Science.gov

Sample records for aeruginosa salmonella typhi

  1. Salmonella typhi sternal wound infection.

    PubMed

    Sfeir, Maroun; Youssef, Pierre; Mokhbat, Jacques E

    2013-12-01

    Samonella typhi usually causes gastrointestinal infections. Few reports in the literature described skin and soft tissue infections related to Salmonella species, especially in immunocompetent patients. Our case exhibited sternal abscess growing Salmonella typhi.

  2. Mechanisms of Salmonella Typhi Host Restriction.

    PubMed

    Spanò, Stefania

    2016-01-01

    Salmonella enterica serovar Typhi (S. Typhi) is the cause of typhoid fever, a life-threatening bacterial infection that is very common in the developing world. Recent spread of antimicrobial resistant isolates of S. Typhi makes typhoid fever, a global public health risk. Despite being a common disease, still very little is known about the molecular mechanisms underlying typhoid fever and S. Typhi pathogenesis. In contrast to other Salmonellae, S. Typhi can only infect humans. The molecular bases of this human restriction are mostly unknown. Recent studies identified a novel pathway that contributes to S. Typhi human restriction and is required for killing S. Typhi in macrophages of nonsusceptible species. The small Rab GTPase Rab32 and its guanine nucleotide exchange factor BLOC-3 are the critical components of this pathway. These proteins were already well known as important regulators of intracellular membrane transport. In particular, they are central for the transport of enzymes that synthetize melanin in pigment cells. The recent findings that Rab32 and BLOC-3 are required for S. Typhi host restriction point out to a novel mechanism restricting the growth of bacterial pathogen, dependent on the transport of still unknown molecule(s) to the S. Typhi vacuole. The identification of this novel antimicrobial pathway constitutes a critical starting point to study molecular mechanisms killing bacterial pathogens and possibly identify novel antimicrobial molecules.

  3. Sexually acquired Salmonella Typhi urinary tract infection.

    PubMed

    Wielding, Sally; Scott, Gordon

    2016-05-01

    We report a case of isolated urinary Salmonella enterica serotype Typhi in an HIV-positive man who has sex with men. He was clinically well and blood and stool cultures were negative, indicating that this may have been a sexually acquired urinary tract infection.

  4. Ludwig's angina by Salmonella Typhi: a clinical dilemma.

    PubMed

    Mahajan, R K; Sharma, S; Madan, P; Sharma, N

    2015-01-01

    Salmonella Typhi has rarely been associated with focal abscesses; and in literature, there is no evidence of its association with abscesses in the neck spaces. Ability of Salmonella Typhi to invade and localise in the neck spaces not only poses a diagnostic challenge but also underscores the necessity to understand the mechanisms that facilitate Salmonella Typhi to establish infections at sites completely non-traditional to the organism.

  5. Salmonella Typhi Vertebral Osteomyelitis and Epidural Abscess

    PubMed Central

    Chua, Ying Ying; Chen, John L. T.

    2016-01-01

    Salmonella vertebral osteomyelitis is an uncommon complication of Salmonella infection. We report a case of a 57-year-old transgender male who presented with lower back pain for a period of one month following a fall. Physical examination only revealed tenderness over the lower back with no neurological deficits. MRI of the thoracic and lumbar spine revealed a spondylodiscitis at T10-T11 and T12-L1 and right posterior epidural collection at the T9-T10 level. He underwent decompression laminectomy with segmental instrumentation and fusion of T8 to L3 vertebrae. Intraoperatively, he was found to have acute-on-chronic osteomyelitis in T10 and T11, epidural abscess, and discitis in T12-L1. Tissue and wound culture grew Salmonella Typhi and with antibiotics susceptibility guidance he was treated with intravenous ceftriaxone for a period of six weeks. He recovered well with no neurological deficits. PMID:27034871

  6. Comparative Virulotyping of Salmonella typhi and Salmonella enteritidis.

    PubMed

    Elemfareji, Omar Ismail; Thong, Kwai Lin

    2013-12-01

    Members of Salmonella enterica are important foodborne pathogens of significant public health concern worldwide. This study aimed to determine a range of virulence genes among typhoidal (S. typhi) and non-typhoidal (S. enteritidis) strains isolated from different geographical regions and different years. A total of 87 S. typhi and 94 S. enteritidis strains were tested for presence of 22 virulence genes by employing multiplex PCR and the genetic relatedness of these strains was further characterized by REP-PCR. In S. typhi, invA, prgH, sifA, spiC, sopB, iroN, sitC, misL, pipD, cdtB, and orfL were present in all the strains, while sopE, agfC, agfA, sefC, mgtC, and sefD were present in 98.8, 97.7, 90.8, 87.4, 87.4 and 17.2 %, of the strains, respectively. No lpfA, lpfC, pefA, spvB, or spvC was detected. Meanwhile, in S. enteritidis, 15 genes, agfA, agfC, invA, lpfA, lpfC, sefD, prgH, spiC, sopB, sopE, iroN, sitC, misL, pipD, and orfL were found in all S. enteritidis strains 100 %, followed by sifA and spvC 98.9 %, pefA, spvB and mgtC 97.8 %, and sefC 90.4 %. cdtB was absent from all S. enteritidis strains tested. REP-PCR subtyped S. typhi strains into 18 REP-types and concurred with the virulotyping results in grouping the strains, while in S. enteritidis, REP-PCR subtyped the strains into eight profiles and they were poorly distinguishable between human and animal origins. The study showed that S. typhi and S. enteritidis contain a range of virulence factors associated with pathogenesis. Virulotyping is a rapid screening method to identify and profile virulence genes in Salmonella strains, and improve an understanding of potential risk for human and animal infections.

  7. Salmonella typhi Liver Abscess Overlying a Metastatic Melanoma

    PubMed Central

    Jorge, Jannaina F.; Costa, Andressa B. V.; Rodrigues, Jorge L. N.; Girão, Evelyne S.; Luiz, Roberta S. S.; Sousa, Anastácio Q.; Moore, Sean R.; Menezes, Dalgimar B.; Leitão, Terezinha M. J. S.

    2014-01-01

    Pyogenic liver abscesses caused by Salmonella enterica serotype Typhi, although rare, can occur especially in patients with pre-existing hepatobiliary disease, hepatocellular carcinoma, and metastatic liver tumors. We present a case of Salmonella liver abscesses complicating metastatic melanoma in a 24-year-old alcoholic male. PMID:24591434

  8. Invasive non-Typhi Salmonella disease in Africa.

    PubMed

    Morpeth, Susan C; Ramadhani, Habib O; Crump, John A

    2009-08-15

    Invasive non-Typhi Salmonella is endemic to sub-Saharan Africa, where it is a leading cause of bloodstream infection. Some host risk factors have been established, but little is known about environmental reservoirs and predominant modes of transmission, so prevention strategies are underdeveloped. Although foodborne transmission from animals to humans predominates in high-income countries, it has been postulated that transmission between humans, both within and outside health care facilities, may be important in sub-Saharan Africa. Antimicrobial resistance to ampicillin, trimethoprim-sulfamethoxazole, and chloramphenicol is common among non-Typhi Salmonella strains; therefore, wider use of alternative agents may be warranted for empirical therapy. Development of vaccines targeting the leading invasive non-Typhi Salmonella serotypes Typhimurium and Enteritidis is warranted. The clinical presentation of non-Typhi Salmonella bacteremia is nonspecific and, in the absence of blood culture, may be confused with other febrile illnesses, such as malaria. Much work remains to be done to understand and control invasive non-Typhi Salmonella disease in sub-Saharan Africa.

  9. Cotrimoxazole treats fluoroquinolone-resistant Salmonella typhi H58 infection.

    PubMed

    Karki, Manan; Pandit, Sarbagya; Baker, Stephen; Basnyat, Buddha

    2016-10-26

    A woman aged 20 years presented with fever and no localising signs. She was treated with cotrimoxazole and the subsequent blood culture was positive for Salmonella typhi (S. typhi), which was resistant to fluoroquinolones but susceptible to cotrimoxazole. Genotyping identified an FQ-R subclade of H58 S. typhi Fever clearance time was 4 days after starting the antibiotics, and no relapses were noted on 2 months of follow-up. This inexpensive, well-known and easily available antimicrobial could be suitably redeployed for fluoroquinolone-resistant enteric fever in South Asia.

  10. Comparison of the Widal Test with Salmonella Typhi Isolation from Typhoid Fever Patients in Jakarta, Indonesia

    DTIC Science & Technology

    1981-01-01

    Salmonella Typhi Isolation From Typhoid Fever Patients In Jakarta Indonesia* Introduction The Widal test has gained universal but controversial acceptance as...an aid to diagnose typhoid fever in lieu of Salmonella typhi isolation. The Widal test, how- ever, is neither sensitive nor specific since S. typhi 0...reverse aide A# neesarUy and Identityf a, block numb"c) Salmonella typhi Indonesia Typhoid fever Vidal Test 20. ABSTRACT (Confrsuo on reverse side

  11. Variable Carbon Catabolism among Salmonella enterica Serovar Typhi Isolates

    PubMed Central

    Chai, Lay Ching; Kong, Boon Hong; Elemfareji, Omar Ismail; Thong, Kwai Lin

    2012-01-01

    Background Salmonella enterica serovar Typhi (S. Typhi) is strictly a human intracellular pathogen. It causes acute systemic (typhoid fever) and chronic infections that result in long-term asymptomatic human carriage. S. Typhi displays diverse disease manifestations in human infection and exhibits high clonality. The principal factors underlying the unique lifestyle of S. Typhi in its human host during acute and chronic infections remain largely unknown and are therefore the main objective of this study. Methodology/Principal Findings To obtain insight into the intracellular lifestyle of S. Typhi, a high-throughput phenotypic microarray was employed to characterise the catabolic capacity of 190 carbon sources in S. Typhi strains. The success of this study lies in the carefully selected library of S. Typhi strains, including strains from two geographically distinct areas oftyphoid endemicity, an asymptomatic human carrier, clinical stools and blood samples and sewage-contaminated rivers. An extremely low carbon catabolic capacity (27% of 190 carbon substrates) was observed among the strains. The carbon catabolic profiles appeared to suggest that S. Typhi strains survived well on carbon subtrates that are found abundantly in the human body but not in others. The strains could not utilise plant-associated carbon substrates. In addition, α-glycerolphosphate, glycerol, L-serine, pyruvate and lactate served as better carbon sources to monosaccharides in the S. Typhi strains tested. Conclusion The carbon catabolic profiles suggest that S. Typhi could survive and persist well in the nutrient depleted metabolic niches in the human host but not in the environment outside of the host. These findings serve as caveats for future studies to understand how carbon catabolism relates to the pathogenesis and transmission of this pathogen. PMID:22662115

  12. Salmonella enterica serovar Typhi and the pathogenesis of typhoid fever.

    PubMed

    Dougan, Gordon; Baker, Stephen

    2014-01-01

    Salmonella enterica serovar Typhi, the cause of typhoid, is host restricted to humans. S. Typhi has a monophyletic population structure, indicating that typhoid in humans is a relatively new disease. Antimicrobial usage is reshaping the current S. Typhi global population and may be driving the emergence of a specific haplotype, H58, that is well adapted to transmission in modern settings and is able to resist antimicrobial killing more efficiently than other S. Typhi. Evidence gathered through genomics and functional studies using the mouse and in vitro cell systems, together with clinical investigations, has provided insight into the mechanisms that underpin the pathogenesis of human typhoid and host restriction. Here we review the latest scientific advances in typhoid research and discuss how these novel approaches are changing our understanding of the disease.

  13. Isolation of Salmonella typhi from Standard Whole Blood Culture versus Blood-Clot Cultures

    DTIC Science & Technology

    1988-12-01

    The use of 10% oxgall and bile broth medium, both supplemented with freshly prepared 100 u/ml streptokinase, for isolating Salmonella typhi by clot...significantly better rate of isolation than the clot culture methods. Keywords: Cultures biology; Clot cultures; Salmonella typhi ; Isolation of S. typhi; Whole blood culture; Blood-clot culture; Reprints.

  14. Salmonella Typhi shdA: pseudogene or allelic variant?

    PubMed

    Urrutia, I M; Fuentes, J A; Valenzuela, L M; Ortega, A P; Hidalgo, A A; Mora, G C

    2014-08-01

    ShdA from Salmonella Typhimurium (ShdASTm) is a large outer membrane protein that specifically recognizes and binds to fibronectin. ShdASTm is involved in the colonization of the cecum and the Peyer's patches of terminal ileum in mice. On the other hand, shdA gene from Salmonella Typhi (shdASTy) has been considered a pseudogene (i.e. a nonfunctional sequence of genomic DNA) due to the presence of deletions and mutations that gave rise to premature stop codons. In this work we show that, despite the deletions and mutations, shdASTy is fully functional. S. Typhi ΔshdA mutants presented an impaired adherence and invasion of HEp-2 pre-treated with TGF-β1, an inducer of fibronectin production. Moreover, shdA from S. Typhi and S. Typhimurium seem to be equivalent since shdASTm restored the adherence and invasion of S. Typhi ΔshdA mutant to wild type levels. In addition, anti-FLAG mAbs interfered with the adherence and invasion of the S. Typhi shdA-3xFLAG strain. Finally, shdASTy encodes a detectable protein when heterologously expressed in Escherichia coli DH5α. The data presented here show that shdASTy is not a pseudogene, but a different functional allele compared with shdASTm.

  15. Vi-CRM 197 as a new conjugate vaccine against Salmonella Typhi.

    PubMed

    Micoli, F; Rondini, S; Pisoni, I; Proietti, D; Berti, F; Costantino, P; Rappuoli, R; Szu, S; Saul, A; Martin, L B

    2011-01-17

    An efficacious, low cost vaccine against typhoid fever, especially for young children, would make a major impact on disease burden in developing countries. The virulence capsular polysaccharide of Salmonella Typhi (Vi) coupled to recombinant mutant Pseudomonas aeruginosa exoprotein A (Vi-rEPA) has been shown to be highly efficacious. We investigated the use of carrier proteins included in infant vaccines, standardized the conjugation process and developed key assays required for routine lot release at production scale. Vi from a BSL1 organism, Citrobacter freundii, strain WR7011, was used as an alternative to Vi from S. Typhi. We showed that Vi conjugated to CRM(197), a non-toxic mutant of diphtheria toxin, widely used in commercial vaccines, was produced at high yield. Vi-CRM(197) proved immunogenic in animal studies, even without adjuvant. Thus, Vi-CRM(197) appears to be a suitable candidate for the development of a commercially viable, effective typhoid vaccine for developing countries.

  16. Antagonistic Activity of Lactobacillus Isolates against Salmonella typhi In Vitro

    PubMed Central

    Abdel-Daim, Amira; Hassouna, Nadia; Hafez, Mohamed; Ashor, Mohamed Seif Aldeen; Aboulwafa, Mohammad M.

    2013-01-01

    Background. Enteric fever is a global health problem, and rapidly developing resistance to various drugs makes the situation more alarming. The potential use of Lactobacillus to control typhoid fever represents a promising approach, as it may exert protective actions through various mechanisms. Methods. In this study, the probiotic potential and antagonistic activities of 32 Lactobacillus isolates against Salmonella typhi were evaluated. The antimicrobial activity of cell free supernatants of Lactobacillus isolates, interference of Lactobacillus isolates with the Salmonella adherence and invasion, cytoprotective effect of Lactobacillus isolates, and possibility of concurrent use of tested Lactobacillus isolates and antibiotics were evaluated by testing their susceptibilities to antimicrobial agents, and their oxygen tolerance was also examined. Results. The results revealed that twelve Lactobacillus isolates could protect against Salmonella typhi infection through interference with both its growth and its virulence properties, such as adherence, invasion, and cytotoxicity. These Lactobacillus isolates exhibited MIC values for ciprofloxacin higher than those of Salmonella typhi and oxygen tolerance and were identified as Lactobacillus plantarum. Conclusion. The tested Lactobacillus plantarum isolates can be introduced as potential novel candidates that have to be subjected for in vivo and application studies for treatment and control of typhoid fever. PMID:24191248

  17. Slide Coagglutination for Salmonella typhi Antigens in Broths Inoculated with Feces from Typhoid Fever Patients

    DTIC Science & Technology

    1981-12-01

    SLIDE COAGGLUTINATION FOR SALMONELLA TYPHI ANTIGENS IN BROTHS INOCULATED WITH FECES FROM TYPHOID FEVER PATIENTS R. C. Rockhill, L. W. Rumans and M...permission of the Editor, Southeast Asian Journal of Tropical Medicine and Public Health SLIDE COAGGLUTINATION FOR SALMONELLA TYPHI ANTIGENS IN...525 Vol. 12 No. 4 December 1981 1 1P .. .. . --U- 1- "J SLIDE COAGGLUTINATION O Salmonella typhi ANTIGFNS the Infectious Disease Hospital and cultured

  18. Human cell mediated immunity to porins from Salmonella typhi.

    PubMed

    Blanco, F; Isibasi, A; Raúl González, C; Ortiz, V; Paniagua, J; Arreguín, C; Kumate, J

    1993-01-01

    The current studies were undertaken to assess the role of the porins and outer membrane proteins (OMP) in the human immune response to Salmonella typhi 9, 12 Vi:d. Experiments were performed to determinate the lymphocyte activation response to porins in individuals who had been vaccinated against typhoid fever. 10 healthy volunteers were studied before and 10 days after oral or subcutaneous immunisation. Five patients with typhoid fever were also studied. Lymphocyte activation was measured by the 3H thymidine incorporation assay. Individuals with typhoid fever as well as those immunised with oral vaccine responded well to porins and outer membrane proteins, as opposed to those immunised with the subcutaneous vaccine. These results suggest that the porins and OMP play a role in the cellular immune response against Salmonella typhi.

  19. Salmonella enterica Serotype Typhi Bacteremia Complicating Pregnancy in the Third Trimester

    PubMed Central

    Patel, Krunal; Gittens-Williams, Lisa; Apuzzio, Joseph J.; Martimucci, Kristina; Williams, Shauna F.

    2017-01-01

    Background. Salmonella enterica serotype Typhi (S. Typhi) is an anaerobic gram-negative enteric rod that causes infection when contaminated food or water is ingested and may cause illness in pregnancy. Case. This is a patient who presented at 31 weeks' gestation with abdominal pain and fever and was diagnosed with S. Typhi bacteremia. Conclusion. S. Typhi should be considered in febrile patients with recent travel presenting with abdominal discomfort with or without elevated liver enzymes. PMID:28203469

  20. Detection of Salmonella typhi utilizing bioconjugated fluorescent polymeric nanoparticles

    NASA Astrophysics Data System (ADS)

    Jain, Swati; Chattopadhyay, Sruti; Jackeray, Richa; Abid, Zainul; Singh, Harpal

    2016-05-01

    Present work demonstrates effective utilization of functionalized polymeric fluorescent nanoparticles as biosensing probe for the detection of Salmonella typhi bacteria on modified polycarbonate (PC) filters in about 3 h. Antibody modified-PC membranes were incubated with contaminated bacterial water for selective capturing which were detected by synthesized novel bioconjugate probe. Core-shell architecture of polymeric nanoparticles endows them with aqueous stabilization and keto-enolic functionalities making them usable for covalently linking S. typhi antibodies without any crosslinker or activator. Bradford analysis revealed that one nanoparticle has an average of 3.51 × 10-19 g or 21 × 104 bound S. typhi Ab molecules. Analysis of the regions of interest (ROI) in fluorescent micrographs of modified fluoroimmunoassay showed higher detection sensitivity of 5 × 102 cells/mL due to signal amplification unlike conventional naked dye FITC-Ab conjugate. Fluorescence of pyrene dye remained same on immobilization of biomolecules and nanoparticles showed stable fluorescent intensity under prolong exposure to laser owing to protective polymeric layer allowing accurate identification of bacteria. Surface-functionalized PC matrix and fluorescent label NPs permit covalent interactions among biomolecules enhancing signal acquisitions showing higher detection efficiency as compared to conventional microtiter plate-based system. Our novel immunoassay has the potential to be explored as rapid detection method for identifying S. typhi contaminations in water.

  1. Revised ciprofloxacin breakpoints for Salmonella Typhi: its implications in India.

    PubMed

    Balaji, V; Sharma, A; Ranjan, P; Kapil, A

    2014-01-01

    The rise of multidrug resistant strains of Salmonella Typhi in the last decade of the previous century led to the use of fluoroquinolones as the drug of choice. However, over the past few years fluoroquinolone resistance has been increasingly reported. In accordance with the revised Clinical and Laboratory Standards Institute (CLSI) breakpoints, only 3% of the isolates were susceptible to ciprofloxacin in comparison to 95% as per the earlier guidelines when 488 isolates collected between 2010 and 2012 were re-interpreted. Interestingly, re-emergence of strains susceptible to chloramphenicol, ampicillin and cotrimoxazole is being seen. Amidst the changing susceptibility profile, azithromycin remains a promising alternative.

  2. Synthesis and antibacterial properties of copper nanoparticles for Salmonella typhi

    NASA Astrophysics Data System (ADS)

    Jaiswal, Anamika; Gaherwal, S.; Lodhi, Pavitra Devi; Singh, Jaiveer; Kaurav, Netram; Shrivastava, M. M. P.

    2016-05-01

    In this study, the antibacterial properties of Cu nanoparitcles (Cu-NPs) were investigated against Salmonella typhi. The Cu-NPs were prepared by the reduction of cupper acetate with the help of ethylene glycol (EG), then sample was characterized by XRD for its average particle size identification. The antibacterial activity assessed by well diffusion and disc diffusion method on different concentration of nanoparticles. It was found that these Cu-NPs showed antibacterial activity in form of zone inhibition, wherein, zone of inhibition increased with increase in concentration of Cu-NPs.

  3. [Multi-resistant strains of Salmonella typhi in Spain].

    PubMed

    Usera, M A; Aladueña, A; Jaime, M L; Raya, C; Fuster, C; Planes, A; Bartolomé, R M

    1992-11-01

    Most Salmonella typhi isolated in Spain are susceptible to antibiotics commonly used in its treatment as chloramphenicol, ampicillin and cotrimoxazole. Three multiresistant strains have been isolated from different patients the last two years. Two phage type M1, biotype xylose tetrationate + strains were isolated from blood of two patients in Bembibre (León). One phage type E1a biotype xylose + tetrationate reductase + strain was isolated from blood and faeces of one patient in Barcelona. All strains harboured a 79 Mdal plasmid responsible for multiresistance, chloramphenicol acetyl transferase production and conjugative.

  4. Acid exposure induces multiplication of Salmonella enterica serovar Typhi.

    PubMed

    Ahirwar, Suneel Kumar; Pratap, Chandra Bhan; Patel, Saurabh Kumar; Shukla, Vijay K; Singh, Indarjeet Gambhir; Mishra, Om Prakash; Kumar, Kailash; Singh, Tej Bali; Nath, Gopal

    2014-12-01

    Salmonella enterica serovar Typhi faces several environmental stresses while going through the stomach (acidic pH) to the small intestine (basic pH) and intracellularly in macrophages (acidic pH) in humans. The acidic pH followed by alkaline pH in the small intestine might be responsible for expression of certain stress-induced genes, resulting in not only better survival but also induction of multiplication and invasion of the bacterium in the small intestine. Based on this hypothesis, we developed a process wherein we exposed the blood, urine, and stool specimens from 90 acute typhoid fever patients and 36 chronic typhoid carriers to acidic pH to see the effect on isolation rate of S. Typhi. About 5 g of freshly passed unpreserved stool, a centrifuged deposit of 15 ml of urine, and 5 ml of blood clot were subjected to 5 ml of Luria-Bertani (LB) broth (pH 3.5) for 20 min, followed by enrichment in bile broth-selenite F broth. When the combined isolation from all 3 specimens, i.e., blood, urine, and stool, after acid exposure was considered, a total of 77.7% of the acute typhoid patients were observed to be positive for the isolation of the S. Typhi serotype, compared to 8.8% by the conventional method. Similarly, 42% (15/36) of chronic carriers yielded positive for S. Typhi growth after acid exposure, compared to 5.5% (2/36) by the conventional method. It therefore can be concluded that acid shock triggers the multiplication of the bacteria, resulting in better isolation rates from blood clot, stool, and urine specimens.

  5. Thoracic spinal epidural abscess caused by Salmonella typhi.

    PubMed

    Abdullah, Saad Hamdan; Ata, Osama Abu; El-Adwan, Nael

    2008-03-01

    A 56-year-old man presented with a rare spinal epidural abscess manifesting as attacks of back pain associated with fever, weight loss, generalized weakness and fatigability, and constipation. He had multiple skin pustules in the last 4 months treated with oral amoxicillin. He had suffered diabetes mellitus for the last 5 years and was insulin dependent. Physical examination found slight paraparesis with sensory loss around the nipple and sphincteric urgency, and diabetic retinopathy. Magnetic resonance imaging showed edematous T2, T3, and T4 vertebral bodies, and narrow enhanced T3-4 disk space with a soft tissue enhanced mass mostly anterior to the spinal cord and indenting the cord. T3-4 costotransversectomy was performed to remove the extradural mass and evacuate the intradiscal material. Histological examination of the bone found osteomyelitis, and culture of the soft tissue showed Salmonella typhi sensitive to ceftriaxone and ciprofloxacin. Intravenous ceftriaxone administration was started, and the patient was discharged after 6 days in good condition. The outcome of spinal epidural abscess is devastating unless recognized and treated early. The present case of spinal epidural abscess in the thoracic spine caused by Salmonella typhi infection illustrates the importance of cultures to assess the drug sensitivity of the specific strain detected and adjusting the treatment accordingly.

  6. [Severe cases of Salmonella non typhi infections on sickle cell patients in Réunion Island].

    PubMed

    Vandroux, D; Jabot, J; Angue, M; Belcour, D; Galliot, R; Allyn, J; Gaüzère, B-A

    2014-12-01

    We report two cases of septic shocks due to Salmonella non typhi infection on sickle cell patients admitted to an intensive care unit. Such patients should enforce food hygiene measures, especially under tropical settings, to avoid potentially deadly severe infections.

  7. A Rab32-dependent pathway contributes to Salmonella typhi host restriction.

    PubMed

    Spanò, Stefania; Galán, Jorge E

    2012-11-16

    Unlike other Salmonellae, the intracellular bacterial human pathogen Salmonella Typhi exhibits strict host specificity. The molecular bases for this restriction are unknown. Here we found that the expression of a single type III secretion system effector protein from broad-host Salmonella Typhimurium allowed Salmonella Typhi to survive and replicate within macrophages and tissues from mice, a nonpermissive host. This effector proteolytically targeted Rab32, which controls traffic to lysosome-related organelles in conjunction with components of the biogenesis of lysosome-related organelle complexes (BLOCs). RNA interference-mediated depletion of Rab32 or of an essential component of a BLOC complex was sufficient to allow S. Typhi to survive within mouse macrophages. Furthermore, S. Typhi was able to survive in macrophages from mice defective in BLOC components.

  8. Formation and resuscitation of viable but nonculturable Salmonella typhi.

    PubMed

    Zeng, Bin; Zhao, Guozhong; Cao, Xiaohong; Yang, Zhen; Wang, Chunling; Hou, Lihua

    2013-01-01

    Salmonella typhi is a pathogen that causes the human disease of typhoid fever. The aim of this study was to investigate the viable but nonculturable (VBNC) state of S. typhi. Some samples were stimulated at 4°C or -20°C, while others were induced by different concentrations of CuSO4. Total cell counts remained constant throughout several days by acridine orange direct counting; however, plate counts declined to undetectable levels within 48 hours by plate counting at -20°C. The direct viable counts remained fairly constant at this level by direct viable counting. Carbon and nitrogen materials slowly decreased which indicated that a large population of cells existed in the VBNC state and entered the VBNC state in response to exposure to 0.01 or 0.015 mmol/L CuSO4 for more than 14 or 12 days, respectively. Adding 3% Tween 20 or 1% catalase enabled cells to become culturable again, with resuscitation times of 48 h and 24 h, respectively. The atomic force microscope results showed that cells gradually changed in shape from short rods to coccoids, and decreased in size when they entered the VBNC state. Further animal experiments suggested that resuscitated cells might regain pathogenicity.

  9. Formation and Resuscitation of Viable but Nonculturable Salmonella typhi

    PubMed Central

    Zeng, Bin; Zhao, Guozhong; Cao, Xiaohong; Yang, Zhen; Wang, Chunling; Hou, Lihua

    2013-01-01

    Salmonella typhi is a pathogen that causes the human disease of typhoid fever. The aim of this study was to investigate the viable but nonculturable (VBNC) state of S. typhi. Some samples were stimulated at 4°C or −20°C, while others were induced by different concentrations of CuSO4. Total cell counts remained constant throughout several days by acridine orange direct counting; however, plate counts declined to undetectable levels within 48 hours by plate counting at −20°C. The direct viable counts remained fairly constant at this level by direct viable counting. Carbon and nitrogen materials slowly decreased which indicated that a large population of cells existed in the VBNC state and entered the VBNC state in response to exposure to 0.01 or 0.015 mmol/L CuSO4 for more than 14 or 12 days, respectively. Adding 3% Tween 20 or 1% catalase enabled cells to become culturable again, with resuscitation times of 48 h and 24 h, respectively. The atomic force microscope results showed that cells gradually changed in shape from short rods to coccoids, and decreased in size when they entered the VBNC state. Further animal experiments suggested that resuscitated cells might regain pathogenicity. PMID:23509799

  10. Use of RapidChek® SELECT™ Salmonella to detect shedding of live attenuated Salmonella enterica serovar Typhi vaccine strains.

    PubMed

    Brenneman, Karen E; McDonald, Caitlin; Kelly-Aehle, Sandra M; Roland, Kenneth L; Curtiss, Roy

    2012-05-01

    Identification of individuals shedding Salmonella enterica serovar Typhi in stool is imperative during clinical trial safety evaluations. Recovery of live attenuated S. Typhi vaccine strains can be difficult because the mutations necessary for safety in humans often compromise survival in stringent selective enrichment media. RapidChek® SELECT™ Salmonella is a highly sensitive detection method for S. enterica species which utilizes a bacteriophage cocktail designed to reduce the growth of competitor microbes in mildly selective enrichment medium. Detection of Salmonella is enhanced by means of a Salmonella-specific antibody strip targeted to lipopolysaccharide. The RapidChek® SELECT™ Salmonella method was compared to conventional enrichment and plating methods to determine the most sensitive method for detecting attenuated S. Typhi strains in human stool samples. Although traditional enrichment strategies were more sensitive to the presence of wild-type S. Typhi, RapidChek® SELECT™ Salmonella was superior at detecting attenuated strains of S. Typhi. Strains containing a wide variety of attenuating mutations were detected with equal sensitivity as the wild type by RapidChek® SELECT™ Salmonella. The presence of Vi capsule or mutations which affected O-antigen synthesis (Δpmi, ΔgalE) did not decrease the sensitivity of the RapidChek® SELECT™ Salmonella assay.

  11. Molecular fingerprinting of multidrug-resistant Salmonella enterica serotype Typhi.

    PubMed Central

    Hampton, M. D.; Ward, L. R.; Rowe, B.; Threlfall, E. J.

    1998-01-01

    For epidemiologic investigations, the primary subdivision of Salmonella Typhi is vi-phage typing; 106 Vi-phage types are defined. For multidrug-resistant strains the most common types have been M1 (Pakistan) and E1 (India, Pakistan, Bangladesh, and the Arabian Gulf); a strain untypable with the Vi phages has been responsible for a major epidemic in Tajikistan. Most often, isolates from the Indian subcontinent have been resistant to ampicillin, chloramphenicol, streptomycin, sulfonamides, tetracyclines, and trimethoprim; but in the 1997 Tajikistan outbreak, the epidemic strain was also resistant to ciprofloxacin. For multidrug-resistant strains, subdivision within phage type can be achieved by plasmid profile typing and pulsed-field gel electrophoresis. PMID:9621206

  12. The Type III Secretion System Effector SptP of Salmonella enterica Serovar Typhi

    PubMed Central

    Johnson, Rebecca; Byrne, Alexander; Berger, Cedric N.; Klemm, Elizabeth; Crepin, Valerie F.; Dougan, Gordon

    2016-01-01

    ABSTRACT Strains of the various Salmonella enterica serovars cause gastroenteritis or typhoid fever in humans, with virulence depending on the action of two type III secretion systems (Salmonella pathogenicity island 1 [SPI-1] and SPI-2). SptP is a Salmonella SPI-1 effector, involved in mediating recovery of the host cytoskeleton postinfection. SptP requires a chaperone, SicP, for stability and secretion. SptP has 94% identity between S. enterica serovar Typhimurium and S. Typhi; direct comparison of the protein sequences revealed that S. Typhi SptP has numerous amino acid changes within its chaperone-binding domain. Subsequent comparison of ΔsptP S. Typhi and S. Typhimurium strains demonstrated that, unlike SptP in S. Typhimurium, SptP in S. Typhi was not involved in invasion or cytoskeletal recovery postinfection. Investigation of whether the observed amino acid changes within SptP of S. Typhi affected its function revealed that S. Typhi SptP was unable to complement S. Typhimurium ΔsptP due to an absence of secretion. We further demonstrated that while S. Typhimurium SptP is stable intracellularly within S. Typhi, S. Typhi SptP is unstable, although stability could be recovered following replacement of the chaperone-binding domain with that of S. Typhimurium. Direct assessment of the strength of the interaction between SptP and SicP of both serovars via bacterial two-hybrid analysis demonstrated that S. Typhi SptP has a significantly weaker interaction with SicP than the equivalent proteins in S. Typhimurium. Taken together, our results suggest that changes within the chaperone-binding domain of SptP in S. Typhi hinder binding to its chaperone, resulting in instability, preventing translocation, and therefore restricting the intracellular activity of this effector. IMPORTANCE Studies investigating Salmonella pathogenesis typically rely on Salmonella Typhimurium, even though Salmonella Typhi causes the more severe disease in humans. As such, an understanding of

  13. Radiosensitization of Escherichia coli and Salmonella typhi in presence of active compounds

    NASA Astrophysics Data System (ADS)

    Lacroix, M.; Chiasson, F.; Borsa, J.; Ouattara, B.

    2004-09-01

    The radiosensitization of Escherichia coli and Salmonella typhi in ground beef was evaluated in the presence of 18 active compounds. Medium fat ground beef (23% fat) was inoculated with E. coli or S. typhi and each active compound was added separately at various concentrations. For E. coli, the most efficient compounds were trans-cinnamaldehyde, thymol and thyme. For S. typhi, the most efficient compounds was trans-cinnamaldehyde, carvacrol and thymol. The addition of tetrasodium pyrophosphate, carvacrol and ascorbic acid had no effect on the irradiation sensitivity of E. coli. For S. typhi, only ascorbic acid had no effect.

  14. Active protection of mice against Salmonella typhi by immunization with strain-specific porins.

    PubMed

    Isibasi, A; Ortiz-Navarrete, V; Paniagua, J; Pelayo, R; González, C R; García, J A; Kumate, J

    1992-01-01

    NIH mice were immunized with between 2.5 and 30 micrograms of two highly purified porins, 34 kDa and 36 kDa, isolated from the virulent strain Salmonella typhi 9,12, Vi:d. Of mice immunized with 10 micrograms of porins, 90% were protected against a challenge with up to 500 LD50 (50% lethal doses) of S. typhi 9,12,Vi:d and only 30% protection was observed in mice immunized with the same dose of porins but challenged with the heterologous strain Salmonella typhimurium. These results demonstrate the utility of porins for the induction of a protective status against S. typhi in mice.

  15. The Vi capsular polysaccharide enables Salmonella enterica serovar typhi to evade microbe-guided neutrophil chemotaxis.

    PubMed

    Wangdi, Tamding; Lee, Cheng-Yuk; Spees, Alanna M; Yu, Chenzhou; Kingsbury, Dawn D; Winter, Sebastian E; Hastey, Christine J; Wilson, R Paul; Heinrich, Volkmar; Bäumler, Andreas J

    2014-08-01

    Salmonella enterica serovar Typhi (S. Typhi) causes typhoid fever, a disseminated infection, while the closely related pathogen S. enterica serovar Typhimurium (S. Typhimurium) is associated with a localized gastroenteritis in humans. Here we investigated whether both pathogens differ in the chemotactic response they induce in neutrophils using a single-cell experimental approach. Surprisingly, neutrophils extended chemotactic pseudopodia toward Escherichia coli and S. Typhimurium, but not toward S. Typhi. Bacterial-guided chemotaxis was dependent on the presence of complement component 5a (C5a) and C5a receptor (C5aR). Deletion of S. Typhi capsule biosynthesis genes markedly enhanced the chemotactic response of neutrophils in vitro. Furthermore, deletion of capsule biosynthesis genes heightened the association of S. Typhi with neutrophils in vivo through a C5aR-dependent mechanism. Collectively, these data suggest that expression of the virulence-associated (Vi) capsular polysaccharide of S. Typhi obstructs bacterial-guided neutrophil chemotaxis.

  16. Surface plasmon resonance immunosensor for the detection of Salmonella typhi antibodies in buffer and patient serum.

    PubMed

    Gupta, Garima; Sharma, P K; Sikarwar, B; Merwyn, S; Kaushik, S; Boopathi, M; Agarwal, G S; Singh, Beer

    2012-01-01

    Surface plasmon resonance (SPR) immunosensor using 4-mercaptobenzoic acid (4-MBA) modified gold SPR chip was developed first time for the detection of flagellin specific antibodies of Salmonella typhi (S. typhi). Flagellin protein of S. typhi was prepared by recombinant DNA technology. The modification of gold chip with 4-MBA was in-situ characterized by SPR and electrochemical impedance spectroscopy. By using kinetic evaluation software, K(D) and B(max) values were calculated and found to be 26.3 fM and 62.04 m°, respectively, for the immobilized monoclonal antibody (Moab) of recombinant flagellin (r-fla) protein of S. typhi (r-fla S. typhi). In addition, thermodynamic parameters such as ΔG, ΔH and ΔS were determined first time for r-fla S. typhi and Moab of r-fla S. typhi interactions and the values revealed the interaction between r-fla S. typhi and Moab of r-fla S. typhi as spontaneous, endothermic and entropy driven one. Moreover, healthy human serum samples and patient sera (Widal positive and Widal negative) were subjected to SPR analysis. The present SPR based approach provides an alternative way for S. typhi detection in less than 10 min.

  17. Salmonella Typhi and Salmonella Paratyphi A elaborate distinct systemic metabolite signatures during enteric fever.

    PubMed

    Näsström, Elin; Vu Thieu, Nga Tran; Dongol, Sabina; Karkey, Abhilasha; Voong Vinh, Phat; Ha Thanh, Tuyen; Johansson, Anders; Arjyal, Amit; Thwaites, Guy; Dolecek, Christiane; Basnyat, Buddha; Baker, Stephen; Antti, Henrik

    2014-06-05

    The host-pathogen interactions induced by Salmonella Typhi and Salmonella Paratyphi A during enteric fever are poorly understood. This knowledge gap, and the human restricted nature of these bacteria, limit our understanding of the disease and impede the development of new diagnostic approaches. To investigate metabolite signals associated with enteric fever we performed two dimensional gas chromatography with time-of-flight mass spectrometry (GCxGC/TOFMS) on plasma from patients with S. Typhi and S. Paratyphi A infections and asymptomatic controls, identifying 695 individual metabolite peaks. Applying supervised pattern recognition, we found highly significant and reproducible metabolite profiles separating S. Typhi cases, S. Paratyphi A cases, and controls, calculating that a combination of six metabolites could accurately define the etiological agent. For the first time we show that reproducible and serovar specific systemic biomarkers can be detected during enteric fever. Our work defines several biologically plausible metabolites that can be used to detect enteric fever, and unlocks the potential of this method in diagnosing other systemic bacterial infections.

  18. The Type III Secretion System Effector SptP of Salmonella enterica Serovar Typhi.

    PubMed

    Johnson, Rebecca; Byrne, Alexander; Berger, Cedric N; Klemm, Elizabeth; Crepin, Valerie F; Dougan, Gordon; Frankel, Gad

    2017-02-15

    Strains of the various Salmonella enterica serovars cause gastroenteritis or typhoid fever in humans, with virulence depending on the action of two type III secretion systems (Salmonella pathogenicity island 1 [SPI-1] and SPI-2). SptP is a Salmonella SPI-1 effector, involved in mediating recovery of the host cytoskeleton postinfection. SptP requires a chaperone, SicP, for stability and secretion. SptP has 94% identity between S. enterica serovar Typhimurium and S Typhi; direct comparison of the protein sequences revealed that S Typhi SptP has numerous amino acid changes within its chaperone-binding domain. Subsequent comparison of ΔsptP S Typhi and S. Typhimurium strains demonstrated that, unlike SptP in S. Typhimurium, SptP in S Typhi was not involved in invasion or cytoskeletal recovery postinfection. Investigation of whether the observed amino acid changes within SptP of S Typhi affected its function revealed that S Typhi SptP was unable to complement S. Typhimurium ΔsptP due to an absence of secretion. We further demonstrated that while S. Typhimurium SptP is stable intracellularly within S Typhi, S Typhi SptP is unstable, although stability could be recovered following replacement of the chaperone-binding domain with that of S. Typhimurium. Direct assessment of the strength of the interaction between SptP and SicP of both serovars via bacterial two-hybrid analysis demonstrated that S Typhi SptP has a significantly weaker interaction with SicP than the equivalent proteins in S. Typhimurium. Taken together, our results suggest that changes within the chaperone-binding domain of SptP in S Typhi hinder binding to its chaperone, resulting in instability, preventing translocation, and therefore restricting the intracellular activity of this effector.

  19. [Endocarditis and arthritis caused by extended spectrum β-lactamase-producing non-Typhi Salmonella].

    PubMed

    García, Mara; García, Natalia; Striebeck, Pablo; Cejas, Daniela; Rodríguez, Viviana

    2016-02-01

    We present the case of a patient with endocarditis and arthritis caused by extended spectrum β-lactamase producing non-Typhi Salmonella, with incomplete response (defined as persistence of Salmonella in joint fluid) to initial instituted treatment (trimethoprim-sulfamethoxazole) and posterior recovery with ertapenem. The disease was associated with implantable central venous catheter infection. Five percent of patients with non-Typhi Salmonella gastroenteritis develop bacteremia. Infective endocarditis and joint infection has been reported in 1,4% and less than 1% of cases, respectively.

  20. Draft Genome Sequence of Salmonella enterica Serovar Typhi IMR_TP298/15, a Strain with Intermediate Susceptibility to Ciprofloxacin, Isolated from a Typhoid Outbreak

    PubMed Central

    Hii, Shirley Yi Fen; Hashim, Rohaidah

    2017-01-01

    ABSTRACT Salmonella enterica serovar Typhi with reduced susceptibility to ciprofloxacin is increasingly being reported globally. An outbreak caused by Salmonella Typhi with decreased ciprofloxacin susceptibility has not been reported before in Malaysia. We present here the annotated draft genome of a Salmonella Typhi strain involved in a typhoid outbreak. PMID:28254988

  1. Protection against Salmonella typhi infection in mice after immunization with outer membrane proteins isolated from Salmonella typhi 9,12,d, Vi.

    PubMed Central

    Isibasi, A; Ortiz, V; Vargas, M; Paniagua, J; González, C; Moreno, J; Kumate, J

    1988-01-01

    The current studies were undertaken to assess the ability of the outer membrane proteins (OMPs) of Salmonella typhi to induce protection against challenge with the bacteria in mucin. OMPs were isolated as described by Schnaitman (J. Bacteriol. 108:553-556, 1971) and were found to be contaminated with approximately 4% lipopolysaccharide (LPS). Immunization with as little as 30 micrograms of OMPs conferred 100% protection to mice challenged with up to 1,000 50% lethal doses (LD50) of two strains of S. typhi (9,12,d, Vi and Ty2). In addition, 30% protection against challenge with up to 500 LD50 of Salmonella typhimurium was achieved. Immunization with LPS at doses equivalent to those found in the OMPs was considerably inferior to the OMPs in the induction of an immune status. Moreover, LPS was effective only when the challenge was performed with S. typhi 9,12,d, Vi (40% protection to 100 LD50). An antiserum raised in rabbits reacted mainly against the bands of the molecular weights corresponding to the so-called porins contained in the OMP preparation as shown by Western blotting (immunoblotting). This rabbit antiserum protected 100% of mice against challenge with 100 LD50 of either strain of S. typhi and 80% of mice against challenge with the same LD50 of S. typhimurium. These results indicate the usefulness of OMPs in the induction of active immunity against S. typhi in mice. Images PMID:2844676

  2. An extended genotyping framework for Salmonella enterica serovar Typhi, the cause of human typhoid

    PubMed Central

    Wong, Vanessa K.; Baker, Stephen; Connor, Thomas R.; Pickard, Derek; Page, Andrew J.; Dave, Jayshree; Murphy, Niamh; Holliman, Richard; Sefton, Armine; Millar, Michael; Dyson, Zoe A.; Dougan, Gordon; Holt, Kathryn E.; Parkhill, Julian; Feasey, Nicholas A.; Kingsley, Robert A.; Thomson, Nicholas R.; Keane, Jacqueline A.; Weill, François- Xavier; Le Hello, Simon; Hawkey, Jane; Edwards, David J.; Harris, Simon R.; Cain, Amy K.; Hadfield, James; Hart, Peter J.; Thieu, Nga Tran Vu; Klemm, Elizabeth J.; Breiman, Robert F.; Watson, Conall H.; Edmunds, W. John; Kariuki, Samuel; Gordon, Melita A.; Heyderman, Robert S.; Okoro, Chinyere; Jacobs, Jan; Lunguya, Octavie; Msefula, Chisomo; Chabalgoity, Jose A.; Kama, Mike; Jenkins, Kylie; Dutta, Shanta; Marks, Florian; Campos, Josefina; Thompson, Corinne; Obaro, Stephen; MacLennan, Calman A.; Dolecek, Christiane; Keddy, Karen H.; Smith, Anthony M.; Parry, Christopher M.; Karkey, Abhilasha; Dongol, Sabina; Basnyat, Buddha; Arjyal, Amit; Mulholland, E. Kim; Campbell, James I.; Dufour, Muriel; Bandaranayake, Don; Toleafoa, Take N.; Singh, Shalini Pravin; Hatta, Mochammad; Newton, Paul N.; Dance, David; Davong, Viengmon; Onsare, Robert S.; Isaia, Lupeoletalalelei; Thwaites, Guy; Wijedoru, Lalith; Crump, John A.; De Pinna, Elizabeth; Nair, Satheesh; Nilles, Eric J.; Thanh, Duy Pham; Turner, Paul; Soeng, Sona; Valcanis, Mary; Powling, Joan; Dimovski, Karolina; Hogg, Geoff; Farrar, Jeremy; Mather, Alison E.; Amos, Ben

    2016-01-01

    The population of Salmonella enterica serovar Typhi (S. Typhi), the causative agent of typhoid fever, exhibits limited DNA sequence variation, which complicates efforts to rationally discriminate individual isolates. Here we utilize data from whole-genome sequences (WGS) of nearly 2,000 isolates sourced from over 60 countries to generate a robust genotyping scheme that is phylogenetically informative and compatible with a range of assays. These data show that, with the exception of the rapidly disseminating H58 subclade (now designated genotype 4.3.1), the global S. Typhi population is highly structured and includes dozens of subclades that display geographical restriction. The genotyping approach presented here can be used to interrogate local S. Typhi populations and help identify recent introductions of S. Typhi into new or previously endemic locations, providing information on their likely geographical source. This approach can be used to classify clinical isolates and provides a universal framework for further experimental investigations. PMID:27703135

  3. Prevalence and genetic analysis of phenotypically Vi- negative Salmonella typhi isolates in children from Kathmandu, Nepal.

    PubMed

    Pulickal, Anoop S; Callaghan, Martin J; Kelly, Dominic F; Maskey, Mitu; Mahat, Sandeep; Hamaluba, Mainga; Dongol, Sabina; Adhikari, Neelam; Thorson, Stephen; Basynat, Buddha; Murdoch, David R; Farrar, Jeremy J; Pollard, Andrew J

    2013-08-01

    The Vi capsular polysaccharide (ViPS) protects Salmonella enterica subspecies enterica serotype Typhi (S.Typhi) in vivo by multiple mechanisms. Recent microbiological reports from typhoid endemic countries suggest that acapsulate S.Typhi may occur in nature and contribute to clinical typhoid fever that is indistinguishable from disease caused by capsulate strains. The prevalence and genetic basis of ViPS-negative S.Typhi isolates in children from Kathmandu, Nepal, were tested in 68 isolates. Although 5.9% of isolates tested negative for capsular expression by slide agglutination tests, a novel multiplex PCR assay and individual PCR analyses demonstrated the presence of all 14 genes responsible for the synthesis, transportation and regulation of the ViPS. These data suggest that phenotypically acapsulate S.Typhi may not have a genetic basis for the same.

  4. Rapid detection of Salmonella Typhi by loop-mediated isothermal amplification (LAMP) method.

    PubMed

    Abdullah, J; Saffie, N; Sjasri, F A R; Husin, A; Abdul-Rahman, Z; Ismail, A; Aziah, I; Mohamed, M

    2014-01-01

    An in-house loop-mediated isothermal amplification (LAMP) reaction was established and evaluated for sensitivity and specificity in detecting the presence of Salmonella Typhi (S. Typhi) isolates from Kelantan, Malaysia. Three sets of primers consisting of two outer and 4 inner were designed based on locus STBHUCCB_38510 of chaperone PapD of S. Typhi genes. The reaction was optimised using genomic DNA of S. Typhi ATCC7251 as the template. The products were visualised directly by colour changes of the reaction. Positive results were indicated by green fluorescence and negative by orange colour. The test was further evaluated for specificity, sensitivity and application on field samples. The results were compared with those obtained by gold standard culture method and Polymerase Chain Reaction (PCR). This method was highly specific and -10 times more sensitive in detecting S. Typhi compared to the optimised conventional polymerase chain reaction (PCR) method.

  5. Salmonella typhi, the causative agent of typhoid fever, is approximately 50,000 years old.

    PubMed

    Kidgell, Claire; Reichard, Ulrike; Wain, John; Linz, Bodo; Torpdahl, Mia; Dougan, Gordon; Achtman, Mark

    2002-10-01

    A global collection of 26 isolates of Salmonella typhi was investigated by sequencing a total of 3336 bp in seven housekeeping genes. Only three polymorphic sites were found and the isolates fell into four sequence types. These results show that S. typhi is a recent clone whose last common ancestor existed so recently that multiple mutations have not yet accumulated. Based on molecular clock rates for the accumulation of synonymous polymorphisms, we estimate that the last common ancestor of S. typhi existed 15,000-150,000 years ago, during the human hunter-gatherer phase and prior to the development of agriculture and the domestication of animals.

  6. Typhoid toxin provides a window into typhoid fever and the biology of Salmonella Typhi.

    PubMed

    Galán, Jorge E

    2016-06-07

    Salmonella Typhi is the cause of typhoid fever, a disease that has challenged humans throughout history and continues to be a major public health concern. Unlike infections with most other Salmonellae, which result in self-limiting gastroenteritis, typhoid fever is a life-threatening systemic disease. Furthermore, in contrast to most Salmonellae, which can infect a broad range of hosts, S. Typhi is a strict human pathogen. The unique features of S. Typhi pathogenesis and its stringent host specificity have been a long-standing puzzle. The discovery of typhoid toxin not only has provided major insight into these questions but also has offered unique opportunities to develop novel therapeutic and prevention strategies to combat typhoid fever.

  7. Typhoid toxin provides a window into typhoid fever and the biology of Salmonella Typhi

    PubMed Central

    Galán, Jorge E.

    2016-01-01

    Salmonella Typhi is the cause of typhoid fever, a disease that has challenged humans throughout history and continues to be a major public health concern. Unlike infections with most other Salmonellae, which result in self-limiting gastroenteritis, typhoid fever is a life-threatening systemic disease. Furthermore, in contrast to most Salmonellae, which can infect a broad range of hosts, S. Typhi is a strict human pathogen. The unique features of S. Typhi pathogenesis and its stringent host specificity have been a long-standing puzzle. The discovery of typhoid toxin not only has provided major insight into these questions but also has offered unique opportunities to develop novel therapeutic and prevention strategies to combat typhoid fever. PMID:27222578

  8. Analysis and construction of pathogenicity island regulatory pathways in Salmonella enterica serovar Typhi.

    PubMed

    Ong, Su Yean; Ng, Fui Ling; Badai, Siti Suriawati; Yuryev, Anton; Alam, Maqsudul

    2010-09-23

    Signal transduction through protein-protein interactions and protein modifications are the main mechanisms controlling many biological processes. Here we described the implementation of MedScan information extraction technology and Pathway Studio software (Ariadne Genomics Inc.) to create a Salmonella specific molecular interaction database. Using the database, we have constructed several signal transduction pathways in Salmonella enterica serovar Typhi which causes Typhoid Fever, a major health threat especially in developing countries. S. Typhi has several pathogenicity islands that control rapid switching between different phenotypes including adhesion and colonization, invasion, intracellular survival, proliferation, and biofilm formation in response to environmental changes. Understanding of the detailed mechanism for S. Typhi survival in host cells is necessary for development of efficient detection and treatment of this pathogen. The constructed pathways were validated using publically available gene expression microarray data for Salmonella.

  9. Increased persistence of Salmonella enterica serovar Typhi in the presence of Acanthamoeba castellanii.

    PubMed

    Douesnard-Malo, Frédéric; Daigle, France

    2011-11-01

    Salmonella enterica serovar Typhi (S. Typhi) is the etiological agent of the systemic disease typhoid fever. Transmission occurs via ingestion of contaminated food or water. S. Typhi is specific to humans, and no animal or environmental reservoirs are known. As the free-living amoeba Acanthamoeba castellanii is an environmental host for many pathogenic bacteria, this study investigates interactions between S. Typhi and A. castellanii by using cocultures. Growth of both organisms was estimated by cell count, viable count, flow cytometry, and fluorescence microscopy. Results indicate that S. Typhi can survive at least 3 weeks when grown with A. castellanii, as opposed to less than 10 days when grown as singly cultured bacteria under the same conditions. Interestingly, growth rates of amoebae after 14 days were similar in cocultures or when amoebae were singly cultured, suggesting that S. Typhi is not cytotoxic to A. castellanii. Bacteria surviving in coculture were not intracellular and did not require a physical contact with amoebae for their survival. These results suggest that S. Typhi may have a selective advantage when it is associated with A. castellanii and that amoebae may contribute to S. Typhi persistence in the environment.

  10. Extended Spectrum Beta Lactamase producing Cephalosporin resistant Salmonella Typhi, reported from Rawalpindi, Pakistan.

    PubMed

    Munir, Tehmina; Lodhi, Munir; Ansari, Jawad Khaliq; Andleeb, Saadia; Ahmed, Mushtaq

    2016-08-01

    Typhoid is endemic in many parts of southeast Asia. Due to the resistance of the organism to first line of antibiotics (ampicillin, chloramphenicol, cotrimoxazole) as well as to fluoroquinolones, third generation cephalosporins have been in use for the empiric treatment of typhoid for years. However an increasing incidence of Salmonella Typhi is being reported sporadically from various regions. We report a case of typhoid due to Salmonella Typhi which was non-responsive to treatment with a cephalosporin, was found to be multidrug resistant and resistant to ciprofloxacin and third generation cephalosporin as well. The patient was finally treated successfully with intravenous administration of a carbapenem.

  11. In vitro antibacterial activity of Argentine folk medicinal plants against Salmonella typhi.

    PubMed

    Pérez, C; Anesini, C

    1994-08-01

    Boiling water extracts of 132 samples from 54 plant families, commonly used in Argentine folk medicine, were screened for antibacterial activity against Salmonella typhi. The agar-well diffusion method was used. A reference concentration-response curve for ampicillin was used to estimate the apparent activity of the samples. Twenty four species showed antibacterial activity. Cassia occidentalis roots, Heimia salicifolia aerial parts, Punica granatum fruit pericarp and Rosa borboniana flowers produced some of the more active extracts. Taking into account the multiple resistance of Salmonella typhi, these findings could be useful in the search for new clinically useful antimicrobials.

  12. Comparative genomics study for identification of putative drug targets in Salmonella typhi Ty2.

    PubMed

    Batool, Nisha; Waqar, Maleeha; Batool, Sidra

    2016-01-15

    Typhoid presents a major health concern in developing countries with an estimated annual infection rate of 21 million. The disease is caused by Salmonella typhi, a pathogenic bacterium acquiring multiple drug resistance. We aim to identify proteins that could prove to be putative drug targets in the genome of S. typhi str. Ty2. We employed comparative and subtractive genomics to identify targets that are absent in humans and are essential to S. typhi Ty2. We concluded that 46 proteins essential to pathogen are absent in the host genome. Filtration on the basis of drug target prioritization singled out 20 potentially therapeutic targets. Their absence in the host and specificity to S. typhi Ty2 makes them ideal targets for treating typhoid in Homo sapiens. 3D structures of two of the final target enzymes, MurA and MurB have been predicted via homology modeling which are then used for a docking study.

  13. Gold nanoparticles as efficient antimicrobial agents for Escherichia coli and Salmonella typhi

    PubMed Central

    2013-01-01

    Background It is imperative to eliminate bacteria present in water in order to avoid problems in healthy. Escherichia coli and Salmonella typhi bacteria are two common pollutants and they are developing resistance to some of the most used bactericide. Therefore new biocide materials are being tested. Thus, gold nanoparticles are proposed to inhibit the growth of these two microorganisms. Results Gold nanoparticles were supported onto clinoptilolite, mordenite and faujasite zeolites. Content of gold in materials varied between 2.3 and 2.8 wt%. The size, dispersion and roughness of gold nanoparticles were highly dependent of the zeolite support. The faujasite support was the support where the 5 nm nanoparticles were highly dispersed. The efficiency of gold-zeolites as bactericides of Escherichia coli and Salmonella typhi was determined by the zeolite support. Conclusions Gold nanoparticles dispersed on zeolites eliminate Escherichia coli and Salmonella typhi at short times. The biocidal properties of gold nanoparticles are influenced by the type of support which, indeed, drives key parameters as the size and roughness of nanoparticles. The more actives materials were pointed out Au-faujasite. These materials contained particles sized 5 nm at surface and eliminate 90–95% of Escherichia coli and Salmonella typhi colonies. PMID:23331621

  14. Plasmid-mediated quinolone resistance among non-typhi Salmonella enterica isolates, USA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We determined the prevalence of plasmid-mediated quinolone resistance mechanisms among non-Typhi Salmonella (NTS) spp. isolates from humans, food animals, and retail meat in the United States in 2007. Fifty-one (2.4%) of human isolates (n=2165), 5 (1.6%) of isolates from animal isolates (n=1915) an...

  15. Whole-Genome Shotgun Sequencing of Cephalosporin-Resistant Salmonella enterica Serovar Typhi.

    PubMed

    Rodrigues, Camilla; Kapil, Arti; Sharma, Anita; Devanga Ragupathi, Naveen Kumar; Inbanathan, Francis Yesurajan; Veeraraghavan, Balaji; Kang, Gagandeep

    2017-03-09

    Typhoid is one of the leading causes of mortality in developing countries. Here, we report the draft genome sequences of four Salmonella enterica serovar Typhi strains isolated from bloodstream infections in a tertiary care hospital. The sequence data indicate genomes of ~4.5 Mb for all isolates, with one plasmid in each.

  16. Whole-Genome Shotgun Sequencing of Cephalosporin-Resistant Salmonella enterica Serovar Typhi

    PubMed Central

    Rodrigues, Camilla; Kapil, Arti; Sharma, Anita; Devanga Ragupathi, Naveen Kumar; Inbanathan, Francis Yesurajan; Kang, Gagandeep

    2017-01-01

    ABSTRACT Typhoid is one of the leading causes of mortality in developing countries. Here, we report the draft genome sequences of four Salmonella enterica serovar Typhi strains isolated from bloodstream infections in a tertiary care hospital. The sequence data indicate genomes of ~4.5 Mb for all isolates, with one plasmid in each. PMID:28280021

  17. Differential Killing of Salmonella enterica Serovar Typhi by Antibodies Targeting Vi and Lipopolysaccharide O:9 Antigen.

    PubMed

    Hart, Peter J; O'Shaughnessy, Colette M; Siggins, Matthew K; Bobat, Saeeda; Kingsley, Robert A; Goulding, David A; Crump, John A; Reyburn, Hugh; Micoli, Francesca; Dougan, Gordon; Cunningham, Adam F; MacLennan, Calman A

    2016-01-01

    Salmonella enterica serovar Typhi expresses a capsule of Vi polysaccharide, while most Salmonella serovars, including S. Enteritidis and S. Typhimurium, do not. Both S. Typhi and S. Enteritidis express the lipopolysaccharide O:9 antigen, yet there is little evidence of cross-protection from anti-O:9 antibodies. Vaccines based on Vi polysaccharide have efficacy against typhoid fever, indicating that antibodies against Vi confer protection. Here we investigate the role of Vi capsule and antibodies against Vi and O:9 in antibody-dependent complement- and phagocyte-mediated killing of Salmonella. Using isogenic Vi-expressing and non-Vi-expressing derivatives of S. Typhi and S. Typhimurium, we show that S. Typhi is inherently more sensitive to serum and blood than S. Typhimurium. Vi expression confers increased resistance to both complement- and phagocyte-mediated modalities of antibody-dependent killing in human blood. The Vi capsule is associated with reduced C3 and C5b-9 deposition, and decreased overall antibody binding to S. Typhi. However, purified human anti-Vi antibodies in the presence of complement are able to kill Vi-expressing Salmonella, while killing by anti-O:9 antibodies is inversely related to Vi expression. Human serum depleted of antibodies to antigens other than Vi retains the ability to kill Vi-expressing bacteria. Our findings support a protective role for Vi capsule in preventing complement and phagocyte killing of Salmonella that can be overcome by specific anti-Vi antibodies, but only to a limited extent by anti-O:9 antibodies.

  18. Salmonella enterica serovar Typhi and gallbladder cancer: a case-control study and meta-analysis.

    PubMed

    Koshiol, Jill; Wozniak, Aniela; Cook, Paz; Adaniel, Christina; Acevedo, Johanna; Azócar, Lorena; Hsing, Ann W; Roa, Juan C; Pasetti, Marcela F; Miquel, Juan F; Levine, Myron M; Ferreccio, Catterina

    2016-11-01

    In Chile, where gallbladder cancer (GBC) rates are high and typhoid fever was endemic until the 1990s, we evaluated the association between Salmonella enterica serovar Typhi (S. Typhi) antibodies and GBC. We tested 39 GBC cases, 40 gallstone controls, and 39 population-based controls for S. Typhi Vi antibodies and performed culture and quantitative polymerase chain reaction for the subset with bile, gallstone, tissue, and stool samples available. We calculated gender and education-adjusted odds ratios (ORs) and 95% confidence intervals (CIs) for the association with GBC. We also conducted a meta-analysis of >1000 GBC cases by combining our results with previous studies. GBC cases were more likely to have high Vi antibody titer levels than combined controls (OR: 4.0, 95% CI: 0.9-18.3), although S. Typhi was not recovered from bile, gallstone, tissue, or stool samples. In our meta-analysis, the summary relative risk was 4.6 (95% CI: 3.1-6.8, Pheterogeneity =0.6) for anti-Vi and 5.0 (95% CI: 2.7-9.3, Pheterogeneity  = 0.2) for bile or stool culture. Our results are consistent with the meta-analysis. Despite differences in study methods (e.g., S. Typhi detection assay), most studies found a positive association between S. Typhi and GBC. However, the mechanism underlying this association requires further investigation.

  19. SufC may promote the survival of Salmonella enterica serovar Typhi in macrophages.

    PubMed

    Wang, Min; Qi, Lin; Xiao, Yan; Wang, Min; Qin, Chenhao; Zhang, Haifang; Sheng, Yongmei; Du, Hong

    2015-08-01

    The sufC gene of Escherichia coli (E. coli) is required for the biogenesis of iron-sulfur (Fe-S) cluster under oxidative stress conditions. In order to investigate the roles of sufC in Salmonella enterica serovar Typhi (S. Typhi), isogenic S. Typhi strain GIFU10007 harboring a non-polar mutation of sufC (ΔsufC) was constructed and the results showed that the sufC deleted mutant grew more slowly than the wild type strain when encounter oxidative stresses. Moreover, the deletion of sufC gene decreased S. Typhi survival within macrophages. After macrophages infected by sufC deleted mutant and wild type strain, we detected IL-6 and TNF-α released into the supernatant, and found the expression of IL-6 and TNF-α decreased in the supernatant of sufC deleted mutant infected groups than the wild type strain infected ones. In summary, our results showed that SufC may promote S. Typhi coping oxidative stress and help S. Typhi survival in macrophages.

  20. Fitness benefits in fluoroquinolone-resistant Salmonella Typhi in the absence of antimicrobial pressure.

    PubMed

    Baker, Stephen; Duy, Pham Thanh; Nga, Tran Vu Thieu; Dung, Tran Thi Ngoc; Phat, Voong Vinh; Chau, Tran Thuy; Turner, A Keith; Farrar, Jeremy; Boni, Maciej F

    2013-12-10

    Fluoroquinolones (FQ) are the recommended antimicrobial treatment for typhoid, a severe systemic infection caused by the bacterium Salmonella enterica serovar Typhi. FQ-resistance mutations in S. Typhi have become common, hindering treatment and control efforts. Using in vitro competition experiments, we assayed the fitness of eleven isogenic S. Typhi strains with resistance mutations in the FQ target genes, gyrA and parC. In the absence of antimicrobial pressure, 6 out of 11 mutants carried a selective advantage over the antimicrobial-sensitive parent strain, indicating that FQ resistance in S. Typhi is not typically associated with fitness costs. Double-mutants exhibited higher than expected fitness as a result of synergistic epistasis, signifying that epistasis may be a critical factor in the evolution and molecular epidemiology of S. Typhi. Our findings have important implications for the management of drug-resistant S. Typhi, suggesting that FQ-resistant strains would be naturally maintained even if fluoroquinolone use were reduced. DOI: http://dx.doi.org/10.7554/eLife.01229.001.

  1. A Salmonella Typhi homologue of bacteriophage muramidases controls typhoid toxin secretion.

    PubMed

    Hodak, Hélène; Galán, Jorge E

    2013-01-01

    Unlike other Salmonella, which can infect a broad range of hosts causing self-limiting infection, Salmonella Typhi is an exclusively human pathogen that causes typhoid fever, a life-threatening systemic disease. Typhoid toxin is a unique virulence factor of Salmonella Typhi, which is expressed when the bacteria are within mammalian cells. Here, we report that an N-acetyl-β-D-muramidase similar to phage endolysins encoded within the same pathogenicity islet as the toxin is required for typhoid toxin secretion. Genetic and functional analysis of TtsA revealed unique amino acids at its predicted peptidoglycan-binding domain that are essential for protein secretion and that distinguishes this protein from other homologues. We propose that TtsA defines a new protein secretion mechanism recently evolved from the machine that mediates phage release.

  2. Experimental Salmonella typhi infection in the domestic pig, Sus scrofa domestica.

    PubMed

    Metcalf, E S; Almond, G W; Routh, P A; Horton, J R; Dillman, R C; Orndorff, P E

    2000-08-01

    The domestic pig, Sus scrofa domestica, was examined as a model for typhoid fever, a severe and systemic disease of humans caused by Salmonella typhi. Six pigs were inoculated 1 week post-weaning with approximately 10(10)colony forming units (cfu) of wild type Salmonella typhi strain ISP1820 intranasally and observed for 3 weeks. S. typhi was cultured from the tonsils of 50% of the pigs at necropsy. Cultures from all other organs analysed (ileum, colon, spleen and liver) were negative. No clinical or histopathological signs of disease were observed. Pigs inoculated in parallel with swine-virulent S. choleraesuis all exhibited signs of systemic salmonellosis indicating that the parameters of the experimental infection with S. typhi (e.g. route) were appropriate. Whereas the pig has a gastrointestinal tract that is very similar to humans, our results indicated that the unique features of host and microbe interaction needed to produce typhoid fever were not mimicked in swine. Nevertheless, our observation of tonsillar involvement was consistent with former observations of S. choleraesuis and S. typhimurium infections in swine and supports a role for the tonsil in all porcine salmonella infections.

  3. Investigation of an outbreak of Salmonella Typhi in Battalgazi district, Malatya-Turkey

    PubMed Central

    Iseri, Latife; Bayraktar, Mehmet Refik; Aktaş, Elif; Durmaz, Riza

    2009-01-01

    Salmonella Typhi infections are important public health problems for the developing countries. In this study we investigated the molecular epidemiology of a suspected well-water borne S. Typhi outbreak occurred in a district of Malatya-Turkey. This outbreak affected 10 patients in two days. Arbitrary primed polymerase chain reaction (AP-PCR) based typing showed two clones, one had seven, and the other had three strains, supporting outbreak speculation. By adding chlorine to wells by local municipal authority, the outbreak ended within a very short time (about ten days). PMID:24031338

  4. Revisit of fluoroquinolone and azithromycin susceptibility breakpoints for Salmonella enterica serovar Typhi.

    PubMed

    Das, Surojit; Ray, Ujjwayini; Dutta, Shanta

    2016-07-01

    In recent years, increase in occurrence of fluoroquinolone (FQ)-resistant S almonella Typhi isolates has caused considerable inconvenience in selecting appropriate antimicrobials for treatment of typhoid. The World Health Organization (WHO) recommends azithromycin for the empirical treatment option of uncomplicated typhoid. The CLSI updated the breakpoints of disc diffusion (DD) and MIC results of FQs and azithromycin for Salmonella Typhi in 2015, but DD breakpoints of ofloxacin and levofloxacin were not included. In this study, the inhibition zone diameters and MICs of nalidixic acid, ciprofloxacin, ofloxacin, levofloxacin and azithromycin were determined in Salmonella Typhi Kolkata isolates (n =146) over a 16-year period (1998 to 2013) and the data were compared with the available CLSI breakpoints. Very major error and major error (ME) of FQs were not observed in the study isolates, but the minor error of ciprofloxacin (15.8 %) and ME of azithromycin (3.5 %) exceeded the acceptable limit. A positive correlation between MICs of FQ and mutations in the quinolone-resistance-determining region (QRDR) showed the reliability of MIC results to determine FQ susceptibility of Salmonella Typhi (n =74). Isolates showing decreased ciprofloxacin susceptibility (MIC 0.125-0.5 µg  ml-1) were likely to have at least one mutation in the QRDR region. The results on DD breakpoints of ofloxacin (resistant, ≤15 mm; intermediate, 16-24 mm, and susceptible, ≥25 mm) and levofloxacin (resistant, ≤18 mm; intermediate, 19-27 mm, and susceptible, ≥28 mm) corroborated those of earlier studies. In view of the emerging FQ- and azithromycin-resistant Salmonella Typhi isolates, DD and MIC breakpoints of those antimicrobials should be revisited routinely.

  5. Antimicrobial susceptibility to azithromycin among Salmonella enterica Typhi and Paratyphi A isolates from India.

    PubMed

    Misra, Richa; Prasad, Kashi Nath

    2016-12-01

    Decreased ciprofloxacin susceptibility (DCS) and multidrug resistance in typhoidal Salmonella isolates in areas of endemicity are significant therapeutic problems. Guidelines for azithromycin disc diffusion and MIC interpretive criteria for Salmonella enterica serovar Typhi were published recently by the Clinical and Laboratory Standards Institute in 2015. We investigated the antimicrobial susceptibility pattern of azithromycin in 100 isolates of Salmonella Typhi (n=80), Paratyphi A (n=18) and B (n=2) recovered from bloodstream infections from January 2013 to December 2015. Zone sizes were extrapolated against MIC values, and a scatter plot was constructed. The azithromycin MICs by Etest ranged from 2 to 16 µg ml-1, while the disc diffusion diameters were from 13 to 22 mm. We observed that the margin of the zone of inhibition around the azithromycin disc may not be very clear and therefore difficult to interpret and that there was wide variation in the zone sizes for the same MIC value in both serovars. DCS was observed in 85 % of Salmonella Typhi recovered (68/80) and in 15/18 (83.3 %) Paratyphi A isolates. Judicious use of azithromycin is advocated as an alternative oral agent in endemic areas where DCS is common.

  6. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    PubMed

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  7. Asymmetric pore occupancy in crystal structure of OmpF porin from Salmonella typhi.

    PubMed

    Balasubramaniam, D; Arockiasamy, Arulandu; Kumar, P D; Sharma, Amit; Krishnaswamy, S

    2012-06-01

    OmpF is a major general diffusion porin of Salmonella typhi, a Gram-negative bacterium, which is an obligatory human pathogen causing typhoid. The structure of S. typhi Ty21a OmpF (PDB Id: 3NSG) determined at 2.8 Å resolution by X-ray crystallography shows a 16-stranded β-barrel with three β-barrel monomers associated to form a trimer. The packing observed in S. typhi Ty21a rfOmpF crystals has not been observed earlier in other porin structures. The variations seen in the loop regions provide a starting point for using the S. typhi OmpF for structure-based multi-valent vaccine design. Along one side of the S. typhi Ty21a OmpF pore there exists a staircase arrangement of basic residues (20R, 60R, 62K, 65R, 77R, 130R and 16K), which also contribute, to the electrostatic potential in the pore. This structure suggests the presence of asymmetric electrostatics in the porin oligomer. Moreover, antibiotic translocation, permeability and reduced uptake in the case of mutants can be understood based on the structure paving the way for designing new antibiotics.

  8. A study of Salmonella typhi isolated in Suez Canal area. Biotyping, phage typing and colicinogenic property.

    PubMed

    Shoeb, S; Khalifa, I; el Daly, O; Heiba, A; Farmer, J; Brenner, F; el Batawi, Y

    1989-01-01

    In this work a total of 82 strains of Salmonella typhi were isolated from Egyptian patients diagnosed as quiry enteric fever. These cases were from Ismalia, Suez and port Said Areas. The strains fell in 16 phage types. Phage types N, 40, E1, and degraded Vi were the commonest phage type in Ismailia, while phage types degraded Vi and C1 were the commonest in Port Said. Phage types Di-N, degraded Vi, A and C1 were the commonest in Suez. Chemotyping of Salmonella typhi showed that the majority of the strains belonged to chemotype I (82%), and the rest belonged to chemotype II (18%). Colicin production was negative and all the strains were susceptible to the currently used antibiotics.

  9. Investigation of an outbreak of Salmonella typhi in a public school in Madrid.

    PubMed

    Usera, M A; Aladueña, A; Echeita, A; Amor, E; Gomez-Garcés, J L; Ibañez, C; Mendez, I; Sanz, J C; Lopez-Brea, M

    1993-05-01

    A typhoid fever outbreak affecting 54 school students occurred in a Public School of Móstoles, Madrid. The date of onset was 11 June 1991 and the last detected case was 8 July 1991. Salmonella typhi was cultured from blood and/or stool samples corresponding to 54 patients and one food-handler. There were no secondary cases detected. Epidemiological investigation suggested a salad or a custard as the common source. Patients and the food-handler were treated with ampicillin/amoxicillin for up to three weeks. There were seven relapses that were also treated with the same antibiotics with success. None were found to be excreting the organisms when tested after four months. All the Salmonella typhi isolated strains were phagetype 34, biotype Xylose +, Tetrationate Reductase + and harboured a similar 22 Mdal plasmid, they were also susceptible to the antibiotics tested.

  10. Use of TaqMan® real-time PCR for rapid detection of Salmonella enterica serovar Typhi.

    PubMed

    Ranjbar, Reza; Naghoni, Ali; Farshad, Shohreh; Lashini, Hadi; Najafi, Ali; Sadeghifard, Nourkhoda; Mammina, Caterina

    2014-06-01

    We evaluated the performances of a newly designed real-time polymerase chain reaction (PCR) assay using TaqMan® probes to detect Salmonella Typhi. TaqMan® real-time PCR assays were performed by designed primers and probe based on the staG gene for detecting S. Typhi. The specificity of the assay was evaluated on 15 Salmonella serovars. The analytical specificity was evaluated on 20 non-Salmonella microorganisms. The analytical sensitivity was assessed using decreasing DNA quantities of S. Typhi ATCC 19430. Finally the detection capability of the TaqMan® real-time PCR assay on isolates recovered from patients with Salmonella infections was compared to the conventional PCR assay. Only S. Typhi strain had positive results when subjected to the assay using Typhi-specific real-time PCR. No amplification products were observed in real-time PCR with any of the non-Salmonella microorganisms tested. The TaqMan® real-time PCR was more sensitive than the conventional PCR. In conclusion, we found that the easy-to-use real-time PCR assays were faster than conventional PCR systems. The staG-based TaqMan® real-time PCR assay showed to be specific and sensitive method for the safe and rapid detection of the S. Typhi.

  11. Interaction of Salmonella typhi strains with cultured human monocyte-derived macrophages.

    PubMed Central

    Sizemore, D R; Elsinghorst, E A; Eck, L C; Branstrom, A A; Hoover, D L; Warren, R L; Rubin, F A

    1997-01-01

    Human monocyte-derived macrophages (MDM) provided this laboratory with a tool to develop a primary-cell assay for evaluating the relative virulence of newly constructed Salmonella typhi carrier strains. In this study, the interaction with and survival within MDM were compared for delta aroA143-attenuated strains, wild-type virulent strains, and the current oral-vaccine strain, Ty21a. PMID:8975929

  12. Intermediate Susceptibility to Ciprofloxacin among Salmonella enterica Serovar Typhi Isolates in Lima, Peru

    PubMed Central

    Lejon, Veerle; Horna, Gertrudis; Astocondor, Lizeth; Vanhoof, Raymond; Bertrand, Sophie; Jacobs, Jan

    2014-01-01

    Thirty-three Salmonella enterica serovar Typhi blood isolates from Lima, Peru (2008 to 2012), were fully susceptible to trimethoprim-sulfamethoxazole, chloramphenicol, ceftriaxone, and tetracycline; 8/33 (24.2%) showed intermediate susceptibility to ciprofloxacin carrying mutations in the quinolone resistance-determining region of the gyrA gene (Ser83-Phe and Asp87-Asn) and in the gyrB gene (Ser464-Phe). PMID:24371234

  13. The flagellar regulator TviA reduces pyroptosis by Salmonella enterica serovar Typhi.

    PubMed

    Winter, Sebastian E; Winter, Maria G; Atluri, Vidya; Poon, Victor; Romão, Everton L; Tsolis, Renée M; Bäumler, Andreas J

    2015-04-01

    To discern virulent from innocuous microbes, the innate immune system senses events associated with bacterial access to immunoprivileged sites such as the host cell cytosol. One such pathway is triggered by the cytosolic delivery of flagellin, the major subunit of the flagellum, by bacterial secretion systems. This leads to inflammasome activation and subsequent proinflammatory cell death (pyroptosis) of the infected phagocyte. In this study, we demonstrate that the causative agent of typhoid fever, Salmonella enterica serovar Typhi, can partially subvert this critical innate immune recognition event. The transcriptional regulator TviA, which is absent from Salmonella serovars associated with human gastroenteritis, repressed the expression of flagellin during infection of human macrophage-like (THP-1) cells. This mechanism allowed S. Typhi to dampen inflammasome activation, leading to reduced interleukin-1β (IL-1β) secretion and diminished cell death. Likewise, the introduction of the tviA gene in nontyphoidal Salmonella enterica serovar Typhimurium reduced flagellin-induced pyroptosis. These data suggest that gene regulation of virulence factors enables S. Typhi to evade innate immune recognition by concealing a pathogen-induced process from being sensed by the inflammasome.

  14. Bug on the back: vertebral osteomyelitis secondary to fluoroquinolone resistant Salmonella typhi in an immunocompetent patient.

    PubMed

    Shrestha, Pragya; Mohan, Sachin; Roy, Satyajeet

    2015-11-27

    Although Salmonella osteomyelitis is commonly seen in immunocompromised patients, it may occasionally affect an immunocompetent host. Symptoms are usually non-specific, such as fever, abdominal or back pain; hence it should be considered in the differential diagnosis of patients with a history of travel to endemic regions. Fluoroquinolone resistance is rising and non-responsive patients should be treated with ampicillin, trimethoprim-sulfamethoxazole and ceftriaxone. We present a case of acute T8-T11 osteomyelitis with cord compression caused by a fluoroquinolone resistant strain of Salmonella typhi.

  15. The ompB Operon Partially Determines Differential Expression of OmpC in Salmonella typhi and Escherichia coli

    PubMed Central

    Martínez-Flores, Irma; Cano, Roxana; Bustamante, Víctor H.; Calva, Edmundo; Puente, José Luis

    1999-01-01

    Expression of the Escherichia coli OmpC and OmpF outer membrane proteins is regulated by the osmolarity of the culture media. In contrast, expression of OmpC in Salmonella typhi is not influenced by osmolarity, while OmpF is regulated as in E. coli. To better understand the lack of osmoregulation of OmpC expression in S. typhi, we compared the expression of the ompC gene in S. typhi and E. coli, using ompC-lacZ fusions and outer membrane protein (OMP) electrophoretic profiles. S. typhi ompC expression levels in S. typhi were similar at low and high osmolarity along the growth curve, whereas osmoregulation of E. coli ompC in E. coli was observed during the exponential phase. Both genes were highly expressed at high and low osmolarity when present in S. typhi, while expression of both was regulated by osmolarity in E. coli. Complementation experiments with either the S. typhi or E. coli ompB operon in an S. typhi ΔompB strain carrying the ompC-lacZ fusions showed that both S. typhi and E. coli ompC were not regulated by osmolarity when they were under the control of S. typhi ompB. Interestingly, in the same strain, both genes were osmoregulated under E. coli ompB. Surprisingly, in E. coli ΔompB, they were both osmoregulated under S. typhi or E. coli ompB. Thus, the lack of osmoregulation of OmpC expression in S. typhi is determined in part by the ompB operon, as well as by other unknown trans-acting elements present in S. typhi. PMID:9882670

  16. Response of Salmonella Typhi to bile-generated oxidative stress: implication of quorum sensing and persister cell populations.

    PubMed

    Walawalkar, Yogesh D; Vaidya, Yatindra; Nayak, Vijayashree

    2016-11-01

    Salmonella Typhi can chronically persist within the gallbladder of patients suffering from gallbladder diseases. This study, intended to improve our understanding of bacterial mechanisms underlying bile adaptation, revealed that bile, which is a bactericidal agent, led to the generation of reactive oxygen species in S Typhi. Salmonella Typhi in response showed a significant increase in the production of anti-oxidative enzymes, namely superoxide dismutase and catalase. The work reports that the quorum-sensing (QS) system of S Typhi regulates the level of these enzymes during oxidative stress. In support of these observations, the quorum-sensing mutant of S Typhi was found to be sensitive to bile with significantly lower levels of anti-oxidant enzymes compared to other clinical isolates. Furthermore the addition of exogenous cell-free extracts (CFEs) of S Typhi containing the quorum-sensing signalling molecule significantly increased the levels of these enzymes within the mutant. Interestingly the CFE addition did not significantly restore the biofilm-forming ability of the mutant strain when compared with the wild-type. In the presence of ciprofloxacin and ampicillin, S Typhi formed persister cells which increased >3-fold in the presence of bile. Thus the QS-system of S Typhi aids in oxidative stress management, and enhanced persister cell populations could assist chronic bacterial persistence within the gallbladder.

  17. Emergence of Ciprofloxacin-Resistant Salmonella enterica Serovar Typhi in Italy.

    PubMed

    García-Fernández, Aurora; Gallina, Silvia; Owczarek, Slawomir; Dionisi, Anna Maria; Benedetti, Ildo; Decastelli, Lucia; Luzzi, Ida

    2015-01-01

    In developed countries, typhoid fever is often associated with persons who travel to endemic areas or immigrate from them. Typhoid fever is a systemic infection caused by Salmonella enterica serovar Typhi. Because of the emergence of antimicrobial resistance to standard first-line drugs, fluoroquinolones are the drugs of choice. Resistance to ciprofloxacin by this Salmonella serovar represents an emerging public health issue. Two S. enterica ser. Typhi strains resistant to ciprofloxacin (CIP) were reported to the Italian surveillance system for foodborne and waterborne diseases (EnterNet-Italia) in 2013. The strains were isolated from two Italian tourists upon their arrival from India. A retrospective analysis of 17 other S. enterica ser. Typhi strains isolated in Italy during 2011-2013 was performed to determine their resistance to CIP. For this purpose, we assayed for susceptibility to antimicrobial agents and conducted PCR and nucleotide sequence analyses. Moreover, all strains were typed using pulsed-field gel electrophoresis to evaluate possible clonal relationships. Sixty-eight percent of the S. enterica ser. Typhi strains were resistant to CIP (MICs, 0.125-16 mg/L), and all isolates were negative for determinants of plasmid-mediated quinolone resistance. Analysis of sequences encoding DNA gyrase and topoisomerase IV subunits revealed mutations in gyrA, gyrB, and parC. Thirteen different clonal groups were detected, and the two CIP-resistant strains isolated from the individuals who visited India exhibited the same PFGE pattern. Because of these findings, the emergence of CIP-resistant S. enterica ser. Typhi isolates in Italy deserves attention, and monitoring antibiotic susceptibility is important for efficiently managing cases of typhoid fever.

  18. Activation of Salmonella Typhi-specific regulatory T cells in typhoid disease in a wild-type S. Typhi challenge model.

    PubMed

    McArthur, Monica A; Fresnay, Stephanie; Magder, Laurence S; Darton, Thomas C; Jones, Claire; Waddington, Claire S; Blohmke, Christoph J; Dougan, Gordon; Angus, Brian; Levine, Myron M; Pollard, Andrew J; Sztein, Marcelo B

    2015-05-01

    Salmonella Typhi (S. Typhi), the causative agent of typhoid fever, causes significant morbidity and mortality worldwide. Currently available vaccines are moderately efficacious, and identification of immunological responses associated with protection or disease will facilitate the development of improved vaccines. We investigated S. Typhi-specific modulation of activation and homing potential of circulating regulatory T cells (Treg) by flow and mass cytometry using specimens obtained from a human challenge study. Peripheral blood mononuclear cells were obtained from volunteers pre- and at multiple time-points post-challenge with wild-type S. Typhi. We identified differing patterns of S. Typhi-specific modulation of the homing potential of circulating Treg between volunteers diagnosed with typhoid (TD) and those who were not (No TD). TD volunteers demonstrated up-regulation of the gut homing molecule integrin α4ß7 pre-challenge, followed by a significant down-regulation post-challenge consistent with Treg homing to the gut. Additionally, S. Typhi-specific Treg from TD volunteers exhibited up-regulation of activation molecules post-challenge (e.g., HLA-DR, LFA-1). We further demonstrate that depletion of Treg results in increased S. Typhi-specific cytokine production by CD8+ TEM in vitro. These results suggest that the tissue distribution of activated Treg, their characteristics and activation status may play a pivotal role in typhoid fever, possibly through suppression of S. Typhi-specific effector T cell responses. These studies provide important novel insights into the regulation of immune responses that are likely to be critical in protection against typhoid and other enteric infectious diseases.

  19. Activation of Salmonella Typhi-Specific Regulatory T Cells in Typhoid Disease in a Wild-Type S. Typhi Challenge Model

    PubMed Central

    McArthur, Monica A.; Fresnay, Stephanie; Magder, Laurence S.; Darton, Thomas C.; Jones, Claire; Waddington, Claire S.; Blohmke, Christoph J.; Dougan, Gordon; Angus, Brian; Levine, Myron M.; Pollard, Andrew J.; Sztein, Marcelo B.

    2015-01-01

    Salmonella Typhi (S. Typhi), the causative agent of typhoid fever, causes significant morbidity and mortality worldwide. Currently available vaccines are moderately efficacious, and identification of immunological responses associated with protection or disease will facilitate the development of improved vaccines. We investigated S. Typhi-specific modulation of activation and homing potential of circulating regulatory T cells (Treg) by flow and mass cytometry using specimens obtained from a human challenge study. Peripheral blood mononuclear cells were obtained from volunteers pre- and at multiple time-points post-challenge with wild-type S. Typhi. We identified differing patterns of S. Typhi-specific modulation of the homing potential of circulating Treg between volunteers diagnosed with typhoid (TD) and those who were not (No TD). TD volunteers demonstrated up-regulation of the gut homing molecule integrin α4ß7 pre-challenge, followed by a significant down-regulation post-challenge consistent with Treg homing to the gut. Additionally, S. Typhi-specific Treg from TD volunteers exhibited up-regulation of activation molecules post-challenge (e.g., HLA-DR, LFA-1). We further demonstrate that depletion of Treg results in increased S. Typhi-specific cytokine production by CD8+ TEM in vitro. These results suggest that the tissue distribution of activated Treg, their characteristics and activation status may play a pivotal role in typhoid fever, possibly through suppression of S. Typhi-specific effector T cell responses. These studies provide important novel insights into the regulation of immune responses that are likely to be critical in protection against typhoid and other enteric infectious diseases. PMID:26001081

  20. Antimicrobial resistance in Salmonella enterica Serovar Typhi isolates from Bangladesh, Indonesia, Taiwan, and Vietnam.

    PubMed

    Chiou, Chien-Shun; Lauderdale, Tsai-Ling; Phung, Dac Cam; Watanabe, Haruo; Kuo, Jung-Che; Wang, Pei-Jen; Liu, Yen-Yi; Liang, Shiu-Yun; Chen, Pei-Chen

    2014-11-01

    We characterized Salmonella enterica serovar Typhi isolates from Bangladesh, Indonesia, Taiwan, and Vietnam to investigate their genetic relatedness and antimicrobial resistance. The isolates from Bangladesh and Vietnam were genetically closely related but were distant from those from Indonesia and Taiwan. All but a few isolates from Indonesia and Taiwan were susceptible to all antimicrobials tested. The majority of isolates from Bangladesh and Vietnam were multidrug resistant (MDR) and belonged to the widespread haplotype H58 clone. IncHI1 plasmids were detected in all MDR S. Typhi isolates from Vietnam but in only 15% of MDR isolates from Bangladesh. Resistance genes in the majority of MDR S. Typhi isolates from Bangladesh should reside in the chromosome. Among the isolates from Bangladesh, 82% and 40% were resistant to various concentrations of nalidixic acid and ciprofloxacin, respectively. Several resistance mechanisms, including alterations in gyrase A, the presence of QnrS, and enhanced efflux pumps, were involved in the reduced susceptibility and resistance to fluoroquinolones. Intensive surveillance is necessary to monitor the spread of chromosome-mediated MDR and fluoroquinolone-resistant S. Typhi emerging in Bangladesh.

  1. Genome dynamics and evolution of Salmonella Typhi strains from the typhoid-endemic zones.

    PubMed

    Baddam, Ramani; Kumar, Narender; Shaik, Sabiha; Lankapalli, Aditya Kumar; Ahmed, Niyaz

    2014-12-12

    Typhoid fever poses significant burden on healthcare systems in Southeast Asia and other endemic countries. Several epidemiological and genomic studies have attributed pseudogenisation to be the major driving force for the evolution of Salmonella Typhi although its real potential remains elusive. In the present study, we analyzed genomes of S. Typhi from different parts of Southeast Asia and Oceania, comprising of isolates from outbreak, sporadic and carrier cases. The genomes showed high genetic relatedness with limited opportunity for gene acquisition as evident from pan-genome structure. Given that pseudogenisation is an active process in S. Typhi, we further investigated core and pan-genome profiles of functional and pseudogenes separately. We observed a decline in core functional gene content and a significant increase in accessory pseudogene content. Upon functional classification, genes encoding metabolic functions formed a major constituent of pseudogenes as well as core functional gene clusters with SNPs. Further, an in-depth analysis of accessory pseudogene content revealed the existence of heterogeneous complements of functional and pseudogenes among the strains. In addition, these polymorphic genes were also enriched in metabolism related functions. Thus, the study highlights the existence of heterogeneous strains in a population with varying metabolic potential and that S. Typhi possibly resorts to metabolic fine tuning for its adaptation.

  2. Characterization of putative multidrug resistance transporters of the major facilitator-superfamily expressed in Salmonella Typhi.

    PubMed

    Shaheen, Aqsa; Ismat, Fouzia; Iqbal, Mazhar; Haque, Abdul; De Zorzi, Rita; Mirza, Osman; Walz, Thomas; Rahman, Moazur

    2015-05-01

    Multidrug resistance mediated by efflux pumps is a well-known phenomenon in infectious bacteria. Although much work has been carried out to characterize multidrug efflux pumps in Gram-negative and Gram-positive bacteria, such information is still lacking for many deadly pathogens. The aim of this study was to gain insight into the substrate specificity of previously uncharacterized transporters of Salmonella Typhi to identify their role in the development of multidrug resistance. S. Typhi genes encoding putative members of the major facilitator superfamily were cloned and expressed in the drug-hypersensitive Escherichia coli strain KAM42, and tested for transport of 25 antibacterial compounds, including representative antibiotics of various classes, antiseptics, dyes and detergents. Of the 15 tested putative transporters, STY0901, STY2458 and STY4874 exhibited a drug-resistance phenotype. Among these, STY4874 conferred resistance to at least ten of the tested antimicrobials: ciprofloxacin, norfloxacin, levofloxacin, kanamycin, streptomycin, gentamycin, nalidixic acid, chloramphenicol, ethidium bromide, and acriflavine, including fluoroquinolone antibiotics, which were drugs of choice to treat S. Typhi infections. Cell-based functional studies using ethidium bromide and acriflavine showed that STY4874 functions as a H(+)-dependent exporter. These results suggest that STY4874 may be an important drug target, which can now be tested by studying the susceptibility of a STY4874-deficient S. Typhi strain to antimicrobials.

  3. Interkingdom crosstalk: host neuroendocrine stress hormones drive the hemolytic behavior of Salmonella typhi.

    PubMed

    Karavolos, Michail H; Williams, Paul; Khan, C M Anjam

    2011-01-01

    The ability of bacterial pathogens to sense their immediate environment plays a significant role on their capacity to survive and cause disease. Salmonella enterica serovar typhi (S. typhi) is an exclusively human pathogen that causes typhoid fever. In a recent study, we have shown that S. typhi senses and responds to host neuroendocrine stress hormones to release the toxin hemolysin E. Hormone-mediated hemolysis by S. typhi was inhibited by the β-blocker propranolol and was dependent on the presence of the CpxAR signal transduction system. Furthermore, we demonstrate that normal expression of the small RNA micA is necessary for the arbitration of the response to host  neuroendocrine hormones. This leads to a significant decrease in the levels of the outer membrane protein OmpA and increased formation of membrane vesicles containing HlyE. The exploration of host pathogen interactions is  of paramount importance in deciphering pathogen virulence and the discovery of novel treatments.

  4. PCR Method To Identify Salmonella enterica Serovars Typhi, Paratyphi A, and Paratyphi B among Salmonella Isolates from the Blood of Patients with Clinical Enteric Fever▿

    PubMed Central

    Levy, Haim; Diallo, Souleymane; Tennant, Sharon M.; Livio, Sofie; Sow, Samba O.; Tapia, Milagritos; Fields, Patricia I.; Mikoleit, Matthew; Tamboura, Boubou; Kotloff, Karen L.; Lagos, Rosanna; Nataro, James P.; Galen, James E.; Levine, Myron M.

    2008-01-01

    PCR methodology was developed to identify Salmonella enterica serovars Typhi, Paratyphi A, and Paratyphi B. One multiplex PCR identifies serogroup D, A, and B and Vi-positive strains; another confirms flagellar antigen “d,” “a,” or “b.” Blinded testing of 664 Malian and Chilean Salmonella blood isolates demonstrated 100% sensitivity and specificity. PMID:18367574

  5. Effect of acid shock with hydrochloric, citric, and lactic acids on the survival and growth of Salmonella typhi and Salmonella typhimurium in acidified media.

    PubMed

    Arvizu-Medrano, Sofía M; Escartín, Eduardo F

    2005-10-01

    The effect of acid shock with hydrochloric, citric, or lactic acid on the survival and growth of Salmonella Typhi and Salmonella Typhimurium in acidified broth was evaluated. Salmonella serovars were acid shocked (1 h at 35 degrees C) in Trypticase soy broth acidified with hydrochloric, citric, or lactic acid at pH 5.5. Unshocked cells were exposed to the same media that had been neutralized before use to pH 7.0. Shocked and unshocked cells were inoculated into broth acidified with hydrochloric acid (pH 3.0), citric acid (pH 3.0), or lactic acid (pH 3.8), and growth and survival ability were evaluated. The acid shock conferred protection to Salmonella against the lethal effects of low pH and organic acids. The adaptive response was not specific to the anion used for adaptation. The biggest difference in reduction of survival between shocked and unshocked strains (approximately 2 log CFU/ml) was observed when the microorganisms were shocked with lactic acid and then challenged with citric acid. Salmonella Typhi was more tolerant of citric acid than was Salmonella Typhimurium, but Salmonella Typhimurium had higher acid tolerance in response to acid shock than did Salmonella Typhi. The acid shock decreased the extension of the lag phase and enhanced the physiological state values of Salmonella Typhi and Salmonella Typhimurium when the pH of growth was 4.5. This increased ability to tolerate acidity may have an important impact on food safety, especially in the case of Salmonella Typhi, given the very low infectious dose of this pathogen.

  6. Characterization of the yehUT two-component regulatory system of Salmonella enterica Serovar Typhi and Typhimurium.

    PubMed

    Wong, Vanessa K; Pickard, Derek J; Barquist, Lars; Sivaraman, Karthikeyan; Page, Andrew J; Hart, Peter J; Arends, Mark J; Holt, Kathryn E; Kane, Leanne; Mottram, Lynda F; Ellison, Louise; Bautista, Ruben; McGee, Chris J; Kay, Sally J; Wileman, Thomas M; Kenney, Linda J; MacLennan, Calman A; Kingsley, Robert A; Dougan, Gordon

    2013-01-01

    Proteins exhibiting hyper-variable sequences within a bacterial pathogen may be associated with host adaptation. Several lineages of the monophyletic pathogen Salmonella enterica serovar Typhi (S. Typhi) have accumulated non-synonymous mutations in the putative two-component regulatory system yehUT. Consequently we evaluated the function of yehUT in S. Typhi BRD948 and S. Typhimurium ST4/74. Transcriptome analysis identified the cstA gene, encoding a carbon starvation protein as the predominantly yehUT regulated gene in both these serovars. Deletion of yehUT had no detectable effect on the ability of these mutant Salmonella to invade cultured epithelial cells (S. Typhi and S. Typhimurium) or induce colitis in a murine model (S. Typhimurium only). Growth, metabolic and antimicrobial susceptibility tests identified no obvious influences of yehUT on these phenotypes.

  7. IS200 and multilocus sequence typing for the identification of Salmonella enterica serovar Typhi strains from Indonesia.

    PubMed

    Martínez-Gamboa, Areli; Silva, Claudia; Fernández-Mora, Marcos; Wiesner, Magdalena; Ponce de León, Alfredo; Calva, Edmundo

    2015-06-01

    In this work, IS200 and multi-locus sequence typing (MLST) were used to analyze 19 strains previously serotyped as Salmonella enterica serovar Typhi and isolated in Indonesia (16 strains), Mexico (2 strains), and Switzerland (1 strain). Most of the strains showed the most common Typhi sequence types, ST1 and ST2, and a new Typhi genotype (ST1856) was described. However, one isolate from Mexico and another from Indonesia were of the ST365 and ST426 sequence types, indicating that they belonged to serovars Weltevreden and Aberdeen, respectively. These results were supported by the amplification of IS200 fragments, which rapidly distinguish Typhi from other serovars. Our results demonstrate the utility of IS200 and MLST in the classification of Salmonella strains into serovars. These methods provide information on the clonal relatedness of strains isolated worldwide.

  8. Host adaptation of a bacterial toxin from the human pathogen Salmonella Typhi.

    PubMed

    Deng, Lingquan; Song, Jeongmin; Gao, Xiang; Wang, Jiawei; Yu, Hai; Chen, Xi; Varki, Nissi; Naito-Matsui, Yuko; Galán, Jorge E; Varki, Ajit

    2014-12-04

    Salmonella Typhi is an exclusive human pathogen that causes typhoid fever. Typhoid toxin is a S. Typhi virulence factor that can reproduce most of the typhoid fever symptoms in experimental animals. Toxicity depends on toxin binding to terminally sialylated glycans on surface glycoproteins. Human glycans are unusual because of the lack of CMAH, which in other mammals converts N-acetylneuraminic acid (Neu5Ac) to N-glycolylneuraminic acid (Neu5Gc). Here, we report that typhoid toxin binds to and is toxic toward cells expressing glycans terminated in Neu5Ac (expressed by humans) over glycans terminated in Neu5Gc (expressed by other mammals). Mice constitutively expressing CMAH thus displaying Neu5Gc in all tissues are resistant to typhoid toxin. The atomic structure of typhoid toxin bound to Neu5Ac reveals the structural bases for its binding specificity. These findings provide insight into the molecular bases for Salmonella Typhi's host specificity and may help the development of therapies for typhoid fever.

  9. Salmonella enterica serovar Typhi impairs CD4 T cell responses by reducing antigen availability.

    PubMed

    Atif, Shaikh M; Winter, Sebastian E; Winter, Maria G; McSorley, Stephen J; Bäumler, Andreas J

    2014-06-01

    Salmonella enterica serovar Typhi is associated with a disseminated febrile illness in humans, termed typhoid fever, while Salmonella enterica serovar Typhimurium causes localized gastroenteritis in immunocompetent individuals. One of the genetic differences between both pathogens is the presence in S. Typhi of TviA, a regulatory protein that shuts down flagellin (FliC) expression when bacteria transit from the intestinal lumen into the intestinal mucosa. Here we investigated the consequences of TviA-mediated flagellum gene regulation on flagellin-specific CD4 T cell responses in a mouse model of S. Typhimurium infection. Introduction of the S. Typhi tviA gene into S. Typhimurium suppressed antigen presentation of dendritic cells to flagellin-specific CD4 T cells in vitro. Furthermore, TviA-mediated repression of flagellin expression impaired the activation and proliferation of naive flagellin-specific CD4 T cells in Peyer's patches and mesenteric lymph nodes, which was accompanied by increased bacterial dissemination to the spleen. We conclude that TviA-mediated repression of flagellin expression reduces antigen availability, thereby weakening flagellin-specific CD4 T cell responses.

  10. Study on Salmonella Typhi occurrence in gallbladder of patients suffering from chronic cholelithiasis-a predisposing factor for carcinoma of gallbladder.

    PubMed

    Walawalkar, Yogesh D; Gaind, Rajni; Nayak, Vijayashree

    2013-09-01

    Cholelithiasis is frequently associated with carcinoma of gallbladder, and the presence of Salmonella Typhi in gallbladder of patients suffering from cholelithiasis is implicated as a predisposing factor for carcinogenesis. This study was conducted on patients suffering from chronic cholelithiasis from a region in North India-endemic area for enteric fever with high incidence of gallstones and gallbladder cancer. Since culture studies rarely reveal the chronic Salmonella Typhi persistence, we use PCR assay to specifically amplify the H1-d flagellin gene sequence homologous with Salmonella Typhi. Seven cases (17.5%), none of which were positive for culture, showed positive PCR results for Salmonella Typhi, 4 (10%) of which were tissue, 2 bile (5%), and 1 gallstone (2.5%). The chronic existence of Salmonella Typhi in gallbladder disease was confirmed. Thus, the study would indicate the importance of vaccination so as to prevent chronic infection and need for early diagnostic tools to prevent any further complications.

  11. Clearance and tissue distribution of intravenously injected Salmonella typhi polysaccharide in rabbits.

    PubMed Central

    Isibasi, A; Jimenez, E; Kumate, J

    1983-01-01

    The interaction of Freeman polysaccharide of Salmonella typhi with blood and tissues of rabbits was studied by radioimmunoassay. After intravenous injection of 1.0 mg of S. typhi Freeman polysaccharide, a rapid clearance phase (t1/2, 6.0 min) was followed by a slower clearance period (t1/2, 55.2 min). These results suggest first, that the distribution of whole lipopolysaccharide is a function of how the polysaccharides are handled by the host; further, that the O side chain determines how and where lipopolysaccharide is cleared from the circulatory system; and finally, that Freeman polysaccharide regulates the toxicity of lipopolysaccharide by influencing its clearance from blood. PMID:6642672

  12. Chromosomal Rearrangements in Salmonella enterica Serotype Typhi Affecting Molecular Typing in Outbreak Investigations

    PubMed Central

    Echeita, M. A.; Usera, M. A.

    1998-01-01

    Salmonella enterica serotype Typhi strains belonging to eight different outbreaks of typhoid fever that occurred in Spain between 1989 and 1994 were analyzed by ribotyping and pulsed-field gel electrophoresis. For three outbreaks, two different patterns were detected for each outbreak. The partial digestion analysis by the intron-encoded endonuclease I-CeuI of the two different strains from each outbreak provided an excellent tool for examining the organization of the genomes of epidemiologically related strains. S. enterica serotype Typhi seems to be more susceptible than other serotypes to genetic rearrangements produced by homologous recombinations between rrn operons; these rearrangements do not substantially alter the stability or survival of the bacterium. We conclude that genetic rearrangements can occur during the emergence of an outbreak. PMID:9650981

  13. [Septic arthritis of hip due to Salmonella Typhi in a patient with multiple sclerosis].

    PubMed

    Olut, Ali Ilgın; Avcı, Meltem; Ozgenç, Onur; Altay, Taşkın; Coşkuner, Seher Ayten; Ozsu Caymaz, Sibel; Havuk, Ayla

    2012-01-01

    The most common microorganisms isolated from septic arthritis are Staphylococcus aureus and streptoccocci. Septic arthritis due to Salmonella spp. are rare and the most commonly isolated species are S.Choleraesuis and S.Typhimurium. However the number of septic arthritis cases due to S.Typhi is low in literature. In this report, septic arthritis of hip due to S.Typhi in a multiple sclerosis patient who was under steroid therapy, was presented. A 25-year-old female patient was admitted to our clinic with the complaints of fever, left hip pain, standing and walking disability for 10 days. Her anamnesis revealed that she had had a multiple sclerosis attack and underwent triple pulse steroid therapy. Laboratory findings were as follows; WBC count: 16.300/mm3 (70% polymorphonuclear leukocyte), hemoglobin: 10.6 g/dl, erythrocyte sedimentation rate: 140 mm/hour, CRP: 28.7 g/L, AST: 86 U/L and ALT: 77 U/L. In lumbosacral magnetic resonance imaging, trochanteric bursitis and generalized myositis were detected in left hip joint compatible with septic arthritis. S.Typhi was isolated from patient's blood and operational tissue samples. Serum Salmonella TO and TH titers were found as 1/400 and 1/200, respectively. Antibiotic susceptibility test was performed by disk diffusion method, and the isolate was found susceptible to ampicillin, chloramphenicol, ceftriaxone, ciprofloxacin and trimethoprim-sulphametoxazole. The patient was treated by surgery and also by two weeks parenteral (2 x 400 mg) and 6 weeks oral (2 x 500 mg) ciprofloxacin treatment. Six months follow-up of the patient revealed that clinical, radiological and laboratory findings were normal. As far as the national literature was considered, this was the first S.Typhi septic arthritis case involving the hip joint and demonstrating bacterial growth both in blood and operational tissue. The presentation of the infection as arthritis plus diffuse myositis and bursitis, is also noteworthy.

  14. Antimicrobial resistance trends in blood culture positive Salmonella Typhi isolates from Pondicherry, India, 2005-2009.

    PubMed

    Menezes, G A; Harish, B N; Khan, M A; Goessens, W H F; Hays, J P

    2012-03-01

    Typhoid fever is caused by Salmonella enterica serovar Typhi, a major public health concern in developing countries. Recently, there has been an upsurge in the occurrence of bacterial isolates that are resistant to ciprofloxacin, and the emergence of broad spectrum β-lactamases in typhoidal salmonellae constitutes a new challenge for the clinician. A total of 337 blood culture isolates of S. Typhi, isolated from Pondicherry, India, between January 2005 and December 2009, were investigated using phenotypic, molecular and serological methods. Of the 337 isolates, 74 (22%) were found to be multidrug resistant (MDR) and 264 (78%) nalidixic acid resistant (NAR). Isolates with reduced susceptibility to ciprofloxacin possessed single mutations in the gyrA gene. A high rate of resistance (8%) was found to ciprofloxacin. All isolates with a ciprofloxacin MIC ≥ 4 mg/L possessed both double mutations in the QRDR of the gyrA gene and a single mutation in the parC gene. Active efflux pump mechanisms were also found to be involved in ciprofloxacin resistance. Finally, a large number of PFGE patterns (non-clonal genotypes) were observed among the S. Typhi isolates. In conclusion, a high rate of ciprofloxacin resistance was observed in comparison to other endemic areas in blood culture isolates of S. Typhi from Pondicherry, India, with steadily increasing NAR but decreasing MDR isolations over the study period. This is most likely to be due to an increased use of ciprofloxacin as a first-line drug of choice over more traditional antimicrobial agents for the treatment of typhoid fever.

  15. The Hd, Hj, and Hz66 flagella variants of Salmonella enterica serovar Typhi modify host responses and cellular interactions.

    PubMed

    Schreiber, Fernanda; Kay, Sally; Frankel, Gad; Clare, Simon; Goulding, David; van de Vosse, Esther; van Dissel, Jaap T; Strugnell, Richard; Thwaites, Guy; Kingsley, Robert A; Dougan, Gordon; Baker, Stephen

    2015-01-22

    Salmonella Typhi, the causative agent of typhoid fever, is a monophyletic, human-restricted bacterium that exhibits limited phenotypic variation. S. Typhi from Indonesia are a notable exception, with circulating strains expressing diverse flagella antigens including Hj, Hd and Hz66. Hypothesizing that S. Typhi flagella plays a key role during infection, we constructed an S. Typhi fliC mutant and otherwise isogenic S. Typhi strains expressing the Hj, Hd, Hz66 flagella antigens. Phenotyping revealed differences in flagellum structure, strain motility and immunogenicity, but not in the ability of flagellated isolates to induce TLR5 activity. Invasion assays using epithelial and macrophage cell lines revealed differences in the ability of these S. Typhi derivatives to invade cells or induce cellular restructuring in the form of ruffles. Notably, the Hj variant induced substantial ruffles that were not fully dependent on the GTPases that contribute to this process. These data highlight important differences in the phenotypic properties of S. Typhi flagella variation and how they impact on the pathogenesis of S. Typhi.

  16. Salmonella enterica serovars Typhimurium and Typhi as model organisms

    PubMed Central

    Garai, Preeti; Gnanadhas, Divya Prakash; Chakravortty, Dipshikha

    2012-01-01

    The lifestyle of intracellular pathogens has always questioned the skill of a microbiologist in the context of finding the permanent cure to the diseases caused by them. The best tool utilized by these pathogens is their ability to reside inside the host cell, which enables them to easily bypass the humoral immunity of the host, such as the complement system. They further escape from the intracellular immunity, such as lysosome and inflammasome, mostly by forming a protective vacuole-bound niche derived from the host itself. Some of the most dreadful diseases are caused by these vacuolar pathogens, for example, tuberculosis by Mycobacterium or typhoid fever by Salmonella. To deal with such successful pathogens therapeutically, the knowledge of a host-pathogen interaction system becomes primarily essential, which further depends on the use of a model system. A well characterized pathogen, namely Salmonella, suits the role of a model for this purpose, which can infect a wide array of hosts causing a variety of diseases. This review focuses on various such aspects of research on Salmonella which are useful for studying the pathogenesis of other intracellular pathogens. PMID:22722237

  17. Co-infection with Cyclospora cayetanensis and Salmonella typhi in a patient with HIV infection and chronic diarrhoea.

    PubMed

    Llanes, Rafael; Velázquez, Beltran; Reyes, Zoila; Somarriba, Lorenzo

    2013-01-01

    A 45-year-old-Haitian male patient with fever, abdominal cramping, chronic diarrhoea and weight loss of about 3 kg was investigated. Stool examination revealed Salmonella typhi and Cyclospora cayetanensis. The HIV test was positive with a CD4 count of 130 cells/mm(3). We provided the first report of co-infection Cyclospora cayetanensis and Salmonella typhi in a HIV patient with chronic diarrhoea. The patient was treated with oral ciprofloxacin, 500 mg, twice daily for two weeks, with a good clinical outcome.

  18. Crystallization and Preliminary X-ray Diffraction Analysis of Salmonella typhi PilS

    SciTech Connect

    Balakrishna,A.; Tan, Y.; Mok, H.; Saxena, A.; Swaminathan, K.

    2006-01-01

    The structure determination of PilS, a type IV pilin, by X-ray crystallography is reported. The recombinant protein from Salmonella typhi was overexpressed, purified and crystallized. The crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 77.88, b = 114.53, c = 31.75 {angstrom}. The selenomethionine derivative of the PilS protein was overexpressed, purified and crystallized in the same space group. Data sets have been collected to 2.1 {angstrom} resolution from the selenomethionine-derivative crystal using synchrotron radiation for multiwavelength anomalous dispersion (MAD) phasing.

  19. Evaluation of the immunogenicity and biological activity of the Citrobacter freundii Vi-CRM197 conjugate as a vaccine for Salmonella enterica serovar Typhi.

    PubMed

    Rondini, Simona; Micoli, Francesca; Lanzilao, Luisa; Hale, Christine; Saul, Allan J; Martin, Laura B

    2011-03-01

    Typhoid fever remains a major health problem in developing countries. Young children are at high risk, and a vaccine effective for this age group is urgently needed. Purified capsular polysaccharide from Salmonella enterica serovar Typhi (Vi) is licensed as a vaccine, providing 50 to 70% protection in individuals older than 5 years. However, this vaccine is ineffective in infants. Vi conjugated to a carrier protein (i.e., an exoprotein A mutant from Pseudomonas aeruginosa [rEPA]) is highly immunogenic, provides long-term protection, and shows more than 90% protective efficacy in children 2 to 5 years old. Here, we describe an alternative glycoconjugate vaccine for S. Typhi, Vi-CRM(197), where Vi was obtained from Citrobacter freundii WR7011 and CRM(197), the mutant diphtheria toxin protein, was used as the carrier. We investigated the optimization of growth conditions for Vi production from C. freundii WR7011 and the immunogenicity of Vi-CRM(197) conjugates in mice. The optimal saccharide/protein ratio of the glycoconjugates was identified for the best antibody production. We also demonstrated the ability of this new vaccine to protect mice against challenge with Vi-positive Salmonella enterica serovar Typhimurium.

  20. [Plasmodium falciparum and Salmonella Typhi co-infection: a case report].

    PubMed

    Sümer, Sua; Ural, Gaye; Ural, Onur

    2014-01-01

    Malaria and salmonella infections are endemic especially in developing countries, however malaria and salmonella co-infection is a rare entity with high mortality. The basic mechanism in developing salmonella co-infection is the impaired mobilization of granulocytes through heme and heme oxygenase which are released from haemoglobin due to the breakdown of erythrocytes during malaria infection. Thus, a malaria infected person becomes more susceptible to develop infection with Salmonella spp. In this report a case with Plasmodium falciparum and Salmonella Typhi co-infection was presented. A 23-year-old male patient was admitted to hospital with the complaints of diarrhea, nausea, vomiting, abdominal pain, fatigue and fever. Laboratory findings yielded decreased number of platelets and increased ALT, AST and CRP levels. Since he had a history of working in Pakistan, malaria infection was considered in differential diagnosis, and the diagnosis was confirmed by the detection of P.falciparum trophozoites in the thick and thin blood smears. As he came from a region with chloroquine-resistant Plasmodium, quinine (3 x 650 mg) and doxycycline (2 x 100 mg/day) were started for the treatment. No erythrocytes, parasite eggs or fungal elements were seen at the stool microscopy of the patient who had diarrhoea during admission. No pathogenic microorganism growth was detected in his stool culture. The patient's blood cultures were also taken in febrile periods starting from the time of his hospitalization. A bacterial growth was observed in his blood cultures, and the isolate was identified as S. Typhi. Thus, the patient was diagnosed with P.falciparum and Salmonella Typhi coinfection. Ceftriaxone (1 x 2 g/day, 14 days) was added to the therapy according to the results of antibiotic susceptibility test. With the combined therapy (quinine, doxycycline, ceftriaxone) the fever was taken under control, his general condition improved and laboratory findings turned to normal values

  1. Importance of Salmonella Typhi-Responsive CD8+ T Cell Immunity in a Human Typhoid Fever Challenge Model.

    PubMed

    Fresnay, Stephanie; McArthur, Monica A; Magder, Laurence S; Darton, Thomas C; Jones, Claire; Waddington, Claire S; Blohmke, Christoph J; Angus, Brian; Levine, Myron M; Pollard, Andrew J; Sztein, Marcelo B

    2017-01-01

    Typhoid fever, caused by the human-restricted organism Salmonella enterica serovar Typhi (S. Typhi), constitutes a major global health problem. The development of improved attenuated vaccines is pressing, but delayed by the lack of appropriate preclinical models. Herein, we report that high levels of S. Typhi-responsive CD8+ T cells at baseline significantly correlate with an increased risk of disease in humans challenged with a high dose (~10(4) CFU) wild-type S. Typhi. Typhoid fever development was associated with higher multifunctional S. Typhi-responsive CD8+ T effector memory cells at baseline. Early decreases of these cells in circulation following challenge were observed in both S. Typhi-responsive integrin α4β7- and integrin α4β7+ CD8+ T effector memory (TEM) cells, suggesting their potential to home to both mucosal and extra-intestinal sites. Participants with higher baseline levels of S. Typhi-responsive CD8+ T memory cells had a higher risk of acquiring disease, but among those who acquired disease, those with a higher baseline responses took longer to develop disease. In contrast, protection against disease was associated with low or absent S. Typhi-responsive T cells at baseline and no changes in circulation following challenge. These data highlight the importance of pre-existing S. Typhi-responsive immunity in predicting clinical outcome following infection with wild-type S. Typhi and provide novel insights into the complex mechanisms involved in protective immunity to natural infection in a stringent human model with a high challenge dose. They also contribute important information on the immunological responses to be assessed in the appraisal and selection of new generation typhoid vaccines.

  2. Importance of Salmonella Typhi-Responsive CD8+ T Cell Immunity in a Human Typhoid Fever Challenge Model

    PubMed Central

    Fresnay, Stephanie; McArthur, Monica A.; Magder, Laurence S.; Darton, Thomas C.; Jones, Claire; Waddington, Claire S.; Blohmke, Christoph J.; Angus, Brian; Levine, Myron M.; Pollard, Andrew J.; Sztein, Marcelo B.

    2017-01-01

    Typhoid fever, caused by the human-restricted organism Salmonella enterica serovar Typhi (S. Typhi), constitutes a major global health problem. The development of improved attenuated vaccines is pressing, but delayed by the lack of appropriate preclinical models. Herein, we report that high levels of S. Typhi-responsive CD8+ T cells at baseline significantly correlate with an increased risk of disease in humans challenged with a high dose (~104 CFU) wild-type S. Typhi. Typhoid fever development was associated with higher multifunctional S. Typhi-responsive CD8+ T effector memory cells at baseline. Early decreases of these cells in circulation following challenge were observed in both S. Typhi-responsive integrin α4β7− and integrin α4β7+ CD8+ T effector memory (TEM) cells, suggesting their potential to home to both mucosal and extra-intestinal sites. Participants with higher baseline levels of S. Typhi-responsive CD8+ T memory cells had a higher risk of acquiring disease, but among those who acquired disease, those with a higher baseline responses took longer to develop disease. In contrast, protection against disease was associated with low or absent S. Typhi-responsive T cells at baseline and no changes in circulation following challenge. These data highlight the importance of pre-existing S. Typhi-responsive immunity in predicting clinical outcome following infection with wild-type S. Typhi and provide novel insights into the complex mechanisms involved in protective immunity to natural infection in a stringent human model with a high challenge dose. They also contribute important information on the immunological responses to be assessed in the appraisal and selection of new generation typhoid vaccines. PMID:28303138

  3. Non-crosslinking gold nanoprobe-LAMP for simple, colorimetric, and specific detection of Salmonella typhi

    NASA Astrophysics Data System (ADS)

    Bozorgmehr, Ali; Yazdanparast, Razieh; Mollasalehi, Hamidreza

    2016-12-01

    In this study, we developed a non-crosslinking gold nanoprobe loop-mediated isothermal amplification (LAMP) method for nanodiagnosis of bacterial typhoid fever source, Salmonella typhi. Therefore, a unique region in the S. typhi genomic DNA was targeted for LAMP amplification using a specific set of four precisely designed primers. Also, for specific colorimetric visualization of the amplicons, a thiolated oligonucleotide probe, complementary to the single-stranded loop region of the amplicons between F2 and F1C segments, was designed. The probe was bound to the surface of gold nanoparticles via covalent bonds. Increasing the salt concentration in the detection reaction medium led to aggregation of nanoprobes in the blank and the negative vessels in a time-dependent form. That was followed by a change in the surface plasmon resonance (SPR) leading to blue/black color that was observable by the naked eyes after about 5 min. Meanwhile, the original pink/red color was retained in the positive sample due to the large interparticle spaces and the stability against the ionic strength elevation which persisted for about 30 min. The whole process of DNA extraction, amplification, and detection took less than 2 h with a sensitivity of 20 CFU/ml. The developed gold nanoprobe-LAMP could serve as a simple, rapid, and cost-effective method for nanodiagnosis of S. typhi in point-of-need applications.

  4. Diagnosis of typhoid fever: detection of Salmonella typhi porins-specific antibodies by inhibition ELISA.

    PubMed Central

    Nandakumar, K S; Palanivel, V; Muthukkaruppan, V

    1993-01-01

    Porins are highly immunogenic outer membrane proteins of Salmonella. Sera from typhoid patients contained a high level of IgG antibodies directed to porins of Salm. typhi. Since porins are highly conserved proteins, anti-porins antibodies both from typhoid patients and healthy normals reacted with porins from several Gram-negative bacteria. Therefore, in order to improve the specificity of detecting Salm. typhi porins-specific antibodies, an inhibition ELISA was developed using enzyme-conjugated MoAbs (MP1 and MPN4) specific to Salm. typhi porins. Sera from typhoid patients with positive haemoculture (16 out of 17) inhibited the binding of MP1 to porins, thus showing a positive test for typhoid, whereas sera from patients with other Gram-negative bacterial infections (n = 7) and from healthy volunteers (66 out of 67) were found to be negative. The sensitivity, specificity, accuracy, positive predictive value and negative predictive value of this assay were 94.1, 98.7, 97.8, 94.1 and 98.7% respectively. The validity of our inhibition ELISA for typhoid was higher than that of the Widal test. The diagnosis of typhoid fever as early as 3 days after the onset of fever, using a single specimen is possible. PMID:8222322

  5. Metal nanoparticle assisted polymerase chain reaction for strain typing of Salmonella Typhi.

    PubMed

    Rehman, Asma; Sarwar, Yasra; Raza, Zulfiqar Ali; Hussain, Syed Zajif; Mustafa, Tanveer; Khan, Waheed S; Ghauri, Muhammad Afzal; Haque, Abdul; Hussain, Irshad

    2015-11-07

    Salmonella enterica serotype Typhi (S. Typhi) is the causative agent of typhoid fever and remains a major health threat in most of the developing countries. The prompt diagnosis of typhoid directly from the patient's blood requires high level of sensitivity and specificity. Some of us were the first to report PCR based diagnosis of typhoid. This approach has since then been reported by many scientists using different genomic targets. Since the number of bacteria circulating in the blood of a patient can be as low as 0.3 cfu ml(-1), there is always a room for improvement in diagnostic PCR. In the present study, the role of different types of nanoparticles was investigated to improve the existing PCR based methods for diagnosis and strain typing of S. Typhi (targeting Variable Number of Tandem Repeats [VNTR]) by using optimized PCR systems. Three different types of nanoparticles were used i.e., citrate stabilized gold nanoparticles, rhamnolipid stabilized gold and silver nanoparticles, and magnetic iron oxide nanoparticles. The non-specific amplification was significantly reduced in VNTR typing when gold and silver nanoparticles were used in an appropriate concentration. More importantly, the addition of nanoparticles decreased the non-specificity to a significant level in the case of multiplex PCR thus further validating the reliability of PCR for the diagnosis of typhoid.

  6. A novel ciprofloxacin-resistant subclade of H58 Salmonella Typhi is associated with fluoroquinolone treatment failure.

    PubMed

    Pham Thanh, Duy; Karkey, Abhilasha; Dongol, Sabina; Ho Thi, Nhan; Thompson, Corinne N; Rabaa, Maia A; Arjyal, Amit; Holt, Kathryn E; Wong, Vanessa; Tran Vu Thieu, Nga; Voong Vinh, Phat; Ha Thanh, Tuyen; Pradhan, Ashish; Shrestha, Saroj Kumar; Gajurel, Damoder; Pickard, Derek; Parry, Christopher M; Dougan, Gordon; Wolbers, Marcel; Dolecek, Christiane; Thwaites, Guy E; Basnyat, Buddha; Baker, Stephen

    2016-03-11

    The interplay between bacterial antimicrobial susceptibility, phylogenetics and patient outcome is poorly understood. During a typhoid clinical treatment trial in Nepal, we observed several treatment failures and isolated highly fluoroquinolone-resistant Salmonella Typhi (S. Typhi). Seventy-eight S. Typhi isolates were genome sequenced and clinical observations, treatment failures and fever clearance times (FCTs) were stratified by lineage. Most fluoroquinolone-resistant S. Typhi belonged to a specific H58 subclade. Treatment failure with S. Typhi-H58 was significantly less frequent with ceftriaxone (3/31; 9.7%) than gatifloxacin (15/34; 44.1%)(Hazard Ratio 0.19, p=0.002). Further, for gatifloxacin-treated patients, those infected with fluoroquinolone-resistant organisms had significantly higher median FCTs (8.2 days) than those infected with susceptible (2.96) or intermediately resistant organisms (4.01)(pS. Typhi clade internationally, but there are no data regarding disease outcome with this organism. We report an emergent new subclade of S. Typhi-H58 that is associated with fluoroquinolone treatment failure.

  7. RpoE is a Putative Antibiotic Resistance Regulator of Salmonella enteric Serovar Typhi.

    PubMed

    Xie, Xiaofang; Zhang, Haifang; Zheng, Yi; Li, Aiqing; Wang, Min; Zhou, Huiqin; Zhu, Xueming; Schneider, Zachary; Chen, Liang; Kreiswirth, Barry N; Du, Hong

    2016-04-01

    Bacterial antimicrobial resistance has been associated with the up regulation of genes encoding efflux pumps and the down regulation of genes encoding outer membrane proteins (OMPs). Gene expression in bacteria is primarily initiated by sigma factors (σ factors) such as RpoE, which plays an important role in responding to many environmental stresses. Here, we report the first observation that RpoE serves as an antibiotic resistance regulator in Salmonella enteric serovar Typhi (S. Typhi). In this study, we found that the rpoE mutant (ΔrpoE) of S. Typhi GIFU10007 has elevated resistance to several antimicrobial agents, including β-lactams, quinolones, and aminoglycosides. Genomic DNA microarray analysis was used to investigate the differential gene expression profiles between a wild type and rpoE mutant in response to ampicillin. The results showed that a total of 57 genes displayed differential expression (two-fold increase or decrease) in ΔrpoE versus the wild-type strain. The expressions of two outer membrane protein genes, ompF and ompC, were significantly down-regulated in ΔrpoE (six and seven-fold lower in comparison to wild-type strain) and RamA, a member of the efflux pump AraC/XylS family, was up-regulated about four-fold in the ΔrpoE. Our results suggest RpoE is a potential antimicrobial regulator in S. Typhi, controlling both the down regulation of the OMP genes and up-regulating the efflux system.

  8. QseB mediates biofilm formation and invasion in Salmonella enterica serovar Typhi.

    PubMed

    Ji, Ying; Li, Wenliang; Zhang, Ying; Chen, Long; Zhang, Yiquan; Zheng, Xueming; Huang, Xinxiang; Ni, Bin

    2017-03-01

    QseB is a response regulator of the QseBC two-component system (TCS) which is associated with quorum sensing and functions as a global regulator of flagella, biofilm formation, and virulence. The function of QseB and its interaction with QseC has been the subject of study in some organisms, however, little work was done in Salmonella enterica serovar Typhi (S. Typhi). The objective of this study was to investigate the effect of QseB on biofilm formation and virulence in S. Typhi. It showed that the biofilm formation ability of qseC mutant was limited as compared to the wild type strain. We also show overexpression of qseB was in a qseC mutant. Interestingly, deletion of qseB in a qseC mutant restored a wild type phenotype. These results suggested that QseB may account for the impaired biofilm formation in the absence of QseC. Furthermore, deletion of qseB in wild type cells decreased biofilm formation, whereas overexpression of qseB in wild type cells increased biofilm formation. Quantitative real-time PCR also revealed the up-regulation of some fimbria-associated genes in a qseB overexpression strain. These results indicate that QseB may enhance biofilm formation in the presence of QseC. Taken together, we hypothesize that QseB has dual regulatory functions which are dependent upon its cognate sensor. Additionally, invasion of HeLa cells was enhanced in qseB mutant but attenuated in a qseC mutant compared with wild-type. The β-galactosidase activity of invF::lacZ was increased in qseB mutant but decreased in qseC mutant which was consistent with invasion results. In conclusion, QseB may have dual regulatory functions concerning biofilm formation and plays a negative role in virulence of S. Typhi.

  9. Structure Based In Silico Analysis of Quinolone Resistance in Clinical Isolates of Salmonella Typhi from India

    PubMed Central

    Sharma, Priyanka; Sharma, Sujata; Singh, Tej P.; Kapil, Arti; Kaur, Punit

    2015-01-01

    Enteric fever is a major cause of morbidity in several parts of the Indian subcontinent. The treatment for typhoid fever majorly includes the fluoroquinolone group of antibiotics. Excessive and indiscriminate use of these antibiotics has led to development of acquired resistance in the causative organism Salmonella Typhi. The resistance towards fluoroquinolones is associated with mutations in the target gene of DNA Gyrase. We have estimated the Minimum Inhibitory Concentration (MIC) of commonly used fluoroquinolone representatives from three generations, ciprofloxacin, ofloxacin, levofloxacin and moxifloxacin, for 100 clinical isolates of Salmonella Typhi from patients in the Indian subcontinent. The MICs have been found to be in the range of 0.032 to 8 μg/ml. The gene encoding DNA Gyrase was subsequently sequenced and point mutations were observed in DNA Gyrase in the quinolone resistance determining region comprising Ser83Phe/Tyr and Asp87Tyr/Gly. The binding ability of these four fluoroquinolones in the quinolone binding pocket of wild type as well as mutant DNA Gyrase was computationally analyzed by molecular docking to assess their differential binding behaviour. This study has revealed that mutations in DNA Gyrase alter the characteristics of the binding pocket resulting in the loss of crucial molecular interactions and consequently decrease the binding affinity of fluoroquinolones with the target protein. The present study assists in understanding the underlying molecular and structural mechanism for decreased fluoroquinolone susceptibility in clinical isolates as a consequence of mutations in DNA Gyrase. PMID:25962113

  10. Structure based in silico analysis of quinolone resistance in clinical isolates of Salmonella Typhi from India.

    PubMed

    Kumar, Manoj; Dahiya, Sushila; Sharma, Priyanka; Sharma, Sujata; Singh, Tej P; Kapil, Arti; Kaur, Punit

    2015-01-01

    Enteric fever is a major cause of morbidity in several parts of the Indian subcontinent. The treatment for typhoid fever majorly includes the fluoroquinolone group of antibiotics. Excessive and indiscriminate use of these antibiotics has led to development of acquired resistance in the causative organism Salmonella Typhi. The resistance towards fluoroquinolones is associated with mutations in the target gene of DNA Gyrase. We have estimated the Minimum Inhibitory Concentration (MIC) of commonly used fluoroquinolone representatives from three generations, ciprofloxacin, ofloxacin, levofloxacin and moxifloxacin, for 100 clinical isolates of Salmonella Typhi from patients in the Indian subcontinent. The MICs have been found to be in the range of 0.032 to 8 μg/ml. The gene encoding DNA Gyrase was subsequently sequenced and point mutations were observed in DNA Gyrase in the quinolone resistance determining region comprising Ser83Phe/Tyr and Asp87Tyr/Gly. The binding ability of these four fluoroquinolones in the quinolone binding pocket of wild type as well as mutant DNA Gyrase was computationally analyzed by molecular docking to assess their differential binding behaviour. This study has revealed that mutations in DNA Gyrase alter the characteristics of the binding pocket resulting in the loss of crucial molecular interactions and consequently decrease the binding affinity of fluoroquinolones with the target protein. The present study assists in understanding the underlying molecular and structural mechanism for decreased fluoroquinolone susceptibility in clinical isolates as a consequence of mutations in DNA Gyrase.

  11. [Salmonella typhi vaccination response study reveals defective antibody production selective IgA deficiency patient].

    PubMed

    Pleguezuelo, Daniel E; Gianelli, Carla

    2015-01-01

    Selective IgA deficiency (SIgAD) is the most prevalent immunodeficiency worldwide, progressing to common variable immunodeficiency only in few reported cases. We report the case of a Spanish female aged 22 and diagnosed of selective IgA deficiency, a long history of bronchitis, several episodes of pneumonia, bilateral bronchiectasis, normal IgG, IgM, IgG subclasses, and detectable pre-vaccination IgG antibodies against tetanus toxoid and Streptococcus pneumoniae. She was evaluated in our clinic in order to rule out common variable immunodeficiency. We observed good antibody response to tetanus toxoid, absence of circulating switched memory B cells, decreased response to pneumococcal polysaccharide antigens and a lack of response to Salmonella typhi vaccine. Most SIgAD patients presents with upper respiratory tract infections or mild diarrhea. Those with lower tract infections, pneumonia or untreatable diarrhea should follow B-cell subpopulations' study and antibody response to vaccines. Absence of response to Salmonella typhi vaccine allowed us to expose the defective antibody production.

  12. Immunological characterization of recombinant Salmonella enterica serovar Typhi FliC protein expressed in Escherichia coli

    PubMed Central

    2012-01-01

    Like any other enteric pathogen, Salmonella also encounters acidic stress in the stomach as well as within the host macrophage milieu. However, the pathogen is reported to combat this stress through acid tolerance response (ATR), expressing a number of genes and eventually the proteins. Recently, an acid induced outer membrane phenotype encoded by fliC gene in Salmonella enterica serovar Typhi has been identified. In the present study, fliC gene was cloned to study its biological implications. The recombinant FliC (rFliC) protein was observed to stimulate the production of antibodies. These antibodies could also recognize the FliC protein (antigen) in the clinical samples i.e. blood samples from typhoid patents as well as healthy blood samples spiked with serovar Typhi. Moreover, the rFliC also reacted with the sera from patients suffering with typhoid fever indicating its in-vivo immunogenicity. Ex-vivo study revealed that rFliC has the potential to stimulate the macrophages to generate higher levels of inflammatory mediators such as malondialdehyde (MDA) and nitrite. The inflammatory potential of FliC was also confirmed in-vivo, by the paw oedema test as well as by flicking response of the inflamed paw indicating hyperalgesia occurring during inflammatory response. The findings of the present study indicate that acid induced FliC might be one of the factors enhancing the virulence of serovar Typhi under the host acidic conditions and may prove to be helpful in designing the prophylactic measures. PMID:23067582

  13. Development of an acid-resistant Salmonella Typhi Ty21a attenuated vector for improved oral vaccine delivery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The licensed oral, live-attenuated bacterial vaccine for typhoid fever, Salmonella Typhi strain Ty21a, has also been utilized as a vaccine delivery platform for expression of diverse foreign antigens that stimulate protection against shigellosis, anthrax, plague, or human papilloma virus. However, T...

  14. Effect of ompR gene mutation in expression of ompC and ompF of Salmonella typhi.

    PubMed

    Malickbasha, Mahaboobbasha; Arunachalam, Ramaiah; Senthilkumar, Balakrishnan; Rajasekarapandian, Moses; Annadurai, Gurusamy

    2010-06-01

    In the present investigation, a total of 50 stool samples were collected from the food handlers to screen the typhoid asymptomatic carriers, positive result was yielded for 2 out of the 50 samples. Salmonella typhi was isolated and identified based on the cultural characteristics on BSA, Macconkey agar, XLD and phylogenetic analysis. The ompR region of these two strains was amplified, sequenced and a Neighbor-Joining algorithm tree of ompR was constructed. The isolates were designated as (Salmonella Strain) SS-3 and SS-5 respectively. The isolates were subjected to mutation using sodium chloride at various osmolarity concentrations in LB broth. Both the wild and mutant Salmonella typhi were used for the isolation of outer membrane protein. The outer membrane protein was isolated and compared with both the wild and mutated Salmonella typhi. The expression of outer membrane protein was showing the variation in the expression which were noticed by using SDS-PAGE. On the basis of the results, it was concluded that the ompR-envZ two component regulatory systems play an important role on the regulation of Vi polysaccharide synthesis in S. typhi, and that one of the environmental signals for this regulation may be osmolarity.

  15. Evaluation of regulated delayed attenuation strategies for Salmonella enterica serovar Typhi vaccine vectors in neonatal and infant mice.

    PubMed

    Shi, Huoying; Wang, Shifeng; Curtiss, Roy

    2013-06-01

    We developed regulated delayed attenuation strategies for Salmonella vaccine vectors. In this study, we evaluated the combination of these strategies in recombinant attenuated Salmonella enterica serovar Typhi and Salmonella enterica serovar Typhimurium vaccine vectors with similar genetic backgrounds in vitro and in vivo. Our goal is to develop a vaccine to prevent Streptococcus pneumoniae infection in newborns; thus, all strains delivered a pneumococcal antigen PspA and the impact of maternal antibodies was evaluated. The results showed that all strains with the regulated delayed attenuated phenotype (RDAP) displayed an invasive ability stronger than that of the S. Typhi vaccine strain, Ty21a, but weaker than that of their corresponding wild-type parental strains. The survival curves of different RDAP vaccine vectors in vitro and in vivo exhibited diverse regulated delayed attenuation kinetics, which was different from S. Typhi Ty21a and the wild-type parental strains. Under the influence of maternal antibody, the persistence of the S. Typhimurium RDAP strain displayed a regulated delayed attenuation trend in nasal lymphoid tissue (NALT), lung, and Peyer's patches, while the persistence of S. Typhi RDAP strains followed the curve only in NALT. The bacterial loads of S. Typhi RDAP strains were lower in NALT, lung, and Peyer's patches in mice born to immune mothers than in those born to naive mothers. In accordance with these results, RDAP vaccine strains induced high titers of IgG antibodies against PspA and against Salmonella lipopolysaccharides. Immunization of mothers with S. Typhi RDAP strains enhanced the level of vaginal mucosal IgA, gamma interferon (IFN-γ), and interleukin 4 (IL-4) and resulted in a higher level of protection against S. pneumoniae challenge.

  16. Variable Responses to Carbon Utilization between Planktonic and Biofilm Cells of a Human Carrier Strain of Salmonella enterica Serovar Typhi.

    PubMed

    Kalai Chelvam, Kalaivani; Yap, Kien Pong; Chai, Lay Ching; Thong, Kwai Lin

    2015-01-01

    Salmonella enterica serovar Typhi (S. Typhi) is a foodborne pathogen that causes typhoid fever and infects only humans. The ability of S. Typhi to survive outside the human host remains unclear, particularly in human carrier strains. In this study, we have investigated the catabolic activity of a human carrier S. Typhi strain in both planktonic and biofilm cells using the high-throughput Biolog Phenotype MicroArray, Minimum Biofilm Eradication Concentration (MBEC) biofilm inoculator (96-well peg lid) and whole genome sequence data. Additional strains of S. Typhi were tested to further validate the variation of catabolism in selected carbon substrates in the different bacterial growth phases. The analyzes of the carbon utilization data indicated that planktonic cells of the carrier strain, S. Typhi CR0044 could utilize a broader range of carbon substrates compared to biofilm cells. Pyruvic acid and succinic acid which are related to energy metabolism were actively catabolised in the planktonic stage compared to biofilm stage. On the other hand, glycerol, L-fucose, L-rhamnose (carbohydrates) and D-threonine (amino acid) were more actively catabolised by biofilm cells compared to planktonic cells. Notably, dextrin and pectin could induce strong biofilm formation in the human carrier strain of S. Typhi. However, pectin could not induce formation of biofilm in the other S. Typhi strains. Phenome data showed the utilization of certain carbon substrates which was supported by the presence of the catabolism-associated genes in S. Typhi CR0044. In conclusion, the findings showed the differential carbon utilization between planktonic and biofilm cells of a S. Typhi human carrier strain. The differences found in the carbon utilization profiles suggested that S. Typhi uses substrates mainly found in the human biliary mucus glycoprotein, gallbladder, liver and cortex of the kidney of the human host. The observed diversity in the carbon catabolism profiles among different S

  17. Salmonella enterica Serovar Typhi Lipopolysaccharide O-Antigen Modification Impact on Serum Resistance and Antibody Recognition

    PubMed Central

    Heiss, Christian; Black, Ian; Donohue, Nicholas; Brown, Naj; Davies, Mark R.; Azadi, Parastoo; Baker, Stephen; Kaye, Paul M.

    2017-01-01

    ABSTRACT Salmonella enterica serovar Typhi is a human-restricted Gram-negative bacterial pathogen responsible for causing an estimated 27 million cases of typhoid fever annually, leading to 217,000 deaths, and current vaccines do not offer full protection. The O-antigen side chain of the lipopolysaccharide is an immunodominant antigen, can define host-pathogen interactions, and is under consideration as a vaccine target for some Gram-negative species. The composition of the O-antigen can be modified by the activity of glycosyltransferase (gtr) operons acquired by horizontal gene transfer. Here we investigate the role of two gtr operons that we identified in the S. Typhi genome. Strains were engineered to express specific gtr operons. Full chemical analysis of the O-antigens of these strains identified gtr-dependent glucosylation and acetylation. The glucosylated form of the O-antigen mediated enhanced survival in human serum and decreased complement binding. A single nucleotide deviation from an epigenetic phase variation signature sequence rendered the expression of this glucosylating gtr operon uniform in the population. In contrast, the expression of the acetylating gtrC gene is controlled by epigenetic phase variation. Acetylation did not affect serum survival, but phase variation can be an immune evasion mechanism, and thus, this modification may contribute to persistence in a host. In murine immunization studies, both O-antigen modifications were generally immunodominant. Our results emphasize that natural O-antigen modifications should be taken into consideration when assessing responses to vaccines, especially O-antigen-based vaccines, and that the Salmonella gtr repertoire may confound the protective efficacy of broad-ranging Salmonella lipopolysaccharide conjugate vaccines. PMID:28167670

  18. Nalidixic Acid-Resistant Salmonella enterica Serotype Typhi Presenting as a Primary Psoas Abscess: Case Report and Review of the Literature

    PubMed Central

    Shakespeare, William A.; Davie, Daniel; Tonnerre, Claude; Rubin, Michael A.; Strong, Michael; Petti, Cathy A.

    2005-01-01

    We report an unusual case of Salmonella enterica serotype Typhi presenting as a primary psoas abscess. The isolate tested susceptible to ciprofloxacin but resistant to nalidixic acid in vitro, a pattern associated with fluoroquinolone therapeutic failures. We review the literature for serovar Typhi psoas abscess in the absence of bacteremia and discuss the importance of identifying isolates with reduced susceptibility to fluoroquinolones. PMID:15695728

  19. Characterization of Anti-Salmonella enterica Serotype Typhi Antibody Responses in Bacteremic Bangladeshi Patients by an Immuno-affinity Proteomic-based Technology (IPT)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella enterica serotype Typhi (S. Typhi) is the cause of typhoid fever and a human-restricted pathogen. Currently available typhoid vaccines provide only 50-75% protection for 2-5 years, and available diagnostic assays to identify individuals with typhoid fever lack both sensitivity and specif...

  20. Characterization of Anti-Salmonella enterica Serotype Typhi Antibody Responses in Bacteremic Bangladeshi Patients Using Immuno-affinity Proteomic-based Technology (IPT)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella enterica serotype Typhi (S. Typhi) is the cause of typhoid fever and a human-restricted pathogen. Currently available typhoid vaccines provide only 50-75% protection for 2-5 years, and available diagnostic assays to identify individuals with typhoid fever lack both sensitivity and specifi...

  1. The virulence polysaccharide Vi released by Salmonella Typhi targets membrane prohibitin to inhibit T-cell activation.

    PubMed

    Santhanam, Srikanth K; Dutta, Debjani; Parween, Farhat; Qadri, Ayub

    2014-07-01

    T cells are critical to immunity against pathogenic Salmonella including Salmonella Typhi which causes systemic infection, typhoid, in humans. The strategies that this pathogen employs to keep T-cell mediated immune responses in check during establishment of systemic infection are not completely understood. Here, we show that the virulence polysaccharide Vi, which distinguishes S. Typhi from localized gastroenteritis-producing nontyphoidal Salmonella serovars, is a potent inhibitor of T-cell activation. Vi released by S. Typhi interacts with the membrane prohibitin complex and inhibits IL-2 secretion from T cells stimulated through the T-cell receptor (TCR) but does not affect PMA-activated interleukin 2 (IL-2) secretion. Treatment with Vi suppresses early activation events including TCR down-regulation, actin polymerization, and phosphorylation of ERK. Coadministration of Vi with anti-CD3 Ab reduces secretion of IL-2 and interferon γ in mice. Our findings reveal a mechanism by which S. Typhi may target T-cell immunity during establishment of typhoid.

  2. Molecular subtyping of Salmonella enterica serovar Typhi isolates from Colombia and Argentina.

    PubMed

    Salve, Angela; Pichel, Mariana; Wiesner, Magdalena; Hidalgo, Marylin; Terragno, Raquel; Alvarez, Adriana; Agudelo, Clara Inés; Castañeda, Elizabeth; Binsztein, Norma

    2006-01-01

    Salmonella Typhi is the etiological agent of typhoid fever with 16 million annual cases estimated worldwide. In Colombia and Argentina it is a notifiable disease but many cases have only a clinical diagnosis. Molecular subtyping of S. Typhi is necessary to complement epidemiologic analysis of typhoid fever. The aims of this study were to determine the genetic relationships between the strains circulating in both countries and to evaluate possible variations in the distribution of 12 virulence genes. A total of 136 isolates were analyzed by pulsed-field gel electrophoresis (PFGE) with XbaI following PulseNet protocols and analysis guidelines. Eighty-three different PFGE patterns were identified, showing high diversity among the strains from both countries. Three outbreaks, two in Colombia and one in Argentina, were caused by strains of different PFGE types. In Colombia, two PFGE patterns were found predominantly, which included 36.6% of the isolates from that country. No association was found between the PFGE patterns and the year or place of isolation of the strains, the age of the patients or type of sample. However, several clusters were detected, which included isolates recovered predominantly either from Colombia or Argentina. Most of the strains (97%) exhibited a single virulence profile, suggesting that the pathogenicity markers analyzed are of limited value for strain discrimination and do not correlate with the origin of the isolates (intestinal vs. extra-intestinal). Since the creation of PulseNet Latin America, this was the first international study conducted in South America. The PFGE types identified were incorporated into the Regional S. Typhi PulseNet Database and are now available for comparison with those of strains isolated in other regions. This information will be used for active surveillance, future studies, and outbreak investigations.

  3. Optimization of Salmonella Typhi biofilm assay on polypropylene microtiter plates using response surface methodology.

    PubMed

    Ganjali Dashti, M; Abdeshahian, P; Sudesh, K; Phua, K K

    2016-01-01

    The objective of this study was to develop an optimized assay for Salmonella Typhi biofilm that mimics the environment of the gallbladder as an experimental model for chronic typhoid fever. Multi-factorial assays are difficult to optimize using traditional one-factor-at-a-time optimization methods. Response surface methodology (RSM) was used to optimize six key variables involved in S. Typhi biofilm formation on cholesterol-coated polypropylene 96-well microtiter plates. The results showed that bile (1.22%), glucose (2%), cholesterol (0.05%) and potassium chloride (0.25%) were critical factors affecting the amount of biofilm produced, but agitation (275 rpm) and sodium chloride (0.5%) had antagonistic effects on each other. Under these optimum conditions the maximum OD reading for biofilm formation was 3.4 (λ600 nm), and the coefficients of variation for intra-plate and inter-plate assays were 3% (n = 20) and 5% (n = 8), respectively. These results showed that RSM is an effective approach for biofilm assay optimization.

  4. Antibiotic binding of STY3178, a yfdX protein from Salmonella Typhi

    PubMed Central

    Saha, Paramita; Manna, Camelia; Das, Santasabuj; Ghosh, Mahua

    2016-01-01

    The yfdX family proteins are known for long time to occur in various virulent bacteria including their multidrug resistant (MDR) strains, without any direct assigned function for them. However, yfdX protein along with other proteins involved in acid tolerance response is reported to be up regulated by the multidrug response regulatory system in E. coli. Hence, molecular and functional characterization of this protein is important for understanding of key cellular processes in bacterial cells. Here we study STY3178, a yfdX protein from a MDR strain of typhoid fever causing Salmonella Typhi. Our experimental results indicate that STY3178 is a helical protein existing in a trimeric oligomerization state in solution. We also observe many small antibiotics, like ciprofloxacin, rifampin and ampicillin viably interact with this protein. The dissociation constants from the quenching of steady state fluorescence and isothermal titration calorimetry show that ciprofloxacin binding is stronger than rifampin followed by ampicillin. PMID:26892637

  5. Antibiotic binding of STY3178, a yfdX protein from Salmonella Typhi.

    PubMed

    Saha, Paramita; Manna, Camelia; Das, Santasabuj; Ghosh, Mahua

    2016-02-19

    The yfdX family proteins are known for long time to occur in various virulent bacteria including their multidrug resistant (MDR) strains, without any direct assigned function for them. However, yfdX protein along with other proteins involved in acid tolerance response is reported to be up regulated by the multidrug response regulatory system in E. coli. Hence, molecular and functional characterization of this protein is important for understanding of key cellular processes in bacterial cells. Here we study STY3178, a yfdX protein from a MDR strain of typhoid fever causing Salmonella Typhi. Our experimental results indicate that STY3178 is a helical protein existing in a trimeric oligomerization state in solution. We also observe many small antibiotics, like ciprofloxacin, rifampin and ampicillin viably interact with this protein. The dissociation constants from the quenching of steady state fluorescence and isothermal titration calorimetry show that ciprofloxacin binding is stronger than rifampin followed by ampicillin.

  6. A bivalent vaccine to protect against Streptococcus pneumoniae and Salmonella typhi.

    PubMed

    Lu, Ying-Jie; Zhang, Fan; Sayeed, Sabina; Thompson, Claudette M; Szu, Shousun; Anderson, Porter W; Malley, Richard

    2012-05-14

    Pneumococcal and Salmonella typhi infections are two major diseases for children in developing countries. For typhoid fever, licensed Vi polysaccharide vaccines are ineffective in children <2-year old. While investigational Vi conjugate vaccines have been shown effective in clinical trials, they are currently only available to restricted areas. Pneumococcal capsular polysaccharide conjugate vaccines are highly effective in children, but suffer from some limitations including cost and limited serotype coverage. We have previously shown that a fusion conjugate vaccine, consisting of pneumococcal fusion protein PsaA and pneumolysoid (PdT) conjugated to a polysaccharide, results in enhanced antibody and CD4+ Th17 cell responses as well as protection against pneumococcal colonization and disease in mice. Here we applied this approach to develop a bivalent vaccine against pneumococcus and S. typhi. Two species-conserved pneumococcal antigens (SP1572 or SP2070) were fused to the nonhemolytic pneumolysoid PdT. SP1572-PdT was then conjugated to Vi polysaccharide and SP2070-PdT was conjugated to the pneumococcal cell wall polysaccharide (CWPS; also conserved). Mice immunized with this bivalent conjugate were protected against pneumococcal colonization and sepsis challenges, and made anti-Vi antibody concentrations higher by 40-fold compared to mice that received equimolar mixtures of the antigens. An enhanced killing of Vi-bearing Salmonellae in vitro was demonstrated from plasma of mice that received the fusion conjugate but not the mixture of antigens. Our results support further evaluation of this bivalent immunogen for the prevention of pneumococcal colonization and disease, and of typhoid fever.

  7. Rapid and Sensitive Salmonella Typhi Detection in Blood and Fecal Samples Using Reverse Transcription Loop-Mediated Isothermal Amplification.

    PubMed

    Fan, Fenxia; Yan, Meiying; Du, Pengcheng; Chen, Chen; Kan, Biao

    2015-09-01

    Typhoid fever caused by Salmonella enterica serovar Typhi remains a significant public health problem in developing countries. Although the main method for diagnosing typhoid fever is blood culture, the test is time consuming and not always able to detect infections. Thus, it is very difficult to distinguish typhoid from other infections in patients with nonspecific symptoms. A simple and sensitive laboratory detection method remains necessary. The purpose of this study is to establish and evaluate a rapid and sensitive reverse transcription-based loop-mediated isothermal amplification (RT-LAMP) method to detect Salmonella Typhi infection. In this study, a new specific gene marker, STY1607, was selected to develop a STY1607-RT-LAMP assay; this is the first report of specific RT-LAMP detection assay for typhoid. Human-simulated and clinical blood/stool samples were used to evaluate the performance of STY1607-RT-LAMP for RNA detection; this method was compared with STY1607-LAMP, reverse transcription real-time polymerase chain reaction (rRT-PCR), and bacterial culture methods for Salmonella Typhi detection. Using mRNA as the template, STY1607-RT-LAMP exhibited 50-fold greater sensitivity than STY1607-LAMP for DNA detection. The STY1607-RT-LAMP detection limit is 3 colony-forming units (CFU)/mL for both the pure Salmonella Typhi samples and Salmonella Typhi-simulated blood samples and was 30 CFU/g for the simulated stool samples, all of which were 10-fold more sensitive than the rRT-PCR method. RT-LAMP exhibited improved Salmonella Typhi detection sensitivity compared to culture methods and to rRT-PCR of clinical blood and stool specimens from suspected typhoid fever patients. Because it can be performed without sophisticated equipment or skilled personnel, RT-LAMP is a valuable tool for clinical laboratories in developing countries. This method can be applied in the clinical diagnosis and care of typhoid fever patients as well as for a quick public health response.

  8. Epidemiology, clinical manifestations, and molecular typing of salmonella typhi isolated from patients with typhoid fever in Lebanon.

    PubMed

    Kanj, Souha S; Kanafani, Zeina A; Shehab, Marwa; Sidani, Nisreen; Baban, Tania; Baltajian, Kedak; Dakdouki, Ghenwa K; Zaatari, Mohamad; Araj, George F; Wakim, Rima Hanna; Dbaibo, Ghassan; Matar, Ghassan M

    2015-06-01

    The objective of this study was to examine the epidemiology and the clinical manifestations of typhoid fever as well as the susceptibility and strain relatedness of Salmonella typhi isolates in Lebanon from 2006 to 2007. A total of 120 patients with typhoid fever were initially identified from various areas of the country based on positive culture results for S. typhi from blood, urine, stools, bone marrow and/or positive serology. Clinical, microbiological and molecular analysis was performed on cases with complete data available. These results indicated that drinking water was an unlikely mode of transmission of the infection. Despite increasing reports of antimicrobial resistance among S. typhi isolates, the vast majority of these isolates were susceptible to various antibiotic agents, including ampicillin, cephalosporins, quinolones, and trimethoprim/sulfamethoxazole. Molecular analysis of the isolates revealed a predominance of one single genotype with no variation in distribution across the geographical regions.

  9. Antibacterial effect of mango (Mangifera indica Linn.) leaf extract against antibiotic sensitive and multi-drug resistant Salmonella typhi.

    PubMed

    Hannan, Abdul; Asghar, Samra; Naeem, Tahir; Ikram Ullah, Muhammad; Ahmed, Ijaz; Aneela, Syeda; Hussain, Shabbir

    2013-07-01

    Alternative herbal medicine has been used to treat various infections from centuries. Natural plants contain phytoconstituents having similar chemical properties as of synthetic antibiotics. Typhoid fever is a serious infection and failure of its treatment emerged multi-drug resistant (MDR) bugs of Salmonella typhi. Due to multiple and repeated issues with antibiotics efficacy, it became essential to evaluate biological properties of plants from different geographical origins. Mango leaves have been Reported for various medicinal effects like antioxidant, antimicrobial, antihelminthic, antidiabetic and antiallergic etc. Objective of present study was to investigate anti-typhoid properties of acetone mango leaf extract (AMLE) against antibiotic sensitive and MDR S. typhi isolates. A total of 50 isolates of S. typhi including MDR (n=30) and antibiotic sensitive (n=20) were investigated. Staphylococcus aureus (ATCC 25923) and Salmonella typhimurium (ATCC14028) were used as quality control strains. AMLE was prepared and its antibacterial activity was evaluated by agar well diffusion screening method and minimum inhibitory concentration (MIC), by agar dilution technique. Zone of inhibition (mm) of AMLE against MDR and antibiotic sensitive isolates was 18±1.5mm (Mean±S.D). Zone of S. aureus (ATCC 25923) and S. typhimurium (ATCC14028) was 20±1.5mm (Mean±S.D). MIC of AMLE was Reported in range from 10-50 mg/ml. The present study described the inhibitory effects of mango leaves against S. typhi.

  10. Whole Genome Sequence Analysis of Salmonella Typhi Isolated in Thailand before and after the Introduction of a National Immunization Program.

    PubMed

    Dyson, Zoe A; Thanh, Duy Pham; Bodhidatta, Ladaporn; Mason, Carl Jeffries; Srijan, Apichai; Rabaa, Maia A; Vinh, Phat Voong; Thanh, Tuyen Ha; Thwaites, Guy E; Baker, Stephen; Holt, Kathryn E

    2017-01-01

    Vaccines against Salmonella Typhi, the causative agent of typhoid fever, are commonly used by travellers, however, there are few examples of national immunization programs in endemic areas. There is therefore a paucity of data on the impact of typhoid immunization programs on localised populations of S. Typhi. Here we have used whole genome sequencing (WGS) to characterise 44 historical bacterial isolates collected before and after a national typhoid immunization program that was implemented in Thailand in 1977 in response to a large outbreak; the program was highly effective in reducing typhoid case numbers. Thai isolates were highly diverse, including 10 distinct phylogenetic lineages or genotypes. Novel prophage and plasmids were also detected, including examples that were previously only reported in Shigella sonnei and Escherichia coli. The majority of S. Typhi genotypes observed prior to the immunization program were not observed following it. Post-vaccine era isolates were more closely related to S. Typhi isolated from neighbouring countries than to earlier Thai isolates, providing no evidence for the local persistence of endemic S. Typhi following the national immunization program. Rather, later cases of typhoid appeared to be caused by the occasional importation of common genotypes from neighbouring Vietnam, Laos, and Cambodia. These data show the value of WGS in understanding the impacts of vaccination on pathogen populations and provide support for the proposal that large-scale typhoid immunization programs in endemic areas could result in lasting local disease elimination, although larger prospective studies are needed to test this directly.

  11. Evaluation and comparison of different blood culture techniques for bacteriological isolation of Salmonella typhi and Brucella abortus.

    PubMed Central

    Gaviria-Ruiz, M M; Cardona-Castro, N M

    1995-01-01

    An experimental study was carried out to evaluate and compare various noncommercial methods of blood culture for the isolation of Salmonella typhi and Brucella abortus from fresh human blood samples that had been artificially inoculated with 1 to 50 microorganisms per ml of blood. The methods compared included the Ruiz-Castañeda blood culture, broth blood culture, leukocyte lysis and direct plating on agar (WBL-P), leukocyte lysis and filtration, Ficoll-Hypaque centrifugation and filtration, Ficoll-Hypaque centrifugation, and Ficoll-Hypaque centrifugation and leukocyte lysis methods. Results with the WBL-P technique showed that S. typhi was isolated in 18 h, and its recovery rate was 36.6% (calculated from the number of CFU recovered per milliliter versus the number inoculated). B. abortus was isolated in 48 h by the same technique, and its recovery rate was 48.8%. The isolation times for the other blood culture techniques were between 36 and 44 h for S. typhi and 66 h for B. abortus. The techniques which relied on filtering systems for the recovery of S. typhi and B. abortus performed poorly. The WBL-P technique for the isolation of S. typhi and B. abortus is faster than the other methods tested. PMID:7790452

  12. Whole Genome Sequence Analysis of Salmonella Typhi Isolated in Thailand before and after the Introduction of a National Immunization Program

    PubMed Central

    Thanh, Duy Pham; Bodhidatta, Ladaporn; Mason, Carl Jeffries; Srijan, Apichai; Rabaa, Maia A.; Vinh, Phat Voong; Thanh, Tuyen Ha; Thwaites, Guy E.; Baker, Stephen; Holt, Kathryn E.

    2017-01-01

    Vaccines against Salmonella Typhi, the causative agent of typhoid fever, are commonly used by travellers, however, there are few examples of national immunization programs in endemic areas. There is therefore a paucity of data on the impact of typhoid immunization programs on localised populations of S. Typhi. Here we have used whole genome sequencing (WGS) to characterise 44 historical bacterial isolates collected before and after a national typhoid immunization program that was implemented in Thailand in 1977 in response to a large outbreak; the program was highly effective in reducing typhoid case numbers. Thai isolates were highly diverse, including 10 distinct phylogenetic lineages or genotypes. Novel prophage and plasmids were also detected, including examples that were previously only reported in Shigella sonnei and Escherichia coli. The majority of S. Typhi genotypes observed prior to the immunization program were not observed following it. Post-vaccine era isolates were more closely related to S. Typhi isolated from neighbouring countries than to earlier Thai isolates, providing no evidence for the local persistence of endemic S. Typhi following the national immunization program. Rather, later cases of typhoid appeared to be caused by the occasional importation of common genotypes from neighbouring Vietnam, Laos, and Cambodia. These data show the value of WGS in understanding the impacts of vaccination on pathogen populations and provide support for the proposal that large-scale typhoid immunization programs in endemic areas could result in lasting local disease elimination, although larger prospective studies are needed to test this directly. PMID:28060810

  13. Antimicrobial resistance in Salmonella enterica serovar typhi and paratyphi in South Asia-current status, issues and prospects.

    PubMed

    Akhtar, Saeed; Sarker, Mahfuzur R; Jabeen, Kausar; Sattar, Ahsan; Qamar, Aftab; Fasih, Naima

    2015-01-01

    The human race owes a debt of gratitude to antimicrobial agents, penicillin and its successors that have saved people from tremendous pain and suffering in the last several decades. Unfortunately, this consideration is no more true, as millions of people are prone to the challenging threat of emergence of antimicrobial resistance worldwide and the menace is more distressing in developing countries. Comparable with other bacterial species, Salmonella enterica serovar Typhi (S. typhi) and Paratyphi (S. paratyphi) have been evolving multidrug resistance (MDR) against a wide array of antibiotics, including chloramphenicol, ampicillin and co-trimoxazole, and globally affecting 21 million people with 220,000 deaths each year. S. typhi and S. paratyphi infections are also endemic in South Asia and a series of antibiotics used to treat these infections, have been losing efficacy against enteric fever. Currently, quinolones are regarded as a choice to treat MDR Salmonella in these regions. Travel-related cases of enteric fever, especially from South Asian countries are the harbinger of the magnitude of MDR Salmonella in that region. Conclusively, the MDR will continue to grow and the available antimicrobial agents would become obsolete. Therefore, a radical and aggressive approach in terms of rational use of antibiotics during treating infections is essentially needed.

  14. Activity of Kaempferia pandurata (Roxb.) rhizome ethanol extract against MRSA, MRCNS, MSSA, Bacillus subtilis and Salmonella typhi.

    PubMed

    Sukandar, Elin Yulinah; Sunderam, Nethiyakalyani; Fidrianny, Irda

    2014-01-01

    Temu kunci (Kaempferia pandurata (Roxb.)) has a number of benefits and one of these is antibacterial. The rhizome is said to have antibacterial activity against Streptococcus mutans, Lactocillus sp. and Candida albicans. The aim of the study is to test the antibacterial activity of Kaempferia pandurata (Roxb.) rhizome ethanol extract on methicillin-resistant Staphylococcus aureus (MRSA), methicillin-resistant coagulase negative Staphylococci (MRCNS), methicillin-sensitive Staphylococcus aureus (MSSA), Bacillus subtilis and Salmonella typhi. Antimicrobial activity of the extract was assayed by the microdilution method using Mueller Hinton Broth with sterilized 96 round-bottomed microwells to determine the Minimum Inhibitory Concentration (MIC) as well as to determine the time-kill activity. The MIC of the extract was 16 ppm for both Bacillus subtilis and MRSA; 8 ppm for both MSSA and Salmonella typhi and 4 ppm for MRCNS. Ethanol extract of Kaempferia pandurata (Roxb.) showed antibacterial activity against all the tested bacteria and was the most potent against MRCNS, with MIC 4 ppm. The killing profile test of the extract displayed bactericidal activity at 8-16 ppm against MRSA, MSSA, Bacillus subtilis and Salmonella typhi and bacteriostatic activity at 4 ppm towards MRCNS.

  15. Unique lipid anchor attaches Vi antigen capsule to the surface of Salmonella enterica serovar Typhi

    PubMed Central

    Liston, Sean D.; Ovchinnikova, Olga G.

    2016-01-01

    Polysaccharide capsules are surface structures that are critical for the virulence of many Gram-negative pathogenic bacteria. Salmonella enterica serovar Typhi is the etiological agent of typhoid fever. It produces a capsular polysaccharide known as “Vi antigen,” which is composed of nonstoichiometrically O-acetylated α-1,4-linked N-acetylgalactosaminuronic acid residues. This glycan is a component of currently available vaccines. The genetic locus for Vi antigen production is also present in soil bacteria belonging to the genus Achromobacter. Vi antigen assembly follows a widespread general strategy with a characteristic glycan export step involving an ATP-binding cassette transporter. However, Vi antigen producers lack the enzymes that build the conserved terminal glycolipid characterizing other capsules using this method. Achromobacter species possess a Vi antigen-specific depolymerase enzyme missing in S. enterica Typhi, and we exploited this enzyme to isolate acylated Vi antigen termini. Mass spectrometry analysis revealed a reducing terminal N-acetylhexosamine residue modified with two β-hydroxyl acyl chains. This terminal structure resembles one half of lipid A, the hydrophobic portion of bacterial lipopolysaccharides. The VexE protein encoded in the Vi antigen biosynthesis locus shares similarity with LpxL, an acyltransferase from lipid A biosynthesis. In the absence of VexE, Vi antigen is produced, but its physical properties are altered, its export is impaired, and a Vi capsule structure is not assembled on the cell surface. The structure of the lipidated terminus dictates a unique assembly mechanism and has potential implications in pathogenesis and vaccine production. PMID:27226298

  16. Unique lipid anchor attaches Vi antigen capsule to the surface of Salmonella enterica serovar Typhi.

    PubMed

    Liston, Sean D; Ovchinnikova, Olga G; Whitfield, Chris

    2016-06-14

    Polysaccharide capsules are surface structures that are critical for the virulence of many Gram-negative pathogenic bacteria. Salmonella enterica serovar Typhi is the etiological agent of typhoid fever. It produces a capsular polysaccharide known as "Vi antigen," which is composed of nonstoichiometrically O-acetylated α-1,4-linked N-acetylgalactosaminuronic acid residues. This glycan is a component of currently available vaccines. The genetic locus for Vi antigen production is also present in soil bacteria belonging to the genus Achromobacter Vi antigen assembly follows a widespread general strategy with a characteristic glycan export step involving an ATP-binding cassette transporter. However, Vi antigen producers lack the enzymes that build the conserved terminal glycolipid characterizing other capsules using this method. Achromobacter species possess a Vi antigen-specific depolymerase enzyme missing in S enterica Typhi, and we exploited this enzyme to isolate acylated Vi antigen termini. Mass spectrometry analysis revealed a reducing terminal N-acetylhexosamine residue modified with two β-hydroxyl acyl chains. This terminal structure resembles one half of lipid A, the hydrophobic portion of bacterial lipopolysaccharides. The VexE protein encoded in the Vi antigen biosynthesis locus shares similarity with LpxL, an acyltransferase from lipid A biosynthesis. In the absence of VexE, Vi antigen is produced, but its physical properties are altered, its export is impaired, and a Vi capsule structure is not assembled on the cell surface. The structure of the lipidated terminus dictates a unique assembly mechanism and has potential implications in pathogenesis and vaccine production.

  17. Extraction, Purification and Characterization of Lipopolysaccharide from Escherichia coli and Salmonella typhi.

    PubMed

    Rezania, Simin; Amirmozaffari, Noor; Tabarraei, Bahman; Jeddi-Tehrani, Mahmood; Zarei, Omid; Alizadeh, Reza; Masjedian, Faramarz; Zarnani, Amir Hassan

    2011-01-01

    Lipopolysaccharide (LPS) is an important structural component of the outer cell membrane complex of gram negative microorganisms. Its causative role in gram negative bacteria-induced diseases and broad applications in different kinds of cell stimulation experiments provided a conceptual basis for studies directed at the isolation, purification, and detailed chemical characterization of LPS. The main problem with LPS purification protocols is the contamination of the end product with nucleic acids and proteins in variable proportions which could potentially interfere with downstream applications. In this study, a simple procedure for purification of LPS from Escherichia coli (E.coli) and Salmonella typhi (S.typhi) with high purity and very low contaminating nucleic acids and proteins based on the hot phenol-water extraction protocol has been introduced. The purity of extracted LPS was evaluated by silver and coomassie blue staining of SDS-PAGE gels and HPLC analysis. Limulus Amebocyte Lysate (LAL) coagulation activity and rabbit pyrogen assay were exploited to monitor the functionality of purified LPS. The results showed that DNase and RNase treatment of the sample is essential after the sonication step to eliminate nucleic acid contamination in the LPS fraction. Silver staining demonstrated ladder pattern which is characteristic of LPS. No contaminating protein was found as assessed by coomassie blue staining. HPLC fractionation revealed high degree of purity comparable with commercial LPS. Parenteral administration of purified LPS resulted in substantial increase of rabbits' body temperature (mean: 1.45°C). LAL coagulation assay confirmed the functional activity of the purified LPS. In conclusion, the protocol presented here could be employed for isolation of LPS with high purity and functional activity.

  18. Occurrence of ß-lactamase genes among non-Typhi Salmonella enterica isolated from humans, food animals, and retail meats in the United States and Canada

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Non-Typhi Salmonella cause over 1.7 million cases of gastroenteritis in North America each year, and food-animal products are commonly implicated in human infections. For invasive infections, antimicrobial therapy is implicated. In North America, the antimicrobial susceptibility of Salmonella is m...

  19. Pseudogenization of sopA and sopE2 is functionally linked and contributes to virulence of Salmonella enterica serovar Typhi.

    PubMed

    Valenzuela, L M; Hidalgo, A A; Rodríguez, L; Urrutia, I M; Ortega, A P; Villagra, N A; Paredes-Sabja, D; Calderón, I L; Gil, F; Saavedra, C P; Mora, G C; Fuentes, J A

    2015-07-01

    The difference in host range between Salmonella enterica serovar Typhimurium (S. Typhimurium) and S. enterica serovar Typhi (S. Typhi) can be partially attributed to pseudogenes. Pseudogenes are genomic segments homologous to functional genes that do not encode functional products due to the presence of genetic defects. S. Typhi lacks several protein effectors implicated in invasion or other important processes necessary for full virulence of S. Typhimurium. SopA and SopE2, effectors that have been lost by pseudogenization in S. Typhi, correspond to an ubiquitin ligase involved in cytokine production by infected cells, and to a guanine exchange factor necessary for invasion of epithelial cells, respectively. We hypothesized that sopA and/or sopE pseudogenization contributed to the virulence of S. Typhi. In this work, we found that S. Typhi expressing S. Typhimurium sopE2 exhibited a decreased invasion in different epithelial cell lines compared with S. Typhi WT. S. Typhimurium sopA completely abolished the hypo-invasive phenotype observed in S. Typhi expressing S. Typhimurium sopE2, suggesting that functional SopA and SopE2 participate concertedly in the invasion process. Finally, the expression of S. Typhimurium sopA and/or sopE2 in S. Typhi, determined changes in the secretion of IL-8 and IL-18 in infected epithelial cells.

  20. Antimicrobial resistance, virulence profiles and molecular subtypes of Salmonella enterica serovars Typhi and Paratyphi A blood isolates from Kolkata, India during 2009-2013.

    PubMed

    Dutta, Shanta; Das, Surojit; Mitra, Utpala; Jain, Priyanka; Roy, Indranil; Ganguly, Shelley S; Ray, Ujjwayini; Dutta, Phalguni; Paul, Dilip Kumar

    2014-01-01

    Enteric fever, caused by Salmonella enterica, remains an unresolved public health problem in India and antimicrobial therapy is the main mode of treatment. The objective of this study was to characterize the Salmonella enterica isolates from Kolkata with respect to their antimicrobial resistance (AMR), virulence profiles and molecular subtypes. Salmonella enterica blood isolates were collected from clinically suspected enteric fever patients attending various hospitals in Kolkata, India from January 2009 to June 2013 and were tested for AMR profiles by standard protocols; for resistance gene transfer by conjugation; for resistance and virulence genes profiles by PCR; and for molecular subtypes by Pulsed Field Gel Electrophoresis (PFGE). A total of 77 Salmonella enterica serovar Typhi (S. Typhi) and 25 Salmonella enterica serovar Paratyphi A (S. Paratyphi A) from Kolkata were included in this study. Although multidrug resistance (resistance to chloramphenicol, ampicillin, co-trimoxazole) was decreasing in S. Typhi (18.2%) and absent in S. Paratyphi A, increased resistance to fluoroquinolone, the current drug of choice, caused growing concern for typhoid treatment. A single, non-conjugative non-IncHI1 plasmid of 180 kb was found in 71.4% multidrug resistant (MDR) S. Typhi; the remaining 28.6% isolates were without plasmid. Various AMR markers (blaTEM-1, catA, sul1, sul2, dfrA15, strA-strB) and class 1 integron with dfrA7 gene were detected in MDR S. Typhi by PCR and sequencing. Most of the study isolates were likely to be virulent due to the presence of virulence markers. Major diversity was not noticed among S. Typhi and S. Paratyphi A from Kolkata by PFGE. The observed association between AMR profiles and S. Typhi pulsotypes might be useful in controlling the spread of the organism by appropriate intervention. The study reiterated the importance of continuous monitoring of AMR and molecular subtypes of Salmonella isolates from endemic regions for better

  1. Inactivation and sub-lethal injury of salmonella typhi, salmonella typhimurium and vibrio cholerae in copper water storage vessels

    PubMed Central

    2011-01-01

    Background This study provides information on the antibacterial effect of copper against the water-borne pathogens Salmonella Typhi, Salmonella Typhimurium and Vibrio cholerae. Methods Suspensions of each pathogen were kept in water within a traditional copper vessel at 30°C for 24 h. Samples were withdrawn, diluted and plated onto suitable growth media. Conventional enumeration of healthy (uninjured) bacteria was carried out using standard aerobic incubation conditions. Additionally, reactive oxygen species-neutralised (ROS-n) conditions were achieved by adding the peroxide scavenger sodium pyruvate to the medium with anaerobic incubation, to enumerate uninjured (ROS-insensitive) and injured (ROS-sensitive) bacteria. Differences between log-transformed means of conventional (aerobic) and ROS-n counts were statistically evaluated using t tests. Results Overall, all three pathogens were inactivated by storage in copper vessels for 24 h. However, for shorter-term incubation (4-12 h), higher counts were observed under ROS-n conditions than under aerobic conditions, which demonstrate the presence of substantial numbers of sub-lethally injured cells prior to their complete inactivation. Conclusions The present study has for the first time confirmed that these bacterial pathogens are inactivated by storage in a copper vessel within 24 h. However, it has also demonstrated that it is necessary to account for short-term sub-lethal injury, manifest as ROS-sensitivity, in order to more fully understand the process. This has important practical implications in terms of the time required to store water within a copper vessel to completely inactivate these bacteria and thereby remove the risk of water-borne disease transmission by this route. PMID:21794163

  2. blaCTX-M-I group extended spectrum beta lactamase-producing Salmonella typhi from hospitalized patients in Lagos, Nigeria

    PubMed Central

    Akinyemi, Kabiru O; Iwalokun, Bamidele A; Alafe, Olajide O; Mudashiru, Sulaiman A; Fakorede, Christopher

    2015-01-01

    Purpose The global spread of blaCTX-M-I extended-spectrum beta-lactamase (ESBL)-producing Salmonella spp. remains a major threat to treatment and control. Evidence of emergence and spread of this marker are lacking in Nigeria. This study investigated blaCTX-M-I ESBL production among Salmonella isolates from hospitalized patients. Methods Patients (158 total) made up of two groups were evaluated. Group A was composed of 135 patients with persistent pyrexia and group B was composed of 23 gastroenteritis patients and their stool samples. Samples were cultured, and isolates were identified and were subjected to antibiotic susceptibility testing by standard methods. Isolates were further screened for ESBL production, blaCTX-M-I genes and transferability by double disk synergy test, plasmid extraction, polymerase chain reaction, and conjugation experiment. Results Thirty-five (25.9%) Salmonella isolates were identified from group A, of which 74.3% were S. typhi, 22.9% were S. paratyphi and two (5.7%) were invasive non-typhoidal S. enteritidis. Nine Plasmodium falciparum infections were recorded, four of which were identified as co-infections with typhoidal Salmonella. Only two (8.7%) S. enteritidis samples were obtained from group B (P>0.05). A total of 24 isolates were ESBL-positive, eliciting resistance to five to seven antibiotics, and were multiple-drug resistant. ESBL production due to the blaCTX-M-I gene cluster was detected in eleven (45.8%) Salmonella isolates. Nine (81.8%) of the eleven blaCTX-M-I ESBL producers were S. typhi and two (18.2%) isolates were S. enteritidis. Four of nine S. typhi blaCTX-M-I ESBL-producing strains harbored 23 kb self-transmissible plasmid that was co-transferred with cefotaxime and augmentin resistance to Escherichia coli j53-2 transconjugants. Conclusion This study revealed the emergence of blaCTX-M-I S. typhi as an agent of persistent pyrexia with potential to spread to other Enterobacteriaceae in Lagos, Nigeria. Cautionary

  3. Loss of Very-Long O-Antigen Chains Optimizes Capsule-Mediated Immune Evasion by Salmonella enterica Serovar Typhi

    PubMed Central

    Crawford, Robert W.; Wangdi, Tamding; Spees, Alanna M.; Xavier, Mariana N.; Tsolis, Renée M.; Bäumler, Andreas J.

    2013-01-01

    ABSTRACT Expression of capsular polysaccharides is a variable trait often associated with more-virulent forms of a bacterial species. For example, typhoid fever is caused by the capsulated Salmonella enterica serovar Typhi, while nontyphoidal Salmonella serovars associated with gastroenteritis are noncapsulated. Here we show that optimization of the immune evasive properties conferred by the virulence-associated (Vi) capsular polysaccharide involved an additional alteration to the cell envelope of S. Typhi, namely inactivation of the fepE gene, encoding the regulator of very-long O-antigen chains. Introduction of the capsule-encoding viaB locus into the nontyphoidal S. enterica serovar Typhimurium reduced complement deposition in vitro and intestinal inflammation in a mouse colitis model. However, both phenotypes were markedly enhanced when the viaB locus was introduced into an S. Typhimurium fepE mutant, which lacks very-long O-antigen chains. Collectively, these data suggest that during the evolution of the S. Typhi lineage, loss of very-long O-antigen chains by pseudogene formation was an adaptation to maximize the anti-inflammatory properties of the Vi capsular polysaccharide. PMID:23860765

  4. Room Temperature Stabilization of Oral, Live Attenuated Salmonella enterica serovar Typhi-Vectored Vaccines

    PubMed Central

    Ohtake, Satoshi; Martin, Russell; Saxena, Atul; Pham, Binh; Chiueh, Gary; Osorio, Manuel; Kopecko, Dennis; Xu, DeQi; Lechuga-Ballesteros, David; Truong-Le, Vu

    2011-01-01

    Foam drying, a modified freeze drying process, was utilized to produce a heat-stable, live attenuated Salmonella Typhi ‘Ty21a’ bacterial vaccine. Ty21a vaccine was formulated with pharmaceutically approved stabilizers, including sugars, plasticizers, amino acids, and proteins. Growth media and harvesting conditions of the bacteria were also studied to enhance resistance to desiccation stress encountered during processing as well as subsequent storage at elevated temperatures. The optimized Ty21a vaccine, formulated with trehalose, methionine, and gelatin, demonstrated stability for approximately 12 weeks at 37°C (i.e., time required for the vaccine to decrease in potency by 1log10 CFU) and no loss in titer at 4 and 25°C following storage for the same duration. Furthermore, the foam dried Ty21a elicited a similar immunogenic response in mice as well as protection in challenge studies compared to Vivotif™, the commercial Ty21a vaccine. The enhanced heat stability of the Ty21a oral vaccine, or Ty21a derivatives expressing foreign antigens (e.g. anthrax), could mitigate risks of vaccine potency loss during long term storage, shipping, delivery to geographical areas with warmer climates or during emergency distribution following a bioterrorist attack. Because the foam drying process is conducted using conventional freeze dryers and can be readily implemented at any freeze drying manufacturing facility, this technology appears ready and appropriate for large scale processing of foam dried vaccines. PMID:21300096

  5. Physico-chemical properties of Salmonella typhi Vi polysaccharide-diphtheria toxoid conjugate vaccines affect immunogenicity.

    PubMed

    An, So Jung; Yoon, Yeon Kyung; Kothari, Sudeep; Kothari, Neha; Kim, Jeong Ah; Lee, Eugene; Kim, Deok Ryun; Park, Tai Hyun; Smith, Greg W; Carbis, Rodney

    2011-10-13

    In this study it was demonstrated that the immunogenicity of Vi polysaccharide-diphtheria toxoid conjugates was related to the physical and chemical structure of the conjugate. Conjugates were prepared in two steps, firstly binding adipic acid dihydrazide (ADH) spacer molecules to diphtheria toxoid (DT) carrier protein then secondly binding varying amounts of this derivatized DT to a fixed amount of Vi capsular polysaccharide purified from Salmonella enterica Serovar Typhi. As the amount of DT bound to the Vi increased the size of the conjugate increased but also the degree of cross-linking increased. The immunogenicity of the conjugates was tested in mice and measured by ELISA for anti Vi and anti DT IgG responses, and the results revealed a trend that as the amount of DT bound to the Vi increased the anti Vi responses increased. This study establishes a correlation between physico-chemical characteristics of the conjugate and the magnitude of the anti Vi and anti DT responses.

  6. An electrochemical genosensor for Salmonella typhi on gold nanoparticles-mercaptosilane modified screen printed electrode.

    PubMed

    Das, Ritu; Sharma, Mukesh K; Rao, Vepa K; Bhattacharya, B K; Garg, Iti; Venkatesh, V; Upadhyay, Sanjay

    2014-10-20

    In this work, we fabricated a system of integrated self-assembled layer of organosilane 3-mercaptopropyltrimethoxy silane (MPTS) on the screen printed electrode (SPE) and electrochemically deposited gold nanoparticle for Salmonella typhi detection employing Vi gene as a molecular marker. Thiolated DNA probe was immobilized on a gold nanoparticle (AuNP) modified SPE for DNA hybridization assay using methylene blue as redox (electroactive) hybridization indicator, and signal was monitored by differential pulse voltammetry (DPV) method. The modified SPE was characterized by cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and atomic force microscopy (AFM) method. The DNA biosensor showed excellent performances with high sensitivity and good selectivity. The current response was linear with the target sequence concentrations ranging from 1.0 × 10(-11) to 0.5 × 10(-8)M and the detection limit was found to be 50 (± 2.1)pM. The DNA biosensor showed good discrimination ability to the one-base, two-base and three-base mismatched sequences. The fabricated genosensor could also be regenerated easily and reused for three to four times for further hybridization studies.

  7. A comparison of dense transposon insertion libraries in the Salmonella serovars Typhi and Typhimurium

    PubMed Central

    Barquist, Lars; Langridge, Gemma C.; Turner, Daniel J.; Phan, Minh-Duy; Turner, A. Keith; Bateman, Alex; Parkhill, Julian; Wain, John; Gardner, Paul P.

    2013-01-01

    Salmonella Typhi and Typhimurium diverged only ∼50 000 years ago, yet have very different host ranges and pathogenicity. Despite the availability of multiple whole-genome sequences, the genetic differences that have driven these changes in phenotype are only beginning to be understood. In this study, we use transposon-directed insertion-site sequencing to probe differences in gene requirements for competitive growth in rich media between these two closely related serovars. We identify a conserved core of 281 genes that are required for growth in both serovars, 228 of which are essential in Escherichia coli. We are able to identify active prophage elements through the requirement for their repressors. We also find distinct differences in requirements for genes involved in cell surface structure biogenesis and iron utilization. Finally, we demonstrate that transposon-directed insertion-site sequencing is not only applicable to the protein-coding content of the cell but also has sufficient resolution to generate hypotheses regarding the functions of non-coding RNAs (ncRNAs) as well. We are able to assign probable functions to a number of cis-regulatory ncRNA elements, as well as to infer likely differences in trans-acting ncRNA regulatory networks. PMID:23470992

  8. SPI-9 of Salmonella enterica serovar Typhi is constituted by an operon positively regulated by RpoS and contributes to adherence to epithelial cells in culture.

    PubMed

    Velásquez, Juan C; Hidalgo, Alejandro A; Villagra, Nicolás; Santiviago, Carlos A; Mora, Guido C; Fuentes, Juan A

    2016-08-01

    The genomic island 9 (SPI-9) from Salmonella enterica serovar Typhi (S. Typhi) carries three ORFs (STY2876, STY2877, STY2878) presenting 98 % identity with a type 1 secretory apparatus (T1SS), and a single ORF (STY2875) similar to a large RTX-like protein exhibiting repeated Ig domains. BapA, the Salmonella enterica serovar Enteritidis orthologous to S. Typhi STY2875, has been associated with biofilm formation, and is described as a virulence factor in mice. Preliminary in silico analyses revealed that S. Typhi STY2875 ORF has a 600 bp deletion compared with S. Enteritidis bapA, suggesting that S. Typhi STY2875 might be non-functional. At present, SPI-9 has not been studied in S. Typhi. We found that the genes constituting SPI-9 are arranged in an operon whose promoter was up-regulated in high osmolarity and low pH in a RpoS-dependent manner. All the proteins encoded by S. Typhi SPI-9 were located at the membrane fraction, consistent with their putative role as T1SS. Furthermore, SPI-9 contributed to adherence of S. Typhi to epithelial cells when bacteria were grown under high osmolarity or low pH. Under the test conditions, S. Typhi SPI-9 did not participate in biofilm formation. SPI-9 is functional in S. Typhi and encodes an adhesin induced under conditions normally found in the intestine, such as high osmolarity. Hence, this is an example of a locus that might be designated a pseudogene by computational approaches but not by direct biological assays.

  9. A case report of thrombocytopenia-associated multiple organ failure secondary to Salmonella enterica serotype Typhi infection in a pediatric patient: successful treatment with plasma exchange.

    PubMed

    Yildirim, Inci; Ceyhan, Mehmet; Bayrakci, Benan; Uysal, Mutlu; Kuskonmaz, Baris; Ozaltin, Fatih

    2010-04-01

    A high proportion of the patients with Salmonella enterica serotype Typhi infection develop severe sepsis. The mortality rate is high despite aggressive antimicrobial therapy in these patients. The case of a 10-year-old boy who developed thrombocytopenia-associated multiple organ failure (TAMOF) secondary to S. typhi infection is reported. The patient did not respond to antimicrobial treatment, including ciprofloxacin, in addition to conventional supportive measures, so plasma exchange was performed. The thrombocytopenia and organ failure had resolved after 3 days of plasma exchange therapy. Plasma exchange is suggested to be a life-saving intervention in a child with TAMOF secondary to S. typhi infection.

  10. Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays

    PubMed Central

    Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata

    2016-01-01

    Salmonella Typhi (S. Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever. PMID:27975062

  11. Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays.

    PubMed

    Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien

    2016-01-01

    Salmonella Typhi (S. Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

  12. Salmonella Typhi OmpS1 and OmpS2 porins are potent protective immunogens with adjuvant properties.

    PubMed

    Moreno-Eutimio, Mario A; Tenorio-Calvo, Alejandra; Pastelin-Palacios, Rodolfo; Perez-Shibayama, Christian; Gil-Cruz, Cristina; López-Santiago, Rubén; Baeza, Isabel; Fernández-Mora, Marcos; Bonifaz, Laura; Isibasi, Armando; Calva, Edmundo; López-Macías, Constantino

    2013-08-01

    Salmonella enterica serovar Typhi (S. Typhi) is the causal agent of typhoid fever, a disease that primarily affects developing countries. Various antigens from this bacterium have been reported to be targets of the immune response. Recently, the S. Typhi genome has been shown to encode two porins--OmpS1 and OmpS2--which are expressed at low levels under in vitro culture conditions. In this study, we demonstrate that immunizing mice with either OmpS1 or OmpS2 induced production of specific, long-term antibody titres and conferred protection against S. Typhi challenge; in particular, OmpS1 was more immunogenic and conferred greater protective effects than OmpS2. We also found that OmpS1 is a Toll-like receptor 4 (TLR4) agonist, whereas OmpS2 is a TLR2 and TLR4 agonist. Both porins induced the production of tumour necrosis factor and interleukin-6, and OmpS2 was also able to induce interleukin-10 production. Furthermore, OmpS1 induced the over-expression of MHC II molecules in dendritic cells and OmpS2 induced the over-expression of CD40 molecules in macrophages and dendritic cells. Co-immunization of OmpS1 or OmpS2 with ovalbumin (OVA) increased anti-OVA antibody titres, the duration and isotype diversity of the OVA-specific antibody response, and the proliferation of T lymphocytes. These porins also had adjuvant effects on the antibody response when co-immunized with either the Vi capsular antigen from S. Typhi or inactivated 2009 pandemic influenza A(H1N1) virus [A(H1N1)pdm09]. Taken together, the data indicate that OmpS1 and OmpS2, despite being expressed at low levels under in vitro culture conditions, are potent protective immunogens with intrinsic adjuvant properties.

  13. Salmonella Typhi OmpS1 and OmpS2 porins are potent protective immunogens with adjuvant properties

    PubMed Central

    Moreno-Eutimio, Mario A; Tenorio-Calvo, Alejandra; Pastelin-Palacios, Rodolfo; Perez-Shibayama, Christian; Gil-Cruz, Cristina; López-Santiago, Rubén; Baeza, Isabel; Fernández-Mora, Marcos; Bonifaz, Laura; Isibasi, Armando; Calva, Edmundo; López-Macías, Constantino

    2013-01-01

    Salmonella enterica serovar Typhi (S. Typhi) is the causal agent of typhoid fever, a disease that primarily affects developing countries. Various antigens from this bacterium have been reported to be targets of the immune response. Recently, the S. Typhi genome has been shown to encode two porins – OmpS1 and OmpS2 – which are expressed at low levels under in vitro culture conditions. In this study, we demonstrate that immunizing mice with either OmpS1 or OmpS2 induced production of specific, long-term antibody titres and conferred protection against S. Typhi challenge; in particular, OmpS1 was more immunogenic and conferred greater protective effects than OmpS2. We also found that OmpS1 is a Toll-like receptor 4 (TLR4) agonist, whereas OmpS2 is a TLR2 and TLR4 agonist. Both porins induced the production of tumour necrosis factor and interleukin-6, and OmpS2 was also able to induce interleukin-10 production. Furthermore, OmpS1 induced the over-expression of MHC II molecules in dendritic cells and OmpS2 induced the over-expression of CD40 molecules in macrophages and dendritic cells. Co-immunization of OmpS1 or OmpS2 with ovalbumin (OVA) increased anti-OVA antibody titres, the duration and isotype diversity of the OVA-specific antibody response, and the proliferation of T lymphocytes. These porins also had adjuvant effects on the antibody response when co-immunized with either the Vi capsular antigen from S. Typhi or inactivated 2009 pandemic influenza A(H1N1) virus [A(H1N1)pdm09]. Taken together, the data indicate that OmpS1 and OmpS2, despite being expressed at low levels under in vitro culture conditions, are potent protective immunogens with intrinsic adjuvant properties. PMID:23432484

  14. Construction, Genotypic and Phenotypic Characterization, and Immunogenicity of Attenuated ΔguaBA Salmonella enterica Serovar Typhi Strain CVD 915

    PubMed Central

    Wang, Jin Yuang; Pasetti, Marcela F.; Noriega, Fernando R.; Anderson, Richard J.; Wasserman, Steven S.; Galen, James E.; Sztein, Marcelo B.; Levine, Myron M.

    2001-01-01

    A promising live attenuated typhoid vaccine candidate strain for mucosal immunization was developed by introducing a deletion in the guaBA locus of pathogenic Salmonella enterica serovar Typhi strain Ty2. The resultant ΔguaBA mutant, serovar Typhi CVD 915, has a gene encoding resistance to arsenite replacing the deleted sequence within guaBA, thereby providing a marker to readily identify the vaccine strain. CVD 915 was compared in in vitro and in vivo assays with wild-type strain Ty2, licensed live oral typhoid vaccine strain Ty21a, or attenuated serovar Typhi vaccine strain CVD 908-htrA (harboring mutations in aroC, aroD, and htrA). CVD 915 was less invasive than CVD 908-htrA in tissue culture and was more crippled in its ability to proliferate after invasion. In mice inoculated intraperitoneally with serovar Typhi and hog gastric mucin (to estimate the relative degree of attenuation), the 50% lethal dose of CVD 915 (7.7 × 107 CFU) was significantly higher than that of wild-type Ty2 (1.4 × 102 CFU) and was only slightly lower than that of Ty21a (1.9 × 108 CFU). Strong serum O and H antibody responses were recorded in mice inoculated intranasally with CVD 915, which were higher than those elicited by Ty21a and similar to those stimulated by CVD 908-htrA. CVD 915 also elicited potent proliferative responses in splenocytes from immunized mice stimulated with serovar Typhi antigens. Used as a live vector, CVD 915(pTETlpp) elicited high titers of serum immunoglobulin G anti-fragment C. These encouraging preclinical data pave the way for phase 1 clinical trials with CVD 915. PMID:11447145

  15. Retrograde pyelonephritis and lumbar spondylitis as a result of Salmonella typhi in a type 2 diabetes patient with neurogenic bladder.

    PubMed

    Fukuda, Tatsuya; Bouchi, Ryotaro; Minami, Isao; Ohara, Norihiko; Nakano, Yujiro; Nishitani, Rie; Murakami, Masanori; Takeuchi, Takato; Akihisa, Momoko; Fujita, Masamichi; Izumiyama, Hajime; Hashimoto, Koshi; Yoshimoto, Takanobu; Ogawa, Yoshihiro

    2016-05-01

    We present a case of a 62-year-old diabetic woman with acute pyelonephritis and spondylitis caused by Salmonella typhi. She was admitted to Tokyo Medical Dental University Hospital, Tokyo, Japan, because of unconsciousness and was diagnosed with sepsis by retrograde pyelonephritis as a result of Salmonella typhi. Antibiotics treatment was immediately started; however, she subsequently developed lumbar spondylitis, and long-term conservative treatment with antibiotics and a fixing device were required. This is the first report of a diabetic patient who developed retrograde urinary tract infection with Salmonella typhi, followed by sepsis and spondylitis. The infection could be a result of diabetic neuropathy, presenting neurogenic bladder and hydronephrosis. The patient was successfully treated with antibiotics and became asymptomatic with normal inflammatory marker levels, and no clinical sign of recurrence was observed in the kidney and spine at 4 months.

  16. Insights from the Genome Sequence of a Salmonella enterica Serovar Typhi Strain Associated with a Sporadic Case of Typhoid Fever in Malaysia

    PubMed Central

    Yap, Kien-Pong; Teh, Cindy Shuan Ju; Baddam, Ramani; Chai, Lay-Ching; Kumar, Narender; Avasthi, Tiruvayipati Suma; Ahmed, Niyaz

    2012-01-01

    Salmonella enterica serovar Typhi is the causative agent of typhoid fever, which causes nearly 21.7 million illnesses and 217,000 deaths globally. Herein, we describe the whole-genome sequence of the Salmonella Typhi strain ST0208, isolated from a sporadic case of typhoid fever in Kuala Lumpur, Malaysia. The whole-genome sequence and comparative genomics allow an in-depth understanding of the genetic diversity, and its link to pathogenicity and evolutionary dynamics, of this highly clonal pathogen that is endemic to Malaysia. PMID:22933756

  17. Outbreak of Salmonella Typhi enteric fever in sub-urban area of North India: a public health perspective.

    PubMed

    Singla, Nidhi; Bansal, Neha; Gupta, Varsha; Chander, Jagdish

    2013-02-01

    Outbreaks of enteric fever are a major health concern not only due to significant human morbidity and mortality but also fear of spread of multidrug resistant strains. We report an outbreak of enteric fever caused by Salmonella enterica serotype Typhi in a suburban area, in city Chandigarh of North India. Twenty-seven strains of S. typhi were isolated from blood cultures over a period of two weeks with 18 of these 27 patients residing in the same area. Maximum cases were in the age group 5-14 years (10 patients, 55.5%) while 4 (22.2%) cases were children under 5 years. All the strains showed similar resistogram being resistant to ampicillin and nalidixic acid, intermediate to ciprofloxacin and sensitive to chloramphenicol, ceftriaxone, cefotaxime, cotrimoxazole and azithromycin on disc diffusion testing. Minimum inhibitory concentration of ciprofloxacin was determined by agar dilution method and was found to be raised (≥ 2 μ g/mL). This nalidixic acid resistant S. typhi outbreak report warrants the necessity of implementing stringent sanitation practices in public health interest.

  18. Salmonella enterica Serovar Typhi conceals the invasion-associated type three secretion system from the innate immune system by gene regulation.

    PubMed

    Winter, Sebastian E; Winter, Maria G; Poon, Victor; Keestra, A Marijke; Sterzenbach, Torsten; Faber, Franziska; Costa, Luciana F; Cassou, Fabiane; Costa, Erica A; Alves, Geraldo E S; Paixão, Tatiane A; Santos, Renato L; Bäumler, Andreas J

    2014-07-01

    Delivery of microbial products into the mammalian cell cytosol by bacterial secretion systems is a strong stimulus for triggering pro-inflammatory host responses. Here we show that Salmonella enterica serovar Typhi (S. Typhi), the causative agent of typhoid fever, tightly regulates expression of the invasion-associated type III secretion system (T3SS-1) and thus fails to activate these innate immune signaling pathways. The S. Typhi regulatory protein TviA rapidly repressed T3SS-1 expression, thereby preventing RAC1-dependent, RIP2-dependent activation of NF-κB in epithelial cells. Heterologous expression of TviA in S. enterica serovar Typhimurium (S. Typhimurium) suppressed T3SS-1-dependent inflammatory responses generated early after infection in animal models of gastroenteritis. These results suggest that S. Typhi reduces intestinal inflammation by limiting the induction of pathogen-induced processes through regulation of virulence gene expression.

  19. Salmonella typhi resistant to Chloramphenicol, Ampicillin, and Other Antimicrobial Agents: Strains Isolated During an Extensive Typhoid Fever Epidemic in Mexico

    PubMed Central

    Olarte, Jorge; Galindo, Emma

    1973-01-01

    During 1972 a large epidemic, in excess of 10,000 cases, of typhoid fever occurred in Mexico City, Pachuca, and other communities of Mexico. The main characteristic of the epidemic, in addition to the large number of persons affected, was the prevalence of a strain of Salmonella typhi which was highly resistant to chloramphenicol both in vivo and in vitro, and which belonged to a single phage type, Vi degraded approaching type A. Of 493 strains of S. typhi studied during the outbreak, 452 (91.7%) were resistant to chloramphenicol (CM), tetracycline (TC), streptomycin (SM), and sulfonamides (SU). The epidemic strain owes its resistance to an R factor which is easily transferable to Escherichia coli K-12 and which appears to be stable. In the third month of the outbreak, a strain of S. typhi resistant to CM, TC, SM, SU, ampicillin (AM), and kanamycin (KM) was isolated from a patient with severe typhoid fever. During the following 9 months, six additional strains of S. typhi resistant to AM, CM, TC, SM, and SU were also isolated. Transfer experiments to E. coli K-12 indicate that these strains are infected with two different R factors, one causing CM, TC, SM, and SU resistance and the other causing AM or AM and KM resistance. The frequency of transfer of the resistance in overnight crosses was in the order of 10−4 for CM, TC, SM, and SU and 10−6 for AM or AM, and KM. The appearance of these strains resistant both to chloramphenicol and ampicillin was a cause for concern for the clinicians; fortunately, they have remained an infrequent cause of disease. PMID:4602828

  20. The antibiotic resistance patterns of Salmonella Typhi isolates in Italy, 1980-96. The Italian SALM-NET Working Group. Salmonella Network.

    PubMed Central

    Scuderi, G.; Fantasia, M.; Niglio, T.

    2000-01-01

    In this paper we report the distribution of Salmonella Typhi isolates in Italy and their resistance patterns to antibiotics. The data were collected by the Italian SALM-NET surveillance system in a pilot retrospective study of the period 1980-96. Data on drug-resistance were available for 82 isolates out of 176 S. Typhi isolated in Italy. Of these 82 isolates, 32 (39%) were resistant or intermediate to 1 or more antibiotics. Eight isolates were resistant and 7 intermediate to streptomycin; 4 isolates were resistant to ampicillin alone or in association with other antibiotics; only 2 strains (1 isolated in Lombardia in 1993 and the other 1 in Lazio in 1994) were resistant to chloramphenicol, and 2 (isolated in Sardegna and Piemonte in 1995 and 1996, respectively) showed intermediate resistance to chloramphenicol. The strains showing resistance to 3 or more antibiotics were very scarce: 1 (with 5 complete resistances) was isolated in Lazio in 1994, and another 1 (with complete resistance to 10 antibiotics and intermediate resistance to 2 antibiotics) was isolated in Molise in 1988. In conclusion, besides the routine activities to control typhoid fever, an accurate and continuous surveillance is necessary in order to quickly identify multidrug-resistant (MDR) S. Typhi strains and prevent their spread, even though their level, in our country, is still quite low. PMID:10722125

  1. Salmonella Typhi Porins OmpC and OmpF Are Potent Adjuvants for T-Dependent and T-Independent Antigens.

    PubMed

    Pérez-Toledo, Marisol; Valero-Pacheco, Nuriban; Pastelin-Palacios, Rodolfo; Gil-Cruz, Cristina; Perez-Shibayama, Christian; Moreno-Eutimio, Mario A; Becker, Ingeborg; Pérez-Tapia, Sonia Mayra; Arriaga-Pizano, Lourdes; Cunningham, Adam F; Isibasi, Armando; Bonifaz, Laura C; López-Macías, Constantino

    2017-01-01

    Several microbial components, such as bacterial DNA and flagellin, have been used as experimental vaccine adjuvants because of their inherent capacity to efficiently activate innate immune responses. Likewise, our previous work has shown that the major Salmonella Typhi (S. Typhi) outer membrane proteins OmpC and OmpF (porins) are highly immunogenic protective antigens that efficiently stimulate innate and adaptive immune responses in the absence of exogenous adjuvants. Moreover, S. Typhi porins induce the expression of costimulatory molecules on antigen-presenting cells through toll-like receptor canonical signaling pathways. However, the potential of major S. Typhi porins to be used as vaccine adjuvants remains unknown. Here, we evaluated the adjuvant properties of S. Typhi porins against a range of experimental and clinically relevant antigens. Co-immunization of S. Typhi porins with ovalbumin (OVA), an otherwise poorly immunogenic antigen, enhanced anti-OVA IgG titers, antibody class switching, and affinity maturation. This adjuvant effect was dependent on CD4(+) T-cell cooperation and was associated with an increase in IFN-γ, IL-17A, and IL-2 production by OVA-specific CD4(+) T cells. Furthermore, co-immunization of S. Typhi porins with an inactivated H1N1 2009 pandemic influenza virus experimental vaccine elicited higher hemagglutinating anti-influenza IgG titers, antibody class switching, and affinity maturation. Unexpectedly, co-administration of S. Typhi porins with purified, unconjugated Vi capsular polysaccharide vaccine (Vi CPS)-a T-independent antigen-induced higher IgG antibody titers and class switching. Together, our results suggest that S. Typhi porins OmpC and OmpF are versatile vaccine adjuvants, which could be used to enhance T-cell immune responses toward a Th1/Th17 profile, while improving antibody responses to otherwise poorly immunogenic T-dependent and T-independent antigens.

  2. Salmonella Typhi Porins OmpC and OmpF Are Potent Adjuvants for T-Dependent and T-Independent Antigens

    PubMed Central

    Pérez-Toledo, Marisol; Valero-Pacheco, Nuriban; Pastelin-Palacios, Rodolfo; Gil-Cruz, Cristina; Perez-Shibayama, Christian; Moreno-Eutimio, Mario A.; Becker, Ingeborg; Pérez-Tapia, Sonia Mayra; Arriaga-Pizano, Lourdes; Cunningham, Adam F.; Isibasi, Armando; Bonifaz, Laura C.; López-Macías, Constantino

    2017-01-01

    Several microbial components, such as bacterial DNA and flagellin, have been used as experimental vaccine adjuvants because of their inherent capacity to efficiently activate innate immune responses. Likewise, our previous work has shown that the major Salmonella Typhi (S. Typhi) outer membrane proteins OmpC and OmpF (porins) are highly immunogenic protective antigens that efficiently stimulate innate and adaptive immune responses in the absence of exogenous adjuvants. Moreover, S. Typhi porins induce the expression of costimulatory molecules on antigen-presenting cells through toll-like receptor canonical signaling pathways. However, the potential of major S. Typhi porins to be used as vaccine adjuvants remains unknown. Here, we evaluated the adjuvant properties of S. Typhi porins against a range of experimental and clinically relevant antigens. Co-immunization of S. Typhi porins with ovalbumin (OVA), an otherwise poorly immunogenic antigen, enhanced anti-OVA IgG titers, antibody class switching, and affinity maturation. This adjuvant effect was dependent on CD4+ T-cell cooperation and was associated with an increase in IFN-γ, IL-17A, and IL-2 production by OVA-specific CD4+ T cells. Furthermore, co-immunization of S. Typhi porins with an inactivated H1N1 2009 pandemic influenza virus experimental vaccine elicited higher hemagglutinating anti-influenza IgG titers, antibody class switching, and affinity maturation. Unexpectedly, co-administration of S. Typhi porins with purified, unconjugated Vi capsular polysaccharide vaccine (Vi CPS)—a T-independent antigen—induced higher IgG antibody titers and class switching. Together, our results suggest that S. Typhi porins OmpC and OmpF are versatile vaccine adjuvants, which could be used to enhance T-cell immune responses toward a Th1/Th17 profile, while improving antibody responses to otherwise poorly immunogenic T-dependent and T-independent antigens. PMID:28337196

  3. Evaluation of two Salmonella typhi strains with reduced virulence for use in teaching and proficiency testing.

    PubMed

    Hickman, F W; Rhoden, D L; Esaias, A O; Baron, L S; Brenner, D J; Farmer, J J

    1982-06-01

    A total of 21 cases of laboratory-acquired typhoid fever associated with teaching and proficiency tests occurred in the United States during a 33-month period, prompting a search for less virulent strains of S. typhi which would be suitable for teaching purposes. Two strains were evaluated which are reported to have reduced virulence for mice. Strain Ty21a is a genetically constructed mutant that lacks the enzyme UDP-glucose-4-epimerase. This strain has reduced virulence for humans if grown under special laboratory conditions (in the presence of 0.1% d-galactose) and has been evaluated as a candidate for use as a live, oral vaccine. Strain H901 was originally isolated in Russia in 1918. It has not been tested in humans, but its nonmotile variant, O901, has been found to be somewhat less virulent for humans; however, it can cause infection with doses of 10(7) organisms. In teaching exercises, all strains should be treated as though they are fully virulent. Ty21a and H901 were satisfactory, but not ideal, for teaching purposes. Biochemically, they could be identified by conventional tests and by commercially available diagnostic systems, although Ty21a was H(2)S negative. Serologically, both strains posed problems. Both Ty21a and H901 were Vi antigen negative, and Ty21a was rough and grew poorly. Both strains were susceptible to antibiotics, including chloramphenicol, ampicillin, and trimethoprim-sulfameth-oxazole. When Ty21a and H901 were mixed with Escherichia coli and plated, Hektoen and salmonella-shigella agars were most useful for their recovery. The appearance of Ty21a and H901 on differential plating media was typical, although Ty21a had smaller colonies. The plating efficiency on MacConkey agar for Ty21a was 0.6 compared with 1 for H901. Neither strain can be recommended unequivocally for teaching purposes; instead, the advantages and disadvantages of each must be considered. Both strains have been deposited in the American Type Culture Collection (Ty21a

  4. Nanoparticle Fullerene (C60) demonstrated stable binding with antibacterial potential towards probable targets of drug resistant Salmonella typhi - a computational perspective and in vitro investigation.

    PubMed

    Skariyachan, Sinosh; Parveen, Asma; Garka, Shruti

    2016-11-23

    Salmonella typhi, a Gram negative bacterium, has become multidrug resistant (MDR) to wide classes of antibacterials which necessitate an alarming precaution. This study focuses on the binding potential and therapeutic insight of Nano-Fullerene C60 towards virulent targets of Salmonella typhi by computational prediction and preliminary in vitro assays. The clinical isolates of Salmonella typhi were collected and antibiotic susceptibility profiles were assessed. The drug targets of pathogen were selected by rigorous literature survey and gene network analysis by various metabolic network resources. Based on this study, 20 targets were screened and the 3D structures of few drug targets were retrieved from PDB and others were computationally predicted. The structures of nanoleads such as Fullerene C60, ZnO and CuO were retrieved from drug databases. The binding potential of these nanoleads towards all selected targets were predicted by molecular docking. The best docked conformations were screened and concept was investigated by preliminary bioassays. This study revealed that most of the isolates of Salmonella typhi were found to be MDR (p < .05). The theoretical models of selected drug targets showed high stereochemical validity. The molecular docking studies suggested that Fullerene C60 showed better binding affinity towards the drug targets when compared to ZnO and CuO. The preliminary in vitro assays suggested that 100 μg/L Fullerene C60 posses significant inhibitory activities and absence of drug resistance to this nanoparticle. This study suggests that Fullerene C60 can be scaled up as probable lead molecules against the major drug targets of MDR Salmonella typhi.

  5. Genomic dissection of travel-associated extended-spectrum-beta-lactamase-producing Salmonella enterica serovar typhi isolates originating from the Philippines: a one-off occurrence or a threat to effective treatment of typhoid fever?

    PubMed

    Hendriksen, Rene S; Leekitcharoenphon, Pimlapas; Mikoleit, Matthew; Jensen, Jacob Dyring; Kaas, Rolf Sommer; Roer, Louise; Joshi, Heena B; Pornruangmong, Srirat; Pulsrikarn, Chaiwat; Gonzalez-Aviles, Gladys D; Reuland, E Ascelijn; Al Naiemi, Nashwan; Wester, Astrid Louise; Aarestrup, Frank M; Hasman, Henrik

    2015-02-01

    One unreported case of extended-spectrum-beta-lactamase (ESBL)-producing Salmonella enterica serovar Typhi was identified, whole-genome sequence typed, among other analyses, and compared to other available genomes of S. Typhi. The reported strain was similar to a previously published strain harboring blaSHV-12 from the Philippines and likely part of an undetected outbreak, the first of ESBL-producing S. Typhi.

  6. Role of the Salmonella enterica serovar Typhi Fur regulator and small RNAs RfrA and RfrB in iron homeostasis and interaction with host cells.

    PubMed

    Leclerc, Jean-Mathieu; Dozois, Charles M; Daigle, France

    2013-03-01

    Iron is an essential element but can be toxic at high concentrations. Therefore, its acquisition and storage require tight control. Salmonella encodes the global regulator Fur (ferric uptake regulator) and the small regulatory non-coding RNAs (sRNAs) RfrA and RfrB, homologues of RyhB. The role of these iron homeostasis regulators was investigated in Salmonella enterica serovar Typhi (S. Typhi). Strains containing either single or combined deletions of these regulators were obtained. The mutants were tested for growth in low and high iron conditions, resistance to oxidative stress, expression and production of siderophores, and during interaction with host cells. The fur mutant showed a growth defect and was sensitive to hydrogen peroxide. The expression of the sRNAs was responsible for these defects. Siderophore expression by S. Typhi and both sRNAs were regulated by iron and by Fur. Fur contributed to invasion of epithelial cells, and was shown for the first time to play a role in phagocytosis and intracellular survival of S. Typhi in human macrophages. The sRNAs RfrA and RfrB were not required for interaction with epithelial cells, but both sRNAs were important for optimal intracellular replication in macrophages. In S. Typhi, Fur is a repressor of both sRNAs, and loss of either RfrA or RfrB resulted in distinct phenotypes, suggesting a non-redundant role for these regulatory RNAs.

  7. Oral Challenge with Wild-Type Salmonella Typhi Induces Distinct Changes in B Cell Subsets in Individuals Who Develop Typhoid Disease

    PubMed Central

    Toapanta, Franklin R.; Bernal, Paula J.; Fresnay, Stephanie; Magder, Laurence S.; Darton, Thomas C.; Jones, Claire; Waddington, Claire S.; Blohmke, Christoph J.; Angus, Brian; Levine, Myron M.; Pollard, Andrew J.; Sztein, Marcelo B.

    2016-01-01

    A novel human oral challenge model with wild-type Salmonella Typhi (S. Typhi) was recently established by the Oxford Vaccine Group. In this model, 104 CFU of Salmonella resulted in 65% of participants developing typhoid fever (referred here as typhoid diagnosis -TD-) 6–9 days post-challenge. TD was diagnosed in participants meeting clinical (oral temperature ≥38°C for ≥12h) and/or microbiological (S. Typhi bacteremia) endpoints. Changes in B cell subpopulations following S. Typhi challenge remain undefined. To address this issue, a subset of volunteers (6 TD and 4 who did not develop TD -NoTD-) was evaluated. Notable changes included reduction in the frequency of B cells (cells/ml) of TD volunteers during disease days and increase in plasmablasts (PB) during the recovery phase (>day 14). Additionally, a portion of PB of TD volunteers showed a significant increase in activation (CD40, CD21) and gut homing (integrin α4β7) molecules. Furthermore, all BM subsets of TD volunteers showed changes induced by S. Typhi infections such as a decrease in CD21 in switched memory (Sm) CD27+ and Sm CD27- cells as well as upregulation of CD40 in unswitched memory (Um) and Naïve cells. Furthermore, changes in the signaling profile of some BM subsets were identified after S. Typhi-LPS stimulation around time of disease. Notably, naïve cells of TD (compared to NoTD) volunteers showed a higher percentage of cells phosphorylating Akt suggesting enhanced survival of these cells. Interestingly, most these changes were temporally associated with disease onset. This is the first study to describe differences in B cell subsets directly related to clinical outcome following oral challenge with wild-type S. Typhi in humans. PMID:27300136

  8. Oral Wild-Type Salmonella Typhi Challenge Induces Activation of Circulating Monocytes and Dendritic Cells in Individuals Who Develop Typhoid Disease.

    PubMed

    Toapanta, Franklin R; Bernal, Paula J; Fresnay, Stephanie; Darton, Thomas C; Jones, Claire; Waddington, Claire S; Blohmke, Christoph J; Dougan, Gordon; Angus, Brian; Levine, Myron M; Pollard, Andrew J; Sztein, Marcelo B

    2015-06-01

    A new human oral challenge model with wild-type Salmonella Typhi (S. Typhi) was recently developed. In this model, ingestion of 104 CFU of Salmonella resulted in 65% of subjects developing typhoid fever (referred here as typhoid diagnosis -TD-) 5-10 days post-challenge. TD criteria included meeting clinical (oral temperature ≥38°C for ≥12 h) and/or microbiological (S. Typhi bacteremia) endpoints. One of the first lines of defense against pathogens are the cells of the innate immune system (e.g., monocytes, dendritic cells -DCs-). Various changes in circulating monocytes and DCs have been described in the murine S. Typhimurium model; however, whether similar changes are present in humans remains to be explored. To address these questions, a subset of volunteers (5 TD and 3 who did not develop typhoid despite oral challenge -NoTD-) were evaluated for changes in circulating monocytes and DCs. Expression of CD38 and CD40 were upregulated in monocytes and DCs in TD volunteers during the disease days (TD-0h to TD-96h). Moreover, integrin α4β7, a gut homing molecule, was upregulated on monocytes but not DCs. CD21 upregulation was only identified in DCs. These changes were not observed among NoTD volunteers despite the same oral challenge. Moreover, monocytes and DCs from NoTD volunteers showed increased binding to S. Typhi one day after challenge. These monocytes showed phosphorylation of p38MAPK, NFkB and Erk1/2 upon stimulation with S. Typhi-LPS-QDot micelles. In contrast, monocytes from TD volunteers showed only a moderate increase in S. Typhi binding 48 h and 96 h post-TD, and only Erk1/2 phosphorylation. This is the first study to describe different activation and migration profiles, as well as differential signaling patterns, in monocytes and DCs which relate directly to the clinical outcome following oral challenge with wild type S. Typhi.

  9. Oral Challenge with Wild-Type Salmonella Typhi Induces Distinct Changes in B Cell Subsets in Individuals Who Develop Typhoid Disease.

    PubMed

    Toapanta, Franklin R; Bernal, Paula J; Fresnay, Stephanie; Magder, Laurence S; Darton, Thomas C; Jones, Claire; Waddington, Claire S; Blohmke, Christoph J; Angus, Brian; Levine, Myron M; Pollard, Andrew J; Sztein, Marcelo B

    2016-06-01

    A novel human oral challenge model with wild-type Salmonella Typhi (S. Typhi) was recently established by the Oxford Vaccine Group. In this model, 104 CFU of Salmonella resulted in 65% of participants developing typhoid fever (referred here as typhoid diagnosis -TD-) 6-9 days post-challenge. TD was diagnosed in participants meeting clinical (oral temperature ≥38°C for ≥12h) and/or microbiological (S. Typhi bacteremia) endpoints. Changes in B cell subpopulations following S. Typhi challenge remain undefined. To address this issue, a subset of volunteers (6 TD and 4 who did not develop TD -NoTD-) was evaluated. Notable changes included reduction in the frequency of B cells (cells/ml) of TD volunteers during disease days and increase in plasmablasts (PB) during the recovery phase (>day 14). Additionally, a portion of PB of TD volunteers showed a significant increase in activation (CD40, CD21) and gut homing (integrin α4β7) molecules. Furthermore, all BM subsets of TD volunteers showed changes induced by S. Typhi infections such as a decrease in CD21 in switched memory (Sm) CD27+ and Sm CD27- cells as well as upregulation of CD40 in unswitched memory (Um) and Naïve cells. Furthermore, changes in the signaling profile of some BM subsets were identified after S. Typhi-LPS stimulation around time of disease. Notably, naïve cells of TD (compared to NoTD) volunteers showed a higher percentage of cells phosphorylating Akt suggesting enhanced survival of these cells. Interestingly, most these changes were temporally associated with disease onset. This is the first study to describe differences in B cell subsets directly related to clinical outcome following oral challenge with wild-type S. Typhi in humans.

  10. RpoS-dependent expression of OsmY in Salmonella enterica serovar typhi: activation under stationary phase and SPI-2-inducing conditions.

    PubMed

    Zheng, Xueming; Ji, Ying; Weng, Xiaoqin; Huang, Xinxiang

    2015-06-01

    OsmY is a periplasmic protein with two BON domains which may attach to phospholipid membranes. Previous reports showed that the expression of OsmY in Escherichia coli was hyperosmotically inducible and RpoS dependent. But little work was done to investigate the expression and function of OsmY in Salmonella. Here, we detected the endogenous OsmY in Salmonella enterica serovar Typhi (S. Typhi) with polyclonal antibody. The results showed that the expression of OsmY was also RpoS dependent and was activated under stationary phase. Further, using in vitro culture, we established the Salmonella pathogenesis island (SPI)-1 and SPI-2-inducing conditions with hyperosmolarity and low-phosphate, low-magnesium medium (pH 5.8), respectively, and found that only SPI-2-inducing conditions can activate the expression of OsmY. osmY deletion mutant showed delayed growth compared with wild-type S. Typhi in SPI-2-inducing conditions. The results indicated that OsmY may function to resist the stress and be favorable for Salmonella's replication in the Salmonella-containing vesicles of macrophage.

  11. The influence of MAP condition and active compounds on the radiosensitization of Escherichia coli and Salmonella typhi present in chicken breast

    NASA Astrophysics Data System (ADS)

    Lacroix, M.; Chiasson, F.

    2004-09-01

    The efficiency of carvacrol, thymol, trans-cinnamaldehyde (Tc) and tetrasodium pyrophosphate (Tp) on the radiosensitization of Escherichia coli and Salmonella typhi in chicken breast was determined. Chicken breast were dipped in a bath of working cultures of E. coli or S. typhi (5×10 7 CFU/ml). Active compounds were added at the concentration corresponding to {1}/{30} of the minimal inhibitory concentration. Samples were packed under air and gamma irradiation was done at doses from 0.1 to 0.7 kGy. The efficiencies of the active compounds against E. coli were 32%, 10%, 3% and 0% for thymol, Tp and carvacrol, respectively. For S. typhi, the efficiencies in the chicken breast were 47%, 19%, 17% and 11% for Tc, Tp, carvacrol and thymol, respectively. Without active compounds, D10 values were 0.145 kGy for E. coli and 0.64 kGy for S. typhi as compared to 0.098 kGy for E. coli and 0.341 kGy for S. typhi in presence of Tc. Under modified atmospheric packaging condition and in presence of Tc, D10 values were reduced to 0.046 for E. coli and to 0.110 for S. typhi.

  12. Enteric fever in Cambodian children is dominated by multidrug-resistant H58 Salmonella enterica serovar Typhi with intermediate susceptibility to ciprofloxacin.

    PubMed

    Emary, Kate; Moore, Catrin E; Chanpheaktra, Ngoun; An, Khun Peng; Chheng, Kheng; Sona, Soeng; Duy, Pham Thanh; Nga, Tran Vu Thieu; Wuthiekanun, Vanaporn; Amornchai, Premjit; Kumar, Varun; Wijedoru, Lalith; Stoesser, Nicole E; Carter, Michael J; Baker, Stephen; Day, Nicholas P J; Parry, Christopher M

    2012-12-01

    Infections with Salmonella enterica serovar Typhi isolates that are multidrug resistant (MDR: resistant to chloramphenicol, ampicillin, trimethoprim-sulphamethoxazole) with intermediate ciprofloxacin susceptibility are widespread in Asia but there is little information from Cambodia. We studied invasive salmonellosis in children at a paediatric hospital in Siem Reap, Cambodia. Between 2007 and 2011 Salmonella was isolated from a blood culture in 162 children. There were 151 children with enteric fever, including 148 serovar Typhi and three serovar Paratyphi A infections, and 11 children with a non-typhoidal Salmonella infection. Of the 148 serovar Typhi isolates 126 (85%) were MDR and 133 (90%) had intermediate ciprofloxacin susceptibility. Inpatient antimicrobial treatment was ceftriaxone alone or initial ceftriaxone followed by a step-down to oral ciprofloxacin or azithromycin. Complications developed in 37/128 (29%) children admitted with enteric fever and two (1.6%) died. There was one confirmed relapse. In a sample of 102 serovar Typhi strains genotyped by investigation of a subset of single nucleotide polymorphisms, 98 (96%) were the H58 haplotype, the majority of which had the common serine to phenylalanine substitution at codon 83 in the DNA gyrase. We conclude that antimicrobial-resistant enteric fever is common in Cambodian children and therapeutic options are limited.

  13. RpoS integrates CRP, Fis, and PhoP signaling pathways to control Salmonella Typhi hlyE expression

    PubMed Central

    2014-01-01

    Background SPI-18 is a pathogenicity island found in some Salmonella enterica serovars, including S. Typhi. SPI-18 harbors two ORFs organized into an operon, hlyE and taiA genes, both implicated in virulence. Regarding the hlyE regulation in S. Typhi, it has been reported that RpoS participates as transcriptional up-regulator under low pH and high osmolarity. In addition, CRP down-regulates hlyE expression during exponential growth. Previously, it has been suggested that there is another factor related to catabolite repression, different from CRP, involved in the down-regulation of hlyE. Moreover, PhoP-dependent hlyE up-regulation has been reported in bacteria cultured simultaneously under low pH and low concentration of Mg2+. Nevertheless, the relative contribution of each environmental signal is not completely clear. In this work we aimed to better understand the regulation of hlyE in S. Typhi and the integration of different environmental signals through global regulators. Results We found that Fis participates as a CRP-independent glucose-dependent down-regulator of hlyE. Also, Fis and CRP seem to exert the repression over hlyE through down-regulating rpoS. Moreover, PhoP up-regulates hlyE expression via rpoS under low pH and low Mg2+ conditions. Conclusions All these results together show that, at least under the tested conditions, RpoS is the central regulator in the hlyE regulatory network, integrating multiple environmental signals and global regulators. PMID:24885225

  14. Constitutive Expression of the Vi Polysaccharide Capsular Antigen in Attenuated Salmonella enterica Serovar Typhi Oral Vaccine Strain CVD 909

    PubMed Central

    Wang, Jin Yuan; Noriega, Fernando R.; Galen, James E.; Barry, Eileen; Levine, Myron M.

    2000-01-01

    Live oral Ty21a and parenteral Vi polysaccharide vaccines provide significant protection against typhoid fever, albeit by distinct immune mechanisms. Vi stimulates serum immunoglobulin G Vi antibodies, whereas Ty21a, which does not express Vi, elicits humoral and cell-mediated immune responses other than Vi antibodies. Protection may be enhanced if serum Vi antibody as well as cell-mediated and humoral responses can be stimulated. Disappointingly, several new attenuated Salmonella enterica serovar Typhi oral vaccines (e.g., CVD 908-htrA and Ty800) that elicit serum O and H antibody and cell-mediated responses following a single dose do not stimulate serum Vi antibody. Vi expression is regulated in response to environmental signals such as osmolarity by controlling the transcription of tviA in the viaB locus. To investigate if Vi antibodies can be stimulated if Vi expression is rendered constitutive, we replaced PtviA in serovar Typhi vaccine CVD 908-htrA with the constitutive promoter Ptac, resulting in CVD 909. CVD 909 expresses Vi even under high-osmolarity conditions and is less invasive for Henle 407 cells. In mice immunized with a single intranasal dose, CVD 909 was more immunogenic than CVD 908-htrA in eliciting serum Vi antibodies (geometric mean titer of 160 versus 49, P = 0.0007), whereas O antibody responses were virtually identical (geometric mean titer of 87 versus 80). In mice challenged intraperitoneally with wild-type serovar Typhi 4 weeks after a single intranasal immunization, the mortality of those immunized with CVD 909 (3 of 8) was significantly lower than that of control mice (10 of 10, P = 0.043) or mice given CVD 908-htrA (9 of 10, P = 0.0065). PMID:10899868

  15. Epidemic typhoid in Chile: analysis by molecular and conventional methods of Salmonella typhi strain diversity in epidemic (1977 and 1981) and nonepidemic (1990) years.

    PubMed Central

    Fica, A E; Prat-Miranda, S; Fernandez-Ricci, A; D'Ottone, K; Cabello, F C

    1996-01-01

    From 1977 to 1986, Chile experienced an important typhoid fever epidemic, despite statistics that indicated apparently improving levels of sanitation of drinking water and sewage disposal. The lack of antibiotic resistance among the Salmonella typhi strains isolated during this period, the mild clinical presentation of the disease, and the initially low level of efficacy of the S. typhi Ty21a vaccine in the population exposed to the epidemic suggested that this epidemic might have resulted from the dissemination of S. typhi strains with unique characteristics. To investigate this hypothesis, we used conventional methods (bacteriophage typing and biotyping) and molecular methods (restriction fragment length polymorphism analysis, ribotyping, IS200 typing, and PCR amplification of the fliC-d gene) to study a population of 149 S. typhi isolates during 1977, 1981, and 1990, the years that included periods with low (when the disease was endemic) and high (when the disease was epidemic) morbidities. Our results indicate that these S. typhi isolates in Chile represent a number of highly diverse variants of the clone of S. typhi with a worldwide distribution described by Selander et al. (R. K. Selander, P. Beltran, N.H. Smith, R. Helmuth, F.A. Rubin, D.J. Kopecko, K. Ferris, B.D. Tall, A. Cravioto, and J.M. Musser, Infect. Immun. 58:2262-2275, 1990). For example, we detected 26 PstI and 10 ClaI ribotypes among 47 and 16 S. typhi strains belonging to this clone, respectively. These results suggest that the Chilean epidemic was probably produced by multiple sources of infection because of deficient sanitary conditions. These findings illustrate the usefulness of molecular methods for characterizing the potential causes of the typhoid epidemics and the possible routes of transmission of S. typhi strains in typhoid epidemics. PMID:8784573

  16. Structural basis of typhod: Salmonella typhi type IVb pilin (PilS) and cystic fibrosis transmembrane conductance regulator interaction

    SciTech Connect

    Balakrishna, A.; Saxena, A; Mok, H; Swaminathan, K

    2009-01-01

    The type IVb pilus of the enteropathogenic bacteria Salmonella typhi is a major adhesion factor during the entry of this pathogen into gastrointestinal epithelial cells. Its target of adhesion is a stretch of 10 residues from the first extracellular domain of cystic fibrosis transmembrane conductance regulator (CFTR). The crystal structure of the N-terminal 25 amino acid deleted S. typhi native PilS protein (PilS), which makes the pilus, was determined at 1.9 A resolution by the multiwavelength anomalous dispersion method. Also, the structure of the complex of PilS and a target CFTR peptide, determined at 1.8 A, confirms that residues 113-117 (NKEER) of CFTR are involved in binding with the pilin protein and gives us insight on the amino acids that are essential for binding. Furthermore, we have also explored the role of a conserved disulfide bridge in pilus formation. The subunit structure and assembly architecture are crucial for understanding pilus functions and designing suitable therapeutics against typhoid.

  17. Structural basis of typhoid: Salmonella typhi type IVb pilin (PiLS) and cystic fibrosis transmembrane conductance regulator interaction

    SciTech Connect

    Balakrishna, A.M.; Saxena, A.; Mok, H. Y.-K.; Swaminathan, K.

    2009-11-01

    The type IVb pilus of the enteropathogenic bacteria Salmonella typhi is a major adhesion factor during the entry of this pathogen into gastrointestinal epithelial cells. Its target of adhesion is a stretch of 10 residues from the first extracellular domain of cystic fibrosis transmembrane conductance regulator (CFTR). The crystal structure of the N-terminal 25 amino acid deleted S. typhi native PilS protein ({Delta}PilS), which makes the pilus, was determined at 1.9 {angstrom} resolution by the multiwavelength anomalous dispersion method. Also, the structure of the complex of {Delta}PilS and a target CFTR peptide, determined at 1.8 {angstrom}, confirms that residues 113-117 (NKEER) of CFTR are involved in binding with the pilin protein and gives us insight on the amino acids that are essential for binding. Furthermore, we have also explored the role of a conserved disulfide bridge in pilus formation. The subunit structure and assembly architecture are crucial for understanding pilus functions and designing suitable therapeutics against typhoid.

  18. Structural Basis of Typhoid: Salmonella typhi Type IVb pilin (PilS) and Cystic Fibrosis Transmembrane Conductance Regulatory Interaction

    SciTech Connect

    Balakrishna, A.; Saxena, A; Mok, H; Swaminathan, K

    2009-01-01

    The type IVb pilus of the enteropathogenic bacteria Salmonella typhi is a major adhesion factor during the entry of this pathogen into gastrointestinal epithelial cells. Its target of adhesion is a stretch of 10 residues from the first extracellular domain of cystic fibrosis transmembrane conductance regulator (CFTR). The crystal structure of the N-terminal 25 amino acid deleted S. typhi native PilS protein (PilS), which makes the pilus, was determined at 1.9 A resolution by the multiwavelength anomalous dispersion method. Also, the structure of the complex of PilS and a target CFTR peptide, determined at 1.8 A, confirms that residues 113-117 (NKEER) of CFTR are involved in binding with the pilin protein and gives us insight on the amino acids that are essential for binding. Furthermore, we have also explored the role of a conserved disulfide bridge in pilus formation. The subunit structure and assembly architecture are crucial for understanding pilus functions and designing suitable therapeutics against typhoid.

  19. Phylogeographical analysis of the dominant multidrug-resistant H58 clade of Salmonella Typhi identifies inter- and intracontinental transmission events

    PubMed Central

    Wong, Vanessa K; Baker, Stephen; Pickard, Derek J; Parkhill, Julian; Page, Andrew J; Feasey, Nicholas A; Kingsley, Robert A; Thomson, Nicholas R; Keane, Jacqueline A; Weill, François-Xavier; Edwards, David J; Hawkey, Jane; Harris, Simon R; Mather, Alison E; Cain, Amy K; Hadfield, James; Hart, Peter J; Thieu, Nga Tran Vu; Klemm, Elizabeth J; Glinos, Dafni A; Breiman, Robert F; Watson, Conall H; Kariuki, Samuel; Gordon, Melita A; Heyderman, Robert S; Okoro, Chinyere; Jacobs, Jan; Lunguya, Octavie; Edmunds, W John; Msefula, Chisomo; Chabalgoity, Jose A; Kama, Mike; Jenkins, Kylie; Dutta, Shanta; Marks, Florian; Campos, Josefina; Thompson, Corinne; Obaro, Stephen; MacLennan, Calman A; Dolecek, Christiane; Keddy, Karen H; Smith, Anthony M; Parry, Christopher M; Karkey, Abhilasha; Mulholland, E Kim; Campbell, James I; Dongol, Sabina; Basnyat, Buddha; Dufour, Muriel; Bandaranayake, Don; Naseri, Take Toleafoa; Singh, Shalini Pravin; Hatta, Mochammad; Newton, Paul; Onsare, Robert S; Isaia, Lupeoletalalei; Dance, David; Davong, Viengmon; Thwaites, Guy; Wijedoru, Lalith; Crump, John A; De Pinna, Elizabeth; Nair, Satheesh; Nilles, Eric J; Thanh, Duy Pham; Turner, Paul; Soeng, Sona; Valcanis, Mary; Powling, Joan; Dimovski, Karolina; Hogg, Geoff; Farrar, Jeremy; Holt, Kathryn E; Dougan, Gordon

    2016-01-01

    The emergence of multidrug-resistant (MDR) typhoid is a major global health threat affecting many countries where the disease is endemic. Here whole-genome sequence analysis of 1,832 Salmonella enterica serovar Typhi (S. Typhi) identifies a single dominant MDR lineage, H58, that has emerged and spread throughout Asia and Africa over the last 30 years. Our analysis identifies numerous transmissions of H58, including multiple transfers from Asia to Africa and an ongoing, unrecognized MDR epidemic within Africa itself. Notably, our analysis indicates that H58 lineages are displacing antibiotic-sensitive isolates, transforming the global population structure of this pathogen. H58 isolates can harbor a complex MDR element residing either on transmissible IncHI1 plasmids or within multiple chromosomal integration sites. We also identify new mutations that define the H58 lineage. This phylogeographical analysis provides a framework to facilitate global management of MDR typhoid and is applicable to similar MDR lineages emerging in other bacterial species. PMID:25961941

  20. Evaluation of salivary anti-Salmonella typhi lipopolysaccharide IgA ELISA for serodiagnosis of typhoid fever in children.

    PubMed

    Zaka-ur-Rab, Zeeba; Abqari, Shaad; Shahab, Tabassum; Islam, Najmul; Shukla, Indu

    2012-03-01

    This observational study was conducted to determine the diagnostic accuracy of ELISA for the detection of anti-Salmonella typhi lipopolysaccharide (LPS) salivary immunoglobulin A (IgA) antibodies in 37 children with culture confirmed typhoid, 30 febrile controls with an alternative diagnosis and 30 healthy controls. The test was positive in 33/37 (89.2%) cases of typhoid, but negative in all patients in the two control groups. Maximum absorbance of anti-LPS IgA was observed during the second and third weeks of typhoid, with a progressive decline thereafter. The sensitivity of ELISA was 71.4%, 100%, 100%, 9.1% and 0%, in first, second, third, fourth and fifth week of illness, respectively. Further large scale studies measuring salivary anti-LPS IgA antibodies are needed to confirm the potential of saliva-based serology in children with suspected typhoid.

  1. Synthesis of di- and tri-saccharide fragments of Salmonella typhi Vi capsular polysaccharide and their zwitterionic analogues.

    PubMed

    Fusari, Matteo; Fallarini, Silvia; Lombardi, Grazia; Lay, Luigi

    2015-12-01

    Zwitterionic polysaccharides (ZPS) behave like traditional T cell-dependent antigens, suggesting the design of new classes of vaccines alternative to currently used glycoconjugates and based on the artificial introduction of a zwitterionic charge motif onto the carbohydrate structure of pathogen antigens. Here we report the new synthesis and antigenic evaluation of di-/tri-saccharide fragments of Salmonella typhi Vi polysaccharide, as well as of their corresponding zwitterionic analogues. Our strategy is based on versatile intermediates enabling chain elongation either by iterative single monomer attachment or by faster and more flexible approach using disaccharide donors. The effect of structural modifications of the synthetic compounds on antigenic properties was evaluated by competitive ELISA. All the oligosaccharides were recognized by specific anti-Vi polyclonal antibodies in a concentration-dependent manner, and the introduction of a zwitterionic motif into the synthetic molecules did not prevent the binding.

  2. Quantification of Salmonella Typhi in water and sediments by molecular-beacon based qPCR.

    PubMed

    Rani, Neetika; Vajpayee, Poornima; Bhatti, Saurabh; Singh, Smriti; Shanker, Rishi; Gupta, Kailash Chand

    2014-10-01

    A molecular-beacon based qPCR assay targeting staG gene was designed for specific detection and quantification of S. Typhi and validated against water and sediment samples collected from the river Ganga, Yamuna and their confluence on two days during Mahakumbha mela 2012-2013 (a) 18 December, 2012: before six major religious holy dips (Makar Sankranti, Paush Poornima, Mauni Amavasya, Basant Panchami, Maghi Poornima and Mahashivratri) (b) 10 February, 2013: after the holy dip was taken by over 3,00,00,000 devotees led by ascetics of Hindu sects at Sangam on 'Mauni Amavasya' (the most auspicious day of ritualistic mass bathing). The assay could detect linearly lowest 1 genomic equivalent per qPCR and is highly sensitive and selective for S. Typhi detection in presence of non specific DNA from other bacterial strains including S. Paratyphi A and S. Typhimurium. It has been observed that water and sediment samples exhibit S. Typhi. The mass holy dip by devotees significantly affected the water and sediment quality by enhancing the number of S. Typhi in the study area. The qPCR developed in the study might be helpful in planning the intervention and prevention strategies for control of enteric fever outbreaks in endemic regions.

  3. What proportion of Salmonella Typhi cases are detected by blood culture? A systematic literature review.

    PubMed

    Mogasale, Vittal; Ramani, Enusa; Mogasale, Vijayalaxmi V; Park, JuYeon

    2016-05-17

    Blood culture is often used in definitive diagnosis of typhoid fever while, bone marrow culture has a greater sensitivity and considered reference standard. The sensitivity of blood culture measured against bone marrow culture results in measurement bias because both tests are not fully sensitive. Here we propose a combination of the two cultures as a reference to define true positive S. Typhi cases. Based on a systematic literature review, we identified ten papers that had performed blood and bone marrow culture for S. Typhi in same subjects. We estimated the weighted mean of proportion of cases detected by culture measured against true S. Typhi positive cases using a random effects model. Of 529 true positive S. Typhi cases, 61 % (95 % CI 52-70 %) and 96 % (95 % CI 93-99 %) were detected by blood and bone marrow cultures respectively. Blood culture sensitivity was 66 % (95 % CI 56-75 %) when compared with bone marrow culture results. The use of blood culture sensitivity as a proxy measure to estimate the proportion of typhoid fever cases detected by blood culture is likely to be an underestimate. As blood culture sensitivity is used as a correction factor in estimating typhoid disease burden, epidemiologists and policy makers should account for the underestimation.

  4. An inducible and secreted eukaryote-like serine/threonine kinase of Salmonella enterica serovar Typhi promotes intracellular survival and pathogenesis.

    PubMed

    Theeya, Nagaraja; Ta, Atri; Das, Sayan; Mandal, Rahul S; Chakrabarti, Oishee; Chakrabarti, Saikat; Ghosh, Amar N; Das, Santasabuj

    2015-02-01

    Eukaryote-like serine/threonine kinases (eSTKs) constitute an important family of bacterial virulence factors. Genome analysis had predicted putative eSTKs in Salmonella enterica serovar Typhi, although their functional characterization and the elucidation of their role in pathogenesis are still awaited. We show here that the primary sequence and secondary structure of the t4519 locus of Salmonella Typhi Ty2 have all the signatures of eukaryotic superfamily kinases. t4519 encodes a ∼39-kDa protein (T4519), which shows serine/threonine kinase activities in vitro. Recombinant T4519 (rT4519) is autophosphorylated and phosphorylates the universal substrate myelin basic protein. Infection of macrophages results in decreased viability of the mutant (Ty2Δt4519) strain, which is reversed by gene complementation. Moreover, reactive oxygen species produced by the macrophages signal to the bacteria to induce T4519, which is translocated to the host cell cytoplasm. That T4519 may target a host substrate(s) is further supported by the activation of host cellular signaling pathways and the induction of cytokines/chemokines. Finally, the role of T4519 in the pathogenesis of Salmonella Typhi is underscored by the significantly decreased mortality of mice infected with the Ty2Δt4519 strain and the fact that the competitive index of this strain for causing systemic infection is 0.25% that of the wild-type strain. This study characterizes the first eSTK of Salmonella Typhi and demonstrates its role in promoting phagosomal survival of the bacteria within macrophages, which is a key determinant of pathogenesis. This, to the best of our knowledge, is the first study to describe the essential role of eSTKs in the in vivo pathogenesis of Salmonella spp.

  5. Cell-free culture supernatant of Bifidobacterium breve CNCM I-4035 decreases pro-inflammatory cytokines in human dendritic cells challenged with Salmonella typhi through TLR activation.

    PubMed

    Bermudez-Brito, Miriam; Muñoz-Quezada, Sergio; Gomez-Llorente, Carolina; Matencio, Esther; Bernal, Maria J; Romero, Fernando; Gil, Angel

    2013-01-01

    Dendritic cells (DCs) constitute the first point of contact between gut commensals and our immune system. Despite growing evidence of the immunomodulatory effects of probiotics, the interactions between the cells of the intestinal immune system and bacteria remain largely unknown. Indeed,, the aim of this work was to determine whether the probiotic Bifidobacterium breve CNCM I-4035 and its cell-free culture supernatant (CFS) have immunomodulatory effects in human intestinal-like dendritic cells (DCs) and how they respond to the pathogenic bacterium Salmonella enterica serovar Typhi, and also to elucidate the molecular mechanisms involved in these interactions. Human DCs were directly challenged with B. breve/CFS, S. typhi or a combination of these stimuli for 4 h. The expression pattern of genes involved in Toll-like receptor (TLR) signaling pathway and cytokine secretion was analyzed. CFS decreased pro-inflammatory cytokines and chemokines in human intestinal DCs challenged with S. typhi. In contrast, the B. breve CNCM I-4035 probiotic strain was a potent inducer of the pro-inflammatory cytokines and chemokines tested, i.e., TNF-α, IL-8 and RANTES, as well as anti-inflammatory cytokines including IL-10. CFS restored TGF-β levels in the presence of Salmonella. Live B.breve and its supernatant enhanced innate immune responses by the activation of TLR signaling pathway. These treatments upregulated TLR9 gene transcription. In addition, CFS was a more potent inducer of TLR9 expression than the probiotic bacteria in the presence of S. typhi. Expression levels of CASP8 and IRAK4 were also increased by CFS, and both treatments induced TOLLIP gene expression. Our results indicate that the probiotic strain B. breve CNCM I-4035 affects the intestinal immune response, whereas its supernatant exerts anti-inflammatory effects mediated by DCs. This supernatant may protect immune system from highly infectious agents such as Salmonella typhi and can down-regulate pro

  6. The influence of atmosphere conditions on Escherichia coli and Salmonella typhi radiosensitization in irradiated ground beef containing carvacrol and tetrasodium pyrophosphate

    NASA Astrophysics Data System (ADS)

    Lacroix, M.; Borsa, J.; Chiasson, F.; Ouattara, B.

    2004-09-01

    The radiosensitization of Escherichia coli and Salmonella typhi in presence of carvacrol (1.0%) and tetrasodium pyrophosphate (0.1%) in ground beef packed under four different atmospheres (air; 100% CO 2; MAP : 60% O 2-30% CO 2-10% N 2 and vacuum) was determined. Medium fat ground beef containing carvacrol and tetrasodium pyrophosphate was inoculated with E. coli or S. typhi. Samples were packed under different atmospheres as described before and irradiated at doses from 0.1 to 0.6 kGy in presence of E. coli and from 0.50 to 2.0 kGy for S. typhi. Results indicated that the best increase in radiosensitization was observed in samples packed under MAP. The D10 values were 0.046 kGy for E. coli and 0.053 kGy for S. typhi. Both bacteria were more resistant to irradiation under air, in the absence of active compound. A D10 values of 0.126 kGy for E. coli and 0.526 kGy for S. typhi was observed.

  7. [Factors of Salmonella typhi virulence in relation to the development of new vaccines].

    PubMed

    García, J A; Paniagua, J; Pelayo, R; Isibasi, A; Kumate, J

    1992-01-01

    Although many vaccines against typhoid fever have been developed, none have been adapted for their further application on developing countries. In order to get better vaccines, the virulence factors of both S. typhi and S. typhimurium have been studied. Thus, some protection assays have been made using surface antigens involved on virulence or using live attenuated vaccines of bacteria mutated on virulence genes. Here we present a brief review about virulence factors studied so far for the development of new vaccines.

  8. CRISPR-Cas system presents multiple transcriptional units including antisense RNAs that are expressed in minimal medium and upregulated by pH in Salmonella enterica serovar Typhi.

    PubMed

    Medina-Aparicio, Liliana; Rebollar-Flores, Javier E; Beltrán-Luviano, América A; Vázquez, Alejandra; Gutiérrez-Ríos, Rosa M; Olvera, Leticia; Calva, Edmundo; Hernández-Lucas, Ismael

    2017-02-01

    The CRISPR-Cas system is involved in bacterial immunity, virulence, gene regulation, biofilm formation and sporulation. In Salmonella enterica serovar Typhi, this system consists of five transcriptional units including antisense RNAs. It was determined that these genetic elements are expressed in minimal medium and are up-regulated by pH. In addition, a transcriptional characterization of cas3 and ascse2-1 is included herein.

  9. Septic arthritis of the hip in a Cambodian child caused by multidrug-resistant Salmonella enterica serovar Typhi with intermediate susceptibility to ciprofloxacin treated with ceftriaxone and azithromycin.

    PubMed

    Pocock, J M; Khun, P A; Moore, C E; Vuthy, S; Stoesser, N; Parry, C M

    2014-08-01

    Septic arthritis is a rare complication of typhoid fever. A 12-year-old boy without pre-existing disease attended a paediatric hospital in Cambodia with fever and left hip pain. A hip synovial fluid aspirate grew multidrug-resistant Salmonella enterica ser. Typhi with intermediate susceptibility to ciprofloxacin. Arthrotomy, 2 weeks of intravenous ceftriaxone and 4 weeks of oral azithromycin led to resolution of symptoms. The optimum management of septic arthritis in drug-resistant typhoid is undefined.

  10. Expression and Immunogenicity of a Mutant Diphtheria Toxin Molecule, CRM197, and Its Fragments in Salmonella typhi Vaccine Strain CVD 908-htrA

    PubMed Central

    Orr, Nadav; Galen, James E.; Levine, Myron M.

    1999-01-01

    Mutant diphtheria toxin molecule CRM197 and fragments thereof were expressed in attenuated Salmonella typhi CVD 908-htrA, and the constructs were tested for their ability to induce serum antitoxin. Initially, expressed proteins were insoluble, and the constructs failed to induce neutralizing antitoxin. Soluble CRM197 was expressed at low levels by utilizing the hemolysin A secretion system from Escherichia coli. PMID:10417208

  11. Overexpression of Salmonella enterica serovar Typhi recA gene confers fluoroquinolone resistance in Escherichia coli DH5α

    PubMed Central

    Yassien, M.A.M.; Elfaky, M.A.

    2015-01-01

    A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α. PMID:26375447

  12. Antimicrobial resistance and molecular subtypes of Salmonella enterica serovar Typhi isolates from Kolkata, India over a 15 years period 1998-2012.

    PubMed

    Das, Surojit; Samajpati, Sriparna; Ray, Ujjwayini; Roy, Indranil; Dutta, Shanta

    2017-01-01

    Typhoid fever, caused by Salmonella enterica serovar Typhi (S. Typhi), remains an unresolved public health problem in India. Emergence of antimicrobial resistant strains poses a great concern for typhoid treatment and influences reshaping of current S. Typhi population. We included representative S. Typhi strains (n=164) from retrospective studies, both community and hospital based, conducted at National Institute of Cholera and Enteric Diseases, Kolkata during 15 years period (1998-2012) to analyze their antimicrobial resistance (AMR) profiles, mechanism of AMR and molecular subtypes of the strains. More than 60% of the S. Typhi isolates were obtained from community based studies. During the study period, steady decline (46.4%-15.6%) in isolation of multidrug-resistant (MDR, resistant to ampicillin, chloramphenicol and co-trimoxazole) S. Typhi was noticed with parallel increase of nalidixic acid-resistant (NAL(R)) strains (60.7%-93.8%) and ciprofloxacin resistant (CIP(R)) strains (0%-25%). Of 53 MDR strains, 46 (86.8%) were NAL(R) showing decreased ciprofloxacin susceptible (DCS) (MIC for ciprofloxacin 0.12-0.5μg/ml) phenotype. Conjugative IncHI1 (230kb) and non-conjugative non-IncHI1 (180kb) plasmids were found in 23 (43.4%) and 14 (26.4%) MDR strains respectively, plasmid was absent in 16 (30.2%) MDR strains. MDR strains with or without plasmid shared the same set of resistance genes (blaTEM-1, catA1, sul1, sul2, strA and strB) and class 1 integron possessing dfrA7 gene cassette. Two S. Typhi strains harbored 50kb transferrable plasmids carrying dfrA15 and aadA1 gene cassettes in class 1 integron. The majority of the strains (135/164, 82.3%) belonged to H58 haplotype. Among the MDR isolates, fluoroquinolone resistant or combined resistant isolates (n=147), 127 (86.4%) were H58 and 20 (13.6%) belonged to non-H58. NAL(R)S. Typhi strains with decreased susceptibility or resistance to ciprofloxacin had point mutation(s) in quinolone resistance-determining region of

  13. Global MLST of Salmonella Typhi Revisited in Post-genomic Era: Genetic Conservation, Population Structure, and Comparative Genomics of Rare Sequence Types

    PubMed Central

    Yap, Kien-Pong; Ho, Wing S.; Gan, Han M.; Chai, Lay C.; Thong, Kwai L.

    2016-01-01

    Typhoid fever, caused by Salmonella enterica serovar Typhi, remains an important public health burden in Southeast Asia and other endemic countries. Various genotyping methods have been applied to study the genetic variations of this human-restricted pathogen. Multilocus sequence typing (MLST) is one of the widely accepted methods, and recently, there is a growing interest in the re-application of MLST in the post-genomic era. In this study, we provide the global MLST distribution of S. Typhi utilizing both publicly available 1,826 S. Typhi genome sequences in addition to performing conventional MLST on S. Typhi strains isolated from various endemic regions spanning over a century. Our global MLST analysis confirms the predominance of two sequence types (ST1 and ST2) co-existing in the endemic regions. Interestingly, S. Typhi strains with ST8 are currently confined within the African continent. Comparative genomic analyses of ST8 and other rare STs with genomes of ST1/ST2 revealed unique mutations in important virulence genes such as flhB, sipC, and tviD that may explain the variations that differentiate between seemingly successful (widespread) and unsuccessful (poor dissemination) S. Typhi populations. Large scale whole-genome phylogeny demonstrated evidence of phylogeographical structuring and showed that ST8 may have diverged from the earlier ancestral population of ST1 and ST2, which later lost some of its fitness advantages, leading to poor worldwide dissemination. In response to the unprecedented increase in genomic data, this study demonstrates and highlights the utility of large-scale genome-based MLST as a quick and effective approach to narrow the scope of in-depth comparative genomic analysis and consequently provide new insights into the fine scale of pathogen evolution and population structure. PMID:26973639

  14. Selection of autochthonous lactic acid bacteria from goat dairies and their addition to evaluate the inhibition of Salmonella typhi in artisanal cheese.

    PubMed

    Ferrari, Iris da Silva; de Souza, Jane Viana; Ramos, Cintia Lacerda; da Costa, Mateus Matiuzzi; Schwan, Rosane Freitas; Dias, Francesca Silva

    2016-12-01

    This study aimed to select autochthonous lactic acid bacteria (LAB) with probiotic and functional properties from goat dairies and test their addition to artisanal cheese for the inhibition of Salmonella typhi. In vitro tests, including survival in the gastrointestinal tract (GIT), auto- and co-aggregation, the hemolytic test, DNase activity, antimicrobial susceptibility, antibacterial activity, tolerance to NaCl and exopolysaccharide (EPS), gas and diacetyl production were conducted for sixty isolates. Based on these tests, four LAB isolates (UNIVASF CAP 16, 45, 84 and 279) were selected and identified. Additional tests, such as production of lactic and citric acids by UNIVASF CAP isolates were performed in addition to assays of bile salt hydrolase (BSH), β-galactosidase and decarboxylase activity. The four selected LAB produced high lactic acid (>17 g/L) and low citric acid (0.2 g/L) concentrations. All selected strains showed BSH and β-galactosidase activity and none showed decarboxylase activity. Three goat cheeses (1, 2 and control) were produced and evaluated for the inhibitory action of selected LAB against Salmonella typhi. The cheese inoculated with LAB (cheese 2) decreased 0.38 log10 CFU/g of S. Typhy population while in the cheese without LAB inoculation (cheese 1) the pathogen population increased by 0.29 log units. Further, the pH value increased linearly over time, by 0.004 units per day in cheese 1. In the cheese 2, the pH value decreased linearly over time, by 0.066 units per day. The cocktail containing selected Lactobacillus strains with potential probiotic and technological properties showed antibacterial activity against S. typhi in vitro and in artisanal goat cheese. Thus, goat milk is important source of potential probiotic LAB which may be used to inhibit the growth of Salmonella population in cheese goat, contributing to safety and functional value of the product.

  15. IFN-γ-producing CD4+ T cells promote generation of protective germinal center-derived IgM+ B cell memory against Salmonella Typhi.

    PubMed

    Perez-Shibayama, Christian; Gil-Cruz, Cristina; Pastelin-Palacios, Rodolfo; Cervantes-Barragan, Luisa; Hisaki, Emiliano; Chai, Qian; Onder, Lucas; Scandella, Elke; Regen, Tommy; Waisman, Ari; Isibasi, Armando; Lopez-Macias, Constantino; Ludewig, Burkhard

    2014-06-01

    Abs play a significant role in protection against the intracellular bacterium Salmonella Typhi. In this article, we investigated how long-term protective IgM responses can be elicited by a S. Typhi outer-membrane protein C- and F-based subunit vaccine (porins). We found that repeated Ag exposure promoted a CD4(+) T cell-dependent germinal center reaction that generated mutated IgM-producing B cells and was accompanied by a strong expansion of IFN-γ-secreting T follicular helper cells. Genetic ablation of individual cytokine receptors revealed that both IFN-γ and IL-17 are required for optimal germinal center reactions and production of porin-specific memory IgM(+) B cells. However, more profound reduction of porin-specific IgM B cell responses in the absence of IFN-γR signaling indicated that this cytokine plays a dominant role. Importantly, mutated IgM mAbs against porins exhibited bactericidal capacity and efficiently augmented S. Typhi clearance. In conclusion, repeated vaccination with S. Typhi porins programs type I T follicular helper cell responses that contribute to the diversification of B cell memory and promote the generation of protective IgM Abs.

  16. The Ecological Dynamics of Fecal Contamination and Salmonella Typhi and Salmonella Paratyphi A in Municipal Kathmandu Drinking Water.

    PubMed

    Karkey, Abhilasha; Jombart, Thibaut; Walker, Alan W; Thompson, Corinne N; Torres, Andres; Dongol, Sabina; Tran Vu Thieu, Nga; Pham Thanh, Duy; Tran Thi Ngoc, Dung; Voong Vinh, Phat; Singer, Andrew C; Parkhill, Julian; Thwaites, Guy; Basnyat, Buddha; Ferguson, Neil; Baker, Stephen

    2016-01-01

    One of the UN sustainable development goals is to achieve universal access to safe and affordable drinking water by 2030. It is locations like Kathmandu, Nepal, a densely populated city in South Asia with endemic typhoid fever, where this goal is most pertinent. Aiming to understand the public health implications of water quality in Kathmandu we subjected weekly water samples from 10 sources for one year to a range of chemical and bacteriological analyses. We additionally aimed to detect the etiological agents of typhoid fever and longitudinally assess microbial diversity by 16S rRNA gene surveying. We found that the majority of water sources exhibited chemical and bacterial contamination exceeding WHO guidelines. Further analysis of the chemical and bacterial data indicated site-specific pollution, symptomatic of highly localized fecal contamination. Rainfall was found to be a key driver of this fecal contamination, correlating with nitrates and evidence of S. Typhi and S. Paratyphi A, for which DNA was detectable in 333 (77%) and 303 (70%) of 432 water samples, respectively. 16S rRNA gene surveying outlined a spectrum of fecal bacteria in the contaminated water, forming complex communities again displaying location-specific temporal signatures. Our data signify that the municipal water in Kathmandu is a predominant vehicle for the transmission of S. Typhi and S. Paratyphi A. This study represents the first extensive spatiotemporal investigation of water pollution in an endemic typhoid fever setting and implicates highly localized human waste as the major contributor to poor water quality in the Kathmandu Valley.

  17. The Ecological Dynamics of Fecal Contamination and Salmonella Typhi and Salmonella Paratyphi A in Municipal Kathmandu Drinking Water

    PubMed Central

    Walker, Alan W.; Thompson, Corinne N.; Torres, Andres; Dongol, Sabina; Tran Vu Thieu, Nga; Pham Thanh, Duy; Tran Thi Ngoc, Dung; Voong Vinh, Phat; Singer, Andrew C.; Parkhill, Julian; Thwaites, Guy; Basnyat, Buddha; Ferguson, Neil; Baker, Stephen

    2016-01-01

    One of the UN sustainable development goals is to achieve universal access to safe and affordable drinking water by 2030. It is locations like Kathmandu, Nepal, a densely populated city in South Asia with endemic typhoid fever, where this goal is most pertinent. Aiming to understand the public health implications of water quality in Kathmandu we subjected weekly water samples from 10 sources for one year to a range of chemical and bacteriological analyses. We additionally aimed to detect the etiological agents of typhoid fever and longitudinally assess microbial diversity by 16S rRNA gene surveying. We found that the majority of water sources exhibited chemical and bacterial contamination exceeding WHO guidelines. Further analysis of the chemical and bacterial data indicated site-specific pollution, symptomatic of highly localized fecal contamination. Rainfall was found to be a key driver of this fecal contamination, correlating with nitrates and evidence of S. Typhi and S. Paratyphi A, for which DNA was detectable in 333 (77%) and 303 (70%) of 432 water samples, respectively. 16S rRNA gene surveying outlined a spectrum of fecal bacteria in the contaminated water, forming complex communities again displaying location-specific temporal signatures. Our data signify that the municipal water in Kathmandu is a predominant vehicle for the transmission of S. Typhi and S. Paratyphi A. This study represents the first extensive spatiotemporal investigation of water pollution in an endemic typhoid fever setting and implicates highly localized human waste as the major contributor to poor water quality in the Kathmandu Valley. PMID:26735696

  18. Immunization with Ty21a live oral typhoid vaccine elicits cross-reactive multifunctional CD8+ T cell responses against Salmonella enterica serovar Typhi, S. Paratyphi A and S. Paratyphi B in humans

    PubMed Central

    Wahid, Rezwanul; Fresnay, Stephanie; Levine, Myron M.; Sztein, Marcelo B.

    2015-01-01

    Previously we have extensively characterized Salmonella enterica serovar Typhi (S. Typhi)-specific cell-mediated immune responses (CMI) in volunteers orally immunized with the licensed Ty21a typhoid vaccine. In this study we measured Salmonella-specific multifunctional (MF) CD8+ T cell responses to further investigate whether Ty21a elicits cross reactive CMI against S. Paratyphi A and S. Paratyphi B, which also cause enteric fever. Ty21a elicited cross-reactive CMI against all three Salmonella serotypes were predominantly observed in CD8+ T effector/memory (TEM) and, to a lesser extent, in CD8+CD45RA+ TEM (TEMRA) subsets. These CD8+ T cell responses were largely mediated by MF cells co producing IFN-γ, MIP-1β and expressing CD107a with or without TNF-α. Significant proportions of Salmonella-specific MF cells expressed the gut homing molecule integrin α4β7. In most subjects similar MF responses were observed to S. Typhi and S. Paratyphi B, but not to S. Paratyphi A. These results suggest that Ty21a elicits MF CMI against Salmonella which could be critical in clearing the infection. Moreover, because S. Paratyphi A is a major public concern and Ty21a was shown in field studies not to afford cross-protection to S. Paratyphi A, these results will be important in developing a S. Typhi/S. Paratyphi A bivalent vaccine against enteric fevers. PMID:25872480

  19. Multi-isotype antibody responses against the multimeric Salmonella Typhi recombinant hemolysin E antigen.

    PubMed

    Ong, Eugene Boon Beng; Ignatius, Joshua; Anthony, Amy Amilda; Aziah, Ismail; Ismail, Asma; Lim, Theam Soon

    2015-01-01

    The detection and measurement of different antibody isotypes in the serum provide valuable indicators of the different stages of typhoid infection. Here, the ability of S. Typhi recombinant hemolysin E (HlyE) to detect multi-isotype antibody responses in sera of patients with typhoid and paratyphoid A was investigated using an indirect antibody immunoassay. Nanogram amounts of HlyE were found to be sufficient for detection of IgG and IgA isotypes and, in a study of individuals' sera (n = 100), the immunoassay was able to distinguish between typhoid and non-typhoid sera. The overall sensitivity, specificity and efficiency of the ELISA were 70% (39/56), 100% (44/44) and 83% respectively.

  20. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhi CVD 908-htrA†

    PubMed Central

    Galen, James E.; Nair, Jay; Wang, Jin Yuang; Wasserman, Steven S.; Tanner, Michael K.; Sztein, Marcelo B.; Levine, Myron M.

    1999-01-01

    The broad objective of the research presented here is to develop a noncatalytic plasmid maintenance system for the stabilization of multicopy expression plasmids encoding foreign antigens in a Salmonella typhi live-vector vaccine strain such as CVD 908-htrA. We have enhanced the maintenance of expression plasmids at two independent levels. First, we removed dependence upon balanced-lethal maintenance systems that involve catalytic enzymes expressed from multicopy plasmids; we accomplished this through incorporation into expression plasmids of a postsegregational killing system based on the noncatalytic hok-sok plasmid addiction system from the antibiotic resistance factor pR1. We also included at least one naturally occurring plasmid partition function in our expression plasmids, which eliminates random segregation of these plasmids, thereby enhancing their inheritance and stability; to accomplish this, we incorporated either the par locus from pSC101, the parA locus from pR1, or both. We monitored the stability of optimized expression plasmids within CVD 908-htrA by quantitating expression of a variant of green fluorescent protein (GFPuv) by using flow cytometry. In this report, we demonstrate the utility of this novel plasmid maintenance system in enhancing the stability of our expression plasmids and go on to show that as the copy number of stabilized plasmids increases, the toxicity of GFPuv synthesis also increases. The implications of these observations for the rational design of immunogenic and protective bacterial live vector vaccines are discussed. PMID:10569759

  1. Flagellins of Salmonella Typhi and nonpathogenic Escherichia coli are differentially recognized through the NLRC4 pathway in macrophages.

    PubMed

    Yang, Jingyi; Zhang, Ejuan; Liu, Fang; Zhang, Yan; Zhong, Maohua; Li, Yaoming; Zhou, Dihan; Chen, Yaoqing; Cao, Yuan; Xiao, Yang; He, Benxia; Yang, Yi; Sun, Ying; Lu, Mengji; Yan, Huimin

    2014-01-01

    Flagellin is recognized by both Toll-like receptor (TLR)5 and NAIP5/NLRC4 inflammasome receptors. We hypothesized that the flagellins derived from different bacteria might differentially activate TLR5 and/or NAIP5/NLRC4 signal pathways. To test this, the immune recognition of recombinant flagellins derived from pathogenic Salmonella Typhi (SF) and the nonpathogenic Escherichia coli K12 strain MG1655 (KF) were examined by the activation of TLR5 and NLRC4 pathways in various cell types. While flagellins SF and KF were not distinguishable in activating the TLR5 pathway, KF induced significantly less interleukin-1β production and pyroptotic cell death in peritoneal macrophages than SF, and showed markedly lower efficiency in activating caspase-1 through the NLRC4 pathway than SF. Macrophages may differentially recognize flagellins by intracellular sensors and thereby initiate the immune response to invading pathogenic bacteria. Our findings suggest an active role of flagellin as an important determinant in host differential immune recognition and for the control of bacteria infection.

  2. Further consideration of the clonal nature of Salmonella typhi: evaluation of molecular and clinical characteristics of strains from Indonesia and Peru.

    PubMed Central

    Franco, A; Gonzalez, C; Levine, O S; Lagos, R; Hall, R H; Hoffman, S L; Moechtar, M A; Gotuzzo, E; Levine, M M; Hone, D M

    1992-01-01

    We examined envelope protein profiles, chromosomal restriction endonuclease digest patterns, and immune responses to envelope proteins for collections of Salmonella typhi strains isolated in Peru and Indonesia. Only minor differences in envelope protein patterns were apparent among strains. Strains from 7 of 20 Indonesian patients had a distinct chromosomal digest pattern compared with patterns of Peruvian and other Indonesian strains. Strains with this pattern carried the gene for the j flagellar antigen (H1-j); differences in response to envelope proteins of j and d strains were noted on immunoblot analysis. Our data suggest that there are genotypic and phenotypic differences among S. typhi strains. The clinical importance of these differences remains to be fully evaluated; however, in this study it was not possible to show a clear correlation between strain characteristics and disease severity. Images PMID:1500532

  3. An Outbreak of Food-Borne Typhoid Fever Due to Salmonella enterica Serotype Typhi in Japan Reported for the First Time in 16 Years

    PubMed Central

    Kobayashi, Tetsuro; Kutsuna, Satoshi; Hayakawa, Kayoko; Kato, Yasuyuki; Ohmagari, Norio; Uryu, Hideko; Yamada, Ritsuko; Kashiwa, Naoyuki; Nei, Takahito; Ehara, Akihito; Takei, Reiko; Mori, Nobuaki; Yamada, Yasuhiro; Hayasaka, Tomomi; Kagawa, Narito; Sugawara, Momoko; Suzaki, Ai; Takahashi, Yuno; Nishiyama, Hiroyuki; Morita, Masatomo; Izumiya, Hidemasa; Ohnishi, Makoto

    2016-01-01

    For the first time in 16 years, a food-borne outbreak of typhoid fever due to Salmonella enterica serotype Typhi was reported in Japan. Seven patients consumed food in an Indian buffet at a restaurant in the center of Tokyo, while one was a Nepali chef in the restaurant, an asymptomatic carrier and the implicated source of this outbreak. The multiple-locus variable-number tandem repeat analysis showed 100% consistency in the genomic sequence for five of the eight cases. PMID:26621565

  4. PrpZ, a Salmonella enterica serovar Typhi serine/threonine protein phosphatase 2C with dual substrate specificity.

    PubMed

    Lai, Sio Mei; Le Moual, Hervé

    2005-04-01

    Genes encoding eukaryotic-type protein kinases and phosphatases are present in many bacterial genomes. An ORF encoding a polypeptide with homology to protein phosphatases 2C (PP2Cs) was identified in the genomes of Salmonella enterica serovar Typhi strains CT18 and Ty2. This protein, termed PrpZ, is the first PP2C to be identified in enterobacteria. Analysis of the amino acid sequence revealed two distinct domains: the N-terminal segment containing motifs of the catalytic domain of PP2Cs and the C-terminal segment with unknown function. PrpZ was expressed in Escherichia coli as a histidine-tagged fusion protein (PrpZ(His)) and the purified protein was analysed for its ability to dephosphorylate various substrates. Using p-nitrophenyl phosphate as a substrate, optimal PrpZ(His) activity was observed at pH 9.5, with a strong preference for Mn(2+) over Mg(2+). Activity of PrpZ(His) was inhibited by EDTA, sodium fluoride, sodium phosphate and sodium pyrophosphate but unaffected by okadaic acid, indicating that PrpZ is a PP2C. Using synthetic phosphopeptides as substrates, PrpZ(His) could hydrolyse phosphorylated serine, threonine or tyrosine residues, with the highest catalytic efficiency (k(cat)/K(m)) for the threonine phosphopeptide. With phosphorylated myelin basic protein (MBP) as the substrate, Mn(2+) was only twofold more efficient than Mg(2+) in stimulating PrpZ(His) activity at pH 8.0. The ability of PrpZ(His) to remove the phosphoryl group from phosphotyrosine residues was confirmed by measuring the release of inorganic phosphate from phospho-Tyr MBP. Together, these data indicate that PrpZ has all the features of a PP2C with dual substrate specificity in vitro.

  5. Development of an Acid-Resistant Salmonella Typhi Ty21a Attenuated Vector For Improved Oral Vaccine Delivery

    PubMed Central

    Feuille, Catherine M.; Starke, Carly Elizabeth C.; Bhagwat, Arvind A.; Stibitz, Scott; Kopecko, Dennis J.

    2016-01-01

    The licensed oral, live-attenuated bacterial vaccine for typhoid fever, Salmonella enterica serovar Typhi strain Ty21a, has also been utilized as a vaccine delivery platform for expression of diverse foreign antigens that stimulate protection against shigellosis, anthrax, plague, or human papilloma virus. However, Ty21a is acid-labile and, for effective oral immunization, stomach acidity has to be either neutralized with buffer or by-passed with Ty21a in an enteric-coated capsule (ECC). Several studies have shown that efficacy is reduced when Ty21a is administered in an ECC versus as a buffered liquid formulation, the former limiting exposure to GI tract lymphoid tissues. However, the ECC was selected as a more practical delivery format for both packaging/shipping and vaccine administration ease. We have sought to increase Ty21a acid-resistance to allow for removal from the ECC and immune enhancement. To improve Ty21a acid-resistance, glutamate-dependent acid resistance genes (GAD; responsible for Shigella spp. survival at very low pH) were cloned on a multi-copy plasmid (pGad) under a controllable arabinose-inducible promoter. pGad enhanced acid survival of Ty21a by 5 logs after 3 hours at pH 2.5, when cells were pre-grown in arabinose and under conditions that promote an acid-tolerance response (ATR). For genetically 100% stable expression, we inserted the gad genes into the Ty21a chromosome, using a method that allowed for subsequent removal of a selectable antibiotic resistance marker. Further, both bacterial growth curves and survival assays in cultured human monocytes/macrophages suggest that neither the genetic methods employed nor the resulting acid-resistance conferred by expression of the Gad proteins in Ty21a had any effect on the existing attenuation of this vaccine strain. PMID:27673328

  6. Effect of selected plant essential oils or their constituents and modified atmosphere packaging on the radiosensitivity of Escherichia coli O157:H7 and Salmonella typhi in ground beef.

    PubMed

    Turgis, M; Borsa, J; Millette, M; Salmieri, S; Lacroix, M

    2008-03-01

    Twenty-six different essential oils were tested for their efficiency to increase the relative radiosensitivity of Escherichia coli and Salmonella Typhi in medium-fat ground beef (23% fat). Ground beef was inoculated with E. coli O157:H7 or Salmonella (10(6) CFU/g), and each essential oil or one of their main constituents was added separately at a concentration of 0.5% (wt/wt). Meat samples (10 g) were packed under air or under modified atmosphere and irradiated at doses from 0 to 1 kGy for the determination of the D10-value of E. coli O157:H7, and from 0 to 1.75 kGy for the determination of the D10-value of Salmonella Typhi. Depending on the compound tested, the relative radiation sensitivity increased from 1 to 3.57 for E. coli O157:H7 and from 1 to 3.26 for Salmonella Typhi. Addition of essential oils or their constituents before irradiation also reduced the irradiation dose needed to eliminate both pathogens. In the presence of Chinese cinnamon or Spanish oregano essential oils, the minimum doses required to eliminate the bacteria were reduced from 1.2 to 0.35 and from 1.4 to 0.5 for E. coli O157:H7 and Salmonella Typhi, respectively. Cinnamon, oregano, and mustard essential oils were the most effective radiosensitizers.

  7. Immunoblot detection of class-specific humoral immune response to outer membrane proteins isolated from Salmonella typhi in humans with typhoid fever.

    PubMed Central

    Ortiz, V; Isibasi, A; García-Ortigoza, E; Kumate, J

    1989-01-01

    The studies reported here were undertaken to assess the ability of the outer membrane proteins (OMPs) of Salmonella typhi to induce a humoral immune response in humans with typhoid fever. OMPs were isolated with the nonionic detergent Triton X-100 and were found to be contaminated with approximately 4% lipopolysaccharide. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis patterns showed protein bands with molecular size ranges from 17 to 70 kilodaltons; the major groups of proteins were those that correspond to the porins and OmpA of gram-negative bacteria. Rabbit antiserum to OMPs or to S. typhi recognized OMPs after absorption with lipopolysaccharide. Sera from patients with typhoid fever contained immunoglobulin M antibodies which reacted with a protein of 28 kilodaltons and immunoglobulin G antibodies which reacted mainly with the porins, as determined by immunoblotting. These results indicate that the porins are the major immunogenic OMPs from S. typhi and that the immune response induced in the infection could be related to the protective status. Images PMID:2768450

  8. Immunoblot detection of class-specific humoral immune response to outer membrane proteins isolated from Salmonella typhi in humans with typhoid fever.

    PubMed

    Ortiz, V; Isibasi, A; García-Ortigoza, E; Kumate, J

    1989-07-01

    The studies reported here were undertaken to assess the ability of the outer membrane proteins (OMPs) of Salmonella typhi to induce a humoral immune response in humans with typhoid fever. OMPs were isolated with the nonionic detergent Triton X-100 and were found to be contaminated with approximately 4% lipopolysaccharide. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis patterns showed protein bands with molecular size ranges from 17 to 70 kilodaltons; the major groups of proteins were those that correspond to the porins and OmpA of gram-negative bacteria. Rabbit antiserum to OMPs or to S. typhi recognized OMPs after absorption with lipopolysaccharide. Sera from patients with typhoid fever contained immunoglobulin M antibodies which reacted with a protein of 28 kilodaltons and immunoglobulin G antibodies which reacted mainly with the porins, as determined by immunoblotting. These results indicate that the porins are the major immunogenic OMPs from S. typhi and that the immune response induced in the infection could be related to the protective status.

  9. Type IV(B) pili are required for invasion but not for adhesion of Salmonella enterica serovar Typhi into BHK epithelial cells in a cystic fibrosis transmembrane conductance regulator-independent manner.

    PubMed

    Bravo, Denisse; Blondel, Carlos J; Hoare, Anilei; Leyton, Lisette; Valvano, Miguel A; Contreras, Inés

    2011-11-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) has been proposed as an epithelial cell receptor for the entry of Salmonella Typhi but not Salmonella Typhimurium. The bacterial ligand recognized by CFTR is thought to reside either in the S. Typhi lipopolysaccharide core region or in the type IV pili. Here, we assessed the ability of virulent strains of S. Typhi and S. Typhimurium to adhere to and invade BHK epithelial cells expressing either the wild-type CFTR protein or the ∆F508 CFTR mutant. Both S. Typhi and S. Typhimurium invaded the epithelial cells in a CFTR-independent fashion. Furthermore and also in a CFTR-independent manner, a S. Typhi pilS mutant adhered normally to BHK cells but displayed a 50% reduction in invasion as compared to wild-type bacteria. Immunofluorescence microscopy revealed that bacteria and CFTR do not colocalize at the epithelial cell surface. Together, our results strongly argue against the established dogma that CFTR is a receptor for entry of Salmonella to epithelial cells.

  10. Multi-drug resistance and reduced susceptibility to ciprofloxacin among Salmonella enterica serovar Typhi isolates from the Middle East and Central Asia

    PubMed Central

    Rahman, B A; Wasfy, M O; Maksoud, M A; Hanna, N; Dueger, E; House, B

    2014-01-01

    Typhoid fever is common in developing countries, with an estimated 120 million infections and 700 000 annual deaths, worldwide. Fluoroquinolones have been the treatment of choice for infection with multidrug-resistant (MDR) Salmonella enterica serovar Typhi (S. Typhi). However, alarming reports of fluoroquinolone-resistance and failure of typhoid fever treatment have recently been published. To determine the proportion of S. Typhi isolates with reduced susceptibility to ciprofloxacin (RSC) from six countries in the Middle East and Central Asia, 968 S. Typhi isolates collected between 2002 and 2007 from Egypt, Uzbekistan, Pakistan, Qatar, Jordan and Iraq were tested for antibiotic susceptibility to five antibiotics using the disc-diffusion method. MDR was defined as resistance to amicillin, chloramphenicol and trimethoprim-sulfamethoxazole. The E-test was employed to determine the MIC of ciprofloxacin only. Nalidixic acid resistance was evaluated as a marker for RSC. Interpretations were made according to CLSI guidelines. MDR strains were considerably more prevalent in Iraq (83%) and Pakistan (52%) compared with the other countries studied (13–52%). Nearly all isolates were susceptible (99.7%) to ceftriaxone. RSC was detected in a total of 218 isolates (22%), mostly from Iraq (54/59, 92%), Uzbekistan (98/123, 80%), Qatar (23/43, 54%) and Pakistan (31/65, 47%). Many of these (21%) were also MDR. Use of nalidixic acid resistance as an indicator for RSC was 99% sensitive and 98% specific. This study reinforces the need for routine antimicrobial susceptibility surveillance of enteric fever isolates and close review of current therapeutic policies in the region. PMID:25356352

  11. A New Generation of Stable, Nonantibiotic, Low-Copy-Number Plasmids Improves Immune Responses to Foreign Antigens in Salmonella enterica Serovar Typhi Live Vectors▿ §

    PubMed Central

    Galen, James E.; Wang, Jin Yuan; Chinchilla, Magaly; Vindurampulle, Christopher; Vogel, Jeffrey E.; Levy, Haim; Blackwelder, William C.; Pasetti, Marcela F.; Levine, Myron M.

    2010-01-01

    We hypothesized that adequately engineered attenuated Salmonella enterica serovar Typhi strains can serve as multivalent mucosal live vector vaccines to immunize against unrelated human pathogens. Toward this ultimate goal, we have developed a novel genetic stabilization system for antigen-expressing plasmids, engineered to encode the single-stranded binding protein (SSB), an essential protein involved in DNA metabolism which was deleted from the live vector chromosome. We utilized full-length protective antigen (PA83) of anthrax toxin from Bacillus anthracis as a foreign antigen and expressed PA83 as a fusion with the ClyA export protein, which allows export of ClyA-PA83 to the surface of S. Typhi live vectors. A series of SSB-encoding multicopy expression plasmids were introduced into reengineered S. Typhi strains previously tested in clinical trials, i.e., CVD 908-htrA and its less attenuated parent CVD 908. Immunogenicity was examined using a mouse model of intranasal immunization with live vector, followed by parenteral boosting with purified PA83. PA-specific antibody responses markedly improved as the copy number of the SSB-encoding plasmids decreased, and this effect was dramatically enhanced when the foreign antigen was delivered by the less attenuated live vector CVD 908ssb. These results suggest that antibody responses to antigens delivered by S. Typhi live vectors are inversely related to the metabolic burden imposed by expression of the foreign antigen and that these responses can be improved when antigens are expressed from low-copy-number plasmids and exported out of the cytoplasm of less attenuated live vectors. PMID:19884333

  12. Live oral Salmonella enterica serovar Typhi vaccines Ty21a and CVD 909 induce opsonophagocytic functional antibodies in humans that cross-react with S. Paratyphi A and S. Paratyphi B.

    PubMed

    Wahid, Rezwanul; Zafar, Shah J; McArthur, Monica A; Pasetti, Marcela F; Levine, Myron M; Sztein, Marcelo B

    2014-03-01

    Live oral Salmonella enterica serovar Typhi vaccine Ty21a induces specific antibodies that cross-react against Salmonella enterica serovar Paratyphi A and Salmonella enterica serovar Paratyphi B, although their functional role in clearance remains unknown. We utilized an in vitro assay with THP-1 macrophages to compare the phagocytosis and survival of Salmonella opsonized with heat-inactivated human sera obtained before and after vaccination with Ty21a or a live oral S. Typhi vaccine, CVD 909. Opsonization with postvaccination sera predominantly increased the phagocytosis of S. Typhi relative to the corresponding prevaccination sera, and increases were also observed with S. Paratyphi A and S. Paratyphi B, albeit of lower magnitudes. Relative to prevaccination sera, opsonization with the postvaccination sera reduced the survival inside macrophages of S. Typhi but not of S. Paratyphi A or S. Paratyphi B. Higher anti-S. Typhi O antigen (lipopolysaccharide [LPS]) IgG, but not IgA, antibody titers correlated significantly with postvaccination increases in opsonophagocytosis. No differences were observed between immunization with four doses of Ty21a or one dose of CVD 909. Ty21a and CVD 909 induced cross-reactive functional antibodies, predominantly against S. Typhi. IgG anti-LPS antibodies may be important in phagocytic clearance of these organisms. Therefore, measurement of functional antibodies might be important in assessing the immunogenicity of a new generation of typhoid and paratyphoid A vaccines. (The CVD 909 study has been registered at ClinicalTrials.gov under registration no. NCT00326443.).

  13. Lose to win: marT pseudogenization in Salmonella enterica serovar Typhi contributed to the surV-dependent survival to H2O2, and inside human macrophage-like cells.

    PubMed

    Ortega, A P; Villagra, N A; Urrutia, I M; Valenzuela, L M; Talamilla-Espinoza, A; Hidalgo, A A; Rodas, P I; Gil, F; Calderón, I L; Paredes-Sabja, D; Mora, G C; Fuentes, J A

    2016-11-01

    The difference in host range between Salmonella enterica serovar Typhimurium (S. Typhimurium) and Salmonella enterica serovar Typhi (S. Typhi) can be partially attributed to the gain of functions, to the loss of functions (i.e. pseudogenization), or to a combination of both processes. As previously reported, the loss of functions by pseudogenization may play a role in bacterial evolution, especially in host-restricted pathogens such as S. Typhi. The marT-fidL operon, located at the SPI-3, encodes the MarT transcriptional regulator and a hypothetical protein (i.e. FidL) with no significant similarities to known proteins, respectively. Even though predicted S. Typhimurium FidL exhibit 99.4% identity with S. Typhi FidL, marT has been annotated as a pseudogene in S. Typhi. In this work, we found that S. Typhi expressing S. Typhimurium marT-fidL exhibited an increased accumulation of reactive oxygen species (ROS), leading to a decreased survival in presence of H2O2. Moreover, we found that that the presence of a functional copy of S. Typhimurium marT-fidL in S. Typhi resulted in a repression of surV (STY4039), an ORF found in the S. Typhi SPI-3 but absent from S. Typhimurium SPI-3, that contribute to the resistance to H2O2 by decreasing the accumulation of ROS. Finally, we observed that the presence of S. Typhimurium marT-fidL in S. Typhi negatively affected the survival inside macrophage-like cells, but not in epithelial cells, after 24h post infection. Therefore, this work provides evidence arguing that marT pseudogenization in Salmonella Typhi contributed to the surV-dependent survival against H2O2, and inside human macrophage-like cells. This is a good example of how the loss of functions (marT pseudogenization) and the gain of functions (presence of surV) might contribute to phenotypic changes improving virulence.

  14. Immunization with Ty21a live oral typhoid vaccine elicits crossreactive multifunctional CD8+ T-cell responses against Salmonella enterica serovar Typhi, S. Paratyphi A, and S. Paratyphi B in humans.

    PubMed

    Wahid, R; Fresnay, S; Levine, M M; Sztein, M B

    2015-11-01

    Previously we have extensively characterized Salmonella enterica serovar Typhi (S. Typhi)-specific cell-mediated immune (CMI) responses in volunteers orally immunized with the licensed Ty21a typhoid vaccine. In this study we measured Salmonella-specific multifunctional (MF) CD8+ T-cell responses to further investigate whether Ty21a elicits crossreactive CMI against S. Paratyphi A and S. Paratyphi B that also cause enteric fever. Ty21a-elicited crossreactive CMI responses against all three Salmonella serotypes were predominantly observed in CD8+ T effector/memory (T(EM)) and, to a lesser extent, in CD8+CD45RA+ T(EM) (T(EMRA)) subsets. These CD8+ T-cell responses were largely mediated by MF cells coproducing interferon-γ and macrophage inflammatory protein-1β and expressing CD107a with or without tumor necrosis factor-α. Significant proportions of Salmonella-specific MF cells expressed the gut-homing molecule integrin α4β7. In most subjects, similar MF responses were observed to S. Typhi and S. Paratyphi B, but not to S. Paratyphi A. These results suggest that Ty21a elicits MF CMI responses against Salmonella that could be critical in clearing the infection. Moreover, because S. Paratyphi A is a major public concern and Ty21a was shown in field studies not to afford cross-protection to S. Paratyphi A, these results will be important in developing a S. Typhi/S. Paratyphi A bivalent vaccine against enteric fevers.

  15. Occurrence of β-lactamase genes among non-Typhi Salmonella enterica isolated from humans, food animals, and retail meats in the United States and Canada.

    PubMed

    Sjölund-Karlsson, Maria; Howie, Rebecca L; Blickenstaff, Karen; Boerlin, Patrick; Ball, Takiyah; Chalmers, Gabhan; Duval, Brea; Haro, Jovita; Rickert, Regan; Zhao, Shaohua; Fedorka-Cray, Paula J; Whichard, Jean M

    2013-06-01

    Non-Typhi Salmonella cause over 1.7 million cases of gastroenteritis in North America each year, and food-animal products are commonly implicated in human infections. For invasive infections, antimicrobial therapy is indicated. In North America, the antimicrobial susceptibility of Salmonella is monitored by the U.S. National Antimicrobial Resistance Monitoring System (NARMS) and The Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS). In this study, we determined the susceptibility to cephalosporins by broth microdilution among 5,041 non-Typhi Salmonella enterica isolated from food animals, retail meats, and humans. In the United States, 109 (4.6%) of isolates collected from humans, 77 (15.7%) from retail meat, and 140 (10.6%) from food animals displayed decreased susceptibility to cephalosporins (DSC). Among the Canadian retail meat and food animal isolates, 52 (13.0%) and 42 (9.4%) displayed DSC. All isolates displaying DSC were screened for β-lactamase genes (bla(TEM), bla(SHV), bla(CMY), bla(CTX-M), and bla(OXA-1)) by polymerase chain reaction. At least one β-lactamase gene was detected in 74/109 (67.9%) isolates collected from humans, and the bla(CMY) genes were most prevalent (69/109; 63.3%). Similarly, the bla(CMY) genes predominated among the β-lactamase-producing isolates collected from retail meats and food animals. Three isolates from humans harbored a bla(CTX-M-15) gene. No animal or retail meat isolates harbored a bla(CTX-M) or bla(OXA-1) gene. A bla(TEM) gene was found in 5 human, 9 retail meat, and 17 animal isolates. Although serotype distributions varied among human, retail meat, and animal sources, overlap in bla(CMY)-positive serotypes across sample sources supports meat and food-animal sources as reservoirs for human infection.

  16. Effect of reduced graphene oxide-hybridized ZnO thin films on the photoinactivation of Staphylococcus aureus and Salmonella enterica serovar Typhi.

    PubMed

    Teh, Swe Jyan; Yeoh, Soo Ling; Lee, Kian Mun; Lai, Chin Wei; Abdul Hamid, Sharifah Bee; Thong, Kwai Lin

    2016-08-01

    The immobilization of photocatalyst nanoparticles on a solid substrate is an important aspect for improved post-treatment separation and photocatalyst reactor design. In this study, we report the simple preparation of reduced graphene oxide (rGO)-hybridized zinc oxide (ZnO) thin films using a one-step electrochemical deposition, and investigated the effect of rGO-hybridization on the photoinactivation efficiency of ZnO thin films towards Staphylococcus aureus (S. aureus) and Salmonella enterica serovar Typhi (S. Typhi) as target bacterial pathogens. Field-emission scanning electron microscopy (FESEM) revealed the formation of geometric, hexagonal flakes of ZnO on the ITO glass substrate, as well as the incorporation of rGO with ZnO in the rGO/ZnO thin film. Raman spectroscopy indicated the successful incorporation of rGO with ZnO during the electrodeposition process. Photoluminescence (PL) spectroscopy indicates that rGO hybridization with ZnO increases the amount of oxygen vacancies, evidenced by the shift of visible PL peak at 650 to 500nm. The photoinactivation experiments showed that the thin films were able to reduce the bacterial cell density of Staph. aureus and S. Typhi from an initial concentration of approximately 10(8) to 10(3)CFU/mL within 15min. The rGO/ZnO thin film increased the photoinactivation rate for S. aureus (log[N/No]) from -5.1 (ZnO) to -5.9. In contrast, the application of rGO/ZnO thin film towards the photoinactivation of S. Typhi did not improve its photoinactivation rate, compared to the ZnO thin film. We may summarise that (1) rGO/ZnO was effective to accelerate the photoinactivation of S. aureus but showed no difference to improve the photoinactivation of S. Typhi, in comparison to the performance of ZnO thin films, and (2) the photoinactivation in the presence of ZnO and rGO/ZnO was by ROS damage to the extracellular wall.

  17. The novel cis-encoded antisense RNA AsrC positively regulates the expression of rpoE-rseABC operon and thus enhances the motility of Salmonella enterica serovar typhi

    PubMed Central

    Zhang, Qi; Zhang, Ying; Zhang, Xiaolei; Zhan, Lifang; Zhao, Xin; Xu, Shungao; Sheng, Xiumei; Huang, Xinxiang

    2015-01-01

    Bacterial non-coding RNAs are essential in many cellular processes, including response to environmental stress, and virulence. Deep sequencing analysis of the Salmonella enterica serovar typhi (S. typhi) transcriptome revealed a novel antisense RNA transcribed in cis on the strand complementary to rseC, an activator gene of sigma factor RpoE. In this study, expression of this antisense RNA was confirmed in S. typhi by Northern hybridization. Rapid amplification of cDNA ends and sequence analysis identified an 893 bp sequence from the antisense RNA coding region that covered all of the rseC coding region in the reverse direction of transcription. This sequence of RNA was named as AsrC. After overexpression of AsrC with recombinantant plasmid in S. typhi, the bacterial motility was increased obviously. To explore the mechanism of AsrC function, regulation of rseC and rpoE expression by AsrC was investigated. We found that AsrC increased the levels of rseC mRNA and protein. The expression of rpoE was also increased in S. typhi after overexpression of AsrC, which was dependent on rseC. Thus, we propose that AsrC increased RseC level and indirectly activating RpoE which can initiate fliA expression and promote the motility of S. typhi. PMID:26441919

  18. Comparative effect of methioninyl adenylate on the growth of Salmonella typhimurium and Pseudomonas aeruginosa.

    PubMed

    Enouf, J; Laurence, F; Farrugia, G; Blanchard, P; Robert-Gero, M

    1976-10-11

    The bacteriostatic effect of methioninyl adenylate(MAMP)--a specific inhibitor of the enzyme methionyl-tRNA synthetase--was investigated on Salmonella typhimurium and Pseudomonas aeruginosa. 0.1 mM of this molecule added to the culture, inhibits the growth of S. typhimurium. The inhibition is specifically reversible by 0.1 mM L-methionine. In the same conditions even 1-2 mM MAMP has a very slight effect on the growth rate of P. aeruginosa and only during the first two generations. The same observation was made with the two other members of the fluorescens group P.fluorescens and P.putida. The growth rate of P. testosteroni with 1 mM MAMP in the medium is similar to the growth rate of P. aeruginosa but the other member of the acidovorans group P. acidovorans is much more affected by the smae concentration of the inhibitor. --P. multivorans is inhibited by MAMP like P. acidovorans but with a somewhat higher yield at the end of the culture. --MAMP has no effect on P. alcaligenes. The possible reasons for the weak bacteriostatic effect of MAMP on P. aeruginosa were investigated. It was established that the inhibitor enters the cells and is not used as a carbon and energy source. The intracellular methionine concentration in S. typhimurium and in P. aeruginosa is about the same and does not increase when bacteria are cultivated with MAMP. The MTS of the two microorganisms is inhibited by MAMP in vitro to about the same extent. Furthermore the tRNAmet from P. aeruginosa are fully acylated after 3 to 4 generations with this compound. Nevertheless MAMP elicits higher MTS activity in P. aeruginosa and in P. acidovorans after 1 h of incubation. The most striking difference between S. typhimurium and P. aeruginosa is that the intra and extracellular level of 5'phosphodiesterase which degrades MAMP is 10-20 fold higher in the second than in the first species.

  19. Enhanced Immunity to Plasmodium falciparum Circumsporozoite Protein (PfCSP) by Using Salmonella enterica Serovar Typhi Expressing PfCSP and a PfCSP-Encoding DNA Vaccine in a Heterologous Prime-Boost Strategy▿ †

    PubMed Central

    Chinchilla, Magaly; Pasetti, Marcela F.; Medina-Moreno, Sandra; Wang, Jin Yuan; Gomez-Duarte, Oscar G.; Stout, Rick; Levine, Myron M.; Galen, James E.

    2007-01-01

    Two Salmonella enterica serovar Typhi strains that express and export a truncated version of Plasmodium falciparum circumsporozoite surface protein (tCSP) fused to Salmonella serovar Typhi cytolysin A (ClyA) were constructed as a first step in the development of a preerythrocytic malaria vaccine. Synthetic codon-optimized genes (t-csp1 and t-csp2), containing immunodominant B- and T-cell epitopes present in native P. falciparum circumsporozoite surface protein (PfCSP), were fused in frame to the carboxyl terminus of the ClyA gene (clyA::t-csp) in genetically stabilized expression plasmids. Expression and export of ClyA-tCSP1 and ClyA-tCSP2 by Salmonella serovar Typhi vaccine strain CVD 908-htrA were demonstrated by immunoblotting of whole-cell lysates and culture supernatants. The immunogenicity of these constructs was evaluated using a “heterologous prime-boost” approach consisting of mucosal priming with Salmonella serovar Typhi expressing ClyA-tCSP1 and ClyA-tCSP2, followed by parenteral boosting with PfCSP DNA vaccines pVR2510 and pVR2571. Mice primed intranasally on days 0 and 28 with CVD 908-htrA(pSEC10tcsp2) and boosted intradermally on day 56 with PfCSP DNA vaccine pVR2571 induced high titers of serum NANP immunoglobulin G (IgG) (predominantly IgG2a); no serological responses to DNA vaccination were observed in the absence of Salmonella serovar Typhi-PfCSP priming. Mice primed with Salmonella serovar Typhi expressing tCSP2 and boosted with PfCSP DNA also developed high frequencies of gamma interferon-secreting cells, which surpassed those produced by PfCSP DNA in the absence of priming. A prime-boost regimen consisting of mucosal delivery of PfCSP exported from a Salmonella-based live-vector vaccine followed by a parenteral PfCSP DNA boosting is a promising strategy for the development of a live-vector-based malaria vaccine. PMID:17502396

  20. In Vivo Characterization of the Murine Intranasal Model for Assessing the Immunogenicity of Attenuated Salmonella enterica Serovar Typhi Strains as Live Mucosal Vaccines and as Live Vectors

    PubMed Central

    Pickett, Thames E.; Pasetti, Marcela F.; Galen, James E.; Sztein, Marcelo B.; Levine, Myron M.

    2000-01-01

    Attenuated Salmonella enterica serovar Typhi live vector vaccine strains are highly immunogenic in mice following intranasal but not orogastric inoculation. To elucidate the relationship between organs within which vaccine organisms are found and the induction of specific serum immunoglobulin G (IgG) antibodies, we examined the in vivo distribution of serovar Typhi vaccine strain CVD 908-htrA following intranasal administration. Vaccine organisms were cultured from the nasal lymphoid tissue (NALT), lungs, and Peyer's patches 2 min after intranasal inoculation. Vaccine organisms persisted longer in NALT than in other organs. By decreasing the volume of intranasal inoculum containing 109 CFU (from a single 30- or 10-μl dose to four 2.5-μl doses given over the course of 1 h), we were able to significantly reduce the number of vaccine organisms isolated from the lungs (P < 0.05) without reducing the number of vaccine organisms in NALT. Reducing the number of vaccine organisms in the lungs resulted in a significant decrease in the serum tetanus antitoxin response elicited by CVD 908-htrA expressing tetanus toxin fragment C under the control of the redox-responsive nir15 promoter. In contrast, a similar construct expressing tetanus toxin fragment C under control of the constitutive lpp promoter stimulated a strong serum IgG tetanus antitoxin response with both inoculation regimens. The data suggest that following intranasal inoculation, NALT is a sufficient inductive site for elicitation of an immune response against both the live vector and heterologous antigen and, as occurs following oral inoculation of humans, attenuated serovar Typhi vaccine organisms elicit serum IgG responses. PMID:10603389

  1. Exploring insights for virulent gene inhibition of multidrug resistant Salmonella typhi, Vibrio cholerae, and Staphylococcus areus by potential phytoligands via in silico screening.

    PubMed

    Skariyachan, Sinosh; Jayaprakash, Nisha; Bharadwaj, Navya; Narayanappa, Rajeswari

    2014-01-01

    In our recent studies on prevalence of multidrug resistant pathogens in Byramangala reservoir, Karnataka, India, we identified Salmonella typhi, Staphylococcus aureus, and Vibrio cholerae which had acquired multiple drug resistance (MDR) and emerged as superbugs. Hence, there is a pressing demand to identify alternative therapeutic remedies. Our study focused on the screening of herbal leads by structure-based virtual screening. The virulent gene products of these pathogens towards Kanamycin(aph), Trimethoprim(dfrA1), Methicillin (mecI), and Vancomycin (vanH) were identified as the probable drug targets and their 3D structures were predicted by homology modeling. The predicted models showed good stereochemical validity. By extensive literature survey, we selected 58 phytoligands and their drug likeliness and pharmacokinetic properties were computationally predicted. The inhibitory properties of these ligands against drug targets were studied by molecular docking. Our studies revealed that Baicalein from S. baicalensis (baikal skullcap) and Luteolin from Taraxacum officinale (dandelion) were identified as potential inhibitors against aph of S. typhi. Resveratrol from Vitis vinifera (grape vine) and Wogonin from S. baicalensis were identified as potential inhibitors against dfrA1 of S. typhi. Herniarin from Herniaria glabra (rupture worts) and Pyrocide from Daucus carota (Carrot) were identified as the best leads against dfrA1 of V. cholerae. Taraxacin of T. officinale (weber) and Luteolin were identified as potential inhibitors against Mec1. Apigenin from Coffee arabica (coffee) and Luteolin were identified as the best leads against vanH of S. aureus. Our findings pave crucial insights for exploring alternative therapeutics against MDR pathogens.

  2. Decline in epidemic of multidrug resistant Salmonella typhi is not associated with increased incidence of antibiotic-susceptible strain in Bangladesh.

    PubMed Central

    Rahman, M.; Ahmad, A.; Shoma, S.

    2002-01-01

    Since 1987, multidrug resistant (MDR) strains of Salmonella Typhi, resistant simultaneously to ampicillin, chloramphenicol and trimethoprim-sulfamethoxazole, have caused epidemics of severe typhoid fever in Asia and Africa. A retrospective analysis of blood culture results (1989-96) in a Diarrhoea Treatment Centre in Dhaka, Bangladesh detected MDR strains in 0.3% (8 of 2793) of samples in 1990. The isolation rate peaked to 3.2% (240 of 7501) in 1994 (P < 0.01) and decreased to 1.8% (165 of 9348) in 1995 and further to 1.0% (82 of 8587) in 1996 (P < 0.01 compared to 1994) indicating the emergence and decline of MDR typhoid epidemic. Ten of 15 MDR strains tested had a 176 kb conjugative R plasmid that mediates resistance to ampicillin, chloramphenicol and trimethoprim-sulfamethoxazole to Escherichia coli K12. Unlike MDR strains, the isolation rate (approximately 3.3%) of susceptible S. Typhi remained remarkably unchanged during the study. The significant decrease in isolation of MDR strains suggests that cheaper and effective first-line antibiotics may re-emerge as drugs of choice for the treatment of typhoid fever in Bangladesh. PMID:12211593

  3. Mucosal immunization with attenuated Salmonella Typhi expressing anthrax PA83 primes monkeys for accelerated serum antibody responses to parenteral PA83 vaccine

    PubMed Central

    Galen, James E.; Chinchilla, Magaly; Pasetti, Marcela F.; Wang, Jin Yuan; Zhao, Licheng; Arciniega-Martinez, Ivonne; Silverman, David J.; Levine, Myron M.

    2008-01-01

    Salmonella enterica serovar Typhi vaccine strain CVD 908-htrA was genetically engineered for stable plasmid-based expression of protective antigen of anthrax toxin (PA83) fused with the export protein ClyA (ClyA-PA83). The priming potential of CVD 908-htrA expressing ClyA-PA83 was assessed in 12 rhesus and 20 cynomolgus macaques immunized mucosally (intranasally) on days 0 and 14. A parenteral boost with purified PA83 plus alum was given to rhesus macaques on days 42 and 225; cynomolgus monkeys were boosted only once, 3 months after priming, with either PA or licensed anthrax vaccine (Biothrax®). Monkeys primed with S. Typhi expressing ClyA-PA83 developed high levels of serum toxin neutralization activity (TNA) antibodies (> 1.3 ×103 ED50), 7 days after boosting, while unprimed controls lacked serum TNA (0 ED50). The success in non-human primates of this anthrax vaccine strategy based on heterologous mucosal prime followed by parenteral subunit vaccine boost paves the way for clinical trials. PMID:19099487

  4. Study on the production of IgG-, IgA- and IgM-antibodies to somatic antigens of Salmonella typhi in humans

    PubMed Central

    Chernokhvostova, Elena; Luxemburg, K. I.; Starshinova, Valentina; Andreeva, Natalia; German, Galina

    1969-01-01

    The immune response to O- and Vi-antigens of Salmonella typhi in humans was studied under a variety of conditions. In sera of persons immunized with various typhoid vaccines and with chemically purified Vi-antigen of S. typhi, anti-Vi-antibodies of three main immunoglobulin types (IgG, IgA and IgM) were found, but anti-O-antibodies were of IgM-type only. In sera of typhoid patients anti-O-antibodies of IgG-, IgA- and IgM-types were detected. Anti-Vi-antibodies appearing in the course of typhoid fever were heterogeneous to the same extent as anti-O-antibodies. The antibody response to Vi-antigen administered subcutaneously was quite similar in typhoid patients and in healthy individuals. Both anti-O- and anti-Vi-antibodies in sera of chronic typhoid carriers were usually of IgG-type only. Immunization of typhoid carriers with Vi-antigen was followed by the significant augmentation of IgG-antibody level, not preceded by IgM-antibody production. The possible reasons of IgM-deficiency in typhoid carrier state are discussed. ImagesFIG. 1 PMID:4182404

  5. Salmonella enterica Serotype Napoli is the First Cause of Invasive Nontyphoidal Salmonellosis in Lombardy, Italy (2010-2014), and Belongs to Typhi Subclade.

    PubMed

    Huedo, Pol; Gori, Maria; Zolin, Anna; Amato, Ettore; Ciceri, Giulia; Bossi, Anna; Pontello, Mirella

    2017-03-01

    Salmonella enterica serotype Napoli (S. Napoli) is currently emerging in Europe and particularly in Italy, where in 2014 it caused a large outbreak associated with elevated rates of bacteremia. However, no study has yet investigated its invasive ability and phylogenetic classification. Here, we show that between 2010 and 2014, S. Napoli was the first cause of invasive salmonellosis affecting 40 cases out of 687 (invasive index: 5.8%), which is significantly higher than the invasive index of all the other nontyphoidal serotypes (2.0%, p < 0.05). Genomic and phylogenetic analyses of an invasive isolate revealed that S. Napoli belongs to Typhi subclade in clade A, Paratyphi A being the most related serotype and carrying almost identical pattern of typhoid-associated genes. This work presents evidence of invasive capacity of S. Napoli and argues for reconsideration of its nontyphoidal category.

  6. Immunomodulatory and antimicrobial efficacy of Lactobacilli against enteropathogenic infection of Salmonella typhi: In-vitro and in-vivo study.

    PubMed

    Mazaya, Basem; Hamzawy, Mohamed A; Khalil, Mahmoud A F; Tawkol, Wael M; Sabit, Hussein

    2015-12-01

    Salmonellosis-induced diarrhea, is one of the commonest cause of childhood mortality in developing countries. Using of probiotics is viewed as a promising means for reducing the pathogenic loads of bacterial infection. The current study aimed to evaluate the potential antimicrobial and immunomodulatory efficacy of isolated lactobacillus strains against the enteropathogenic effect of S. Typhi. Different Lactobacillus strains were isolated from 13 dairy products. Their antimicrobial activities were tested against different bacterial strains. Six groups of CD1 mice were treated for 8 days as follows: group (1) untreated control; group (2) was challenged with single inoculation S. typhi, and groups (3) and (4) were treated with Lactobacillus plantarum (LA5) or Lactobacillus paracsi (LA7) for 7 days, respectively. Groups (5) and (6) were challenged with S. typhi, and then treated with either LA5 or LA 7 for 7 days, respectively. Isolated Lactobacillus showed antimicrobial activity against wide range of bacterial strains. Salmonellosis showed high widal titer, induced significant disturbance of TNF and IL-1β, while sever changes of the histological patterns of the intestinal villi and hepatocytes have been illustrated. LA5 or LA7 succeeded to eradicate typhoid infection, restore the values of inflammatory cytokines to typical levels of control group, and improve histological pictures of intestinal and hepatic tissues. It can be concluded that lactobacilli are promising candidate in protection and eradication against bacterial infection induced by S. Typhi due to its antimicrobial, anti-inflammatory, and immunomodulatory activities.

  7. Genomic signature of multidrug-resistant Salmonella enterica serovar typhi isolates related to a massive outbreak in Zambia between 2010 and 2012.

    PubMed

    Hendriksen, Rene S; Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Lukwesa-Musyani, Chileshe; Tambatamba, Bushimbwa; Mwaba, John; Kalonda, Annie; Nakazwe, Ruth; Kwenda, Geoffrey; Jensen, Jacob Dyring; Svendsen, Christina A; Dittmann, Karen K; Kaas, Rolf S; Cavaco, Lina M; Aarestrup, Frank M; Hasman, Henrik; Mwansa, James C L

    2015-01-01

    Retrospectively, we investigated the epidemiology of a massive Salmonella enterica serovar Typhi outbreak in Zambia during 2010 to 2012. Ninety-four isolates were susceptibility tested by MIC determinations. Whole-genome sequence typing (WGST) of 33 isolates and bioinformatic analysis identified the multilocus sequence type (MLST), haplotype, plasmid replicon, antimicrobial resistance genes, and genetic relatedness by single nucleotide polymorphism (SNP) analysis and genomic deletions. The outbreak affected 2,040 patients, with a fatality rate of 0.5%. Most (83.0%) isolates were multidrug resistant (MDR). The isolates belonged to MLST ST1 and a new variant of the haplotype, H58B. Most isolates contained a chromosomally translocated region containing seven antimicrobial resistance genes, catA1, blaTEM-1, dfrA7, sul1, sul2, strA, and strB, and fragments of the incompatibility group Q1 (IncQ1) plasmid replicon, the class 1 integron, and the mer operon. The genomic analysis revealed 415 SNP differences overall and 35 deletions among 33 of the isolates subjected to whole-genome sequencing. In comparison with other genomes of H58, the Zambian isolates separated from genomes from Central Africa and India by 34 and 52 SNPs, respectively. The phylogenetic analysis indicates that 32 of the 33 isolates sequenced belonged to a tight clonal group distinct from other H58 genomes included in the study. The small numbers of SNPs identified within this group are consistent with the short-term transmission that can be expected over a period of 2 years. The phylogenetic analysis and deletions suggest that a single MDR clone was responsible for the outbreak, during which occasional other S. Typhi lineages, including sensitive ones, continued to cocirculate. The common view is that the emerging global S. Typhi haplotype, H58B, containing the MDR IncHI1 plasmid is responsible for the majority of typhoid infections in Asia and sub-Saharan Africa; we found that a new variant of the

  8. Live Recombinant Salmonella Typhi Vaccines Constructed to Investigate the Role of rpoS in Eliciting Immunity to a Heterologous Antigen

    PubMed Central

    Brenneman, Karen E.; Wanda, Soo-Young; Wang, Shifeng; Senechal, Patti; Sun, Wei; Roland, Kenneth L.; Curtiss, Roy

    2010-01-01

    We hypothesized that the immunogenicity of live Salmonella enterica serovar Typhi vaccines expressing heterologous antigens depends, at least in part, on its rpoS status. As part of our project to develop a recombinant attenuated S. Typhi vaccine (RASTyV) to prevent pneumococcal diseases in infants and children, we constructed three RASTyV strains synthesizing the Streptococcus pneumoniae surface protein PspA to test this hypothesis. Each vector strain carried ten engineered mutations designed to optimize safety and immunogenicity. Two S. Typhi vector strains (χ9639 and χ9640) were derived from the rpoS mutant strain Ty2 and one (χ9633) from the RpoS+ strain ISP1820. In χ9640, the nonfunctional rpoS gene was replaced with the functional rpoS gene from ISP1820. Plasmid pYA4088, encoding a secreted form of PspA, was moved into the three vector strains. The resulting RASTyV strains were evaluated for safety in vitro and for immunogenicity in mice. All three RASTyV strains were similar to the live attenuated typhoid vaccine Ty21a in their ability to survive in human blood and human monocytes. They were more sensitive to complement and were less able to survive and persist in sewage and surface water than their wild-type counterparts. Adult mice intranasally immunized with any of the RASTyV strains developed immune responses against PspA and Salmonella antigens. The RpoS+ vaccines induced a balanced Th1/Th2 immune response while the RpoS− strain χ9639(pYA4088) induced a strong Th2 immune response. Immunization with any RASTyV provided protection against S. pneumoniae challenge; the RpoS+ strain χ9640(pYA4088) provided significantly greater protection than the ISP1820 derivative, χ9633(pYA4088). In the pre-clinical setting, these strains exhibited a desirable balance between safety and immunogenicity and are currently being evaluated in a Phase 1 clinical trial to determine which of the three RASTyVs has the optimal safety and immunogenicity profile in human

  9. In hydrolyzed cow's milk Helicobacter pylori becomes nonculturable and the growth of Salmonella typhi and Escherichia coli is inhibited.

    PubMed

    Orozco, A; Ogura, T; Hirosawa, T; Garduño, R; Kubo, I

    2007-10-01

    The colony forming unit (CFU) of H. pylori is reduced rapidly in lipase hydrolyzed cow's milk and a similar reduction was found in a physiological saline solution when it was supplemented with soluble C4 to C10 fatty acids of milk fat composition. Slight CFU decreases were observed for E. coli and S. typhi in hydrolyzed milk buffered to pH 3, while the counts in milk and physiological saline solution at pH 3 stayed almost unchanged for 24 h. E. coli proliferated in glucose-peptone medium, better at pH 4.7 than at pH 3. On the other hand, supplementation of the medium with soluble fatty acids of milk composition completely inhibited growth for 32 h. Supplementation of the medium with fatty acids reduced the growth of S. typhi to approximately 1/20 at pH 4.7. Therefore, milk hydrolyzed by gastric lipase may damage H. pylori, producing a nonculturable state. With E. coli and S. typhi, hydrolyzed milk does not induce inactivation to a nonculturable state but inhibits their proliferation potently. The latter is considered to be a state prior to VBNC (viable but nonculturable). However, the antibiotic effect will disappear when the fatty acids are absorbed by the intestine.

  10. Mig-14 plays an important role in influencing gene expression of Salmonella enterica serovar Typhi, which contributes to cell invasion under hyperosmotic conditions.

    PubMed

    Sheng, Xiumei; Zhang, Hong; Xia, Qiufeng; Xu, Shungao; Xu, Huaxi; Huang, Xinxiang

    2013-11-01

    mig-14 is a horizontally acquired host-induced virulence gene in Salmonella enterica serovar Typhi. The molecular function of mig-14 is still unknown; sequence analysis showed that mig-14 shared homology with the helix-loop-helix motif of the AraC family of transcriptional regulatory proteins. In our previous microarray-based studies, mig-14 was upregulated at the early stage of high osmotic stress, indicating a potential role under this condition. Therefore, we compared growth and the global transcriptional difference between wild-type and mig-14 mutant strains to identify the role of Mig-14. The results showed that growth of mig-14 mutant strain was clearly slower than that of the wild-type strain, and 148 genes showed significant differences in expression between these two strains under upshift high osmotic treatment for 30 min. In total, 77 genes and 71 genes in the mig-14 mutant strain were upregulated and downregulated, respectively. Genes involved in invasion, virulence, flagellation, motility and chemotaxis of Salmonella were downregulated. Thus, cell invasion abilities of these two strains were further analyzed. The results confirmed that activities of mig-14 were important for cell invasion.

  11. Adaptation of the Endogenous Salmonella enterica Serovar Typhi clyA-Encoded Hemolysin for Antigen Export Enhances the Immunogenicity of Anthrax Protective Antigen Domain 4 Expressed by the Attenuated Live-Vector Vaccine Strain CVD 908-htrA

    PubMed Central

    Galen, James E.; Zhao, Licheng; Chinchilla, Magaly; Wang, Jin Yuan; Pasetti, Marcela F.; Green, Jeffrey; Levine, Myron M.

    2004-01-01

    Bacterial live-vector vaccines aim to deliver foreign antigens to the immune system and induce protective immune responses, and surface-expressed or secreted antigens are generally more immunogenic than cytoplasmic constructs. We hypothesize that an optimum expression system will use an endogenous export system to avoid the need for large amounts of heterologous DNA encoding additional proteins. Here we describe the cryptic chromosomally encoded 34-kDa cytolysin A hemolysin of Salmonella enterica serovar Typhi (ClyA) as a novel export system for the expression of heterologous antigens in the supernatant of attenuated Salmonella serovar Typhi live-vector vaccine strains. We constructed a genetic fusion of ClyA to the reporter green fluorescent protein and showed that in Salmonella serovar Typhi CVD 908-htrA, the fusion protein retains biological activity in both domains and is exported into the supernatant of an exponentially growing live vector in the absence of detectable bacterial lysis. The utility of ClyA for enhancing the immunogenicity of an otherwise problematic antigen was demonstrated by engineering ClyA fused to the domain 4 (D4) moiety of Bacillus anthracis protective antigen (PA). A total of 11 of 15 mice immunized intranasally with Salmonella serovar Typhi exporting the protein fusion manifested fourfold or greater rises in serum anti-PA immunoglobulin G, compared with only 1 of 16 mice immunized with the live vector expressing cytoplasmic D4 (P = 0.0002). In addition, the induction of PA-specific gamma interferon and interleukin 5 responses was observed in splenocytes. This technology offers exceptional versatility for enhancing the immunogenicity of bacterial live-vector vaccines. PMID:15557633

  12. Expression and immunogenicity of pertussis toxin S1 subunit-tetanus toxin fragment C fusions in Salmonella typhi vaccine strain CVD 908.

    PubMed Central

    Barry, E M; Gomez-Duarte, O; Chatfield, S; Rappuoli, R; Pizza, M; Losonsky, G; Galen, J; Levine, M M

    1996-01-01

    Salmonella typhi vaccine strain CVD 908 can deliver heterologous antigens to the host immune system following mucosal immunization. Stable expression of foreign proteins in Salmonella cells often requires antigen-specific engineering strategies. Fusion of antigens to stabilizing proteins has proven to be a successful strategy for rescuing otherwise unstable proteins. We designed plasmids to allow the fusion of antigens to the amino terminus or carboxyl terminus of fragment C of tetanus toxin, separated by a 4-amino-acid hinge region. Towards the ultimate goal of developing a live oral diphtheria-pertussis-tetanus vaccine, we used these plasmids to stably express the S1 subunit of pertussis toxin in CVD 908. Driven by the anaerobically inducible nirB promoter, the S1 subunit alone was expressed poorly in Salmonella cytoplasm. In contrast, hybrid proteins with S1 fused to either the amino or carboxyl terminus of fragment C were expressed at a high level in CVD 908 and were recognized in Western blot (immunoblot) analysis by monoclonal antibodies directed to S1 and to fragment C. Mice were immunized by the oral or intranasal routes with CVD 908 derivatives harboring these recombinant plasmids. All fusion proteins elicited serum antibody responses to fragment C following intranasal immunization, whereas oral inoculation did not. The configuration of antigens constituting the fusion was critical; S1 fused to the amino terminus of fragment C was less effective than S1 fused to the carboxyl terminus in generating anti-fragment C antibodies. CVD 908 expressing truncated S1 fused to the carboxyl terminus of fragment C elicited neutralizing serum pertussis antitoxin following intranasal immunization of mice. PMID:8926085

  13. Nasal immunization of mice with AFCo1 or AFPL1 plus capsular polysaccharide Vi from Salmonella typhi induces cellular response and memory B and T cell responses.

    PubMed

    Romeu, Belkis; Lastre, Miriam; Reyes, Laura; González, Elizabeth; Borrero, Yusnaby; Lescaille, Diandra; Pérez, Rocmira; Nuñez, Darzy; Pérez, Oliver

    2014-12-05

    The response to infection against Salmonella involves both B and T cell mediated immunity. An effective immunization can activate an adequate immune response capable to control the primary infection and protect against a secondary infection. Mucosal vaccination, by inducing local pathogen-specific immune responses, has the potential to counter mucosally transmitted pathogens at the portal of entry, thereby increasing the efficacy of vaccines. The aim of this work was to explore the efficacy of AFCo1 or AFPL1, as mucosal adjuvants to stimulate cell immunity and memory responses against Vi polysaccharide antigen of Salmonella typhi (PsVi). Mice immunized with 3 intranasal doses exhibited high levels of PsVi-specific IgG (p<0.05), IgG2a and IgG2c subclasses. Also, an amplified recall response after a booster immunization with a plain polysaccharide vaccine was induced. Avidities index were higher in mice immunized with adjuvanted formulations at different chaotropic concentrations. Furthermore, IL-12 and IFN-γ levels in nasally vaccinated mice with both adjuvants were induced. Moreover, priming with 3 doses followed by booster immunization with VaxTyVi(®) resulted in high levels of anti-Vi specific IgG, IgG subclasses and antibody avidity. Long lived plasma cells in bone marrow, memory B cells and long-term memory T cells after booster dose were induced. The combined formulation of Vi polysaccharide with mucosal adjuvants provides an improved immunogenicity, in particular with regard to cellular responses and long lasting cells responses.

  14. The Cytolethal Distending Toxin Produced by Nontyphoidal Salmonella Serotypes Javiana, Montevideo, Oranienburg, and Mississippi Induces DNA Damage in a Manner Similar to That of Serotype Typhi

    PubMed Central

    Miller, Rachel A.

    2016-01-01

    ABSTRACT Select nontyphoidal Salmonella enterica (NTS) serotypes were recently found to encode the Salmonella cytolethal distending toxin (S-CDT), an important virulence factor for serotype Typhi, the causative agent of typhoid fever. Using a PCR-based assay, we determined that among 21 NTS serotypes causing the majority of food-borne salmonellosis cases in the United States, genes encoding S-CDT are conserved in isolates representing serotypes Javiana, Montevideo, and Oranienburg but that among serotype Mississippi isolates, the presence of S-CDT-encoding genes is clade associated. HeLa cells infected with representative strains of these S-CDT-positive serotypes had a significantly higher proportion of cells arrested in the G2/M phase than HeLa cells infected with representative strains of S-CDT-negative serotypes Typhimurium, Newport, and Enteritidis. The G2/M cell cycle arrest was dependent on CdtB, the active subunit of S-CDT, as infection with isogenic ΔcdtB mutants abolished their ability to induce a G2/M cell cycle arrest. Infection with S-CDT-encoding serotypes was significantly associated with activation of the host cell’s DNA damage response (DDR), a signaling cascade that is important for detecting and repairing damaged DNA. HeLa cell populations infected with S-CDT-positive serotypes had a significantly higher proportion of cells with DDR protein 53BP1 and γH2AX foci than cells infected with either S-CDT-negative serotypes or isogenic ΔcdtB strains. Intoxication with S-CDT occurred via autocrine and paracrine pathways, as uninfected HeLa cells among populations of infected cells also had an activated DDR. Overall, we show that S-CDT plays a significant role in the cellular outcome of infection with NTS serotypes. PMID:27999166

  15. Crystal structure of an antigenic outer-membrane protein from Salmonella Typhi suggests a potential antigenic loop and an efflux mechanism

    PubMed Central

    Guan, Hong-Hsiang; Yoshimura, Masato; Chuankhayan, Phimonphan; Lin, Chien-Chih; Chen, Nai-Chi; Yang, Ming-Chi; Ismail, Asma; Fun, Hoong-Kun; Chen, Chun-Jung

    2015-01-01

    ST50, an outer-membrane component of the multi-drug efflux system from Salmonella enterica serovar Typhi, is an obligatory diagnostic antigen for typhoid fever. ST50 is an excellent and unique diagnostic antigen with 95% specificity and 90% sensitivity and is used in the commercial diagnosis test kit (TYPHIDOTTM). The crystal structure of ST50 at a resolution of 2.98 Å reveals a trimer that forms an α-helical tunnel and a β-barrel transmembrane channel traversing the periplasmic space and outer membrane. Structural investigations suggest significant conformational variations in the extracellular loop regions, especially extracellular loop 2. This is the location of the most plausible antibody-binding domain that could be used to target the design of new antigenic epitopes for the development of better diagnostics or drugs for the treatment of typhoid fever. A molecule of the detergent n-octyl-β-D-glucoside is observed in the D-cage, which comprises three sets of Asp361 and Asp371 residues at the periplasmic entrance. These structural insights suggest a possible substrate transport mechanism in which the substrate first binds at the periplasmic entrance of ST50 and subsequently, via iris-like structural movements to open the periplasmic end, penetrates the periplasmic domain for efflux pumping of molecules, including poisonous metabolites or xenobiotics, for excretion outside the pathogen. PMID:26563565

  16. Crystal structure of an antigenic outer-membrane protein from Salmonella Typhi suggests a potential antigenic loop and an efflux mechanism.

    PubMed

    Guan, Hong-Hsiang; Yoshimura, Masato; Chuankhayan, Phimonphan; Lin, Chien-Chih; Chen, Nai-Chi; Yang, Ming-Chi; Ismail, Asma; Fun, Hoong-Kun; Chen, Chun-Jung

    2015-11-13

    ST50, an outer-membrane component of the multi-drug efflux system from Salmonella enterica serovar Typhi, is an obligatory diagnostic antigen for typhoid fever. ST50 is an excellent and unique diagnostic antigen with 95% specificity and 90% sensitivity and is used in the commercial diagnosis test kit (TYPHIDOT(TM)). The crystal structure of ST50 at a resolution of 2.98 Å reveals a trimer that forms an α-helical tunnel and a β-barrel transmembrane channel traversing the periplasmic space and outer membrane. Structural investigations suggest significant conformational variations in the extracellular loop regions, especially extracellular loop 2. This is the location of the most plausible antibody-binding domain that could be used to target the design of new antigenic epitopes for the development of better diagnostics or drugs for the treatment of typhoid fever. A molecule of the detergent n-octyl-β-D-glucoside is observed in the D-cage, which comprises three sets of Asp361 and Asp371 residues at the periplasmic entrance. These structural insights suggest a possible substrate transport mechanism in which the substrate first binds at the periplasmic entrance of ST50 and subsequently, via iris-like structural movements to open the periplasmic end, penetrates the periplasmic domain for efflux pumping of molecules, including poisonous metabolites or xenobiotics, for excretion outside the pathogen.

  17. Immunization with the conjugate vaccine Vi-CRM₁₉₇ against Salmonella typhi induces Vi-specific mucosal and systemic immune responses in mice.

    PubMed

    Fiorino, Fabio; Ciabattini, Annalisa; Rondini, Simona; Pozzi, Gianni; Martin, Laura B; Medaglini, Donata

    2012-09-21

    Typhoid fever is a public health problem, especially among young children in developing countries. To address this need, a glycoconjugate vaccine Vi-CRM₁₉₇, composed of the polysaccharide antigen Vi covalently conjugated to the non-toxic mutant of diphtheria toxin CRM₁₉₇, is under development. Here, we assessed the antibody and cellular responses, both local and systemic, following subcutaneous injection of Vi-CRM₁₉₇. The glycoconjugate elicited Vi-specific serum IgG titers significantly higher than unconjugated Vi, with prevalence of IgG1 that persisted for at least 60 days after immunization. Vi-specific IgG, but not IgA, were present in intestinal washes. Lymphocytes proliferation after restimulation with Vi-CRM₁₉₇ was observed in spleen and mesenteric lymph nodes. These data confirm the immunogenicity of Vi-CRM₁₉₇ and demonstrate that the vaccine-specific antibody and cellular immune responses are present also in the intestinal tract, thus strengthening the suitability of Vi-CRM₁₉₇ as a promising candidate vaccine against Salmonella Typhi.

  18. Draft Genome Sequence of Salmonellaenterica Serovar Typhi IMR_TP298/15, a Strain with Intermediate Susceptibility to Ciprofloxacin, Isolated from a Typhoid Outbreak.

    PubMed

    Ahmad, Norazah; Hii, Shirley Yi Fen; Hashim, Rohaidah; Issa, Rahizan

    2017-03-02

    Salmonella enterica serovar Typhi with reduced susceptibility to ciprofloxacin is increasingly being reported globally. An outbreak caused by Salmonella Typhi with decreased ciprofloxacin susceptibility has not been reported before in Malaysia. We present here the annotated draft genome of a Salmonella Typhi strain involved in a typhoid outbreak.

  19. The Subtleties and Contrasts of the LeuO Regulator in Salmonella Typhi: Implications in the Immune Response.

    PubMed

    Guadarrama, Carmen; Villaseñor, Tomás; Calva, Edmundo

    2014-01-01

    Salmonella are facultative intracellular pathogens. Salmonella infection occurs mainly by expression of two Salmonella pathogenicity Islands (SPI-1 and SPI-2). SPI-1 encodes transcriptional factors that participate in the expression of virulence factors encoded in the island. However, there are transcriptional factors encoded outside the island that also participate in the expression of SPI-1-encoded genes. Upon infection, bacteria are capable of avoiding the host immune response with several strategies that involve several virulence factors under the control of transcriptional regulators. Interestingly, LeuO a transcriptional global regulator which is encoded outside of any SPI, is proposed to be part of a complex regulatory network that involves expression of several genes that help bacteria to survive stress conditions and, also, induces the expression of porins that have been shown to be immunogens and can thus be considered as antigenic candidates for acellular vaccines. Hence, the understanding of the LeuO regulon implies a role of bacterial genetic regulation in determining the host immune response.

  20. The Subtleties and Contrasts of the LeuO Regulator in Salmonella Typhi: Implications in the Immune Response

    PubMed Central

    Guadarrama, Carmen; Villaseñor, Tomás; Calva, Edmundo

    2014-01-01

    Salmonella are facultative intracellular pathogens. Salmonella infection occurs mainly by expression of two Salmonella pathogenicity Islands (SPI-1 and SPI-2). SPI-1 encodes transcriptional factors that participate in the expression of virulence factors encoded in the island. However, there are transcriptional factors encoded outside the island that also participate in the expression of SPI-1-encoded genes. Upon infection, bacteria are capable of avoiding the host immune response with several strategies that involve several virulence factors under the control of transcriptional regulators. Interestingly, LeuO a transcriptional global regulator which is encoded outside of any SPI, is proposed to be part of a complex regulatory network that involves expression of several genes that help bacteria to survive stress conditions and, also, induces the expression of porins that have been shown to be immunogens and can thus be considered as antigenic candidates for acellular vaccines. Hence, the understanding of the LeuO regulon implies a role of bacterial genetic regulation in determining the host immune response. PMID:25566242

  1. Clinicopathological Profile of Salmonella Typhi and Paratyphi Infections Presenting as Fever of Unknown Origin in a Tropical Country

    PubMed Central

    Iqbal, Nayyar; Basheer, Aneesh; Mookkappan, Sudhagar; Ramdas, Anita; Varghese, Renu G’Boy; Padhi, Somanath; Shrimanth, Bhairappa; Chidambaram, Saranya; Anandhalakshmi, S.; Kanungo, Reba

    2015-01-01

    Background Enteric fever, a common infection in the tropics and endemic to India, often manifests as an acute febrile illness. However, presentation as fever of unknown origin (FUO) is not uncommon in tropical countries. Methods We aim to describe the clinical, laboratory and pathological features of patients hospitalized with fever of unknown origin and diagnosed as enteric fever. All culture proven cases of enteric fever were analyzed retrospectively over a period of three years from January 2011 to December 2013. Results Seven of 88 (8%) cases with enteric fever presented as FUO. Abdominal pain was the most common symptom besides fever. Relative bradycardia and splenomegaly were uncommon. Thrombocytopenia was the most common haematological abnormality while leucopenia was rare. Transaminase elevation was almost universal. S. Typhi and S. Paratyphi A were isolated from six cases and one case respectively. Yield of organisms from blood culture was superior to that of bone marrow aspirate. Multiple granulomas were identified in 4 out of 6 (67%) of the bone marrows studied, including that due to S. Paratyphi A and histiocytic hemophagocytosis was noted in two cases. Conclusion FUO is a relatively common manifestation of enteric fever in the tropics. Clinical and laboratory features may be atypical in such cases, including absence of relative bradycardia, leucopenia, and presence of thrombocytopenia, bicytopenia or pancytopenia. In addition, in endemic countries, enteric fever should be considered as a differential diagnosis, next to tuberculosis, in the evaluation of bone marrow granulomas in cases with FUO and culture correlation should be mandatory. PMID:25745548

  2. Immune adjuvant effect of V. cholerae O1 derived Proteoliposome coadministered by intranasal route with Vi polysaccharide from Salmonella Typhi.

    PubMed

    Acevedo, Reinaldo; Callicó, Adriana; Aranguren, Yisabel; Zayas, Caridad; Valdés, Yolanda; Pérez, Oliver; García, Luis; Ferro, Valerie A; Pérez, José Luis

    2013-01-01

    The proteoliposome derived from Vibrio cholerae O1 (PLc) is a nanoscaled structure obtained by a detergent extraction process. Intranasal (i.n) administration of PLc was immunogenic at mucosal and systemic level vs. V. cholerae; however the adjuvant potential of this structure for non-cholera antigens has not been proven yet. The aim of this work was to evaluate the effect of coadministering PLc with the Vi polysaccharide antigen (Poli Vi) of S. Typhi by the i.n route. The results showed that Poli Vi coadministered with PLc (PLc+Poli Vi) induce a higher IgA response in saliva (p<0.01) and faeces (p<0.01) than Poli Vi administered alone. Likewise, the IgG response in sera was higher in animals immunised with PLc+Poli Vi (p<0.01). Furthermore, IgG induced in sera of mice immunised with PLc+Poli Vi was similar (p>0.05) to that induced in a group of mice immunised by the parenteral route with the Cuban anti-typhoid vaccine vax-TyVi, although this vaccine did not induce a mucosal response. In conclusion, this work demonstrates that PLc can be used as a mucosal adjuvant to potentiate the immune response against a polysaccharide antigen like Poli Vi.

  3. Immune adjuvant effect of V. cholerae O1 derived Proteoliposome coadministered by intranasal route with Vi polysaccharide from Salmonella Typhi

    PubMed Central

    2013-01-01

    The proteoliposome derived from Vibrio cholerae O1 (PLc) is a nanoscaled structure obtained by a detergent extraction process. Intranasal (i.n) administration of PLc was immunogenic at mucosal and systemic level vs. V. cholerae; however the adjuvant potential of this structure for non-cholera antigens has not been proven yet. The aim of this work was to evaluate the effect of coadministering PLc with the Vi polysaccharide antigen (Poli Vi) of S. Typhi by the i.n route. The results showed that Poli Vi coadministered with PLc (PLc+Poli Vi) induce a higher IgA response in saliva (p<0.01) and faeces (p<0.01) than Poli Vi administered alone. Likewise, the IgG response in sera was higher in animals immunised with PLc+Poli Vi (p<0.01). Furthermore, IgG induced in sera of mice immunised with PLc+Poli Vi was similar (p>0.05) to that induced in a group of mice immunised by the parenteral route with the Cuban anti-typhoid vaccine vax-TyVi®, although this vaccine did not induce a mucosal response. In conclusion, this work demonstrates that PLc can be used as a mucosal adjuvant to potentiate the immune response against a polysaccharide antigen like Poli Vi. PMID:23458379

  4. NMR line-fitting quantification of polysaccharide N-acylurea-based modification in glycoconjugates of Salmonella Typhi Vi polysaccharide.

    PubMed

    Garrido, Raine; Soubal, Jean Pierre; Torres, Leonid; Ramírez, Ubel; Vérez, Vicente

    2017-01-14

    The polysaccharides modification via carbodiimide reaction is one of the most applied methods for obtaining conjugated vaccines against Salmonella enterica. However, N-acylurea carbodiimide adduct generated in the process is a critical impurity in carbohydrate-based vaccines. A quantitative NMR method was developed for assessing the N-acylurea carbodiimide adduct impurity. The procedure was based on line-fitting facilities for processing the NMR signals on complex spectra. The method showed good linearity, accuracy and precision under inter-operator variation (relative standard deviation <5%). Copyright © 2017 John Wiley & Sons, Ltd.

  5. A bivalent conjugate vaccine containing PspA families 1 and 2 has the potential to protect against a wide range of Streptococcus pneumoniae strains and Salmonella Typhi.

    PubMed

    Kothari, Neha; Kothari, Sudeep; Choi, Young Joo; Dey, Ayan; Briles, David E; Rhee, Dong Kwon; Carbis, Rodney

    2015-02-04

    Previously we showed that conjugation of pneumococcal surface protein A (PspA) to Vi capsular polysaccharide from Salmonella Typhi enhanced the anti-PspA response without the need to add adjuvant. In the current study conjugates consisting of the α helical regions of PspA families 1 or 2 bound to Vi were used to vaccinate mice to test their ability to protect against a lethal intravenous challenge of a range of various strains of Streptococcus pneumoniae. Conjugate vaccine containing PspA family 1 provided good protection from PspA family 1 challenge strains but offered very little protection against PspA family 2 challenge strains. Similarly, PspA family 2 conjugates provided good protection from PspA family 2 challenge strains and poor protection against PspA family 1 challenge strains. This observation was supported by the low levels of cross-reactivity of PspA antibodies seen in ELISA plates coated with the heterologous PspA family. Cytokine profiles showed a mixed Th1/Th2 response to Vi and the Vi-PspA conjugates. IgG subclass analysis of the anti-Vi response showed a shift from predominantly IgG2a/3 to IgG1 after conjugation to PspA was consistent with other polysaccharide conjugate vaccines. The results demonstrate that conjugation of the α helical region of PspA to Vi enhances its capacity to induce a protective immune response and that a vaccine based on the α helical region of PspA should contain PspA from both families 1 and 2 to achieve broad cross-protection.

  6. Crl binds to domain 2 of σ(S) and confers a competitive advantage on a natural rpoS mutant of Salmonella enterica serovar Typhi.

    PubMed

    Monteil, Véronique; Kolb, Annie; Mayer, Claudine; Hoos, Sylviane; England, Patrick; Norel, Françoise

    2010-12-01

    The RpoS sigma factor (σ(S)) is the master regulator of the bacterial response to a variety of stresses. Mutants in rpoS arise in bacterial populations in the absence of stress, probably as a consequence of a subtle balance between self-preservation and nutritional competence. We characterized here one natural rpoS mutant of Salmonella enterica serovar Typhi (Ty19). We show that the rpoS allele of Ty19 (rpoS(Ty19)) led to the synthesis of a σ(S)(Ty19) protein carrying a single glycine-to-valine substitution at position 282 in σ(S) domain 4, which was much more dependent than the wild-type σ(S) protein on activation by Crl, a chaperone-like protein that increases the affinity of σ(S) for the RNA polymerase core enzyme (E). We used the bacterial adenylate cyclase two-hybrid system to demonstrate that Crl bound to residues 72 to 167 of σ(S) domain 2 and that G282V substitution did not directly affect Crl binding. However, this substitution drastically reduced the ability of σ(S)(Ty19) to bind E in a surface plasmon resonance assay, a defect partially rescued by Crl. The modeled structure of the Eσ(S) holoenzyme suggested that substitution G282V could directly disrupt a favorable interaction between σ(S) and E. The rpoS(Ty19) allele conferred a competitive fitness when the bacterial population was wild type for crl but was outcompeted in Δcrl populations. Thus, these results indicate that the competitive advantage of the rpoS(Ty19) mutant is dependent on Crl and suggest that crl plays a role in the appearance of rpoS mutants in bacterial populations.

  7. Studies on the antibacterial activity of Khaya senegalensis [(Desr.) A. Juss)] stem bark extract on Salmonella enterica subsp. enterica serovar Typhi [(ex Kauffmann and Edwards) Le Minor and Popoff

    PubMed Central

    Ugoh, Sylvanus Chukwudi; Agarry, Oluwabunmi Olaitan; Garba, Samuel Alimi

    2014-01-01

    Objective To study the phytochemical screening and antibacterial activity of the stem bark extracts of Khaya senegalensis (K. senegalensis) against Salmonella enterica subsp. enterica serovar Typhi. Methods The plant components were extracted using methanol, ethanol and water. The phytochemical screening of the stem bark extracts were carried out using a standard method. The antibacterial assay of the stem bark extracts against Salmonella Typhi (S. Typhi) using the agar well diffusion method with different concentrations of 50, 100, 200, 400 and 500 mg/mL and the corresponding concentrations of the control was carried out and the result compared with a standard antibiotic, amoxicillin as the control. Results The results obtained from the phytochemical screening of the three plant bark extracts of K. senegalensis showed 10 plant secondary metabolites including saponins, tannins, reducing sugars, aldehyde, phlobatannins, flavonoids, terpenoids, alkaloids, cardiac glycoside and anthroquinones. The ethanol and aqueous extracts showed antibacterial activities against S. Typhi at concentration of 50 mg/mL with the zone diameter of inhibition (ZDI) of 14 mm and 15 mm respectively. The ethanol and aqueous extracts also showed zone diameter of inhibition of 23 mm and 25 mm respectively at 250 mg/mL and 27 mm each at 500 mg/mL. The ethanol and aqueous stem bark extracts gave the highest ZDI at 500 mg/mL while 100 mg/mL gave the least ZDI for ethanol extract and 50 mg/mL for the aqueous extract. This was followed by 400 mg/mL that gave 24 mm ZDI of the aqueous extract and 27 mm of the ethanol extract. The methanol extract showed intermediate susceptibility evidenced by ZDI of 10 mm at 100 mg/mL concentration. The methanol extract also showed antibacterial activity of 24 mm ZDI against the test organism at a higher concentration of 250 mg/mL and 26 mm at 500 mg/mL concentration. The methanol, ethanol and aqueous extracts displayed antibacterial activities against S. Typhi with

  8. Safety and immunogenicity in humans of an attenuated Salmonella typhi vaccine vector strain expressing plasmid-encoded hepatitis B antigens stabilized by the Asd-balanced lethal vector system.

    PubMed Central

    Tacket, C O; Kelly, S M; Schödel, F; Losonsky, G; Nataro, J P; Edelman, R; Levine, M M; Curtiss, R

    1997-01-01

    Attenuated Salmonella typhi organisms which express genes encoding protective antigens of other pathogens have been developed for use as experimental oral vaccines. A delta asd S. typhi strain attenuated by deletions in cya, crp, and cdt which contains hepatitis B core (HBc) and pre-S genes encoded on an Asd+ pBR-based plasmid vector was constructed. Healthy adult volunteers ingested a single dose of 5 x 10(5) to 5 x 10(8) CFU of strain chi4073 (delta cya delta crp delta cdt S. typhi Ty2), 6 x 10(7) or 1 x 10(9) CFU of strain chi4632(pYA3149), a further derivative of chi4073 deleted in asd and containing the Asd+ vector without the HBc-pre-S fusion, or 3 x 10(7) or 7 x 10(8) CFU of strain X4632(pYA3167), a derivative containing the vector with the HBc-pre-S fusion. Chi4073 was generally well tolerated by 22 volunteers. No volunteer had fever or positive blood cultures; 4 of 22 volunteers shed vaccine organisms in the stool in the first 48 h only. Two of 18 volunteers who received one of the plasmid-containing derivatives of chi4073 developed low-grade fevers on day 10 or 12 after ingestion. One of these volunteers had positive blood cultures on days 7 and 8. Seven of these 18 volunteers had vaccine organisms detected in their stools in the first 48 h only. Most volunteers developed S. typhi-specific serum responses and developed S. typhi-specific antibody-secreting cells. However, no volunteer developed serum antibody to hepatitis pre-S or pre-S-specific antibody-secreting cells. Although the parent strain chi4073 was well tolerated, induced immunoglobulin G seroconversion to S. typhi lipopolysaccharide in 80 to 100% of vaccinees and stimulated specific IgA-secreting lymphocytes in 80 to 100% of vaccinees given a single oral dose of 2 x 10(7) and 5 x 10(8) CFU, chi4073 derivatives containing the Asd+ vector with and without sequences encoding the HBc-pre-S fusion caused occasional febrile reactions at high doses and did not stimulate detectable immune responses to

  9. Identification of Salmonella spp. with Rambach agar in conjunction with the 4-methylumbelliferyl caprylate (MUCAP) fluorescence test.

    PubMed

    Abdalla, S; Vila, J; Jimenez de Anta, M T

    1994-03-01

    The utility of Rambach agar to identify Salmonella spp. was examined relative to its usefulness in clinical microbiology. Forty-four of 54 (82%) salmonella organisms isolated from faecal cultures and 66 of 82 (84%) salmonella stock cultures produced bright red colour colonies after 24 h incubation at 37 degrees C, whereas 48 of 54 (89%) salmonellae isolated from faecal cultures, and 74 of 82 (90%) salmonella stock cultures, yielded the bright red colour when the incubation time was extended to 48 h. Apart from Salmonella typhi and Salmonella paratyphi A the sensitivity of Rambach agar to detect salmonella strains belonging to five serogroups was 83% and 92% after 24 and 48 h of incubation, respectively. In contrast, other members of the family Enterobacteriaceae tested failed to give the bright red colour, except for one strain of Pseudomonas aeruginosa and another of Acinetobacter baumannii. The non-salmonella strains either gave a different colour--blue, green or orange--or were colourless. To supplement the use of Rambach agar in the detection of Salm. typhi and Salm. paratyphi A and other late or negative acid-producing salmonella species on this medium, the 4-methylumbelliferyl caprylate fluorescence (MUCAP) test was carried out, and this showed positive results with all the salmonella strains tested. These results suggest that while Rambach agar can not pre-identify Salm. typhi and Salm. paratyphi A, the use of a simple and rapid (MUCAP) test in combination would make it very useful to identify all Salmonella spp. after 24 h incubation.

  10. Live attenuated vaccines for invasive Salmonella infections.

    PubMed

    Tennant, Sharon M; Levine, Myron M

    2015-06-19

    Salmonella enterica serovar Typhi produces significant morbidity and mortality worldwide despite the fact that there are licensed Salmonella Typhi vaccines available. This is primarily due to the fact that these vaccines are not used in the countries that most need them. There is growing recognition that an effective invasive Salmonella vaccine formulation must also prevent infection due to other Salmonella serovars. We anticipate that a multivalent vaccine that targets the following serovars will be needed to control invasive Salmonella infections worldwide: Salmonella Typhi, Salmonella Paratyphi A, Salmonella Paratyphi B (currently uncommon but may become dominant again), Salmonella Typhimurium, Salmonella Enteritidis and Salmonella Choleraesuis (as well as other Group C Salmonella). Live attenuated vaccines are an attractive vaccine formulation for use in developing as well as developed countries. Here, we describe the methods of attenuation that have been used to date to create live attenuated Salmonella vaccines and provide an update on the progress that has been made on these vaccines.

  11. Salmonella

    MedlinePlus

    ... outbreaks of human Salmonella infections linked to backyard poultry. Get tips to help protect you and your ... Outbreaks of Human Salmonella Infections Linked to Live Poultry in Backyard Flocks Multistate Outbreak of Salmonella Virchow ...

  12. Evaluation of copper ion of antibacterial effect on Pseudomonas aeruginosa, Salmonella typhimurium and Helicobacter pylori and optical, mechanical properties

    NASA Astrophysics Data System (ADS)

    Kim, Young-Hwan; Choi, Yu-ri; Kim, Kwang-Mahn; Choi, Se-Young

    2012-02-01

    Antibacterial effect on Pseudomonas aeruginosa, Salmonella typhimurium and Helicobacter pylori of copper ion was researched. Also, additional effects of copper ion coating on optical and mechanical properties were researched as well. Copper ion was coated on glass substrate as a thin film to prevent bacteria from growing. Cupric nitrate was used as precursors for copper ion. The copper ion contained sol was deposited by spin coating process on glass substrate. Then, the deposited substrates were heat treated at the temperature range between 200 °C and 250 °C. The thickness of deposited copper layer on the surface was 63 nm. The antibacterial effect of copper ion coated glass on P. aeruginosa, S. typhimurium and H. pylori demonstrated excellent effect compared with parent glass. Copper ion contained layer on glass showed a similar value of transmittance compared with value of parent glass. The 3-point bending strength and Vickers hardness were 209.2 MPa, 540.9 kg/mm2 which were about 1.5% and 1.3% higher than the value of parent glass. From these findings, it is clear that copper ion coating on glass substrate showed outstanding effect not only in antibacterial activity but also in optical and mechanical properties as well.

  13. Mix-infection of S. Typhi and ParaTyphi A in Typhoid Fever and Chronic Typhoid Carriers: A Nested PCR Based Study in North India

    PubMed Central

    Pratap, Chandra Bhan; Kumar, Gopal; Patel, Saurabh Kumar; Shukla, Vijay K; Kumar, Kailash; Singh, Tej Bali

    2014-01-01

    Introduction: Enteric fever is a systemic disease caused by Salmonella organism such as serotypes Typhi and ParaTyphi A, B, C. Salmonella ParaTyphi A contributes more than 50% of all the enteric fever cases and it has recently been projected as an emerging pathogen. Materials and Methods: The present study was aimed to detect Salmonella Typhi and ParaTyphi A in urine, blood and stool specimens collected from cases of enteric fever (110), chronic typhoid carriers (46) and healthy controls (75) to explore the possibility of mixed infection by nested PCR. A new nested PCR primer was designed targeting putative fimbrial protein (stkG) gene which is one of the fimbrial gene families to Salmonella ParaTyphi A and for S. Typhi already reported primers targeting flagellin (fliC) gene. Results: Large volume of urine specimens (15 ml) was found to be the best for detection of Salmonella serotypes. The urine sample was found to have mixed-infection by both the serotypes in 40.9% of the cases but lower in blood (27.3%) and stool (13.6%). Conclusion: The present study concludes that occurrence of mixed infection may be quite frequent in typhoid and chronic typhoid carriers’ individuals, although the reported recent rise in ParaTyphi A incidence may not be real. PMID:25584217

  14. Bakteriologisch-Serologische Untersuchungen an Experimentell mit S. Typhil Infizierten Meerschweinchen (Typhusbakterienausscheider) (Bacteriological and Seriological Investigations on Guinea Pigs, Experimentally Infected with S. Typhi (Bacterial Excretors),

    DTIC Science & Technology

    Investigations were carried out on 151 guinea pigs previously infected with Salmonella typhi through the gallbladder. The animals were examined for...their excreting of Salmonella typhi as well as for their agglutination titers. Depending on the duration of the observation period excretion of... Salmonella typhi was demonstrated in the individual groups as long as 103, 114, 208, 302, 315, and 351 days following infection. In a great number of

  15. Evaluation of Two Salmonella typhimurium Hybrids as Challenge Organisms in a System for the Assay of Typhoid Vaccines

    DTIC Science & Technology

    1982-03-02

    March 1982/Accepted 2 July 1982 ___A mouse-virulent Salmonella typhinturitim hybrid (H42), which expresses the -ac Salmonella typhi Vi antigen in addition... Salmonella typhi surface antigens as ments in which S. typhimurium hybrids, ex- challenge organisms in vaccinated Swiss-Web- pressing different... Salmonella typhi anti- ride-protein conjugates induce protection against infec- gens. Infect. Immun. 24:90-93. lion with Salmonella typhimurium. Infect. Immun

  16. Extensively drug-resistant pseudomonas aeruginosa isolates containing blaVIM-2 and elements of Salmonella genomic island 2: a new genetic resistance determinant in Northeast Ohio.

    PubMed

    Perez, Federico; Hujer, Andrea M; Marshall, Steven H; Ray, Amy J; Rather, Philip N; Suwantarat, Nuntra; Dumford, Donald; O'Shea, Patrick; Domitrovic, T Nicholas J; Salata, Robert A; Chavda, Kalyan D; Chen, Liang; Kreiswirth, Barry N; Vila, Alejandro J; Haussler, Susanne; Jacobs, Michael R; Bonomo, Robert A

    2014-10-01

    Carbapenems are a mainstay of treatment for infections caused by Pseudomonas aeruginosa. Carbapenem resistance mediated by metallo-β-lactamases (MBLs) remains uncommon in the United States, despite the worldwide emergence of this group of enzymes. Between March 2012 and May 2013, we detected MBL-producing P. aeruginosa in a university-affiliated health care system in northeast Ohio. We examined the clinical characteristics and outcomes of patients, defined the resistance determinants and structure of the genetic element harboring the blaMBL gene through genome sequencing, and typed MBL-producing P. aeruginosa isolates using pulsed-field gel electrophoresis (PFGE), repetitive sequence-based PCR (rep-PCR), and multilocus sequence typing (MLST). Seven patients were affected that were hospitalized at three community hospitals, a long-term-care facility, and a tertiary care center; one of the patients died as a result of infection. Isolates belonged to sequence type 233 (ST233) and were extensively drug resistant (XDR), including resistance to all fluoroquinolones, aminoglycosides, and β-lactams; two isolates were nonsusceptible to colistin. The blaMBL gene was identified as blaVIM-2 contained within a class 1 integron (In559), similar to the cassette array previously detected in isolates from Norway, Russia, Taiwan, and Chicago, IL. Genomic sequencing and assembly revealed that In559 was part of a novel 35-kb region that also included a Tn501-like transposon and Salmonella genomic island 2 (SGI2)-homologous sequences. This analysis of XDR strains producing VIM-2 from northeast Ohio revealed a novel recombination event between Salmonella and P. aeruginosa, heralding a new antibiotic resistance threat in this region's health care system.

  17. [Salmonella].

    PubMed

    Amo, Kiyoko

    2012-08-01

    Nontyphoidal salmonella causes infectious gastroenteritis, and sometimes causes bacteremia and meningitis. Gastroenteritis associated with nontyphoidal salmonella, in which fever, diarrhea, vomiting and abdominal cramps, is a common disease. The major way of transmittion is food of animal origin, for example egg. That is the reason why precausion is so important such as wash hands before cooking, avoid eating raw egg and wash the cooking utensils after contact raw foods. In this report, I presented the rare severe case of encephalitis caused by salmonella infection.

  18. Salmonella

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The problem of Salmonella in the global food chain and its current and projected repercussions on human health is cause for concern. Numerous studies have suggested that antimicrobial resistance among bacteria is on the rise and this has lead to changes in control and treatment strategies. Increas...

  19. Salmonella

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella are facultative anaerobic Gram-negative non-spore forming rods belonging to the family Enterobacteriaceae. Salmonellosis is a zoonotic and foodborne illness that is usually transmitted by the fecal-oral route estimated to be responsible for 1.4 million cases of human infections in 2009 in...

  20. Alternative Fecal Indicators and Their Empirical Relationships with Enteric Viruses, Salmonella enterica, and Pseudomonas aeruginosa in Surface Waters of a Tropical Urban Catchment

    PubMed Central

    Liang, L.; Goh, S. G.; Vergara, G. G. R. V.; Fang, H. M.; Rezaeinejad, S.; Chang, S. Y.; Bayen, S.; Lee, W. A.; Sobsey, M. D.; Rose, J. B.

    2014-01-01

    The suitability of traditional microbial indicators (i.e., Escherichia coli and enterococci) has been challenged due to the lack of correlation with pathogens and evidence of possible regrowth in the natural environment. In this study, the relationships between alternative microbial indicators of potential human fecal contamination (Bacteroides thetaiotaomicron, Methanobrevibacter smithii, human polyomaviruses [HPyVs], and F+ and somatic coliphages) and pathogens (Salmonella spp., Pseudomonas aeruginosa, rotavirus, astrovirus, norovirus GI, norovirus GII, and adenovirus) were compared with those of traditional microbial indicators, as well as environmental parameters (temperature, conductivity, salinity, pH, dissolved oxygen, total organic carbon, total suspended solids, turbidity, total nitrogen, and total phosphorus). Water samples were collected from surface waters of urban catchments in Singapore. Salmonella and P. aeruginosa had significant positive correlations with most of the microbial indicators, especially E. coli and enterococci. Norovirus GII showed moderately strong positive correlations with most of the microbial indicators, except for HPyVs and coliphages. In general, high geometric means and significant correlations between human-specific markers and pathogens suggest the possibility of sewage contamination in some areas. The simultaneous detection of human-specific markers (i.e., B. thetaiotaomicron, M. smithii, and HPyVs) with E. coli and enterococcus supports the likelihood of recent fecal contamination, since the human-specific markers are unable to regrow in natural surface waters. Multiple-linear-regression results further confirm that the inclusion of M. smithii and HPyVs, together with traditional indicators, would better predict the occurrence of pathogens. Further study is needed to determine the applicability of such models to different geographical locations and environmental conditions. PMID:25416765

  1. Live attenuated vaccines for invasive Salmonella infections

    PubMed Central

    Tennant, Sharon M.; Levine, Myron M.

    2015-01-01

    Salmonella enterica serovar Typhi produces significant morbidity and mortality worldwide despite the fact that there are licensed S. Typhi vaccines available. This is primarily due to the fact that these vaccines are not used in the countries that most need them. There is growing recognition that an effective invasive Salmonella vaccine formulation must also prevent infection due to other Salmonella serovars. We anticipate that a multivalent vaccine that targets the following serovars will be needed to control invasive Salmonella infections worldwide: S. Typhi, S. Paratyphi A, S. Paratyphi B (currently uncommon but may become dominant again), S. Typhimurium, S. Enteritidis and S. Choleraesuis (as well as other Group C Salmonella). Live attenuated vaccines are an attractive vaccine formulation for use in developing as well as developed countries. Here, we describe the methods of attenuation that have been used to date to create live attenuated Salmonella vaccines and provide an update on the progress that has been made on these vaccines. PMID:25902362

  2. A Salmonella typhi OmpC fusion protein expressing the CD154 Trp140–Ser149 amino acid strand binds CD40 and activates a lymphoma B-cell line

    PubMed Central

    Vega, Mario I; Santos-Argumedo, Leopoldo; Huerta-Yepez, Sara; Luría-Perez, Rosendo; Ortiz-Navarrete, Vianney; Isibasi, Armado; González-Bonilla, Cesar R

    2003-01-01

    CD154 is a type II glycoprotein member of the tumour necrosis factor (TNF) ligand family, which is expressed mainly on the surface of activated T lymphocytes. The interaction with its receptor CD40, plays a central role in the control of several functions of the immune system. Structural models based on the homology of CD154 with TNF and lymphotoxin indicate that binding to CD40 involves three regions surrounding amino acids K143, R203 and Q220, and that strands W140–S149 and S198–A210 are critical for such interactions. Also, it has been reported that two recombinant CD154 fragments, including amino acid residues Y45–L261 or E108–L261 are biologically active, whereas other polypeptides, including S149–L261, are not. Therefore, we decided to construct a fusion protein inserting the W140-S149 amino acid strand (WAEKGYYTMS) in an external loop of the outer membrane protein C (OmpC) from Salmonella enterica serovar Typhi and assess its ability to bind CD40 and activate B cells. The sodium dodecyl sulphate–polyacrylamide gel electrophoresis demonstrated that the chimeric OmpC–gp39 protein conserved its ability to form trimers. Binding to CD40 was established by three variants of enzyme-linked immunosorbent assay, a direct binding assay by coating plates with a recombinant CD40–Fc protein and through two competition assays between OmpC–gp39 and recombinant CD154 or soluble CD40–Fc. Flow cytometry analysis demonstrated that OmpC–gp39 increased the expression levels of major histocompatibility complex II, CD23, and CD80, in Raji human B-cell lymphoma similarly to an antibody against CD40. These results further support that the CD154/CD40 interaction is similar to the TNF/TNF receptor. This is the first report of a bacterial fusion protein containing a small amino acid strand form a ligand that is able to activate its cognate receptor. PMID:14511234

  3. Vi Antigen Biosynthesis in Salmonella typhi: Characterization of UDP-N-acetylglucosamine C-6 Dehydrogenase (TviB) and UDP-N-acetylglucosaminuronic Acid C-4 Epimerase (TviC)†

    PubMed Central

    Zhang, Hua; Zhou, Ying; Bao, Hongbo; Liu, Hung-wen

    2008-01-01

    Vi antigen, the virulence factor of Salmonella typhi, has been used clinically as a molecular vaccine. TviB and TviC are two enzymes involved in the formation of Vi antigen, a linear polymer consisting of α-1,4-linked N-acetylgalactosaminuronate. Protein sequence analysis suggests that TviB is a dehydrogenase and TviC is an epimerase. Both enzymes are expected to be NAD+ dependent. In order to verify their functions, TviB and TviC were cloned, expressed in Escherichia coli, and characterized. The C-terminal His6-tagged TviB protein, purified from soluble cell fractions in the presence of 10 mM DTT, shows UDP-N-acetylglucosamine 6-dehydrogenase activity, and is capable of catalyzing the conversion of UDP-N-acetylglucosamine (UDP-GlcNAc) to UDP-N-acetylglucosaminuronic acid (UDP-GlcNAcA) with a kcat value of 15.5 ± 1.0 min−1. The Km values of TviB for UDP-GlcNAc and NAD+ are 77 ± 9 μM and 276 ± 52 μM, respectively. TviC, purified as C-terminal hexahistidine-tagged protein, shows UDP-GlcNAcA 4-epimerase and UDP-N-acetylgalactosamine (UDP-GalNAc) 4-epimerase activities. The Km values of TviC for UDP-GlcNAcA and UDP-N-acetylgalactosaminuronic acid (UDP-GalNAcA) are 20 ± 1 μM and 42 ± 2 μM, respectively. The kcat value for the conversion of UDP-GlcNAcA to UDP-GalNAcA is 56.8 ± 0.5 min−1, while that for the reverse reaction is 39.1 ± 0.6 min−1. These results show that the biosynthesis of Vi antigen is initiated by the TviB-catalyzed oxidation of UDP-GlcNAc to UDP-GalNAc, followed by the TviC-catalyzed epimerization at C-4 to form UDP-GalNAcA, which serves as the building block for the formation of Vi polymer. These results set the stage for future in vitro biosynthesis of Vi antigen. These enzymes may also be drug targets to inhibit Vi antigen production. PMID:16800641

  4. Ultra-fast and sensitive detection of non-typhoidal Salmonella using microwave-accelerated metal-enhanced fluorescence ("MAMEF").

    PubMed

    Tennant, Sharon M; Zhang, Yongxia; Galen, James E; Geddes, Chris D; Levine, Myron M

    2011-04-08

    Certain serovars of Salmonella enterica subsp. enterica cause invasive disease (e.g., enteric fever, bacteremia, septicemia, meningitis, etc.) in humans and constitute a global public health problem. A rapid, sensitive diagnostic test is needed to allow prompt initiation of therapy in individual patients and for measuring disease burden at the population level. An innovative and promising new rapid diagnostic technique is microwave-accelerated metal-enhanced fluorescence (MAMEF). We have adapted this assay platform to detect the chromosomal oriC locus common to all Salmonella enterica subsp. enterica serovars. We have shown efficient lysis of biologically relevant concentrations of Salmonella spp. suspended in bacteriological media using microwave-induced lysis. Following lysis and DNA release, as little as 1 CFU of Salmonella in 1 ml of medium can be detected in <30 seconds. Furthermore the assay is sensitive and specific: it can detect oriC from Salmonella serovars Typhi, Paratyphi A, Paratyphi B, Paratyphi C, Typhimurium, Enteritidis and Choleraesuis but does not detect Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae or Acinetobacter baumanii. We have also performed preliminary experiments using a synthetic Salmonella oriC oligonucleotide suspended in whole human blood and observed rapid detection when the sample was diluted 1:1 with PBS. These pre-clinical data encourage progress to the next step to detect Salmonella in blood (and other ordinarily sterile, clinically relevant body fluids).

  5. Cell Wall Structures Which May Be Important for Successful Immunization with Salmonella-Shigella Hybrid Vaccines

    DTIC Science & Technology

    1990-04-01

    Salmonella typhi Ty2la typhoid vaccine strain, infect. Immun. 1981,the non-protective Lot 8 %accine. whereas pili were 34,746 present in vaccine Lots 2 and 5...epimeraseless mutant of Salmonella typhi as a live oral vaccine reaction was confined to the flagella of Lot 5 but not Lot J. Infect. Dis. 1977, 136

  6. Ultra-Fast and Sensitive Detection of Non-Typhoidal Salmonella Using Microwave-Accelerated Metal-Enhanced Fluorescence (“MAMEF”)

    PubMed Central

    Galen, James E.; Geddes, Chris D.; Levine, Myron M.

    2011-01-01

    Certain serovars of Salmonella enterica subsp. enterica cause invasive disease (e.g., enteric fever, bacteremia, septicemia, meningitis, etc.) in humans and constitute a global public health problem. A rapid, sensitive diagnostic test is needed to allow prompt initiation of therapy in individual patients and for measuring disease burden at the population level. An innovative and promising new rapid diagnostic technique is microwave-accelerated metal-enhanced fluorescence (MAMEF). We have adapted this assay platform to detect the chromosomal oriC locus common to all Salmonella enterica subsp. enterica serovars. We have shown efficient lysis of biologically relevant concentrations of Salmonella spp. suspended in bacteriological media using microwave-induced lysis. Following lysis and DNA release, as little as 1 CFU of Salmonella in 1 ml of medium can be detected in <30 seconds. Furthermore the assay is sensitive and specific: it can detect oriC from Salmonella serovars Typhi, Paratyphi A, Paratyphi B, Paratyphi C, Typhimurium, Enteritidis and Choleraesuis but does not detect Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Streptococcus pneumoniae, Haemophilus influenzae or Acinetobacter baumanii. We have also performed preliminary experiments using a synthetic Salmonella oriC oligonucleotide suspended in whole human blood and observed rapid detection when the sample was diluted 1∶1 with PBS. These pre-clinical data encourage progress to the next step to detect Salmonella in blood (and other ordinarily sterile, clinically relevant body fluids). PMID:21494634

  7. Molecular typing of Salmonella enterica serovar typhi.

    PubMed Central

    Navarro, F; Llovet, T; Echeita, M A; Coll, P; Aladueña, A; Usera, M A; Prats, G

    1996-01-01

    The efficiencies of different tests for epidemiological markers--phage typing, ribotyping, IS200 typing, and pulsed-field gel electrophoresis (PFGE)--were evaluated for strains from sporadic cases of typhoid fever and a well-defined outbreak. Ribotyping and PFGE proved to be the most discriminating. Both detected two different patterns among outbreak-associated strains. PMID:8897193

  8. [Evaluation of the antimicrobial action of honey against Staphylococcus aureus, Staphylococcus epidermidis, Pseudomonas aeruginosa, Escherichia coli, Salmonella enteritidis, Listeria monocytogenes and Aspergillus niger. Evaluation of its microbiological charge].

    PubMed

    Estrada, Heylin; Gamboa, María del Mar; Arias, Maria Laura; Chaves, Carolina

    2005-06-01

    The evaluation of the microbiological charge present in Costa Rican samples as the evaluation of its antimicrobial activity over different microorganisms, including those associated to wound infections, will allow to emit criteria referred to its use in therapeutic treatments, specially as alternative therapy for cases involving antibiotic resistant bacteria. The microbiological charge of 25 honey samples, acquired in Costa Rican markets was evaluated through several indicators including total plate aerobic count, total plate anaerobic count, total aerobic spore count, total anaerobic spore count and molds and yeast count. Also, samples were inoculated in tubes with chopped meat media and plated in egg yolk agar in order to determine the presence of Clostridium botulinum. For the antimicrobial activity evaluation, the diffusion method in Muller Hinton agar was performed, testing different honey concentrations (100, 75, 50, 25, 12,5 and 6,25 % v/v) against Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (UCR 2902), Pseudomonas aeruginosa (ATCC 9027), Escherichia coli (ATCC25922), Salmonella enteritidis (ATCC 13076), Listeria monocytogenes (ATCC 19116) and Aspergillus niger. The results obtained for the microbiological characterization of honey show that 91% of samples had counts equal or lower than 1,0 x 10(1) CFU/g. No positive result was obtained for the isolation of C. botulinum. 24 of the samples analyzed inhibited the growth of S. aureus even in a 25% v/v concentration, nevertheless, A. niger was no inhibited by any of the samples tested.

  9. Protective host immune responses to Salmonella infection.

    PubMed

    Pham, Oanh H; McSorley, Stephen J

    2015-01-01

    Salmonella enterica serovars Typhi and Paratyphi are the causative agents of human typhoid fever. Current typhoid vaccines are ineffective and are not widely used in endemic areas. Greater understanding of host-pathogen interactions during Salmonella infection should facilitate the development of improved vaccines to combat typhoid and nontyphoidal Salmonellosis. This review will focus on our current understanding of Salmonella pathogenesis and the major host immune components that participate in immunity to Salmonella infection. In addition, recent findings regarding host immune mechanisms in response to Salmonella infection will be also discussed, providing a new perspective on the utility of improved tools to study the immune response to Salmonella infections.

  10. Design, synthesis, and evaluation of pyrazolo-pyrazole derivatives on Methylisocitratelyase of Pseudomonas aeruginosa: in silico and in vitro study.

    PubMed

    Pulaganti, Madhusudana; C M, Anuradha; Kumar, Chitta Suresh

    2017-02-20

    Pseudomonas aeruginosa is an opportunistic micro-organism causing diseases both in animals and humans. In case of human pathology, the role of P. aeruginosa is one of the major concerns in intensive care septicemia. Presently, the drug resistance strains of P. aeruginosa are arising mainly by developing multiple mechanisms due to its natural and acquired resistance to many of the antimicrobial agents commonly used in clinical practice. As a result, there is a direct need to invent new drugs so that they may restrict the outbreak of multidrug resistant strains. Virtual high-throughput insilico screening, which helps to identify the chemical ligands that bind to the enzymes, is an important tool in drug discovery and the drugs discovered in this way are clinically tested. In this study, Methylisocitratelyase (MICL), which is essential for the survival of the bacterium and which doesn't show any similarity with the humans, was selected to evaluate the functions of high-affinity inhibitors (PPI-analogs) that are identified using the virtual screening approach. By adopting the computational analysis tools, structural, functional, and inhibitor interactions of MICL against P. aeruginosa were identified. The PPIA-32 is found to be the best binding interactions with MICL. PPIA-32 reduces the binding affinity for substrate to residues required for MICL enzyme activity and also Root Mean Square Deviation simulations show the most stable nature of PPA32-MICL(complex) than that of MICL alone, thereby effectively inhibiting the growth of virulent P. aeruginosa. To our surprise, the same phenomenon is also identified with other gram-negative bacteria like Escherichia coli, Klebsiella pneumoniae, and Salmonella typhi.

  11. Disseminated Salmonella Infection Coexisting with Thymoma.

    PubMed

    Saheer, S; Immanuel, Subash; Balamugesh, T; Christopher, D J

    2015-01-01

    A 21-year-old boy presented with high grade fever, diffuse chest pain and exertional breathlessness of one month duration. Radiologically he had a large lobulated anterior mediastinal mass with necrotic thick enhancing septaes. Histopathology of the mass was suggestive of thymoma and culture from the necrotic aspirate yielded Salmonella typhi. The same pathogen was isolated in subsequent blood and sputum cultures. This current report describes the rare association of salmonella infection with thymoma.

  12. Use of Rambach Propylene Glycol Containing Agar for identification of Salmonella spp.

    PubMed

    Gruenewald, R; Henderson, R W; Yappow, S

    1991-10-01

    When grown on Rambach Propylene Glycol Containing Agar (Rambach agar), 216 of 230 (93.9%) Salmonella organisms isolated from patients and 54 of 62 (87.1%) Salmonella stock cultures produced a crimson-colored growth. Of the 14 clinical Salmonella isolates which displayed colors other than crimson, 8 were Salmonella typhi, 2 were Salmonella paratyphi A, and 4 belonged to other commonly isolated serotypes. All eight Salmonella stock cultures which failed to produce a crimson color belonged to rarely isolated serotypes. In contrast, of 83 non-Salmonella stock cultures distributed among 29 bacterial species, none produced a crimson color. These results suggest that while Rambach agar cannot preidentify S. typhi and S. paratyphi A, the medium can be used for the presumptive identification and can assist in the definitive identification of the overwhelming majority of Salmonella isolates.

  13. [Salmonella enteritidis pericarditis. Apropos of a case and review of the literature].

    PubMed

    Victor, F; Gras, D; Le Breton, H; Gras, S; Amelot, J; Pony, J C

    1997-02-01

    The authors report a case of Salmonella enteritidis pericarditis. The diagnosis was based on bacteriological analyses (blood and effusion cultures and pericardial biopsy). The microbiology of bacterial pericarditis is reviewed underlying the exceptionally rare finding of a non typhi Salmonella in this condition.

  14. Antimicrobial susceptibility to azithromycin among Salmonella enterica isolated from the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Due to emerging resistance to traditional antimicrobial agents such as ampicillin, trimethoprim-sulfamethoxazole and chloramphenicol, azithromycin is increasingly used for the treatment of invasive Salmonella infections. In the present study, 696 isolates of non-Typhi Salmonella collected from human...

  15. EFFECT OF THE ANTIMUTAGENS VANILLIN AND CINNAMALDEHYDE ON THE SPONTANEOUS MUTATION SPECTRA OF SALMONELLA TA104

    EPA Science Inventory

    Effect of the Antimutagens Vanillin and Cinnamaldehyde on the / Spontaneous Mutation Spectra of Salmonella TAlO4

    Vanillin (VAN) and cinnamaldehyde (CIN) are dietary antimutagens that, when added to assay plates, reduced the spontaneous mutant frequency in Salmonella typhi...

  16. Interaction between Salmonella and Schistosomiasis: A Review

    PubMed Central

    Hsiao, Amber; Toy, Trevor; Marks, Florian

    2016-01-01

    The interaction between schistosomiasis and Salmonella is a particularly important issue in Africa, where dual infection by the parasite and the bacterium are likely common. In this review, the ways in which schistosomiasis affects human biology as it relates to Salmonella are described. Those who are infected by both organisms experience reduced immunological functioning, exhibit irreversible organ damage due to prolonged schistosomiasis infection, and become latent carriers of Salmonella enterica serotypes Typhi and Paratyphi and S. Typhimurium. The sequestration of the bacteria in the parasite leads to ineffective antibiotic treatment because the bacteria cannot be completely killed, and lingering infection may then lead to antimicrobial resistance. These manifestations are likely not just for those dually infected but also for those first infected with schistosomes and, later, Salmonella. More data are needed to better understand dual infection, particularly as it may impact treatment and prevention of schistosomiasis and Salmonella in sub-Saharan Africa. PMID:27907208

  17. Vaccines against invasive Salmonella disease: current status and future directions.

    PubMed

    MacLennan, Calman A; Martin, Laura B; Micoli, Francesca

    2014-01-01

    Though primarily enteric pathogens, Salmonellae are responsible for a considerable yet under-appreciated global burden of invasive disease. In South and South-East Asia, this manifests as enteric fever caused by serovars Typhi and Paratyphi A. In sub-Saharan Africa, a similar disease burden results from invasive nontyphoidal Salmonellae, principally serovars Typhimurium and Enteritidis. The existing Ty21a live-attenuated and Vi capsular polysaccharide vaccines target S. Typhi and are not effective in young children where the burden of invasive Salmonella disease is highest. After years of lack of investment in new Salmonella vaccines, recent times have seen increased interest in the area led by emerging-market manufacturers, global health vaccine institutes and academic partners. New glycoconjugate vaccines against S. Typhi are becoming available with similar vaccines against other invasive serovars in development. With other new vaccines under investigation, including live-attenuated, protein-based and GMMA vaccines, now is an exciting time for the Salmonella vaccine field.

  18. Salmonella Infection

    MedlinePlus

    Salmonella infection Overview By Mayo Clinic Staff Salmonella infection (salmonellosis) is a common bacterial disease that affects the intestinal tract. Salmonella bacteria typically live in animal and human intestines and are ...

  19. Salmonella Prevention

    MedlinePlus

    ... Case Count Maps Epi Curves Signs & Symptoms Key Resources Human Salmonella Infections Linked to Live Poultry Advice to ... Case Count Maps Epi Curves Signs & Symptoms Key Resources Human Salmonella Infections Linked to Small Turtles Human Salmonella ...

  20. Relationship between genotype and phenotype of flagellin C in Salmonella

    PubMed Central

    Ji, Wan-Sheng; Hu, Jia-Lu; Qiu, Jun-Wen; Pan, Bo-Rong; Peng, Dao-Rong; Shi, Bing-Long; Zhou, Shao-Juan; Wu, Kai-Chun; Fan, Dai-Ming

    2001-01-01

    AIM: To discover the relationship between the genotype and antigen serotype of flagellin C among Salmonella strains. METHODS: Fragment of Salmonella flagellin C in plasmid pLS408 was cloned, sequenced and compared with the corresponding sequence in other strains. Salmonella strains including two typhi strains, one paratyphoid strain, one enteritidis and one typhimurium strain were isolated from outpatients. Genome DNA was purified respectively from these clinical isolates, then the corresponding flagellin C fragment was amplified by polymerase chain reaction, and the amplification products were analyzed by agarose gel electrophoresis. RESULTS: The cloned fragment includes 582 nucleotides encoding the variable region and partial conservative region of Salmonella flagellin C in plasmid pLS408. With comparison to the corresponding sequences reported previously, there is only a little difference from other strains with the same flagellar serotype in both nucleotide and amino acid level. Specific PCR products were amplified in Salmonella strains with flagellar serotype H-1-d including S. muenchen, typhi and typhimurium, but not in S. paratyphoid C or S. enteritidis strains. CONCLUSION: In this experiment, the specificity of nucleotide sequence could be found in flagellin C central variable regions as it exists in flagellar serotypes in Salmonella. It may be helpful to developing a rapid, sensitive, accurate and PCR-based method to detect Salmonella strains with serotype H-1-d. PMID:11854918

  1. Biofilm formation and genetic diversity of Salmonella isolates recovered from clinical, food, poultry and environmental sources.

    PubMed

    Nair, Amruta; Rawool, Deepak B; Doijad, Swapnil; Poharkar, Krupali; Mohan, Vysakh; Barbuddhe, Sukhadeo B; Kolhe, Rahul; Kurkure, Nitin V; Kumar, Ashok; Malik, S V S; Balasaravanan, T

    2015-12-01

    In the present study, Salmonella isolates (n=40) recovered from clinical, food, poultry and environmental sources were characterized for serotype identification, genetic diversity and biofilm formation capability. Serotype identification using multiplex PCR assay revealed six isolates to be Salmonella Typhimurium, 14 as Salmonella Enteritidis, 11 as Salmonella Typhi, and the remaining nine isolates unidentified were considered as other Salmonella spp. Most of the Salmonella isolates (85%) produced biofilm on polystyrene surfaces as assessed by microtitre plate assay. About 67.5% isolates were weak biofilm producers and 17.5% were moderate biofilm producers. There was no significant difference in biofilm-forming ability among the Salmonella isolates recovered from different geographical regions or different sources. Among the genetic methods, Enterobacterial Repetitive Intergenic Consensus (ERIC) PCR revealed greater discriminatory power (DI, 0.943) followed by pulsed field gel electrophoresis (PFGE) (DI, 0.899) and random amplification of polymorphic DNA (RAPD) PCR (DI, 0.873). However, composite analysis revealed the highest discrimination index (0.957). Greater discrimination of S. Typhimurium and S. Typhi was achieved using PFGE, while ERIC PCR was better for S. Enteritidis and other Salmonella serotypes. A strong positive correlation (r=0.992) was observed between biofilm formation trait and clustered Salmonella isolates in composite genetic analysis.

  2. Epidemic increase in Salmonella bloodstream infection in children, Bwamanda, the Democratic Republic of Congo.

    PubMed

    Phoba, M-F; De Boeck, H; Ifeka, B B; Dawili, J; Lunguya, O; Vanhoof, R; Muyembe, J-J; Van Geet, C; Bertrand, S; Jacobs, J

    2014-01-01

    Salmonella enterica is the leading cause of bloodstream infection in children in sub-Saharan Africa, but few data are available from Central-Africa. We documented during the period November 2011 to May 2012 an epidemic increase in invasive Salmonella bloodstream infections in HGR Bwamanda, a referral hospital in Equateur Province, DR Congo. Salmonella spp. represented 90.4 % (103 out of 114) of clinically significant blood culture isolates and comprised Salmonella Typhimurium (54.4 %, 56 out of 103), Salmonella Enteritidis (28.2 %, 29 out of 103) and Salmonella Typhi (17.5 %, 18 out of 103), with Salmonella Enteritidis accounting for most of the increase. Most (82 out of 103, 79.6 %) isolates were obtained from children < 5 years old. Median ages of patients infected with Salmonella Typhimurium and Salmonella Enteritidis were 14 months (14 days to 64 years) and 19 months (3 months to 8 years) respectively. Clinical presentation was non-specific; the in-hospital case fatality rate was 11.1 %. More than two thirds (69.7 %, 53 out of 76) of children < 5 years for whom laboratory data were available had Plasmodium falciparum infection. Most (83/85, 97.6 %) non-typhoid Salmonella isolates as well as 6/18 (33.3 %) Salmonella Typhi isolates were multidrug resistant (i.e. resistant to the first-line oral antibiotics amoxicillin, trimethoprim-sulfamethoxazole and chloramphenicol), one (1.0 %) Salmonella Typhimurium had decreased ciprofloxacin susceptibility owing to a point mutation in the gyrA gene (Gly81Cys). Multilocus variable-number tandem-repeat (MLVA) analysis of the Salmonella Enteritidis isolates revealed closely related patterns comprising three major and four minor profiles, with differences limited to one out of five loci. These data show an epidemic increase in clonally related multidrug-resistant Salmonella bloodstream infection in children in DR Congo.

  3. Serum bactericidal assays to evaluate typhoidal and nontyphoidal Salmonella vaccines.

    PubMed

    Boyd, Mary Adetinuke; Tennant, Sharon M; Saague, Venant A; Simon, Raphael; Muhsen, Khitam; Ramachandran, Girish; Cross, Alan S; Galen, James E; Pasetti, Marcela F; Levine, Myron M

    2014-05-01

    Invasive Salmonella infections for which improved or new vaccines are being developed include enteric fever caused by Salmonella enterica serovars Typhi, Paratyphi A, and Paratyphi B and sepsis and meningitis in young children in sub-Saharan Africa caused by nontyphoidal Salmonella (NTS) serovars, particularly S. enterica serovars Typhimurium and Enteritidis. Assays are needed to measure functional antibodies elicited by the new vaccines to assess their immunogenicities and potential protective capacities. We developed in vitro assays to quantify serum bactericidal antibody (SBA) activity induced by S. Typhi, S. Paratyphi A, S. Typhimurium, and S. Enteritidis vaccines in preclinical studies. Complement from various sources was tested in assays designed to measure antibody-dependent complement-mediated killing. Serum from rabbits 3 to 4 weeks of age provided the best complement source compared to serum from pigs, goats, horses, bovine calves, or rabbits 8 to 12 weeks of age. For S. Enteritidis, S. Typhimurium, and S. Typhi SBA assays to be effective, bacteria had to be harvested at log phase. In contrast, S. Paratyphi A was equally susceptible to killing whether it was grown to the stationary or log phase. The typhoidal serovars were more susceptible to complement-mediated killing than were the nontyphoidal serovars. Lastly, the SBA endpoint titers correlated with serum IgG anti-lipopolysaccharide (LPS) titers in mice immunized with mucosally administered S. Typhimurium, S. Enteritidis, and S. Paratyphi A but not S. Typhi live attenuated vaccines. The SBA assay described here is a useful tool for measuring functional antibodies elicited by Salmonella vaccine candidates.

  4. Serum Bactericidal Assays To Evaluate Typhoidal and Nontyphoidal Salmonella Vaccines

    PubMed Central

    Boyd, Mary Adetinuke; Saague, Venant A.; Simon, Raphael; Muhsen, Khitam; Ramachandran, Girish; Cross, Alan S.; Galen, James E.; Pasetti, Marcela F.; Levine, Myron M.

    2014-01-01

    Invasive Salmonella infections for which improved or new vaccines are being developed include enteric fever caused by Salmonella enterica serovars Typhi, Paratyphi A, and Paratyphi B and sepsis and meningitis in young children in sub-Saharan Africa caused by nontyphoidal Salmonella (NTS) serovars, particularly S. enterica serovars Typhimurium and Enteritidis. Assays are needed to measure functional antibodies elicited by the new vaccines to assess their immunogenicities and potential protective capacities. We developed in vitro assays to quantify serum bactericidal antibody (SBA) activity induced by S. Typhi, S. Paratyphi A, S. Typhimurium, and S. Enteritidis vaccines in preclinical studies. Complement from various sources was tested in assays designed to measure antibody-dependent complement-mediated killing. Serum from rabbits 3 to 4 weeks of age provided the best complement source compared to serum from pigs, goats, horses, bovine calves, or rabbits 8 to 12 weeks of age. For S. Enteritidis, S. Typhimurium, and S. Typhi SBA assays to be effective, bacteria had to be harvested at log phase. In contrast, S. Paratyphi A was equally susceptible to killing whether it was grown to the stationary or log phase. The typhoidal serovars were more susceptible to complement-mediated killing than were the nontyphoidal serovars. Lastly, the SBA endpoint titers correlated with serum IgG anti-lipopolysaccharide (LPS) titers in mice immunized with mucosally administered S. Typhimurium, S. Enteritidis, and S. Paratyphi A but not S. Typhi live attenuated vaccines. The SBA assay described here is a useful tool for measuring functional antibodies elicited by Salmonella vaccine candidates. PMID:24623629

  5. Salmonella enterica.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Avian Salmonella infections are important as both a cause of clinical disease in poultry and as a source of food-borne transmission of disease to humans. Host-adapted salmonellae (Salmonella enterica serovar Pullorum and Gallinarum) are responsible for severe systemic diseases, whereas numerous sero...

  6. In vitro modeling of gallbladder-associated Salmonella spp. colonization.

    PubMed

    Gonzalez-Escobedo, Geoffrey; Gunn, John S

    2015-01-01

    The host-pathogen interactions occurring in the gallbladder during Salmonella Typhi colonization contribute to typhoid fever pathogenesis during the acute and chronic stages of disease. The gallbladder is the primary reservoir during chronic typhoid carriage. In this organ, Salmonella encounters host-barriers including bile, immunoglobulins, and mucus. However, the bacterium possesses mechanisms to resist and persist in this environment, in part by its ability to attach to and invade into the gallbladder epithelium. Such persistence in the gallbladder epithelium contributes to chronic carriage. In addition, patients harboring gallstones in their gallbladders have increased risk of becoming carriers because these abnormalities serve as a substrate for Salmonella biofilm formation. Our laboratory has studied the Salmonella interactions in this specific environment by developing in vitro methods that closely mimic the gallbladder and gallstones niches. These methods are reproducible and provide a platform for future studies of acute and chronic bacterial infections in the gallbladder.

  7. Heterogeneity of Multifunctional IL-17A Producing S. Typhi-Specific CD8+ T Cells in Volunteers following Ty21a Typhoid Immunization

    PubMed Central

    McArthur, Monica A.; Sztein, Marcelo B.

    2012-01-01

    Salmonella enterica serovar Typhi (S. Typhi), the causative agent of typhoid fever, continues to cause significant morbidity and mortality world-wide. CD8+ T cells are an important component of the cell mediated immune (CMI) response against S. Typhi. Recently, interleukin (IL)-17A has been shown to contribute to mucosal immunity and protection against intracellular pathogens. To investigate multifunctional IL-17A responses against S. Typhi antigens in T memory subsets, we developed multiparametric flow cytometry methods to detect up to 6 cytokines/chemokines (IL-10, IL-17A, IL-2, interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α) and macrophage inflammatory protein-1β (MIP-1β)) simultaneously. Five volunteers were immunized with a 4 dose regimen of live-attenuated S. Typhi vaccine (Ty21a), peripheral blood mononuclear cells (PBMC) were isolated before and at 11 time points after immunization, and CMI responses were evaluated. Of the 5 immunized volunteers studied, 3 produced detectable CD8+ T cell responses following stimulation with S. Typhi-infected autologous B lymphoblastoid cell lines (B-LCL). Additionally, 2 volunteers had detectable levels of intracellular cytokines in response to stimulation with S. Typhi-infected HLA-E restricted cells. Although the kinetics of the responses differed among volunteers, all of the responses were bi- or tri-phasic and included multifunctional CD8+ T cells. Virtually all of the IL-17A detected was derived from multifunctional CD8+ T cells. The presence of these multifunctional IL-17A+ CD8+ T cells was confirmed using an unsupervised analysis program, flow cytometry clustering without K (FLOCK). This is the first report of IL-17A production in response to S. Typhi in humans, indicating the presence of a Tc17 response which may be important in protection. The presence of IL-17A in multifunctional cells co-producing Tc1 cytokines (IL-2, IFN-γ and TNF-α) may also indicate that the distinction between Tc17 and Tc1

  8. Lymphocytic proliferative response to outer-membrane proteins isolated from Salmonella.

    PubMed

    González, C R; Isibasi, A; Ortiz-Navarrete, V; Paniagua, J; García, J A; Blanco, F; Kumate, J

    1993-01-01

    Porins isolated from Salmonella typhi have been demonstrated to protect against the challenge with this bacteria in mice. The mechanism has not been clarified, but could be associated with activation of both humoral and cellular immunity. In order to evaluate the induction of specific T cell responses, the lymphocytic proliferation to porins isolated from Salmonella typhimurium, Salmonella typhi and Escherichia coli was examined by 3H-thymidine incorporation assay in mice immunized with three different antigens: acetone-killed S. typhimurium, its porins, or outer-membrane proteins (OMPs) isolated from S. typhi. Higher proliferative responses were observed in mice immunized with porins and OMPs compared with those which received the acetone-killed bacteria. Although cross-reactivity was observed between porins, they were not mitogenic. Moreover, porins were able to activate T lymphocytes isolated from mice immunized with S. typhi OMPs. These results suggest that T cell activation, through the release of lymphokines, may play a role in the induction of protective immunity with porins.

  9. Determination of antimicrobial resistance in Salmonella spp.

    PubMed

    Harish, Belgode N; Menezes, Godfred A

    2015-01-01

    Infections with Salmonella are an important public health problem worldwide. Salmonella are one of the most common causes of food-borne illness in humans. There are many types of Salmonella but they can be divided into two broad categories: those that cause typhoid and those that do not. The typhoidal Salmonella (TS), such as S. enterica subsp. enterica serovars Typhi and S. Paratyphi only colonize humans and are usually acquired by the consumption of food or water contaminated with human fecal material. The much broader group of non-typhoidal Salmonella (NTS) usually results from improperly handled food that has been contaminated by animal or human fecal material. Antimicrobials are critical to the successful outcome of invasive Salmonella infections and enteric fever. Due to resistance to the older antimicrobials, ciprofloxacin [fluoroquinolone (FQ)] has become the first-line drug for treatment. Nevertheless, switch to FQ has led to a subsequent increase in the occurrence of salmonellae resistant to this antimicrobial agent. The exact mechanism of this FQ resistance is not fully understood. FQ resistance has driven the use of third-generation cephalosporins and azithromycin. However, there are sporadic worldwide reports of high level resistance to expanded-spectrum cephalosporins (such as ceftriaxone) in TS and in NTS it has been recognized since 1988 and are increasing in prevalence worldwide. Already there are rare reports of azithromycin resistance leading to treatment failure. Spread of such resistance would further greatly limit the available therapeutic options, and leave us with only the reserve antimicrobials such as carbapenem and tigecycline as possible treatment options. Here, we describe the methods involved in the genotypic characterization of antimicrobial resistance in clinical isolates of salmonellae.

  10. [Salmonella taxonomy].

    PubMed

    Eiguer, T; Caffer, M I

    1988-01-01

    Throughout the years, Salmonella nomenclature has suffered continual revisions, due to the confusion created by the different criteria adopted by the several groups of researchers. At the present time, it is recognized that the genus Salmonella is a single species, composed by seven taxa, with the level of subspecies (subsp.), which can be divided into serovars, described in the Kauffmann-White scheme. The name of four the species type Salmonella is Salmonella enteral sp. nov. nom. rev. The serovar of the taxon I is designated, for instance, Salmonella subsp. I ser. Typhimurium. For the other taxa, less frequent in human or animal pathology, the name of the subsp., followed by the antigenic formula (e.g. Salmonella subsp. IV 50: b-) is used. This criterion has been validated by the International Committee of Systematic Bacteriology and the names of the serovars are included in the Approved Lists of Bacterial Names.

  11. Poor biofilm-forming ability and long-term survival of invasive Salmonella Typhimurium ST313.

    PubMed

    Ramachandran, Girish; Aheto, Komi; Shirtliff, Mark E; Tennant, Sharon M

    2016-07-01

    Salmonella enterica serovar Typhimurium, an enteric pathogen that causes a self-limiting gastroenteritis, forms biofilms on different surfaces. In sub-Saharan Africa, Salmonella Typhimurium of a novel sequence type (ST) 313 was identified and produces septicemia in the absence of gastroenteritis. No animal reservoir has been identified, and it is hypothesized that transmission occurs via human to human. In this study, we show that invasive Salmonella Typhimurium ST313 strains from Mali are poor biofilm producers compared to Salmonella Typhimurium ST19 strains, which are found worldwide and are known to be associated with gastroenteritis. We evaluated biofilms using crystal violet staining, examination of the red, dry and rough morphotype, pellicle formation and a continuous flow system. One month-old Salmonella Typhimurium ST19 colonies survived in the absence of exogenous nutrients and were highly resistant to sodium hypochlorite treatment compared to Salmonella Typhimurium ST313. This study for the first time demonstrates the comparative biofilm-forming ability and long-term survival of clinical Salmonella Typhimurium ST19 and ST313 isolates. Salmonella Typhimurium ST19 strains are strong biofilm producers and can survive desiccation compared to Salmonella Typhimurium ST313 that form weak biofilms and survive poorly following desiccation. Our data suggest that like Salmonella Typhi, Salmonella Typhimurium ST313 lack mechanisms that allow it to persist in the environment.

  12. Salmonella Osteomyelitis.

    PubMed

    McAnearney, S; McCall, D

    2015-10-01

    Salmonella infection can cause four predominant clinical syndromes: enteric fever, acute gastroenteritis, bacteraemia with or without metastatic infection, and the asymptomatic carrier state. Salmonella as an aetiological agent in osteomyelitis is essentially rare and salmonella osteomyelitis in itself is predominantly seen in patients with haemoglobinopathies such as sickle cell disease or thalassemia. There are very few cases reported in the literature in which salmonella osteomyelitis is seen in otherwise healthy individuals. We describe here a case of salmonella osteomyelitis in a young gentleman with no significant comorbidities who presented with fever and severe back pain, having returned from recent foreign travel. It is therefore important to consider uncommon pathogens in the differential diagnosis of travellers with prolonged fever and insidious symptoms.

  13. Persisting Rickettsia typhi Causes Fatal Central Nervous System Inflammation

    PubMed Central

    Papp, Stefanie; Moderzynski, Kristin; Kuehl, Svenja; Richardt, Ulricke; Fleischer, Bernhard

    2016-01-01

    Rickettsioses are emerging febrile diseases caused by obligate intracellular bacteria belonging to the family Rickettsiaceae. Rickettsia typhi belongs to the typhus group (TG) of this family and is the causative agent of endemic typhus, a disease that can be fatal. In the present study, we analyzed the course of R. typhi infection in C57BL/6 RAG1−/− mice. Although these mice lack adaptive immunity, they developed only mild and temporary symptoms of disease and survived R. typhi infection for a long period of time. To our surprise, 3 to 4 months after infection, C57BL/6 RAG1−/− mice suddenly developed lethal neurological disorders. Analysis of these mice at the time of death revealed high bacterial loads, predominantly in the brain. This was accompanied by a massive expansion of microglia and by neuronal cell death. Furthermore, high numbers of infiltrating CD11b+ macrophages were detectable in the brain. In contrast to the microglia, these cells harbored R. typhi and showed an inflammatory phenotype, as indicated by inducible nitric oxide synthase (iNOS) expression, which was not observed in the periphery. Having shown that R. typhi persists in immunocompromised mice, we finally asked whether the bacteria are also able to persist in resistant C57BL/6 and BALB/c wild-type mice. Indeed, R. typhi could be recultivated from lung, spleen, and brain tissues from both strains even up to 1 year after infection. This is the first report demonstrating persistence and reappearance of R. typhi, mainly restricted to the central nervous system in immunocompromised mice. PMID:26975992

  14. Live Attenuated Human Salmonella Vaccine Candidates: Tracking the Pathogen in Natural Infection and Stimulation of Host Immunity.

    PubMed

    Galen, James E; Buskirk, Amanda D; Tennant, Sharon M; Pasetti, Marcela F

    2016-11-01

    Salmonellosis, caused by members of the genus Salmonella, is responsible for considerable global morbidity and mortality in both animals and humans. In this review, we will discuss the pathogenesis of Salmonella enterica serovar Typhi and Salmonella enterica serovar Typhimurium, focusing on human Salmonella infections. We will trace the path of Salmonella through the body, including host entry sites, tissues and organs affected, and mechanisms involved in both pathogenesis and stimulation of host immunity. Careful consideration of the natural progression of disease provides an important context in which attenuated live oral vaccines can be rationally designed and developed. With this in mind, we will describe a series of attenuated live oral vaccines that have been successfully tested in clinical trials and demonstrated to be both safe and highly immunogenic. The attenuation strategies summarized in this review offer important insights into further development of attenuated vaccines against other Salmonella for which live oral candidates are currently unavailable.

  15. Typhoidal Salmonellae: Use of Multi-Locus Sequence Typing to Determine Population Structure.

    PubMed

    Sharma, Priyanka; Dahiya, Sushila; Balaji, Veeraraghavan; Kanga, Anil; Panda, Preetilata; Das, Rashna; Dhanraju, Anbumani; Mendiratta, Deepak Kumar; Sood, Seema; Das, Bimal Kumar; Kapil, Arti

    2016-01-01

    Enteric fever is an invasive infection predominantly caused by Salmonella enterica serovars Typhi and Paratyphi A. The pathogens have evolved from other nontyphoidal salmonellaeto become invasive and host restricted. Emergence of antimicrobial resistance in typhoidal salmonellae in some countries is a major therapeutic concern as the travelers returning from endemic countries carry resistant strains to non endemic areas. In order to understand the epidemiology and to design disease control strategies molecular typing of the pathogen is very important. We performed Multilocus Sequence Typing (MLST) of 251 S. Typhi and 18 S. Paratyphi strains isolated from enteric fever patients from seven centers across India during 2010-2013to determine the population structure and prevalence of MLST sequence types in India. MLST analysis revealed the presence of five sequence types (STs) of typhoidal salmonellae in India namely ST1, ST2 and ST3 for S. Typhi and ST85 and ST129 for S. Paratyphi A.S. Typhi strains showed monophyletic lineage and clustered in to 3 Sequence Types-ST1, ST2 and ST3 and S. Paratyphi A isolates segregated in two sequence types ST85 and ST129 respectively. No association was found between antimicrobial susceptibility and sequence types. This study found ST1 as the most prevalent sequence type of S. Typhi in India followed by ST2, which is in concordance with previous studies and MLST database. In addition a rare sequence type ST3 has been found which is reported for the first time from the Indian subcontinent. Amongst S. Paratyphi A, the most common sequence type is ST129 as also reported from other parts of world. This distribution and prevalence suggest the common spread of the sequence types across the globe and these findings can help in understanding the disease distribution.

  16. Typhoidal Salmonellae: Use of Multi-Locus Sequence Typing to Determine Population Structure

    PubMed Central

    Sharma, Priyanka; Dahiya, Sushila; Balaji, Veeraraghavan; Kanga, Anil; Panda, Preetilata; Das, Rashna; Dhanraju, Anbumani; Mendiratta, Deepak Kumar; Sood, Seema; Das, Bimal Kumar; Kapil, Arti

    2016-01-01

    Enteric fever is an invasive infection predominantly caused by Salmonella enterica serovars Typhi and Paratyphi A. The pathogens have evolved from other nontyphoidal salmonellaeto become invasive and host restricted. Emergence of antimicrobial resistance in typhoidal salmonellae in some countries is a major therapeutic concern as the travelers returning from endemic countries carry resistant strains to non endemic areas. In order to understand the epidemiology and to design disease control strategies molecular typing of the pathogen is very important. We performed Multilocus Sequence Typing (MLST) of 251 S. Typhi and 18 S. Paratyphi strains isolated from enteric fever patients from seven centers across India during 2010-2013to determine the population structure and prevalence of MLST sequence types in India. MLST analysis revealed the presence of five sequence types (STs) of typhoidal salmonellae in India namely ST1, ST2 and ST3 for S. Typhi and ST85 and ST129 for S. Paratyphi A.S. Typhi strains showed monophyletic lineage and clustered in to 3 Sequence Types—ST1, ST2 and ST3 and S. Paratyphi A isolates segregated in two sequence types ST85 and ST129 respectively. No association was found between antimicrobial susceptibility and sequence types. This study found ST1 as the most prevalent sequence type of S. Typhi in India followed by ST2, which is in concordance with previous studies and MLST database. In addition a rare sequence type ST3 has been found which is reported for the first time from the Indian subcontinent. Amongst S. Paratyphi A, the most common sequence type is ST129 as also reported from other parts of world. This distribution and prevalence suggest the common spread of the sequence types across the globe and these findings can help in understanding the disease distribution. PMID:27618626

  17. Salmonella Infections (For Parents)

    MedlinePlus

    ... Old Feeding Your 1- to 2-Year-Old Salmonella Infections KidsHealth > For Parents > Salmonella Infections A A ... bathroom and before handling food in any way. Salmonella Basics Not everyone who ingests Salmonella bacteria will ...

  18. Prevalence of antimicrobial resistance in Salmonella serotype Hadar isolated from humans, retail meat, and food animals at slaughter, United States, NARMS 1996-2008

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Non-Typhi Salmonella (NTS) is a leading cause of bacterial gastroenteritis in the United States. Although most infections are self-limited, antibiotic treatment is essential for severe illness. Use of antimicrobial agents in food animals contributes to resistance in NTS. Multidrug resis...

  19. ClyA cytolysin from Salmonella: distribution within the genus, regulation of expression by SlyA, and pore-forming characteristics.

    PubMed

    von Rhein, Christine; Bauer, Susanne; López Sanjurjo, Enrique Javier; Benz, Roland; Goebel, Werner; Ludwig, Albrecht

    2009-01-01

    Functional homologs of the Escherichia coli cytolysin A (clyA, hlyE, sheA) gene have recently been detected in Salmonella enterica serovars Typhi (S. Typhi) and Paratyphi A (S. Paratyphi A). In this study, analysis of a collection of Salmonella strains showed that all S. Typhi and S. Paratyphi A strains tested harbor an intact copy of the corresponding clyA variant, i.e. clyA(STy) and clyA(SPaA), respectively. On the other hand, clyA proved to be absent in the S. enterica serovar Paratyphi B and serovar Paratyphi C strains, in various non-typhoid S. enterica subsp. enterica serovars (Typhimurium, Enteritidis, Choleraesuis, Dublin, and Gallinarum), and in S. enterica subsp. arizonae and Salmonella bongori strains. When grown under normal laboratory conditions, the S. Typhi and S. Paratyphi A strains produced only basal amounts of ClyA protein and did not exhibit a clyA-dependent hemolytic phenotype. RT-PCR and immunoblot analyses as well as phenotypic data revealed, however, that the expression of clyA(STy) and clyA(SPaA) can be activated by the Salmonella transcription factor SlyA. In addition, osmotic protection assays and lipid bilayer experiments demonstrated that the hemolytic ClyA(STy) and ClyA(SPaA) proteins are effective pore-forming toxins which, similar to E. coli ClyA, generate large, stable, moderately cation-selective channels in target membranes. Taken together with our recent serological findings which have indicated that S. Typhi and S. Paratyphi A strains produce substantial amounts of ClyA during human infection, these data suggest that ClyA may play a role in S. Typhi and S. Paratyphi A pathogenesis.

  20. Gallstones play a significant role in Salmonella spp. gallbladder colonization and carriage.

    PubMed

    Crawford, Robert W; Rosales-Reyes, Roberto; Ramírez-Aguilar, María de la Luz; Chapa-Azuela, Oscar; Alpuche-Aranda, Celia; Gunn, John S

    2010-03-02

    Salmonella enterica serovar Typhi can colonize the gallbladder and persist in an asymptomatic carrier state that is frequently associated with the presence of gallstones. We have shown that salmonellae form bile-mediated biofilms on human gallstones and cholesterol-coated surfaces in vitro. Here, we test the hypothesis that biofilms on cholesterol gallbladder stones facilitate typhoid carriage in mice and men. Naturally resistant (Nramp1(+/+)) mice fed a lithogenic diet developed cholesterol gallstones that supported biofilm formation during persistent serovar Typhimurium infection and, as a result, demonstrated enhanced fecal shedding and enhanced colonization of gallbladder tissue and bile. In typhoid endemic Mexico City, 5% of enrolled cholelithiasis patients carried serovar Typhi, and bacterial biofilms could be visualized on gallstones from these carriers whereas significant biofilms were not detected on gallstones from Escherichia coli infected gallbladders. These findings offer direct evidence that gallstone biofilms occur in humans and mice, which facilitate gallbladder colonization and shedding.

  1. Salmonella Infections

    MedlinePlus

    ... reptiles like snakes, turtles, and lizards. Symptoms include Fever Diarrhea Abdominal cramps Headache Possible nausea, vomiting, and ... be serious. The usual treatment is antibiotics. Typhoid fever, a more serious disease caused by Salmonella, is ...

  2. Salmonella pyomyositis with concurrent sacroiliac osteomyelitis presenting as piriformis syndrome: A rare case.

    PubMed

    Phadke, P S; Gandhi, A R; More, S A; Joshirao, R P

    2017-01-01

    A-21-year old male admitted with fever and piriformis syndrome, typically associated with gluteal region pain radiating down the thigh, was evaluated and found to have pyomyositis involving piriformis and osteomyelitis with sacroiliac joint affection on radiological imaging. Salmonella serotype typhi was isolated from blood culture. He was treated with intravenous Ceftriaxone for 6 weeks with signs of recovery documented clinically as well as on imaging studies. Salmonella pyomyositis with osteomyelitis in an immunocompetent patient with no previous hematological or endocrine disorder makes this case an unusual presentation.

  3. Innate immune control of Salmonella enterica serovar Typhimurium: mechanisms contributing to combating systemic Salmonella infection.

    PubMed

    Wick, Mary Jo

    2011-01-01

    Infections with Salmonella enterica serovars remain a serious problem worldwide. While serovar Typhi causes significant morbidity and mortality that is restricted to humans, serovar Typhimurium causes gastroenteritidis in humans and can also infect other animals. As mice with the susceptible Nramp1 locus get systemic infection with serovar Typhimurium, murine infection models using this serovar have been widely used to decipher the immune mechanisms required to survive systemic Salmonella infection. This review summarizes recent studies in murine infection models that have advanced our understanding of the events that occur during the first days after oral Salmonella infection. The pathways of bacterial penetration across the intestinal epithelium, bacterial spread to draining (mesenteric) lymph nodes and dissemination to systemic tissues is discussed. The response of myeloid cell populations, including dendritic cells, inflammatory monocytes and neutrophils, during the early stage of infection is also discussed. Finally, the mechanisms driving recruitment of myeloid cells to infected intestinal lymphoid tissues and what is known about Toll-like receptor signaling pathways in innate immunity to Salmonella infection is also discussed.

  4. Salmonella Infections

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infections with bacteria of the genus Salmonella are responsible for both acute and chronic poultry diseases. These diseases cause economically significant losses for poultry producers in many nations and absorb large investments of public and private resources in testing and control efforts. Infect...

  5. Salmonella typhimurium Invasion Induces Apoptosis in Infected Macrophages

    NASA Astrophysics Data System (ADS)

    Monack, Denise M.; Raupach, Barbel; Hromockyj, Alexander E.; Falkow, Stanley

    1996-09-01

    Invasive Salmonella typhimurium induces dramatic cytoskeletal changes on the membrane surface of mammalian epithelial cells and RAW264.7 macrophages as part of its entry mechanism. Noninvasive S. typhimurium strains are unable to induce this membrane ruffling. Invasive S. typhimurium strains invade RAW264.7 macrophages in 2 h with 7- to 10-fold higher levels than noninvasive strains. Invasive S. typhimurium and Salmonella typhi, independent of their ability to replicate intracellularly, are cytotoxic to RAW264.7 macrophages and, to a greater degree, to murine bone marrow-derived macrophages. Here, we show that the macrophage cytotoxicity mediated by invasive Salmonella is apoptosis, as shown by nuclear morphology, cytoplasmic vacuolization, and host cell DNA fragmentation. S. typhimurium that enter cells causing ruffles but are mutant for subsequent intracellular replication also initiate host cell apoptosis. Mutant S. typhimurium that are incapable of inducing host cell membrane ruffling fail to induce apoptosis. The activation state of the macrophage plays a significant role in the response of macrophages to Salmonella invasion, perhaps indicating that the signal or receptor for initiating programmed cell death is upregulated in activated macrophages. The ability of Salmonella to promote apoptosis may be important for the initiation of infection, bacterial survival, and escape of the host immune response.

  6. Cathelicidin antimicrobial peptide expression is not induced or required for bacterial clearance during salmonella enterica infection of human monocyte-derived macrophages.

    PubMed

    Strandberg, Kristi L; Richards, Susan M; Gunn, John S

    2012-11-01

    Salmonella enterica serovar Typhimurium is able to resist antimicrobial peptide killing by induction of the PhoP-PhoQ and PmrA-PmrB two-component systems and the lipopolysaccharide (LPS) modifications they mediate. Murine cathelin-related antimicrobial peptide (CRAMP) has been reported to inhibit S. Typhimurium growth in vitro and in vivo. We hypothesize that infection of human monocyte-derived macrophages (MDMs) with Salmonella enterica serovar Typhi and S. Typhimurium will induce human cathelicidin antimicrobial peptide (CAMP) production, and exposure to LL-37 (processed, active form of CAMP/hCAP18) will lead to upregulation of PmrAB-mediated LPS modifications and increased survival in vivo. Unlike in mouse macrophages, in which CRAMP is upregulated during infection, camp gene expression was not induced in human MDMs infected with S. Typhi or S. Typhimurium. Upon infection, intracellular levels of ΔphoPQ, ΔpmrAB, and PhoP(c) S. Typhi decreased over time but were not further inhibited by the vitamin D(3)-induced increase in camp expression. MDMs infected with wild-type (WT) S. Typhi or S. Typhimurium released similar levels of proinflammatory cytokines; however, the LPS modification mutant strains dramatically differed in MDM-elicited cytokine levels. Overall, these findings indicate that camp is not induced during Salmonella infection of MDMs nor is key to Salmonella intracellular clearance. However, the cytokine responses from MDMs infected with WT or LPS modification mutant strains differ significantly, indicating a role for LPS modifications in altering the host inflammatory response. Our findings also suggest that S. Typhi and S. Typhimurium elicit different proinflammatory responses from MDMs, despite being capable of adding similar modifications to their LPS structures.

  7. Cytotoxic mechanism of cytolethal distending toxin in nontyphoidal Salmonella serovar (Salmonella Javiana) during macrophage infection.

    PubMed

    Williams, Katherine; Gokulan, Kuppan; Shelman, Diamond; Akiyama, Tatsuya; Khan, Ashraf; Khare, Sangeeta

    2015-02-01

    Cytolethal distending toxin B (cdtB) is a conserved virulence factor in Salmonella enterica serovar Typhi. Here we report the presence and functionality of cdtB in some nontyphoidal Salmonella (NTS) serovars, including Salmonella Javiana (cdtB+wt S. Javiana), isolated from imported food. To understand the role of cdtB in NTS serovars, a deletion mutant (cdtB(-)ΔS. Javiana) was constructed. Macrophages were infected with cdtB+wt S. Javiana (wild type), cdtB(-)Δ S. Javiana (mutant), and cdtB-negative NTS serovar (S. Typhimurium). Cytotoxic activity and transcription level of genes involved in cell death (apoptosis, autophagy, and necrosis) were assessed in infected macrophages. The cdtB+wt S. Javiana caused cellular distension as well as high degree of vacuolization and presence of the autophagosome marker LC3 in infected macrophages as compared with cdtB(-)ΔS. Javiana. The mRNA expression of genes involved in the induction of autophagy in response to toxin (Esr1 and Pik3C3) and coregulators of autophagy and apoptosis (Bax and Cyld) were significantly upregulated in cdtB(+)wt S. Javiana-infected macrophages. As autophagy destroys internalized pathogens in addition to the infected cell, it may reduce the spread of infection.

  8. Cooccurrence of Metastatic Papillary Thyroid Carcinoma and Salmonella Induced Neck Abscess in a Cervical Lymph Node

    PubMed Central

    Kim, Jae-Myung; Jung, Eun Jung; Song, Eun Jin; Kim, Dong Chul; Jeong, Chi-Young; Ju, Young-Tae; Lee, Young-Joon; Hong, Soon-Chan; Choi, Sang-Kyung; Ha, Woo-Song

    2017-01-01

    Cervical lymph node metastasis is common in patients with papillary thyroid carcinoma (PTC). Salmonella species are rarely reported as causative agents in focal infections of the head and neck. The cooccurrence of lymph node metastasis from PTC and a bacterial infection is rare. This report describes a 76-year-old woman with a cervical lymph node metastasis from PTC and Salmonella infection of the same lymph node. The patient presented with painful swelling in her left lateral neck region for 15 days, and neck ultrasonography and computed tomography showed a cystic mass along left levels II–IV. The cystic mass was suspected of being a metastatic lymph node; modified radical neck dissection was performed. Histopathological examination confirmed the presence of PTC in the resected node and laboratory examination of the combined abscess cavity confirmed the presence of Salmonella Typhi. Following antibiotic sensitivity testing of the cultured Salmonella Typhi, she was treated with proper antibiotics. Cystic lesions in lymph nodes with metastatic cancer may indicate the presence of cooccurring bacterial infection. Thus, culturing of specimen can be option to make accurate diagnosis and to provide proper postoperative management. PMID:28261270

  9. Prevalence of Salmonella Excretion in Stool: A Community Survey in 2 Sites, Guinea-Bissau and Senegal

    PubMed Central

    Im, Justin; Nichols, Chelsea; Bjerregaard-Andersen, Morten; Sow, Amy Gassama; Løfberg, Sandra; Tall, Adama; Pak, Gi Deok; Aaby, Peter; Baker, Stephen; Clemens, John D.; Espinoza, Ligia Maria Cruz; Konings, Frank; May, Jürgen; Monteiro, Mario; Niang, Aissatou; Panzner, Ursula; Park, Se Eun; Schütt-Gerowitt, Heidi; Wierzba, Thomas F.; Marks, Florian; von Kalckreuth, Vera

    2016-01-01

    Background. Chronic and convalescent carriers play an important role in the transmission and endemicity of many communicable diseases. A high incidence of Salmonella enterica serovar Typhi and invasive nontyphoidal Salmonella (NTS) infection has been reported in parts of sub-Saharan Africa, yet the prevalence of Salmonella excretion in the general population is unknown. Methods. Stool specimens were collected from a random sample of households in 2 populations in West Africa: Bissau, Guinea-Bissau, and Dakar, Senegal. Stool was cultured to detect presence of Salmonella, and antimicrobial susceptibility testing was performed on the isolated organisms. Results. Stool was cultured from 1077 and 1359 individuals from Guinea-Bissau and Senegal, respectively. Salmonella Typhi was not isolated from stool samples at either site. Prevalence of NTS in stool samples was 24.1 (95% confidence interval [CI], 16.5–35.1; n = 26/1077) per 1000 population in Guinea-Bissau and 10.3 (95% CI, 6.1–17.2; n = 14/1359) per 1000 population in Senegal. Conclusions. Evidence of NTS excretion in stool in both study populations indicates a possible NTS transmission route in these settings. PMID:26933022

  10. Salmonella in effluent from sewage treatment plants, wastepipe of butcher's shops and surface water in Walcheren.

    PubMed

    Kampelmacher, E H; van Noorle Jansen, L M

    1976-07-01

    In the frame of the "Walcheren-project" in which the epidemiology of salmonellosis is studied in a certain area, effluent from sewage treatment plants, wastepipe's of butcher's shops and surface waters, which receive the effluent were studied for the presence of salmonellae. From 160 samples of effluent 150 (94%) contained salmonellae. The most common serotype was S. typhi murium (35%) followed by S. panama and S. infantis. 14 butcher's shops' wastepipes were sampled 54 times. 14 (26%) times salmonellae were found, but only twice was the type isolated from the butcher's shop the same as found in the effluent on the same day. With regard to the presence of salmonellae in surface waters receiving effluent it was shown that from the immediate vicinity of the plant to 250 m downstream from the site of drainage of effluent the number of salmonellae per 100 ml remains almost constant. After 1.5-4 kilometers Salmonella could not be isolated from any of the samples examined. The results underline the hypothesis that salmonellae multiply in the sewage system and/or plant. The spread of samonellae by effluent seems to be limited to the plant itself and of the nearest vicinity. Proposals are brought forward to interupt contamination cycles by decontamination measures.

  11. Evaluation the antibacterial effects of Echinophora platyloba extracts against some Salmonella species

    PubMed Central

    Ranjbar, Reza; Babaie, Saeed

    2016-01-01

    Introduction Salmonellosis, which is caused by nontyphoid salmonella bacteria, is one of the most common foodborne diseases, and it causes gastrointestinal infections worldwide, most of which are limited gastroenteritis that requires antimicrobial treatment. The aim of this study was to investigate the effects of echinophora platyloba extract on inhibiting the growth of Salmonella typhi, Salmonella enteritidis, and salmonella choleraesuis. Methods Echinophora Platyloba extract was collected in the East Azarbaijan Province in Iran in June 2015. Weeds, infected plants, and dried roots were separated and removed. After drying and grinding the plant, 100 grams of powder were weighed, and the extraction of the plant was carried out by percolation. This study tested the Minimum Inhibitory Concentration (MIC) by the broth micro dilution method and Minimum Bactericidal Concentration (MBC). All of the data were analyzed by SPSS statistical software, version 22.0. One-Way ANOVA and the Duncan test were used to compare the effect of various concentrations of the extract on each type of bacteria. Results Our results indicated that, in 250 mg/ml of extracts discs, the largest growth inhibition zones were formed, and they were 26.11 ± 1.16, 21.23 ± 0.89, and 19.65 ± 0.60 in S. enteritidis, S. typhi, and S. choleraesuis groups, respectively. The statistical results indicated that, in each type of bacteria, there was a statistical difference (p < 0.01) between the various concentrations of the extracts and the chloramphenicol discs. Also, it was indicated that this extract at a concentration of 150 mg/ml had a germicidal effect on S. enteritidis and S. typhi bacteria and that 250 mg/ml had a bactericidal effect on S. choleraesuis. Conclusion The results of this study indicated that E. platyloba extract has potential effects as antimicrobial agents. PMID:27054002

  12. Live Attenuated Human Salmonella Vaccine Candidates: tracking the pathogen in natural infection and stimulation of host immunity

    PubMed Central

    Galen, James E.; Buskirk, Amanda D.; Tennant, Sharon M.; Pasetti, Marcela F.

    2016-01-01

    Salmonellosis, caused by members of the genus Salmonella, is responsible for considerable global morbidity and mortality, in both animals and humans. In this review, we will discuss the pathogenesis of S. Typhi and S. Typhimurium, focusing on human Salmonella infections. We will trace the path of Salmonella through the body, including host entry sites, tissues and organs affected, and mechanisms involved in both pathogenesis and stimulation of host immunity. Careful consideration of the natural progression of disease provides an important context in which attenuated live oral vaccines can be rationally designed and developed. With this in mind, we will describe a series of attenuated live oral vaccines that have been successfully tested in clinical trials and demonstrated to be both safe and highly immunogenic. The attenuation strategies summarized in this review offer important insights into further development of attenuated vaccines against other Salmonella for which live oral candidates are currently unavailable. PMID:27809955

  13. [Experimental study of the inoculative transmission of Rickettsia typhi by gamasid mites (Gamasidae) Ornithonyssus bacoti].

    PubMed

    Grabarev, P A; Suroviatkin, A V; Tikhonova, Iu Iu; Mishchenko, O A; Potapenko, O V

    2009-01-01

    The authors' studies have established that the concentration of Rickettsia typhi may increase about 100-fold in the infected Ornithonyssus bacoti mites. At the time, when on feeding 20 to 200 adult mites on guinea-pigs and albino rats 4 to 36 days after inoculation, they did not transmit Rickettsia typhi on blood sucking.

  14. Inhibition of Salmonella enterica biofilm formation using small-molecule adenosine mimetics.

    PubMed

    Koopman, Jacob A; Marshall, Joanna M; Bhatiya, Aditi; Eguale, Tadesse; Kwiek, Jesse J; Gunn, John S

    2015-01-01

    Biofilms have been widely implicated in chronic infections and environmental persistence of Salmonella enterica, facilitating enhanced colonization of surfaces and increasing the ability of the bacteria to be transmitted to new hosts. Salmonella enterica serovar Typhi biofilm formation on gallstones from humans and mice enhances gallbladder colonization and bacterial shedding, while Salmonella enterica serovar Typhimurium biofilms facilitate long-term persistence in a number of environments important to food, medical, and farming industries. Salmonella regulates expression of many virulence- and biofilm-related processes using kinase-driven pathways. Kinases play pivotal roles in phosphorylation and energy transfer in cellular processes and possess an ATP-binding pocket required for their functions. Many other cellular proteins also require ATP for their activity. Here we test the hypothesis that pharmacological interference with ATP-requiring enzymes utilizing adenosine mimetic compounds would decrease or inhibit bacterial biofilm formation. Through the screening of a 3,000-member ATP mimetic library, we identified a single compound (compound 7955004) capable of significantly reducing biofilm formation by S. Typhimurium and S. Typhi. The compound was not bactericidal or bacteriostatic toward S. Typhimurium or cytotoxic to mammalian cells. An ATP-Sepharose affinity matrix technique was used to discover potential protein-binding targets of the compound and identified GroEL and DeoD. Compound 7955004 was screened against other known biofilm-forming bacterial species and was found to potently inhibit biofilms of Acinetobacter baumannii as well. The identification of a lead compound with biofilm-inhibiting capabilities toward Salmonella provides a potential new avenue of therapeutic intervention against Salmonella biofilm formation, with applicability to biofilms of other bacterial pathogens.

  15. Salmonella enterica serovar Typhi Live Vector Vaccines Finally Come of Age

    PubMed Central

    Galen, James E.; Pasetti, Marcela F.; Tennant, Sharon; Olveira-Ruiz, Patricia; Sztein, Marcelo B.; Levine, Myron M.

    2013-01-01

    Attenuated bacterial vaccine strains hold great promise as live vectors for presentation of foreign antigens from unrelated bacterial, viral, and parasitic pathogens to the immune system. While this approach has proven quite successful in experimental animal models for eliciting antigen-specific mucosal, humoral, and cellular responses, results have been disappointing for clinical trials carried out thus far. We hypothesize that the paucity of human responses to foreign antigens delivered by live vectors suggests that the strains and genetic approaches used to date have resulted in over-attenuated vaccine strains with severely reduced immunogenicity. However, remarkable advances have now been made in the genetics of foreign antigen expression, understanding mechanisms of live vector immunity, and refining immunization strategies. The time has now come for development of multivalent live vectors in which stable antigen expression is balanced with metabolic fitness to create highly immunogenic vaccines. PMID:19417771

  16. Culture proven Salmonella typhi co-infection in a child with Dengue fever: a case report.

    PubMed

    Srinivasaraghavan, Rangan; Narayanan, Parameswaran; Kanimozhi, Thandapani

    2015-09-27

    Infectious diseases are one of the major causes of morbidity and mortality in developing countries. Sometimes concurrent infections with multiple infectious agents may occur in one patient, which make the diagnosis and management a challenging task. The authors here present a case of co-infection of typhoid fever with dengue fever in a ten-year-old child and discuss the pertinent issues. The authors emphasize that the risk factors predicting the presence of such co-infections, if developed, will be immensely useful in areas where dengue outbreak occurs in the background of high transmission of endemic infections.

  17. Antigen-Specific B Cells Reactivate an Effective Cytotoxic T Cell Response against Phagocytosed Salmonella through Cross-Presentation

    PubMed Central

    de Wit, Jelle; Souwer, Yuri; Jorritsma, Tineke; Klaasse Bos, Hanny; ten Brinke, Anja; Neefjes, Jacques; van Ham, S. Marieke

    2010-01-01

    Background The eradication of facultative intracellular bacterial pathogens, like Salmonella typhi, requires the concerted action of both the humoral immune response and the cytotoxic CD8+ T cell response. Dendritic cells (DCs) are considered to orchestrate the cytotoxic CD8+ T cell response via cross-presentation of bacterial antigens onto MHC class I molecules. Cross-presentation of Salmonella by DCs however, is accompanied by the induction of apoptosis in the DCs. Besides antibody production, B cells are required to clear Salmonella infection for other unknown reasons. Methodology/Principal Findings Here we show that Salmonella-specific B cells that phagocytose Salmonella upon BCR-ligation reactivate human memory CD8+ T cells via cross-presentation yielding a Salmonella-specific cytotoxic T cell response. The reactivation of CD8+ T cells is dependent on CD4+ T cell help. Unlike the DCs, B cell-mediated cross-presentation of Salmonella does not coincide with apoptosis. Conclusions/Significance B cells form a new player in the activation of the cytotoxic effector arm of the immune response and the generation of effective adaptive immunity in Salmonella infection. PMID:20885961

  18. Antimicrobial resistance and management of invasive Salmonella disease.

    PubMed

    Kariuki, Samuel; Gordon, Melita A; Feasey, Nicholas; Parry, Christopher M

    2015-06-19

    Invasive Salmonella infections (typhoidal and non-typhoidal) cause a huge burden of illness estimated at nearly 3.4 million cases and over 600,000 deaths annually especially in resource-limited settings. Invasive non-typhoidal Salmonella (iNTS) infections are particularly important in immunosuppressed populations especially in sub-Saharan Africa, causing a mortality of 20-30% in vulnerable children below 5 years of age. In these settings, where routine surveillance for antimicrobial resistance is rare or non-existent, reports of 50-75% multidrug resistance (MDR) in NTS are common, including strains of NTS also resistant to flouroquinolones and 3rd generation cephalosporins. Typhoid (enteric) fever caused by Salmonella Typhi and Salmonella Paratyphi A remains a major public health problem in many parts of Asia and Africa. Currently over a third of isolates in many endemic areas are MDR, and diminished susceptibility or resistance to fluoroquinolones, the drugs of choice for MDR cases over the last decade is an increasing problem. The situation is particularly worrying in resource-limited settings where the few remaining effective antimicrobials are either unavailable or altogether too expensive to be afforded by either the general public or by public health services. Although the prudent use of effective antimicrobials, improved hygiene and sanitation and the discovery of new antimicrobial agents may offer hope for the management of invasive salmonella infections, it is essential to consider other interventions including the wider use of WHO recommended typhoid vaccines and the acceleration of trials for novel iNTS vaccines. The main objective of this review is to describe existing data on the prevalence and epidemiology of antimicrobial resistant invasive Salmonella infections and how this affects the management of these infections, especially in endemic developing countries.

  19. Salmonella Bacteremia Among Children in Central and Northwest Nigeria, 2008–2015

    PubMed Central

    Obaro, Stephen K.; Hassan-Hanga, Fatimah; Olateju, Eyinade K.; Umoru, Dominic; Lawson, Lovett; Olanipekun, Grace; Ibrahim, Sadeeq; Munir, Huda; Ihesiolor, Gabriel; Maduekwe, Augustine; Ohiaeri, Chinatu; Adetola, Anthony; Shetima, Denis; Jibir, Binta W.; Nakaura, Hafsat; Kocmich, Nicholas; Ajose, Therasa; Idiong, David; Masokano, Kabir; Ifabiyi, Adeyemi; Ihebuzor, Nnenna; Chen, Baojiang; Meza, Jane; Akindele, Adebayo; Rezac-Elgohary, Amy; Olaosebikan, Rasaq; Suwaid, Salman; Gambo, Mahmoud; Alter, Roxanne; Davies, Herbert D.; Fey, Paul D.

    2015-01-01

    Background. Etiologic agents of childhood bacteremia remain poorly defined in Nigeria. The absence of such data promotes indiscriminate use of antibiotics and delays implementation of appropriate preventive strategies. Methods. We established diagnostic laboratories for bacteremia surveillance at regional sites in central and northwest Nigeria. Acutely ill children aged <5 years with clinically suspected bacteremia were evaluated at rural and urban clinical facilities in the Federal Capital Territory, central region and in Kano, northwest Nigeria. Blood was cultured using the automated Bactec incubator system. Results. Between September 2008 and April 2015, we screened 10 133 children. Clinically significant bacteremia was detected in 609 of 4051 (15%) in the northwest and 457 of 6082 (7.5%) in the central region. Across both regions, Salmonella species account for 24%–59.8% of bacteremias and are the commonest cause of childhood bacteremia, with a predominance of Salmonella enterica serovar Typhi. The prevalence of resistance to ampicillin, chloramphenicol, and cotrimoxazole was 38.11%, with regional differences in susceptibility to different antibiotics but high prevalence of resistance to readily available oral antibiotics. Conclusions. Salmonella Typhi is the leading cause of childhood bacteremia in central Nigeria. Expanded surveillance is planned to define the dynamics of transmission. The high prevalence of multidrug-resistant strains calls for improvement in environmental sanitation in the long term and vaccination in the short term. PMID:26449948

  20. Salmonella infections associated with international travel: a Foodborne Diseases Active Surveillance Network (FoodNet) study.

    PubMed

    Johnson, Laura R; Gould, L Hannah; Dunn, John R; Berkelman, Ruth; Mahon, Barbara E

    2011-09-01

    Salmonella species cause an estimated 1.2 million infections per year in the United States, making it one of the most commonly reported enteric pathogens. In addition, Salmonella is an important cause of travel-associated diarrhea and enteric fever, a systemic illness commonly associated with Salmonella serotypes Typhi and Paratyphi A. We reviewed cases of Salmonella infection reported to the Centers for Disease Control and Prevention's (CDC) Foodborne Diseases Active Surveillance Network (FoodNet), a sentinel surveillance network, from 2004 to 2008. We compared travelers with Salmonella infection to nontravelers with Salmonella infection with respect to demographics, clinical characteristics, and serotypes. Among 23,712 case-patients with known travel status, 11% had traveled internationally in the 7 days before illness. Travelers with Salmonella infection tended to be older (median age, 30 years) than nontravelers (median age, 24 years; p<0.0001), but were similar with respect to gender. The most common destinations reported were Mexico (38% of travel-associated infections), India (9%), Jamaica (7%), the Dominican Republic (4%), China (3%), and the Bahamas (2%). The proportions of travelers with Salmonella infection hospitalized and with invasive disease were inversely related to the income level of the destination (p<0.0001). The most commonly reported serotypes, regardless of travel status, were Enteritidis (19% of cases), Typhimurium (14%), Newport (9%), and Javiana (5%). Among infections caused by these four serotypes, 22%, 6%, 5%, and 4%, respectively, were associated with travel. A high index of clinical suspicion for Salmonella infection is appropriate when evaluating recent travelers, especially those who visited Africa, Asia, or Latin America.

  1. Isolation, characterization, and application of bacteriophages for Salmonella spp. biocontrol in pigs.

    PubMed

    Albino, Luiz A A; Rostagno, Marcos H; Húngaro, Humberto M; Mendonça, Regina C S

    2014-08-01

    Foodborne illness due to Salmonella-contaminated pork products is an important public health problem, causing significant economic losses worldwide. The use of bacteriophages is a potential intervention tool that has attracted interest for the control of foodborne pathogens. The objective of this study was to detect the presence of Salmonella in commercial pig farms and to isolate specific autochthonous bacteriophages against Salmonella Typhimurium, to characterize them and to evaluate their lytic capacity against Salmonella Typhimurium in vivo and in vitro. Salmonella was isolated on 50% (4/8) of the farms, with serotype Typhimurium being the most prevalent, detected in 48.2% of samples (13/27). The isolated Salmonella Typhimurium bacteriophages belong to the Podoviridae family, were active against serotypes Abony, Enteritidis, Typhi, and Typhimurium, but not against serotypes Arizonae, Cholerasuis, Gallinarum, and Pullorum. In in vitro tests, bacteriophage at 10(7) PFU/mL and 10(9) PFU/mL significantly reduced (p<0.05) Salmonella Typhimurium counts in 1.6 and 2.5 log10 colony-forming units (CFU)/mL, respectively, after 24 h. Before the in vivo treatment with bacteriophages, Salmonella was identified in 93.3% (28/30) of the fecal samples from the pigs inoculated with 10(6) CFU/mL, and only in 56.6% (17/30) after the treatment consisting of oral administration of the pool of the bacteriophages after the fasting period, simulating a common preslaughter practice. These results indicate that the pool of bacteriophages administered was capable of reducing the colonization of Salmonella in pigs.

  2. 78 FR 42526 - Salmonella

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-16

    ... HUMAN SERVICES Food and Drug Administration Salmonella Contamination of Dry Dog Food; Withdrawal of...) entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food.'' This CPG is obsolete. DATES: The.... SUPPLEMENTARY INFORMATION: FDA issued the CGP entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog...

  3. [Serotypes of Salmonella in the Republic of Argentina isolated from human and non-human sources, 1979-1981].

    PubMed

    Eiguer, T; Butta, N; Picandet, A M

    1983-01-01

    A total of 49 serotypes were isolated in Argentina during the triennium 1979-1981, from 3,665 Salmonella strains isolated from different sources: human, animal, food and water. The degree of correlation among every one of them was analyzed in order to establish their influence in the cycles of transmission and human infection. S. typhimurium prevailed in human materials, being also isolated from water and animal, although in a smaller degree. Something similar occurred with S. oranienburg. It was observed that S. typhi retained its usual feature of endemic disease. Other serotypes of Salmonella were also found, particularly: S. paratyphi, S. panama, S. derby, S. agona, S. bredeney, S. newport, S. anatum and S. montevideo. From 3,665 Salmonella strains studied, 73.73% were isolated from human sources and the other 26.27% from non human sources, 5.40% corresponding to animal isolations, 15.39% from water and 5.48% from food.

  4. Occurrence of extended-spectrum and AmpC β-lactamases in multiple drug resistant Salmonella isolates from clinical samples in Lagos, Nigeria

    PubMed Central

    Akinyemi, KO; Iwalokun, Bamidele Abiodun; Oyefolu, Akeeb O Bola; Fakorede, CO

    2017-01-01

    Purpose Salmonella spp. are important foodborne pathogens exhibiting increasing resistance to antimicrobial drugs. Resistance to broad-spectrum β-lactams, mediated by extended-spectrum β-lactamase (ESBL) and AmpC β-lactamase enzymes is fast spreading and has had negative impacts on the clinical outcomes, particularly on third-generation cephalosporins. This study investigated the carriage of AmpC gene among multidrug-resistant Salmonella spp. from Lagos, Nigeria. Methods Forty Salmonella spp. from clinical samples (S. typhi = 13; S. typhimurium = 10; S. enteritidis = 8; S. choleraesuis = 5; S. paratyphi = 4) were subjected to in vitro susceptibility test by disk diffusion methods. Isolates that were resistant to cefoxitin and third-generation cephalosporins were screened for ESBL (Double Disk Synergy Test Method) and AmpC enzyme (AmpC disk test) production. Detection of AmpC fox gene was carried out by polymerase chain reaction. Results Thirty-two (80%) of the Salmonella isolates were cefoxitin resistant. Plasmid-mediated AmpC β-lactamase and ESBL enzymes were recorded in 10/40 (25%) and 16/40 (40%) of the Salmonella isolates, respectively. Specifically, 16/40 (40%) of the Salmonella isolates possessed 380 bp AmpC fox gene, with the highest occurrence found in S. typhi strains (43.8%) followed by S. typhimurium (25%). There was no AmpC fox gene detected in S. paratyphi strains. Interestingly, coproduction of enzymes occurred in some of the isolates, raising fears of resistance to a multitude of antibiotics in the treatment of bacterial infections. Conclusion Emergence of AmpC β-lactamase–producing Salmonella isolates in our environment was recorded for the first time, raising concern on increased antibiotic resistance among strains of Salmonella serovars in Lagos. Further genotypic study of the isolates could answer the questions on strain sources, clonal relatedness, and mechanism of spread. PMID:28144154

  5. Case report: failure under azithromycin treatment in a case of bacteremia due to Salmonella enterica Paratyphi A

    PubMed Central

    2014-01-01

    Background Limited information is available regarding the clinical efficacy of azithromycin for the treatment of enteric fever due to fluoroquinolone-resistant Salmonella Typhi and Salmonella Paratyphi among travelers returning to their home countries. Case presentation We report a case of a 52-year-old Japanese man who returned from India, who developed a fever of 39°C with no accompanying symptoms 10 days after returning to Japan from a 1-month business trip to Delhi, India. His blood culture results were positive for Salmonella Paratyphi A. He was treated with 14 days of ceftriaxone, after which he remained afebrile for 18 days before his body temperature again rose to 39°C with no apparent symptoms. He was then empirically given 500 mg of azithromycin, but experienced clinical and microbiological failure of azithromycin treatment for enteric fever due to Salmonella Paratyphi A. However, the minimum inhibitory concentration (MIC) of azithromycin was not elevated (8 mg/L). He was again given ceftriaxone for 14 days with no signs of recurrence during the follow-up. Conclusion There are limited data available for the treatment of enteric fever using azithromycin in travelers from developed countries who are not immune to the disease, and thus, careful follow-up is necessary. In our case, the low azithromycin dose might have contributed the treatment failure. Additional clinical data are needed to determine the rate of success, MIC, and contributing factors for success and/or failure of azithromycin treatment for both Salmonella Typhi and Salmonella Paratyphi infections. PMID:25041573

  6. The relationship between infecting dose and severity of disease in reported outbreaks of Salmonella infections.

    PubMed Central

    Glynn, J. R.; Bradley, D. J.

    1992-01-01

    The relationship between size of the infecting dose and severity of the resulting disease has been investigated for salmonella infections by reanalysis of data within epidemics for 32 outbreaks, and comparing data between outbreaks for 68 typhoid epidemics and 49 food-poisoning outbreaks due to salmonellas. Attack rate, incubation period, amount of infected food consumed and type of vehicle are used as proxy measures of infecting dose, while case fatality rates for typhoid and case hospitalization rates for food poisoning salmonellas were used to assess severity. Limitations of the data are discussed. Both unweighted and logit analysis models are used. There is no evidence for a dose-severity relationship for Salmonella typhi, but evidence of a correlation between dose and severity is available from within-epidemic or between-epidemic analysis, or both, for Salmonella typhimurium, S. enteritidis, S. infantis, S. newport, and S. thompson. The presence of such a relationship affects the way in which control interventions should be assessed. PMID:1468522

  7. Epidemiology, Clinical Presentation, Laboratory Diagnosis, Antimicrobial Resistance, and Antimicrobial Management of Invasive Salmonella Infections

    PubMed Central

    Sjölund-Karlsson, Maria; Gordon, Melita A.; Parry, Christopher M.

    2015-01-01

    SUMMARY Salmonella enterica infections are common causes of bloodstream infection in low-resource areas, where they may be difficult to distinguish from other febrile illnesses and may be associated with a high case fatality ratio. Microbiologic culture of blood or bone marrow remains the mainstay of laboratory diagnosis. Antimicrobial resistance has emerged in Salmonella enterica, initially to the traditional first-line drugs chloramphenicol, ampicillin, and trimethoprim-sulfamethoxazole. Decreased fluoroquinolone susceptibility and then fluoroquinolone resistance have developed in association with chromosomal mutations in the quinolone resistance-determining region of genes encoding DNA gyrase and topoisomerase IV and also by plasmid-mediated resistance mechanisms. Resistance to extended-spectrum cephalosporins has occurred more often in nontyphoidal than in typhoidal Salmonella strains. Azithromycin is effective for the management of uncomplicated typhoid fever and may serve as an alternative oral drug in areas where fluoroquinolone resistance is common. In 2013, CLSI lowered the ciprofloxacin susceptibility breakpoints to account for accumulating clinical, microbiologic, and pharmacokinetic-pharmacodynamic data suggesting that revision was needed for contemporary invasive Salmonella infections. Newly established CLSI guidelines for azithromycin and Salmonella enterica serovar Typhi were published in CLSI document M100 in 2015. PMID:26180063

  8. Epidemiology, Clinical Presentation, Laboratory Diagnosis, Antimicrobial Resistance, and Antimicrobial Management of Invasive Salmonella Infections.

    PubMed

    Crump, John A; Sjölund-Karlsson, Maria; Gordon, Melita A; Parry, Christopher M

    2015-10-01

    Salmonella enterica infections are common causes of bloodstream infection in low-resource areas, where they may be difficult to distinguish from other febrile illnesses and may be associated with a high case fatality ratio. Microbiologic culture of blood or bone marrow remains the mainstay of laboratory diagnosis. Antimicrobial resistance has emerged in Salmonella enterica, initially to the traditional first-line drugs chloramphenicol, ampicillin, and trimethoprim-sulfamethoxazole. Decreased fluoroquinolone susceptibility and then fluoroquinolone resistance have developed in association with chromosomal mutations in the quinolone resistance-determining region of genes encoding DNA gyrase and topoisomerase IV and also by plasmid-mediated resistance mechanisms. Resistance to extended-spectrum cephalosporins has occurred more often in nontyphoidal than in typhoidal Salmonella strains. Azithromycin is effective for the management of uncomplicated typhoid fever and may serve as an alternative oral drug in areas where fluoroquinolone resistance is common. In 2013, CLSI lowered the ciprofloxacin susceptibility breakpoints to account for accumulating clinical, microbiologic, and pharmacokinetic-pharmacodynamic data suggesting that revision was needed for contemporary invasive Salmonella infections. Newly established CLSI guidelines for azithromycin and Salmonella enterica serovar Typhi were published in CLSI document M100 in 2015.

  9. [Pneumonia due to Pseudomonas aeruginosa].

    PubMed

    Vallés, Jordi; Mariscal, Dolors

    2005-12-01

    Pseudomonas aeruginosa is one of the leading causes of Gram-negative nosocomial pneumonia. It is the most common cause of ventilator-associated pneumonia and carries the highest mortality among hospital-acquired infections. P. aeruginosa produces a large number of toxins and surface components that make it especially virulent compared with other microorganisms. These include pili, flagella, membrane bound lipopolysaccharide, and secreted products such as exotoxins A, S and U, elastase, alkaline protease, cytotoxins and phospholipases. The most common mechanism of infection in mechanically ventilated patients is through aspiration of upper respiratory tract secretions previously colonized in the process of routine nursing care or via contaminated hands of hospital personnel. Intravenous therapy with an antipseudomonal regimen should be started immediately when P. aeruginosa pneumonia is suspected or confirmed. Empiric therapy with drugs active against P. aeruginosa should be started, especially in patients who have received previous antibiotics or present late-onset pneumonia.

  10. Chronic Pseudomonas aeruginosa cervical osteomyelitis

    PubMed Central

    Meher, Sujeet Kumar; Jain, Harsh; Tripathy, Laxmi Narayan; Basu, Sunandan

    2016-01-01

    Pseudomonas aeruginosa is a rare cause of osteomyelitis of the cervical spine and is usually seen in the background of intravenous drug use and immunocompromised state. Very few cases of osteomyelitis of the cervical spine caused by pseudomonas aeruginosa have been reported in otherwise healthy patients. This is a case presentation of a young female, who in the absence of known risk factors for cervical osteomyelitis presented with progressively worsening neurological signs and symptoms. PMID:27891039

  11. Signatures of Adaptation in Human Invasive Salmonella Typhimurium ST313 Populations from Sub-Saharan Africa

    PubMed Central

    Okoro, Chinyere K.; Barquist, Lars; Connor, Thomas R.; Harris, Simon R.; Clare, Simon; Stevens, Mark P.; Arends, Mark J.; Hale, Christine; Kane, Leanne; Pickard, Derek J.; Hill, Jennifer; Harcourt, Katherine; Parkhill, Julian; Dougan, Gordon; Kingsley, Robert A.

    2015-01-01

    Two lineages of Salmonella enterica serovar Typhimurium (S. Typhimurium) of multi-locus sequence type ST313 have been linked with the emergence of invasive Salmonella disease across sub-Saharan Africa. The expansion of these lineages has a temporal association with the HIV pandemic and antibiotic usage. We analysed the whole genome sequence of 129 ST313 isolates representative of the two lineages and found evidence of lineage-specific genome degradation, with some similarities to that observed in S. Typhi. Individual ST313 S. Typhimurium isolates exhibit a distinct metabolic signature and modified enteropathogenesis in both a murine and cattle model of colitis, compared to S. Typhimurium outside of the ST313 lineages. These data define phenotypes that distinguish ST313 isolates from other S. Typhimurium and may represent adaptation to a distinct pathogenesis and lifestyle linked to an-immuno-compromised human population. PMID:25803844

  12. [Epidemiological studies on salmonella in a particular area ("Walcheren Project"). III. The incidence of salmonella in man, insects, gulls as well as foods scrapings from butcher's blocks, effluents of sewage treatment plants and drains from butcher's shops (author's transl)].

    PubMed

    Edel, W; Van Schothorst, M; Van Leusden, F M; Kampelmacher, E H

    1977-03-15

    In continuation of previous studies, various materials (meat and meat products, insects, gull droppings, scrapings from butcher's blocks, effluents of sewage treatment plants, drains from butcher's shops and faeces of patients) were examined again at the same time for the presence of Salmonella in a relatively small are (Walcheren) over a period of three months. As was also the case in previous studies, S. typhi murium (27.5 per cent), S. panama (22.2 per cent) and S. brandenburg (9.2 per cent) were the three serotypes most frequently isolated. The three most frequently isolated phage types of S. typhi murium were II 505 (62.1 per cent), II 502 (5.3 per cent) and I 650 (4.2 per cent). The serotypes and phage types were present in nearly all the materials studied which again emphasizes the fact that there are contamination cycles of Salmonella. These studies showed that the route of contamination divides in the butcher's shop. Salmonella ogranisms carried with the meat frome the slaughter-house find their way into the drains on the one hand, and, by meat and meat products, to consumers on the other. Moreover, the high degree of contamination of effluents is not in accordance with the small number of cases of salmonellosis.

  13. Antimicrobial susceptibility profile, treatment outcome and serotype distribution of clinical isolates of Salmonella enterica subspecies enterica: a 2-year study from Kerala, South India

    PubMed Central

    Harichandran, Deepa; Dinesh, Kavitha Radhakrishnan

    2017-01-01

    Background/purpose Typhoid and paratyphoid fever continue to be important causes of illness and death in parts of Asia, being associated with poor sanitation and consumption of unsafe food and water. Antimicrobial resistance has emerged to traditional first-line drugs, namely, the fluoroquinolones, as well as to third-generation cephalosporins, posing challenges to treatment. Azithromycin has proven to be an effective alternative for treatment of uncomplicated typhoid fever. The purpose of this study was to determine the antimicrobial susceptibility, clinical outcome and serotype distribution pattern of clinical isolates belonging to Salmonella enterica subspecies enterica. Methodology All clinical isolates of S. enterica obtained from blood, sterile body fluids, as well as stool and urine samples at Amrita Institute of Medical Sciences and Research Centre, Kerala, India, between August 2011 and July 2013 were included in the study and processed based on standard microbiology protocols. Results A total of 118 isolates of Salmonella were obtained during the study period. Out of these, 79 were of S. Typhi (66.95%), followed by isolates of S. Paratyphi A (22; 18.64%) and S. Typhimurium 12 (10.17%). Five isolates could not be identified further. There was 100% susceptibility to ceftriaxone in all S. enterica subspecies. Ciprofloxacin susceptibility was 32.91% for S. Typhi and 40.90% for S. Paratyphi A as determined by the disk diffusion method. The susceptibility profile of S. Typhi isolates to different antimicrobials was as follows: chloramphenicol (94.93%), ampicillin (77.21%), cotrimoxazole (75.94%) and azithromycin (78.48%). For S. Typhi, the minimum inhibitory concentration (MIC) of ciprofloxacin required to inhibit the growth of 50% of organisms was 0.5 μg/mL (intermediate) and MIC required to inhibit the growth of 90% of organisms was 1 μg/mL (resistant). S. Typhimurium was 100% susceptible to cotrimoxazole, ampicillin, ceftriaxone, chloramphenicol, ofloxacin

  14. Response of Pseudomonas aeruginosa PAO1 to low shear modelled microgravity involves AlgU regulation.

    PubMed

    Crabbé, Aurélie; Pycke, Benny; Van Houdt, Rob; Monsieurs, Pieter; Nickerson, Cheryl; Leys, Natalie; Cornelis, Pierre

    2010-06-01

    As a ubiquitous environmental organism that is occasionally part of the human flora, Pseudomonas aeruginosa could pose a health hazard for the immunocompromised astronauts during long-term missions. Therefore, insights into the behaviour of P. aeruginosa under spaceflight conditions were gained using two spaceflight-analogue culture systems: the rotating wall vessel (RWV) and the random position machine (RPM). Microarray analysis of P. aeruginosa PAO1 grown in the low shear modelled microgravity (LSMMG) environment of the RWV, compared with the normal gravity control (NG), revealed an apparent regulatory role for the alternative sigma factor AlgU (RpoE-like). Accordingly, P. aeruginosa cultured in LSMMG exhibited increased alginate production and upregulation of AlgU-controlled transcripts, including those encoding stress-related proteins. The LSMMG increased heat and oxidative stress resistance and caused a decrease in the oxygen transfer rate of the culture. This study also showed the involvement of the RNA-binding protein Hfq in the LSMMG response, consistent with its previously identified role in the Salmonella LSMMG and spaceflight response. The global transcriptional response of P. aeruginosa grown in the RPM was highly similar to that in NG. Fluid mixing was assessed in both systems and is believed to be a pivotal factor contributing to transcriptional differences between RWV- and RPM-grown P. aeruginosa. This study represents the first step towards the identification of virulence mechanisms of P. aeruginosa activated in response to spaceflight-analogue conditions, and could direct future research regarding the risk assessment and prevention of Pseudomonas infections during spaceflight and in immunocompromised patients.

  15. Adaptation of red blood cell lysis represents a fundamental breakthrough that improves the sensitivity of Salmonella detection in blood

    PubMed Central

    Boyd, MA; Tennant, SM; Melendez, JH; Toema, D; Galen, JE; Geddes, CD; Levine, MM

    2015-01-01

    Aims Isolation of Salmonella Typhi from blood culture is the standard diagnostic for confirming typhoid fever but it is unavailable in many developing countries. We previously described a Microwave Accelerated Metal Enhanced Fluorescence (MAMEF)-based assay to detect Salmonella in medium. Attempts to detect Salmonella in blood were unsuccessful, presumably due to the interference of erythrocytes. The objective of this study was to evaluate various blood treatment methods that could be used prior to PCR, real-time PCR or MAMEF to increase sensitivity of detection of Salmonella. Methods and Results We tested ammonium chloride and erythrocyte lysis buffer, water, Lymphocyte Separation Medium, BD Vacutainer® CPT™ Tubes and dextran. Erythrocyte lysis buffer was the best isolation method as it is fast, inexpensive and works with either fresh or stored blood. The sensitivity of PCR- and real-time PCR detection of Salmonella in spiked blood was improved when whole blood was first lysed using erythrocyte lysis buffer prior to DNA extraction. Removal of erythrocytes and clotting factors also enabled reproducible lysis of Salmonella and fragmentation of DNA, which are necessary for MAMEF sensing. Conclusions Use of the erythrocyte lysis procedure prior to DNA extraction has enabled improved sensitivity of Salmonella detection by PCR and real-time PCR and has allowed lysis and fragmentation of Salmonella using microwave radiation (for future detection by MAMEF). Significance and Impact of the Study Adaptation of the blood lysis method represents a fundamental breakthrough that improves the sensitivity of DNA-based detection of Salmonella in blood. PMID:25630831

  16. Testing Feeds for Salmonella.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Human salmonellosis outbreaks have been linked to contamination of animal feeds. Thus it is crucial to employ sensitive Salmonella detection methods for animal feeds. Based on a review of the literature, Salmonella sustains acid injury at about pH 4.0 to5.0. Low pH can also alter the metabolism of S...

  17. Genomics of Salmonella Species

    NASA Astrophysics Data System (ADS)

    Canals, Rocio; McClelland, Michael; Santiviago, Carlos A.; Andrews-Polymenis, Helene

    Progress in the study of Salmonella survival, colonization, and virulence has increased rapidly with the advent of complete genome sequencing and higher capacity assays for transcriptomic and proteomic analysis. Although many of these techniques have yet to be used to directly assay Salmonella growth on foods, these assays are currently in use to determine Salmonella factors necessary for growth in animal models including livestock animals and in in vitro conditions that mimic many different environments. As sequencing of the Salmonella genome and microarray analysis have revolutionized genomics and transcriptomics of salmonellae over the last decade, so are new high-throughput sequencing technologies currently accelerating the pace of our studies and allowing us to approach complex problems that were not previously experimentally tractable.

  18. TolC-dependent secretion of an ankyrin repeat-containing protein of Rickettsia typhi.

    PubMed

    Kaur, Simran J; Rahman, M Sayeedur; Ammerman, Nicole C; Beier-Sexton, Magda; Ceraul, Shane M; Gillespie, Joseph J; Azad, Abdu F

    2012-09-01

    Rickettsia typhi, the causative agent of murine (endemic) typhus, is an obligate intracellular pathogen with a life cycle involving both vertebrate and invertebrate hosts. In this study, we characterized a gene (RT0218) encoding a C-terminal ankyrin repeat domain-containing protein, named Rickettsia ankyrin repeat protein 1 (RARP-1), and identified it as a secreted effector protein of R. typhi. RT0218 showed differential transcript abundance at various phases of R. typhi intracellular growth. RARP-1 was secreted by R. typhi into the host cytoplasm during in vitro infection of mammalian cells. Transcriptional analysis revealed that RT0218 was cotranscribed with adjacent genes RT0217 (hypothetical protein) and RT0216 (TolC) as a single polycistronic mRNA. Given one of its functions as a facilitator of extracellular protein secretion in some Gram-negative bacterial pathogens, we tested the possible role of TolC in the secretion of RARP-1. Using Escherichia coli C600 and an isogenic tolC insertion mutant as surrogate hosts, our data demonstrate that RARP-1 is secreted in a TolC-dependent manner. Deletion of either the N-terminal signal peptide or the C-terminal ankyrin repeats abolished RARP-1 secretion by wild-type E. coli. Importantly, expression of R. typhi tolC in the E. coli tolC mutant restored the secretion of RARP-1, suggesting that TolC has a role in RARP-1 translocation across the outer membrane. This work implies that the TolC component of the putative type 1 secretion system of R. typhi is involved in the secretion process of RARP-1.

  19. Impact of sporadic reporting of poultry Salmonella serovars from selected developing countries.

    PubMed

    Barbour, Elie K; Ayyash, Danielle B; Alturkistni, Wafa; Alyahiby, Areej; Yaghmoor, Soonham; Iyer, Archana; Yousef, Jehad; Kumosani, Taha; Harakeh, Steve

    2015-01-15

    This review documents the sporadic reporting of poultry Salmonella serovars in South Africa, Egypt, Indonesia, India, and Romania, five countries selected based on the importance of their distribution in different regions of the world and their cumulative significant population size of 1.6 billion. South Africa reported contamination of its poultry carcasses by S. Hadar, S. Blockley, S. Irumu, and S. Anatum. Results from Egypt showed that S. Enteritidis and S. Typhimurium were predominant in poultry along with other non-typhoid strains, namely S. Infantis, S. Kentucky, S. Tsevie, S. Chiredzi, and S. Heidelberg. In Indonesia, the isolation of Salmonella Typhi was the main focus, while other serovars included S. Kentucky, S. Typhimurium, and S. Paratyhi C. In India, S. Bareilly was predominant compared to S. Enteritidis, S. Typhimurium, S. Paratyphi B, S. Cerro, S. Mbandaka, S. Molade, S. Kottbus, and S. Gallinarum. Romania reported two Salmonella serovars in poultry that affect humans, namely S. Enteritidis and S. Typhimurium, and other non-typhoid strains including S. Infantis, S. Derby, S. Colindale, S. Rissen, S. Ruzizi, S. Virchow, S. Brandenburg, S. Bredeney, S. Muenchen, S. Kortrijk, and S. Calabar. The results showed the spread of different serovars of Salmonella in those five developing countries, which is alarming and emphasizes the urgent need for the World Health Organization Global Foodborne Infections Network (WHO-GFN) to expand its activities to include more strategic participation and partnership with most developing countries in order to protect poultry and humans from the serious health impact of salmonellosis.

  20. Meningitis Caused by Salmonella Newport in a Five-Year-Old Child

    PubMed Central

    De Malet, Ana; Ingerto, Sheila

    2016-01-01

    Salmonella Newport is a Gram-negative bacillus belonging to the Enterobacteria family and the nontyphi Salmonella (NTS), usually related to gastroenteritis. Main difference between NTS and Salmonella typhi is that the last one evolves to an invasive disease easier than NTS. These can progress to bacteremias in around 5% of cases and secondary focuses can appear occasionally, as in meningitis. An infection of the central nervous system is uncommon, considering its incidence in 0.6–8% of the cases; most of them are described in developing countries and mainly in childhood, especially neonates. Bacterial meningitis by NTS mostly affects immunosuppressed people in Europe. Prognosis is adverse, with a 50% mortality rate, mainly due to complications of infection: hydrocephalus, ventriculitis, abscesses, subdural empyema, or stroke. Choice antibiotic treatments are cefotaxime, ceftriaxone, or ceftazidime. The aim of this paper is to present a case of meningitis caused by Salmonella Newport diagnosed in a five-year-old girl living in a rural area of the province of Ourense (Spain), with favorable evolution and without neurological disorders. PMID:28058121

  1. Genome-Based Identification of Chromosomal Regions Specific for Salmonella spp.

    PubMed Central

    Hansen-Wester, Imke; Hensel, Michael

    2002-01-01

    Acquisition of genomic elements by horizontal gene transfer represents an important mechanism in the evolution of bacterial species. Pathogenicity islands are a subset of horizontally acquired elements present in various pathogens. These elements are frequently located adjacent to tRNA genes. We performed a comparative genome analysis of Salmonella enterica serovars Typhi and Typhimurium and Escherichia coli and scanned tRNA loci for the presence of species-specific, horizontally acquired genomic elements. A large number of species-specific elements were identified. Here, we describe the characteristics of four large chromosomal insertions at tRNA genes of Salmonella spp. The tRNA-associated elements harbor various genes previously identified as single virulence genes, indicating that these genes have been acquired with large chromosomal insertions. Southern blot analyses confirmed that the tRNA-associated elements are specific to Salmonella and also indicated a heterogeneous distribution within the salmonellae. Systematic scanning for insertions at tRNA genes thus represents a tool for the identification of novel pathogenicity islands. PMID:11953370

  2. Typhoid fever

    MedlinePlus

    ... most commonly caused due to a bacteria called Salmonella typhi ( S typhi ). Causes S typhi is spread through contaminated ... as food handlers. Alternative Names Enteric fever Images Salmonella typhi organism Fly Digestive system organs References Harris ...

  3. Pseudomonas aeruginosa: breaking down barriers.

    PubMed

    Berube, Bryan J; Rangel, Stephanie M; Hauser, Alan R

    2016-02-01

    Many bacterial pathogens have evolved ingenious ways to escape from the lung during pneumonia to cause bacteremia. Unfortunately, the clinical consequences of this spread to the bloodstream are frequently dire. It is therefore important to understand the molecular mechanisms used by pathogens to breach the lung barrier. We have recently shown that Pseudomonas aeruginosa, one of the leading causes of hospital-acquired pneumonia, utilizes the type III secretion system effector ExoS to intoxicate pulmonary epithelial cells. Injection of these cells leads to localized disruption of the pulmonary-vascular barrier and dissemination of P. aeruginosa to the bloodstream. We put these data in the context of previous studies to provide a holistic model of P. aeruginosa dissemination from the lung. Finally, we compare P. aeruginosa dissemination to that of other bacteria to highlight the complexity of bacterial pneumonia. Although respiratory pathogens use distinct and intricate strategies to escape from the lungs, a thorough understanding of these processes can lay the foundation for new therapeutic approaches for bacterial pneumonia.

  4. [Stationary and migratory avifauna as reservoirs of Salmonella, Yersinia and Campylobacter].

    PubMed

    Levrè, E; Valentini, P; Brunetti, M; Sacchelli, F

    1989-01-01

    . Salmonella spp.: 8 strains belonging to the genus Salmonella were isolated from 3 different species of birds. The isolates were identified as Salmonella typhi-murium (7 strains) and Salmonella blockley (1 strain). Salmonella has been isolated from 8 birds, six of which were pheasants shot during the same day in the same area and probably coming from the same breeding. In fact, in Tuscany, pheasants are bred and then set free in many hunting areas.(ABSTRACT TRUNCATED AT 400 WORDS)

  5. Oral Administration of a Salmonella enterica-Based Vaccine Expressing Bacillus anthracis Protective Antigen Confers Protection against Aerosolized B. anthracis▿

    PubMed Central

    Stokes, Margaret G. M.; Titball, Richard W.; Neeson, Brendan N.; Galen, James E.; Walker, Nicola J.; Stagg, Anthony J.; Jenner, Dominic C.; Thwaite, Joanne E.; Nataro, James P.; Baillie, Leslie W. J.; Atkins, Helen S.

    2007-01-01

    Bacillus anthracis is the causative agent of anthrax, a disease that affects wildlife, livestock, and humans. Protection against anthrax is primarily afforded by immunity to the B. anthracis protective antigen (PA), particularly PA domains 4 and 1. To further the development of an orally delivered human vaccine for mass vaccination against anthrax, we produced Salmonella enterica serovar Typhimurium expressing full-length PA, PA domains 1 and 4, or PA domain 4 using codon-optimized PA DNA fused to the S. enterica serovar Typhi ClyA and under the control of the ompC promoter. Oral immunization of A/J mice with Salmonella expressing full-length PA protected five of six mice against a challenge with 105 CFU of aerosolized B. anthracis STI spores, whereas Salmonella expressing PA domains 1 and 4 provided only 25% protection (two of eight mice), and Salmonella expressing PA domain 4 or a Salmonella-only control afforded no measurable protection. However, a purified recombinant fusion protein of domains 1 and 4 provided 100% protection, and purified recombinant 4 provided protection in three of eight immunized mice. Thus, we demonstrate for the first time the efficacy of an oral S. enterica-based vaccine against aerosolized B. anthracis spores. PMID:17145938

  6. Evolution of Salmonella enterica Virulence via Point Mutations in the Fimbrial Adhesin

    PubMed Central

    Kisiela, Dagmara I.; Chattopadhyay, Sujay; Libby, Stephen J.; Karlinsey, Joyce E.; Fang, Ferric C.; Tchesnokova, Veronika; Kramer, Jeremy J.; Beskhlebnaya, Viktoriya; Samadpour, Mansour; Grzymajlo, Krzysztof; Ugorski, Maciej; Lankau, Emily W.; Mackie, Roderick I.; Clegg, Steven; Sokurenko, Evgeni V.

    2012-01-01

    Whereas the majority of pathogenic Salmonella serovars are capable of infecting many different animal species, typically producing a self-limited gastroenteritis, serovars with narrow host-specificity exhibit increased virulence and their infections frequently result in fatal systemic diseases. In our study, a genetic and functional analysis of the mannose-specific type 1 fimbrial adhesin FimH from a variety of serovars of Salmonella enterica revealed that specific mutant variants of FimH are common in host-adapted (systemically invasive) serovars. We have found that while the low-binding shear-dependent phenotype of the adhesin is preserved in broad host-range (usually systemically non-invasive) Salmonella, the majority of host-adapted serovars express FimH variants with one of two alternative phenotypes: a significantly increased binding to mannose (as in S. Typhi, S. Paratyphi C, S. Dublin and some isolates of S. Choleraesuis), or complete loss of the mannose-binding activity (as in S. Paratyphi B, S. Choleraesuis and S. Gallinarum). The functional diversification of FimH in host-adapted Salmonella results from recently acquired structural mutations. Many of the mutations are of a convergent nature indicative of strong positive selection. The high-binding phenotype of FimH that leads to increased bacterial adhesiveness to and invasiveness of epithelial cells and macrophages usually precedes acquisition of the non-binding phenotype. Collectively these observations suggest that activation or inactivation of mannose-specific adhesive properties in different systemically invasive serovars of Salmonella reflects their dynamic trajectories of adaptation to a life style in specific hosts. In conclusion, our study demonstrates that point mutations are the target of positive selection and, in addition to horizontal gene transfer and genome degradation events, can contribute to the differential pathoadaptive evolution of Salmonella. PMID:22685400

  7. Functional Activity of Antibodies Directed towards Flagellin Proteins of Non-Typhoidal Salmonella.

    PubMed

    Ramachandran, Girish; Tennant, Sharon M; Boyd, Mary A; Wang, Jin Y; Tulapurkar, Mohan E; Pasetti, Marcela F; Levine, Myron M; Simon, Raphael

    2016-01-01

    Non-typhoidal Salmonella (NTS) serovars Typhimurium and Enteritidis are major causes of invasive bacterial infections in children under 5 years old in sub-Saharan Africa, with case fatality rates of ~20%. There are no licensed NTS vaccines for humans. Vaccines that induce antibodies against a Salmonella Typhi surface antigen, Vi polysaccharide, significantly protect humans against typhoid fever, establishing that immune responses to Salmonella surface antigens can be protective. Flagella proteins, abundant surface antigens in Salmonella serovars that cause human disease, are also powerful immunogens, but the functional capacity of elicited anti-flagellar antibodies and their role in facilitating bacterial clearance has been unclear. We examined the ability of anti-flagellar antibodies to mediate microbial killing by immune system components in-vitro and assessed their role in protecting mice against invasive Salmonella infection. Polyclonal (hyperimmune sera) and monoclonal antibodies raised against phase 1 flagellin proteins of S. Enteritidis and S. Typhimurium facilitated bacterial uptake and killing of the homologous serovar pathogen by phagocytes. Polyclonal anti-flagellar antibodies accompanied by complement also achieved direct bacterial killing. Serum bactericidal activity was restricted to Salmonella serovars expressing the same flagellin used as immunogen. Notably, individual anti-flagellin monoclonal antibodies with complement were not bactericidal, but this biological activity was restored when different monoclonal anti-flagellin antibodies were combined. Passive transfer immunization with a monoclonal IgG antibody specific for phase 1 flagellin from S. Typhimurium protected mice against lethal challenge with a representative African invasive S. Typhimurium strain. These findings have relevance for the use of flagellin proteins in NTS vaccines, and confirm the role of anti-flagellin antibodies as mediators of protective immunity.

  8. Salmonella Infections (For Parents)

    MedlinePlus

    ... by chickens, cows, pigs, and reptiles (such as turtles, lizards, and iguanas). Another, rarer form — called Salmonella ... contact with a baby. Even healthy reptiles (especially turtles and iguanas) are not safe pets for small ...

  9. Salmonellae in the environment.

    PubMed

    Murray, C J

    1991-09-01

    Salmonellae are part of the bacterial flora normally found in Man and animals, although the frequency of occurrence is variable, reflecting the general level of Salmonella in food, water and the environment. They are widely disseminated into environments which have been disturbed by human activities. Wildlife may harbour the organisms but do not appear to be a major conduit by which the organisms enter the human and animal food chain. In areas associated with Man, salmonellae in wild animals and birds reflect the serovars disseminated into the environment. Seasonal changes in infection occur, and the capacity of the organisms to survive in nature varies. Water plays an important role in the spread of the organisms to Man and animals. Control of salmonellae must start with a significant decrease in the number of organisms which are discharged into the environment.

  10. Diagnostics for invasive Salmonella infections: Current challenges and future directions.

    PubMed

    Andrews, Jason R; Ryan, Edward T

    2015-06-19

    Invasive Salmonellosis caused by Salmonella enterica serotype Typhi or Paratyphi A, B, C, or invasive non-typhoidal Salmonella serotypes, is an immensely important disease cluster for which reliable, rapid diagnostic tests are not available. Blood culture remains the gold standard but is insensitive, slow, and resource-intensive. Existing molecular diagnostics have poor sensitivity due to the low organism burden in bodily fluids. Commercially available serologic tests for typhoidal Salmonella have had limited sensitivity and specificity. In high burden, resource-limited settings, reliance on clinical diagnosis or inaccurate tests often results in frequent, unnecessary treatment, which contributes selective pressure for the emergence of antimicrobial resistance. This practice also results in inadequate therapy for other etiologies of acute febrile illnesses, including leptospirosis and rickettsial infections. A number of novel serologic, molecular, transcriptomic and metabolomic approaches to diagnostics are under development. Target product profiles that outline specific needs may focus development and investment, and establish benchmarks for accuracy, cost, speed, and portability of new diagnostics. Of note, a critical barrier to diagnostic assay rollout will be the low cost and low perceived harm of empiric therapy on behalf of providers and patients, which leaves few perceived incentives to utilize diagnostics. Approaches that align incentives with societal goals of limiting inappropriate antimicrobial use, such as subsidizing diagnostics, may be essential for stimulating development and uptake of such assays in resource-limited settings. New diagnostics for invasive Salmonellosis should be developed and deployed alongside diagnostics for alternative etiologies of acute febrile illnesses to improve targeted use of antibiotics.

  11. Seroprevalence of Rickettsia typhi and Rickettsia conorii infection among rodents and dogs in Egypt.

    PubMed

    Soliman, A K; Botros, B A; Ksiazek, T G; Hoogstraal, H; Helmy, I; Morrill, J C

    1989-10-01

    A serological survey of 1813 rodent and 549 dog sera, collected from 1979 to 1986 from animals in 16 Egyptian Governorates were tested for antibody to Rickettsia typhi and Rickettsia conorii by the indirect fluorescent antibody test. Only three of 82 (4%) sera from Rattus rattus collected near Aswan had antibody to R. conorii. The prevalence of R. typhi antibody in dog sera was only 0.4% (n = 549) while 25% (n = 547) of Rattus norvegicus and 11% (n = 1138) of R. rattus had measurable antibodies. Among the other rodents, antibody was demonstrated in only 2% (n = 45) of Arvicanthis spp., and 1% (n = 83) of Acomys spp. Collectively, rodents captured in the Nile Delta had a higher prevalence (mean 24% (n = 787] than those captured in the Nile Valley (mean 4% (n = 650]. Antibody to R. typhi was detected in rodents collected in all port cities: ismailiya, 13%; Port Said, 9%; Suez, 9%; Safaga, 16%; Quseir, 32% and Alexandria, 34%. These data showed evidence of R. typhi infection among rodents in widespread geographic localities of Egypt and suggested that infected rodents may be a source of human infections.

  12. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi

    PubMed Central

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37oC followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39oC. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793

  13. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi.

    PubMed

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37°C followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39°C. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus.

  14. [The induction and the prevention of Vi antigen of S.typhi loss by three metalic ions of salts].

    PubMed

    Zhang, J X; Cao, J; Tu, J

    1997-04-01

    Three metalic salts Ferrous, Mgnesium and Calcium were used to induce and to prevent Vi antigen of S. typhi loss. All of the 96 Vi-II phage typing standard strains belonged to V type (a recovery rate of 100%). Out of 1320 local strains, 1292 were type V (a recovery rate of 97.7%) and 28 remained type W with a Vi loss rate of 2.1%. The results showed that induction and prevention of Vi antigen of S. typhi loss by the three metalic salts was higher than that of other reports which showed a loss rate of 5% Vi antigen of S. typhi.

  15. Computational Analysis and In silico Predictive Modeling for Inhibitors of PhoP Regulon in S. typhi on High-Throughput Screening Bioassay Dataset.

    PubMed

    Kaur, Harleen; Ahmad, Mohd; Scaria, Vinod

    2016-03-01

    There is emergence of multidrug-resistant Salmonella enterica serotype typhi in pandemic proportions throughout the world, and therefore, there is a necessity to speed up the discovery of novel molecules having different modes of action and also less influenced by the resistance formation that would be used as drug for the treatment of salmonellosis particularly typhoid fever. The PhoP regulon is well studied and has now been shown to be a critical regulator of number of gene expressions which are required for intracellular survival of S. enterica and pathophysiology of disease like typhoid. The evident roles of two-component PhoP-/PhoQ-regulated products in salmonella virulence have motivated attempts to target them therapeutically. Although the discovery process of biologically active compounds for the treatment of typhoid relies on hit-finding procedure, using high-throughput screening technology alone is very expensive, as well as time consuming when performed on large scales. With the recent advancement in combinatorial chemistry and contemporary technique for compounds synthesis, there are more and more compounds available which give ample growth of diverse compound library, but the time and endeavor required to screen these unfocused massive and diverse library have been slightly reduced in the past years. Hence, there is demand to improve the high-quality hits and success rate for high-throughput screening that required focused and biased compound library toward the particular target. Therefore, we still need an advantageous and expedient method to prioritize the molecules that will be utilized for biological screens, which saves time and is also inexpensive. In this concept, in silico methods like machine learning are widely applicable technique used to build computational model for high-throughput virtual screens to prioritize molecules for advance study. Furthermore, in computational analysis, we extended our study to identify the common enriched

  16. Salmonella in sesame seed products.

    PubMed

    Brockmann, Stefan O; Piechotowski, Isolde; Kimmig, Peter

    2004-01-01

    In the context of an international outbreak of multiresistant Salmonella Typhimurium DT 104 that was correlated to the consumption of halvah ("helva," an Asian candy made from sesame seed), we examined several sesame seed products for the occurrence of Salmonella. Of 117 ready-to-eat food items containing sesame, we isolated salmonellae from 11 (9.4%) samples. In addition to finding Salmonella Typhimurium DT 104 in the halvah involved in the outbreak, we also isolated different Salmonella Typhimurium strains out of halvah from other manufacturers and countries of origin, as well as Salmonella Offa, Salmonella Tennessee, and Salmonella Poona from sesame paste (tahini) and sesame seed, which is sold for raw consumption in cereals.

  17. Phosphate taxis in Pseudomonas aeruginosa.

    PubMed

    Kato, J; Ito, A; Nikata, T; Ohtake, H

    1992-08-01

    Pseudomonas aeruginosa was shown to be attracted to phosphate. The chemotactic response was induced by phosphate starvation. The specificity of chemoreceptors for phosphate was high so that no other tested phosphorus compounds elicited a chemotactic response as strong as that elicited by phosphate. Competition experiments showed that the chemoreceptors for phosphate appeared to be different from those for the common amino acids. Mutants constitutive for alkaline phosphatase showed the chemotactic response to phosphate regardless of whether the cells were starved for phosphate.

  18. Carbenicillin resistance of Pseudomonas aeruginosa.

    PubMed Central

    Rodríguez-Tebar, A; Rojo, F; Dámaso, D; Vázquez, D

    1982-01-01

    Four strains of Pseudomonas aeruginosa obtained from clinical isolates which are carbenicillin resistant were studied to find the cause(s) of resistance to this beta-lactam antibiotic. The electrophoresis patterns of the four strains (PH20610, PH20815, PH4011, and PH4301) were found to be different from those of a wild-type strain, P. aeruginosa NCTC 10662, and appeared to lack penicillin-binding protein 2. Affinity of other penicillin-binding proteins from strains PH20610 and PH20815 for carbenicillin seemed to be normal or slightly diminished. Electrophoretic patterns of penicillin-binding proteins from strains PH4011 and PH4301 had more profound differences, since the affinities of their penicillin-binding proteins 1a, 1b, and 4 for carbenicillin were decreased by nearly two orders of magnitude relative to the preparations from the wild-type strain. Kinetic studies on binding of carbenicillin to penicillin-binding proteins both in isolated membrane preparations and in intact cells revealed that carbenicillin penetration into resistant cells was a much slower process than in susceptible cells, suggesting that the outer envelope structures serve as an efficient barrier against carbenicillin entry into our P. aeruginosa strains from clinical isolates. PMID:6821456

  19. Pathogenesis of Salmonellosis: Salmonella Exotoxins

    DTIC Science & Technology

    1982-03-08

    Newport; Sal. 9633 - serotype Newport; and Sal. 9186 - serotype Newport. Salmonella enteritidis serotype typhimurium strain 2000 was obtained from...7054 Table 1I CULTURE MEDIA SURVEY Salmonella enteritidis Salmonella typhimurium serotype Javiana #10016 SRlI Culture Media C H 0 Cell Factor C H 0 Cell...the pediatric bacteriology laboratory of the UTMB Children’s Hospital and previously reported to prs-’uce the heat labile toxin (9). Salmonella

  20. Pseudomonas aeruginosa Population Structure Revisited

    PubMed Central

    Pirnay, Jean-Paul; Bilocq, Florence; Pot, Bruno; Cornelis, Pierre; Zizi, Martin; Van Eldere, Johan; Deschaght, Pieter; Vaneechoutte, Mario; Jennes, Serge; Pitt, Tyrone; De Vos, Daniel

    2009-01-01

    At present there are strong indications that Pseudomonas aeruginosa exhibits an epidemic population structure; clinical isolates are indistinguishable from environmental isolates, and they do not exhibit a specific (disease) habitat selection. However, some important issues, such as the worldwide emergence of highly transmissible P. aeruginosa clones among cystic fibrosis (CF) patients and the spread and persistence of multidrug resistant (MDR) strains in hospital wards with high antibiotic pressure, remain contentious. To further investigate the population structure of P. aeruginosa, eight parameters were analyzed and combined for 328 unrelated isolates, collected over the last 125 years from 69 localities in 30 countries on five continents, from diverse clinical (human and animal) and environmental habitats. The analysed parameters were: i) O serotype, ii) Fluorescent Amplified-Fragment Length Polymorphism (FALFP) pattern, nucleotide sequences of outer membrane protein genes, iii) oprI, iv) oprL, v) oprD, vi) pyoverdine receptor gene profile (fpvA type and fpvB prevalence), and prevalence of vii) exoenzyme genes exoS and exoU and viii) group I pilin glycosyltransferase gene tfpO. These traits were combined and analysed using biological data analysis software and visualized in the form of a minimum spanning tree (MST). We revealed a network of relationships between all analyzed parameters and non-congruence between experiments. At the same time we observed several conserved clones, characterized by an almost identical data set. These observations confirm the nonclonal epidemic population structure of P. aeruginosa, a superficially clonal structure with frequent recombinations, in which occasionally highly successful epidemic clones arise. One of these clones is the renown and widespread MDR serotype O12 clone. On the other hand, we found no evidence for a widespread CF transmissible clone. All but one of the 43 analysed CF strains belonged to a ubiquitous P

  1. Enhancing the Feasibility of Microcystis aeruginosa as a Feedstock for Bioethanol Production under the Influence of Various Factors

    PubMed Central

    Lee, Moon Geon; Seo, Hyo Jin; Shin, Jin Hyuk; Shin, Tai Sun; Kim, Min Yong; Choi, Jong Il

    2016-01-01

    Microcystis aeruginosa, a freshwater microalga, is capable of producing and accumulating different types of sugars in its biomass which make it a good feedstock for bioethanol production. Present study aims to investigate the effect of different factors increasing growth rate and carbohydrates productivity of M. aeruginosa. MF media (modified BG11 media) and additional ingredients such as aminolevulinic acid (2 mM), lysine (2.28 mM), alanine (1 mM), and Naphthalene acetic acid (1 mM) as cytokine promoted M. aeruginosa growth and sugar contents. Salmonella showed growth-assisting effect on M. aeruginosa. Enhanced growth rate and carbohydrates contents were observed in M. aeruginosa culture grown at 25°C under red LED light of 90 μmolm−2s−1 intensity. More greenish and carbohydrates rich M. aeruginosa biomass was prepared (final OD660 nm = 2.21 and sugar contents 10.39 mM/mL) as compared to control (maximum OD660 nm = 1.4 and sugar contents 3 mM/mL). The final algae biomass was converted to algae juice through a specific pretreatment method. The resulted algae Juice was used as a substrate in fermentation process. Highest yield of bioethanol (50 mM/mL) was detected when Brettanomyces custersainus, Saccharomyces cerevisiae, and Pichia stipitis were used in combinations for fermentation process as compared to their individual fermentation. The results indicated the influence of different factors on the growth rate and carbohydrates productivity of M. aeruginosa and its feasibility as a feedstock for fermentative ethanol production. PMID:27556034

  2. Enhancing the Feasibility of Microcystis aeruginosa as a Feedstock for Bioethanol Production under the Influence of Various Factors.

    PubMed

    Khan, Muhammad Imran; Lee, Moon Geon; Seo, Hyo Jin; Shin, Jin Hyuk; Shin, Tai Sun; Yoon, Yang Ho; Kim, Min Yong; Choi, Jong Il; Kim, Jong Deog

    2016-01-01

    Microcystis aeruginosa, a freshwater microalga, is capable of producing and accumulating different types of sugars in its biomass which make it a good feedstock for bioethanol production. Present study aims to investigate the effect of different factors increasing growth rate and carbohydrates productivity of M. aeruginosa. MF media (modified BG11 media) and additional ingredients such as aminolevulinic acid (2 mM), lysine (2.28 mM), alanine (1 mM), and Naphthalene acetic acid (1 mM) as cytokine promoted M. aeruginosa growth and sugar contents. Salmonella showed growth-assisting effect on M. aeruginosa. Enhanced growth rate and carbohydrates contents were observed in M. aeruginosa culture grown at 25°C under red LED light of 90 μmolm(-2)s(-1) intensity. More greenish and carbohydrates rich M. aeruginosa biomass was prepared (final OD660 nm = 2.21 and sugar contents 10.39 mM/mL) as compared to control (maximum OD660 nm = 1.4 and sugar contents 3 mM/mL). The final algae biomass was converted to algae juice through a specific pretreatment method. The resulted algae Juice was used as a substrate in fermentation process. Highest yield of bioethanol (50 mM/mL) was detected when Brettanomyces custersainus, Saccharomyces cerevisiae, and Pichia stipitis were used in combinations for fermentation process as compared to their individual fermentation. The results indicated the influence of different factors on the growth rate and carbohydrates productivity of M. aeruginosa and its feasibility as a feedstock for fermentative ethanol production.

  3. Salmonella porins induce a sustained, lifelong specific bactericidal antibody memory response

    PubMed Central

    Secundino, Ismael; López-Macías, Constantino; Cervantes-Barragán, Luisa; Gil-Cruz, Cristina; Ríos-Sarabia, Nora; Pastelin-Palacios, Rodolfo; Angel Villasis-Keever, Miguel; Becker, Ingeborg; Luis Puente, José; Calva, Edmundo; Isibasi, Armando

    2006-01-01

    We examined the ability of porins from Salmonella enterica serovar typhi to induce a long-term antibody response in BALB/c mice. These porins triggered a strong lifelong production of immunoglobulin G (IgG) antibody in the absence of exogenous adjuvant. Analysis of the IgG subclasses produced during this antibody response revealed the presence of the subclasses IgG2b, IgG1, IgG2a and weak IgG3. Despite the high homology of porins, the long-lasting anti-S. typhi porin sera did not cross-react with S. typhimurium. Notably, the antiporin sera showed a sustained lifelong bactericidal-binding activity to the wild-type S. typhi strain, whereas porin-specific antibody titres measured by enzyme-linked immunosorbent assay (ELISA) decreased with time. Because our porin preparations contained the outer membrane proteins C and F (OmpC and OmpF), we evaluated the individual contribution of each porin to the long-lasting antibody response. OmpC and OmpF induced long-lasting antibody titres, measured by ELISA, which were sustained for 300 days. In contrast, although OmpC induced sustained high bactericidal antibody titres for 300 days, postimmunization, the bactericidal antibody titre induced by OmpF was not detected at day 180. These results indicate that OmpC is the main protein responsible for the antibody-mediated memory bactericidal response induced by porins. Taken together, our results show that porins are strong immunogens that confer lifelong specific bactericidal antibody responses in the absence of added adjuvant. PMID:16423041

  4. Comparative evaluation of two Rickettsia typhi-specific quantitative real-time PCRs for research and diagnostic purposes.

    PubMed

    Papp, Stefanie; Rauch, Jessica; Kuehl, Svenja; Richardt, Ulricke; Keller, Christian; Osterloh, Anke

    2017-02-01

    Rickettsioses are caused by intracellular bacteria of the family of Rickettsiaceae. Rickettsia (R.) typhi is the causative agent of endemic typhus. The disease occurs worldwide and is one of the most prevalent rickettsioses. Rickettsial diseases, however, are generally underdiagnosed which is mainly due to the lack of sensitive and specific methods. In addition, methods for quantitative detection of the bacteria for research purposes are rare. We established two qPCRs for the detection of R. typhi by amplification of the outer membrane protein B (ompB) and parvulin-type PPIase (prsA) genes. Both qPCRs are specific and exclusively recognize R. typhi but no other rickettsiae including the closest relative, R. prowazekii. The prsA-based qPCR revealed to be much more sensitive than the amplification of ompB and provided highly reproducible results in the detection of R. typhi in organs of infected mice. Furthermore, as a nested PCR the prsA qPCR was applicable for the detection of R. typhi in human blood samples. Collectively, the prsA-based qPCR represents a reliable method for the quantitative detection of R. typhi for research purposes and is a promising candidate for differential diagnosis.

  5. Development of two salmonella-based oral vaccines against human respiratory syncytial virus.

    PubMed

    Azizi Jalilian, F; Yusoff, K; Suhaimi, S; Amini, R; Sekawi, Z; Jahanshiri, F

    2015-01-01

    Human respiratory syncytial virus is the most common cause of bronchiolitis and other respiratory infections in infants and the elderly worldwide. We have developed two new oral vaccines using Salmonella typhi TY21a to carry and express the immunogenic epitopes of RSV fusion (F) and attachment (G) glycoproteins on its surface, separately. To evaluate the efficacy of the designed vaccines, BALB/c mice were orally immunized and then infected with RSV. Immune response analyses showed that cellmediated, mucosal and humoral immunity in the vaccinated mice were significantly enhanced compared to the control group. Both vaccines generated a balanced Th1/Th2 immune response which is crucial for efficiency of vaccines against RSV. Furthermore, histopathological examination proved that these vaccines were safe as they did not cause any Th2-associated adverse effects in the lungs of RSV-infected mice. The findings of this research suggest that Salmonella-F and Salmonella-G vaccine candidates may have strong potential to prevent RSV infection.

  6. Histopathological Analysis of Salmonella Chronic Carriage in the Mouse Hepatopancreatobiliary System

    PubMed Central

    Gonzalez-Escobedo, Geoffrey; La Perle, Krista M. D.; Gunn, John S.

    2013-01-01

    Salmonella Typhi asymptomatic chronic carriage represents a challenge for the diagnosis and prevention of typhoid fever in endemic areas. Such carriers are thought to be reservoirs for further spread of the disease. Gallbladder carriage has been demonstrated to be mediated by biofilm formation on gallstones and by intracellular persistence in the gallbladder epithelium of mice. In addition, both gallstones and chronic carriage have been associated with chronic inflammation and the development of gallbladder carcinoma. However, the pathogenic relationship between typhoid carriage and the development of pre-malignant and/or malignant lesions in the hepatopancreatobiliary system as well as the host-pathogen interactions occurring during chronic carriage remains unclear. In this study, we monitored the histopathological features of chronic carriage up to 1 year post-infection. Chronic cholecystitis and hepatitis ranging from mild to severe were present in infected mice regardless of the presence of gallstones. Biliary epithelial hyperplasia was observed more commonly in the gallbladder of mice with gallstones (uninfected or infected). However, pre-malignant lesions, atypical hyperplasia and metaplasia of the gallbladder and exocrine pancreas, respectively, were only associated with chronic Salmonella carriage. This study has implications regarding the role of Salmonella chronic infection and inflammation in the development of pre-malignant lesions in the epithelium of the gallbladder and pancreas that could lead to oncogenesis. PMID:24349565

  7. Cyclic Rhamnosylated Elongation Factor P Establishes Antibiotic Resistance in Pseudomonas aeruginosa

    PubMed Central

    Rajkovic, Andrei; Erickson, Sarah; Witzky, Anne; Branson, Owen E.; Seo, Jin; Gafken, Philip R.; Frietas, Michael A.; Whitelegge, Julian P.; Faull, Kym F.; Navarre, William; Darwin, Andrew J.

    2015-01-01

    ABSTRACT Elongation factor P (EF-P) is a ubiquitous bacterial protein that is required for the synthesis of poly-proline motifs during translation. In Escherichia coli and Salmonella enterica, the posttranslational β-lysylation of Lys34 by the PoxA protein is critical for EF-P activity. PoxA is absent from many bacterial species such as Pseudomonas aeruginosa, prompting a search for alternative EF-P posttranslation modification pathways. Structural analyses of P. aeruginosa EF-P revealed the attachment of a single cyclic rhamnose moiety to an Arg residue at a position equivalent to that at which β-Lys is attached to E. coli EF-P. Analysis of the genomes of organisms that both lack poxA and encode an Arg32-containing EF-P revealed a highly conserved glycosyltransferase (EarP) encoded at a position adjacent to efp. EF-P proteins isolated from P. aeruginosa ΔearP, or from a ΔrmlC::acc1 strain deficient in dTDP-l-rhamnose biosynthesis, were unmodified. In vitro assays confirmed the ability of EarP to use dTDP-l-rhamnose as a substrate for the posttranslational glycosylation of EF-P. The role of rhamnosylated EF-P in translational control was investigated in P. aeruginosa using a Pro4-green fluorescent protein (Pro4GFP) in vivo reporter assay, and the fluorescence was significantly reduced in Δefp, ΔearP, and ΔrmlC::acc1 strains. ΔrmlC::acc1, ΔearP, and Δefp strains also displayed significant increases in their sensitivities to a range of antibiotics, including ertapenem, polymyxin B, cefotaxim, and piperacillin. Taken together, our findings indicate that posttranslational rhamnosylation of EF-P plays a key role in P. aeruginosa gene expression and survival. PMID:26060278

  8. Salmonella enteritidis in Argentina.

    PubMed

    Caffer, M I; Eiguer, T

    1994-01-01

    A significant increase in the number of isolations of Salmonella enteritidis has been observed in Argentina since 1986. Outbreaks of foodborne diseases in humans were associated with the consumption of raw or undercooked hens' eggs. Between 1986 and the first 6 months of 1993 there were 150 outbreaks reported, affecting more than 6000 persons. A total of 71.3% of these outbreaks were confirmed by stool cultures, and 47.3% by bacteriological study of the food implicated in the outbreak. A permanent surveillance of salmonellosis is imperative, taking into account the persistence of Salmonella enteritidis isolations in sporadic cases and in new outbreaks.

  9. Cephalosporin Resistance among Non-Typhi Salmonella from Humans, Retail Meats and Food Animals in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The National Antimicrobial Resistance Monitoring System (NARMS) is a collaboration among the Food and Drug Administration (FDA), U.S. Department of Agriculture (USDA), and the Centers for Disease Control and Prevention (CDC). Here we report on decreased susceptibility to cephalosporins ...

  10. A case of clinical and microbiological failure of azithromycin therapy in Salmonella enterica serotype Typhi despite low azithromycin MIC.

    PubMed

    Manesh, Abi; Balaji, Veeraraghavan; Kumar, Devanga Ragupathi Naveen; Rupali, Priscilla

    2017-01-01

    Typhoid fever remains a serious problem in many developing countries. Due to resistance to multiple first line drugs, azithromycin has evolved as an important drug in the treatment of typhoid. While therapy with azithromycin is highly effective, no clinically validated mean inhibitory concentration (MIC) break points or disc diffusion cutoff guidelines are available so far. We describe an Indian adult with clinical and microbiological failure to azithromycin despite low azithromycin MIC.

  11. [Various Salmonella serotypes isolated at a sewage purification plant in a smaller city over a one-year period].

    PubMed

    Schüsseler, G; Sobotta, B; Gerhardt, G G; Teitge, E; Gundermann, K O

    1986-04-01

    A one-year-study was carried out in the waste-water treatment plant of Plön (population equivalents 60,000), which has a mechanical and a biological purification and an additional chemical flocculation. Samples were taken at five different places in the plant and examined for Salmonella by use of membrane-filtration and MPN-method. 2,611 Salmonella-strains, representing 23 species, were isolated and serologically typed from samples taken at ten days. S. typhi-murium was found most frequently (Table 1, Fig. 1). The largest spectrum of different types was located in the activated sludge-basin and at the outlet of the chemical flocculation (Table 2). No correlation could be established between the qualitative findings and the Salmonella-counts or other parameter like temperatures. All the ten species that have been officially reported to cause salmonellosis in man were also isolated from the sewage (Table 5). Findings of other Salmonella-serotypes are attributed to unreported human infections and animals or other sources.

  12. The Accessory Genome of Pseudomonas aeruginosa

    PubMed Central

    Kung, Vanderlene L.; Ozer, Egon A.; Hauser, Alan R.

    2010-01-01

    Summary: Pseudomonas aeruginosa strains exhibit significant variability in pathogenicity and ecological flexibility. Such interstrain differences reflect the dynamic nature of the P. aeruginosa genome, which is composed of a relatively invariable “core genome” and a highly variable “accessory genome.” Here we review the major classes of genetic elements comprising the P. aeruginosa accessory genome and highlight emerging themes in the acquisition and functional importance of these elements. Although the precise phenotypes endowed by the majority of the P. aeruginosa accessory genome have yet to be determined, rapid progress is being made, and a clearer understanding of the role of the P. aeruginosa accessory genome in ecology and infection is emerging. PMID:21119020

  13. Interaction of Salmonella enterica with Fresh Produce Leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Attachment and colonization of Salmonella enterica serovars to fresh produce leaves was investigated. Biofilm assay and attachment of Salmonella serovars to intact and cut leaves were determined. Salmonella Tennessee and Salmonella Thompson produced stronger biofilms compared to Salmonella Newpor...

  14. Foodborne Salmonella control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Almost all of the paratyphoid Salmonella spp. are normal flora bacteria of the intestines of chickens and turkeys. They cohabit together and have a very comfortable living arrangement, causing little or no harm to one another and seldom attracting much attention from the birds’ defense systems. Th...

  15. [Various Salmonella serotypes isolated at a sewage purification plant in a large city over a one-year period].

    PubMed

    Sobotta, B; Schüsseler, G; Gerhardt, G G; Teitge, E; Gundermann, K O

    1986-04-01

    The paper offers the results of a one-year-survey of Salmonella-serotypes in a municipal sewage-purification plant with a capacity of roughly 70,000 m3 per day. Findings of a quantitative study had shown Salmonella-maxima in the activated-sludge-basin. This suggested specialized Salmonella-serotypes, resident in this part of the plant as a possible explanation which was to be verified by this study. On ten days samples were taken from the inlet, and the outlet of the primary-sedimentation-tank, the outlet of the activated-sludge-basin and the effluent of the final sedimentation-basin. A combination of membrane-filtration and MPN-Method with a fifefold enrichment in 2.5% tetrathionate was applied for salmonella isolation. Plating was done on malachit-green-chinablue-lactose-agar followed by serological typing. 1,587 strains representing 38 different serotypes (Table 1) were identified with S. typhi-murium (Fig. 1) accounting for 36% of the isolations followed by S. bovis-morbificans, S. hadar (Fig. 2) and S. panama. None of the serotypes found showed a preference of a special sampling point. The qualitative and quantitative distribution of Salmonella in the plant seems to depend on the Salmonella contents of the entering waste water mainly. The greatest variety of Salmonella-serotypes was located in the activated-sludge-basin (Table 2) where oxygen-enrichment seems to result in the best ecological conditions for Salmonella survival. 3.3% of 722 strains examined did not produce hydrogen-sulphide (Table 3) and some showed damaged flagella-antigens. As a possible explanation toxic influences in the sewage are discussed. The epidemiological links between findings of Salmonella in sewage and in man of the same area are established and results differing in some aspects explained by the high rate of unknown infections. The existence of an autochthonous Salmonella-population in the sewage plant could not be proved.

  16. Importance of Tryptophan in Transforming an Amphipathic Peptide into a Pseudomonas aeruginosa-Targeted Antimicrobial Peptide

    PubMed Central

    Zhu, Xin; Ma, Zhi; Wang, Jiajun; Chou, Shuli; Shan, Anshan

    2014-01-01

    Here, we found that simple substitution of amino acids in the middle position of the hydrophobic face of an amphipathic peptide RI16 with tryptophan (T9W) considerably transformed into an antimicrobial peptide specifically targeting Pseudomonas aeruginosa. Minimal inhibitory concentration (MIC) results demonstrated that T9W had a strong and specifically antimicrobial activity against P. aeruginosa, including antibiotic-resistant strains, but was not active against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and Staphyfococcus epidermidis. Fluorescent spectroscopic assays indicated that T9W interacted with the membrane of P. aeruginosa, depolarizing the outer and the inner membrane of bacterial cells. Salt susceptibility assay showed that T9W still maintained its strong anti-pseudomonas activity in the presence of salts at physiological concentrations, and in hemolytic and MTT assays T9W also showed no toxicity against human blood cells and macrophages. In vivo assay demonstrated that T9W also displayed no toxicity to Chinese Kun Ming (KM) mice. Furthermore, the strong antibiofilm activity was also observed with the peptide T9W, which decreased the percentage of biomass formation in a dose-dependent manner. Overall, these findings indicated that design of single-pathogen antimicrobial agents can be achieved by simple amino acid mutation in naturally occurring peptide sequences and this study suggested a model of optimization/design of anti-pseudomonas drugs in which the tryptophan residue was a conserved element. PMID:25494332

  17. Importance of Tryptophan in Transforming an Amphipathic Peptide into a Pseudomonas aeruginosa-Targeted Antimicrobial Peptide.

    PubMed

    Zhu, Xin; Ma, Zhi; Wang, Jiajun; Chou, Shuli; Shan, Anshan

    2014-01-01

    Here, we found that simple substitution of amino acids in the middle position of the hydrophobic face of an amphipathic peptide RI16 with tryptophan (T9W) considerably transformed into an antimicrobial peptide specifically targeting Pseudomonas aeruginosa. Minimal inhibitory concentration (MIC) results demonstrated that T9W had a strong and specifically antimicrobial activity against P. aeruginosa, including antibiotic-resistant strains, but was not active against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and Staphyfococcus epidermidis. Fluorescent spectroscopic assays indicated that T9W interacted with the membrane of P. aeruginosa, depolarizing the outer and the inner membrane of bacterial cells. Salt susceptibility assay showed that T9W still maintained its strong anti-pseudomonas activity in the presence of salts at physiological concentrations, and in hemolytic and MTT assays T9W also showed no toxicity against human blood cells and macrophages. In vivo assay demonstrated that T9W also displayed no toxicity to Chinese Kun Ming (KM) mice. Furthermore, the strong antibiofilm activity was also observed with the peptide T9W, which decreased the percentage of biomass formation in a dose-dependent manner. Overall, these findings indicated that design of single-pathogen antimicrobial agents can be achieved by simple amino acid mutation in naturally occurring peptide sequences and this study suggested a model of optimization/design of anti-pseudomonas drugs in which the tryptophan residue was a conserved element.

  18. Comparative metabolism of Lappaconitine in rat and human liver microsomes and in vivo of rat using ultra high-performance liquid chromatography-quadrupole/time-of-flight mass spectrometry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lappaconitine (LAP) is a non-addictive potent analgesic drug broadly used to treat severe cancer pain and postoperative pain in many countries around the world, and it also has antibiotic activity against Pseudomonas aeruginosa and Salmonella typhi. Despite its widespread usage and potential for ex...

  19. Oral immunization of mice with attenuated Salmonella enteritidis containing a recombinant plasmid which codes for production of the B subunit of heat-labile Escherichia coli enterotoxin.

    PubMed Central

    Clements, J D; Lyon, F L; Lowe, K L; Farrand, A L; el-Morshidy, S

    1986-01-01

    We used Salmonella enteritidis serotype dublin strain SL1438, a nonreverting, aromatic-dependent, histidine-requiring mutant, as a recipient for a recombinant plasmid coding for production of the nontoxic B subunit of the heat-labile Escherichia coli enterotoxin. The S. enteritidis derivative EL23 produced heat-labile enterotoxin subunit B that was indistinguishable from heat-labile enterotoxin subunit B produced by strains of E. coli or Salmonella typhi harboring the same plasmid. Mice immunized orally with strain EL23 developed progressively increasing mucosal and serum antibody responses to both heat-labile enterotoxin subunit B and to the lipopolysaccharide of the vaccine strain. The mucosal antibody response was shown to be immunoglobulin A specific and to be capable of neutralizing the biological activities of both E. coli heat-labile enterotoxin and cholera enterotoxin in vitro. Images PMID:3527989

  20. O:2-CRM(197) conjugates against Salmonella Paratyphi A.

    PubMed

    Micoli, Francesca; Rondini, Simona; Gavini, Massimiliano; Lanzilao, Luisa; Medaglini, Donata; Saul, Allan; Martin, Laura B

    2012-01-01

    Enteric fevers remain a common and serious disease, affecting mainly children and adolescents in developing countries. Salmonella enterica serovar Typhi was believed to cause most enteric fever episodes, but several recent reports have shown an increasing incidence of S. Paratyphi A, encouraging the development of a bivalent vaccine to protect against both serovars, especially considering that at present there is no vaccine against S. Paratyphi A. The O-specific polysaccharide (O:2) of S. Paratyphi A is a protective antigen and clinical data have previously demonstrated the potential of using O:2 conjugate vaccines. Here we describe a new conjugation chemistry to link O:2 and the carrier protein CRM(197), using the terminus 3-deoxy-D-manno-octulosonic acid (KDO), thus leaving the O:2 chain unmodified. The new conjugates were tested in mice and compared with other O:2-antigen conjugates, synthesized adopting previously described methods that use CRM(197) as carrier protein. The newly developed conjugation chemistry yielded immunogenic conjugates with strong serum bactericidal activity against S. Paratyphi A.

  1. Antigenic determinants of the OmpC porin from Salmonella typhimurium.

    PubMed Central

    Singh, S P; Singh, S R; Williams, Y U; Jones, L; Abdullah, T

    1995-01-01

    The antigenic determinants of Salmonella typhimurium OmpC were investigated by the analysis of cyanogen bromide (CNBr)-generated porin peptides with antiporin monoclonal antibodies (MAbs). We identified six bands (f1 to f6) with estimated molecular masses of 35.5, 31.0, 25.0, 22.5, 13.8, and 10.0 kDa, respectively. In addition, two small fragments (f7 and f8; 3.0 to 6.0 kDa) were detected only infrequently. The OmpC monomer or its CNBr-generated peptides were electrophoretically transferred to a polyvinylidene difluoride membrane and then subjected to amino acid composition analysis and N-terminal sequencing. A comparison of the amino acid composition data with known compositions of Escherichia coli and Salmonella typhi OmpC showed some differences; however, the amino acid sequences of 71 residues identified in S. typhimurium showed 88 and 98% identity with OmpC from E. coli and S. typhi, respectively. The screening of CNBr peptides with the 12 anti-(S. typhimurium) OmpC MAbs by Western blot (immunoblot), in conjunction with the prediction of the OmpC folding pattern based on the known three-dimensional structure of E. coli OmpF, showed that four MAbs reacted with surface-exposed epitopes on loops L2, L8, and L4 to L7, four MAbs reacted with a region in the eyelet structure on loop L3, and four MAbs reacted with the buried epitopes on transmembrane beta strands. The MAbs reacting with surface-exposed loops showed no cross-reaction with E. coli OmpC, whose sequence has diverged extensively from that of S. typhi and (probably) S. typhimurium OmpC only in regions of the externally exposed loops. In contrast, MAbs reacting with transmembrane beta strands, whose sequence is strongly conserved, showed strong cross-reaction with E. coli OmpC. These results show that comparison with the E. coli OmpF structure predicts the folding pattern of S. typhimurium OmpC rather accurately and that evolutionary divergence in sequences is confined to the external loops. The possible

  2. Pathogenesis of Salmonellosis: Salmonella Exotoxins

    DTIC Science & Technology

    1982-03-08

    77Z7I AD _ REPORT NUMBER 3 0 Pathogenesis of Salmonellosis : Salmonella Exotoxins Annual Progress Report (9/1/79-8/31/80) M Johnny W. Peterson, Ph.D...OVT ACCESSION NO. 3. RECIPIENT’S CATALOG NUMBER 4. TITLE (nd Subtitle) S. TYPE OF REPORT &PERIOD COVERED Pathogenesis of Salmonellosis : Salmonella... salmonellosis , One of the rapid, in vitro assays measures biological activity in terms of Salmonella toxin’s capacity to stimulate adenylate cyclase in Chinese

  3. Lipopolysaccharides belonging to different Salmonella serovars are differentially capable of activating Toll-like receptor 4.

    PubMed

    Chessa, Daniela; Spiga, Luisella; De Riu, Nicola; Delaconi, Paola; Mazzarello, Vittorio; Ganau, Giulia; Rubino, Salvatore

    2014-11-01

    Salmonella enterica subsp. enterica serovar (serotype) Abortusovis is a member of the Enterobacteriaceae. This serotype is naturally restricted to ovine species and does not infect humans. Limited information is available about the immune response of sheep to S. Abortusovis. S. Abortusovis, like Salmonella enterica subsp. enterica serovar Typhi, causes a systemic infection in which, under natural conditions, animals are not able to raise a rapid immune response. Failure to induce the appropriate response allows pathogens to reach the placenta and results in an abortion. Lipopolysaccharides (LPSs) are pathogen-associated molecular patterns (PAMPs) that are specific to bacteria and are not synthesized by the host. Toll-like receptors (TLRs) are a family of receptors that specifically recognize PAMPs. As a first step, we were able to identify the presence of Toll-like receptor 4 (TLR4) on the ovine placenta by using an immunohistochemistry technique. To our knowledge, this is the first work describing the interaction between S. Abortusovis LPS and TLR4. Experiments using an embryonic cell line (HEK293) transfected with human and ovine TLR4s showed a reduction of interleukin 8 (IL-8) production by S. Abortusovis and Salmonella enterica subsp. enterica serovar Paratyphi upon LPS stimulation compared to Salmonella enterica subsp. enterica serovar Typhimurium. Identical results were observed using heat-killed bacteria instead of LPS. Based on data obtained with TLR4 in vitro stimulation, we demonstrated that the serotype S. Abortusovis is able to successfully evade the immune system whereas S. Typhimurium and other serovars fail to do so.

  4. Involvement of caspase-3, lipid peroxidation and TNF-alpha in causing apoptosis of macrophages by coordinately expressed Salmonella phenotype under stress conditions.

    PubMed

    Chanana, Vishal; Majumdar, Siddharth; Rishi, Praveen

    2007-03-01

    Invasive Salmonella has been reported to induce apoptosis of macrophages as a part of its infection process, which may allow it to avoid detection by the innate immune system. However, the bacterial components capable of inducing apoptosis, particularly under the environments offered by the host have not been fully identified. Therefore, in the present study, attempts were made to evaluate the apoptotic potential of Salmonella enterica serovar Typhi (S. typhi) outer membrane protein expressed under stress conditions like iron, oxidative and anaerobic simulating the in vivo situations encountered by the pathogen. Analysis of data revealed that a coordinately expressed 69kDa outer membrane protein (OMP) expressed with enhanced intensity under iron, oxidative and anaerobic stress conditions caused apoptotic cell death in 51% of macrophages, whereas OMPs of S. typhi extracted under normal conditions accounted for apoptotic cell death in only 31% of macrophages. A significantly enhanced activity of caspase-3 was observed during macrophage-apoptosis induced by this protein. A significant increase in the extent of lipid peroxidation (levels of oxidant) and decrease in the activities of antioxidants was also observed which correlated with the increased generation of tumor necrosis factor-alpha, interleukine-1alpha and interleukine-6. These results suggest that caspase-3 and tumor necrosis factor-alpha in conjunction with other cytokines may induce apoptotic cell death through the up-regulation of oxidants and down-regulation of antioxidants. These findings may be relevant for the better understanding of the disease pathophysiology and for the future developments of diagnostic and preventive strategies during the host-pathogen interactions.

  5. Microcystis aeruginosa toxin: cell culture toxicity, hemolysis, and mutagenicity assays.

    PubMed Central

    Grabow, W O; Du Randt, W C; Prozesky, O W; Scott, W E

    1982-01-01

    Crude toxin was prepared by lyophilization and extraction of toxic Microcystis aeruginosa from four natural sources and a unicellular laboratory culture. The responses of cultures of liver (Mahlavu and PCL/PRF/5), lung (MRC-5), cervix (HeLa), ovary (CHO-K1), and kidney (BGM, MA-104, and Vero) cell lines to these preparations did not differ significantly from one another, indicating that toxicity was not specific for liver cells. The results of a trypan blue staining test showed that the toxin disrupted cell membrane permeability within a few minutes. Human, mouse, rat, sheep, and Muscovy duck erythrocytes were also lysed within a few minutes. Hemolysis was temperature dependent, and the reaction seemed to follow first-order kinetics. Escherichia coli, Streptococcus faecalis, and Tetrahymena pyriformis were not significantly affected by the toxin. The toxin yielded negative results in Ames/Salmonella mutagenicity assays. Microtiter cell culture, trypan blue, and hemolysis assays for Microcystis toxin are described. The effect of the toxin on mammalian cell cultures was characterized by extensive disintegration of cells and was distinguishable from the effects of E. coli enterotoxin, toxic chemicals, and pesticides. A possible reason for the acute lethal effect of Microcystis toxin, based on cytolytic activity, is discussed. Images PMID:6808921

  6. Analysis of Pseudomonas aeruginosa growth and virulence in modelled microgravity

    NASA Astrophysics Data System (ADS)

    Guadarrama, Seratna; Pulcini, Elinor de L.; Broadaway, Susan C.; Pyle, Barry H.

    2005-08-01

    Stress, radiation and microgravity cause astronauts to experience secondary immunosuppression. Spaceflight conditions enhance bacterial growth and alter antimicrobial susceptibility. Clinostats are used to model microgravity effects at 1xg. In controls rotated on the vertical axis, the g-vector acts on cells as in static cultures. Salmonella enterica serovar T yphimurium virulence genes are up-regulated in modelled microgravity (MMG); a MMG regulon has been postulated. We hypothesize that the virulence of P. aeruginosa (PA) may be affected similarly by microgravity, which could be observed in MMG. This study focused on regulation of the ETA protein by PA during growth in MMG. PA103 was grown in an ETA production medium at 37°C. One series of media was inoculated with frozen cultures and grown using horizontal (MMG) or static incubation. Another series inoculated with refrigerated cultures included vertical rotating controls. Analyses included optical density (OD), agar plate counts (PC) on R2A, ETA ELISA, and protein expression by 2-D gel analyses. Growth and ETA results differed depending on inoculum, with minor effects of MMG. Proteomic analysis of 2-D gels indicate differences in protein expression with MMG. Growth and ETA results show that consistent methodology is critical when studying environmental effects. This study provides information on the relationships between environmental changes and virulence regulation, especially for flight experiments, when ground experiments are used to predict potential spaceflight effects.

  7. Analysis of Pdeudomonas aeruginosa Growth and Virulence in Modelled Microgravity

    NASA Technical Reports Server (NTRS)

    Guadarrama, Seratna; deL. Pulcini, Elinor; Broadaway, Susan C.; Pyle, Barry H.

    2005-01-01

    Stress, radiation and microgravity cause astronauts to experience secondary immunosuppression. Spaceflight conditions enhance bacterial growth and alter antimicrobial susceptibility. Clinostats are used to model microgravity effects at lxg. In controls rotated on the vertical axis, the g-vector acts on cells as in static cultures. Salmonella enterica serovar Typhimurium virulence genes are up-regulated in modelled microgravity (MMG); a MMG regulon has been postulated. We hypothesize that the virulence of P. aeruginosa (PA) may be affected similarly by microgravity, which could be observed in MMG. This study focused on regulation of the ETA protein by PA during growth in MMG. PA103 was grown in an ETA production medium at 37 C. One series of media was inoculated with frozen cultures and grown using horizontal (MMG) or static incubation. Another series inoculated with refrigerated cultures included vertical rotating controls. Analyses included optical density (OD), agar plate counts (PC) on R2A, ETA ELISA, and protein expression by 2-D gel analyses. Growth and ETA results differed depending on inoculum, with minor effects of MMG. Proteomic analysis of 2-D gels indicate differences in protein expression with MMG. Growth and ETA results show that consistent methodology is critical when studying environmental effects. This study provides information on the relationships between environmental changes and virulence regulation, especially for flight experiments, when ground experiments are used to predict potential spaceflight effects.

  8. Antibiotic Conditioned Growth Medium of Pseudomonas Aeruginosa

    ERIC Educational Resources Information Center

    Benathen, Isaiah A.; Cazeau, Barbara; Joseph, Njeri

    2004-01-01

    A simple method to study the consequences of bacterial antibiosis after interspecific competition between microorganisms is presented. Common microorganisms are used as the test organisms and Pseudomonas aeruginosa are used as the source of the inhibitor agents.

  9. Occurrence of Pseudomonas aeruginosa in Kuwait soil.

    PubMed

    Al-Saleh, Esmaeil; Akbar, Abrar

    2015-02-01

    Environmentally ubiquitous bacteria such as Pseudomonas aeruginosa evolved mechanisms to adapt and prevail under diverse conditions. In the current investigation, strains of P. aeruginosa demonstrating high rates of crude oil utilization and tolerance to high concentrations of heavy metals were found in both crude oil-contaminated and uncontaminated sites in Kuwait, and were dominant in the contaminated sites. The incidence of P. aeruginosa in tested soils implies the definitive pattern of crude oil contamination in the selection of the bacterial population in petroleum-contaminated sites in Kuwait. Surprisingly, the unculturable P. aeruginosa in different soil samples showed significant high similarity coefficients based on 16S-RFLP analyses, implying that the unculturable fraction of existing bacterial population in environmental samples is more stable and, hence, reliable for phylogenetic studies compared to the culturable bacteria.

  10. Osmoregulation in Pseudomonas aeruginosa under hyperosmotic shock.

    PubMed

    Velasco, R; Burgoa, R; Flores, E; Hernández, E; Villa, A; Vaca, S

    1995-01-01

    Pseudomonas aeruginosa PAO1 strain was found to be able to tolerate 700 mM NaCl. 0.5 mM of the osmoprotectant betaine restablished the growth of this strain in 1200 mM NaCl. Intracellular K+ and glutamate concentrations of P. aeruginosa PAO1 after an hyperosmotic shock (400 mM NaCl) showed a permanent increase. Adition of betaine (0.5 mM) to the medium with NaCl had an inhibitory effect on the intracellular accumulation of glutamate. The results indicate that P. aeruginosa PAO1 resists high NaCl concentrations, K+ accumulation and glutamate synthesis probably being the first mechanisms involved in adaptation to osmotic stress. Also is is demonstrated that betaine modulates intracellular glutamate levels in osmotically stressed P. aeruginosa PAO1.

  11. Epidemiological study of Rickettsia typhi infection in two provinces of the north of Spain: analysis of sera from the general population and sheep.

    PubMed

    Lledo, L; Gegundez, M I; Medina, J; Gonzalez, J V; Alamo, R; Saz, J V

    2005-01-01

    Data relating to Rickettsia typhi infection in Spain are scarce. A serological survey of 383 serum samples (184 males, 199 females) from the general population and 120 sera from sheep were studied by immunofluorescence assay (IFA). The human serum samples were collected from the general population of Palencia and Burgos provinces, and sheep serum samples were collected from Palencia province. Of the 383 human serum samples studied, 29 were positive for antibodies against R. typhi (7.5%) No statistical differences were found according to age, sex, origin (rural vs. urban) or geographic distribution, but a significant difference was observed related to occupation. In addition, 69 serums were found positives for R. typhi in sheep samples (57.5%). Our results indicated the circulation of R. typhi infectious for humans and sheep in Palencia and Burgos provinces. This study indicates that sheep may be infected with R. typhi, and that animals can, therefore be used as indicators of the presence of this organism.

  12. Effect of systemic infection induced by Pseudomonas aeruginosa on the brain uptake of colistin in mice.

    PubMed

    Jin, Liang; Li, Jian; Nation, Roger L; Nicolazzo, Joseph A

    2012-10-01

    In view of reports of colistin-induced neurotoxicity in infected patients, the aim of this study was to assess whether the integrity of the blood-brain barrier (BBB) and the brain uptake of colistin are altered in the presence of systemic Pseudomonas aeruginosa infection. Bacteremia was confirmed 8 h after intramuscular administration of P. aeruginosa ATCC 27853 to Swiss Outbred mice, at which time a single subcutaneous dose of colistin sulfate (40 mg/kg of body weight) or an intravenous dose of [(14)C]sucrose (2 μCi) was administered. Despite a substantial elevation in plasma levels of the proinflammatory cytokines tumor necrosis factor alpha, interleukin-1β, and interleukin-6 during bacterial infection, the brain uptake of colistin was similar between infected and noninfected mice with AUC(brain)/AUC(plasma) (where AUC(brain) is the area under the brain concentration-time curve and AUC(plasma) is the area under the plasma concentration-time curve) ratios of 0.023 and 0.024, respectively. Similarly, the brain-to-plasma ratios of [(14)C]sucrose were no different between infected and noninfected mice, consistent with a lack of effect of bacteremia on BBB integrity. To further correlate any relationship between BBB disruption and plasma levels of proinflammatory cytokines, BBB integrity, colistin brain uptake, and plasma proinflammatory cytokines were measured following the administration of Salmonella enterica lipopolysaccharide (LPS), an agent known to induce BBB disruption. Despite LPS inducing a 4-fold increase in colistin brain uptake and a significant (P < 0.05) 1.2-fold increase in [(14)C]sucrose BBB penetration, plasma cytokine levels were lower with LPS treatment relative to those obtained with bacterial infection with P. aeruginosa. This study demonstrates that the brain uptake of colistin is not increased in mice during P. aeruginosa-induced systemic bacteremia despite a significant increase in plasma levels of three proinflammatory cytokines.

  13. High Prevalence of Rickettsia typhi and Bartonella Species in Rats and Fleas, Kisangani, Democratic Republic of the Congo

    PubMed Central

    Laudisoit, Anne; Falay, Dadi; Amundala, Nicaise; Akaibe, Dudu; de Bellocq, Joëlle Goüy; Van Houtte, Natalie; Breno, Matteo; Verheyen, Erik; Wilschut, Liesbeth; Parola, Philippe; Raoult, Didier; Socolovschi, Cristina

    2014-01-01

    The prevalence and identity of Rickettsia and Bartonella in urban rat and flea populations were evaluated in Kisangani, Democratic Republic of the Congo (DRC) by molecular tools. An overall prevalence of 17% Bartonella species and 13% Rickettsia typhi, the agent of murine typhus, was found in the cosmopolitan rat species, Rattus rattus and Rattus norvegicus that were infested by a majority of Xenopsylla cheopis fleas. Bartonella queenslandensis, Bartonella elizabethae, and three Bartonella genotypes were identified by sequencing in rat specimens, mostly in R. rattus. Rickettsia typhi was detected in 72% of X. cheopis pools, the main vector and reservoir of this zoonotic pathogen. Co-infections were observed in rodents, suggesting a common mammalian host shared by R. typhi and Bartonella spp. Thus, both infections are endemic in DRC and the medical staffs need to be aware knowing the high prevalence of impoverished populations or immunocompromised inhabitants in this area. PMID:24445202

  14. High prevalence of Rickettsia typhi and Bartonella species in rats and fleas, Kisangani, Democratic Republic of the Congo.

    PubMed

    Laudisoit, Anne; Falay, Dadi; Amundala, Nicaise; Akaibe, Dudu; de Bellocq, Joëlle Goüy; Van Houtte, Natalie; Breno, Matteo; Verheyen, Erik; Wilschut, Liesbeth; Parola, Philippe; Raoult, Didier; Socolovschi, Cristina

    2014-03-01

    The prevalence and identity of Rickettsia and Bartonella in urban rat and flea populations were evaluated in Kisangani, Democratic Republic of the Congo (DRC) by molecular tools. An overall prevalence of 17% Bartonella species and 13% Rickettsia typhi, the agent of murine typhus, was found in the cosmopolitan rat species, Rattus rattus and Rattus norvegicus that were infested by a majority of Xenopsylla cheopis fleas. Bartonella queenslandensis, Bartonella elizabethae, and three Bartonella genotypes were identified by sequencing in rat specimens, mostly in R. rattus. Rickettsia typhi was detected in 72% of X. cheopis pools, the main vector and reservoir of this zoonotic pathogen. Co-infections were observed in rodents, suggesting a common mammalian host shared by R. typhi and Bartonella spp. Thus, both infections are endemic in DRC and the medical staffs need to be aware knowing the high prevalence of impoverished populations or immunocompromised inhabitants in this area.

  15. Salmonella: an ecological success story

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella was first described in 1885 as a secondary pathogen in the infectious disease process. In 1929, a paper published in the Proceedings of the Royal Society of Medicine reported that Salmonella organisms were predominant in food borne outbreaks but acknowledged that the path of infection wa...

  16. Salmonella: A century old conundrum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In 1885 a new bacterial species, Salmonella cholerae suis which was thought to cause hog cholera. Interestingly, Salmonella cholerae suis was not the etiologic agent of hog cholera (which is caused by a virus), but it was observed to be a secondary pathogen in the infectious process. In 1929, a pa...

  17. [Comparative studies of methods of salmonella enrichment (author's transl)].

    PubMed

    Pietzsch, O; Kretschmer, F J; Bulling, E

    1975-07-01

    Eight different methods of salmonella enrichment were compared in two series of experiments involving 100 samples of whole-egg powder and 80 samples of frozen whole liquid egg, respectively. 66 out of a total of 100 samples of whole-egg powder had been artificially infected with varying numbers of S. typhi-murium; 60 out of 80 samples of frozen whole liquid egg were found to be naturally infected with various salmonella species. 3 of the 8 methods (Table 1) were compared within an international collaborative study with 14 laboratories in 11 countries participating. A reduction of the pre-enrichment period from 18 to 6 hours and of volumes used in pre-enrichment and selective enrichment from 10 and 100 ml, respectively to 1 and 10 ml, respectively were found to have adverse influence upon the result of isolations, in particular in the case of weakly infected samples. In contrast, extended incubation over 48 hours as well as preparation of two sub-cultures on solid selective media following incubation of enrichment cultures over 18-24 hours and 42-48 hours, respectively always resulted in a certain increase of salmonella yield which, however, exhibited gradual differences for the individual methods examined. Preparation of a 2nd sub-culture meant, in particular, a decisive improvement of the result of isolations from artificially infected samples if selenite-cystine enrichment volumes were 10 and 100 ml, respectively. The best results could be obtained by means of the following methods of enrichment: Pre-enrichment of material in buffered peptone water at 37 degrees C over 18 hours; pipetting of 10 ml inoculated and incubated pre-enriched material into 100 ml selenite-cystine or tetrathionate enrichment medium according to MULLER-KAUFFMANN; onward incubation of the enrichment culture at 43 degrees C over 48 hours; and preparation of sub-cultures on solid selective media after 24 and 48 hours. The method using tetrathionate enrichment medium was found to be most

  18. Malaria and Other Vector-Borne Infection Surveillance in the U.S. Department of Defense Armed Forces Health Surveillance Center-Global Program: Review of 2009 Accomplishments

    DTIC Science & Technology

    2011-03-04

    RESPONSIBLE PERSON a. REPORT unclassified b . ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI...made in 2009 to enhance or establish hospi- tal-based febrile illness surveillance platforms in Azer- baijan, Bolivia, Cambodia, Ecuador , Georgia...Pseudomonas aeruginosa (one), E. coli (one), Salmonella typhi (three), Salmonella paratyphi A (four), leptospirosis (37), hepatitis A virus (four), hepatitis C

  19. Effect of the surface composition of motile Escherichia coli and motile Salmonella species on the direction of galvanotaxis.

    PubMed Central

    Shi, W; Stocker, B A; Adler, J

    1996-01-01

    We have reported that motile Escherichia coli K-12 placed in an electric field swims toward the anode but that motile Salmonella typhimurium strains swim toward the cathode, a phenomenon called galvanotaxis (J. Adler and W. Shi, Cold Spring Harbor Symp. Quant. Biol. 53:23-25, 1988). In the present study, we isolated mutants with an altered direction of galvanotaxis. By further analyses of these mutants and by examination of E. coli and Salmonella strains with altered cell surface structure, we have now established a correlation between the direction of galvanotaxis and the surface structure of the cell: motile rough bacteria (that is, those without O polysaccharide; for example, E. coli K-12 and S. typhimurium mutants of classes galE and rfa) swam toward the anode, whereas motile smooth bacteria (that is, those with O polysaccharide; for example, wild-type S. typhimurium LT2) swam toward the cathode. However, smooth bacteria with acidic polysaccharide capsules (K1 in E. coli and Vi in Salmonella typhi) swam toward the anode. Measurements of passive electrophoretic mobility of strains representative of each set were made. We propose that the different directions of galvanotaxis of rough (or capsulate) bacteria and of smooth bacteria are explicable if the negative electrophoretic mobility of flagellar filaments is less than that of rough bodies but greater than that of smooth bodies. PMID:8576046

  20. Prevalence, serotyping and antimicrobials resistance mechanism of Salmonella enterica isolated from clinical and environmental samples in Saudi Arabia.

    PubMed

    El-Tayeb, Mohamed A; Ibrahim, Abdelnasser S S; Al-Salamah, Ali A; Almaary, Khalid S; Elbadawi, Yahya B

    2017-02-14

    Salmonella is recognized as a common foodborne pathogen, causing major health problems in Saudi Arabia. Herein, we report epidemiology, antimicrobial susceptibility and the genetic basis of resistance among S. enterica strains isolated in Saudi Arabia. Isolation of Salmonella spp. from clinical and environmental samples resulted in isolation of 33 strains identified as S. enterica based on their biochemical characteristics and 16S-rDNA sequences. S. enterica serovar Enteritidis showed highest prevalence (39.4%), followed by S. Paratyphi (21.2%), S. Typhimurium (15.2%), S. Typhi and S. Arizona (12.1%), respectively. Most isolates were resistant to 1st and 2nd generation cephalosporin; and aminoglycosides. Moreover, several S. enterica isolates exhibited resistance to the first-line antibiotics used for Salmonellosis treatment including ampicillin, trimethoprim-sulfamethoxazole and chloramphenicol. In addition, the results revealed the emergence of two S. enterica isolates showing resistance to third-generation cephalosporin. Analysis of resistance determinants in S. enterica strains (n=33) revealed that the resistance to β-lactam antibiotics, trimethoprim-sulfamethoxazole, chloramphenicol, and tetracycline, was attributed to the presence of carb-like, dfrA1, floR, tetA gene, respectively. On the other hand, fluoroquinolone resistance was related to the presence of mutations in gyrA and parC genes. These findings improve the information about foodborne Salmonella in Saudi Arabia, alarming the emergence of multi-drug resistant S. enterica strains, and provide useful data about the resistance mechanisms.

  1. Induced Pluripotent Stem Cell Derived Macrophages as a Cellular System to Study Salmonella and Other Pathogens

    PubMed Central

    Hale, Christine; Yeung, Amy; Goulding, David; Pickard, Derek; Alasoo, Kaur; Powrie, Fiona; Dougan, Gordon; Mukhopadhyay, Subhankar

    2015-01-01

    A number of pathogens, including several human-restricted organisms, persist and replicate within macrophages (Mφs) as a key step in pathogenesis. The mechanisms underpinning such host-restricted intracellular adaptations are poorly understood, in part, due to a lack of appropriate model systems. Here we explore the potential of human induced pluripotent stem cell derived macrophages (iPSDMs) to study such pathogen interactions. We show iPSDMs express a panel of established Mφ-specific markers, produce cytokines, and polarise into classical and alternative activation states in response to IFN-γ and IL-4 stimulation, respectively. iPSDMs also efficiently phagocytosed inactivated bacterial particles as well as live Salmonella Typhi and S. Typhimurium and were able to kill these pathogens. We conclude that iPSDMs can support productive Salmonella infection and propose this as a flexible system to study host/pathogen interactions. Furthermore, iPSDMs can provide a flexible and practical cellular platform for assessing host responses in multiple genetic backgrounds. PMID:25946027

  2. A Shigella boydii bacteriophage which resembles Salmonella phage ViI

    PubMed Central

    2011-01-01

    Background Lytic bacteriophages have been applied successfully to control the growth of various foodborne pathogens. Sequencing of their genomes is considered as an important preliminary step to ensure their safety prior to food applications. Results The lytic bacteriophage, ΦSboM-AG3, targets the important foodborne pathogen, Shigella. It is morphologically similar to phage ViI of Salmonella enterica serovar Typhi and a series of phages of Acinetobacter calcoaceticus and Rhizobium meliloti. The complete genome of ΦSboM-AG3 was determined to be 158 kb and was terminally redundant and circularly permuted. Two hundred and sixteen open reading frames (ORFs) were identified and annotated, most of which displayed homology to proteins of Salmonella phage ViI. The genome also included four genes specifying tRNAs. Conclusions This is the first time that a Vi-specific phage for Shigella has been described. There is no evidence for the presence of virulence and lysogeny-associated genes. In conclusion, the genome analysis of ΦSboM-AG3 indicates that this phage can be safely used for biocontrol purposes. PMID:21595934

  3. Transcriptional and Proteomic Responses of Pseudomonas aeruginosa PAO1 to Spaceflight Conditions Involve Hfq Regulation and Reveal a Role for Oxygen▿

    PubMed Central

    Crabbé, Aurélie; Schurr, Michael J.; Monsieurs, Pieter; Morici, Lisa; Schurr, Jill; Wilson, James W.; Ott, C. Mark; Tsaprailis, George; Pierson, Duane L.; Stefanyshyn-Piper, Heidi; Nickerson, Cheryl A.

    2011-01-01

    Assessing bacterial behavior in microgravity is important for risk assessment and prevention of infectious diseases during spaceflight missions. Furthermore, this research field allows the unveiling of novel connections between low-fluid-shear regions encountered by pathogens during their natural infection process and bacterial virulence. This study is the first to characterize the spaceflight-induced global transcriptional and proteomic responses of Pseudomonas aeruginosa, an opportunistic pathogen that is present in the space habitat. P. aeruginosa responded to spaceflight conditions through differential regulation of 167 genes and 28 proteins, with Hfq as a global transcriptional regulator. Since Hfq was also differentially regulated in spaceflight-grown Salmonella enterica serovar Typhimurium, Hfq represents the first spaceflight-induced regulator acting across bacterial species. The major P. aeruginosa virulence-related genes induced in spaceflight were the lecA and lecB lectin genes and the gene for rhamnosyltransferase (rhlA), which is involved in rhamnolipid production. The transcriptional response of spaceflight-grown P. aeruginosa was compared with our previous data for this organism grown in microgravity analogue conditions using the rotating wall vessel (RWV) bioreactor. Interesting similarities were observed, including, among others, similarities with regard to Hfq regulation and oxygen metabolism. While RWV-grown P. aeruginosa mainly induced genes involved in microaerophilic metabolism, P. aeruginosa cultured in spaceflight presumably adopted an anaerobic mode of growth, in which denitrification was most prominent. Whether the observed changes in pathogenesis-related gene expression in response to spaceflight culture could lead to an alteration of virulence in P. aeruginosa remains to be determined and will be important for infectious disease risk assessment and prevention, both during spaceflight missions and for the general public. PMID:21169425

  4. Transcriptional and proteomic responses of Pseudomonas aeruginosa PAO1 to spaceflight conditions involve Hfq regulation and reveal a role for oxygen.

    PubMed

    Crabbé, Aurélie; Schurr, Michael J; Monsieurs, Pieter; Morici, Lisa; Schurr, Jill; Wilson, James W; Ott, C Mark; Tsaprailis, George; Pierson, Duane L; Stefanyshyn-Piper, Heidi; Nickerson, Cheryl A

    2011-02-01

    Assessing bacterial behavior in microgravity is important for risk assessment and prevention of infectious diseases during spaceflight missions. Furthermore, this research field allows the unveiling of novel connections between low-fluid-shear regions encountered by pathogens during their natural infection process and bacterial virulence. This study is the first to characterize the spaceflight-induced global transcriptional and proteomic responses of Pseudomonas aeruginosa, an opportunistic pathogen that is present in the space habitat. P. aeruginosa responded to spaceflight conditions through differential regulation of 167 genes and 28 proteins, with Hfq as a global transcriptional regulator. Since Hfq was also differentially regulated in spaceflight-grown Salmonella enterica serovar Typhimurium, Hfq represents the first spaceflight-induced regulator acting across bacterial species. The major P. aeruginosa virulence-related genes induced in spaceflight were the lecA and lecB lectin genes and the gene for rhamnosyltransferase (rhlA), which is involved in rhamnolipid production. The transcriptional response of spaceflight-grown P. aeruginosa was compared with our previous data for this organism grown in microgravity analogue conditions using the rotating wall vessel (RWV) bioreactor. Interesting similarities were observed, including, among others, similarities with regard to Hfq regulation and oxygen metabolism. While RWV-grown P. aeruginosa mainly induced genes involved in microaerophilic metabolism, P. aeruginosa cultured in spaceflight presumably adopted an anaerobic mode of growth, in which denitrification was most prominent. Whether the observed changes in pathogenesis-related gene expression in response to spaceflight culture could lead to an alteration of virulence in P. aeruginosa remains to be determined and will be important for infectious disease risk assessment and prevention, both during spaceflight missions and for the general public.

  5. Salmonella methodology update.

    PubMed

    Cox, N A

    1988-06-01

    This paper reviews the numerous research studies carried out at Richard Russell Agricultural Research Center over the past 10 to 15 yr that ultimately led to the Center's present methods for the isolation of Salmonella from processed broiler carcasses and poultry feed. In addition, the newer technologies that have recently evolved are discussed in complete detail. Included in these discussions are the advantages and disadvantages of the various technologies along with recommendations for making them more useful to the practicing food or poultry microbiologist.

  6. Salmonella, Shigella, and Yersinia

    PubMed Central

    Dekker, John; Frank, Karen

    2015-01-01

    Synopsis Salmonella, Shigella, and Yersinia cause a well-characterized spectrum of disease in humans, ranging from asymptomatic carriage to hemorrhagic colitis and fatal typhoidal fever. These pathogens are responsible for millions of cases of food-borne illness in the U.S. each year, with substantial costs measured in hospitalizations and lost productivity. In the developing world, illness caused by these pathogens is not only more prevalent, but is also associated with a greater case-fatality rate. Classical methods for identification rely on selective media and serology, but newer methods based on mass spectrometry and PCR show great promise for routine clinical testing. PMID:26004640

  7. Developing an international Pseudomonas aeruginosa reference panel.

    PubMed

    De Soyza, Anthony; Hall, Amanda J; Mahenthiralingam, Eshwar; Drevinek, Pavel; Kaca, Wieslaw; Drulis-Kawa, Zuzanna; Stoitsova, Stoyanka R; Toth, Veronika; Coenye, Tom; Zlosnik, James E A; Burns, Jane L; Sá-Correia, Isabel; De Vos, Daniel; Pirnay, Jean-Paul; Kidd, Timothy J; Reid, David; Manos, Jim; Klockgether, Jens; Wiehlmann, Lutz; Tümmler, Burkhard; McClean, Siobhán; Winstanley, Craig

    2013-12-01

    Pseudomonas aeruginosa is a major opportunistic pathogen in cystic fibrosis (CF) patients and causes a wide range of infections among other susceptible populations. Its inherent resistance to many antimicrobials also makes it difficult to treat infections with this pathogen. Recent evidence has highlighted the diversity of this species, yet despite this, the majority of studies on virulence and pathogenesis focus on a small number of strains. There is a pressing need for a P. aeruginosa reference panel to harmonize and coordinate the collective efforts of the P. aeruginosa research community. We have collated a panel of 43 P. aeruginosa strains that reflects the organism's diversity. In addition to the commonly studied clones, this panel includes transmissible strains, sequential CF isolates, strains with specific virulence characteristics, and strains that represent serotype, genotype or geographic diversity. This focussed panel of P. aeruginosa isolates will help accelerate and consolidate the discovery of virulence determinants, improve our understanding of the pathogenesis of infections caused by this pathogen, and provide the community with a valuable resource for the testing of novel therapeutic agents.

  8. Pseudomonas aeruginosa Dose-Response and Bathing Water Infection

    EPA Science Inventory

    Pseudomonas aeruginosa is the most commonly identified opportunistic pathogen associated with pool acquired bather disease. To better understand why this microorganism poses this protracted problem we recently appraised P. aeruginosa pool risk management. Much is known about the ...

  9. Interventions for control of Salmonella: clearance of microbial growth from rubber picker fingers.

    PubMed

    Arnold, J W; Yates, I E

    2009-06-01

    A study was conducted to determine if a surface material with antimicrobial properties combined with an effective disinfectant could achieve total clearance of bacterial contamination. Before beginning the project, new rubber picker fingers collected from 3 processing facilities were tested for endogenous microflora. Five species of bacteria common to soil and human handling were present: Bacillus amyloliquefaciens, Bacillus cereus/thuringiensis, Staphylococcus epidermidis, Staphylococcus hominis ssp. novobiosepticus, and Staphylococcus intermedius. In separate experiments, new (unused) rubber picker fingers from 3 manufacturers were exposed to broiler carcass rinses, and the kinetics of bacterial attachment to finger material was determined. Turbidity of the bacterial suspensions at varying dilutions containing picker finger sections was compared hourly with controls to evaluate inhibition. New rubber finger material from the 3 manufacturers significantly inhibited bacterial growth (P < 0.05), without the aid of antibacterial additives. We improved an assay for screening disinfectants against growth of pathogens and determined the activity of 5 disinfectant compounds. Two of the compounds were most effective against Pseudomonas aeruginosa, Listeria monocytogenes, Staphylococcus aureus, Salmonella Enteritidis, and Escherichia coli, and one of the compounds was selected for further study with Salmonella Enteritidis. Scanning electron microscopy confirmed the levels of Salmonella Enteritidis before and after treatment. The most effective compound was nontoxic and completely cleared Salmonella Enteritidis contamination from the rubber picker finger surface.

  10. Characterization of the Invasive, Multidrug Resistant Non-typhoidal Salmonella Strain D23580 in a Murine Model of Infection

    PubMed Central

    Roland, Kenneth L.; Kilbourne, Jacquelyn; Ott, C. Mark; Forsyth, Rebecca J.; Nickerson, Cheryl A.

    2015-01-01

    A distinct pathovar of Salmonella enterica serovar Typhimurium, ST313, has emerged in sub-Saharan Africa as a major cause of fatal bacteremia in young children and HIV-infected adults. D23580, a multidrug resistant clinical isolate of ST313, was previously shown to have undergone genome reduction in a manner that resembles that of the more human-restricted pathogen, Salmonella enterica serovar Typhi. It has since been shown through tissue distribution studies that D23580 is able to establish an invasive infection in chickens. However, it remains unclear whether ST313 can cause lethal disease in a non-human host following a natural course of infection. Herein we report that D23580 causes lethal and invasive disease in a murine model of infection following peroral challenge. The LD50 of D23580 in female BALB/c mice was 4.7 x 105 CFU. Tissue distribution studies performed 3 and 5 days post-infection confirmed that D23580 was able to more rapidly colonize the spleen, mesenteric lymph nodes and gall bladder in mice when compared to the well-characterized S. Typhimurium strain SL1344. D23580 exhibited enhanced resistance to acid stress relative to SL1344, which may lend towards increased capability to survive passage through the gastrointestinal tract as well as during its intracellular lifecycle. Interestingly, D23580 also displayed higher swimming motility relative to SL1344, S. Typhi strain Ty2, and the ST313 strain A130. Biochemical tests revealed that D23580 shares many similar metabolic features with SL1344, with several notable differences in the Voges-Proskauer and catalase tests, as well alterations in melibiose, and inositol utilization. These results represent the first full duration infection study using an ST313 strain following the entire natural course of disease progression, and serve as a benchmark for ongoing and future studies into the pathogenesis of D23580. PMID:26091096

  11. Characterization of the Invasive, Multidrug Resistant Non-typhoidal Salmonella Strain D23580 in a Murine Model of Infection.

    PubMed

    Yang, Jiseon; Barrila, Jennifer; Roland, Kenneth L; Kilbourne, Jacquelyn; Ott, C Mark; Forsyth, Rebecca J; Nickerson, Cheryl A

    2015-06-01

    A distinct pathovar of Salmonella enterica serovar Typhimurium, ST313, has emerged in sub-Saharan Africa as a major cause of fatal bacteremia in young children and HIV-infected adults. D23580, a multidrug resistant clinical isolate of ST313, was previously shown to have undergone genome reduction in a manner that resembles that of the more human-restricted pathogen, Salmonella enterica serovar Typhi. It has since been shown through tissue distribution studies that D23580 is able to establish an invasive infection in chickens. However, it remains unclear whether ST313 can cause lethal disease in a non-human host following a natural course of infection. Herein we report that D23580 causes lethal and invasive disease in a murine model of infection following peroral challenge. The LD50 of D23580 in female BALB/c mice was 4.7 x 10(5) CFU. Tissue distribution studies performed 3 and 5 days post-infection confirmed that D23580 was able to more rapidly colonize the spleen, mesenteric lymph nodes and gall bladder in mice when compared to the well-characterized S. Typhimurium strain SL1344. D23580 exhibited enhanced resistance to acid stress relative to SL1344, which may lend towards increased capability to survive passage through the gastrointestinal tract as well as during its intracellular lifecycle. Interestingly, D23580 also displayed higher swimming motility relative to SL1344, S. Typhi strain Ty2, and the ST313 strain A130. Biochemical tests revealed that D23580 shares many similar metabolic features with SL1344, with several notable differences in the Voges-Proskauer and catalase tests, as well alterations in melibiose, and inositol utilization. These results represent the first full duration infection study using an ST313 strain following the entire natural course of disease progression, and serve as a benchmark for ongoing and future studies into the pathogenesis of D23580.

  12. Iron-stimulated toxin production in Microcystis aeruginosa.

    PubMed Central

    Utkilen, H; Gjølme, N

    1995-01-01

    Nitrate- and phosphate-limited conditions had no effect on toxin production by Microcystis aeruginosa. In contrast, iron-limited conditions influenced toxin production by M. aeruginosa, and iron uptake was light dependent. A model for production of toxin by M. aeruginosa is proposed. PMID:7574617

  13. RalF-Mediated Activation of Arf6 Controls Rickettsia typhi Invasion by Co-Opting Phosphoinositol Metabolism

    PubMed Central

    Rennoll-Bankert, Kristen E.; Rahman, M. Sayeedur; Guillotte, Mark L.; Lehman, Stephanie S.; Beier-Sexton, Magda; Gillespie, Joseph J.

    2016-01-01

    Rickettsiae are obligate intracellular pathogens that induce their uptake into nonphagocytic cells; however, the events instigating this process are incompletely understood. Importantly, diverse Rickettsia species are predicted to utilize divergent mechanisms to colonize host cells, as nearly all adhesins and effectors involved in host cell entry are differentially encoded in diverse Rickettsia species. One particular effector, RalF, a Sec7 domain-containing protein that functions as a guanine nucleotide exchange factor of ADP-ribosylation factors (Arfs), is critical for Rickettsia typhi (typhus group rickettsiae) entry but pseudogenized or absent from spotted fever group rickettsiae. Secreted early during R. typhi infection, RalF localizes to the host plasma membrane and interacts with host ADP-ribosylation factor 6 (Arf6). Herein, we demonstrate that RalF activates Arf6, a process reliant on a conserved Glu within the RalF Sec7 domain. Furthermore, Arf6 is activated early during infection, with GTP-bound Arf6 localized to the R. typhi entry foci. The regulation of phosphatidylinositol 4-phosphate 5-kinase (PIP5K), which generates PI(4,5)P2, by activated Arf6 is instrumental for bacterial entry, corresponding to the requirement of PI(4,5)P2 for R. typhi entry. PI(3,4,5)P3 is then synthesized at the entry foci, followed by the accumulation of PI(3)P on the short-lived vacuole. Inhibition of phosphoinositide 3-kinases, responsible for the synthesis of PI(3,4,5)P3 and PI(3)P, negatively affects R. typhi infection. Collectively, these results identify RalF as the first bacterial effector to directly activate Arf6, a process that initiates alterations in phosphoinositol metabolism critical for a lineage-specific Rickettsia entry mechanism. PMID:27698019

  14. Salmonellae interactions with host processes.

    PubMed

    LaRock, Doris L; Chaudhary, Anu; Miller, Samuel I

    2015-04-01

    Salmonellae invasion and intracellular replication within host cells result in a range of diseases, including gastroenteritis, bacteraemia, enteric fever and focal infections. In recent years, considerable progress has been made in our understanding of the molecular mechanisms that salmonellae use to alter host cell physiology; through the delivery of effector proteins with specific activities and through the modulation of defence and stress response pathways. In this Review, we summarize our current knowledge of the complex interplay between bacterial and host factors that leads to inflammation, disease and, in most cases, control of the infection by its animal hosts, with a particular focus on Salmonella enterica subsp. enterica serovar Typhimurium. We also highlight gaps in our knowledge of the contributions of salmonellae and the host to disease pathogenesis, and we suggest future avenues for further study.

  15. EPA Method 1682: Salmonella spp.

    EPA Pesticide Factsheets

    Method 1682 describes procedures for analysis of solid samples (biosolids) and may be adapted for assessment of water, liquid, particulate and aerosol samples contaminated with Salmonella spp. using culture and immunoassay.

  16. Bacteriophage SP6 encodes a second tailspike protein that recognizes Salmonella enterica serogroups C2 and C3.

    PubMed

    Gebhart, Dana; Williams, Steven R; Scholl, Dean

    2017-03-10

    SP6 is a salmonella phage closely related to coliphage K1-5. K1-5 is notable in that it encodes two polysaccharide-degrading tailspike proteins, an endosialidase that allows it to infect E. coli K1, and a lyase that enables it to infect K5 strains. SP6 is similar to K1-5 except that it encodes a P22-like endorhamnosidase tailspike, gp46, allowing it to infect group B Salmonella. We show here that SP6 can also infect Salmonella serogroups C2 and C3 and that a mutation in a putative second tailspike, gp47, eliminates this specificity. Gene 47 was fused to the coding region of the N-terminal portion of the Pseudomonas aeruginosa R2 pyocin tail fiber and expressed in trans such that the fusion protein becomes incorporated into pyocin particles. These pyocins, termed AvR2-SP47, killed serogroups C2 and C3Salmonella. We conclude that SP6 encodes two tail proteins providing it a broad host range among Salmonella enterica.

  17. Salmonella isolation from hospital areas.

    PubMed Central

    Harvey, R. W.; Price, T. H.; Joynson, D. H.

    1979-01-01

    Evidence of the presence of salmonellas in a paediatric ward, a special care baby unit, a maternity unit and a hospital kitchen was obtained by culture of sewer swabs, faeces and food samples. The survey was designed to cause as little administrative interference as possible. The technical aspects of the survey did not strain laboratory facilities. Minimal secondary spread of salmonella infection was experienced. PMID:390044

  18. Risk assessment of Pseudomonas aeruginosa in water.

    PubMed

    Mena, Kristina D; Gerba, Charles P

    2009-01-01

    P. aeruginosa is part of a large group of free-living bacteria that are ubiquitous in the environment. This organism is often found in natural waters such as lakes and rivers in concentrations of 10/100 mL to >1,000/100 mL. However, it is not often found in drinking water. Usually it is found in 2% of samples, or less, and at concentrations up to 2,300 mL(-1) (Allen and Geldreich 1975) or more often at 3-4 CFU/mL. Its occurrence in drinking water is probably related more to its ability to colonize biofilms in plumbing fixtures (i.e., faucets, showerheads, etc.) than its presence in the distribution system or treated drinking water. P. aeruginosa can survive in deionized or distilled water (van der Jooij et al. 1982; Warburton et al. 1994). Hence, it may be found in low nutrient or oligotrophic environments, as well as in high nutrient environments such as in sewage and in the human body. P. aeruginosa can cause a wide range of infections, and is a leading cause of illness in immunocompromised individuals. In particular, it can be a serious pathogen in hospitals (Dembry et al. 1998). It can cause endocarditis, osteomyelitis, pneumonia, urinary tract infections, gastrointestinal infections, and meningitis, and is a leading cause of septicemia. P. aeruginosa is also a major cause of folliculitis and ear infections acquired by exposure to recreational waters containing the bacterium. In addition, it has been recognized as a serious cause of keratitis, especially in patients wearing contact lenses. P. aeruginosa is also a major pathogen in burn and cystic fibrosis (CF) patients and causes a high mortality rate in both populations (MOlina et al. 1991; Pollack 1995). P. aeruginosa is frequently found in whirlpools and hot tubs, sometimes in 94-100% of those tested at concenrations of <1 to 2,400 CFU/mL. The high concentrations found probably result from the relatively high temperatures of whirlpools, which favor the growth of P. aeruginosa, and the aeration which also

  19. Copper and quaternary ammonium cations exert synergistic bactericidal and antibiofilm activity against Pseudomonas aeruginosa.

    PubMed

    Harrison, Joe J; Turner, Raymond J; Joo, Daniel A; Stan, Michelle A; Chan, Catherine S; Allan, Nick D; Vrionis, Helen A; Olson, Merle E; Ceri, Howard

    2008-08-01

    Biofilms are slimy aggregates of microbes that are likely responsible for many chronic infections as well as for contamination of clinical and industrial environments. Pseudomonas aeruginosa is a prevalent hospital pathogen that is well known for its ability to form biofilms that are recalcitrant to many different antimicrobial treatments. We have devised a high-throughput method for testing combinations of antimicrobials for synergistic activity against biofilms, including those formed by P. aeruginosa. This approach was used to look for changes in biofilm susceptibility to various biocides when these agents were combined with metal ions. This process identified that Cu(2+) works synergistically with quaternary ammonium compounds (QACs; specifically benzalkonium chloride, cetalkonium chloride, cetylpyridinium chloride, myristalkonium chloride, and Polycide) to kill P. aeruginosa biofilms. In some cases, adding Cu(2+) to QACs resulted in a 128-fold decrease in the biofilm minimum bactericidal concentration compared to that for single-agent treatments. In combination, these agents retained broad-spectrum antimicrobial activity that also eradicated biofilms of Escherichia coli, Staphylococcus aureus, Salmonella enterica serovar Cholerasuis, and Pseudomonas fluorescens. To investigate the mechanism of action, isothermal titration calorimetry was used to show that Cu(2+) and QACs do not interact in aqueous solutions, suggesting that each agent exerts microbiological toxicity through independent biochemical routes. Additionally, Cu(2+) and QACs, both alone and in combination, reduced the activity of nitrate reductases, which are enzymes that are important for normal biofilm growth. Collectively, the results of this study indicate that Cu(2+) and QACs are effective combinations of antimicrobials that may be used to kill bacterial biofilms.

  20. Molecular detection of Rickettsia felis, Rickettsia typhi and two genotypes closely related to Bartonella elizabethae.

    PubMed

    De Sousa, Rita; Edouard-Fournier, Pierre; Santos-Silva, Margarida; Amaro, Fatima; Bacellar, Fatima; Raoult, Didier

    2006-10-01

    A total of 56 fleas were collected from mice, rats, and one hedgehog in national parks of mainland Portugal and the Madeira Island. All fleas were tested for the presence of bacteria of the genera Rickettsia and Bartonella using PCR assays. In fleas from mainland Portugal, we detected Rickettsia felis in one Archaeopsylla erinacei maura flea and in one Ctenophtalmus sp. In five Leptopsylla segnis fleas taken from rats in the Madeira Island, we identified Rickettsia typhi. In addition, in four fleas from the genera Ornithophaga and Stenoponia collect from mice and a rat in mainland Portugal, we detected the presence of two new Bartonella genotypes closely related to Bartonella elizabethae. Our findings emphasize the potential risk of flea-transmitted infections in mainland Portugal and the Madeira archipelago, and extend our knowledge of the potential flea vectors of human pathogens.

  1. Pseudomonas Aeruginosa: Resistance to the Max

    PubMed Central

    Poole, Keith

    2011-01-01

    Pseudomonas aeruginosa is intrinsically resistant to a variety of antimicrobials and can develop resistance during anti-pseudomonal chemotherapy both of which compromise treatment of infections caused by this organism. Resistance to multiple classes of antimicrobials (multidrug resistance) in particular is increasingly common in P. aeruginosa, with a number of reports of pan-resistant isolates treatable with a single agent, colistin. Acquired resistance in this organism is multifactorial and attributable to chromosomal mutations and the acquisition of resistance genes via horizontal gene transfer. Mutational changes impacting resistance include upregulation of multidrug efflux systems to promote antimicrobial expulsion, derepression of ampC, AmpC alterations that expand the enzyme's substrate specificity (i.e., extended-spectrum AmpC), alterations to outer membrane permeability to limit antimicrobial entry and alterations to antimicrobial targets. Acquired mechanisms contributing to resistance in P. aeruginosa include β-lactamases, notably the extended-spectrum β-lactamases and the carbapenemases that hydrolyze most β-lactams, aminoglycoside-modifying enzymes, and 16S rRNA methylases that provide high-level pan-aminoglycoside resistance. The organism's propensity to grow in vivo as antimicrobial-tolerant biofilms and the occurrence of hypermutator strains that yield antimicrobial resistant mutants at higher frequency also compromise anti-pseudomonal chemotherapy. With limited therapeutic options and increasing resistance will the untreatable P. aeruginosa infection soon be upon us? PMID:21747788

  2. Spaceflight Effects on Virulence of Pseudomonas Aeruginosa

    NASA Astrophysics Data System (ADS)

    Broadway, S.; Goins, T.; Crandell, C.; Richards, C.; Patel, M.; Pyle, B.

    2008-06-01

    Pseudomonas aeruginosa is an opportunistic pathogen found in the environment. It is known to infect the immunocompromised. The organism has about 25 virulence genes that play different roles in disease processes. Several exotoxin proteins may be produced, including ExoA, ExoS, ExoT and ExoY, and other virulence factors. In spaceflight, possible increased expression of P. aeruginosa virulence proteins could increase health risks for spaceflight crews who experience decreased immunity. Cultures of P. aeruginosa strains PA01 and PA103 grown on orbit on Shuttle Endeavour flight STS-123 vs. static ground controls were used for analysis. The production of ETA was quantitated using an ELISA procedure. Results showed that while flight cultures of PA103 produced slightly more ETA than corresponding ground controls, the opposite was found for PA01. While it appears that spaceflight has little effect on ETA, stimulation of other virulence factors could cause increased virulence of this organism in space flight. Similar increased virulence in spaceflight has been observed for other bacteria. This is important because astronauts may be more susceptible to opportunistic pathogens including P. aeruginosa.

  3. The decline of typhoid and the rise of non-typhoid salmonellae and fungal infections in a changing HIV landscape: bloodstream infection trends over 15 years in southern Vietnam.

    PubMed

    Nga, Tran Vu Thieu; Parry, Christopher M; Le, Thuy; Lan, Nguyen Phu Huong; Diep, To Song; Campbell, James I; Hoang, Nguyen Van Minh; Dung, Le Thi; Wain, John; Dolecek, Christiane; Farrar, Jeremy J; Chau, Nguyen Van Vinh; Hien, Tran Tinh; Day, Jeremy N; Baker, Stephen

    2012-01-01

    The etiological spectrum of bloodstream infections is variable between industrialized and developing countries and even within a defined location over time. We investigated trends in bloodstream infections at an infectious disease hospital in Ho Chi Minh City, Vietnam, from 1994-2008. Amongst 66,111 blood cultures performed, a clinically relevant pathogen was isolated in 7645 episodes (positivity rate; 116/1000 cultures). Salmonella Typhi was the predominant pathogen until 2002; however, a considerable annual decline in the proportion of S. Typhi was observed (OR 0.6993, 95% CI [0.6885, 0.7103], p<0.0001). Conversely, there was a significant increase in the proportions of non-typhoidal Salmonella (NTS), Cryptococcus neoformans and Penicillium marneffei, concurrent with increasing HIV prevalence. These data document a substantial longitudinal shift in bloodstream infection etiology in southern Vietnam. We propose such changes are related to increasing economic prosperity and HIV prevalence, and this pattern marks a substantial change in the epidemiology of invasive salmonellosis in Southeast Asia.

  4. The risk of salmonellae shedding by dogs fed Salmonella-contaminated commercial raw food diets.

    PubMed

    Finley, Rita; Ribble, Carl; Aramini, Jeff; Vandermeer, Meredith; Popa, Maria; Litman, Marcus; Reid-Smith, Richard

    2007-01-01

    Twenty-eight research dogs were enrolled to determine the prevalence of salmonellae shedding after consumption of 1 Salmonella-contaminated commercial raw food diet meal. Sixteen dogs were exposed to Salmonella-contaminated commercial raw food diets and 12 to Salmonella-free commercial raw food diets. Seven of the exposed dogs shed salmonellae 1-7 days after consumption of Salmonella-contaminated raw food diets. None of the dogs fed Salmonella-free diets shed salmonellae. No clinical signs were observed in either group. Five of the 7 dogs shed the same serotypes as those recovered from food samples used for feeding. Results showed the same serotypes and antimicrobial resistance pattern in 2 of the 7 shedders. Dogs fed Salmonella-contaminated raw food diets can shed salmonellae and may, therefore, be a source of environmental contamination potentially leading to human or animal illness.

  5. Liver Necrosis and Lethal Systemic Inflammation in a Murine Model of Rickettsia typhi Infection: Role of Neutrophils, Macrophages and NK Cells

    PubMed Central

    Papp, Stefanie; Moderzynski, Kristin; Rauch, Jessica; Heine, Liza; Kuehl, Svenja; Richardt, Ulricke; Mueller, Heidelinde; Fleischer, Bernhard; Osterloh, Anke

    2016-01-01

    Rickettsia (R.) typhi is the causative agent of endemic typhus, an emerging febrile disease that is associated with complications such as pneumonia, encephalitis and liver dysfunction. To elucidate how innate immune mechanisms contribute to defense and pathology we here analyzed R. typhi infection of CB17 SCID mice that are congenic to BALB/c mice but lack adaptive immunity. CB17 SCID mice succumbed to R. typhi infection within 21 days and showed high bacterial load in spleen, brain, lung, and liver. Most evident pathological changes in R. typhi-infected CB17 SCID mice were massive liver necrosis and splenomegaly due to the disproportionate accumulation of neutrophils and macrophages (MΦ). Both neutrophils and MΦ infiltrated the liver and harbored R. typhi. Both cell populations expressed iNOS and produced reactive oxygen species (ROS) and, thus, exhibited an inflammatory and bactericidal phenotype. Surprisingly, depletion of neutrophils completely prevented liver necrosis but neither altered bacterial load nor protected CB17 SCID mice from death. Furthermore, the absence of neutrophils had no impact on the overwhelming systemic inflammatory response in these mice. This response was predominantly driven by activated MΦ and NK cells both of which expressed IFNγ and is considered as the reason of death. Finally, we observed that iNOS expression by MΦ and neutrophils did not correlate with R. typhi uptake in vivo. Moreover, we demonstrate that MΦ hardly respond to R. typhi in vitro. These findings indicate that R. typhi enters MΦ and also neutrophils unrecognized and that activation of these cells is mediated by other mechanisms in the context of tissue damage in vivo. PMID:27548618

  6. Sampling and detection of Salmonella in eggs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The detection of Salmonella in the edible internal contents of shell eggs provides the most incontrovertible and epidemiologically relevant evidence that laying flocks might threaten consumers. Accordingly, dependable tests for Salmonella in eggs remain essential for achieving public health objectiv...

  7. Prevalence of Salmonella in Australian reptiles.

    PubMed

    Scheelings, T Franciscus; Lightfoot, Dianne; Holz, Peter

    2011-01-01

    From January 2007 until June 2008, 504 reptiles of four families and 57 species were examined for Salmonella by using cloacal or intestinal swabs. Salmonella was identified in 139 (28%) of the 504 animals tested. Of the 504 reptiles examined, 210 were captive and 294 were wild. Ninety-eight (47%) of the captive reptiles were shedding Salmonella at the time of sampling. In contrast, only 41 (14%) of the wild reptiles were shedding Salmonella. The higher prevalence of Salmonella in captive reptiles was statistically significant (P<0.0001). No Salmonella was found in 60 wild, freshwater chelonians or 48 wild southern water skinks (Eulamprus heatwolei). Our results suggest that some species of wild reptiles in Australia are not natural carriers of Salmonella and that diet and captivity may influence Salmonella excretion in other species.

  8. Antimicrobial activity of the bioactive components of essential oils from Pakistani spices against Salmonella and other multi-drug resistant bacteria

    PubMed Central

    2013-01-01

    Background The main objective of this study was the phytochemical characterization of four indigenous essential oils obtained from spices and their antibacterial activities against the multidrug resistant clinical and soil isolates prevalent in Pakistan, and ATCC reference strains. Methods Chemical composition of essential oils from four Pakistani spices cumin (Cuminum cyminum), cinnamon (Cinnamomum verum), cardamom (Amomum subulatum) and clove (Syzygium aromaticum) were analyzed on GC/MS. Their antibacterial activities were investigated by minimum inhibitory concentration (MIC) and Thin-Layer Chromatography-Bioautographic (TLC-Bioautographic) assays against pathogenic strains Salmonella typhi (D1 Vi-positive), Salmonella typhi (G7 Vi-negative), Salmonella paratyphi A, Escherichia coli (SS1), Staphylococcus aureus, Pseudomonas fluorescens and Bacillus licheniformis (ATCC 14580). The data were statistically analyzed by using Analysis of Variance (ANOVA) and Least Significant Difference (LSD) method to find out significant relationship of essential oils biological activities at p <0.05. Results Among all the tested essential oils, oil from the bark of C. verum showed best antibacterial activities against all selected bacterial strains in the MIC assay, especially with 2.9 mg/ml concentration against S. typhi G7 Vi-negative and P. fluorescens strains. TLC-bioautography confirmed the presence of biologically active anti-microbial components in all tested essential oils. P. fluorescens was found susceptible to C. verum essential oil while E. coli SS1 and S. aureus were resistant to C. verum and A. subulatum essential oils, respectively, as determined in bioautography assay. The GC/MS analysis revealed that essential oils of C. cyminum, C. verum, A. subulatum, and S. aromaticum contain 17.2% cuminaldehyde, 4.3% t-cinnamaldehyde, 5.2% eucalyptol and 0.73% eugenol, respectively. Conclusions Most of the essential oils included in this study possessed good antibacterial

  9. Screening for Salmonella in backyard chickens.

    PubMed

    Manning, Johanna; Gole, Vaibhav; Chousalkar, Kapil

    2015-06-15

    Salmonellosis is a significant zoonotic disease which has a considerable economic impact on the egg layer industry. There is limited information about the prevalence of Salmonella spp. in backyard chickens. The current study was conducted to determine the prevalence of Salmonella in backyard chickens, and the associated virulence of any serovars identified. Hundred and fifteen pooled samples from 30 backyard flocks in South Australia were screened. Four flocks tested positive for Salmonella spp. The overall Salmonella isolation rate in the current study was 10.4%. The estimated prevalence at individual bird level was 0.02% (95% CI 0.025-0.975). The serovars isolated were Salmonella Agona, Salmonella subsp 2 ser 21:z10:z6 (Wandsbek) and Salmonella Bovismorbificans. All Salmonella isolates tested positive for the prgH, orfL and spiC genes. The Salmonella subsp 2 ser 21:z10:z6 (Wandsbek) had the most antibiotic resistance, being resistant to ampicillin and cephalothin and having intermediate resistance to florphenicol. All of the Salmonella Agona had intermediate resistance to the ampicillin, while the Salmonella Bovismorbificans were susceptible to all antibiotics tested. With the increased interest of keeping backyard chickens, the current study highlights the zoonotic risk from Salmonella spp. associated with home flocks.

  10. Clearance of Pseudomonas aeruginosa from the murine gastrointestinal tract is effectively mediated by O-antigen-specific circulating antibodies.

    PubMed Central

    Pier, G B; Meluleni, G; Goldberg, J B

    1995-01-01

    The colonization of mucosal surfaces by Pseudomonas aeruginosa can lead to local or disseminated disease. Secretory immunoglobulin A (IgA) has been assumed to be responsible for preventing mucosal colonization by interfering with the binding of bacterial ligands to epithelial surface receptors. However, the efficacy of this mechanism of immunity derives little actual support from in vivo experiments. In an investigation of the role of local and systemic immunization strategies in reducing colonization of the gastrointestinal tract of mice by P. aeruginosa, the bacterial antigens that were potential targets for immune effectors promoting mucosal clearance were identified. Levels of gastrointestinal colonization were reduced when immunity to homologous O antigens, but not that to pili or flagella, was elicited. Oral vaccination with attenuated Salmonella typhimurium expressing P. aeruginosa serogroup O11 antigen elicited mucosal and serum IgA antibodies and serum IgG antibodies specific for the recombinant antigen. Oral challenge of immunized mice with P. aeruginosa serogroup O11 demonstrated protection against gastrointestinal colonization. Intraperitoneal immunization with a serogroup O11 high-molecular-weight O-polysaccharide antigen elicited only serum IgG and IgM antibodies yet was as effective as oral vaccination in protecting mice against gastrointestinal colonization. This finding was confirmed by the demonstration that intraperitoneal immunization with purified lipopolysaccharide was also protective against mucosal surface colonization. These results call into question the need for local immune effectors, particularly secretory IgA, directed at bacterial ligands for epithelial surface components, in protecting a mucosal surface from bacterial challenge. PMID:7542632

  11. An Oral Salmonella-Based Vaccine Inhibits Liver Metastases by Promoting Tumor-Specific T-Cell-Mediated Immunity in Celiac and Portal Lymph Nodes: A Preclinical Study

    PubMed Central

    Vendrell, Alejandrina; Mongini, Claudia; Gravisaco, María José; Canellada, Andrea; Tesone, Agustina Inés; Goin, Juan Carlos; Waldner, Claudia Inés

    2016-01-01

    Primary tumor excision is one of the most widely used therapies of cancer. However, the risk of metastases development still exists following tumor resection. The liver is a common site of metastatic disease for numerous cancers. Breast cancer is one of the most frequent sources of metastases to the liver. The aim of this work was to evaluate the efficacy of the orally administered Salmonella Typhi vaccine strain CVD 915 on the development of liver metastases in a mouse model of breast cancer. To this end, one group of BALB/c mice was orogastrically immunized with CVD 915, while another received PBS as a control. After 24 h, mice were injected with LM3 mammary adenocarcinoma cells into the spleen and subjected to splenectomy. This oral Salmonella-based vaccine produced an antitumor effect, leading to a decrease in the number and volume of liver metastases. Immunization with Salmonella induced an early cellular immune response in mice. This innate stimulation rendered a large production of IFN-γ by intrahepatic immune cells (IHIC) detected within 24 h. An antitumor adaptive immunity was found in the liver and celiac and portal lymph nodes (LDLN) 21 days after oral bacterial inoculation. The antitumor immune response inside the liver was associated with increased CD4+ and dendritic cell populations as well as with an inflammatory infiltrate located around liver metastatic nodules. Enlarged levels of inflammatory cytokines (IFN-γ and TNF) were also detected in IHIC. Furthermore, a tumor-specific production of IFN-γ and TNF as well as tumor-specific IFN-γ-producing CD8 T cells (CD8+IFN-γ+) were found in the celiac and portal lymph nodes of Salmonella-treated mice. This study provides first evidence for the involvement of LDLN in the development of an efficient cellular immune response against hepatic tumors, which resulted in the elimination of liver metastases after oral Salmonella-based vaccination. PMID:26973649

  12. Phagocytic and chemiluminescent responses of mouse peritoneal macrophages to living and killed Salmonella typhimurium and other bacteria

    SciTech Connect

    Tomita, T.; Blumenstock, E.; Kanegasaki, S.

    1981-06-01

    In the presence of luminol, resident as well as thioglycolate-induced and immunized macrophages emitted chemiluminescence more efficiently when the cells were exposed to living Salmonella typhimurium than when they were exposed to the same bacterium killed by ultraviolet light or heat. This phenomenon was observed whether or not the bacterium was opsonized. The different response to living and killed bacteria was also found with Escherichia coli, Pseudomonas aeruginosa, Proteus morganii, and Enterobacter aerogenes, but not with Shigella sonnei, Klebsiella pneumoniae, and Propionibacterium acnes. The results suggest that macrophages respond better to living, motile bacteria than to nonmotile or killed bacteria. The experimental results obtained with motility mutants of S. typhimurium, E. coli, and P. aeruginosa confirm that macrophages exposed to the motile bacteria emit chemiluminescence more efficiently and ingest the motile bacteria at a much faster rate than the nonmotile bacteria.

  13. Dynamic Duo—The Salmonella Cytolethal Distending Toxin Combines ADP-Ribosyltransferase and Nuclease Activities in a Novel Form of the Cytolethal Distending Toxin

    PubMed Central

    Miller, Rachel; Wiedmann, Martin

    2016-01-01

    The cytolethal distending toxin (CDT) is a well characterized bacterial genotoxin encoded by several Gram-negative bacteria, including Salmonella enterica (S. enterica). The CDT produced by Salmonella (S-CDT) differs from the CDT produced by other bacteria, as it utilizes subunits with homology to the pertussis and subtilase toxins, in place of the traditional CdtA and CdtC subunits. Previously, S-CDT was thought to be a unique virulence factor of S. enterica subspecies enterica serotype Typhi, lending to its classification as the “typhoid toxin.” Recently, this important virulence factor has been identified and characterized in multiple nontyphoidal Salmonella (NTS) serotypes as well. The significance of S-CDT in salmonellosis with regards to the: (i) distribution of S-CDT encoding genes among NTS serotypes, (ii) contributions to pathogenicity, (iii) regulation of S-CDT expression, and (iv) the public health implication of S-CDT as it relates to disease severity, are reviewed here. PMID:27120620

  14. Immunoblot studies to analyze antibody to the Rickettsia typhi group antigen in sera from patients with acute febrile cerebrovasculitis.

    PubMed Central

    Hechemy, K E; Fox, J A; Gröschel, D H; Hayden, F G; Wenzel, R P

    1991-01-01

    In 1986, an unusual syndrome of acute febrile cerebrovasculitis in the Piedmont Region of Virginia was reported. All patients had encephalopathy and prior exposure to both a sylvan environment and flea-infested animals. The initial serological studies suggested a rickettsial origin, corroborating clinical, epidemiological, and histopathological findings. Sera from four of five patients were subsequently studied by immunoblotting. Unabsorbed and absorbed sera were tested with electrophoresed and electroblotted Rickettsia typhi, Legionella bozemanii, and Proteus vulgaris OX19 antigens. The unabsorbed sera reacted with all three antigens. The P. vulgaris- and L. bozemanii-absorbed sera reacted with R. typhi only and without significantly less intensity. In contrast, the reactivity of R. typhi-absorbed sera was significantly lower with all three antigens. These results indicate that these patients had specific antibodies to a typhus group antigen. Although our findings suggest that a rickettsia of the typhus group may have caused this syndrome, no definitive diagnosis could be achieved because a rickettsial organism was not isolated. Images PMID:1723073

  15. Lactoylglutathione lyase, a critical enzyme in methylglyoxal detoxification, contributes to survival of Salmonella in the nutrient rich environment

    PubMed Central

    Chakraborty, Sangeeta; Gogoi, Mayuri; Chakravortty, Dipshikha

    2015-01-01

    Glyoxalase I which is synonymously known as lactoylglutathione lyase is a critical enzyme in methylglyoxal (MG) detoxification. We assessed the STM3117 encoded lactoylglutathione lyase (Lgl) of Salmonella Typhimurium, which is known to function as a virulence factor, due in part to its ability to detoxify methylglyoxal. We found that STM3117 encoded Lgl isomerises the hemithioacetal adduct of MG and glutathione (GSH) into S-lactoylglutathione. Lgl was observed to be an outer membrane bound protein with maximum expression at the exponential growth phase. The deletion mutant of S. Typhimurium (Δlgl) exhibited a notable growth inhibition coupled with oxidative DNA damage and membrane disruptions, in accordance with the growth arrest phenomenon associated with typical glyoxalase I deletion. However, growth in glucose minimal medium did not result in any inhibition. Endogenous expression of recombinant Lgl in serovar Typhi led to an increased resistance and growth in presence of external MG. Being a metalloprotein, Lgl was found to get activated maximally by Co2+ ion followed by Ni2+, while Zn2+ did not activate the enzyme and this could be attributed to the geometry of the particular protein-metal complex attained in the catalytically active state. Our results offer an insight on the pivotal role of the virulence associated and horizontally acquired STM3117 gene in non-typhoidal serovars with direct correlation of its activity in lending survival advantage to Salmonella spp. PMID:25517857

  16. The horizontally-acquired response regulator SsrB drives a Salmonella lifestyle switch by relieving biofilm silencing

    PubMed Central

    Desai, Stuti K; Winardhi, Ricksen S; Periasamy, Saravanan; Dykas, Michal M; Jie, Yan; Kenney, Linda J

    2016-01-01

    A common strategy by which bacterial pathogens reside in humans is by shifting from a virulent lifestyle, (systemic infection), to a dormant carrier state. Two major serovars of Salmonella enterica, Typhi and Typhimurium, have evolved a two-component regulatory system to exist inside Salmonella-containing vacuoles in the macrophage, as well as to persist as asymptomatic biofilms in the gallbladder. Here we present evidence that SsrB, a transcriptional regulator encoded on the SPI-2 pathogenicity-island, determines the switch between these two lifestyles by controlling ancestral and horizontally-acquired genes. In the acidic macrophage vacuole, the kinase SsrA phosphorylates SsrB, and SsrB~P relieves silencing of virulence genes and activates their transcription. In the absence of SsrA, unphosphorylated SsrB directs transcription of factors required for biofilm formation specifically by activating csgD (agfD), the master biofilm regulator by disrupting the silenced, H-NS-bound promoter. Anti-silencing mechanisms thus control the switch between opposing lifestyles. DOI: http://dx.doi.org/10.7554/eLife.10747.001 PMID:26880544

  17. Pseudomonas aeruginosa ventilator-associated pneumonia management.

    PubMed

    Ramírez-Estrada, Sergio; Borgatta, Bárbara; Rello, Jordi

    2016-01-01

    Ventilator-associated pneumonia is the most common infection in intensive care unit patients associated with high morbidity rates and elevated economic costs; Pseudomonas aeruginosa is one of the most frequent bacteria linked with this entity, with a high attributable mortality despite adequate treatment that is increased in the presence of multiresistant strains, a situation that is becoming more common in intensive care units. In this manuscript, we review the current management of ventilator-associated pneumonia due to P. aeruginosa, the most recent antipseudomonal agents, and new adjunctive therapies that are shifting the way we treat these infections. We support early initiation of broad-spectrum antipseudomonal antibiotics in present, followed by culture-guided monotherapy de-escalation when susceptibilities are available. Future management should be directed at blocking virulence; the role of alternative strategies such as new antibiotics, nebulized treatments, and vaccines is promising.

  18. Pseudomonas aeruginosa ventilator-associated pneumonia management

    PubMed Central

    Ramírez-Estrada, Sergio; Borgatta, Bárbara; Rello, Jordi

    2016-01-01

    Ventilator-associated pneumonia is the most common infection in intensive care unit patients associated with high morbidity rates and elevated economic costs; Pseudomonas aeruginosa is one of the most frequent bacteria linked with this entity, with a high attributable mortality despite adequate treatment that is increased in the presence of multiresistant strains, a situation that is becoming more common in intensive care units. In this manuscript, we review the current management of ventilator-associated pneumonia due to P. aeruginosa, the most recent antipseudomonal agents, and new adjunctive therapies that are shifting the way we treat these infections. We support early initiation of broad-spectrum antipseudomonal antibiotics in present, followed by culture-guided monotherapy de-escalation when susceptibilities are available. Future management should be directed at blocking virulence; the role of alternative strategies such as new antibiotics, nebulized treatments, and vaccines is promising. PMID:26855594

  19. Cryptic transposable phages of Pseudomonas aeruginosa

    SciTech Connect

    Krylov, V.N.; Mit`kina, L.N.; Pleteneva, E.A.; Aleshin, V.V.

    1995-11-01

    Frequencies of nucleotide sequences homologous to phage transposons (PT) of two species, D3112 and B3, were assessed in genomes of natural Pseudomonas aeruginosa strains by the dot-blot hybridization method. These strains were incapable of liberating viable phages on a lawn of the PA01 standard indicator strain of P. aeruginosa. It was shown that the homologies detected belong to two groups, high and intermediate, with respect to homology level. Homology patterns were classified as high when they provided signals comparable to those for hybridization in a positive control; patterns were classified as intermediate when the hybridization level was higher than the background level, but lower than in the positive control. Homologous PT sequences were designated as cryptic PT. Intact cryptic PT prophages were shown to exist in genomes of particular natural strains manifesting a higher level of hybridization. However, the growth of these phages was limited by the restriction system of strain PA01. It is possible to isolate strains maintaining the growth of some cryptic PT. These strains differed from P. aeruginosa with respect to the specificity of the restriction and modification system. Nevertheless, in most cases, the attempt to identify a novel host capable of maintaining growth of a cryptic PT failed. Natural strains often carry cryptic PT related to both known PT species, D3112 and B3. The frequency of cryptic PT is extremely high, reaching 30% in strains with a high level of homology only and up to 50% in all strains exhibiting homology. This high PT frequency is assumed to be associated with the considerable variation of P. aeruginosa. 15 refs., 1 fig., 2 tabs.

  20. Pseudomonas aeruginosa essentials: an update on investigation of essential genes.

    PubMed

    Juhas, Mario

    2015-11-01

    Pseudomonas aeruginosa is the leading cause of nosocomial infections, particularly in immunocompromised, cancer, burn and cystic fibrosis patients. Development of novel antimicrobials against P. aeruginosa is therefore of the highest importance. Although the first reports on P. aeruginosa essential genes date back to the early 2000s, a number of more sensitive genomic approaches have been used recently to better define essential genes in this organism. These analyses highlight the evolution of the definition of an 'essential' gene from the traditional to the context-dependent. Essential genes, particularly those indispensable under the clinically relevant conditions, are considered to be promising targets of novel antibiotics against P. aeruginosa. This review provides an update on the investigation of P. aeruginosa essential genes. Special focus is on recently identified P. aeruginosa essential genes and their exploitation for the development of antimicrobials.

  1. Glycerol metabolism promotes biofilm formation by Pseudomonas aeruginosa.

    PubMed

    Scoffield, Jessica; Silo-Suh, Laura

    2016-08-01

    Pseudomonas aeruginosa causes persistent infections in the airways of cystic fibrosis (CF) patients. Airway sputum contains various host-derived nutrients that can be utilized by P. aeruginosa, including phosphotidylcholine, a major component of host cell membranes. Phosphotidylcholine can be degraded by P. aeruginosa to glycerol and fatty acids to increase the availability of glycerol in the CF lung. In this study, we explored the role that glycerol metabolism plays in biofilm formation by P. aeruginosa. We report that glycerol metabolism promotes biofilm formation by both a chronic CF isolate (FRD1) and a wound isolate (PAO1) of P. aeruginosa. Moreover, loss of the GlpR regulator, which represses the expression of genes involved in glycerol metabolism, enhances biofilm formation in FRD1 through the upregulation of Pel polysaccharide. Taken together, our results suggest that glycerol metabolism may be a key factor that contributes to P. aeruginosa persistence by promoting biofilm formation.

  2. Long term persistence of inflammation in children vaccinated with Salmonella conjugate vaccine is associated with augmented Th9-Th17 cytokine.

    PubMed

    Balaji, Chinnasamy; Kevinkumar, Vijayakumar; Aravindhan, Vivekanandhan

    2017-03-01

    Vaccine induced serum cytokines not only serves as a biomarker of immunity but also serves as a reliable measure of inflammation. Long term persistence of inflammation can lead to metabolic derangement. Towards this end, in the present study, we measured levels of cytokines along with hormones (insulin, leptin and adiponectin) in children who have been vaccinated with Salmonella typhi Vi conjugate vaccine, 30months after vaccination. Vaccinated children showed a unique cytokine profile with suppressed Th1-Th2 and increased Th9-Th17 cytokines indicating immune polarization which was associated with decreased serum adiponectin (but not insulin or leptin) levels. The study gains major importance since it is a longitudinal study which reports vaccine induced long term persistence of inflammation for the first time in the high risk ethnic population.

  3. Autophagy enhances bacterial clearance during P. aeruginosa lung infection.

    PubMed

    Junkins, Robert D; Shen, Ann; Rosen, Kirill; McCormick, Craig; Lin, Tong-Jun

    2013-01-01

    Pseudomonas aeruginosa is an opportunistic bacterial pathogen which is the leading cause of morbidity and mortality among cystic fibrosis patients. Although P. aeruginosa is primarily considered an extacellular pathogen, recent reports have demonstrated that throughout the course of infection the bacterium acquires the ability to enter and reside within host cells. Normally intracellular pathogens are cleared through a process called autophagy which sequesters and degrades portions of the cytosol, including invading bacteria. However the role of autophagy in host defense against P. aeruginosa in vivo remains unknown. Understanding the role of autophagy during P. aeruginosa infection is of particular importance as mutations leading to cystic fibrosis have recently been shown to cause a blockade in the autophagy pathway, which could increase susceptibility to infection. Here we demonstrate that P. aeruginosa induces autophagy in mast cells, which have been recognized as sentinels in the host defense against bacterial infection. We further demonstrate that inhibition of autophagy through pharmacological means or protein knockdown inhibits clearance of intracellular P. aeruginosa in vitro, while pharmacologic induction of autophagy significantly increased bacterial clearance. Finally we find that pharmacological manipulation of autophagy in vivo effectively regulates bacterial clearance of P. aeruginosa from the lung. Together our results demonstrate that autophagy is required for an effective immune response against P. aeruginosa infection in vivo, and suggest that pharmacological interventions targeting the autophagy pathway could have considerable therapeutic potential in the treatment of P. aeruginosa lung infection.

  4. Mechanism of resistance to benzalkonium chloride by Pseudomonas aeruginosa.

    PubMed

    Sakagami, Y; Yokoyama, H; Nishimura, H; Ose, Y; Tashima, T

    1989-08-01

    The mechanisms of resistance of Pseudomonas aeruginosa to benzalkonium chloride (BC) were studied. The effluence of cell components was observed in susceptible P. aeruginosa by electron microscopy, but resistant P. aeruginosa seemed to be undamaged. No marked changes in cell surface potential between Escherichia coli NIHJC-2 and a spheroplast strain were found. The contents of phospholipids (PL) and fatty and neutral lipids (FNL) in the cell walls of resistant P. aeruginosa were higher than those in the cell walls of susceptible P. aeruginosa. The amounts of BC adsorbed to PL and FNL of cell walls of BC-resistant P. aeruginosa were lower than those for BC-susceptible P. aeruginosa. Fifteen species of cellular fatty acids were identified by capillary gas chromatography and gas chromatography-mass spectrometry. The ability of BC to permeate the cell wall was reduced because of the increase in cellular fatty acids. These results suggested that the resistance of P. aeruginosa to BC is mainly a result of increased in the contents of PL and FNL. In resistant P. aeruginosa, the decrease in the amount of BC adsorbed is likely to be the result of increases in the contents of PL and FNL.

  5. Mechanism of resistance to benzalkonium chloride by Pseudomonas aeruginosa.

    PubMed Central

    Sakagami, Y; Yokoyama, H; Nishimura, H; Ose, Y; Tashima, T

    1989-01-01

    The mechanisms of resistance of Pseudomonas aeruginosa to benzalkonium chloride (BC) were studied. The effluence of cell components was observed in susceptible P. aeruginosa by electron microscopy, but resistant P. aeruginosa seemed to be undamaged. No marked changes in cell surface potential between Escherichia coli NIHJC-2 and a spheroplast strain were found. The contents of phospholipids (PL) and fatty and neutral lipids (FNL) in the cell walls of resistant P. aeruginosa were higher than those in the cell walls of susceptible P. aeruginosa. The amounts of BC adsorbed to PL and FNL of cell walls of BC-resistant P. aeruginosa were lower than those for BC-susceptible P. aeruginosa. Fifteen species of cellular fatty acids were identified by capillary gas chromatography and gas chromatography-mass spectrometry. The ability of BC to permeate the cell wall was reduced because of the increase in cellular fatty acids. These results suggested that the resistance of P. aeruginosa to BC is mainly a result of increased in the contents of PL and FNL. In resistant P. aeruginosa, the decrease in the amount of BC adsorbed is likely to be the result of increases in the contents of PL and FNL. Images PMID:2506813

  6. Strain differences among Salmonella serotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Foodborne pathogens are constantly adapting to circumvent intervention strategies. The ability to detect and overcome these adaptations are critical to ensure a safe food supply. We determined genotypic and/or phenotypic differences between Salmonella recovered from broiler chicks after comingling w...

  7. Salmonella-secreted Virulence Factors

    SciTech Connect

    Heffron, Fred; Niemann, George; Yoon, Hyunjin; Kidwai, Afshan S.; Brown, Roslyn N.; McDermott, Jason E.; Smith, Richard D.; Adkins, Joshua N.

    2011-05-01

    In this short review we discuss secreted virulence factors of Salmonella, which directly affect Salmonella interaction with its host. Salmonella secretes protein to subvert host defenses but also, as discussed, to reduce virulence thereby permitting the bacteria to persist longer and more successfully disperse. The type III secretion system (TTSS) is the best known and well studied of the mechanisms that enable secretion from the bacterial cytoplasm to the host cell cytoplasm. Other secretion systems include outer membrane vesicles, which are present in all Gram-negative bacteria examined to date, two-partner secretion, and type VI secretion will also be addressed. Excellent reviews of Salmonella secreted effectors have focused on themes such as actin rearrangements, vesicular trafficking, ubiquitination, and the activities of the virulence factors themselves. This short review is based on S. Typhimurium infection of mice because it is a model of typhoid like disease in humans. We have organized effectors in terms of events that happen during the infection cycle and how secreted effectors may be involved.

  8. Pathogenesis of Salmonellosis: Salmonella Exotoxins

    DTIC Science & Technology

    1982-03-08

    enterobacteria . J. Bacteriol. 119:736-747. 48. Nozawa, R.T., T. Yokota, and S. Kuwahara. 1978. Assay method for Vibrio cholerae and Escherichia coli...and A. Nakamura. 1974. Enteropathogenic and enterotoxigenic activities on ligated gut loops in rabbits of Salmonella and some other enterobacteria

  9. Identification and characterization of salmonella serotypes using DNA spectral characteristics by fourier transform infrared (FT-IR) spectroscopy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Analysis of DNA samples of Salmonella serotypes (Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Infantis, Salmonella Heidelberg and Salmonella Kentucky) were performed using Fourier transform infrared spectroscopy (FT-IR) spectrometer by placing directly in contact with a diamond attenua...

  10. 75 FR 48973 - Draft Guidance for Industry: Prevention of Salmonella

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-12

    ... HUMAN SERVICES Food and Drug Administration Draft Guidance for Industry: Prevention of Salmonella... availability of a draft guidance entitled ``Prevention of Salmonella Enteritidis in Shell Eggs During... ``Prevention of Salmonella Enteritidis in Shell Eggs During Production, Storage, and Transportation''...

  11. Specificity of Salmonella Typhimurium strain (ATCC 14028) growth responses to Salmonella serovar-generated spent media.

    PubMed

    Calo, Juliany Rivera; Park, Si Hong; Baker, Christopher A; Ricke, Steven C

    2015-01-01

    Salmonella enterica is one of the most prevalent pathogens responsible for foodborne illness worldwide. Numerous Salmonella serovars have been associated with the consumption of a variety of products, and limiting food-borne illness due to Salmonella serovars is a continuing problem for food producers and public health. The emergence and prevalence of Salmonella serovars has been studied but the predominant serovars have varied somewhat over the years. The aims of this research were to compare the aerobic growth responses of selected predominant foodborne Salmonella serovars, and evaluate how the spent media from different serovars affects the growth of a well-characterized Salmonella Typhimurium strain. Growth responses were similar for most strains in spent media except for S. Typhimurium (ATCC 14028), which exhibited a decrease in growth in the presence of Salmonella Heidelberg (ARI-14) spent media. This research will provide a better understanding of the growth differences among several Salmonella serovars in nutrient limited spent media.

  12. The prevalence of Salmonella enteritidis and other Salmonella sp. among Canadian registered commercial chicken broiler flocks.

    PubMed Central

    Poppe, C.; Irwin, R. J.; Messier, S.; Finley, G. G.; Oggel, J.

    1991-01-01

    A nation-wide survey was conducted to estimate the prevalence of Salmonella enteritidis and other salmonellas among Canadian commercial broiler flocks. Environmental (litter and/or water) samples from 226 of 294 (76.9%) randomly selected flocks were contaminated with salmonellas. Litter samples were more often contaminated with salmonellas than water samples (47.4 v. 12.3%). Fifty different salmonella serovars were isolated. The most prevalent serovars were S. hadar, S. infantis, and S. schwarzengrund; they were isolated from samples of 98/294 (33.3%), 26/294 (8.8%), and 21/294 (7.1%) flocks, respectively. Feed samples of 39/290 (13.4%) flocks were contaminated with salmonellas. Salmonella enteritidis was isolated from the environmental samples of 9/294 (3.1%) flocks. Salmonella enteritidis phage type (PT) 8 was isolated from seven flocks, and PT 13a from two flocks. PMID:1879484

  13. Human Salmonella and Concurrent Decreased Susceptibility to Quinolones and Extended-Spectrum Cephalosporins

    PubMed Central

    Gay, Kathryn; Stevenson, Jennifer E.; Joyce, Kevin J.; Cooper, Kara L.; Omondi, Michael; Medalla, Felicita; Jacoby, George A.; Barrett, Timothy J.

    2007-01-01

    The National Antimicrobial Resistance Monitoring System monitors susceptibility among Enterobacteriaceae in humans in the United States. We studied isolates exhibiting decreased susceptibility to quinolones (nalidixic acid MIC >32 µg/mL or ciprofloxacin MIC >0.12 µg/mL) and extended-spectrum cephalosporins (ceftiofur or ceftriaxone MIC >2 µg/mL) during 1996–2004. Of non-Typhi Salmonella, 0.19% (27/14,043) met these criteria: 11 Senftenberg; 6 Typhimurium; 3 Newport; 2 Enteridis; and 1 each Agona, Haifa, Mbandaka, Saintpaul, and Uganda. Twenty-six isolates had gyrA mutations (11 at codon 83 only, 3 at codon 87 only, 12 at both). All Senftenberg isolates had parC mutations (S80I and T57S); 6 others had the T57S mutation. The Mbandaka isolate contained qnrB2. Eight isolates contained blaCMY-2; 1 Senftenberg contained blaCMY-23. One Senftenberg and 1Typhimurium isolate contained blaSHV-12; the Mbandaka isolate contained blaSHV-30. Nine Senftenberg isolates contained blaOXA-1; 1 contained blaOXA-9. Further studies should address patient outcomes, risk factors, and resistance dissemination prevention strategies. PMID:18217551

  14. Use of Attenuated but Metabolically Competent Salmonella as a Probiotic To Prevent or Treat Salmonella Infection.

    PubMed

    Sabag-Daigle, Anice; Blunk, Henry M; Gonzalez, Juan F; Steidley, Brandi L; Boyaka, Prosper N; Ahmer, Brian M M

    2016-07-01

    Salmonella enterica is among the most burdensome of foodborne disease agents. There are over 2,600 serovars that cause a range of disease manifestations ranging from enterocolitis to typhoid fever. While there are two vaccines in use in humans to protect against typhoid fever, there are none that prevent enterocolitis. If vaccines preventing enterocolitis were to be developed, they would likely protect against only one or a few serovars. In this report, we tested the hypothesis that probiotic organisms could compete for the preferred nutrient sources of Salmonella and thus prevent or treat infection. To this end, we added the fra locus, which encodes a utilization pathway for the Salmonella-specific nutrient source fructose-asparagine (F-Asn), to the probiotic bacterium Escherichia coli Nissle 1917 (Nissle) to increase its ability to compete with Salmonella in mouse models. We also tested a metabolically competent, but avirulent, Salmonella enterica serovar Typhimurium mutant for its ability to compete with wild-type Salmonella The modified Nissle strain became more virulent and less able to protect against Salmonella in some instances. On the other hand, the modified Salmonella strain was safe and effective in preventing infection with wild-type Salmonella While we tested for efficacy only against Salmonella Typhimurium, the modified Salmonella strain may be able to compete metabolically with most, if not all, Salmonella serovars, representing a novel approach to control of this pathogen.

  15. Use of Attenuated but Metabolically Competent Salmonella as a Probiotic To Prevent or Treat Salmonella Infection

    PubMed Central

    Sabag-Daigle, Anice; Blunk, Henry M.; Gonzalez, Juan F.; Steidley, Brandi L.; Boyaka, Prosper N.

    2016-01-01

    Salmonella enterica is among the most burdensome of foodborne disease agents. There are over 2,600 serovars that cause a range of disease manifestations ranging from enterocolitis to typhoid fever. While there are two vaccines in use in humans to protect against typhoid fever, there are none that prevent enterocolitis. If vaccines preventing enterocolitis were to be developed, they would likely protect against only one or a few serovars. In this report, we tested the hypothesis that probiotic organisms could compete for the preferred nutrient sources of Salmonella and thus prevent or treat infection. To this end, we added the fra locus, which encodes a utilization pathway for the Salmonella-specific nutrient source fructose-asparagine (F-Asn), to the probiotic bacterium Escherichia coli Nissle 1917 (Nissle) to increase its ability to compete with Salmonella in mouse models. We also tested a metabolically competent, but avirulent, Salmonella enterica serovar Typhimurium mutant for its ability to compete with wild-type Salmonella. The modified Nissle strain became more virulent and less able to protect against Salmonella in some instances. On the other hand, the modified Salmonella strain was safe and effective in preventing infection with wild-type Salmonella. While we tested for efficacy only against Salmonella Typhimurium, the modified Salmonella strain may be able to compete metabolically with most, if not all, Salmonella serovars, representing a novel approach to control of this pathogen. PMID:27185789

  16. Social cheating in Pseudomonas aeruginosa quorum sensing.

    PubMed

    Sandoz, Kelsi M; Mitzimberg, Shelby M; Schuster, Martin

    2007-10-02

    In a process termed quorum sensing, bacteria use diffusible chemical signals to coordinate cell density-dependent gene expression. In the human pathogen Pseudomonas aeruginosa, quorum sensing controls hundreds of genes, many of which encode extracellular virulence factors. Quorum sensing is required for P. aeruginosa virulence in animal models. Curiously, quorum sensing-deficient variants, most of which carry a mutation in the gene encoding the central quorum sensing regulator lasR, are frequently isolated from acute and chronic infections. The mechanism for their emergence is not known. Here we provide experimental evidence suggesting that these lasR mutants are social cheaters that cease production of quorum-controlled factors and take advantage of their production by the group. We detected an emerging subpopulation of lasR mutants after approximately 100 generations of in vitro evolution of the P. aeruginosa wild-type strain under culture conditions that require quorum sensing for growth. Under such conditions, quorum sensing appears to impose a metabolic burden on the proliferating bacterial cell, because quorum-controlled genes not normally induced until cessation of growth were highly expressed early in growth, and a defined lasR mutant showed a growth advantage when cocultured with the parent strain. The emergence of quorum-sensing-deficient variants in certain environments is therefore an indicator of high quorum sensing activity of the bacterial population as a whole. It does not necessarily indicate that quorum sensing is insignificant, as has previously been suggested. Thus, novel antivirulence strategies aimed at disrupting bacterial communication may be particularly effective in such clinical settings.

  17. First report of NDM-1-producing Pseudomonas aeruginosa in Egypt.

    PubMed

    Zafer, Mai Mahmoud; Amin, Mady; El Mahallawy, Hadir; Ashour, Mohammed Seif El-Din; Al Agamy, Mohamed

    2014-12-01

    This work reports the occurrence of New Delhi metallo-beta-lactamase 1 (NDM-1) in metallo-beta-lactamase-producing Pseudomonas aeruginosa in Egypt for the first time, and the presence of more than one blaMBL gene in carbapenem-resistant P. aeruginosa.

  18. Oxidation of 1-Tetradecene by Pseudomonas aeruginosa

    PubMed Central

    Markovetz, A. J.; Klug, M. J.; Forney, F. W.

    1967-01-01

    Pseudomonas aeruginosa strain Sol 20 was grown on 1-tetradecene as sole carbon source, and a vinyl-unsaturated 14-carbon monocarboxylic acid, 13-tetradecenoic acid, was identified from culture fluid. This acid was not produced when n-tetradecane served as substrate for growth. Oxidation of the methyl group represents one method of attack on the 1-alkene by this organism. Tentative identification of 2-tetradecanol indicates that an attack on the double bond is also occurring. α, ω-Dienes would not support growth. PMID:4962057

  19. Rickettsia typhi in rodents and R. felis in fleas in Yucatán as a possible causal agent of undefined febrile cases.

    PubMed

    Peniche-Lara, Gaspar; Dzul-Rosado, Karla; Pérez-Osorio, Carlos; Zavala-Castro, Jorge

    2015-01-01

    Rickettsia typhi is the causal agent of murine typhus; a worldwide zoonotic and vector-borne infectious disease, commonly associated with the presence of domestic and wild rodents. Human cases of murine typhus in the state of Yucatán are frequent. However, there is no evidence of the presence of Rickettsia typhi in mammals or vectors in Yucatán. The presence of Rickettsia in rodents and their ectoparasites was evaluated in a small municipality of Yucatán using the conventional polymerase chain reaction technique and sequencing. The study only identified the presence of Rickettsia typhi in blood samples obtained from Rattus rattus and it reported, for the first time, the presence of R. felis in the flea Polygenis odiosus collected from Ototylomys phyllotis rodent. Additionally, Rickettsia felis was detected in the ectoparasite Ctenocephalides felis fleas parasitizing the wild rodent Peromyscus yucatanicus. This study's results contributed to a better knowledge of Rickettsia epidemiology in Yucatán.

  20. Thermal inactivation of Salmonella in peanut butter.

    PubMed

    Ma, Li; Zhang, Guodong; Gerner-Smidt, Peter; Mantripragada, Vijaya; Ezeoke, Ifeoma; Doyle, Michael P

    2009-08-01

    The objective of this study was to determine the rates of thermal inactivation of three Salmonella Tennessee strains in peanut butter associated with an outbreak and to compare them to the rates of inactivation of Salmonella strains of other serotypes (Enteritidis, Typhimurium, and Heidelberg) (SSOS) and of clinical isolates of Salmonella Tennessee from sporadic cases (STSC). Commercial peanut butter was inoculated with Salmonella isolates and heated at 71, 77, 83, and 90 degrees C. The thermal inactivation curves were upwardly concave, indicating rapid death at the beginning (20 min) of heating followed by lower death rates thereafter. The first-order kinetics approach and nonlinear Weibull model were used to fit the inactivation curves and describe the rates of thermal inactivation of Salmonella in peanut butter. The calculated minimum times needed to obtain a 7-log reduction at 90 degrees C for the composited three outbreak-associated strains were significantly greater (P < 0.05) than those of SSOS and STSC. Approximately 120 min were needed to reduce the outbreak strains of Salmonella Tennessee by 7 log, whereas 86 and 55 min were needed for SSOS and STSC, respectively. These results indicate that the outbreak-associated Salmonella strains were more thermotolerant than the other Salmonella strains tested, and this greater thermal resistance was not serotype specific. Thermal treatments of peanut butter at 90 degrees C for less than 30 min are not sufficient to kill large populations (5 log CFU/g) of Salmonella in highly contaminated peanut butter.

  1. Molecular epidemiology of Pseudomonas aeruginosa in an intensive care unit.

    PubMed Central

    Döring, G.; Hörz, M.; Ortelt, J.; Grupp, H.; Wolz, C.

    1993-01-01

    Genotyping was used to analyse Pseudomonas aeruginosa isolates from sink drains and 15 intubated patients as part of a 3-month prospective study of strain transmission in a medical-surgical intensive care unit. Ninety percent of all washbasin drains were persistently contaminated with several P. aeruginosa genotypes. In 60% (9/15) of the patients, P. aeruginosa colonization or infection was hospital-acquired: P. aeruginosa strains isolated from these patients were present in hospital sinks or in other patients before their admission. Since all patients were immobile, personnel were the probable route of transmission of P. aeruginosa in the hospital. The mechanism of strain transmission from sinks to hands during hand washing was investigated in a children's hospital. When P. aeruginosa was present at densities of > 10(5)/c.f.u. per ml in sink drains, hand washing resulted in hand contamination with P. aeruginosa via aerosol generation in the majority of experiments or P. aeruginosa was detected using an air sampler above the washing basin. High P. aeruginosa cfu were present at 4.30 h in the eight sinks (5.4 x 10(5)-7.0 x 10(10) c.f.u./ml), whereas at 13.00 h P. aeruginosa c.f.u. were significantly lower (3.1 x 10(2)-8.0 x 10(5) c.f.u./ml). These data reveal that the danger of bacterial contamination of hands during hand washing is highest in the morning. The identified transmission routes demand more effective hygienic measures in hospital settings particularly concerning personnel hands and sink drains. Images Fig. 1 PMID:8519308

  2. Imported PER-1 producing Pseudomonas aeruginosa, PER-1 producing Acinetobacter baumanii and VIM-2-producing Pseudomonas aeruginosa strains in Hungary

    PubMed Central

    Szabó, Dora; Szentandrássy, Julia; Juhász, Zsuzsa; Katona, Katalin; Nagy, Károly; Rókusz, László

    2008-01-01

    Introduction Pseudomonas aeruginosa and Acinetobacter baumanii are important nosocomial pathogens with wide intrinsic resistance. However, due to the dissemination of the acquired resistance mechanisms, such as extended-spectrum beta-lactamase (ESBL) and metallo beta-lactamase (MBL) production, multidrug resistant strains have been isolated more often. Case presentation We report a case of a Hungarian tourist, who was initially hospitalized in Egypt and later transferred to Hungary. On the day of admission PER-1-producing P. aeruginosa, PER-1 producing A. baumannii, SHV-5-producing Klebsiella pneumoniae and VIM-2-producing P. aeruginosa isolates were subcultured from the patient's samples in Hungary. Comparing the pulsed-field gel electrophoresis (PFGE) patterns of the P. aeruginosa strains from the patient to the P. aeruginosa strains occurring in this hospital, we can state that the PER-1-producing P. aeruginosa and VIM-2-producing P. aeruginosa had external origin. Conclusion This is the first report of PER-1-producing P. aeruginosa,and PER-1-producing A. baumanii strains in Hungary. This case highlights the importance of spreading of the beta-lactamase-mediated resistance mechanisms between countries and continents, showing the importance of careful screening and the isolation of patients arriving from a different country. PMID:18513394

  3. Molecular Methods for Identification of Monophasic Salmonella Typhimurium Strains.

    PubMed

    Madajczak, Grzegorz; Dera-Tomaszewska, Bozena; Wasiak, Monika; Chróst, Anna; Szych, Jolanta

    2015-01-01

    Two molecular biology methods were used to differentiate Salmonella enterica 1,4,[5],12:i:- strains: "Salmonella Check&Trace microarray" (CT) and multiplex PCR (mPCR). For 92 strains in CT result "Salmonella 1,4,[5],12:i:-" were obtained. Those strains were confirmed in mPCR as monophasic fljB-lack Salmonella Typhimurium. For 17 strains, which in CT assay were recognized as Salmonella Typhimurium, the same identification was obtained in mPCR. Reference Salmonella strains: Lagos, Agama, Tsevie, Glocester and Tumodi in CT were recognized as Salmonella genovar, in mPCR--as Salmonella O:4, H:i other than Salmonella Typhimurium, the same like Salmonella Farsta, recognized incorrectly in CT as Salmonella Typhimurium.

  4. Shell-vial culture and real-time PCR applied to Rickettsia typhi and Rickettsia felis detection.

    PubMed

    Segura, Ferran; Pons, Immaculada; Pla, Júlia; Nogueras, María-Mercedes

    2015-11-01

    Murine typhus is a zoonosis transmitted by fleas, whose etiological agent is Rickettsia typhi. Rickettsia felis infection can produces similar symptoms. Both are intracellular microorganisms. Therefore, their diagnosis is difficult and their infections can be misdiagnosed. Early diagnosis prevents severity and inappropriate treatment regimens. Serology can't be applied during the early stages of infection because it requires seroconversion. Shell-vial (SV) culture assay is a powerful tool to detect Rickettsia. The aim of the study was to optimize SV using a real-time PCR as monitoring method. Moreover, the study analyzes which antibiotics are useful to isolate these microorganisms from fleas avoiding contamination by other bacteria. For the first purpose, SVs were inoculated with each microorganism. They were incubated at different temperatures and monitored by real-time PCR and classical methods (Gimenez staining and indirect immunofluorescence assay). R. typhi grew at all temperatures. R. felis grew at 28 and 32 °C. Real-time PCR was more sensitive than classical methods and it detected microorganisms much earlier. Besides, the assay sensitivity was improved by increasing the number of SV. For the second purpose, microorganisms and fleas were incubated and monitored in different concentrations of antibiotics. Gentamicin, sufamethoxazole, trimethoprim were useful for R. typhi isolation. Gentamicin, streptomycin, penicillin, and amphotericin B were useful for R. felis isolation. Finally, the optimized conditions were used to isolate R. felis from fleas collected at a veterinary clinic. R. felis was isolated at 28 and 32 °C. However, successful establishment of cultures were not possible probably due to sub-optimal conditions of samples.

  5. Control of Salmonella infections in animals and prevention of human foodborne Salmonella infections. WHO Consultation.

    PubMed Central

    1994-01-01

    In many countries the incidence of human salmonella infections has markedly increased in recent years. To discuss recent developments and current understanding on the control of salmonella infections in animals, WHO organized a Consultation on the Control of Salmonella Infections in Animals: Prevention of Foodborne Salmonella Infections in Humans, held in Jena, Germany, on 21-26 November 1993. The present article summarizes the recommendations made by the participants on the pathoimmunogenesis, diagnosis, epidemiology, and control of salmonella infections and contaminations in animal production. PMID:7867127

  6. Pathogenesis of Salmonellosis: Salmonella Exotoxins

    DTIC Science & Technology

    1982-03-08

    m • . °° • ° . •• -. . .-.-.. .. °. . - J. the enteroatoxin produced by Vibrio cholerae . A significant degree of relatedness was shown between the...Columbia, Missouri on June 1, 1978. It has been "reviewed and accepted for publication in the American Journal of Clinical Nutrition , and we expect that... cholera toxin or Salmonella antisomatic serum, but it could be simulated by high concentrations of LPS from S. typhimurium. The appearance of the

  7. Salmonella dublin abortion in cattle

    PubMed Central

    Hinton, M.

    1973-01-01

    The somatic and flagellar serum agglutinin titre were determined in paired samples obtained from seventy-seven cases of bovine abortion associated with Salmonella dublin infection. The cases could be divided into four serological groups with an active infection being demonstrated in most cases. The serum agglutination test was shown to be a relatively specific diagnostic test but was of more limited value in the retrospective identification of convalescent cases. PMID:4518345

  8. Biotransformation of myrcene by Pseudomonas aeruginosa

    PubMed Central

    2011-01-01

    Background Dihydrolinalool and terpineol are sources of fragrances that provide a unique volatile terpenoid alcohol of low toxicity and thus are widely used in the perfumery industry, in folk medicine, and in aromatherapy. They are important chemical constituents of the essential oil of many plants. Previous studies have concerned the biotransformation of limonene by Pseudomonas putida. The objective of this research was to study biotransformation of myrcene by Pseudomonas aeruginosa. The culture preparation was done using such variables as different microbial methods and incubation periods to obtain maximum cells of P. aeruginosa for myrcene biotransformation. Results It was found that myrcene was converted to dihydrolinalool and 2,6-dimethyloctane in high percentages. The biotransformation products were identified by Fourier-transform infrared spectroscopy (FT-IR), ultraviolet (UV) analysis, gas chromatography (GC), and gas chromatography-mass spectroscopy (GC-MS). Comparison of the different incubation times showed that 3 days was more effective, the major products being 2,6-dimethyloctane (90.0%) and α-terpineol (7.7%) and comprising 97.7%. In contrast, the main compounds derived for an incubation time of 1.5 days were dihydrolinalool (79.5%) and 2,6-dimethyloctane (9.3%), with a total yield of 88.8%. PMID:21609445

  9. Purification of extracellular lipase from Pseudomonas aeruginosa.

    PubMed Central

    Stuer, W; Jaeger, K E; Winkler, U K

    1986-01-01

    Lipase (triacylglycerol acylhydrolase, EC 3.1.1.3) was excreted by Pseudomonas aeruginosa PAC1R during the late logarithmic growth phase. Characterization of cell-free culture supernatants by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed the presence of significant amounts of lipopolysaccharide, part of which seemed to be tightly bound to lipase. After concentration of culture supernatants by ultrafiltration, lipase-lipopolysaccharide complexes were dissociated by treatment with EDTA-Tris buffer and subsequent sonication in the presence of the zwitterionic detergent 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. The solubilized lipase was purified by isoelectric focusing in an agarose gel containing the same detergent; the lipase activity appeared in a single peak corresponding to a distinct band in the silver-stained gel. The isoelectric point was 5.8. Analysis of purified lipase by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and scanning revealed an apparent molecular weight of 29,000 and a specific activity of 760 mu kat/mg of protein. Estimations based on these data showed that a single P. aeruginosa cell excreted about 200 molecules of lipase, each having a molecular activity of 2.2 X 10(4) per s. Images PMID:3096967

  10. Unorthodox expression of an enzyme: evidence for an untranslated region within carA from Pseudomonas aeruginosa.

    PubMed Central

    Wong, S C; Abdelal, A T

    1990-01-01

    The genes encoding carbamoylphosphate synthetase from Pseudomonas aeruginosa PAO1 were cloned in Escherichia coli. Deletion and transposition analysis determined the locations of carA, encoding the small subunit, and carB, encoding the large subunit, on the chromosomal insert. The nucleotide sequence of carA and the flanking regions was determined. The derived amino acid sequence for the small subunit of carbamoylphosphate synthetase from P. aeruginosa exhibited 68% homology with its counterparts in E. coli and Salmonella typhimurium. The derived sequences in the three organisms were essentially identical in the three polypeptide segments that are conserved in glutamine amidotransferases but showed low homology at the amino- and carboxy-terminal regions. The amino-terminal amino acid sequences were determined for the large and small subunits. The first 15 amino acids of the large subunit were identical to those derived from the carB sequence. However, comparison of the derived sequence for carA with the amino-terminal amino acid sequence for the small subunit suggested that codons 5 to 8 are not translated. The DNA sequence for the region encompassing these four codons was confirmed by direct sequencing of chromosomal DNA after amplification by the polymerase chain reaction. The mRNA sequence was also deduced by in vitro synthesis of cDNA, enzymatic amplification, and sequencing, confirming that 12 nucleotides in the 5' terminal of carA are transcribed but are not translated. Images FIG. 2 FIG. 3 FIG. 7 FIG. 8 PMID:2153657

  11. ANTIBACTERIAL ACTIVITY OF LEAF EXTRACT OF Abutilon indicum

    PubMed Central

    Poonkothai, M.

    2006-01-01

    Chloroform, ethanol and aqueous extracts of the leaves of Abutilon indicum were investigated for antibacterial activity against Bacillus subtilis, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli and Salmonella typhi. Among the various extracts, maximum antibacterial activity was exhibited by ethanol extract (14, 25, 14, 25, 17, 18 mm) followed by chloroform extract (13, 17, 8, 15, 15, 20 mm) while aqueous extract, showed no activity. PMID:22557222

  12. Subinhibitory bismuth-thiols reduce virulence of Pseudomonas aeruginosa.

    PubMed

    Wu, Chieh-Liang; Domenico, Philip; Hassett, Daniel J; Beveridge, Terry J; Hauser, Alan R; Kazzaz, Jeffrey A

    2002-06-01

    Pseudomonas aeruginosa is a common pathogen in mechanically ventilated patients and produces a wide array of virulence factors. Bismuth-thiols (BTs) are active in vitro against all bacterial lung pathogens, including P. aeruginosa. The objective of these studies was to examine the biochemical and morphologic effects of sublethal BT concentrations on P. aeruginosa and to evaluate virulence in cell culture. Bismuth-dimercaprol, at a fraction of the minimal inhibitory concentration, reduced alginate expression by 67% in P. aeruginosa, whereas subinhibitory bismuth-ethanedithiol (BisEDT) reduced alginate by 92% in P. syringae. BisEDT effects on lipopolysaccharide content and type III secreted cytoxins were examined by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Subinhibitory BisEDT reduced cell-associated lipopolysaccharide, and inhibited processing of the secreted cytotoxic protein ExoU. BisEDT-induced outer membrane blebbing and aggregation of cytoplasmic material was noted in electron microscopy. Virulence of P. aeruginosa was assessed by adherence to epithelial cells and sensitivity to serum killing. BisEDT inhibited adherence of P. aeruginosa to 16HBE14o- cells by 28% and to a collagen matrix by 53%. BisEDT-treated bacteria were also 100-fold more sensitive to serum bactericidal activity. In summary, low BT concentrations affect P. aeruginosa in a variety of ways, the combination of which may help prevent or resolve respiratory tract infection.

  13. Dynorphin Activates Quorum Sensing Quinolone Signaling in Pseudomonas aeruginosa

    PubMed Central

    Zaborina, Olga; Lepine, Francois; Xiao, Gaoping; Valuckaite, Vesta; Chen, Yimei; Li, Terry; Ciancio, Mae; Zaborin, Alex; Petroff, Elaine; Turner, Jerrold R; Rahme, Laurence G; Chang, Eugene; Alverdy, John C

    2007-01-01

    There is now substantial evidence that compounds released during host stress directly activate the virulence of certain opportunistic pathogens. Here, we considered that endogenous opioids might function as such compounds, given that they are among the first signals to be released at multiple tissue sites during host stress. We tested the ability of various opioid compounds to enhance the virulence of Pseudomonas aeruginosa using pyocyanin production as a biological readout, and demonstrated enhanced virulence when P. aeruginosa was exposed to synthetic (U-50,488) and endogenous (dynorphin) κ-agonists. Using various mutants and reporter strains of P. aeruginosa, we identified involvement of key elements of the quorum sensing circuitry such as the global transcriptional regulator MvfR and the quorum sensing-related quinolone signaling molecules PQS, HHQ, and HQNO that respond to κ-opioids. The in vivo significance of κ-opioid signaling of P. aeruginosa was demonstrated in mice by showing that dynorphin is released from the intestinal mucosa following ischemia/reperfusion injury, activates quinolone signaling in P. aeruginosa, and enhances the virulence of P. aeruginosa against Lactobacillus spp. and Caenorhabditis elegans. Taken together, these data demonstrate that P. aeruginosa can intercept opioid compounds released during host stress and integrate them into core elements of quorum sensing circuitry leading to enhanced virulence. PMID:17367209

  14. Otopathogenic Pseudomonas aeruginosa Enters and Survives Inside Macrophages

    PubMed Central

    Mittal, Rahul; Lisi, Christopher V.; Kumari, Hansi; Grati, M’hamed; Blackwelder, Patricia; Yan, Denise; Jain, Chaitanya; Mathee, Kalai; Weckwerth, Paulo H.; Liu, Xue Z.

    2016-01-01

    Otitis media (OM) is a broad term describing a group of infectious and inflammatory disorders of the middle ear. Despite antibiotic therapy, acute OM can progress to chronic suppurative otitis media (CSOM) characterized by ear drum perforation and purulent discharge. Pseudomonas aeruginosa is the most common pathogen associated with CSOM. Although, macrophages play an important role in innate immune responses but their role in the pathogenesis of P. aeruginosa-induced CSOM is not known. The objective of this study is to examine the interaction of P. aeruginosa with primary macrophages. We observed that P. aeruginosa enters and multiplies inside human and mouse primary macrophages. This bacterial entry in macrophages requires both microtubule and actin dependent processes. Transmission electron microscopy demonstrated that P. aeruginosa was present in membrane bound vesicles inside macrophages. Interestingly, deletion of oprF expression in P. aeruginosa abrogates its ability to survive inside macrophages. Our results suggest that otopathogenic P. aeruginosa entry and survival inside macrophages is OprF-dependent. The survival of bacteria inside macrophages will lead to evasion of killing and this lack of pathogen clearance by phagocytes contributes to the persistence of infection in CSOM. Understanding host–pathogen interaction will provide novel avenues to design effective treatment modalities against OM. PMID:27917157

  15. Interactions between Neutrophils and Pseudomonas aeruginosa in Cystic Fibrosis

    PubMed Central

    Rada, Balázs

    2017-01-01

    Cystic fibrosis (CF) affects 70,000 patients worldwide. Morbidity and mortality in CF is largely caused by lung complications due to the triad of impaired mucociliary clearance, microbial infections and chronic inflammation. Cystic fibrosis airway inflammation is mediated by robust infiltration of polymorphonuclear neutrophil granulocytes (PMNs, neutrophils). Neutrophils are not capable of clearing lung infections and contribute to tissue damage by releasing their dangerous cargo. Pseudomonas aeruginosa is an opportunistic pathogen causing infections in immunocompromised individuals. P. aeruginosa is a main respiratory pathogen in CF infecting most patients. Although PMNs are key to attack and clear P. aeruginosa in immunocompetent individuals, PMNs fail to do so in CF. Understanding why neutrophils cannot clear P. aeruginosa in CF is essential to design novel therapies. This review provides an overview of the antimicrobial mechanisms by which PMNs attack and eliminate P. aeruginosa. It also summarizes current advances in our understanding of why PMNs are incapable of clearing P. aeruginosa and how this bacterium adapts to and resists PMN-mediated killing in the airways of CF patients chronically infected with P. aeruginosa. PMID:28282951

  16. Mast cells protect against Pseudomonas aeruginosa-induced lung injury.

    PubMed

    Junkins, Robert D; Carrigan, Svetlana O; Wu, Zhengli; Stadnyk, Andrew W; Cowley, Elizabeth; Issekutz, Thomas; Berman, Jason; Lin, Tong-Jun

    2014-08-01

    Pseudomonas aeruginosa, an opportunistic pathogen, is the leading cause of morbidity and mortality in immune-compromised individuals. Maintaining the integrity of the respiratory epithelium is critical for an effective host response to P. aeruginosa. Given the close spatial relationship between mast cells and the respiratory epithelium, and the importance of tightly regulated epithelial permeability during lung infections, we examined whether mast cells influence airway epithelial integrity during P. aeruginosa lung infection in a mouse model. We found that mast cell-deficient Kit(W-sh)/Kit(W-sh) mice displayed greatly increased epithelial permeability, bacterial dissemination, and neutrophil accumulation compared with wild-type animals after P. aeruginosa infection; these defects were corrected on reconstitution with mast cells. An in vitro Transwell co-culture model further demonstrated that a secreted mast cell factor decreased epithelial cell apoptosis and tumor necrosis factor production after P. aeruginosa infection. Together, our data demonstrate a previously unrecognized role for mast cells in the maintenance of epithelial integrity during P. aeruginosa infection, through a mechanism that likely involves prevention of epithelial apoptosis and tumor necrosis factor production. Our understanding of mechanisms of the host response to P. aeruginosa will open new avenues for the development of successful preventative and treatment strategies.

  17. Environmental Pseudomonads Inhibit Cystic Fibrosis Patient-Derived Pseudomonas aeruginosa.

    PubMed

    Chatterjee, Payel; Davis, Elizabeth; Yu, Fengan; James, Sarah; Wildschutte, Julia H; Wiegmann, Daniel D; Sherman, David H; McKay, Robert M; LiPuma, John J; Wildschutte, Hans

    2017-01-15

    Pseudomonas aeruginosa is an opportunistic pathogen which is evolving resistance to many currently used antibiotics. While much research has been devoted to the roles of pathogenic P. aeruginosa in cystic fibrosis (CF) patients, less is known of its ecological properties. P. aeruginosa dominates the lungs during chronic infection in CF patients, yet its abundance in some environments is less than that of other diverse groups of pseudomonads. Here, we sought to determine if clinical isolates of P. aeruginosa are vulnerable to environmental pseudomonads that dominate soil and water habitats in one-to-one competitions which may provide a source of inhibitory factors. We isolated a total of 330 pseudomonads from diverse habitats of soil and freshwater ecosystems and competed these strains against one another to determine their capacity for antagonistic activity. Over 900 individual inhibitory events were observed. Extending the analysis to P. aeruginosa isolates revealed that clinical isolates, including ones with increased alginate production, were susceptible to competition by multiple environmental strains. We performed transposon mutagenesis on one isolate and identified an ∼14.8-kb locus involved in antagonistic activity. Only two other environmental isolates were observed to carry the locus, suggesting the presence of additional unique compounds or interactions among other isolates involved in outcompeting P. aeruginosa This collection of strains represents a source of compounds that are active against multiple pathogenic strains. With the evolution of resistance of P. aeruginosa to currently used antibiotics, these environmental strains provide opportunities for novel compound discovery against drug-resistant clinical strains.

  18. Field Trials of Attenuated Salmonella Typhi Live Oral Vaccine TY21A in Liquid and Enteric-Coated Capsule Formulations in Santiago, Chile

    DTIC Science & Technology

    1990-06-01

    randomized, double-blind, controlled field trial in Santiago, Chile, 81,621 school- children , 5-19 years of age, received three doses, within one week, of...liquid formulation protected young children (5-9 year olds) (vaccine efficacy 82.3%) as well as older children (> 10 years) (69.3% vaccine efficacy...while the capsules significantly protected only older children . The liquid suspension was practical to prepare by mixing lyophilized vaccine with buffer

  19. DIVA defense: Broad protection for salmonella suppression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A live, attenuated Salmonella enterica serovar Typhimurium vaccine was developed to confer broad protection against multiple Salmonella serovars to prevent disease and reduce pathogen colonization and shedding. Two vaccine trials were performed in swine to determine the protection afforded by the va...

  20. Effects of Climate Change on Salmonella Infections

    PubMed Central

    Akil, Luma; Reddy, Remata S.

    2014-01-01

    Abstract Background: Climate change and global warming have been reported to increase spread of foodborne pathogens. To understand these effects on Salmonella infections, modeling approaches such as regression analysis and neural network (NN) were used. Methods: Monthly data for Salmonella outbreaks in Mississippi (MS), Tennessee (TN), and Alabama (AL) were analyzed from 2002 to 2011 using analysis of variance and time series analysis. Meteorological data were collected and the correlation with salmonellosis was examined using regression analysis and NN. Results: A seasonal trend in Salmonella infections was observed (p<0.001). Strong positive correlation was found between high temperature and Salmonella infections in MS and for the combined states (MS, TN, AL) models (R2=0.554; R2=0.415, respectively). NN models showed a strong effect of rise in temperature on the Salmonella outbreaks. In this study, an increase of 1°F was shown to result in four cases increase of Salmonella in MS. However, no correlation between monthly average precipitation rate and Salmonella infections was observed. Conclusion: There is consistent evidence that gastrointestinal infection with bacterial pathogens is positively correlated with ambient temperature, as warmer temperatures enable more rapid replication. Warming trends in the United States and specifically in the southern states may increase rates of Salmonella infections. PMID:25496072