabet; Márquez, Carolina


    Acinetobacter baumannii has emerged as a serious problem in the hospital environment at a global scale. Previous results from our laboratory showed a high frequency of class 2 integrons in A. baumannii strains from Argentina regarding the low rate of this element in A. baumannii isolates from the rest of the world. To reveal the current epidemiology of class 2 integrons, a molecular surveillance analyzing 78 multidrug resistant (MDR) A. baumannii isolates from Argentina and Uruguay was performed, exposing the presence of class 2 integron in the 36.61% of the isolates. Class 2 integron characterization showed that the typical Tn7::In2-7 array was present in 26 out of 27 intI2 positive isolates. All intI2 positive isolates contained at least one of the Tn7 transposition genes. In addition, we identified that 18 intI2 positive isolates possessed the Tn7::In2-7 within the attTn7 site. The molecular typing evidenced that clones I and IV that do not belong to widespread European clones I and II were found among the intI2 positive isolates. Our results exposed the widely dissemination of class 2 integron among MDR A. baumannii isolates from Argentina and Uruguay, also showing the persistence of two novel clones in our region, which could explain in part the high frequency of class 2 integron found in our region. PMID:22198473

  16. Rapid killing of Acinetobacter baumannii by polymyxins is mediated by a hydroxyl radical death pathway.


    Sampson, Timothy R; Liu, Xiang; Schroeder, Max R; Kraft, Colleen S; Burd, Eileen M; Weiss, David S


    Acinetobacter baumannii is an opportunistic pathogen that is a cause of clinically significant nosocomial infections. Increasingly, clinical isolates of A. baumannii are extensively resistant to numerous antibiotics, and the use of polymyxin antibiotics against these infections is often the final treatment option. Historically, the polymyxins have been thought to kill bacteria through membrane lysis. Here, we present an alternative mechanism based on data demonstrating that polymyxins induce rapid cell death through hydroxyl radical production. Supporting this notion, we found that inhibition of radical production delays the ability of polymyxins to kill A. baumannii. Notably, we demonstrate that this mechanism of killing occurs in multidrug-resistant clinical isolates of A. baumannii and that this response is not induced in a polymyxin-resistant isolate. This study is the first to demonstrate that polymyxins induce rapid killing of A. baumannii and other Gram-negatives through hydroxyl radical production. This significantly augments our understanding of the mechanism of polymyxin action, which is critical knowledge toward the development of adjunctive therapies, particularly given the increasing necessity for treatment with these antibiotics in the clinical setting.

  17. Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach

    PubMed Central

    Hua, Xiaoting; Liu, Lilin; Fang, Youhong; Shi, Qiucheng; Li, Xi; Chen, Qiong; Shi, Keren; Jiang, Yan; Zhou, Hua; Yu, Yunsong


    Acinetobacter baumannii has emerged as an important opportunistic pathogen due to its ability to acquire resistance to most currently available antibiotics. Colistin is often considered as the last line of therapy for infections caused by multidrug-resistant A. baumannii (MDRAB). However, colistin-resistant A. baumannii strain has recently been reported. To explore how multiple drug-resistant A. baumannii responded to colistin resistance, we compared the genomic, transcriptional and proteomic profile of A. baumannii MDR-ZJ06 to the induced colistin-resistant strain ZJ06-200P5-1. Genomic analysis showed that lpxC was inactivated by ISAba1 insertion, leading to LPS loss. Transcriptional analysis demonstrated that the colistin-resistant strain regulated its metabolism. Proteomic analysis suggested increased expression of the RND efflux pump system and down-regulation of FabZ and β-lactamase. These alterations were believed to be response to LPS loss. In summary, the lpxC mutation not only established colistin resistance but also altered global gene expression. PMID:28275586

  18. Acinetobacter baumannii outer membrane protein A modulates the biogenesis of outer membrane vesicles.


    Moon, Dong Chan; Choi, Chul Hee; Lee, Jung Hwa; Choi, Chi-Won; Kim, Hye-Yeon; Park, Jeong Soon; Kim, Seung Il; Lee, Je Chul


    Acinetobacter baumannii secretes outer membrane vesicles (OMVs) during both in vitro and in vivo growth, but the biogenesis mechanism by which A. baumannii produces OMVs remains undefined. Outer membrane protein A of A. baumannii (AbOmpA) is a major protein in the outer membrane and the C-terminus of AbOmpA interacts with diaminopimelate of peptidoglycan. This study investigated the role of AbOmpA in the biogenesis of A. baumannii OMVs. Quantitative and qualitative approaches were used to analyze OMV biogenesis in A. baumannii ATCC 19606T and an isogenic ΔAbOmpA mutant. OMV production was significantly increased in the ΔAbOmpA mutant compared to wild-type bacteria as demonstrated by quantitation of proteins and lipopolysaccharides (LPS) packaged in OMVs. LPS profiles prepared from OMVs from wild-type bacteria and the ΔAbOmpA mutant had identical patterns, but proteomic analysis showed different protein constituents in OMVs from wild-type bacteria compared to the ΔAbOmpA mutant. In conclusion, AbOmpA influences OMV biogenesis by controlling OMV production and protein composition.

  19. Genome-wide recombination drives diversification of epidemic strains of Acinetobacter baumannii.


    Snitkin, Evan S; Zelazny, Adrian M; Montero, Clemente I; Stock, Frida; Mijares, Lilia; Murray, Patrick R; Segre, Julie A


    Acinetobacter baumannii is an emerging human pathogen and a significant cause of nosocomial infections among hospital patients worldwide. The enormous increase in multidrug resistance among hospital isolates and the recent emergence of pan-drug-resistant strains underscores the urgency to understand how A. baumannii evolves in hospital environments. To this end, we undertook a genomic study of a polyclonal outbreak of multidrug-resistant A. baumannii at the research-based National Institutes of Health Clinical Center. Comparing the complete genome sequences of the three dominant outbreak strain types enabled us to conclude that, despite all belonging to the same epidemic lineage, the three strains diverged before their arrival at the National Institutes of Health. The simultaneous presence of three divergent strains from this lineage supports its increasing prevalence in international hospitals and suggests an ongoing adaptation to the hospital environment. Further genomic comparisons uncovered that much of the diversification that occurred since the divergence of the three outbreak strains was mediated by homologous recombination across 20% of their genomes. Inspection of recombinant regions revealed that several regions were associated with either the loss or swapping out of genes encoding proteins that are exposed to the cell surface or that synthesize cell-surface molecules. Extending our analysis to a larger set of international clinical isolates revealed a previously unappreciated ability of A. baumannii to vary surface molecules through horizontal gene transfer, with subsequent intraspecies dissemination by homologous recombination. These findings have immediate implications in surveillance, prevention, and treatment of A. baumannii infections.

  20. Ability of bacteriophage in resolving wound infection caused by multidrug-resistant Acinetobacter baumannii in uncontrolled diabetic rats.


    Shivaswamy, VinodKumar Chickmangalure; Kalasuramath, Suneeta Basavaraj; Sadanand, Chethan Kumar; Basavaraju, Abhishek Kilagere; Ginnavaram, Varsha; Bille, Sumanth; Ukken, Sanjay Saju; Pushparaj, Usha Nandini


    Acinetobacter baumannii, a substantial nosocomial pathogen, has developed resistance to almost all available antimicrobial drugs. Bacteriophage therapy is a possible alternative treatment for multidrug-resistant (MDR) bacterial infections. In this study, we have successfully isolated bacteriophage active against clinical strains of A. baumannii by enrichment from hospital sewage sludge using representatives of those strains. The bacteriophage isolated against A. baumannii formed plaques against beta-lactamases producing strains of A. baumannii. The utility of bacteriophage specific for A. baumannii to resolve wound infection in uncontrolled diabetic rats was evaluated. Five groups of uncontrolled diabetic rats were used. Group I was noninfected (Control), Group II was infected with MDR A. baumannii and challenged with bacteriophage, Group III was infected with MDR A. baumannii, Group IV was infected with MDR A. baumannii and challenged with antibiotic colistin, and Group V consisted of noninfected rats and sprayed with phage (Phage control). A significant decrease in infection, period of epithelization, and wound contraction was observed in the phage-challenged group when compared with antibiotic-treated uncontrolled diabetic rats and the control group. To conclude the study, new insights are provided into the biology of the broad host range of A. baumannii phage, demonstrating that A. baumannii phage has prospects for the treatment of infections caused by the MDR A. baumannii.

  1. Multidrug-Resistant Acinetobacter baumannii in Veterinary Clinics, Germany

    PubMed Central

    Prenger-Berninghoff, Ellen; Weiss, Reinhard; van der Reijden, Tanny; van den Broek, Peterhans; Baljer, Georg; Dijkshoorn, Lenie


    An increase in prevalence of multidrug-resistant Acinetobacter spp. in hospitalized animals was observed at the Justus-Liebig-University (Germany). Genotypic analysis of 56 isolates during 2000–2008 showed 3 clusters that corresponded to European clones I–III. Results indicate spread of genotypically related strains within and among veterinary clinics in Germany. PMID:21888812

  2. OmpA Binding Mediates the Effect of Antimicrobial Peptide LL-37 on Acinetobacter baumannii

    PubMed Central

    Lin, Ming-Feng; Tsai, Pei-Wen; Chen, Jeng-Yi; Lin, Yun-You; Lan, Chung-Yu


    Multidrug-resistant Acinetobacter baumannii has recently emerged as an important pathogen in nosocomial infection; thus, effective antimicrobial regimens are urgently needed. Human antimicrobial peptides (AMPs) exhibit multiple functions and antimicrobial activities against bacteria and fungi and are proposed to be potential adjuvant therapeutic agents. This study examined the effect of the human cathelicidin-derived AMP LL-37 on A. baumannii and revealed the underlying mode of action. We found that LL-37 killed A. baumannii efficiently and reduced cell motility and adhesion. The bacteria-killing effect of LL-37 on A. baumannii was more efficient compared to other AMPs, including human ß–defensin 3 (hBD3) and histatin 5 (Hst5). Both flow cytometric analysis and immunofluorescence staining showed that LL-37 bound to A. baumannii cells. Moreover, far-western analysis demonstrated that LL-37 could bind to the A. baumannii OmpA (AbOmpA) protein. An ELISA assay indicated that biotin-labelled LL-37 (BA-LL37) bound to the AbOmpA74-84 peptide in a dose-dependent manner. Using BA-LL37 as a probe, the ~38 kDa OmpA signal was detected in the wild type but the ompA deletion strain did not show the protein, thereby validating the interaction. Finally, we found that the ompA deletion mutant was more sensitive to LL-37 and decreased cell adhesion by 32% compared to the wild type. However, ompA deletion mutant showed a greatly reduced adhesion defect after LL-37 treatment compared to the wild strain. Taken together, this study provides evidence that LL-37 affects A. baumannii through OmpA binding. PMID:26484669

  3. A penicillin-binding protein inhibits selection of colistin-resistant, lipooligosaccharide-deficient Acinetobacter baumannii

    PubMed Central

    Boll, Joseph M.; Crofts, Alexander A.; Peters, Katharina; Cattoir, Vincent; Vollmer, Waldemar; Davies, Bryan W.; Trent, M. Stephen


    The Gram-negative bacterial outer membrane fortifies the cell against environmental toxins including antibiotics. Unique glycolipids called lipopolysaccharide/lipooligosaccharide (LPS/LOS) are enriched in the cell-surface monolayer of the outer membrane and promote antimicrobial resistance. Colistin, which targets the lipid A domain of LPS/LOS to lyse the cell, is the last-line treatment for multidrug-resistant Gram-negative infections. Lipid A is essential for the survival of most Gram-negative bacteria, but colistin-resistant Acinetobacter baumannii lacking lipid A were isolated after colistin exposure. Previously, strain ATCC 19606 was the only A. baumannii strain demonstrated to subsist without lipid A. Here, we show that other A. baumannii strains can also survive without lipid A, but some cannot, affording a unique model to study endotoxin essentiality. We assessed the capacity of 15 clinical A. baumannii isolates including 9 recent clinical isolates to develop colistin resistance through inactivation of the lipid A biosynthetic pathway, the products of which assemble the LOS precursor. Our investigation determined that expression of the well-conserved penicillin-binding protein (PBP) 1A, prevented LOS-deficient colony isolation. The glycosyltransferase activity of PBP1A, which aids in the polymerization of the peptidoglycan cell wall, was lethal to LOS-deficient A. baumannii. Global transcriptomic analysis of a PBP1A-deficient mutant and four LOS-deficient A. baumannii strains showed a concomitant increase in transcription of lipoproteins and their transporters. Examination of the LOS-deficient A. baumannii cell surface demonstrated that specific lipoproteins were overexpressed and decorated the cell surface, potentially compensating for LOS removal. This work expands our knowledge of lipid A essentiality and elucidates a drug resistance mechanism. PMID:27681618

  4. In Vivo Selection of Pan-Drug Resistant Acinetobacter baumannii during Antibiotic Treatment

    PubMed Central

    Kim, Yoonjung; Bae, Il Kwon; Yong, Dongeun; Lee, Kyungwon


    Purpose Colistin resistance in Acinetobacter baumannii (A. baumannii) is mediated by a complete loss of lipopolysaccharide production via mutations in lpxA, lpxC, and lpxD gene or lipid A modifications via mutations in the pmrA and pmrB genes. However, the exact mechanism of therapy-induced colistin resistance in A. baumannii is not well understood. Materials and Methods We investigated the genotypic and phenotypic changes that underlie pan-drug resistance mechanisms by determining differences between the alterations in extensively drug-resistant (XDR) A. baumannii (AB001 and AB002) isolates and a pan-drug resistant (PDR) counterpart (AB003) recovered from one patient before and after antibiotic treatment, respectively. Results All three clinical isolates shared an identical sequence type (ST138), belonging to the global epidemic clone, clonal complex 92, and all produced OXA-23 carbapenemase. The PDR AB003 showed two genetic differences, acquisition of armA gene and an amino acid substitution (Glu229Asp) in pmrB gene, relative to XDR isolates. No mutations were detected in the pmrA, pmrC, lpxA, lpxC, or lpxD genes in all three isolates. In matrix-assisted laser desorption ionization-time of flight analysis, the three isolates commonly showed two major peaks at 1728 m/z and 1912 m/z, but peaks at 2034 m/z, 2157 m/z, 2261 m/z, and 2384 m/z were detected only in the PDR A. baumannii AB003 isolate. Conclusion Our results show that changes in lipid A structure via a mutation in the pmrB gene and acquisition of armA gene might confer resistance to colistin and aminoglycosides to XDR A. baumannii strains, resulting in appearance of a PDR A. baumannii strain of ST138. PMID:26069113

  5. A rapid and simple method for constructing stable mutants of Acinetobacter baumannii

    PubMed Central


    Background Acinetobacter baumannii is a multidrug-resistant bacterium responsible for nosocomial infections in hospitals worldwide. Study of mutant phenotypes is fundamental for understanding gene function. The methodologies developed to inactivate A. baumannii genes are complicated and time-consuming; sometimes result in unstable mutants, and do not enable construction of double (or more) gene knockout mutant strains of A. baumannii. Results We describe here a rapid and simple method of obtaining A. baumannii mutants by gene replacement via double crossover recombination, by use of a PCR product that carries an antibiotic resistance cassette flanked by regions homologous to the target locus. To demonstrate the reproducibility of the approach, we produced mutants of three different chromosomal genes (omp33, oxyR, and soxR) by this method. In addition, we disrupted one of these genes (omp33) by integration of a plasmid into the chromosome by single crossover recombination, the most widely used method of obtaining A. baumannii mutants. Comparison of the different techniques revealed absolute stability when the gene was replaced by a double recombination event, whereas up to 40% of the population reverted to wild-type when the plasmid was disrupting the target gene after 10 passages in broth without selective pressure. Moreover, we demonstrate that the combination of both gene disruption and gene replacement techniques is an easy and useful procedure for obtaining double gene knockout mutants in A. baumannii. Conclusions This study provides a rapid and simple method of obtaining stable mutants of A. baumannii free of foreign plasmidic DNA, which does not require cloning steps, and enables construction of multiple gene knockout mutants. PMID:21062436

  6. Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii

    PubMed Central

    Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun


    The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem-resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine-arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β-lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA-51 was present in 46 isolates, blaOXA-23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant-associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA-58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem-resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β-lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals. PMID:27485638

  7. Carbapenem-Resistant Acinetobacter baumannii: Concomitant Contamination of Air and Environmental Surfaces.


    Shimose, Luis A; Masuda, Eriko; Sfeir, Maroun; Berbel Caban, Ana; Bueno, Maria X; dePascale, Dennise; Spychala, Caressa N; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Doi, Yohei; Munoz-Price, L Silvia


    OBJECTIVE To concomitantly determine the differential degrees of air and environmental contamination by Acinetobacter baumannii based on anatomic source of colonization and type of ICU layout (single-occupancy vs open layout). DESIGN Longitudinal prospective surveillance study of air and environmental surfaces in patient rooms. SETTING A 1,500-bed public teaching hospital in Miami, Florida. PATIENTS Consecutive A. baumannii-colonized patients admitted to our ICUs between October 2013 and February 2014. METHODS Air and environmental surfaces of the rooms of A. baumannii-colonized patients were sampled daily for up to 10 days. Pulsed-field gel electrophoresis (PFGE) was used to type and match the matching air, environmental, and clinical A. baumannii isolates. RESULTS A total of 25 A. baumannii-colonized patients were identified during the study period; 17 were colonized in the respiratory tract and 8 were colonized in the rectum. In rooms with rectally colonized patients, 38.3% of air samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 13.1% of air samples were positive (P=.0001). In rooms with rectally colonized patients, 15.5% of environmental samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 9.5% of environmental samples were positive (P=.02). The rates of air contamination in the open-layout and single-occupancy ICUs were 17.9% and 21.8%, respectively (P=.5). Environmental surfaces were positive in 9.5% of instances in open-layout ICUs versus 13.4% in single-occupancy ICUs (P=.09). CONCLUSIONS Air and environmental surface contaminations were significantly greater among rectally colonized patients; however, ICU layout did not influence the rate of contamination. Infect Control Hosp Epidemiol 2016;37:777-781.

  8. Impact of a Cross-Kingdom Signaling Molecule of Candida albicans on Acinetobacter baumannii Physiology

    PubMed Central

    Kostoulias, Xenia; Murray, Gerald L.; Cerqueira, Gustavo M.; Kong, Jason B.; Bantun, Farkad; Mylonakis, Eleftherios; Khoo, Chen Ai


    Multidrug-resistant (MDR) Acinetobacter baumannii is an opportunistic human pathogen that has become highly problematic in the clinical environment. Novel therapies are desperately required. To assist in identifying new therapeutic targets, the antagonistic interactions between A. baumannii and the most common human fungal pathogen, Candida albicans, were studied. We have observed that the C. albicans quorum-sensing molecule, farnesol, has cross-kingdom interactions, affecting the viability of A. baumannii. To gain an understanding of its mechanism, the transcriptional profile of A. baumannii exposed to farnesol was examined. Farnesol caused dysregulation of a large number of genes involved in cell membrane biogenesis, multidrug efflux pumps (AcrAB-like and AdeIJK-like), and A. baumannii virulence traits such as biofilm formation (csuA, csuB, and ompA) and motility (pilZ and pilH). We also observed a strong induction in genes involved in cell division (minD, minE, ftsK, ftsB, and ftsL). These transcriptional data were supported by functional assays showing that farnesol disrupts A. baumannii cell membrane integrity, alters cell morphology, and impairs virulence characteristics such as biofilm formation and twitching motility. Moreover, we showed that A. baumannii uses efflux pumps as a defense mechanism against this eukaryotic signaling molecule. Owing to its effects on membrane integrity, farnesol was tested to see if it potentiated the activity of the membrane-acting polymyxin antibiotic colistin. When coadministered, farnesol increased sensitivity to colistin for otherwise resistant strains. These data provide mechanistic understanding of the antagonistic interactions between diverse pathogens and may provide important insights into novel therapeutic strategies. PMID:26482299

  9. Use of Comparative Genomics To Characterize the Diversity of Acinetobacter baumannii Surveillance Isolates in a Health Care Institution.


    Wallace, Lalena; Daugherty, Sean C; Nagaraj, Sushma; Johnson, J Kristie; Harris, Anthony D; Rasko, David A


    Despite the increasing prevalence of the nosocomial pathogen Acinetobacter baumannii, little is known about which genomic components contribute to clinical presentation of this important pathogen. Most whole-genome comparisons of A. baumannii have focused on specific genomic regions associated with phenotypes in a limited number of genomes. In this work, we describe the results of a whole-genome comparative analysis of 254 surveillance isolates of Acinetobacter species, 203 of which were A. baumannii, isolated from perianal swabs and sputum samples collected as part of an infection control active surveillance program at the University of Maryland Medical Center. The collection of surveillance isolates includes both carbapenem-susceptible and -resistant isolates. Based on the whole-genome phylogeny, the A. baumannii isolates collected belong to two major phylogenomic lineages. Results from multilocus sequence typing indicated that one of the major phylogenetic groups of A. baumannii was comprised solely of strains from the international clonal lineage 2. The genomic content of the A. baumannii isolates was examined using large-scale BLAST score ratio analysis to identify genes that are associated with carbapenem-susceptible and -resistant isolates, as well as genes potentially associated with the source of isolation. This analysis revealed a number of genes that were exclusive or at greater frequency in each of these classifications. This study is the most comprehensive genomic comparison of Acinetobacter isolates from a surveillance study to date and provides important information that will contribute to our understanding of the success of A. baumannii as a human pathogen.

  10. RNA-mediated cis-regulation in Acinetobacter baumannii modulates stress-induced phenotypic variation.


    Ching, Carly; Gozzi, Kevin; Heinemann, Björn; Chai, Yunrong; Godoy, Veronica G


    In the nosocomial opportunistic pathogen Acinetobacter baumannii, RecA-dependent mutagenesis, which causes antibiotic resistance acquisition, is linked to the DNA damage response (DDR). Notably, unlike the Escherichia coli paradigm, recA and DDR gene expression in A. baumannii are bimodal. Namely, there is phenotypic variation upon DNA damage, which may provide a bet-hedging strategy for survival. Thus, understanding recA gene regulation is key to elucidate the yet unknown DDR regulation in A. baumannii Here, we identify a structured 5' Untranslated Region (5' UTR) in the recA transcript which serves as a cis-regulatory element. We show that a predicted stem-loop structure in this 5' UTR affects mRNA half-life and underlies bimodal gene expression and thus phenotypic variation in response to ciprofloxacin treatment. We furthermore show that the stem-loop structure of the recA 5' UTR influences intracellular RecA protein levels and, in vivo, impairing the formation of the stem-loop structure of the recA 5' UTR lowers cell survival to UV treatment and decreases rifampicin resistance acquisition from DNA damage-induced mutagenesis. We hypothesize that the 5' UTR allows for stable recA transcripts during stress, including antibiotic treatment, enabling cells to maintain suitable RecA levels for survival. This innovative strategy to regulate the DDR in A. baumannii may contribute to its success as a pathogen.ImportanceAcinetobacter baumannii is an opportunistic pathogen quickly gaining antibiotic resistances. Mutagenesis and antibiotic resistance acquisition are linked to the DNA damage response (DDR). However, how the DDR is regulated in A. baumannii remains unknown, since unlike most bacteria, A. baumannii does not follow the regulation of the Escherichia coli paradigm. Here, we have started to uncover the mechanisms regulating the novel A. baumannii DDR. We have found that a cis-acting 5' UTR regulates recA transcript stability, RecA protein levels, and DNA damage

  11. Presence of OXA-23-producing isolates of Acinetobacter baumannii in wastewater from hospitals in southern Brazil.


    Ferreira, Alessandra E; Marchetti, Desirée P; De Oliveira, Lyvia M; Gusatti, Carolina S; Fuentefria, Daiane B; Corção, Gertrudes


    The aim of the study was to evaluate the dissemination of multiresistant isolates of Acinetobacter baumannii carrying resistance genes, by samples of wastewater from hospitals in Porto Alegre, Rio Grande do Sul, Brazil. We obtained 303 bacterial isolates from the wastewater of three hospitals in Porto Alegre, Rio Grande do Sul. For each isolate, we determined the profile of susceptibility to antimicrobials and the presence of the genes bla(OXA-23), bla(OXA-24), bla(OXA-51), bla(OXA-58), bla(SPM-1), bla(IMP), and bla(VIM.) The bla(OXA-51) gene was found in 56% of the isolates, indicating the presence of A. baumannii in this environment. Of these, three multiresistant isolates were positive for the bla(OXA-23) gene, in wastewater from two of the hospitals. The results obtained in this study indicate that isolates of A. baumannii which are multiresistant and carry resistance genes such as bla(OXA-51) and bla(OXA-23) are being released into the environment in the wastewater from the hospitals analyzed. Multiresistant Acinetobacter junii, the newly emerging pathogen, were also found among the multiresistant isolates. Hospital wastewater may be crucial to the development and dispersal of multiresistant bacteria, making waterbodies reservoirs of bacterial resistance.

  12. Characterisation of Pellicles Formed by Acinetobacter baumannii at the Air-Liquid Interface

    PubMed Central

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B.; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster’s Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  13. Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii.


    Zhang, J; Liu, X; Li, X-J


    The phages of Acinetobacter baumannii has drawn increasing attention because of the multi-drug resistance of A. baumanni. The aim of this study was to sequence Acinetobacter baumannii phage AB3 and conduct bioinformatic analysis to lay a foundation for genome remodeling and phage therapy. We isolated and sequenced A. baumannii phage AB3 and attempted to annotate and analyze its genome. The results showed that the genome is a double-stranded DNA with a total length of 31,185 base pairs (bp) and 97 open reading frames greater than 100 bp. The genome includes 28 predicted genes, of which 24 are homologous to phage AB1. The entire coding sequence is located on the negative strand, representing 90.8% of the total length. The G+C mol% was 39.18%, without areas of high G+C content over 200 bp in length. No GC island, tRNA gene, or repeated sequence was identified. Gene lengths were 120-3099 bp, with an average of 1011 bp. Six genes were found to be greater than 2000 bp in length. Genomic alignment and phylogenetic analysis of the RNA polymerase gene showed that similar to phage AB1, phage AB3 is a phiKMV-like virus in the T7 phage family.

  14. Characterisation of pellicles formed by Acinetobacter baumannii at the air-liquid interface.


    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B; Jouenne, Thierry; Dé, Emmanuelle


    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster's Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen.

  15. The opportunistic human pathogen Acinetobacter baumannii senses and responds to light.


    Mussi, María A; Gaddy, Jennifer A; Cabruja, Matías; Arivett, Brock A; Viale, Alejandro M; Rasia, Rodolfo; Actis, Luis A


    Light is a ubiquitous environmental signal that many organisms sense and respond to by modulating their physiological responses accordingly. While this is an expected response among phototrophic microorganisms, the ability of chemotrophic prokaryotes to sense and react to light has become a puzzling and novel issue in bacterial physiology, particularly among bacterial pathogens. In this work, we show that the opportunistic pathogen Acinetobacter baumannii senses and responds to blue light. Motility and formation of biofilms and pellicles were observed only when bacterial cells were incubated in darkness. In contrast, the killing of Candida albicans filaments was enhanced when they were cocultured with bacteria under light. These bacterial responses depend on the expression of the A. baumannii ATCC 17978 A1S_2225 gene, which codes for an 18.6-kDa protein that contains an N-terminal blue-light-sensing-using flavin (BLUF) domain and lacks a detectable output domain(s). Spectral analyses of the purified recombinant protein showed its ability to sense light by a red shift upon illumination. Therefore, the A1S_2225 gene, which is present in several members of the Acinetobacter genus, was named blue-light-sensing A (blsA). Interestingly, temperature plays a role in the ability of A. baumannii to sense and respond to light via the BlsA photoreceptor protein.

  16. [Toxigenic effect of Acinetobacter baumannii isolated from children with acute diarrhoea].


    Polanco, Nina; Manzi, Lorna


    Diarrheal diseases with diarrhea are the most frequent cause of morbidity and mortality in children; however the causative agent cannot be identified always, which suggests the presence of unknown enteropathogens inducing diarrhea. The isolation of Acinetobacter sp. from feces of children with acute diarrhea, unrelated to known enteropathogens motivated this investigation to detect a possible enterotoxigenic effect on HT-29 cells. The study population comprised 150 children with an age range from 0 to 5 years old; 120 were assisted in the "Hospital Materno Infantil del Este'' with gastrointestinal syndrome and 30 healthy controls who went to the center for routine analysis. In 25% of symptomatic patients were diagnosed parasites and bacteria, identified routinely. From four symptomatic patients were isolated three Acinetobacter baumannii strains and two A. calcoaceticus strains. The strains were cultured in brain-heart infusion for 24 and 48 hrs, at 35 degrees C, and the supernatants were obtained by centrifugation and filtration and their activity tested on HT-29 cell monolayers. The supernatants of the three strains of A. baumannii induced alterations of the cell monolayer, showed by detachments of cell monolayers, cell segregation, cell rounding and swelling. These effects were more intense with the 48 h culture exoproducts of the 016 strain, which were higher than the positive control. This toxigenic effect of A. baumannii, could represent a pathogenic mechanism whose definition requires more studies to determine the possible role in the pathogenicity of this bacillus.

  17. Phenotypic characterization of Acinetobacter baumannii isolates from intensive care units at a tertiary-care hospital in Egypt.


    Nageeb, W; Kamel, M; Zakaria, S; Metwally, L


    Multi-drug resistant (MDR) strains of Acinetobacter baumannii are responsible for an increasing number of opportunistic infections in hospitals. This study determined the prevalence of MDR A. baumannii isolates from intensive care units in a large tertiary-care hospital in Ismailia, Egypt, and the occurrence of different beta-lactamases in these isolates. Biotyping and antimicrobial susceptibility profile was done for isolated strains. Respiratory, urine, burn wound and blood specimens were collected from 350 patients admitted to different units; 10 strains (2.9%) of A. baumannii were isolated. All isolates showed resistance to more than 3 classes of antibiotics. Among the isolates, 6 isolates were carbapenemase producers, 2 were AmpC beta-lactamase producers and no isolates were metallo-beta-lactamase producers. Despite the low prevalence of A. baumannii infection in this hospital, the antibiotic resistance profile suggests that prevention of health-care-associated transmission of MDR Acinetobacter spp. infection is essential.

  18. Molecular epidemiology and spatiotemporal analysis of hospital-acquired Acinetobacter baumannii infection in a tertiary care hospital in southern Thailand.


    Chusri, S; Chongsuvivatwong, V; Rivera, J I; Silpapojakul, K; Singkhamanan, K; McNeil, E; Doi, Y


    Acinetobacter baumannii is a major hospital-acquired pathogen in Thailand that has a negative effect on patient survival. The nature of its transmission is poorly understood. To investigate the genotypic and spatiotemporal pattern of A. baumannii infection at a hospital in Thailand. The medical records of patients infected with A. baumannii at an 800-bed tertiary care hospital in southern Thailand between January 2010 and December 2011 were reviewed retrospectively. A. baumannii was identified at the genomospecies level. Carbapenemase genes were identified among carbapenem-resistant isolates associated with A. baumannii infection. A spatiotemporal analysis was performed by admission ward, time of infection and pulsed-field gel electrophoresis (PFGE) groups of A. baumannii. Nine PFGE groups were identified among the 197 A. baumannii infections. All A. baumannii isolates were assigned to International Clonal Lineage II. blaOXA-23 was the most prevalent carbapenemase gene. Outbreaks were observed mainly in respiratory and intensive care units. The association between PFGE group and hospital unit was significant. Spatiotemporal analysis identified 20 clusters of single PFGE group infections. Approximately half of the clusters involved multiple hospital units simultaneously. A. baumannii transmitted both within and between hospital wards. Better understanding and control of the transmission of A. baumannii are needed. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  19. Bed rails and endotracheal tube connectors as possible sources for spreading Acinetobacter baumannii in ventilator-associated pneumonia patients.


    Chaladchalam, Suphawita; Diraphat, Pornphan; Utrarachkij, Fuangfa; Suthienkul, Orasa; Samakoses, Rudiwilai; Siripanichgon, Kanokrat


    This study aimed to determine molecular patterns of Acinetobacter baumannii using a PCR-based technique with REP-1, REP-2 and M13 primers to distinguish the patients' strains and the environmental strains (condensate, endotracheal tube connector, bed rail and nurses hands). There were 67 cases of ventilator-associated pneumonia (VAP) among 600 patients using mechanical ventilators in 10 wards from March to July 2006. The incidence of VAP was 11.2% or 8.9/1,000 ventilator days with a 54.5% fatality rate. Among 19 of 22 A. baumannii VAP patients, 68.4% (13/19) had their environmental samples contaminated with A. baumannii and the most common contaminated sites were bed rails and endotracheal tube connectors (36.8% each). Multidrug resistant (MDR) A. baumannii were involved in 77.3% of A. baumannii VAP. Molecular typing of 96 A. baumannii isolates was able to differentiate A. baumannii isolates into 7 types. Type 2 was the most common and found in 77.3% (17/22) of A. baumannii VAP patients admitted in 6 of 7 wards. Identical fingerprints were found in clinical isolates and their bed rails, endotracheal tube connectors and condensates of 5 patients. The results demonstrate that multiple clones of MDR A. baumannii were widely spread in the hospital. Bed rails and contaminated endotracheal tube connectors could be potential sources of A. baumannii spread.

  20. Evaluation of the ability of Acinetobacter baumannii to form biofilms on six different biomedical relevant surfaces.


    Greene, C; Wu, J; Rickard, A H; Xi, C


    The human opportunistic pathogen, Acinetobacter baumannii, has the propensity to form biofilms and frequently cause medical device-related infections in hospitals. However, the physio-chemical properties of medical surfaces, in addition to bacterial surface properties, will affect colonization and biofilm development. The objective of this study was to compare the ability of A. baumannii to form biofilms on six different materials common to the hospital environment: glass, porcelain, stainless steel, rubber, polycarbonate plastic and polypropylene plastic. Biofilms were developed on material coupons in a CDC biofilm reactor. Biofilms were visualized and quantified using fluorescent staining and imaged using confocal laser scanning microscopy (CLSM) and by direct viable cell counts. Image analysis of CLSM stacks indicated that the mean biomass values for biofilms grown on glass, rubber, porcelain, polypropylene, stainless steel and polycarbonate were 0·04, 0·26, 0·62, 1·00, 2·08 and 2·70 μm(3) /μm(2) respectively. Polycarbonate developed statistically more biofilm mass than glass, rubber, porcelain and polypropylene. Viable cell counts data were in agreement with the CLSM-derived data. In conclusion, polycarbonate was the most accommodating surface for A. baumannii ATCC 17978 to form biofilms while glass was least favourable. Alternatives to polycarbonate for use in medical and dental devices may need to be considered. In the hospital environment, Acinetobacter baumannii is one of the most persistent and difficult to control opportunistic pathogens. The persistence of A. baumannii is due, in part, to its ability to colonize surfaces and form biofilms. This study demonstrates that A. baumannii can form biofilms on a variety of different surfaces and develops substantial biofilms on polycarbonate - a thermoplastic material that is often used in the construction of medical devices. The findings highlight the need to further study the in

  1. Epidemiologic and clinical impact of Acinetobacter baumannii colonization and infection: a reappraisal.


    Villar, Macarena; Cano, María E; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús


    Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence.

  2. Effect of carbapenem consumption patterns on the molecular epidemiology and carbapenem resistance of Acinetobacter baumannii.


    Mózes, Julianna; Ebrahimi, Fatemeh; Gorácz, Orsolya; Miszti, Cecília; Kardos, Gábor


    This study investigated the molecular epidemiology of Acinetobacter baumannii in the University of Debrecen in relation to antibiotic consumption. Overall and ward-specific antibiotic consumption was measured by the number of defined daily doses (DDD) per 100 bed-days between 2002 and 2012. Consumption was analysed against the number of A. baumannii positive patients per 100 bed-days, number of isolates per positive sample, and proportion of carbapenem resistant A. baumannii, using time-series analysis. Altogether 160 A. baumannii isolates from different wards were collected and analysed. Carbapenemase genes bla(OXA-23-like), bla(OXA-24-like), bla(OXA-48-like), bla(OXA-51-like), bla(OXA-58-like) and integrons were sought by PCR. Relatedness of isolates was assessed by PFGE. Prevalence and carbapenem resistance of A. baumannii were statistically associated with carbapenem consumption. Prevalence data followed carbapenem usage with three quarterly lags (r = 0.51-0.53, P<0.001), and meropenem and ertapenem, but not imipenem usage, affected prevalence. Colistin usage, in turn, lagged behind prevalence with one lag (r = 0.68-0.70, P<0.001). Six clusters were identified; the neurology ward with the lowest carbapenem consumption was associated with the carbapenem-susceptible cluster, as well as with the carbapenem-susceptible isolates in the cluster with variable susceptibility. Wards with high carbapenem usage almost exclusively harboured isolates from carbapenem-resistant clusters. All clusters were dominated by isolates of one or two wards, but most wards were represented in multiple clusters. Increases in prevalence and carbapenem resistance of A. baumannii were associated with usage of meropenem and ertapenem but not of imipenem, which led to the spread of multiple clones in the University.

  3. Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E.; Schmidt, Robert E.; Beckett, Amber C.; Ticak, Tomislav; Carrier, Mary V.; Ghosh, Rajarshi; Ohneck, Emily J.; Metz, Maeva L.; Sellin Jeffries, Marlo K.; Actis, Luis A.


    Acinetobacter baumannii is an opportunistic Gram-negative pathogen that causes a wide range of infections including pneumonia, septicemia, necrotizing fasciitis and severe wound and urinary tract infections. Analysis of A. baumannii representative strains grown in Chelex 100-treated medium for hemolytic activity demonstrated that this pathogen is increasingly hemolytic to sheep, human and horse erythrocytes, which interestingly contain increasing amounts of phosphatidylcholine in their membranes. Bioinformatic, genetic and functional analyses of 19 A. baumannii isolates showed that the genomes of each strain contained two phosphatidylcholine-specific phospholipase C (PC-PLC) genes, which were named plc1 and plc2. Accordingly, all of these strains were significantly hemolytic to horse erythrocytes and their culture supernatants tested positive for PC-PLC activity. Further analyses showed that the transcriptional expression of plc1 and plc2 and the production of phospholipase and thus hemolytic activity increased when bacteria were cultured under iron-chelation as compared to iron-rich conditions. Testing of the A. baumannii ATCC 19606T plc1::aph-FRT and plc2::aph isogenic insertion derivatives showed that these mutants had a significantly reduced PC-PLC activity as compared to the parental strain, while testing of plc1::ermAM/plc2::aph demonstrated that this double PC-PLC isogenic mutant expressed significantly reduced cytolytic and hemolytic activity. Interestingly, only plc1 was shown to contribute significantly to A. baumannii virulence using the Galleria mellonella infection model. Taken together, our data demonstrate that both PLC1 and PLC2, which have diverged from a common ancestor, play a concerted role in hemolytic and cytolytic activities; although PLC1 seems to play a more critical role in the virulence of A. baumannii when tested in an invertebrate model. These activities would provide access to intracellular iron stores this pathogen could use during

  4. Predictors of mortality in patients with extensively drug-resistant Acinetobacter baumannii pneumonia receiving colistin therapy.


    Choi, Ik Sung; Lee, Yu Ji; Wi, Yu Mi; Kwan, Byung Soo; Jung, Kae Hwa; Hong, Woong Pyo; Kim, June Myong


    The ratio of the area under the free (unbound) concentration-time curve to minimum inhibitory concentration (fAUC/MIC) was proposed to be the pharmacokinetic/pharmacodynamic index most strongly linked to the antibacterial effect of colistin against Acinetobacter baumannii. A retrospective study of patients who received colistin to treat pneumonia caused by extensively drug-resistant (XDR) A. baumannii over a 4-year period was performed to assess the impact of the colistin MIC on mortality. A total of 227 patients were included in the analysis. The 7-day and 14-day mortality rates of patients with XDR A. baumannii pneumonia receiving colistin therapy were 15.0% and 23.8%, respectively. In the multivariate analysis, Acute Physiology and Chronic Health Evaluation (APACHE) II score, days from index culture to first dose of colistin, underlying tumour and septic shock at presentation were independent predictors of mortality in patients with XDR A. baumannii pneumonia receiving colistin therapy. In the univariate analysis, the colistin dose based on ideal body weight (IBW) correlated with patient outcome. Therefore, the use of IBW appeared to be more appropriate to calculate the colistin dosage. In addition, these results highlight the clinical significance of colistin MIC in patients with XDR A. baumannii pneumonia receiving colistin therapy. Although MICs were in the 'susceptible' range, patients infected with isolates with high colistin MICs showed a poorer clinical response rate than patients infected with isolates with low colistin MICs. Further clinical studies are needed to evaluate the roles of colistin MIC for predicting mortality in XDR A. baumannii pneumonia with a high colistin MIC. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  5. Intraventricular versus intravenous colistin for the treatment of extensively drug resistant Acinetobacter baumannii meningitis.


    De Bonis, P; Lofrese, G; Scoppettuolo, G; Spanu, T; Cultrera, R; Labonia, M; Cavallo, M A; Mangiola, A; Anile, C; Pompucci, A


    Reports on the safety and efficacy of intraventricularly administered (IVT) colistin for the treatment of Acinetobacter baumannii ventriculomeningitis in adults are limited and no comparative studies of IVT colistin versus intravenous (IV) therapy alone have been published. This study compared outcomes of patients with postneurosurgical ventriculomeningitis caused by extensively drug-resistant A. baumannii treated with IV colistin or IV plus IVT colistin. In an 11-year period, information on 18 consecutive patients with extensively drug-resistant A. baumannii ventriculomeningitis was collected. Infection was defined on the basis of (i) isolation of A. baumannii from the cerebrospinal fluid (CSF); (ii) laboratory evidence of CSF infection; (iii) signs/symptoms of central nervous system (CNS) infection. Patients were divided into group 1 (nine patients, IV colistin alone) and group 2 (nine patients, IV plus IVT colistin). Cerebrospinal fluid sterilization was documented for 12 of 18 patients (66.6%). The CSF sterilization rate was 33.3% in group 1 and 100% in group 2 (P = 0.009). The mean time to CSF sterilization was 21 days (range 8-48). Five patients died due to A. baumannii CNS infection (all in group 1), and five deaths were unrelated to A. baumannii ventriculomeningitis. Intensive care unit mean length of stay was shorter in group 2 (20.7 vs. 41.6 days, P = 0.046). Crude relative risk ratio of cumulative incidence of persistent CNS infection in group 1 versus group 2 was 13. No cases of chemical meningitis due to intrathecal colistin administration were encountered. Intraventricular colistin administration is much more effective than IV therapy alone and does not seem to add further toxicity. © 2015 EAN.

  6. Diversity of multi-drug resistant Acinetobacter baumannii population in a major hospital in Kuwait

    PubMed Central

    Vali, Leila; Dashti, Khadija; Opazo-Capurro, Andrés F.; Dashti, Ali A.; Al Obaid, Khaled; Evans, Benjamin A.


    Acinetobacter baumannii is one of the most important opportunistic pathogens that causes serious health care associated complications in critically ill patients. In the current study we report on the diversity of the clinical multi-drug resistant (MDR) A. baumannii in Kuwait by molecular characterization. One hundred A. baumannii were isolated from one of the largest governmental hospitals in Kuwait. Following the identification of the isolates by molecular methods, the amplified blaOXA-51-like gene product of one isolate (KO-12) recovered from blood showed the insertion of the ISAba19 at position 379 in blaOXA-78. Of the 33 MDR isolates, 28 (85%) contained blaOXA-23, 2 (6%) blaOXA-24 and 6 (18%) blaPER-1 gene. We did not detect blaOXA-58, blaVIM, blaIMP, blaGES, blaVEB, and blaNDM genes in any of the tested isolates. In three blaPER-1 positive isolates the genetic environment of blaPER-1 consisted of two copies of ISPa12 (tnpiA1) surrounding the blaPER-1 gene on a highly stable plasmid of ca. 140-kb. Multilocus-sequence typing (MLST) analysis of the 33 A. baumannii isolates identified 20 different STs, of which six (ST-607, ST-608, ST-609, ST-610, ST-611, and ST-612) were novel. Emerging STs such as ST15 (identified for the first time in the Middle East), ST78 and ST25 were also detected. The predominant clonal complex was CC2. Pulsed-field gel electrophoresis and MLST defined the MDR isolates as multi-clonal with diverse lineages. Our results lead us to believe that A. baumannii is diverse in clonal origins and/or is undergoing clonal expansion continuously while multiple lineages of MDR A. baumannii circulate in hospital ward simultaneously. PMID:26257720

  7. Repeated local emergence of carbapenem-resistant Acinetobacter baumannii in a single hospital ward

    PubMed Central

    Pham Thanh, Duy; Tran Do Hoan, Nhu; Wick, Ryan R.; Ingle, Danielle J.; Hawkey, Jane; Edwards, David J.; Kenyon, Johanna J.; Phu Huong Lan, Nguyen; Campbell, James I.; Thwaites, Guy; Thi Khanh Nhu, Nguyen; Hall, Ruth M.; Fournier-Level, Alexandre; Baker, Stephen; Holt, Kathryn E.


    We recently reported a dramatic increase in the prevalence of carbapenem-resistant Acinetobacter baumannii infections in the intensive care unit (ICU) of a Vietnamese hospital. This upsurge was associated with a specific oxa23-positive clone that was identified by multilocus VNTR analysis. Here, we used whole-genome sequence analysis to dissect the emergence of carbapenem-resistant A. baumannii causing ventilator-associated pneumonia (VAP) in the ICU during 2009–2012. To provide historical context and distinguish microevolution from strain introduction, we compared these genomes with those of A. baumannii asymptomatic carriage and VAP isolates from this same ICU collected during 2003–2007. We identified diverse lineages co-circulating over many years. Carbapenem resistance was associated with the presence of oxa23, oxa40, oxa58 and ndm1 genes in multiple lineages. The majority of resistant isolates were oxa23-positive global clone GC2; fine-scale phylogenomic analysis revealed five distinct GC2 sublineages within the ICU that had evolved locally via independent chromosomal insertions of oxa23 transposons. The increase in infections caused by carbapenem-resistant A. baumannii was associated with transposon-mediated transmission of a carbapenemase gene, rather than clonal expansion or spread of a carbapenemase-harbouring plasmid. Additionally, we found evidence of homologous recombination creating diversity within the local GC2 population, including several events resulting in replacement of the capsule locus. We identified likely donors of the imported capsule locus sequences amongst the A. baumannii isolated on the same ward, suggesting that diversification was largely facilitated via reassortment and sharing of genetic material within the localized A. baumannii population. PMID:28348846

  8. Outbreak of resistant Acinetobacter baumannii- measures and proposal for prevention and control.


    Romanelli, Roberta Maia de Castro; Jesus, Lenize Adriana de; Clemente, Wanessa Trindade; Lima, Stella Sala Soares; Rezende, Edna Maria; Coutinho, Rosane Luiza; Moreira, Ricardo Luiz Fontes; Neves, Francelli Aparecida Cordeiro; Brás, Nelma de Jesus


    Acinetobacter baumannii colonization and infection, frequent in Intensive Care Unit (ICU) patients, is commonly associated with high morbimortality. Several outbreaks due to multidrug-resistant (MDR) A. baumanii have been reported but few of them in Brazil. This study aimed to identify risk factors associated with colonization and infection by MDR and carbapenem-resistant A. baumannii strains isolated from patients admitted to the adult ICU at HC/UFMG. A case-control study was performed from January 2007 to June 2008. Cases were defined as patients colonized or infected by MDR/carbapenem-resistant A. baumannii, and controls were patients without MDR/carbapenem-resistant A. baumannii isolation, in a 1:2 proportion. For statistical analysis, due to changes in infection control guidelines, infection criteria and the notification process, this study was divided into two periods. During the first period analyzed, from January to December 2007, colonization or infection by MDR/carbapenem-resistant A. baumannii was associated with prior infection, invasive device utilization, prior carbapenem use and clinical severity. In the multivariate analysis, prior infection and mechanical ventilation proved to be statistically significant risk factors. Carbapenem use showed a tendency towards a statistical association. During the second study period, from January to June 2008, variables with a significant association with MDR/carbapenem-resistant A. baumannii colonization/infection were catheter utilization, carbapenem and third-generation cephalosporin use, hepatic transplantation, and clinical severity. In the multivariate analysis, only CVC use showed a statistical difference. Carbapenem and third-generation cephalosporin use displayed a tendency to be risk factors. Risk factors must be focused on infection control and prevention measures considering A. baumanni dissemination.

  9. Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin


    The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

  10. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.


    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu


    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital.

  11. Proteomic analysis of Acinetobacter baumannii in biofilm and planktonic growth mode.


    Shin, Ji-Hyun; Lee, Hee-Woo; Kim, Sung-Min; Kim, Jungmin


    Recently, multidrug-resistant clinical isolates of Acinetobacter baumannii have been found to have a high capacity to form biofilm. It is well known that bacterial cells within biofilms are highly resistant to antibiotics, UV light, acid exposure, dehydration, and phagocytosis in comparison to their planktonic counterparts, which suggests that the cells in a biofilm have altered metabolic activity. To determine which proteins are up-regulated in A. baumannii biofilm cells, we performed a proteomic analysis. A clinical isolate of A. baumannii 1656-2, which was characterized to have a high biofilm forming ability, was cultivated under biofilm and planktonic conditions. Outer membrane enriched A. baumannii 1656-2 proteins were separated by two-dimensional (2-D) gel electrophoresis and the differentially expressed proteins were identified by MALDI-TOF mass spectrometry. The proteins up-regulated or expressed only in biofilm cells of A. baumannii are categorized as follows: (i) proteins processing environmental information such as the outer membrane receptor protein involved in mostly Fe transport, a sensor histidine kinase/response regulator, and diguanylate cyclase (PAS-GGEDF-EAL domain); (ii) proteins involved in metabolism such as NAD-linked malate dehydrogenase, nucleoside-diphosphate sugar epimerase, putative GalE, ProFAR isomerase, and N-acetylmuramoyl-L: -alanine amidase; (iii) bacterial antibiotic resistance related proteins; and (iv) proteins related to gene repair such as exodeoxyribonuclease III and GidA. This proteomic analysis provides a fundamental platform for further studies to reveal the role of biofilm in the persistence and tolerance of A. baumannii.

  12. Repurposing the anticancer drug mitomycin C for the treatment of persistent Acinetobacter baumannii infections.


    Cruz-Muñiz, Martha Yumiko; López-Jacome, Luis Esau; Hernández-Durán, Melissa; Franco-Cendejas, Rafael; Licona-Limón, Paula; Ramos-Balderas, Jose Luis; Martinéz-Vázquez, Mariano; Belmont-Díaz, Javier A; Wood, Thomas K; García-Contreras, Rodolfo


    Acinetobacter baumannii is an emergent opportunistic bacterial pathogen responsible for recalcitrant infections owing to its high intrinsic tolerance to most antibiotics; therefore, suitable strategies to treat these infections are needed. One plausible approach is the repurposing of drugs that are already in use. Among them, anticancer drugs may be especially useful due their cytotoxic activities and ample similarities between bacterial infections and growing tumours. In this work, the effectiveness of four anticancer drugs on the growth of A. baumannii ATTC BAA-747 was evaluated, including the antimetabolite 5-fluorouracil and three DNA crosslinkers, namely cisplatin, mitomycin C (MMC) and merphalan. MMC was the most effective drug, having a minimum inhibitory concentration for 50% of growth in Luria-Bertani medium at ca. 7 µg/mL and completely inhibiting growth at 25 µg/mL. Hence, MMC was tested against a panel of 21 clinical isolates, including 18 multidrug-resistant (MDR) isolates, 3 of which were sensitive only to colistin. The minimum inhibitory concentrations and minimum bactericidal concentrations of MMC in all tested strains were found to be similar to those of A. baumannii ATCC BAA-747, and MMC also effectively killed stationary-phase, persister and biofilm cells. Moreover, MMC was able to increase survival of the insect larvae Galleria mellonella against an otherwise lethal A. baumannii infection from 0% to ≥53% for the antibiotic-sensitive A. baumannii ATCC BAA-747 strain and the MDR strains A560 and A578. Therefore, MMC is highly effective at killing the emergent opportunistic pathogen A. baumannii.

  13. Small, Enigmatic Plasmids of the Nosocomial Pathogen, Acinetobacter baumannii: Good, Bad, Who Knows?

    PubMed Central

    Lean, Soo Sum; Yeo, Chew Chieng


    Acinetobacter baumannii is a Gram-negative nosocomial pathogen that has become a serious healthcare concern within a span of two decades due to its ability to rapidly acquire resistance to all classes of antimicrobial compounds. One of the key features of the A. baumannii genome is an open pan genome with a plethora of plasmids, transposons, integrons, and genomic islands, all of which play important roles in the evolution and success of this clinical pathogen, particularly in the acquisition of multidrug resistance determinants. An interesting genetic feature seen in majority of A. baumannii genomes analyzed is the presence of small plasmids that usually ranged from 2 to 10 kb in size, some of which harbor antibiotic resistance genes and homologs of plasmid mobilization genes. These plasmids are often overlooked when compared to their larger, conjugative counterparts that harbor multiple antibiotic resistance genes and transposable elements. In this mini-review, we will examine our current knowledge of these small A. baumannii plasmids and look into their genetic diversity and phylogenetic relationships. Some of these plasmids, such as the Rep-3 superfamily group and the pRAY-type, which has no recognizable replicase genes, are quite widespread among diverse A. baumannii clinical isolates worldwide, hinting at their usefulness to the lifestyle of this pathogen. Other small plasmids especially those from the Rep-1 superfamily are truly enigmatic, encoding only hypothetical proteins of unknown function, leading to the question of whether these small plasmids are “good” or “bad” to their host A. baumannii. PMID:28861061

  14. Systematic Review of Antimicrobial Resistance of Clinical Acinetobacter baumannii Isolates in Iran: An Update.


    Razavi Nikoo, Hadi; Ardebili, Abdollah; Mardaneh, Jalal


    Treatment of Acinetobacter baumannii has become a medical challenge because of the increasing incidence of multiresistant strains and a lack of viable treatment alternatives. This systematic review attempts to investigate the changes in resistance of A. baumannii to different classes of antibiotics in Iran, with emphasis on the antimicrobial activity of polymyxin B (PMB) and colistin (COL). Biomedical databases were searched for English-published articles evaluating microbiological activity of various antimicrobial agents, including PMB and COL. Then, the available data were extracted and analyzed. Thirty-one studies, published from 2009 to 2015, were identified which contain data for 3,018 A. baumannii clinical isolates. With the exception of polymyxins and tigecycline (TIG), there was a high rate of resistance to various groups of antibiotics, including carbapenems. The minimum inhibitory concentration (MIC) ranges for PMB and COL on A. baumannii isolates tested were 0.12-64 μg/ml and 0.001-128 μg/ml, respectively. Polymyxins showed adequate activity with no significant trends in the resistance rate during most of the study period. The incidence of resistance to TIG was estimated low from 2% to 38.4% among the majority of A. baumannii. The present systematic review of the published literatures revealed that multidrug-resistant (including carbapenem-resistant) strains of A. baumannii have increased in Iran. In these circumstances, the older antibiotics, such as COL or PMB, preferably in combination with other antimicrobials (rifampicin, meropenem), could be considered as the therapeutic solution against the healthcare-associated infections. Designing rational dosage regimens for patients to maximize the antimicrobial activity and minimize the emergence and prevalence of resistance is recommended.

  15. Association of biofilm production with colonization among clinical isolates of Acinetobacter baumannii

    PubMed Central

    Ryu, Seong Yeol; Baek, Won-Ki; Kim, Hyun Ah


    Background/Aims The pathogen Acinetobacter baumannii is increasingly causing healthcare-associated infections worldwide, particularly in intensive care units. Biofilm formation, a factor contributing to the virulence of A. baumannii, is associated with long-term persistence in hospital environments. The present study investigates the clinical impact of biofilm production on colonization and acquisition after patient admission. Methods Forty-nine A. baumannii isolates were obtained between August and November 2013 from Keimyung University Dongsan Medical Center, Daegu, Korea. All isolates were obtained from sputum samples of new patients infected or colonized by A. baumannii. The microtiter plate assay was used to determine biofilm formation. Results Twenty-four A. baumannii isolates (48%) demonstrated enhanced biofilm formation capacity than that of the standard A. baumannii strain (ATCC 19606). All isolates were resistant to carbapenem, 38 isolates (77%) were collected from patients in an intensive care unit, and 47 isolates (95%) were from patients who had been exposed to antibiotics in the previous month. The median duration of colonization was longer for biofilm-producing isolates than that of the biofilm non-biofilm producing isolates (18 days vs. 12 days, p < 0.05). Simultaneous colonization with other bacteria was more common for biofilm-producing isolates than that for the non-biofilm producing isolates. The most prevalent co-colonizing bacteria was Staphylococcus aureus. Conclusions Biofilm-producing isolates seem to colonize the respiratory tract for longer durations than the non-biofilm producing isolates. During colonization, biofilm producers promote co-colonization by other bacteria, particularly S. aureus. Additional research is required to determine possible links between biofilm formation and nosocomial infection. PMID:27653617

  16. First report of an OXA-23 carbapenemase-producing Acinetobacter baumannii clinical isolate related to Tn2006 in Spain.


    Espinal, P; Macià, M D; Roca, I; Gato, E; Ruíz, E; Fernández-Cuenca, F; Oliver, A; Rodríguez-Baño, J; Bou, G; Tomás, M; Vila, J


    A carbapenem-resistant Acinetobacter baumannii clinical isolate belonging to European clone II and sequence type 2 was recovered from a patient in the Son Espases hospital in Mallorca, Spain. Genetic analysis showed the presence of the bla(OXA-23) gene in association with the widely disseminated transposon Tn2006. This is the first reported identification of A. baumannii carrying bla(OXA-23) in Spain.

  17. Whole-Genome Sequence of a Colombian Acinetobacter baumannii Strain, a Coproducer of OXA-72 and OXA-255-Like Carbapenemases

    PubMed Central

    Saavedra, Sandra Yamile; Prada-Cardozo, Diego; Pérez-Cardona, Hermes; Hidalgo, Andrea Melissa; González, María Nilse; Reguero, María T.; Valenzuela de Silva, Emilia M.; Mantilla, José R.; Falquet, Laurent; Barreto-Hernández, Emiliano; Duarte, Carolina


    ABSTRACT Colombian Acinetobacter baumannii strain ST920 was isolated from the sputum of a 68-year-old male patient. This isolate possessed blaOXA-72 and blaOXA-255-like genes. The assembled genome contained 4,104,098 pb and 38.79% G+C content. This is the first case reported of the coproduction (blaOXA-72 and blaOXA-255-like) of carbapenem-hydrolyzing class D β-lactamases (CHDLs) in Acinetobacter baumannii. PMID:28209815

  18. Characterizing in vivo pharmacodynamics of carbapenems against Acinetobacter baumannii in a murine thigh infection model to support breakpoint determinations.


    Macvane, Shawn H; Crandon, Jared L; Nicolau, David P


    Pharmacodynamic profiling data of carbapenems for Acinetobacter spp. are sparse. This study aimed to determine the pharmacodynamic targets of carbapenems for Acinetobacter baumannii based on a range of percentages of the dosing interval in which free drug concentrations remained above the MIC (fT>MIC) in the neutropenic murine thigh infection model. fT>MIC values of 23.7%, 32.8%, and 47.5% resulted in stasis, 1-log reductions, and 2-log reductions in bacterial density after 24 h, respectively. The pharmacodynamic targets of carbapenems for A. baumannii demonstrated in vivo are similar to those of other Gram-negative bacteria.

  19. DNA Microarray for Genotyping Antibiotic Resistance Determinants in Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Dally, Simon; Lemuth, Karin; Kaase, Martin; Rupp, Steffen; Knabbe, Cornelius


    In recent decades, Acinetobacter baumannii has emerged as an organism of great concern due to its ability to accumulate antibiotic resistance. In order to improve the diagnosis of resistance determinants in A. baumannii in terms of lead time and accuracy, we developed a microarray that can be used to detect 91 target sequences associated with antibiotic resistance within 4 h from bacterial culture to result. The array was validated with 60 multidrug-resistant strains of A. baumannii in a blinded, prospective study. The results were compared to phenotype results determined by the automated susceptibility testing system VITEK2. Antibiotics considered were piperacillin-tazobactam, ceftazidime, imipenem, meropenem, trimethoprim-sulfamethoxazole, amikacin, gentamicin, tobramycin, ciprofloxacin, and tigecycline. The average positive predictive value, negative predictive value, sensitivity, and specificity were 98, 98, 99, and 94%, respectively. For carbapenemase genes, the array results were compared to singleplex PCR results provided by the German National Reference Center for Gram-Negative Pathogens, and results were in complete concordance. The presented array is able to detect all relevant resistance determinants of A. baumannii in parallel. The short handling time of 4 h from culture to result helps to provide fast results in order to initiate adequate anti-infective therapy for critically ill patients. Another application would be data acquisition for epidemiologic surveillance. PMID:23856783

  20. Differential protection from tobramycin by extracellular polymeric substances from Acinetobacter baumannii and Staphylococcus aureus biofilms.


    Davenport, Emily K; Call, Douglas R; Beyenal, Haluk


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a "universal protector" by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg(2+) or Ca(2+) reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection.

  1. Serum Albumin and Ca2+ Are Natural Competence Inducers in the Human Pathogen Acinetobacter baumannii

    PubMed Central

    Traglia, German Matias; Quinn, Brettni; Schramm, Sareda T. J.; Soler-Bistue, Alfonso


    The increasing frequency of bacteria showing antimicrobial resistance (AMR) raises the menace of entering into a postantibiotic era. Horizontal gene transfer (HGT) is one of the prime reasons for AMR acquisition. Acinetobacter baumannii is a nosocomial pathogen with outstanding abilities to survive in the hospital environment and to acquire resistance determinants. Its capacity to incorporate exogenous DNA is a major source of AMR genes; however, few studies have addressed this subject. The transformation machinery as well as the factors that induce natural competence in A. baumannii are unknown. In this study, we demonstrate that naturally competent strain A118 increases its natural transformation frequency upon the addition of Ca2+or albumin. We show that comEA and pilQ are involved in this process since their expression levels are increased upon the addition of these compounds. An unspecific protein, like casein, does not reproduce this effect, showing that albumin's effect is specific. Our work describes the first specific inducers of natural competence in A. baumannii. Overall, our results suggest that the main protein in blood enhances HGT in A. baumannii, contributing to the increase of AMR in this threatening human pathogen. PMID:27270286

  2. Multidrug Resistance of Acinetobacter Baumannii in Ladoke Akintola University Teaching Hospital, Osogbo, Nigeria

    PubMed Central

    Odewale, G.; Adefioye, O. J.; Ojo, J.; Adewumi, F. A.; Olowe, O. A.


    Acinetobacter baumannii is a ubiquitous pathogen that has emerged as a major cause of healthcare-associated infections at Ladoke Akintola University Teaching Hospital. Isolates were assayed according to standard protocol. The isolates were subjected to molecular techniques to detect blaOXA, blaTEM, blaCTX-M, and blaSHV genes in strains of the A. baumannii isolates. The prevalence of A. baumannii was 8.5% and was most prevalent among patients in the age group 51–60 (36%); the male patients (63.6%) were more infected than their female counterparts. Patients (72.7%) in the intensive care unit (ICU) were most infected with this organism. The isolates showed 100% resistance to both amikacin and ciprofloxacin and 90.9% to both ceftriaxone and ceftazidime, while resistance to the other antibiotics used in this study were: piperacillin (81.8%), imipenem (72.7%), gentamycin (72.2%), and meropenem (63.6%). None of the isolates was, however, resistant to colistin. PCR results showed that blaOXA, blaTEM, and blaCTX-M genes were positive in some isolates, while blaSHV was not detected in any of the isolates. This study has revealed that the strains of A. baumannii isolated are multiple drug resistant. Regular monitoring, judicious prescription, and early detection of resistance to these antibiotics are, therefore, necessary to check further dissemination of the organism. PMID:27766173

  3. Acinetobacter baumannii phenylacetic acid metabolism influences infection outcome through a direct effect on neutrophil chemotaxis

    PubMed Central

    Bhuiyan, Md Saruar; Ellett, Felix; Murray, Gerald L.; Kostoulias, Xenia; Cerqueira, Gustavo M.; Schulze, Keith E.; Mahamad Maifiah, Mohd Hafidz; Li, Jian; Creek, Darren J.; Lieschke, Graham J.; Peleg, Anton Y.


    Innate cellular immune responses are a critical first-line defense against invading bacterial pathogens. Leukocyte migration from the bloodstream to a site of infection is mediated by chemotactic factors that are often host-derived. More recently, there has been a greater appreciation of the importance of bacterial factors driving neutrophil movement during infection. Here, we describe the development of a zebrafish infection model to study Acinetobacter baumannii pathogenesis. By using isogenic A. baumannii mutants lacking expression of virulence effector proteins, we demonstrated that bacterial drivers of disease severity are conserved between zebrafish and mammals. By using transgenic zebrafish with fluorescent phagocytes, we showed that a mutation of an established A. baumannii global virulence regulator led to marked changes in neutrophil behavior involving rapid neutrophil influx to a localized site of infection, followed by prolonged neutrophil dwelling. This neutrophilic response augmented bacterial clearance and was secondary to an impaired A. baumannii phenylacetic acid catabolism pathway, which led to accumulation of phenylacetate. Purified phenylacetate was confirmed to be a neutrophil chemoattractant. These data identify a previously unknown mechanism of bacterial-guided neutrophil chemotaxis in vivo, providing insight into the role of bacterial metabolism in host innate immune evasion. Furthermore, the work provides a potentially new therapeutic paradigm of targeting a bacterial metabolic pathway to augment host innate immune responses and attenuate disease. PMID:27506797

  4. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace

    PubMed Central

    Roca, Ignasi; Espinal, Paula; Vila-Farrés, Xavier; Vila, Jordi


    During the past few decades Acinetobacter baumannii has evolved from being a commensal dweller of health-care facilities to constitute one of the most annoying pathogens responsible for hospitalary outbreaks and it is currently considered one of the most important nosocomial pathogens. In a prevalence study of infections in intensive care units conducted among 75 countries of the five continents, this microorganism was found to be the fifth most common pathogen. Two main features contribute to the success of A. baumannii: (i) A. baumannii exhibits an outstanding ability to accumulate a great variety of resistance mechanisms acquired by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, integrons, transposons, or resistant islands, making this microorganism multi- or pan-drug-resistant and (ii) The ability to survive in the environment during prolonged periods of time which, combined with its innate resistance to desiccation and disinfectants, makes A. baumannii almost impossible to eradicate from the clinical setting. In addition, its ability to produce biofilm greatly contributes to both persistence and resistance. In this review, the pathogenesis of the infections caused by this microorganism as well as the molecular bases of antibacterial resistance and clinical aspects such as treatment and potential future therapeutic strategies are discussed in depth. PMID:22536199

  5. Acinetobacter baumannii infection was decreased by the structural renovation of a medical intensive care unit.


    Nah, Seong-Su; Park, Yun-Hee; Chung, Joo Won; Yoo, Sunmi; Hong, Sang Bum; Lim, Chae-Man; Koh, Younsuck


    The study aimed to determine whether improvements in intensive care unit (ICU) structural environment affect the incidence of ICU-acquired infections (IAIs), particularly those caused by multidrug-resistant pathogens. The incidence of IAI and the number of infections caused by organisms during the 6 months immediately before ICU renovation and during the 6 months immediately after ICU renovation were compared. The observational duration was prolonged for an additional 1 year after recruiting the after-renovation data to observe if the found effect of ICU structural renovation is maintained. The relevant data were prospectively gathered. The overall IAI incidence and distribution of infection site showed no difference in both periods. In IAI-causing pathogens, no considerable difference was found between before and after renovation, except for Acinetobacter baumannii. In comparison of the major pathogens' identification rate between the entire hospital and the renovated ICU during the study periods, only A baumannii cases in the renovated ICU significantly decreased. However, the reduction of the IAI cases by A baumannii was not sustained for more than 1 year. These results suggest that structural ICU renovations only may not improve overall IAI incidence, except for transient decrease in IAI by A baumannii. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Isolation and Characterization of Acinetobacter baumannii Recovered from Campylobacter Selective Medium

    PubMed Central

    Fernando, Dinesh M.; Khan, Izhar U. H.; Patidar, Rakesh; Lapen, David R.; Talbot, Guylaine; Topp, Edward; Kumar, Ayush


    Acinetobacter baumannii, a Gram-negative opportunistic pathogen, is known to cause multidrug resistant infections. This organism has primarily been isolated from clinical environments and its environmental reservoirs remain largely unknown. In the present study, we recovered seven isolates of A. baumannii growing under conditions selective for Campylobacter spp. (microaerophilic at 42°C and in the presence of antibiotics) from dairy cattle manure storage tank or surface water impacted by livestock effluents. Antibiotic susceptibility tests revealed that all of these isolates were less susceptible to at least two different clinically relevant antibiotics, compared to the type strain A. baumannii ATCC17978. Expression of resistance-nodulation-division efflux pumps, an important mechanism of intrinsic resistance in these organisms, was analyzed, and adeB was found to be overexpressed in one and adeJ was overexpressed in three isolates. Comparison of these isolates using genomic DNA Macro-Restriction Fragment Pattern Analysis (MRFPA) revealed relatively low relatedness among themselves or with some of the clinical isolates from previous studies. This study suggests that A. baumannii isolates are capable of growing under selective conditions for Campylobacter spp. and that this organism can be present in manure and water. PMID:27917170

  7. Differential Protection from Tobramycin by Extracellular Polymeric Substances from Acinetobacter baumannii and Staphylococcus aureus Biofilms

    PubMed Central

    Davenport, Emily K.; Call, Douglas R.


    We investigated biofilms of two pathogens, Acinetobacter baumannii and Staphylococcus aureus, to characterize mechanisms by which the extracellular polymeric substance (EPS) found in biofilms can protect bacteria against tobramycin exposure. To do so, it is critical to study EPS-antibiotic interactions in a homogeneous environment without mass transfer limitations. Consequently, we developed a method to grow biofilms, harvest EPS, and then augment planktonic cultures with isolated EPS and tobramycin. We demonstrated that planktonic cultures respond differently to being treated with different types of EPS (A. baumannii versus S. aureus) in the presence of tobramycin. By harvesting EPS from the biofilms, we found that A. baumannii EPS acts as a “universal protector” by inhibiting tobramycin activity against bacterial cells regardless of species; S. aureus EPS did not show any protective ability in cell cultures. Adding Mg2+ or Ca2+ reduced the protective effect of A. baumannii EPS. Finally, when we selectively digested the proteins or DNA of the EPS, we found that the protective ability did not change, suggesting that neither has a significant role in protection. To the best of our knowledge, this is the first study that demonstrates how EPS protects pathogens against antibiotics in a homogeneous system without mass transfer limitations. Our results suggest that EPS protects biofilm communities, in part, by adsorbing antibiotics near the surface. This may limit antibiotic diffusion to the bottom of the biofilms but is not likely to be the only mechanism of protection. PMID:24913166

  8. Serum Albumin and Ca2+ Are Natural Competence Inducers in the Human Pathogen Acinetobacter baumannii.


    Traglia, German Matias; Quinn, Brettni; Schramm, Sareda T J; Soler-Bistue, Alfonso; Ramirez, Maria Soledad


    The increasing frequency of bacteria showing antimicrobial resistance (AMR) raises the menace of entering into a postantibiotic era. Horizontal gene transfer (HGT) is one of the prime reasons for AMR acquisition. Acinetobacter baumannii is a nosocomial pathogen with outstanding abilities to survive in the hospital environment and to acquire resistance determinants. Its capacity to incorporate exogenous DNA is a major source of AMR genes; however, few studies have addressed this subject. The transformation machinery as well as the factors that induce natural competence in A. baumannii are unknown. In this study, we demonstrate that naturally competent strain A118 increases its natural transformation frequency upon the addition of Ca(2+)or albumin. We show that comEA and pilQ are involved in this process since their expression levels are increased upon the addition of these compounds. An unspecific protein, like casein, does not reproduce this effect, showing that albumin's effect is specific. Our work describes the first specific inducers of natural competence in A. baumannii Overall, our results suggest that the main protein in blood enhances HGT in A. baumannii, contributing to the increase of AMR in this threatening human pathogen.

  9. Thai ethnomedicinal plants as resistant modifying agents for combating Acinetobacter baumannii infections

    PubMed Central


    Abstracts Background Acinetobacter baumannii is well-recognized as an important nosocomial pathogen, however, due to their intrinsic resistance to several antibiotics, treatment options are limited. Synergistic effects between antibiotics and medicinal plants, particularly their active components, have intensively been studied as alternative approaches. Methods Fifty-one ethanol extracts obtained from 44 different selected medicinal plant species were tested for resistance modifying agents (RMAs) of novobiocin against A. baumannii using growth inhibition assay. Results At 250 μg/ml, Holarrhena antidysenterica, Punica granatum, Quisqualis indica, Terminalia bellirica, Terminalia chebula, and Terminalia sp. that possessed low intrinsic antibacterial activity significantly enhanced the activity of novobiocin at 1 μg/ml (1/8xminimum inhibitory concentration) against this pathogen. Holarrhena antidysenterica at 7.8 μg/ml demonstrated remarkable resistant modifying ability against A. baumannii in combination with novobiocin. The phytochemical study revealed that constituents of this medicinal plant contain alkaloids, condensed tannins, and triterpenoids. Conclusion The use of Holarrhena antidysenterica in combination with novobiocin provides an effective alternative treatment for multidrug resistant A. baumannii infections. PMID:22536985

  10. Emergence of Acinetobacter baumannii ST730 carrying the blaOXA-72 gene in Brazil.


    Pagano, Mariana; Rozales, Franciéli P; Bertolini, Diego; Rocha, Lisiane; Sampaio, Jorge Lm; Barth, Afonso L; Martins, Andreza F


    Over the last decade, Acinetobacter baumannii resistant to carbapenems has emerged in many medical centres and has been commonly associated with high morbimortality. In Brazil, this resistance is mainly attributed to the spread of OXA-23-producing clones and, to a lesser extent, to OXA-143-producing clones. Here, we describe, for the first time, two OXA-72-producing A. baumannii isolates in southern Brazil to a broad spectrum of antibiotics, except polymyxin B and tigecycline. Molecular typing by multilocus sequence typing (MLST) demonstrated that both OXA-72-producing isolates belong to a new sequence type (ST), ST730, which was recently identified in OXA-23-producing A. baumannii isolates in São Paulo, Brazil. We demonstrate that the two A. baumannii ST730 isolates carrying blaOXA-72share a common ancestral origin with the blaOXA-23producers in Brazil. This observation reinforces the importance of strain-typing methods in order to clarify the dynamics of the emergence of new clones in a geographic region.

  11. Emergence of Acinetobacter baumannii ST730 carrying the bla OXA-72 gene in Brazil

    PubMed Central

    Pagano, Mariana; Rozales, Franciéli P; Bertolini, Diego; Rocha, Lisiane; Sampaio, Jorge LM; Barth, Afonso L; Martins, Andreza F


    Over the last decade, Acinetobacter baumannii resistant to carbapenems has emerged in many medical centres and has been commonly associated with high morbimortality. In Brazil, this resistance is mainly attributed to the spread of OXA-23-producing clones and, to a lesser extent, to OXA-143-producing clones. Here, we describe, for the first time, two OXA-72-producing A. baumannii isolates in southern Brazil to a broad spectrum of antibiotics, except polymyxin B and tigecycline. Molecular typing by multilocus sequence typing (MLST) demonstrated that both OXA-72-producing isolates belong to a new sequence type (ST), ST730, which was recently identified in OXA-23-producing A. baumannii isolates in São Paulo, Brazil. We demonstrate that the two A. baumannii ST730 isolates carrying blaOXA-72share a common ancestral origin with the blaOXA-23producers in Brazil. This observation reinforces the importance of strain-typing methods in order to clarify the dynamics of the emergence of new clones in a geographic region. PMID:27653364

  12. Comparative transcriptomics analyses of the different growth states of multidrug-resistant Acinetobacter baumannii.


    Li, Shuai; Li, Haitao; Qi, Tianjie; Yan, Xixin; Wang, Boli; Guan, Jitao; Li, Yu


    Multidrug-resistant (MDR) Acinetobacter baumannii is an important bacterial pathogen commonly associated with hospital acquired infections. A. baumannii can remain viable and hence virulent in the environment for a long period of time due primarily to its ability to form biofilms. A total of 459 cases of MDR A. baumannii our hospital collected from March 2014 to March 2015 were examined in this study, and a representative isolate selected for high-throughput mRNA sequencing and comparison of gene expression profiles under the biofilm and exponential growth conditions. Our study found that the same bacteria indeed exhibited differential mRNA expression under different conditions. Compared to the rapidly growing bacteria, biofilm bacteria had 106 genes upregulated and 92 genes downregulated. Bioinformatics analyses suggested that many of these genes are involved in the formation and maintenance of biofilms, whose expression also depends on the environment and specific signaling pathways and transcription factors that are absent in the log phase bacteria. These differentially expressed mRNAs might contribute to A. baumannii's unique pathogenicity and ability to inflict chronic and recurrent infections.

  13. Characterisation of successive Acinetobacter baumannii isolates from a deceased haemophagocytic lymphohistiocytosis patient.


    Choi, Hyeon Jin; Kil, Min Cheol; Choi, Ji-Young; Kim, Sun Ju; Park, Ki-Sup; Kim, Yae-Jean; Ko, Kwan Soo


    In this study, 38 Acinetobacter baumannii isolates successively isolated from blood, skin swabs and tracheal aspirates from a single patient who died from haemophagocytic lymphohistiocytosis were investigated. The isolates were collected between March 2012 and August 2012. A. baumannii genotypes were determined by multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). In vitro antimicrobial susceptibility testing was performed and colistin heteroresistance and persistence were evaluated. The structure of AbaR resistance islands was explored, and serum sensitivity was determined. Based on MLST analysis, all 38 A. baumannii isolates showed the same sequence type (ST138). However, PFGE analysis showed that isolates from blood samples belonged to different genotypes depending on the isolation time: whilst blood isolates obtained at the early stages showed restriction patterns similar to those of isolates from other sources, isolates obtained at later stages exhibited a distinct pattern. All isolates were resistant to imipenem, cefepime, ciprofloxacin and piperacillin/tazobactam. Five isolates from tracheal aspirates and one from a skin swab were resistant to polymyxins, and two isolates from skin swabs and one from another source were non-susceptible to tigecycline. All colistin-susceptible isolates showed heteroresistance to colistin, and four were persisters. Isolates from blood showed higher survival rates against human serum than those from other sources. This study shows that the patient was infected with more than one A. baumannii strain. Heteroresistance, persistence or evasion of the innate immune response may explain the failure of antimicrobial treatments in this patient.

  14. Association of the outer membrane protein Omp33 with fitness and virulence of Acinetobacter baumannii.


    Smani, Younes; Dominguez-Herrera, Juan; Pachón, Jerónimo


    Outer membrane protein 33 (Omp33) is an outer membrane porin of Acinetobacter baumannii associated with carbapenem resistance. However, the role of Omp33 in the fitness and virulence of A. baumannii remains unknown. In the present study, we investigated the role of Omp33 in fitness and virulence of A. baumannii by using an isogenic knockout strain deficient in the omp33 gene (JPAB02), derived from the ATCC 17978 wild-type (wt). Both in vitro and in vivo defect in the growth rate was found in the JPAB02 strain in competition with the ATCC 17978 wt, highlighting the effect of Omp33 on the metabolic fitness. A significant reduction was observed both in adherence and invasion of human lung epithelial cells and in cytotoxicity of these cells and macrophages with JPAB02. In a murine peritoneal sepsis model, the JPAB02 strain exhibited lower lethal dose 0 (LD0), LD50, and LD100, and dissemination in mice, with reduced bacterial concentration in spleen and lungs. From these data, we concluded that Omp33 plays an important role for fitness and virulence of A. baumannii.

  15. Screening of nuclear targeting proteins in Acinetobacter baumannii based on nuclear localization signals.


    Moon, Dong Chan; Gurung, Mamata; Lee, Jung Hwa; Lee, Yong Seok; Choi, Chi Won; Kim, Seung Il; Lee, Je Chul


    Nuclear targeting of bacterial proteins is an emerging pathogenic mechanism in bacteria. However, due to the absence of an appropriate screening system for nuclear targeting proteins, systematic approaches to nuclear targeting of bacterial proteins and subsequent host cell pathology are limited. In this study, we developed a screening system for nuclear targeting proteins in Acinetobacter baumannii using a combination of bioinformatic analysis based on nuclear localization signal (NLS) and the Gateway(®) recombinational cloning system. Among 3367 open reading frames of A. baumannii ATCC 17978, 34 functional or hypothetical proteins were predicted to carry the putative NLS sequences. Of the 29 clones generated by the Gateway(®) recombinational cloning system, 14 proteins tagged with green fluorescent protein (GFP) were targeted to nuclei of host cells. Among the 14 nuclear targeting proteins, S21, L20, and L32 ribosomal proteins and transposase carried putative nuclear export signal (NES) sequences, but only transposase harbored the functional NES. After translocation to nuclei of host cells, four A. baumannii proteins induced cytotoxicity. In conclusion, we have developed a screening system for nuclear targeting proteins in A. baumannii. This system may open the way to a new field of bacterial pathogenesis.

  16. The Effect of Colistin Resistance-Associated Mutations on the Fitness of Acinetobacter baumannii.


    Mu, Xinli; Wang, Nanfei; Li, Xi; Shi, Keren; Zhou, Zhihui; Yu, Yunsong; Hua, Xiaoting


    Acinetobacter baumannii had emerged as an important nosocomial and opportunistic pathogen worldwide. To assess the evolution of colistin resistance in A. baumannii and its effect on bacterial fitness, we exposed five independent colonies of A. baumannii ATCC 17978 to increasing concentrations of colistin in agar (4/5) and liquid media (1/5). Stable resistant isolates were analyzed using whole genome sequencing. All strains were colistin resistant after exposure to colistin. In addition to the previously reported lpxCAD and pmrAB mutations, we identified four novel putative colistin resistance genes: A1S_1983. hepA. A1S_3026, and rsfS. Lipopolysaccharide (LPS) loss mutants exhibited higher fitness costs than those of the pmrB mutant in nutrient-rich medium. The colistin-resistant mutants had a higher inhibition ratio in the serum growth experiment than that of the wild type strain in 100% serum. Minimum inhibitory concentration (MIC) results showed that the LPS-deficient but not the pmrB mutant had an altered antibiotic resistance profile. The compensatory mutations partially or completely rescued the LPS-deficient's fitness, suggesting that compensatory mutations play an important role in the emergence and spread of colistin resistance in A. baumannii.

  17. The Effect of Colistin Resistance-Associated Mutations on the Fitness of Acinetobacter baumannii

    PubMed Central

    Mu, Xinli; Wang, Nanfei; Li, Xi; Shi, Keren; Zhou, Zhihui; Yu, Yunsong; Hua, Xiaoting


    Acinetobacter baumannii had emerged as an important nosocomial and opportunistic pathogen worldwide. To assess the evolution of colistin resistance in A. baumannii and its effect on bacterial fitness, we exposed five independent colonies of A. baumannii ATCC 17978 to increasing concentrations of colistin in agar (4/5) and liquid media (1/5). Stable resistant isolates were analyzed using whole genome sequencing. All strains were colistin resistant after exposure to colistin. In addition to the previously reported lpxCAD and pmrAB mutations, we identified four novel putative colistin resistance genes: A1S_1983. hepA. A1S_3026, and rsfS. Lipopolysaccharide (LPS) loss mutants exhibited higher fitness costs than those of the pmrB mutant in nutrient-rich medium. The colistin-resistant mutants had a higher inhibition ratio in the serum growth experiment than that of the wild type strain in 100% serum. Minimum inhibitory concentration (MIC) results showed that the LPS-deficient but not the pmrB mutant had an altered antibiotic resistance profile. The compensatory mutations partially or completely rescued the LPS-deficient’s fitness, suggesting that compensatory mutations play an important role in the emergence and spread of colistin resistance in A. baumannii. PMID:27847502

  18. Identification and Characterization of an Acinetobacter baumannii Biofilm-Associated Protein▿

    PubMed Central

    Loehfelm, Thomas W.; Luke, Nicole R.; Campagnari, Anthony A.


    We have identified a homologue to the staphylococcal biofilm-associated protein (Bap) in a bloodstream isolate of Acinetobacter baumannii. The fully sequenced open reading frame is 25,863 bp and encodes a protein with a predicted molecular mass of 854 kDa. Analysis of the nucleotide sequence reveals a repetitive structure consistent with bacterial cell surface adhesins. Bap-specific monoclonal antibody (MAb) 6E3 was generated to an epitope conserved among 41% of A. baumannii strains isolated during a recent outbreak in the U.S. military health care system. Flow cytometry confirms that the MAb 6E3 epitope is surface exposed. Random transposon mutagenesis was used to generate A. baumannii bap1302::EZ-Tn5, a mutant negative for surface reactivity to MAb 6E3 in which the transposon disrupts the coding sequence of bap. Time course confocal laser scanning microscopy and three-dimensional image analysis of actively growing biofilms demonstrates that this mutant is unable to sustain biofilm thickness and volume, suggesting a role for Bap in supporting the development of the mature biofilm structure. This is the first identification of a specific cell surface protein directly involved in biofilm formation by A. baumannii and suggests that Bap is involved in intercellular adhesion within the mature biofilm. PMID:18024522

  19. Active and Passive Immunization Protects against Lethal, Extreme Drug Resistant-Acinetobacter baumannii Infection

    PubMed Central

    Luo, Guanpingshen; Lin, Lin; Ibrahim, Ashraf S.; Baquir, Beverlie; Pantapalangkoor, Paul; Bonomo, Robert A.; Doi, Yohei; Adams, Mark D.; Russo, Thomas A.; Spellberg, Brad


    Extreme-drug-resistant (XDR) Acinetobacter baumannii is a rapidly emerging pathogen causing infections with unacceptably high mortality rates due to inadequate available treatment. New methods to prevent and treat such infections are a critical unmet medical need. To conduct a rational vaccine discovery program, OmpA was identified as the primary target of humoral immune response after intravenous infection by A. baumannii in mice. OmpA was >99% conserved at the amino acid level across clinical isolates harvested between 1951 and 2009 from cerebrospinal fluid, blood, lung, and wound infections, including carbapenem-resistant isolates, and was ≥89% conserved among other sequenced strains, but had minimal homology to the human proteome. Vaccination of diabetic mice with recombinant OmpA (rOmpA) with aluminum hydroxide adjuvant markedly improved survival and reduced tissue bacterial burden in mice infected intravenously. Vaccination induced high titers of anti-OmpA antibodies, the levels of which correlated with survival in mice. Passive transfer with immune sera recapitulated protection. Immune sera did not enhance complement-mediated killing but did enhance opsonophagocytic killing of A. baumannii. These results define active and passive immunization strategies to prevent and treat highly lethal, XDR A. baumannii infections. PMID:22253723

  20. 2-DE analysis indicates that Acinetobacter baumannii displays a robust and versatile metabolism

    PubMed Central

    Soares, Nelson C; Cabral, Maria P; Parreira, José R; Gayoso, Carmen; Barba, Maria J; Bou, Germán


    Background Acinetobacter baumannii is a nosocomial pathogen that has been associated with outbreak infections in hospitals. Despite increasing awareness about this bacterium, its proteome remains poorly characterised, however recently the complete genome of A. baumannii reference strain ATCC 17978 has been sequenced. Here, we have used 2-DE and MALDI-TOF/TOF approach to characterise the proteome of this strain. Results The membrane and cytoplasmatic protein extracts were analysed separately, these analyses revealed the reproducible presence of 239 and 511 membrane and cytoplamatic protein spots, respectively. MALDI-TOF/TOF characterisation identified a total of 192 protein spots (37 membrane and 155 cytoplasmatic) and revealed that the identified membrane proteins were mainly transport-related proteins, whereas the cytoplasmatic proteins were of diverse nature, although mainly related to metabolic processes. Conclusion This work indicates that A. baumannii has a versatile and robust metabolism and also reveal a number of proteins that may play a key role in the mechanism of drug resistance and virulence. The data obtained complements earlier reports of A. baumannii proteome and provides new tools to increase our knowledge on the protein expression profile of this pathogen. PMID:19785748

  1. The Immune Response against Acinetobacter baumannii, an Emerging Pathogen in Nosocomial Infections.


    García-Patiño, María Guadalupe; García-Contreras, Rodolfo; Licona-Limón, Paula


    Acinetobacter baumannii is the etiologic agent of a wide range of nosocomial infections, including pneumonia, bacteremia, and skin infections. Over the last 45 years, an alarming increase in the antibiotic resistance of this opportunistic microorganism has been reported, a situation that hinders effective treatments. In order to develop effective therapies against A. baumannii it is crucial to understand the basis of host-bacterium interactions, especially those concerning the immune response of the host. Different innate immune cells such as monocytes, macrophages, dendritic cells, and natural killer cells have been identified as important effectors in the defense against A. baumannii; among them, neutrophils represent a key immune cell indispensable for the control of the infection. Several immune strategies to combat A. baumannii have been identified such as recognition of the bacteria by immune cells through pattern recognition receptors, specifically toll-like receptors, which trigger bactericidal mechanisms including oxidative burst and cytokine and chemokine production to amplify the immune response against the pathogen. However, a complete picture of the protective immune strategies activated by this bacteria and its potential therapeutic use remains to be determined and explored.

  2. Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii.


    Da Silva, Gabriela Jorge; Domingues, Sara


    Horizontal gene transfer (HGT) is a driving force to the evolution of bacteria. The fast emergence of antimicrobial resistance reflects the ability of genetic adaptation of pathogens. Acinetobacter baumannii has emerged in the last few decades as an important opportunistic nosocomial pathogen, in part due to its high capacity of acquiring resistance to diverse antibiotic families, including to the so-called last line drugs such as carbapenems. The rampant selective pressure and genetic exchange of resistance genes hinder the effective treatment of resistant infections. A. baumannii uses all the resistance mechanisms to survive against carbapenems but production of carbapenemases are the major mechanism, which may act in synergy with others. A. baumannii appears to use all the mechanisms of gene dissemination. Beyond conjugation, the mostly reported recent studies point to natural transformation, transduction and outer membrane vesicles-mediated transfer as mechanisms that may play a role in carbapenemase determinants spread. Understanding the genetic mobilization of carbapenemase genes is paramount in preventing their dissemination. Here we review the carbapenemases found in A. baumannii and present an overview of the current knowledge of contributions of the various HGT mechanisms to the molecular epidemiology of carbapenem resistance in this relevant opportunistic pathogen.

  3. Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Da Silva, Gabriela Jorge; Domingues, Sara


    Horizontal gene transfer (HGT) is a driving force to the evolution of bacteria. The fast emergence of antimicrobial resistance reflects the ability of genetic adaptation of pathogens. Acinetobacter baumannii has emerged in the last few decades as an important opportunistic nosocomial pathogen, in part due to its high capacity of acquiring resistance to diverse antibiotic families, including to the so-called last line drugs such as carbapenems. The rampant selective pressure and genetic exchange of resistance genes hinder the effective treatment of resistant infections. A. baumannii uses all the resistance mechanisms to survive against carbapenems but production of carbapenemases are the major mechanism, which may act in synergy with others. A. baumannii appears to use all the mechanisms of gene dissemination. Beyond conjugation, the mostly reported recent studies point to natural transformation, transduction and outer membrane vesicles-mediated transfer as mechanisms that may play a role in carbapenemase determinants spread. Understanding the genetic mobilization of carbapenemase genes is paramount in preventing their dissemination. Here we review the carbapenemases found in A. baumannii and present an overview of the current knowledge of contributions of the various HGT mechanisms to the molecular epidemiology of carbapenem resistance in this relevant opportunistic pathogen. PMID:27681923

  4. A case of necrotizing fasciitis with septic shock in a cat caused by Acinetobacter baumannii.


    Brachelente, Chiara; Wiener, Dominique; Malik, Yasminda; Huessy, Daniela


    A 4-year-old, neutered female, domestic shorthair cat admitted to the animal hospital for recurrent constipation presumed to be due to post-traumatic injuries, went into shock with signs including fever and ataxia followed by stupor. On the fifth day of hospitalization, the cat developed severe, diffuse oedema of the ventral abdomen with multifocal to coalescing erythematous areas and small vesicle formation. The results of bacteriological cultures of liver, spleen and kidney specimens led to the diagnosis of Acinetobacter baumannii sepsis. Histopathological findings of skin samples taken during necropsy showed an extensive epidermal and dermal necrosis with septic vasculitis and numerous intralesional gram-negative bacteria. Detection of the bla(OXA-51-like) gene specific for A. baumannii by PCR, performed retrospectively on samples of the deep layers of the skin, confirmed the presence of A. baumannii also in the cutaneous lesions. To our knowledge this is the first report of a necrotizing fasciitis with septic shock in a cat caused by A. baumannii.

  5. Effectiveness of hand-cleansing agents for removing Acinetobacter baumannii strain from contaminated hands.


    Cardoso, C L; Pereira, H H; Zequim, J C; Guilhermetti, M


    The effectiveness of hand-cleansing agents (plain liquid soap, 70% ethyl alcohol, 10% povidone-iodine, and 4% chlorhexidine gluconate) for removing a hospital strain of Acinetobacter baumannii from artificially contaminated hands of 5 volunteers was studied. The experiments were performed by using a Latin square statistical design, with two 5 x 4 randomized blocks, and the results were estimated by ANOVA. In the first and second blocks, the fingertips of the volunteers were contaminated with approximately 10(3) colony-forming units (light contamination hand) and 10(6) colony-forming units (heavy contamination hand), respectively. In the first block, all products tested were effective, almost completely removing the microbial population of A baumannii artificially applied to the hands. In the second block, the use of hand-cleansing agents resulted in 91.36% (4% chlorhexidine), 92.33% (liquid soap), 98.49% (10% povidone-iodine), and 98.93% (70% ethyl alcohol) reduction in counts of A baumannii cells applied to the fingertips. The ethyl alcohol and povidone-iodine had significantly higher removal rates than plain soap and chlorhexidine (P <.05). These results suggest that 70% ethyl alcohol and 10% povidone-iodine may be the most effective hand-cleansing agents for removing A baumannii strain from heavily contaminated hands (10(6) colony-forming units/fingertip).

  6. Detoxification of Indole by an Indole-Induced Flavoprotein Oxygenase from Acinetobacter baumannii

    PubMed Central

    Lin, Guang-Huey; Chen, Hao-Ping; Shu, Hung-Yu


    Indole, a derivative of the amino acid tryptophan, is a toxic signaling molecule, which can inhibit bacterial growth. To overcome indole-induced toxicity, many bacteria have developed enzymatic defense systems to convert indole to non-toxic, water-insoluble indigo. We previously demonstrated that, like other aromatic compound-degrading bacteria, Acinetobacter baumannii can also convert indole to indigo. However, no work has been published investigating this mechanism. Here, we have shown that the growth of wild-type A. baumannii is severely inhibited in the presence of 3.5 mM indole. However, at lower concentrations, growth is stable, implying that the bacteria may be utilizing a survival mechanism to oxidize indole. To this end, we have identified a flavoprotein oxygenase encoded by the iifC gene of A. baumannii. Further, our results suggest that expressing this recombinant oxygenase protein in Escherichia coli can drive indole oxidation to indigo in vitro. Genome analysis shows that the iif operon is exclusively present in the genomes of A. baumannii and Pseudomonas syringae pv. actinidiae. Quantitative PCR and Western blot analysis also indicate that the iif operon is activated by indole through the AraC-like transcriptional regulator IifR. Taken together, these data suggest that this species of bacteria utilizes a novel indole-detoxification mechanism that is modulated by IifC, a protein that appears to be, at least to some extent, regulated by IifR. PMID:26390211

  7. Anthelmintic closantel enhances bacterial killing of polymyxin B against multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Tran, Thien B.; Cheah, Soon-Ee; Yu, Heidi H.; Bergen, Phillip J.; Nation, Roger L.; Creek, Darren J.; Purcell, Anthony; Forrest, Alan; Doi, Yohei; Song, Jiangning; Velkov, Tony; Li, Jian


    Polymyxins, an old class of antibiotics, are currently used as the last resort for the treatment of multidrug-resistant (MDR) Acinetobacter baumannii. However, recent pharmacokinetic and pharmacodynamic data indicate that monotherapy can lead to the development of resistance. Novel approaches are urgently needed to preserve and improve the efficacy of this last-line class of antibiotics. This study examined the antimicrobial activity of novel combination of polymyxin B with anthelmintic closantel against A. baumannii. Closantel monotherapy (16 mg/L) was ineffective against most tested A. baumannii isolates. However, closantel at 4–16 mg/L with a clinically achievable concentration of polymyxin B (2 mg/L) successfully inhibited the development of polymyxin resistance in polymyxin-susceptible isolates, and provided synergistic killing against polymyxin-resistant isolates (MIC ≥4 mg/L). Our findings suggest that the combination of polymyxin B with closantel could be potentially useful for the treatment of MDR, including polymyxin-resistant, A. baumannii infections. The re-positioning of non-antibiotic drugs to treat bacterial infections may significantly expedite discovery of new treatment options for bacterial ‘superbugs’. PMID:26669752

  8. Anthelmintic closantel enhances bacterial killing of polymyxin B against multidrug-resistant Acinetobacter baumannii.


    Tran, Thien B; Cheah, Soon-Ee; Yu, Heidi H; Bergen, Phillip J; Nation, Roger L; Creek, Darren J; Purcell, Anthony; Forrest, Alan; Doi, Yohei; Song, Jiangning; Velkov, Tony; Li, Jian


    Polymyxins, an old class of antibiotics, are currently used as the last resort for the treatment of multidrug-resistant (MDR) Acinetobacter baumannii. However, recent pharmacokinetic and pharmacodynamic data indicate that monotherapy can lead to the development of resistance. Novel approaches are urgently needed to preserve and improve the efficacy of this last-line class of antibiotics. This study examined the antimicrobial activity of novel combination of polymyxin B with anthelmintic closantel against A. baumannii. Closantel monotherapy (16 mg l(-1)) was ineffective against most tested A. baumannii isolates. However, closantel at 4-16 mg l(-1) with a clinically achievable concentration of polymyxin B (2 mg l(-1)) successfully inhibited the development of polymyxin resistance in polymyxin-susceptible isolates, and provided synergistic killing against polymyxin-resistant isolates (MIC ⩾4 mg l(-1)). Our findings suggest that the combination of polymyxin B with closantel could be potentially useful for the treatment of MDR, including polymyxin-resistant, A. baumannii infections. The repositioning of non-antibiotic drugs to treat bacterial infections may significantly expedite discovery of new treatment options for bacterial 'superbugs'.

  9. Biotypes, serovars and antimicrobial resistance patterns of Acinetobacter baumannii clinical isolates.


    Oliveira, M G; Irino, K; Vaz, T M; Gonçalves, C R; Levy, C E


    255 Acinetobacter strains, from clinical specimens of inpatients and outpatients, were identified phenotypically according to the new taxonomy proposed by Bouvet and Grimont. A. baumannii was the most frequent species (80.8%). This species underwent biotyping and serotyping according to the scheme of Bouvet and Grimont, and that of Traub, respectively, 81.2% of samples belonged to biotypes 2, 6 and 9 with a predominance of biotype 2. 86.6% of the strains could be serotyped; 2 new serotypes were encountered. The new serotype 29, being the most frequently isolated, was related to biotype 2 (86.6%), whereas serotype 13 was related to biotype 6 (84.8%). These clones presented marked multiple resistance patterns and were widespread in different wards. No outbreak was reported during the period studied. These phenotypical methods proved to be useful in differentiating strains of A. baumannii and, if used together, they showed a high discriminatory power.

  10. Antibiotic resistance determinants of a group of multidrug-resistant Acinetobacter baumannii in China.


    Xiao-Min, Xu; You-Fen, Fan; Wei-Yun, Feng; Zu-Huang, Mi; Xing-Bei, Weng


    A group of Acinetobacter baumannii confers multidrug resistance, but the molecular epidemiology and multidrug resistance mechanisms are poorly understood. Nineteen isolates were identified, and the antimicrobial susceptibility profile was determined using the disc diffusion method. Then, PCR of 78 kinds of resistance-associated genes were performed. A novel variant of blaADC gene: blaADC-67 gene (Genbank accession No. JX169789) was prevalent in all 19 isolates. Moreover, ISAba1 could also provide strong promoter to upregulate the expression of blaADC67 to confer resistance to beta-lactam. This is the first report of emergence of blaADC-67 in A. baumannii worldwide, which might confer resistance to beta-lactam.

  11. Variable number tandem repeat loci providing discrimination within widespread genotypes of Acinetobacter baumannii.


    Turton, J F; Matos, J; Kaufmann, M E; Pitt, T L


    Some genotypes of Acinetobacter baumannii, defined by pulsed-field gel electrophoresis (PFGE), have been found in many hospitals. Our aim was to find variable number tandem repeat (VNTR) loci capable of providing discrimination among isolates with highly similar or identical PFGE profiles, to gain insights into the epidemiology. Thirteen loci identified in A. baumannii ATCC 17978 were tested using a panel of isolates that included multiple representatives of genotypes belonging to the three European clonal lineages. Two loci, with repeat units of 9 and 6 bp respectively were selected. Repeat numbers varied between 3 and 29, and 9 and 26 respectively at the two loci. The repeat numbers of representatives of each genotype often differed between hospitals, providing a means of tracking patient transfers and possible transmissions between patients. The results suggest that this analysis accurately reflects the known epidemiological information, and provides a valuable tool for cross-infection studies.

  12. Brain abscess caused by multidrug-resistant Acinetobacter baumannii. Case report.


    Guinand Vives, Carlos H; Monsalve Duarte, Guillermo A; Beltrán, Sandra Valderrama; Pinzón, Johanna Osorio


    This 24-year-old soldier had a history of polytrauma caused by firearm missiles of a fragmentation weapon. He was referred to the Hospital Militar Central, where multiple shrapnel wounds in the head, face, thorax, and extremities were found. A brain abscess was documented and drained, and a culture grew a multidrug-resistant Acinetobacter baumannii. An appropriate antibiotic treatment was started but did not lead to a good response, and the patient died. The clinical course of the illness is presented, as is its treatment and the role of A baumannii as an etiological agent of a brain abscess. To the authors' knowledge, there have been no reported cases in the worldwide literature of brain abscess by this infectious agent.

  13. Discovery and Characterization of New Hydroxamate Siderophores, Baumannoferrin A and B, produced by Acinetobacter baumannii.


    Penwell, William F; DeGrace, Nancy; Tentarelli, Sharon; Gauthier, Lise; Gilbert, Catherine M; Arivett, Brock A; Miller, Alita A; Durand-Reville, Thomas F; Joubran, Camil; Actis, Luis A


    Acinetobacter baumannii AYE does not produce acinetobactin but grows under iron limitation. Accordingly, analyses of AYE iron-restricted culture supernatants resulted in the isolation of two fractions, which contained only hydroxamates and showed siderophore activity. Structural analyses identified baumannoferrin A and baumannoferrin B, which differ only by a double bond. These siderophores are composed of citrate, 1,3-diaminopropane, 2,4-diaminobutyrate, decenoic acid, and α-ketoglutarate. Analysis of the AYE genome showed the presence of a 12-gene cluster coding for proteins similar to those involved in the production and utilization of the hydroxamate siderophores acinetoferrin and achromobactin. As A. baumannii AYE does not produce acinetobactin and harbors only one gene cluster encoding the production and utilization of a siderophore, this strain's growth under iron limitation depends on baumannoferrin, a novel hydroxamate that could play a role in its virulence.

  14. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil


    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  15. Combined therapy for multi-drug-resistant Acinetobacter baumannii infection--is there evidence outside the laboratory?


    Tuon, Felipe F; Rocha, Jaime L; Merlini, Alexandre B


    Acinetobacter are among the most common bacteria isolated in hospital infections, especially in developing countries. Multi-drug, extended-drug or pan-drug resistance makes treatment a real medical challenge. In the present review, the authors describe clinical and experimental data in order to present different current and potential future strategies to treat infections caused by multi-drug-resistant Acinetobacter. The therapeutic options for carbapenem-resistant Acinetobacter are scarce, and the current options have poor pharmacokinetic aspects and several side effects. Combined therapy has been an alternative for multi-drug-resistant Acinetobacter. However, this issue is always controversial. In some studies combined therapy has shown superiority for some strains of Acinetobacter in animal models and in vitro studies. However, studies with humans are scarce and too poor quality to suggest the best approach for the treatment of infections caused by multi-drug-resistant Acinetobacter baumannii.

  16. Reduction in chlorhexidine efficacy against multi-drug-resistant Acinetobacter baumannii international clone II.


    Hayashi, M; Kawamura, K; Matsui, M; Suzuki, M; Suzuki, S; Shibayama, K; Arakawa, Y


    Nosocomial infections caused by Acinetobacter baumannii international clone II (IC II) can cause severe clinical outcomes. Differential evaluation of bactericidal efficacy of chlorhexidine gluconate (CHX) and benzethonium chloride (BZT) disinfectants against IC II and non-IC II isolates. Minimum inhibitory concentrations (MICs) of CHX and BZT were determined for 137 A. baumannii IC II, 99 non-IC II and 69 non-baumannii isolates, further classified according to MIC values into disinfectant-reduced susceptible (DRS) and disinfectant-susceptible (DS) groups. Time-kill curves and minimum bactericidal concentrations (MBCs) were evaluated for representative isolates in each group. CHX and BZT MIC90s for IC II isolates were 100 and 175mg/L, respectively, but those for non-IC II and non-baumannii isolates were <100mg/L. Nevertheless, time-kill curves indicated that CHX and BZT reduced live bacterial cell number by 5 log10 for IC II and non-IC II isolates within 30s when used at 1000mg/L, comparable to practical use concentrations. CHX MBC at 30s was 1000mg/L for IC II and non-IC II isolates, and was not influenced by addition of 3% bovine serum albumin (BSA); BZT MBC at 30s was 100mg/L without BSA and increased up to 500mg/L upon addition of BSA. No significant differences in BSA were found between DRS and DS isolates. CHX and BZT were effective against Acinetobacter spp. including IC II at a concentration of 1000mg/L and exposure for at least 30s, but their concentrations should be considered carefully to ensure sufficient effects in both clinical and healthcare settings. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  17. Diversity of polymyxin resistance mechanisms among Acinetobacter baumannii clinical isolates.


    Girardello, Raquel; Visconde, Marina; Cayô, Rodrigo; Figueiredo, Regina Célia Bressan Queiroz de; Mori, Marcelo Alves da Silva; Lincopan, Nilton; Gales, Ana Cristina


    Polymyxins have become drugs of last resort for treatment of multi-drug resistant (MDR) Gram-negative infections. However, the mechanisms of resistance to this compound have not been completely elucidated. In this study, we evaluated the mechanisms of resistance to this antimicrobial in two A. baumannii clinical isolates, respectively, susceptible (A027) and resistant (A009) to polymyxin B before and after polymyxin B exposure (A027(ind) and A009(ind)). The pmrAB and lpxACD were sequenced and their transcriptional levels were analyzed by qRT-PCR. The bacterial cell morphology was evaluated by transmission electronic microscopy (TEM) and the membrane potential was measured using Zeta-potential analyzer. The virulence of strains was studied using a Caenorhabditis elegans model. Both clinical isolates exhibited an elevation of the polymyxin B MIC after exposure to this compound. On the other hand, A027(ind) showed decreased values of MIC for β-lactams, aminoglycosides, vancomycin, teicoplanin, oxacillin and erythromycin. A027(ind) harbored two mutations in pmrB and the ISAba125 disrupting the lpxA. In contrast, A009(ind) strain exhibited increase of pmrB transcriptional level, after polymyxin B exposure, despite the absence of mutations in the pmrAB genes. The TEM images revealed a thicker and more electron-dense peptidoglycan layer for A009 than that of A027. The exposure to polymyxin B induced a strong condensation and darkening of intracellular material, mainly in A009(ind). In addition, the surface charge of A009 was significantly less negative than the one of A027. Using the C. elegans model, only A027(ind) strain showed a reduction on virulence. The diversity of polymyxin B resistance mechanisms among A. baumannii strains evaluated in this study confirms the complexity of these mechanisms, which may vary depending of the background of each strain.

  18. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil


    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  19. Colistin-Resistant Acinetobacter baumannii Clinical Strains with Deficient Biofilm Formation

    PubMed Central

    Dafopoulou, Konstantina; Xavier, Basil Britto; Hotterbeekx, An; Janssens, Lore; Lammens, Christine; Dé, Emmanuelle; Goossens, Herman; Tsakris, Athanasios; Malhotra-Kumar, Surbhi


    In two pairs of clinical colistin-susceptible/colistin-resistant (Csts/Cstr) Acinetobacter baumannii strains, the Cstr strains showed significantly decreased biofilm formation in static and dynamic assays (P < 0.001) and lower relative fitness (P < 0.05) compared with those of the Csts counterparts. The whole-genome sequencing comparison of strain pairs identified a mutation converting a stop codon to lysine (*241K) in LpsB (involved in lipopolysaccharide [LPS] synthesis) in one Cstr strain and a frameshift mutation in CarO and the loss of a 47,969-bp element containing multiple genes associated with biofilm production in the other. PMID:26666921

  20. Clonal spread of blaOXA-72-carrying Acinetobacter baumannii sequence type 512 in Taiwan.


    Kuo, Han-Yueh; Hsu, Po-Jui; Chen, Jiann-Yuan; Liao, Po-Cheng; Lu, Chia-Wei; Chen, Chang-Hua; Liou, Ming-Li


    This is the first report to show an insidious outbreak of armA- and blaOXA-72-carrying Acinetobacter baumannii sequence type 512 (ST512) at a study hospital in northern Taiwan. Multilocus sequence typing revealed that this was a ST512 clone. All of the isolates with ST512 carried a novel 12,056-bp repGR2 in combination with a repGR12-type plasmid. This plasmid, designated pAB-ML, had one copy of the blaOXA-72 gene that was flanked by XerC/XerD-like sites and conferred resistance to carbapenems.

  1. In Vivo Fitness Adaptations of Colistin-Resistant Acinetobacter baumannii Isolates to Oxidative Stress

    PubMed Central

    Singh, Shweta S.; Alamneh, Yonas; Casella, Leila G.; Ernst, Robert K.; Lesho, Emil P.; Waterman, Paige E.; Zurawski, Daniel V.


    ABSTRACT The loss of fitness in colistin-resistant (CR) Acinetobacter baumannii was investigated using longitudinal isolates from the same patient. Early CR isolates were outcompeted by late CR isolates for growth in broth and survival in the lungs of mice. Fitness loss was associated with an increased susceptibility to oxidative stress since early CR strains had reduced in vitro survival in the presence of hydrogen peroxide and decreased catalase activity compared to that of late CR and colistin-susceptible (CS) strains. PMID:27993849

  2. Clinical isolates of Acinetobacter baumannii from a Portuguese hospital: PFGE characterization, antibiotic susceptibility and biofilm-forming ability.


    Duarte, Andreia; Ferreira, Susana; Almeida, Sofia; Domingues, Fernanda C


    Acinetobacter baumannii is an emerging pathogen associated with nosocomial infections that in addition has shown an increasing resistance to antibiotics. In this work the genetic diversity of A. baumannii isolates from a Portuguese hospital, their antibiotic resistance profiles and ability to form biofilms was studied. Seventy-nine clinical A. baumannii isolates were characterized by pulsed-field gel electrophoresis (PFGE) with 9 different PFGE profiles being obtained. Concerning the antimicrobial susceptibility, all A. baumannii isolates were resistant to 12 of the 17 tested antibiotics and classified as multidrug-resistant (MDR). In addition, 74.7% of the isolates showed biofilm formation ability, however no statistical significance with antibiotic resistance was observed. In contrast, urine samples isolates were more likely to form biofilms than strains isolated from other sources. Our findings highlight the high number of MDR A. baumannii isolates and the importance of the formation of biofilms as a potential virulence factor.

  3. Tigecycline combination for ventilator-associated pneumonia caused by extensive drug-resistant Acinetobacter baumannii

    PubMed Central

    Zheng, Yali; Tang, Xiao; Wang, Rui; Tong, Zhaohui


    Background Extensive drug-resistant Acinetobacter baumannii (XDR A. baumannii) has emerged as an important pathogen in patients with ventilator-associated pneumonia (VAP) worldwide. This study determined whether or not combination tigecycline (TGC) treatment improved the short-term outcome of patients with XDR A. baumannii-induced VAP. Methods: Fifty-eight patients admitted to our intensive care unit (ICU) with confirmed XDR A. baumannii VAP between January 2011 and June 2013 were retrospectively studied. Fourteen patients were excluded. The included subjects were classified into two groups depending on treatment regimens with or without TGC (TGC group, n=20; non-TGC group, n=24). Thirty-day mortality rates, and clinical and microbiologic responses were reviewed and compared in detail. Results Microbiological eradication was observed in 3 patients (15.0%) in the TGC group and 7 patients (29.2%) in the non-TGC group (P=0.264). The mean time-to-eradication of XDR A. baumannii was 5.3±2.1 versus 7.6±4.0 days (P=0.395). Ten of 20 (50%) patients developed resistance to TGC after initiation of TGC therapy in the TGC group. Clinical cure were achieved in 50.0% of the patients (10/20) in the TGC group and 45.8% of the patients (7/24) in the non-TGC group (P=1.000). No differences existed in the 30-day mortality, length of ICU stay, length of hospital stay (LOS), and length of invasive mechanical ventilation (MV) between the two groups. The occurrence of septic shock was significantly lower in the TGC group (20.0% vs. 54.2%; P=0.030). Conclusions TGC combination therapy did not improve the clinical cure and microbiologic eradication in patients with XDR A. baumannii VAP. TGC combination therapy did not decrease all-cause mortality in patients with XDR A. baumannii VAP. TGC combination therapy reduced the incidence of septic shock in patients with XDR A. baumannii VAP, and might decrease the incidence of poly-microbial VAP. TGC combination therapy can only be recommended

  4. Use of a stainless steel washer platform to study Acinetobacter baumannii adhesion and biofilm formation on abiotic surfaces

    PubMed Central

    Orsinger-Jacobsen, Samantha J.; Patel, Shenan S.; Vellozzi, Ernestine M.; Gialanella, Phillip; Nimrichter, Leonardo; Miranda, Kildare


    Acinetobacter baumannii is a frequent cause of hospital-acquired pneumonia, and has recently increased in incidence as the causative agent of severe disease in troops wounded in Afghanistan and Iraq. Clinical approaches are limited since A. baumannii strains isolated from patients are extremely resistant to current antimicrobials. A. baumannii can survive desiccation and during outbreaks has been recovered from various sites in the patients’ environment. To better understand its prevalence in hospital settings, we used a stainless steel washer (SSW) platform to investigate A. baumannii biofilm formation on abiotic surfaces. Scanning electron microscopy demonstrated that A. baumannii forms strong biofilms on stainless steel surfaces. This platform was combined with a colorimetric 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino)carbonyl]-2H-tetrazolium hydroxide (XTT) reduction assay to observe the metabolic activity of bacterial cells, and to facilitate the manipulation and comparison of multiple A. baumannii clinical strains. A strong correlation between XTT and c.f.u. assays was demonstrated. To complement the cell viability assays, A. baumannii biofilm mass was measured by crystal violet staining. Furthermore, the effect of commonly used disinfectants and environmental stressors on A. baumannii biofilms and planktonic cells was compared and characterized. Biofilms on SSWs were significantly more resistant than their planktonic counterparts, providing additional evidence that may allow us to understand the high prevalence of this microbe in hospital settings. Our results validate that SSWs are a simple, versatile and innovative method to study A. baumannii biofilms in vitro. PMID:24025603

  5. Diversity of Acinetobacter baumannii strains isolated in humans, companion animals, and the environment in Reunion Island: an exploratory study.


    Pailhoriès, Hélène; Belmonte, Olivier; Kempf, Marie; Lemarié, Carole; Cuziat, Julien; Quinqueneau, Catherine; Ramont, Catherine; Joly-Guillou, Marie-Laure; Eveillard, Matthieu


    Acinetobacter baumannii can be responsible for community-acquired infections in tropical climates like that of Reunion Island. The epidemiology of these community-acquired A. baumannii infections is not well understood. The aim of this study was to characterize A. baumannii strains isolated from patients at the time of admission to the university hospital of Saint-Denis, from environmental samples, and from pets. In this exploratory study, samples were collected by swabbing the rectum and mouth. A. baumannii isolates from positive samples were identified by VITEK 2 system, blaOXA-51-like gene PCR, and partial sequencing of the rpoB gene. Antimicrobial susceptibility testing was then performed. Strains were further analysed by multilocus sequence typing and pulsed-field gel electrophoresis. A high prevalence of A. baumannii carriage was found in pets (8.5%). Only one A. baumannii isolate was resistant to carbapenems (isolated from a patient). A wide variety of A. baumannii, assigned to different sequence types, were isolated from pets, humans, and the environment. This study shows that A. baumannii strains are present outside the hospital setting in Reunion Island and show great diversity. Further studies are needed to explore these extra-hospital reservoirs of A. baumannii in Reunion Island in greater detail and to determine their possible means of dissemination. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China.


    Li, Puyuan; Niu, Wenkai; Li, Huan; Lei, Hong; Liu, Wei; Zhao, Xiangna; Guo, Leijing; Zou, Dayang; Yuan, Xin; Liu, Huiying; Yuan, Jing; Bai, Changqing


    Acinetobacter baumannii is an important opportunistic pathogen associated with a variety of nosocomial infections. A rapid and sensitive molecular detection in clinical isolates is quite needed for the appropriate therapy and outbreak control of A. baumannii. Group 2 carbapenems have been considered the agents of choice for the treatment of multiple drug-resistant A. baumannii. But the prevalence of carbapenem-resistant A. baumannii (CRAB) has been steadily increasing in recent years. Here, we developed a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of A. baumannii in clinical samples by using high-specificity primers of the bla OXA-51 gene. Then we investigated the OXA-carbapenemases molecular epidemiology of A. baumannii isolates in two comprehensive hospitals in Beijing. The results showed that the LAMP assay could detect target DNA within 60 min at 65°C. The detection limit was 50 pg/μl, which was about 10-fold greater than that of PCR. Furthermore, this method could distinguish A. baumannii from the homologous A. nosocomialis and A. pittii. A total of 228 positive isolates were identified by this LAMP-based method for A. baumannii from 335 intensive care unit patients with clinically suspected multi-resistant infections in two hospitals in Beijing. The rates of CRAB are on the rise and are slowly becoming a routine phenotype for A. baumannii. Among the CRABs, 92.3% harbored both the bla OXA-23 and bla OXA-51 genes. Thirty-three pulsotypes were identified by pulsed-field gel electrophoresis, and the majority belonged to clone C. In conclusion, the LAMP method developed for detecting A. baumannii was faster and simpler than conventional PCR and has great potential for both point-of-care testing and basic research. We further demonstrated a high distribution of class D carbapenemase-encoding genes, mainly OXA-23, which presents an emerging threat in hospitals in China.

  7. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China

    PubMed Central

    Li, Puyuan; Niu, Wenkai; Li, Huan; Lei, Hong; Liu, Wei; Zhao, Xiangna; Guo, Leijing; Zou, Dayang; Yuan, Xin; Liu, Huiying; Yuan, Jing; Bai, Changqing


    Acinetobacter baumannii is an important opportunistic pathogen associated with a variety of nosocomial infections. A rapid and sensitive molecular detection in clinical isolates is quite needed for the appropriate therapy and outbreak control of A. baumannii. Group 2 carbapenems have been considered the agents of choice for the treatment of multiple drug-resistant A. baumannii. But the prevalence of carbapenem-resistant A. baumannii (CRAB) has been steadily increasing in recent years. Here, we developed a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of A. baumannii in clinical samples by using high-specificity primers of the blaOXA-51 gene. Then we investigated the OXA-carbapenemases molecular epidemiology of A. baumannii isolates in two comprehensive hospitals in Beijing. The results showed that the LAMP assay could detect target DNA within 60 min at 65°C. The detection limit was 50 pg/μl, which was about 10-fold greater than that of PCR. Furthermore, this method could distinguish A. baumannii from the homologous A. nosocomialis and A. pittii. A total of 228 positive isolates were identified by this LAMP-based method for A. baumannii from 335 intensive care unit patients with clinically suspected multi-resistant infections in two hospitals in Beijing. The rates of CRAB are on the rise and are slowly becoming a routine phenotype for A. baumannii. Among the CRABs, 92.3% harbored both the blaOXA-23 and blaOXA-51 genes. Thirty-three pulsotypes were identified by pulsed-field gel electrophoresis, and the majority belonged to clone C. In conclusion, the LAMP method developed for detecting A. baumannii was faster and simpler than conventional PCR and has great potential for both point-of-care testing and basic research. We further demonstrated a high distribution of class D carbapenemase-encoding genes, mainly OXA-23, which presents an emerging threat in hospitals in China. PMID:26441924

  8. Immunization against Multidrug-Resistant Acinetobacter baumannii Effectively Protects Mice in both Pneumonia and Sepsis Models

    PubMed Central

    Huang, Weiwei; Yao, Yufeng; Long, Qiong; Yang, Xu; Sun, Wenjia; Liu, Cunbao; Jin, Xiaomei; li, Yang; Chu, Xiaojie; Chen, Bin; Ma, Yanbing


    Objective Acinetobacter baumannii is considered the prototypical example of a multi- or pan- drug-resistant bacterium. It has been increasingly implicated as a major cause of nosocomial and community-associated infections. This study proposed to evaluate the efficacy of immunological approaches to prevent and treat A. baumannii infections. Methods Mice were immunized with outer membrane vesicles (OMVs) prepared from a clinically isolated multidrug-resistant strain of A. baumannii. Pneumonia and sepsis models were used to evaluate the efficacy of active and passive immunization with OMVs. The probable effective mechanisms and the protective potential of clonally distinct clinical isolates were investigated in vitro using an opsonophagocytic assay. Results Intramuscular immunization with OMVs rapidly produced high levels of OMV-specific IgG antibodies, and subsequent intranasal challenge with A. baumannii elicited mucosal IgA and IgG responses. Both active and passive immunization protected the mice from challenges with homologue bacteria in a sepsis model. Bacterial burden in bronchoalveolar lavage fluids (BALF), lung, and spleen, inflammatory cell infiltration in BALF and lung, and inflammatory cytokine accumulation in BALF was significantly suppressed in the pneumonia model by both active and passive immunization strategies. The antisera from immunized mice presented with significant opsonophagocytic activities in a dose-dependent manner against not only homologous strains but also five of the other six clonally distinct clinical isolates. Conclusions Utilizing immunological characteristics of outer membrane proteins to elevate protective immunity and circumvent complex multidrug-resistance mechanisms might be a viable approach to effectively control A. baumannii infections. PMID:24956279

  9. Pharmacokinetics and Pharmacodynamics of Minocycline against Acinetobacter baumannii in a Neutropenic Murine Pneumonia Model.


    Zhou, Jian; Ledesma, Kimberly R; Chang, Kai-Tai; Abodakpi, Henrietta; Gao, Song; Tam, Vincent H


    Multidrug-resistant (MDR) Acinetobacter baumannii is increasingly more prevalent in nosocomial infections. Although in vitro susceptibility of A. baumannii to minocycline is promising, the in vivo efficacy of minocycline has not been well established. In this study, the in vivo activity of minocycline was evaluated in a neutropenic murine pneumonia model. Specifically, we investigated the relationship between minocycline exposure and bactericidal activity using five A. baumannii isolates with a broad range of susceptibility (MIC ranged from 0.25 mg/liter to 16 mg/liter). The pharmacokinetics of minocycline (single dose of 25 mg/kg of body weight, 50 mg/kg, 100 mg/kg, and a humanized regimen, given intraperitoneally) in serum and epithelial lining fluid (ELF) were characterized. Dose linearity was observed for doses up to 50 mg/kg and pulmonary penetration ratios (area under the concentration-time curve in ELF from 0 to 24 h [AUCELF,0-24]/area under the concentration time curve in serum from 0 to 24 h [AUCserum,0-24]) ranged from 2.5 to 2.8. Pharmacokinetic-pharmacodynamics (PK-PD) index values in ELF for various dose regimens against different A. baumannii isolates were calculated. The maximum efficacy at 24 h was approximately 1.5-log-unit reduction of pulmonary bacterial burdens from baseline. The AUC/MIC ratio was the PK-PD index most closely correlating to the bacterial burden (r(2) = 0.81). The required AUCELF,0-24/MIC for maintaining stasis and achieving 1-log-unit reduction were 140 and 410, respectively. These findings could guide the treatment of infections caused by A. baumannii using minocycline in the future. Additional studies to examine resistance development during therapy are warranted. Copyright © 2017 American Society for Microbiology.

  10. Distribution and expression of the Ade multidrug efflux systems in Acinetobacter baumannii clinical isolates.


    Pagdepanichkit, Sirawit; Tribuddharat, Chanwit; Chuanchuen, Rungtip


    One hundred Acinetobacter baumannii clinical isolates were examined for inhibitory effect of reserpine and carbonyl cyanide m-chlorophenylhydrazone (CCCP) on the antimicrobial susceptibility and expression of 4 resistant-nodulation-cell division (RND)-type multidrug efflux systems, including AdeABC, AdeDE, AdeIJK, and AdeFGH, using RT-PCR. Ten A. baumannii isolates expressing AdeABC, AdeIJK, or AdeFGH were randomly selected for determination of transcription level and regulatory mutations. While all the isolates were resistant to multiple drugs, the reserpine and CCCP experiment showed that the multidrug resistance phenotype in most A. baumannii isolates was associated with efflux pumps. Most isolates expressed at least one of the RND-type efflux pumps tested (97%). AdeIJK expression was most common (97%), but none of the isolates produced AdeDE. Fifty-two percent of the A. baumannii isolates simultaneously produced up to 3 RND-type efflux systems (i.e., AdeABC, AdeFGH, and AdeIJK). No good correlation between the expression of RND-type efflux pumps and the type of antimicrobial resistance was observed. Overexpression of AdeABC, AdeIJK, and AdeFGH was not always related to the presence of mutations in their corresponding regulatory genes. This study highlights (i) the universal presence of the RND-type efflux pumps with variable levels of expression level among the A. baumannii in this collection and (ii) the complexity of their regulation of expression.

  11. Intraspecies Transfer of the Chromosomal Acinetobacter baumannii blaNDM-1 Carbapenemase Gene

    PubMed Central

    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Bontron, Séverine; Sczyrba, Alexander; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent


    The species Acinetobacter baumannii is one of the most important multidrug-resistant human pathogens. To determine its virulence and antibiotic resistance determinants, the genome of the nosocomial blaNDM-1-positive A. baumannii strain R2090 originating from Egypt was completely sequenced. Genome analysis revealed that strain R2090 is highly related to the community-acquired Australian A. baumannii strain D1279779. The two strains belong to sequence type 267 (ST267). Isolate R2090 harbored the chromosomally integrated transposon Tn125 carrying the carbapenemase gene blaNDM-1 that is not present in the D1279779 genome. To test the transferability of the metallo-β-lactamase (MBL) gene region, the clinical isolate R2090 was mated with the susceptible A. baumannii recipient CIP 70.10, and the carbapenem-resistant derivative R2091 was obtained. Genome sequencing of the R2091 derivative revealed that it had received an approximately 66-kb region comprising the transposon Tn125 embedding the blaNDM-1 gene. This region had integrated into the chromosome of the recipient strain CIP 70.10. From the four known mechanisms for horizontal gene transfer (conjugation, outer membrane vesicle-mediated transfer, transformation, and transduction), conjugation could be ruled out, since strain R2090 lacks any plasmid, and a type IV secretion system is not encoded in its chromosome. However, strain R2090 possesses three putative prophages, two of which were predicted to be complete and therefore functional. Accordingly, it was supposed that the transfer of the resistance gene region from the clinical isolate R2090 to the recipient occurred by general transduction facilitated by one of the prophages present in the R2090 genome. Hence, phage-mediated transduction has to be taken into account for the dissemination of antibiotic resistance genes within the species A. baumannii. PMID:26953198

  12. Photodynamic Inactivation of Acinetobacter baumannii Using Phenothiazinium Dyes: In Vitro and In Vivo Studies

    PubMed Central

    Ragàs, Xavier; Dai, Tianhong; Tegos, George P.; Agut, Montserrat; Nonell, Santi; Hamblin, Michael R.


    Background and Objective Phenothiazinium dyes have been reported to be effective photosensitizers inactivating a wide range of microorganisms in vitro after illumination with red light. However, their application in vivo has not extensively been explored. This study evaluates the bactericidal activity of phenothiazinium dyes against multidrug-resistant Acinetobacter baumannii both in vitro and in vivo. Study Design/Materials and Methods We report the investigation of toluidine blue O, methylene blue, 1,9-dimethylmethylene blue, and new methylene blue for photodynamic inactivation of multidrug-resistant A. baumannii in vitro. The most effective dye was selected to carry out in vivo studies using third-degree mouse burns infected with a bioluminescent A. baumannii strain, upon irradiation with a 652 nm noncoherent light source. The mice were imaged daily for 2 weeks to observe differences in the bioluminescence–time curve between the photodynamic therapy (PDT)-treated mice in comparison with untreated burns. Results All the dyes were effective in vitro against A. baumannii after 30 J/cm2 irradiation of 635 or 652 nm red light had been delivered, with more effective killing when the dye remained in solution. New methylene blue was the most effective of the four dyes, achieving a 3.2-log reduction of the bacterial luminescence during PDT in vivo after 360 J/cm2 and an 800 μM dye dose. Moreover, a statistically significant reduction of the area under the bioluminescence–time curve of PDT-treated mice was observed showing that the infection did not recur after PDT. Conclusions Phenothiazinium dyes, and especially new methylene blue, are potential photosensitizers for PDT to treat burns infected with multidrug-resistant A. baumannii in vivo. PMID:20583252

  13. Deciphering the iron response in Acinetobacter baumannii: a proteomics approach

    PubMed Central

    Nwugo, Chika; Gaddy, Jennifer A.; Zimbler, Daniel L.; Actis, Luis A.


    Iron is an essential nutrient that plays a role in bacterial differential gene expression and protein production. Accordingly, the comparative analysis of total lysate and outer membrane fractions isolated from A. baumannii ATCC 19606T cells cultured under iron-rich and -chelated conditions using 2-D gel electrophoresis-mass spectrometry resulted in the identification of 58 protein spots differentially produced. While 19 and 35 of them represent iron-repressed and iron-induced protein spots, respectively, four other spots represent a metal chelation response unrelated to iron. Most of the iron-repressed protein spots represent outer membrane siderophore receptors, some of which could be involved in the utilization of siderophores produced by other bacteria. The iron-induced protein spots represent a wide range of proteins including those involved in iron storage, such as Bfr, metabolic and energy processes, such as AcnA, AcnB, GlyA, SdhA, and SodB, as well as lipid biosynthesis. The detection of an iron-regulated Hfq ortholog indicates that iron regulation in this bacterium could be mediated by Fur and small RNAs as described in other bacteria. The iron-induced production of OmpA suggests this protein plays a role in iron metabolism as shown by the diminished ability of an OmpA isogenic deficient derivative to grow under iron-chelated conditions. PMID:20692388

  14. Surface-associated motility, a common trait of clinical isolates of Acinetobacter baumannii, depends on 1,3-diaminopropane.


    Skiebe, Evelyn; de Berardinis, Véronique; Morczinek, Peter; Kerrinnes, Tobias; Faber, Franziska; Lepka, Daniela; Hammer, Bettina; Zimmermann, Ortrud; Ziesing, Stefan; Wichelhaus, Thomas A; Hunfeld, Klaus-Peter; Borgmann, Stefan; Gröbner, Sabine; Higgins, Paul G; Seifert, Harald; Busse, Hans-Jürgen; Witte, Wolfgang; Pfeifer, Yvonne; Wilharm, Gottfried


    While flagella-independent motility has long been described in representatives of the genus Acinetobacter, the mechanism of motility remains ambiguous. Acinetobacter baumannii, a nosocomial pathogen appearing increasingly multidrug-resistant, may profit from motility during infection or while persisting in the hospital environment. However, data on the frequency of motility skills among clinical A. baumannii isolates is scarce. We have screened a collection of 83 clinical A. baumannii isolates of different origin and found that, with the exception of one isolate, all were motile on wet surfaces albeit to varying degrees and exhibiting differing morphologies. Screening a collection of transposon mutants of strain ATCC 17978 for motility defects, we identified 2 akinetic mutants carrying transposon insertions in the dat and ddc gene, respectively. These neighbouring genes contribute to synthesis of 1,3-diaminopropane (DAP), a polyamine ubiquitously produced in Acinetobacter. Supplementing semi-solid media with DAP cured the motility defect of both mutants. HPLC analyses confirmed that DAP synthesis was abolished in ddc and dat mutants of different A. baumannii isolates and was re-established after genetic complementation. Both, the dat and ddc mutant of ATCC 17978 were attenuated in the Galleria mellonella caterpillar infection model. Taken together, surface-associated motility is a common trait of clinical A. baumannii isolates that requires DAP and may play a role in its virulence.

  15. Genome Sequence of Acinetobacter baumannii Strain D36, an Antibiotic-Resistant Isolate from Lineage 2 of Global Clone 1

    PubMed Central

    Hamidian, Mohammad; Hawkey, Jane


    Multiply antibiotic-resistant Acinetobacter baumannii isolate D36 was recovered in Australia in 2008 and belongs to a distinct lineage of global clone 1 (GC1). Here, we present the complete 4.13 Mbp genome sequence (chromosome plus 4 plasmids), generated via long read sequencing (PacBio). PMID:26679588

  16. Genome Sequence of vB_AbaS_TRS1, a Viable Prophage Isolated from Acinetobacter baumannii Strain A118.


    Turner, Dann; Wand, Matthew E; Sutton, J Mark; Centron, Daniela; Kropinski, Andrew M; Reynolds, Darren M


    A novel temperate phage, vB_AbaS_TRS1, was isolated from cultures of Acinetobacter baumannii strain A118 that had been exposed to mitomycin C. Phage TRS1 belongs to the Siphoviridae family of bacteriophages and encapsulates a 40,749-bp genome encoding 70 coding sequences and a single tRNA.

  17. Genome Sequence of vB_AbaS_TRS1, a Viable Prophage Isolated from Acinetobacter baumannii Strain A118

    PubMed Central

    Turner, Dann; Wand, Matthew E.; Sutton, J. Mark; Centron, Daniela; Kropinski, Andrew M.


    A novel temperate phage, vB_AbaS_TRS1, was isolated from cultures of Acinetobacter baumannii strain A118 that had been exposed to mitomycin C. Phage TRS1 belongs to the Siphoviridae family of bacteriophages and encapsulates a 40,749-bp genome encoding 70 coding sequences and a single tRNA. PMID:27738026

  18. Draft Genome Sequences of Seven Multidrug-Resistant Acinetobacter baumannii Strains, Isolated from Respiratory Samples in Spain

    PubMed Central

    Labrador-Herrera, Gema; Álvarez, Rocío; López-Rojas, Rafael; Smani, Younes; Cebrero-Cangueiro, Tania; Rueda, Antonio; Pérez Florido, Javier; Pachón-Ibáñez, María Eugenia


    The draft genome sequences of seven multidrug-resistant Acinetobacter baumannii clinical strains belonging to sequence types ST-208 and ST-218 are reported in this study. They were isolated from tracheobronchial aspirate of mechanically ventilated adult patients admitted to the intensive care unit of a Spanish tertiary hospital during 2010 to 2011. PMID:27034482

  19. Distinct Genetic Diversity of Carbapenem-Resistant Acinetobacter baumannii from Colombian Hospitals.


    Correa, Adriana; Del Campo, Rosa; Escandón-Vargas, Kevin; Perenguez, Marcela; Rodríguez-Baños, Mercedes; Hernández-Gómez, Cristhian; Pallares, Christian; Perez, Federico; Arias, Cesar A; Cantón, Rafael; Villegas, María V


    The global success of multidrug-resistant Acinetobacter baumannii has been associated with the dissemination of a high-risk clone designated clonal complex (CC) 92(B) (Bartual scheme)/CC2(P) (Pasteur scheme), which is the most frequent genetic lineage in European, Asian, and North American carbapenem-resistant Acinetobacter isolates. In these isolates, carbapenem resistance is mainly mediated by β-lactamases encoded by blaOXA-23-like, blaOXA-24-like, blaOXA-51-like, and/or blaOXA-58-like genes. In this study, we characterized the population genetics of 121 carbapenem-resistant A. baumannii complex isolates recovered from 14 hospitals in seven cities in Colombia (2008-2010). Multiplex PCR was used to detect blaOXA-23-like, blaOXA-24-like, blaOXA-51-like, and blaOXA-58-like genes. Molecular typing was performed using pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). PCR showed that 118 (97.5%) of the isolates were positive for both blaOXA-23-like and blaOXA-51-like genes, and three other isolates were only positive for blaOXA-51-like. PFGE identified 18 different pulsotypes, while MLST identified 11 different sequence types (STs), seven of which had not been previously described in Acinetobacter. None of the STs found in this study was associated with CC92(B)/CC2(P). The most widespread STs in our isolates belonged to ST636 and their single-locus variants ST121/ST124/ST634 (CC636(B)) followed by STs belonging to CC110(B). Our observations suggest a wide distribution of diverse A. baumannii complex clones containing blaOXA-23-like in Colombian hospitals (especially CC636(B) and CC110(B)) that differ from the high-risk clones commonly found in other regions of the world, indicating a distinct molecular epidemiology of carbapenem-resistant Acinetobacter spp. in Colombia.

  20. Synergistic Effects and Antibiofilm Properties of Chimeric Peptides against Multidrug-Resistant Acinetobacter baumannii Strains

    PubMed Central

    Gopal, Ramamourthy; Kim, Young Gwon; Lee, Jun Ho; Lee, Seog Ki; Chae, Jeong Don; Son, Byoung Kwan; Seo, Chang Ho


    The increasing prevalence of drug-resistant pathogens highlights the need to identify novel antibiotics. Here we investigated the efficacies of four new antimicrobial peptides (AMPs) for potential drug development. The antibacterial activities, synergistic effects, and antibiofilm properties of the four chimeric AMPs were tested against Acinetobacter baumannii, an emerging Gram-negative, nosocomial, drug-resistant pathogen. Nineteen A. baumannii strains resistant to ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin were isolated at a hospital from patients with cholelithiasis. All four peptides exhibited significant antibacterial effects (MIC = 3.12 to 12.5 μM) against all 19 strains, whereas five commercial antibiotics showed little or no activity against the same pathogens. An exception was polymyxin, which was effective against all of the strains tested. Each of the peptides showed synergy against one or more strains when administered in combination with cefotaxime, ciprofloxacin, or erythromycin. The peptides also exhibited an ability to prevent biofilm formation, which was not seen with cefotaxime, ciprofloxacin, or erythromycin, though polymyxin also inhibited biofilm formation. Indeed, when administered in combination with ciprofloxacin, the AMP HPMA exerted a potent synergistic effect against A. baumannii biofilm formation. Collectively, our findings indicate that the AMPs tested have no cytotoxicity but possess potent antibacterial and antibiofilm activities and may act synergistically with commercial antibiotics. PMID:24366740

  1. H-NS Plays a Role in Expression of Acinetobacter baumannii Virulence Features

    PubMed Central

    Eijkelkamp, Bart A.; Stroeher, Uwe H.; Hassan, Karl A.; Elbourne, Liam D. H.; Paulsen, Ian T.


    Acinetobacter baumannii has become a major problem in the clinical setting with the prevalence of infections caused by multidrug-resistant strains on the increase. Nevertheless, only a limited number of molecular mechanisms involved in the success of A. baumannii as a human pathogen have been described. In this study, we examined the virulence features of a hypermotile derivative of A. baumannii strain ATCC 17978, which was found to display enhanced adherence to human pneumocytes and elevated levels of lethality toward Caenorhabditis elegans nematodes. Analysis of cellular lipids revealed modifications to the fatty acid composition, providing a possible explanation for the observed changes in hydrophobicity and subsequent alteration in adherence and motility. Comparison of the genome sequences of the hypermotile variant and parental strain revealed that an insertion sequence had disrupted an hns-like gene in the variant. This gene encodes a homologue of the histone-like nucleoid structuring (H-NS) protein, a known global transcriptional repressor. Transcriptome analysis identified the global effects of this mutation on gene expression, with major changes seen in the autotransporter Ata, a type VI secretion system, and a type I pilus cluster. Interestingly, isolation and analysis of a second independent hypermotile ATCC 17978 variant revealed a mutation to a residue within the DNA binding region of H-NS. Taken together, these mutants indicate that the phenotypic and transcriptomic differences seen are due to loss of regulatory control effected by H-NS. PMID:23649094

  2. Sheltering effect and indirect pathogenesis of carbapenem-resistant Acinetobacter baumannii in polymicrobial infection.


    Liao, Yu-Ting; Kuo, Shu-Chen; Lee, Yi-Tzu; Chen, Chien-Pei; Lin, Shu-Wen; Shen, Li-Jiuan; Fung, Chang-Phone; Cho, Wen-Long; Chen, Te-Li


    The role of carbapenem-resistant Acinetobacter baumannii (CRAb) in polymicrobial infection remains elusive. Having observed the ability of CRAb to shelter other susceptible bacteria from carbapenem killing, we sought to determine the factors contributing to this sheltering effect by transforming different recombinant plasmids into recipient A. baumannii cells. The sheltering effects of CRAb were reproduced in recipient A. baumannii cells that highly expressed carbapenem-hydrolyzing class D β-lactamases (CHDLs) through their associated strong promoter. With the use of Western blot analysis and a bioassay, the highly expressed CHDLs were found to be extracellularly released and led to hydrolysis of carbapenem. The level of extracellular CHDLs increased after challenge with a higher concentration of CHDL substrates, such as carbapenem and ticarcillin. This increased CHDL may, in part, be attributed to cell lysis, as indicated by the presence of extracellular gyrase. In the planktonic condition, the sheltering effect for the cocultured susceptible bacteria might represent an indirect and passive effect of the CRAb self-defense mechanism, because coculture with the susceptible pathogen did not augment the amount of the extracellular CHDLs. Polymicrobial infection caused by CRAb and a susceptible counterpart exerted higher pathogenicity than monomicrobial infection caused by either pathogen alone in mice receiving carbapenem therapy. This study demonstrated that CHDL-producing CRAb appears to provide a sheltering effect for carbapenem-susceptible pathogens via the extracellular release of CHDLs and, by this mechanism, can enhance the pathogenesis of polymicrobial infection in the presence of carbapenem therapy.

  3. Characterization of a high-affinity iron transport system in Acinetobacter baumannii.

    PubMed Central

    Echenique, J R; Arienti, H; Tolmasky, M E; Read, R R; Staneloni, R J; Crosa, J H; Actis, L A


    Analysis of a clinical isolate of Acinetobacter baumannii showed that this bacterium was able to grow under iron-limiting conditions, using chemically defined growth media containing different iron chelators such as human transferrin, ethylenediaminedi-(o-hydroxyphenyl)acetic acid, nitrilotriacetic acid, and 2,2'-bipyridyl. This iron uptake-proficient phenotype was due to the synthesis and secretion of a catechol-type siderophore compound. Utilization bioassays using the Salmonella typhimurium iron uptake mutants enb-1 and enb-7 proved that this siderophore is different from enterobactin. This catechol siderophore was partially purified from culture supernatants by adsorption chromatography using an XAD-7 resin. The purified component exhibited a chromatographic behavior and a UV-visible light absorption spectrum different from those of 2,3-dihydroxybenzoic acid and other bacterial catechol siderophores. Furthermore, the siderophore activity of this extracellular catechol was confirmed by its ability to stimulate energy-dependent uptake of 55Fe(III) as well as to promote the growth of A. baumannii bacterial cells under iron-deficient conditions imposed by 60 microM human transferrin. Polyacrylamide gel electrophoresis analysis showed the presence of iron-regulated proteins in both inner and outer membranes of this clinical isolate of A. baumannii. Some of these membrane proteins may be involved in the recognition and internalization of the iron-siderophore complexes. Images PMID:1447137

  4. Epidemiology of Carbapenemase-Producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean Countries

    PubMed Central

    Djahmi, Nassima; Dunyach-Remy, Catherine; Pantel, Alix; Dekhil, Mazouz; Sotto, Albert; Lavigne, Jean-Philippe


    The emergence and global spread of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii are of great concern to health services worldwide. These β-lactamases hydrolyse almost all β-lactams, are plasmid-encoded, and are easily transferable among bacterial species. They are mostly of the KPC, VIM, IMP, NDM, and OXA-48 types. Their current extensive spread worldwide in Enterobacteriaceae is an important source of concern. Infections caused by these bacteria have limited treatment options and have been associated with high mortality rates. Carbapenemase producers are mainly identified among Klebsiella pneumoniae, Escherichia coli, and A. baumannii and still mostly in hospital settings and rarely in the community. The Mediterranean region is of interest due to a great diversity and population mixing. The prevalence of carbapenemases is particularly high, with this area constituting one of the most important reservoirs. The types of carbapenemase vary among countries, partially depending on the population exchange relationship between the regions and the possible reservoirs of each carbapenemase. This review described the epidemiology of carbapenemases produced by enterobacteria and A. baumannii in this part of the world highlighting the worrisome situation and the need to screen and detect these enzymes to prevent and control their dissemination. PMID:24955354

  5. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  6. Activity of Gallium Meso- and Protoporphyrin IX against Biofilms of Multidrug-Resistant Acinetobacter baumannii Isolates

    PubMed Central

    Chang, David; Garcia, Rebecca A.; Akers, Kevin S.; Mende, Katrin; Murray, Clinton K.; Wenke, Joseph C.; Sanchez, Carlos J.


    Acinetobacter baumannii is a challenging pathogen due to antimicrobial resistance and biofilm development. The role of iron in bacterial physiology has prompted the evaluation of iron-modulation as an antimicrobial strategy. The non-reducible iron analog gallium(III) nitrate, Ga(NO3)3, has been shown to inhibit A. baumannii planktonic growth; however, utilization of heme-iron by clinical isolates has been associated with development of tolerance. These observations prompted the evaluation of iron-heme sources on planktonic and biofilm growth, as well as antimicrobial activities of gallium meso- and protoporphyrin IX (Ga-MPIX and Ga-PPIX), metal heme derivatives against planktonic and biofilm bacteria of multidrug-resistant (MDR) clinical isolates of A. baumannii in vitro. Ga(NO3)3 was moderately effective at reducing planktonic bacteria (64 to 128 µM) with little activity against biofilms (≥512 µM). In contrast, Ga-MPIX and Ga-PPIX were highly active against planktonic bacteria (0.25 to 8 µM). Cytotoxic effects in human fibroblasts were observed following exposure to concentrations exceeding 128 µM of Ga-MPIX and Ga-PPIX. We observed that the gallium metal heme conjugates were more active against planktonic and biofilm bacteria, possibly due to utilization of heme-iron as demonstrated by the enhanced effects on bacterial growth and biofilm formation. PMID:26999163

  7. Intravesical colistin irrigation to treat multidrug-resistant Acinetobacter baumannii urinary tract infection: a case report

    PubMed Central


    Introduction Acinetobacter baumannii is a Gram-negative bacteria and a significant nosocomial pathogen in hospitals. Multidrug-resistant A. baumannii have emerged as a cause of nosocomial infections in critically ill patients. This microorganism has the ability to produce biofilms on different surfaces, which could explain their ability to persist in clinical environments and their role in device-related infections. Case presentation We present the case of a 33-year-old Hispanic man with local invasive retroperitoneal leiomyosarcoma and right kidney exclusion along with femoral venous thrombosis, who was admitted for tumor resection. He had been receiving multiple nephrotoxic antibiotics for a long time (including tigecycline and colistimethate sodium) and had a persistent urinary infection related to multidrug-resistant A. baumannii (with susceptibility to colistimethate). Colistimethate was administered through a three-lumen urinary device for continuous urinary irrigation over seven days. Our patient did not refer to any adverse effects. A urine culture control taken at the end of the irrigation and another taken 10 days later were negative. Conclusion Colistimethate sodium and other antimicrobials infused by urinary irrigation can be a good option in patients in whom parenteral administration could be toxic. PMID:23273314

  8. [Lower respiratory tract infections related to Stenotrophomonas maltophilia and Acinetobacter baumannii].


    Baranzelli, A; Wallyn, F; Nseir, S


    Stenotrophomonas maltophilia and Acinetobacter baumannii are both non-fermenting ubiquitous Gram-negative bacilli. The incidence of lower respiratory tract infections related to these microorganisms is increasing, especially in intensive care units. Their capacity to acquire resistance against several antimicrobials is challenging for clinicians and microbiologists. Despite their low virulence, these pathogens are responsible for colonization and infection in patients with comorbidities, immunosuppression, and critically ill patients. S. maltophilia and A. baumannii are mainly identified in nosocomial infections: ventilator-associated pneumonia, bacteremia and surgical wound infection. Infections related to these microorganism are associated with high mortality and morbidity. Trimethoprime-sulfamethoxazole and carbapenem are the first line treatment for infections related to S. maltophilia and A. baumannii respectively. However, the increasing rate of resistance against these agents results in difficulties in treating patients with infections related to these pathogens. New antimicrobial agents and further randomized studies are needed to improve the treatment of these infections. Prevention of spared of these multidrug-resistant bacteria is mandatory, including hand-hygiene, environment cleaning, and limited usage of large spectrum antibiotics. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  9. Imipenem Treatment Induces Expression of Important Genes and Phenotypes in a Resistant Acinetobacter baumannii Isolate

    PubMed Central

    AbuBakar, Sazaly; Cerqueira, Gustavo Maia; Al-Haroni, Mohammed; Pang, Sui Ping


    Acinetobacter baumannii has emerged as a notorious multidrug-resistant pathogen, and development of novel control measures is of the utmost importance. Understanding the factors that play a role in drug resistance may contribute to the identification of novel therapeutic targets. Pili are essential for A. baumannii adherence to and biofilm formation on abiotic surfaces as well as virulence. In the present study, we found that biofilm formation was significantly induced in an imipenem-resistant (Impr) strain treated with a subinhibitory concentration of antibiotic compared to that in an untreated control and an imipenem-susceptible (Imps) isolate. Using microarray and quantitative PCR analyses, we observed that several genes responsible for the synthesis of type IV pili were significantly upregulated in the Impr but not in the Imps isolate. Notably, this finding is corroborated by an increase in the motility of the Impr strain. Our results suggest that the ability to overproduce colonization factors in response to imipenem treatment confers biological advantage to A. baumannii and may contribute to clinical success. PMID:26666943

  10. Molecular Epidemiology and Characterization of Genotypes of Acinetobacter baumannii Isolates from Regions of South China.


    Ying, Jun; Lu, Junwan; Zong, Li; Li, Ailing; Pan, Ruowang; Cheng, Cong; Li, Kunpeng; Chen, Liqiang; Ying, Jianchao; Tou, Huifen; Zhu, Chuanxin; Xu, Teng; Yi, Huiguang; Li, Jinsong; Ni, Liyan; Xu, Zuyuan; Bao, Qiyu; Li, Peizhen


    The aim of this study was to analyze the molecular epidemiologic characteristics of Acinetobacter baumannii. A total of 398 isolates were collected in 7 regions of South China from January to June of 2012. Drug sensitivity was tested toward 15 commonly used antibiotics; thus, 146 multi-drug-resistant strains (resistant to more than 7 drugs) were identified, representing 36.7% of all isolates. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for molecular subtyping. According to the PFGE results (with a cutoff of 70% similarity for the DNA electrophoretic bands), 146 strains were subdivided into 15 clusters, with cluster A being the largest (33.6%, distributed in all districts except Jiaxing). Cluster B was also widespread and included 14.4% of all strains. In addition, MLST results revealed 11 sequence types (ST), with ST208 being the most prevalent, followed by ST191 and ST729. Furthermore, 4 novel alleles and 6 novel STs were identified. Our results showed that multi-drug-resistant A. baumannii in South China shares the origin with other widespread strains in other countries. The nosocomial infections caused by A. baumannii have been severe in South China. Continuous monitoring and judicious antibiotic use are required.

  11. H-NS plays a role in expression of Acinetobacter baumannii virulence features.


    Eijkelkamp, Bart A; Stroeher, Uwe H; Hassan, Karl A; Elbourne, Liam D H; Paulsen, Ian T; Brown, Melissa H


    Acinetobacter baumannii has become a major problem in the clinical setting with the prevalence of infections caused by multidrug-resistant strains on the increase. Nevertheless, only a limited number of molecular mechanisms involved in the success of A. baumannii as a human pathogen have been described. In this study, we examined the virulence features of a hypermotile derivative of A. baumannii strain ATCC 17978, which was found to display enhanced adherence to human pneumocytes and elevated levels of lethality toward Caenorhabditis elegans nematodes. Analysis of cellular lipids revealed modifications to the fatty acid composition, providing a possible explanation for the observed changes in hydrophobicity and subsequent alteration in adherence and motility. Comparison of the genome sequences of the hypermotile variant and parental strain revealed that an insertion sequence had disrupted an hns-like gene in the variant. This gene encodes a homologue of the histone-like nucleoid structuring (H-NS) protein, a known global transcriptional repressor. Transcriptome analysis identified the global effects of this mutation on gene expression, with major changes seen in the autotransporter Ata, a type VI secretion system, and a type I pilus cluster. Interestingly, isolation and analysis of a second independent hypermotile ATCC 17978 variant revealed a mutation to a residue within the DNA binding region of H-NS. Taken together, these mutants indicate that the phenotypic and transcriptomic differences seen are due to loss of regulatory control effected by H-NS.

  12. Acinetobacter baumannii Virulence Is Mediated by the Concerted Action of Three Phospholipases D

    PubMed Central

    Stahl, Julia; Bergmann, Holger; Göttig, Stephan; Ebersberger, Ingo; Averhoff, Beate


    Acinetobacter baumannii causes a broad range of opportunistic infections in humans. Its success as an emerging pathogen is due to a combination of increasing antibiotic resistance, environmental persistence and adaptation to the human host. To date very little is known about the molecular basis of the latter. Here we demonstrate that A. baumannii can use phosphatidylcholine, an integral part of human cell membranes, as sole carbon and energy source. We report on the identification of three phospholipases belonging to the PLD superfamily. PLD1 and PLD2 appear restricted to the bacteria and display the general features of bacterial phospholipases D. They possess two PLDc_2 PFAM domains each encompassing the HxKx4Dx6GS/GGxN (HKD) motif necessary for forming the catalytic core. The third candidate, PLD3, is found in bacteria as well as in eukaryotes and harbours only one PLDc_2 PFAM domain and one conserved HKD motif, which however do not overlap. Employing a markerless mutagenesis system for A. baumannii ATCC 19606T, we generated a full set of PLD knock-out mutants. Galleria mellonella infection studies as well as invasion experiments using A549 human lung epithelial cells revealed that the three PLDs act in a concerted manner as virulence factors and are playing an important role in host cell invasion. PMID:26379240

  13. Host Fate is Rapidly Determined by Innate Effector-Microbial Interactions During Acinetobacter baumannii Bacteremia

    PubMed Central

    Bruhn, Kevin W.; Pantapalangkoor, Paul; Nielsen, Travis; Tan, Brandon; Junus, Justin; Hujer, Kristine M.; Wright, Meredith S.; Bonomo, Robert A.; Adams, Mark D.; Chen, Wangxue; Spellberg, Brad


    Background. Acinetobacter baumannii is one of the most antibiotic-resistant pathogens. Defining mechanisms driving pathogenesis is critical to enable new therapeutic approaches. Methods. We studied virulence differences across a diverse panel of A. baumannii clinical isolates during murine bacteremia to elucidate host-microbe interactions that drive outcome. Results. We identified hypervirulent strains that were lethal at low intravenous inocula and achieved very high early, and persistent, blood bacterial densities. Virulent strains were nonlethal at low inocula but lethal at 2.5-fold higher inocula. Finally, relatively avirulent (hypovirulent) strains were nonlethal at 20-fold higher inocula and were efficiently cleared by early time points. In vivo virulence correlated with in vitro resistance to complement and macrophage uptake. Depletion of complement, macrophages, and neutrophils each independently increased bacterial density of the hypovirulent strain but insufficiently to change lethality. However, disruption of all 3 effector mechanisms enabled early bacterial densities similar to hypervirulent strains, rendering infection 100% fatal. Conclusions. The lethality of A. baumannii strains depends on distinct stages. Strains resistant to early innate effectors are able to establish very high early bacterial blood density, and subsequent sustained bacteremia leads to Toll-like receptor 4–mediated hyperinflammation and lethality. These results have important implications for translational efforts to develop therapies that modulate host-microbe interactions. PMID:25378635

  14. Spread of Amikacin Resistance in Acinetobacter baumannii Strains Isolated in Spain Due to an Epidemic Strain

    PubMed Central

    Vila, Jordi; Ruiz, Joaquim; Navia, Margarita; Becerril, Berta; Garcia, Isabel; Perea, Sofia; Lopez-Hernandez, Inmaculada; Alamo, Isabel; Ballester, Frederic; Planes, Anna M.; Martinez-Beltran, Jesus; De Anta, Teresa Jimenez


    Sixteen amikacin-resistant clinical Acinetobacter baumannii isolates from nine different hospitals in Spain were investigated to determine whether the high incidence of amikacin-resistant A. baumannii was due to the dissemination of an amikacin-resistant strain or to the spread of an amikacin resistance gene. The epidemiological relationship studied by repetitive extragenic palindromic PCR and low-frequency restriction analysis of chromosomal DNA showed that the same clone was isolated in eight of nine hospitals, although other clones were also found. The strains were studied for the presence of the aph(3′)-VIa and aac(6′)-I genes, which encode enzymes which inactivate amikacin, by PCR. All 16 clinical isolates had positive PCRs with primers specific for the amplification of the aph(3′)-VIa gene, whereas none had a positive reaction for the amplification of the aac(6′)-I gene. Therefore, the high incidence of amikacin resistance among clinical A. baumannii isolates in Spain was mainly due to an epidemic strain, although the spread of the aph(3′)-VI gene cannot be ruled out. PMID:9986846

  15. Structure of the K2 capsule associated with the KL2 gene cluster of Acinetobacter baumannii.


    Kenyon, Johanna J; Marzaioli, Alberto M; Hall, Ruth M; De Castro, Cristina


    The repeat unit structure of the K2 capsule from an extensively antibiotic-resistant Acinetobacter baumannii global clone 2 (GC2) strain was determined. The oligosaccharide contains three simple sugars, d-glucopyranose, d-galatopyranose and N-acetyl-d-galactosamine, and the complex sugar, 5,7-diacetamido-3,5,7,9-tetradeoxy-l-glycero-l-manno-non-2-ulosonic acid (Pse5Ac7Ac or pseudaminic acid), which has not previously been reported in any A. baumannii capsule. The strain was found to carry all the genes required for the synthesis of the sugars and construction of the K2 structure. The linkages catalyzed by the initiating transferase, three glycosyltransferases and the Wzy polymerase were also predicted. Examination of publicly available A. baumannii genome sequences revealed that the same gene cluster, KL2, often occurs in extensively antibiotic-resistant GC2 isolates and in further strain types. The gene module responsible for the synthesis of pseudaminic acid was also detected in four other K loci. A related module including genes for an acylated relative of pseudaminic acid was also found in two new KL types. A polymerase chain reaction scheme was developed to detect all modules containing genes for sugars based on pseudaminic acid and to specifically detect KL2.

  16. An Ribonuclease T2 Family Protein Modulates Acinetobacter baumannii Abiotic Surface Colonization

    PubMed Central

    Jacobs, Anna C.; Blanchard, Catlyn E.; Catherman, Seana C.; Dunman, Paul M.; Murata, Yoshihiko


    Acinetobacter baumannii is an emerging bacterial pathogen of considerable medical concern. The organism's transmission and ability to cause disease has been associated with its propensity to colonize and form biofilms on abiotic surfaces in health care settings. To better understand the genetic determinants that affect biomaterial attachment, we performed a transposon mutagenesis analysis of abiotic surface-colonization using A. baumannii strain 98-37-09. Disruption of an RNase T2 family gene was found to limit the organism's ability to colonize polystyrene, polypropylene, glass, and stainless steel surfaces. DNA microarray analyses revealed that in comparison to wild type and complemented cells, the RNase T2 family mutant exhibited reduced expression of 29 genes, 15 of which are predicted to be associated with bacterial attachment and surface-associated motility. Motility assays confirmed that RNase T2 mutant displays a severe motility defect. Taken together, our results indicate that the RNase T2 family protein identified in this study is a positive regulator of A. baumannii's ability to colonize inanimate surfaces and motility. Moreover, the enzyme may be an effective target for the intervention of biomaterial colonization, and consequently limit the organism's transmission within the hospital setting. PMID:24489668

  17. Molecular epidemiology of carbapenem non-susceptible Acinetobacter baumannii in France.


    Jeannot, Katy; Diancourt, Laure; Vaux, Sophie; Thouverez, Michelle; Ribeiro, Amandina; Coignard, Bruno; Courvalin, Patrice; Brisse, Sylvain


    Carbapenem-resistant Acinetobacter baumannii have emerged globally. The objective of this study was to investigate the epidemiology, clonal diversity and resistance mechanisms of imipenem non-susceptible A. baumannii isolates in France. Between December 2010 and August 2011, 132 notifications were collected, including 37 outbreaks corresponding to 242 cases (2 to 55 per cluster). Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on 110 non-repetitive isolates. Gene blaOXA-23 was the most frequently detected (82%), followed by blaOXA-24 (11%) and blaOXA-58 (7%). Eleven sequence types (ST) were distinguished, among which sequence types ST1, ST2 (64%), ST20, ST25, ST85 and ST107. Isolates from epidemiological clusters had the same ST and resistance genes, indicating probable transmission within centres. In contrast, PFGE types of isolates differed among centres, arguing against transmission among centers. This study provides the first epidemiological snapshot of the population of A. baumannii with reduced susceptibility to carbapenems from France, and further underlines the predominance of international clones.

  18. Molecular Epidemiology of Carbapenem Non-Susceptible Acinetobacter baumannii in France

    PubMed Central

    Jeannot, Katy; Diancourt, Laure; Vaux, Sophie; Thouverez, Michelle; Ribeiro, Amandina; Coignard, Bruno; Courvalin, Patrice; Brisse, Sylvain


    Carbapenem-resistant Acinetobacter baumannii have emerged globally. The objective of this study was to investigate the epidemiology, clonal diversity and resistance mechanisms of imipenem non-susceptible A. baumannii isolates in France. Between December 2010 and August 2011, 132 notifications were collected, including 37 outbreaks corresponding to 242 cases (2 to 55 per cluster). Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on 110 non-repetitive isolates. Gene blaOXA-23 was the most frequently detected (82%), followed by blaOXA-24 (11%) and blaOXA-58 (7%). Eleven sequence types (ST) were distinguished, among which sequence types ST1, ST2 (64%), ST20, ST25, ST85 and ST107. Isolates from epidemiological clusters had the same ST and resistance genes, indicating probable transmission within centres. In contrast, PFGE types of isolates differed among centres, arguing against transmission among centers. This study provides the first epidemiological snapshot of the population of A. baumannii with reduced susceptibility to carbapenems from France, and further underlines the predominance of international clones. PMID:25517732

  19. Antibacterial effects of Iranian fennel essential oil on isolates of Acinetobacter baumannii.


    Jazani, N H; Zartoshti, M; Babazadeh, H; Ali-daiee, N; Zarrin, S; Hosseini, S


    The aim of the present study was the evaluation of the antibacterial activity of Fennel essential oil on isolates of Acinetobacter baumannii. Forty eight isolates were collected from clinical specimens from burn wards of hospitals in Tehran, Iran between April and September, 2006. The susceptibility of isolates was determined using a broth microdilution method. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) of isolates to Fennel essential oil were determined. The susceptibilities of isolates to different antibiotics were tested using agar disk diffusion method. The rates of resistance were determined to antibiotics as follows: cefazolin 100%, ciprofloxacin 100%, ofloxacin 95.8%, kanamycin 95.8%, carbenicillin 93.7%, ticarcillin 93.7%, piperacillin 88.9%, co-trimoxazole 79.1%, ceftizoxime 75%, gentamicin 70.8%, cefalotin 60.4%, amikacin 52% and imipenem 14.6%. Fennel essential oil possessed antibacterial effect against all isolates of A. baumannii. These results suggest the potential use of the Fennel essential oil for the control of multi-drug resistant A. baumannii infections. However, more adequate studies must be carried out to verify the possibility of using it for fighting bacterial infections in human.

  20. Emergence and clonal dissemination of carbapenem-hydrolysing OXA-58-producing Acinetobacter baumannii isolates in Bolivia.


    Sevillano, Elena; Fernández, Elena; Bustamante, Zulema; Zabalaga, Silvia; Rosales, Ikerne; Umaran, Adelaida; Gallego, Lucía


    Acinetobacter baumannii is an emerging multidrug-resistant pathogen and very little information is available regarding its imipenem resistance in Latin American countries such as Bolivia. This study investigated the antimicrobial resistance profile of 46 clinical strains from different hospitals in Cochabamba, Bolivia, from March 2008 to July 2009, and the presence of carbapenemases as a mechanism of resistance to imipenem. Isolates were obtained from 46 patients (one isolate per patient; 30 males,16 females) with an age range of 1 day to 84 years, and were collected from different sample types, the majority from respiratory tract infections (17) and wounds (13). Resistance to imipenem was detected in 15 isolates collected from different hospitals of the city. These isolates grouped into the same genotype, named A, and were resistant to all antibiotics tested including imipenem, with susceptibility only to colistin. Experiments to detect carbapenemases revealed the presence of the OXA-58 carbapenemase. Further analysis revealed the location of the bla(OXA-58) gene on a 40 kb plasmid. To our knowledge, this is the first report of carbapenem resistance in A. baumannii isolates from Bolivia that is conferred by the OXA-58 carbapenemase. The presence of this gene in a multidrug-resistant clone and its location within a plasmid is of great concern with regard to the spread of carbapenem-resistant A. baumannii in the hospital environment in Bolivia.

  1. Activation of phenotypic subpopulations in response to ciprofloxacin treatment in Acinetobacter baumannii.


    Macguire, Ashley E; Ching, Meining Carly; Diamond, Brett H; Kazakov, Alexey; Novichkov, Pavel; Godoy, Veronica G


    The multidrug-resistant, opportunistic pathogen, Acinetobacter baumannii, has spread swiftly through hospitals worldwide. Previously, we demonstrated that A. baumannii regulates the expression of various genes in response to DNA damage. Some of these regulated genes, especially those encoding the multiple error-prone DNA polymerases, can be implicated in induced mutagenesis, leading to antibiotic resistance. Here, we further explore the DNA damage-inducible system at the single cell level using chromosomal transcriptional reporters for selected DNA damage response genes. We found the genes examined respond in a bimodal fashion to ciprofloxacin treatment, forming two phenotypic subpopulations: induced and uninduced. This bimodal response to ciprofloxacin treatment in A. baumannii is unique and quite different than the Escherichia coli paradigm. The subpopulations are not genetically different, with each subpopulation returning to a starting state and differentiating with repeated treatment. We then identified a palindromic motif upstream of certain DNA damage response genes, and have shown alterations to this sequence to diminish the bimodal induction in response to DNA damaging treatment. Lastly, we are able to show a biological advantage for a bimodal response, finding that one subpopulation survives ciprofloxacin treatment better than the other. © 2014 John Wiley & Sons Ltd.

  2. Activation of Phenotypic Subpopulations in Response to Ciprofloxacin Treatment in Acinetobacter baumannii

    PubMed Central

    MacGuire, Ashley E.; Ching, Meining Carly; Diamond, Brett H.; Kazakov, Alexey; Novichkov, Pavel; Godoy, Veronica G.


    Summary The multidrug-resistant, opportunistic pathogen, Acinetobacter baumannii, has spread swiftly through hospitals worldwide. Previously, we demonstrated that A. baumannii regulates the expression of various genes in response to DNA damage. Some of these regulated genes, especially those encoding the multiple error-prone DNA polymerases, can be implicated in induced mutagenesis, leading to antibiotic resistance. Here, we further explore the DNA damage-inducible system at the single cell level using chromosomal transcriptional reporters for selected DNA damage response genes. We found the genes examined respond in a bimodal fashion to ciprofloxacin treatment, forming two phenotypic subpopulations: induced and uninduced. This bimodal response to ciprofloxacin treatment in A. baumannii is unique and quite different than the Escherichia coli paradigm. The subpopulations are not genetically different, with each subpopulation returning to a starting state and differentiating with repeated treatment. We then identified a palindromic motif upstream of certain DNA damage response genes, and have shown alterations to this sequence to diminish the bimodal induction in response to DNA damaging treatment. Lastly, we are able to show a biological advantage for a bimodal response, finding that one subpopulation survives ciprofloxacin treatment better than the other. PMID:24612352

  3. Meropenem selection induced overproduction of the intrinsic carbapenemase as well as phenotype divergence in Acinetobacter baumannii.


    Chen, Xin; Meng, Xiaobin; Gao, Qianqian; Zhang, Guoxiong; Gu, Hanfu; Guo, Xuemin


    Acinetobacter baumannii 37662 is a carbapenem-susceptible isolate with blaOXA-51-like as the sole carbapenemase gene. Following selection with meropenem (MEM) at a subinhibitory concentration, two morphologically different mutants, designated 37662RM1 and 37662RM2, were obtained and characterised. Compared with the parent strain, resistant mutant 37662RM1 grew at a slower rate and had impaired capsule synthesis, whereas 37662RM2 grew fast and abolished capsule synthesis. In addition, the latter resistant mutant also lost pathogenicity but showed significantly enhanced biofilm formation. Transposition of the insertion sequence ISAba1 and formation of ISAba1-blaOXA-51-like was responsible for the upregulated expression of blaOXA-51-like. The blaOXA-51-like gene of A. baumannii 37662 is a close variant of blaOXA-138 and has been designated blaOXA-508. Overproduction of OXA-508 conferred major carbapenem resistance to these two mutants. Overall, these results indicate that a subinhibitory concentration of MEM can induce phenotype divergence together with carbapenem resistance in A. baumannii. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  4. Computational gene network study on antibiotic resistance genes of Acinetobacter baumannii.


    Anitha, P; Anbarasu, Anand; Ramaiah, Sudha


    Multi Drug Resistance (MDR) in Acinetobacter baumannii is one of the major threats for emerging nosocomial infections in hospital environment. Multidrug-resistance in A. baumannii may be due to the implementation of multi-combination resistance mechanisms such as β-lactamase synthesis, Penicillin-Binding Proteins (PBPs) changes, alteration in porin proteins and in efflux pumps against various existing classes of antibiotics. Multiple antibiotic resistance genes are involved in MDR. These resistance genes are transferred through plasmids, which are responsible for the dissemination of antibiotic resistance among Acinetobacter spp. In addition, these resistance genes may also have a tendency to interact with each other or with their gene products. Therefore, it becomes necessary to understand the impact of these interactions in antibiotic resistance mechanism. Hence, our study focuses on protein and gene network analysis on various resistance genes, to elucidate the role of the interacting proteins and to study their functional contribution towards antibiotic resistance. From the search tool for the retrieval of interacting gene/protein (STRING), a total of 168 functional partners for 15 resistance genes were extracted based on the confidence scoring system. The network study was then followed up with functional clustering of associated partners using molecular complex detection (MCODE). Later, we selected eight efficient clusters based on score. Interestingly, the associated protein we identified from the network possessed greater functional similarity with known resistance genes. This network-based approach on resistance genes of A. baumannii could help in identifying new genes/proteins and provide clues on their association in antibiotic resistance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Prevalence and analysis of microbiological factors associated with phenotypic heterogeneous resistance to carbapenems in Acinetobacter baumannii.


    Fernández Cuenca, Felipe; Sánchez, M del Carmen Gómez; Caballero-Moyano, Francisco Javier; Vila, Jordi; Martínez-Martínez, Luis; Bou, Germán; Baño, Jesús Rodríguez; Pascual, Alvaro


    The objectives of this study were to determine the prevalence of Acinetobacter baumannii with phenotypic heterogeneous resistance (PHR) to carbapenems (colonies inside the halo of inhibition) and to analyse its association with several microbiological variables. Acinetobacter baumannii isolates collected in Spain were used to analyse: (i) minimum inhibitory concentrations (MICs) of carbapenems; (ii) heteroresistance to carbapenems; (iii) genes encoding β-lactamases (bla genes); (iv) insertion sequences; and (v) inactivation of genes encoding porins (CarO, OprD and Omp33-36) and genes associated with the AdeABC efflux system (adeB, adeR and adeS). Polymerase chain reaction (PCR) amplification was used for gene detection. The rate of PHR was 20% to imipenem and 24% to meropenem. Susceptibility to imipenem was observed in 39% of PHR isolates. MICs of carbapenems for colonies were similar (± 1 log(2) dilution) to those of their parental isolates. These colonies growing inside the inhibition halo also reproduced the PHR to carbapenems. Differences observed between PHR isolates and non-PHR isolates were: bla(OXA-58-like), 57% vs. 0%; oprD-like, 96% vs. 56%; adeB, 89% vs. 94%; adeR, 82% vs. 94%; adeS, 82% vs. 94%; ISAba2, 61% vs. 31%; and ISAba3, 57% vs. 0%. No interruption of genes encoding porins or the efflux-related genes (adeB, adeR and adeS) was observed. In conclusion, A. baumannii strains with PHR to carbapenems are widespread in Spain. This phenotype is present in carbapenem-susceptible isolates as well as those that are not susceptible to carbapenems. Heteroresistance cannot explain the PHR to carbapenems, which appears to relate more to persistence or tolerance to carbapenems. bla(OXA-58-like), bla(OXA-51-like), ISAba2 and ISAba3 are associated with PHR to carbapenems. Inactivation of genes encoding porins or genes related to AdeABC is infrequent.

  6. Effect of chlorine exposure on the survival and antibiotic gene expression of multidrug resistant Acinetobacter baumannii in water.


    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar


    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen.

  7. Effect of Chlorine Exposure on the Survival and Antibiotic Gene Expression of Multidrug Resistant Acinetobacter baumannii in Water

    PubMed Central

    Karumathil, Deepti Prasad; Yin, Hsin-Bai; Kollanoor-Johny, Anup; Venkitanarayanan, Kumar


    Acinetobacter baumannii is a multidrug resistant pathogen capable of causing a wide spectrum of clinical conditions in humans. Acinetobacter spp. is ubiquitously found in different water sources. Chlorine being the most commonly used disinfectant in water, the study investigated the effect of chlorine on the survival of A. baumannii in water and transcription of genes conferring antibiotic resistance. Eight clinical isolates of A. baumannii, including a fatal meningitis isolate (ATCC 17978) (~108 CFU/mL) were separately exposed to free chlorine concentrations (0.2, 1, 2, 3 and 4 ppm) with a contact time of 30, 60, 90 and 120 second. The surviving pathogen counts at each specified contact time were determined using broth dilution assay. In addition, real-time quantitative PCR (RT-qPCR) analysis of the antibiotic resistance genes (efflux pump genes and those encoding resistance to specific antibiotics) of three selected A. baumannii strains following exposure to chlorine was performed. Results revealed that all eight A. baumannii isolates survived the tested chlorine levels during all exposure times (p > 0.05). Additionally, there was an up-regulation of all or some of the antibiotic resistance genes in A. baumannii, indicating a chlorine-associated induction of antibiotic resistance in the pathogen. PMID:24514427

  8. Emergence of carbapenem-resistant Acinetobacter baumannii as the major cause of ventilator-associated pneumonia in intensive care unit patients at an infectious disease hospital in southern Vietnam.


    Nhu, Nguyen Thi Khanh; Lan, Nguyen Phu Huong; Campbell, James I; Parry, Christopher M; Thompson, Corinne; Tuyen, Ha Thanh; Hoang, Nguyen Van Minh; Tam, Pham Thi Thanh; Le, Vien Minh; Nga, Tran Vu Thieu; Nhu, Tran Do Hoang; Van Minh, Pham; Nga, Nguyen Thi Thu; Thuy, Cao Thu; Dung, Le Thi; Yen, Nguyen Thi Thu; Van Hao, Nguyen; Loan, Huynh Thi; Yen, Lam Minh; Nghia, Ho Dang Trung; Hien, Tran Tinh; Thwaites, Louise; Thwaites, Guy; Chau, Nguyen Van Vinh; Baker, Stephen


    Ventilator-associated pneumonia (VAP) is a serious healthcare-associated infection that affects up to 30 % of intubated and mechanically ventilated patients in intensive care units (ICUs) worldwide. The bacterial aetiology and corresponding antimicrobial susceptibility of VAP is highly variable, and can differ between countries, national provinces and even between different wards in the same hospital. We aimed to understand and document changes in the causative agents of VAP and their antimicrobial susceptibility profiles retrospectively over an 11 year period in a major infectious disease hospital in southern Vietnam. Our analysis outlined a significant shift from Pseudomonas aeruginosa to Acinetobacter spp. as the most prevalent bacteria isolated from quantitative tracheal aspirates in patients with VAP in this setting. Antimicrobial resistance was common across all bacterial species and we found a marked proportional annual increase in carbapenem-resistant Acinetobacter spp. over a 3 year period from 2008 (annual trend; odds ratio 1.656, P = 0.010). We further investigated the possible emergence of a carbapenem-resistant Acinetobacter baumannii clone by multiple-locus variable number tandem repeat analysis, finding a blaOXA-23-positive strain that was associated with an upsurge in the isolation of this pathogen. We additionally identified a single blaNDM-1-positive A. baumannii isolate. This work highlights the emergence of a carbapenem-resistant clone of A. baumannii and a worrying trend of antimicrobial resistance in the ICU of the Hospital for Tropical Diseases in Ho Chi Minh City, Vietnam.

  9. Reinforcing Lipid A Acylation on the Cell Surface of Acinetobacter baumannii Promotes Cationic Antimicrobial Peptide Resistance and Desiccation Survival

    PubMed Central

    Boll, Joseph M.; Tucker, Ashley T.; Klein, Dustin R.; Beltran, Alexander M.; Brodbelt, Jennifer S.; Davies, Bryan W.


    ABSTRACT Acinetobacter baumannii is an emerging Gram-negative pathogen found in hospitals and intensive care units. In order to persist in hospital environments, A. baumannii withstands desiccative conditions and can rapidly develop multidrug resistance to conventional antibiotics. Cationic antimicrobial peptides (CAMPs) have served as therapeutic alternatives because they target the conserved lipid A component of the Gram-negative outer membrane to lyse the bacterial cell. However, many Gram-negative pathogenic bacteria, including A. baumannii, fortify their outer membrane with hepta-acylated lipid A to protect the cell from CAMP-dependent cell lysis. Whereas in Escherichia coli and Salmonella, increased production of the outer membrane acyltransferase PagP results in formation of protective hepta-acylated lipid A, which reinforces the lipopolysaccharide portion of the outer membrane barrier, A. baumannii does not carry a gene that encodes a PagP homolog. Instead, A. baumannii has evolved a PagP-independent mechanism to synthesize protective hepta-acylated lipid A. Taking advantage of a recently adapted A. baumannii genetic recombineering system, we characterized two putative acyltransferases in A. baumannii designated LpxLAb (A. baumannii LpxL) and LpxMAb (A. baumannii LpxM), which transfer one and two lauroyl (C12:0) acyl chains, respectively, during lipid A biosynthesis. Hepta-acylation of A. baumannii lipid A promoted resistance to vertebrate and polymyxin CAMPs, which are prescribed as last-resort treatment options. Intriguingly, our analysis also showed that LpxMAb-dependent acylation of lipid A is essential for A. baumannii desiccation survival, a key resistance mechanism for survival in hospital environments. Compounds that inhibit LpxMAb-dependent hepta-acylation of lipid A could act synergistically with CAMPs to provide innovative transmission prevention strategies and treat multidrug-resistant infections. PMID:25991684

  10. [Distribution of blaOXA genes in Acinetobacter baumannii strains: a multicenter study].


    Ciftci, Ihsan Hakkı; Aşık, Gülşah; Karakeçe, Engin; Oksüz, Lütfiye; Yağcı, Server; Sesli Çetin, Emel; Ozdemir, Mehmet; Atasoy, Ali Rıza; Koçoğlu, Esra; Gül, Mustafa; Kurtoğlu, Muhammet Güzel; Köksal Çakırlar, Fatma; Seyrek, Adnan; Berktaş, Mustafa; Gültepe, Bilge; Ayyildiz, Ahmet


    Acinetobacter baumannii is the most important agent of nosocomial infections within the Acinetobacter genus. This gram-negative coccobacillus is intrinsically resistant to many antibiotics used in antimicrobial therapy, and capable of developing resistance including carbapenems. The objective of this study was to develop a multiplex real time polymerase chain reaction (qPCR) kit for OXA subgroups in A.baumannii, and to investigate the distribution of OXA subgroups in A.baumannii strains isolated from geographically different regions of Turkey. A total of 834 A.baumannii clinical isolates collected from different state and university medical centers in 13 provinces (Afyonkarahisar, Ankara, Bolu, Elazig, Erzurum, Isparta, Istanbul, Kahramanmaras, Konya, Sakarya, Van) between 2008-2011, were included in the study. The isolates were identified by conventional methods and automated systems [Vitek2 (bioMerieux, ABD) and Phoenix (BD Diagnostic, MD)]. The susceptibility profiles of the isolates were studied with automated systems and standard disc diffusion method. All samples were subjected to qPCR to detect blaOXA-51-like, blaOXA-23-like and blaOXA-58-like genes. A conventional PCR method was also used to detect blaOXA-24-like gene. The resistance rates observed during the study period were as follows: 96.8% for amoxicillin-clavulanate, 86.8% for ciprofloxacin, 74.7% for gentamicin, 71.7% for amikacin, 73.5% for cefaperozone-sulbactam, 72.1% for imipenem and 73% for meropenem. Six hundred and two (72.2 %) isolates were resistant to both imipenem and meropenem. Colistin was found to be the most effective antibiotic against A.baumannii isolates with 100% susceptibility rate. All isolates were positive for blaOXA-51-like, however blaOXA-24-like gene could not be demonstrated in any isolate. Total positivity rates of blaOXA-23-like and blaOXA-58-like genes were found as 53.7% and 12.5%, respectively, while these rates were 74.4% and 17.3% in carbapenem-resistant isolates

  11. CRISPR-cas Subtype I-Fb in Acinetobacter baumannii: Evolution and Utilization for Strain Subtyping

    PubMed Central

    Karah, Nabil; Samuelsen, Ørjan; Zarrilli, Raffaele; Sahl, Jason W.; Wai, Sun Nyunt; Uhlin, Bernt Eric


    Clustered regularly interspaced short palindromic repeats (CRISPR) are polymorphic elements found in the genome of some or all strains of particular bacterial species, providing them with a system of acquired immunity against invading bacteriophages and plasmids. Two CRISPR-Cas systems have been identified in Acinetobacter baumannii, an opportunistic pathogen with a remarkable capacity for clonal dissemination. In this study, we investigated the mode of evolution and diversity of spacers of the CRISPR-cas subtype I-Fb locus in a global collection of 76 isolates of A. baumannii obtained from 14 countries and 4 continents. The locus has basically evolved from a common ancestor following two main lineages and several pathways of vertical descent. However, this vertical passage has been interrupted by occasional events of horizontal transfer of the whole locus between distinct isolates. The isolates were assigned into 40 CRISPR-based sequence types (CST). CST1 and CST23-24 comprised 18 and 9 isolates, representing two main sub-clones of international clones CC1 and CC25, respectively. Epidemiological data showed that some of the CST1 isolates were acquired or imported from Iraq, where it has probably been endemic for more than one decade and occasionally been able to spread to USA, Canada, and Europe. CST23-24 has shown a remarkable ability to cause national outbreaks of infections in Sweden, Argentina, UAE, and USA. The three isolates of CST19 were independently imported from Thailand to Sweden and Norway, raising a concern about the prevalence of CST19 in Thailand. Our study highlights the dynamic nature of the CRISPR-cas subtype I-Fb locus in A. baumannii, and demonstrates the possibility of using a CRISPR-based approach for subtyping a significant part of the global population of A. baumannii. PMID:25706932

  12. CRISPR-cas subtype I-Fb in Acinetobacter baumannii: evolution and utilization for strain subtyping.


    Karah, Nabil; Samuelsen, Ørjan; Zarrilli, Raffaele; Sahl, Jason W; Wai, Sun Nyunt; Uhlin, Bernt Eric


    Clustered regularly interspaced short palindromic repeats (CRISPR) are polymorphic elements found in the genome of some or all strains of particular bacterial species, providing them with a system of acquired immunity against invading bacteriophages and plasmids. Two CRISPR-Cas systems have been identified in Acinetobacter baumannii, an opportunistic pathogen with a remarkable capacity for clonal dissemination. In this study, we investigated the mode of evolution and diversity of spacers of the CRISPR-cas subtype I-Fb locus in a global collection of 76 isolates of A. baumannii obtained from 14 countries and 4 continents. The locus has basically evolved from a common ancestor following two main lineages and several pathways of vertical descent. However, this vertical passage has been interrupted by occasional events of horizontal transfer of the whole locus between distinct isolates. The isolates were assigned into 40 CRISPR-based sequence types (CST). CST1 and CST23-24 comprised 18 and 9 isolates, representing two main sub-clones of international clones CC1 and CC25, respectively. Epidemiological data showed that some of the CST1 isolates were acquired or imported from Iraq, where it has probably been endemic for more than one decade and occasionally been able to spread to USA, Canada, and Europe. CST23-24 has shown a remarkable ability to cause national outbreaks of infections in Sweden, Argentina, UAE, and USA. The three isolates of CST19 were independently imported from Thailand to Sweden and Norway, raising a concern about the prevalence of CST19 in Thailand. Our study highlights the dynamic nature of the CRISPR-cas subtype I-Fb locus in A. baumannii, and demonstrates the possibility of using a CRISPR-based approach for subtyping a significant part of the global population of A. baumannii.

  13. Antimicrobial Activity of Gallium Protoporphyrin IX against Acinetobacter baumannii Strains Displaying Different Antibiotic Resistance Phenotypes.


    Arivett, Brock A; Fiester, Steven E; Ohneck, Emily J; Penwell, William F; Kaufman, Cynthia M; Relich, Ryan F; Actis, Luis A


    A paucity of effective, currently available antibiotics and a lull in antibiotic development pose significant challenges for treatment of patients with multidrug-resistant (MDR) Acinetobacter baumannii infections. Thus, novel therapeutic strategies must be evaluated to meet the demands of treatment of these often life-threatening infections. Accordingly, we examined the antibiotic activity of gallium protoporphyrin IX (Ga-PPIX) against a collection of A. baumannii strains, including nonmilitary and military strains and strains representing different clonal lineages and isolates classified as susceptible or MDR. Susceptibility testing demonstrated that Ga-PPIX inhibits the growth of all tested strains when cultured in cation-adjusted Mueller-Hinton broth, with a MIC of 20 μg/ml. This concentration significantly reduced bacterial viability, while 40 μg/ml killed all cells of the A. baumannii ATCC 19606(T) and ACICU MDR isolate after 24-h incubation. Recovery of ATCC 19606(T) and ACICU strains from infected A549 human alveolar epithelial monolayers was also decreased when the medium was supplemented with Ga-PPIX, particularly at a 40-μg/ml concentration. Similarly, the coinjection of bacteria with Ga-PPIX increased the survival of Galleria mellonella larvae infected with ATCC 19606(T) or ACICU. Ga-PPIX was cytotoxic only when monolayers or larvae were exposed to concentrations 16-fold and 1,250-fold higher than those showing antibacterial activity, respectively. These results indicate that Ga-PPIX could be a viable therapeutic option for treatment of recalcitrant A. baumannii infections regardless of the resistance phenotype, clone lineage, time and site of isolation of strains causing these infections and their iron uptake phenotypes or the iron content of the media. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Antimicrobial Activity of Gallium Protoporphyrin IX against Acinetobacter baumannii Strains Displaying Different Antibiotic Resistance Phenotypes

    PubMed Central

    Arivett, Brock A.; Fiester, Steven E.; Ohneck, Emily J.; Penwell, William F.; Kaufman, Cynthia M.; Relich, Ryan F.


    A paucity of effective, currently available antibiotics and a lull in antibiotic development pose significant challenges for treatment of patients with multidrug-resistant (MDR) Acinetobacter baumannii infections. Thus, novel therapeutic strategies must be evaluated to meet the demands of treatment of these often life-threatening infections. Accordingly, we examined the antibiotic activity of gallium protoporphyrin IX (Ga-PPIX) against a collection of A. baumannii strains, including nonmilitary and military strains and strains representing different clonal lineages and isolates classified as susceptible or MDR. Susceptibility testing demonstrated that Ga-PPIX inhibits the growth of all tested strains when cultured in cation-adjusted Mueller-Hinton broth, with a MIC of 20 μg/ml. This concentration significantly reduced bacterial viability, while 40 μg/ml killed all cells of the A. baumannii ATCC 19606T and ACICU MDR isolate after 24-h incubation. Recovery of ATCC 19606T and ACICU strains from infected A549 human alveolar epithelial monolayers was also decreased when the medium was supplemented with Ga-PPIX, particularly at a 40-μg/ml concentration. Similarly, the coinjection of bacteria with Ga-PPIX increased the survival of Galleria mellonella larvae infected with ATCC 19606T or ACICU. Ga-PPIX was cytotoxic only when monolayers or larvae were exposed to concentrations 16-fold and 1,250-fold higher than those showing antibacterial activity, respectively. These results indicate that Ga-PPIX could be a viable therapeutic option for treatment of recalcitrant A. baumannii infections regardless of the resistance phenotype, clone lineage, time and site of isolation of strains causing these infections and their iron uptake phenotypes or the iron content of the media. PMID:26416873

  15. Risk factors and molecular epidemiology of Acinetobacter baumannii bacteremia in neonates.


    Lee, Hao-Yuan; Hsu, Shih-Yun; Hsu, Jen-Fu; Chen, Chyi-Liang; Wang, Yi-Hsin; Chiu, Cheng-Hsun


    Acinetobacter baumannii infections in neonates are not uncommon but rarely studied. Clinical and molecular epidemiology of 40 patients with A. baumannii bacteremia in the neonatal intensive care units (NICUs) of a medical center from 2004 to 2014 was analyzed. Multi-drug resistance was found in only 3 isolates (7.5%). Sequence types (STs) of A. baumannii defined by multilocus sequencing typing were diverse, and 72.4% identified isolates belonged to novel STs. Majority of the isolates were susceptible to antibiotics tested. Among the 3 imipenem-resistant A. baumannii (IRAB) isolates, 2 (66.7%) belonged to ST684, a novel ST. All of the 3 isolates were susceptible to tigecycline and colistin. The predominant mechanism of imipenem resistance in these neonatal isolates is ISAba1-blaOXA-80, which has never been reported in Asia before. Most infected newborns were premature (95%), with very low birth weight (70% < 1500 g), prolonged intubation, usage of percutaneous central venous catheter (65%) and long-term usage of total parenteral nutrition or intravenous lipid (95%). IRAB infection, inappropriate initial therapy, 1-minute Apgar score and early onset infection within the first 10 days of life were found to correlate with mortality by log-rank test. Prior use of imipenem for at least 5 days and use of high frequency oscillation ventilation (HFOV) were statistically significant risk factors for acquiring IRAB infections. To reduce mortality of IRAB infection, it is crucial to consider giving effective agents, such as colistin, in 2 days for high risk neonates who has been given imipenem or used HFOV. Copyright © 2017. Published by Elsevier B.V.

  16. Analysis of genes encoding penicillin-binding proteins in clinical isolates of Acinetobacter baumannii.


    Cayô, Rodrigo; Rodríguez, María-Cruz; Espinal, Paula; Fernández-Cuenca, Felipe; Ocampo-Sosa, Alain A; Pascual, Alvaro; Ayala, Juan A; Vila, Jordi; Martínez-Martínez, Luis


    There is limited information on the role of penicillin-binding proteins (PBPs) in the resistance of Acinetobacter baumannii to β-lactams. This study presents an analysis of the allelic variations of PBP genes in A. baumannii isolates. Twenty-six A. baumannii clinical isolates (susceptible or resistant to carbapenems) from three teaching hospitals in Spain were included. The antimicrobial susceptibility profile, clonal pattern, and genomic species identification were also evaluated. Based on the six complete genomes of A. baumannii, the PBP genes were identified, and primers were designed for each gene. The nucleotide sequences of the genes identified that encode PBPs and the corresponding amino acid sequences were compared with those of ATCC 17978. Seven PBP genes and one monofunctional transglycosylase (MGT) gene were identified in the six genomes, encoding (i) four high-molecular-mass proteins (two of class A, PBP1a [ponA] and PBP1b [mrcB], and two of class B, PBP2 [pbpA or mrdA] and PBP3 [ftsI]), (ii) three low-molecular-mass proteins (two of type 5, PBP5/6 [dacC] and PBP6b [dacD], and one of type 7 (PBP7/8 [pbpG]), and (iii) a monofunctional enzyme (MtgA [mtgA]). Hot spot mutation regions were observed, although most of the allelic changes found translated into silent mutations. The amino acid consensus sequences corresponding to the PBP genes in the genomes and the clinical isolates were highly conserved. The changes found in amino acid sequences were associated with concrete clonal patterns but were not directly related to susceptibility or resistance to β-lactams. An insertion sequence disrupting the gene encoding PBP6b was identified in an endemic carbapenem-resistant clone in one of the participant hospitals.

  17. Analysis of Genes Encoding Penicillin-Binding Proteins in Clinical Isolates of Acinetobacter baumannii ▿ †

    PubMed Central

    Cayô, Rodrigo; Rodríguez, María-Cruz; Espinal, Paula; Fernández-Cuenca, Felipe; Ocampo-Sosa, Alain A.; Pascual, Álvaro; Ayala, Juan A.; Vila, Jordi; Martínez-Martínez, Luis


    There is limited information on the role of penicillin-binding proteins (PBPs) in the resistance of Acinetobacter baumannii to β-lactams. This study presents an analysis of the allelic variations of PBP genes in A. baumannii isolates. Twenty-six A. baumannii clinical isolates (susceptible or resistant to carbapenems) from three teaching hospitals in Spain were included. The antimicrobial susceptibility profile, clonal pattern, and genomic species identification were also evaluated. Based on the six complete genomes of A. baumannii, the PBP genes were identified, and primers were designed for each gene. The nucleotide sequences of the genes identified that encode PBPs and the corresponding amino acid sequences were compared with those of ATCC 17978. Seven PBP genes and one monofunctional transglycosylase (MGT) gene were identified in the six genomes, encoding (i) four high-molecular-mass proteins (two of class A, PBP1a [ponA] and PBP1b [mrcB], and two of class B, PBP2 [pbpA or mrdA] and PBP3 [ftsI]), (ii) three low-molecular-mass proteins (two of type 5, PBP5/6 [dacC] and PBP6b [dacD], and one of type 7 (PBP7/8 [pbpG]), and (iii) a monofunctional enzyme (MtgA [mtgA]). Hot spot mutation regions were observed, although most of the allelic changes found translated into silent mutations. The amino acid consensus sequences corresponding to the PBP genes in the genomes and the clinical isolates were highly conserved. The changes found in amino acid sequences were associated with concrete clonal patterns but were not directly related to susceptibility or resistance to β-lactams. An insertion sequence disrupting the gene encoding PBP6b was identified in an endemic carbapenem-resistant clone in one of the participant hospitals. PMID:21947403

  18. Unsuitability of MALDI-TOF MS to discriminate Acinetobacter baumannii clones under routine experimental conditions

    PubMed Central

    Sousa, Clara; Botelho, João; Grosso, Filipa; Silva, Liliana; Lopes, João; Peixe, Luísa


    MALDI-TOF MS (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry) is now in the forefront for routine bacterial species identification methodologies, being its value for clonality assessment controversial. In this work we evaluated the potential of MALDI-TOF MS for assisting infection control by depicting Acinetobacter baumannii clones. Mass spectra of 58 A. baumannii clinical isolates belonging to the worldwide spread lineages (ST98, ST103, ST208, and ST218) isolated in our country, were obtained and analyzed with several chemometric tools (pseudo gel views, peakfind function, and partial least squares discriminant analysis). The clonal lineages were obtained using the “Oxford” scheme, belonging ST98, ST208, and ST218 to the international clone II and ST103 to an epidemic clonal lineage (SG5). Additionally, mass spectra of a highly diverse international collection of 38 isolates belonging to 22 sequence types (STs) were obtained for further comparisons. Pseudo gel views and direct peak pattern analysis did not allow the discrimination of A. baumannii isolates belonging to ST98, ST103, ST208, or ST218. Moreover, a partial least square discriminant analysis of the mass spectra considering two spectral ranges (2–20 kDa and 4–10 kDa) revealed a poor degree of discrimination with only 64.6 and 65.8% of correct ST assignments, respectively. Also, mass spectra of the international isolates (n = 38, 22STs) revealed a very congruent peak pattern among them as well as among the four lineages included in this work. Despite the increasing interest of MALDI-TOF MS for bacterial typing at different taxonomical levels, we demonstrated, using routine experimental conditions, the unsuitability of this methodology for A. baumannii clonal discrimination. PMID:26042113

  19. The importance of colonization pressure in multiresistant Acinetobacter baumannii acquisition in a Greek intensive care unit

    PubMed Central


    Introduction We investigated the role of colonization pressure on multiresistant Acinetobacter baumannii acquisition and defined patient-related predictors for carriage at admission and acquisition during hospitalization in intensive care unit (ICU) patients. Methods This was a 12-month, prospective, cohort study of all patients admitted to a single ICU of a tertiary hospital. Screening samples were collected at ICU admission to identify imported carriers, and weekly during hospitalization to identify acquisition. Colonization pressure (carriers' patient-days × 100/all patients' patient-days) and the absolute number of carriers were calculated weekly, and the statistical correlation between these parameters and acquisition was explored. Multivariable analysis was performed to identify predictors for A. baumannii carriage at admission and acquisition during hospitalization. A. baumannii isolates were genotyped by repetitive-extragenic-palindromic polymerase chain reaction (PCR; rep-PCR). Results At ICU admission, 284 patients were screened for carriage. A. baumannii was imported in 16 patients (5.6%), and acquisition occurred in 32 patients (15.7%). Acquisition was significantly correlated to weekly colonization pressure (correlation coefficient, 0.379; P = 0.004) and to the number of carriers per week (correlation coefficient, 0.499; P <0.001). More than one carrier per week significantly increased acquisition risk (two to three carriers, odds ratio (OR), 12.66; P = 0.028; more than four carriers, OR, 25.33; P = 0.004). Predictors of carriage at admission were infection at admission (OR, 11.03; confidence interval (CI), 3.56 to 34.18; P < 0.01) and hospitalization days before ICU (OR, 1.09; CI, 1.01 to 1.16; P = 0.02). Predictors of acquisition were a medical reason for ICU admission (OR, 5.11; CI, 1.31 to 19.93; P = 0.02), duration of antibiotic administration in the unit (OR, 1.24; CI, 1.12 to 1.38; P < 0.001), and duration of mechanical ventilation (OR, 1

  20. Detection of class 1 integron in Acinetobacter baumannii isolates collected from nine hospitals in Turkey

    PubMed Central

    ÇİÇek, Ayşegül Çopur; Düzgün, Azer Özad; Saral, Ayşegül; Kayman, Tuba; Çİzmecİ, Zeynep; Balcı, Pervin Özlem; Dal, Tuba; Fırat, Mehmet; Tosun, İsmail; Alıtntop, Yasemin Ay; Çalışkan, Ahmet; Yazıcı, Yelda; Sandallı, Cemal


    Objective To investigate the antibiotic resistance genes inserted into class 1 and class 2 integrons in Acinetobacter baumannii (A. baumannii) isolates obtained from nine different cities in Turkey. Methods A collection of 281 A. baumannii clinical isolates were collected from nine diferent state hospitals in Turkey and were confirmed as A. baumannii by conventional biochemical, API testing and bla-OXA-51 specific PCR. The isolates were examined by PCR for existence of class 1 and 2 integron gene cassettes. Results They were characterized by antimicrobial susceptibility testing and the highest resistance rates were determined for piperacillin (90.03%), ciprofloxacin (87.54%), cefepime and trimethoprim/sulfamethoxazole (81.13%). The lowest resistance rates was for cefotaxime (3.55%). class I integrons were detected in 6.4% (18/281) of A. baumannii strains and no class 2 integron was detected. The gene cassettes of class 1 integrons AacC1-AAC(3)I-aadA1, AacC1-aadA1, AAC(3)-I, AAC(3)-I -AAC(3)-I -aadA1, TEM-1, AAC(3)-I-aadA1 - AAC(3)-I -AAC(3)-I, AAC(3)-I -AAC(3)-I -AAC(3)-I -aadA1, AAC(3)-I - aadA1, AAC(3)-I-AAC(3)-I, AAC(3)-I-aadA1- AAC(3)-I-aadA1, AAC(3)-I- AAC(3)-I- aadA1-AAC(3)-I-aadA1 were detected in eighteen strains. The aac genes family were most frequently found integrated into the class 1 integrons and it was followed by aadA genes and TEM-1 genes. Conclusions This is an extensive study on the distribution of class 1 integron among A. baumannii in Turkey. In addition to these, two new alleles were observed. Their percentage rates of similarity to other cassettes are 95% aadA1 ( TKA18) and 89% aadA1 (ANKA3). PMID:23998017

  1. Multi-omics approach to study global changes in a triclosan-resistant mutant strain of Acinetobacter baumannii ATCC 17978.


    Fernando, Dinesh M; Chong, Patrick; Singh, Manu; Spicer, Victor; Unger, Mark; Loewen, Peter C; Westmacott, Garrett; Kumar, Ayush


    Acinetobacter baumannii AB042, a triclosan-resistant mutant strain, was examined for modulated gene expression using whole-genome sequencing, transcriptomics and proteomics in order to understand the mechanism of triclosan resistance as well as its impact on A. baumannii. Data revealed modulated expression of the fatty acid metabolism pathway, co-factors known to play a role in the synthesis of fatty acids, as well as several transcriptional regulators. The membrane composition of the mutant revealed a decrease in C18 with a corresponding increase in C16 fatty acids compared with the parent strain A. baumannii ATCC 17978. These data indicate that A. baumannii responds to triclosan by altering the expression of genes involved in fatty acid metabolism, antibiotic resistance and amino acid metabolism.

  2. Colistin enhances therapeutic efficacy of daptomycin or teicoplanin in a murine model of multiresistant Acinetobacter baumannii sepsis.


    Cirioni, Oscar; Simonetti, Oriana; Pierpaoli, Elisa; Barucca, Alessandra; Ghiselli, Roberto; Orlando, Fiorenza; Pelloni, Maria; Trombettoni, Maria Michela Cappelletti; Guerrieri, Mario; Offidani, Annamaria; Giacometti, Andrea; Provinciali, Mauro


    We investigated the efficacy of colistin combined with teicoplanin or daptomycin in an experimental mouse model of multiresistant Acinetobacter baumannii infection. Animal received intraperitoneally 1ml saline containing 2×10(10)CFU of A. baumannii. Colistin, daptomycin, teicoplanin, and colistin plus daptomycin or teicoplanin were given by intraperitoneal administration 2h after bacterial challenge. A control group received sodium chloride solution. In the in vitro study A. baumannii showed to be susceptible only to colistin with MIC of 2mg/l. In the in vivo study, colistin alone showed a good antimicrobial efficacy. When combined with teicoplanin or daptomycin, colistin produced the lowest bacterial and the best survival rates. In immunological studies, when colistin was associated to daptomycin or teicoplanin, both the number and the cytotoxic activity of NK cells increased. In conclusion, colistin combined with teicoplanin or daptomycin may improve the therapy of multiresistant A. baumannii infection. Copyright © 2016. Published by Elsevier Inc.

  3. Antibiogram of multidrug resistant Acinetobacter baumannii isolated from clinical specimens at King Hussein Medical Centre, Jordan: a retrospective analysis.


    Batarseh, A; Al-Sarhan, A; Maayteh, M; Al-Khatirei, S; Alarmouti, M


    This study was conducted to determine the prevalence and the local antibiogram of multidrug-resistant Acinetobacter baumannii isolates in Al-Hussein Hospital at King Hussein Medical Centre in Amman, Jordan. In a retrospective study from January to December 2013, data on 116 non-repetitive positive clinical samples were retrieved from patients' laboratory records. The resistance rates of A. baumannii isolates were high for ceftriaxone, cefotaxime and ticarcillin (100%), ceftazidime, cefepime and piperacillin (98.3%), imipenem (97.4%), piperacillin/tazobactam (96.6%), quinolones (94.8%), ampicillin/sulbactam (89.7%), gentamicin, (87.9%), tobramycin and tetracycline (76.7%) and trimethoprim/sulfamethoxazole (75.9%), but lower for minocycline (26.7%) and colistin (1.7%). A. baumannii in our hospital were highly resistant to all antibiotics, including tigecycline, except for minocycline and colistin which are considered the last resort treatment for multidrug-resistant A. baumannii.

  4. No evidence of Bartonella quintana but detection of Acinetobacter baumannii in head lice from elementary schoolchildren in Paris.


    Bouvresse, Sophie; Socolovshi, Cristina; Berdjane, Zohra; Durand, Rémy; Izri, Arezki; Raoult, Didier; Chosidow, Olivier; Brouqui, Philippe


    The human body louse is the only known vector of Bartonella quintana. However, the presence of this bacterium has recently been detected in the head lice of homeless individuals and Nepalese slum children. Previous studies have reported the isolation of Acinetobacter baumannii from the body lice of homeless individuals. An epidemiological survey including 74 schools was conducted between 2008 and 2009 in Paris. After a first visual examination, the hair of children with suspected pediculosis was combed with a fine-tooth comb to collect live adult head lice. Molecular studies were performed on randomly selected DNA samples to detect B. quintana and A. baumannii by specific quantitative real-time PCR. Among a collection of 288 DNA samples, B. quintana was not detected, but A. baumannii was detected in 95 DNA samples (33%). Further study is needed to determine the significance of the finding of A. baumannii in head lice.

  5. Whole-genome pyrosequencing of an epidemic multidrug-resistant Acinetobacter baumannii strain belonging to the European clone II group.


    Iacono, Michele; Villa, Laura; Fortini, Daniela; Bordoni, Roberta; Imperi, Francesco; Bonnal, Raoul J P; Sicheritz-Ponten, Thomas; De Bellis, Gianluca; Visca, Paolo; Cassone, Antonio; Carattoli, Alessandra


    The whole-genome sequence of an epidemic, multidrug-resistant Acinetobacter baumannii strain (strain ACICU) belonging to the European clone II group and carrying the plasmid-mediated bla(OXA)(-)(58) carbapenem resistance gene was determined. The A. baumannii ACICU genome was compared with the genomes of A. baumannii ATCC 17978 and Acinetobacter baylyi ADP1, with the aim of identifying novel genes related to virulence and drug resistance. A. baumannii ACICU has a single chromosome of 3,904,116 bp (which is predicted to contain 3,758 genes) and two plasmids, pACICU1 and pACICU2, of 28,279 and 64,366 bp, respectively. Genome comparison showed 86.4% synteny with A. baumannii ATCC 17978 and 14.8% synteny with A. baylyi ADP1. A conspicuous number of transporters belonging to different superfamilies was predicted for A. baumannii ACICU. The relative number of transporters was much higher in ACICU than in ATCC 17978 and ADP1 (76.2, 57.2, and 62.5 transporters per Mb of genome, respectively). An antibiotic resistance island, AbaR2, was identified in ACICU and had plausibly evolved by reductive evolution from the AbaR1 island previously described in multiresistant strain A. baumannii AYE. Moreover, 36 putative alien islands (pAs) were detected in the ACICU genome; 24 of these had previously been described in the ATCC 17978 genome, 4 are proposed here for the first time and are present in both ATCC 17978 and ACICU, and 8 are unique to the ACICU genome. Fifteen of the pAs in the ACICU genome encode genes related to drug resistance, including membrane transporters and ex novo acquired resistance genes. These findings provide novel insight into the genetic basis of A. baumannii resistance.

  6. Is the use of low-pressure pulsatile lavage for pressure ulcer management associated with environmental contamination with Acinetobacter baumannii?


    Ho, Chester H; Johnson, Tova; Miklacic, Joan; Donskey, Curtis J


    Ho CH, Johnson T, Miklacic J, Donskey CJ. Is the use of low-pressure pulsatile lavage for pressure ulcer management associated with environmental contamination with Acinetobacter baumannii? To determine the extent of environmental contamination associated with low-pressure pulsatile lavage of stage III or IV pressure ulcers in patients with spinal cord injury (SCI) when routine infection control precautions are used for wounds colonized or infected with Acinetobacter baumannii. Prospective investigation in which pressure ulcer cultures and environmental cultures were obtained before and after low-pressure pulsatile lavage treatment, and before and after regular dressing changes. Environmental cultures included the patient's bedrail and settle plates placed 0.6, 1.5, and 2.4m from the wound to assess airborne spread of A. baumannii. SCI inpatient unit in a Department of Veterans Affairs Medical Center. Inpatients (N=15) with SCI receiving daily low-pressure pulsatile lavage treatment for stage III or IV pressure ulcers with standard dressing change, as well as regular dressing changes without low-pressure pulsatile lavage at other times of the day. Standard, regular dressing changes and dressing changes with low-pressure pulsatile lavage. Comparison of frequency of environmental contamination with A. baumannii associated with low-pressure pulsatile lavage versus regular dressing changes.