Science.gov

Sample records for afb1 afb2 afg1

  1. Identification of AFB1-interacting proteins and interactions between RPSA and AFB1.

    PubMed

    Zhuang, Zhenhong; Huang, Yaling; Yang, Yanling; Wang, Shihua

    2016-01-15

    A method using immobilized affinity chromatography (IAC) was developed to screen for aflatoxin B1 (AFB1)-binding proteins. AFB1 and bovine serum albumin (BSA) coupled protein (BSA-AFB1) was prepared using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride. The resulting coupled compound was immobilized onto PVDF transfer membranes, which were then incubated with total protein from mouse liver. AFB1-binding proteins were eluted, after non-specific washing, by specific elution, and the eluted proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Two candidate AFB1-binding proteins were identified by liquid chromatography-tandem mass spectrometry as the 40S ribosomal protein SA (RPSA) and a putative uncharacterized protein. RPSA and AFB1 interactions were further analyzed by ELISA in vitro and laser confocal immunofluorescence analysis in vivo. The results from ELISA and immunofluorescence showed that RPSA efficiently bound AFB1 in vitro and in vivo. This study's conclusion laid the foundation for further exploration of the role of AFB1-binding proteins in AFB1 toxicology towards hepatocytes and the entry pathway of AFB1 into hepatocytes. PMID:26372695

  2. Studies on the biological functions of CPS1 in AFB1 induced hepatocarcinogenesis.

    PubMed

    Yang, Chi; Fu, Rao; Zhuang, Zhenhong; Wang, Shihua

    2016-10-10

    Carbamyl phosphate synthetase 1 (CPS1) was down-regulated in hepatocellular carcinoma (HCC), as treated by aflatoxin B1 (AFB1), a potent hepatocarcinogenesis mycotoxin. In this study, we firstly confirmed that AFB1 down-regulated the expression of CPS1 in a dose-dependent manner. At the meantime, both siRNA knock down of CPS1 and AFB1 treatment inhibited cell proliferation, and induced cell apoptosis. To further analysis the function of CPS1, the interacting proteins of CPS1 were searched by Co-IP, and three interacting proteins including type II cytoskeletal 1 (KRT1), albumin (ALB), and ubiquitin C (UBC) were found. Both KRT1 and ALB were new interacting proteins for CPS1. Our further study showed that CPS1 was regulating interacted and colocalized with KRT1 and ALB, and the intensity correlation was changed by AFB1. KRT1, ALB and CPS1 were all reported to play an important role in differentiation and tissue specialization. These results may offer an increasing understand that CPS1 might have a function in differentiation. PMID:27425868

  3. The mammalian homologue of yeast Afg1 ATPase (lactation elevated 1) mediates degradation of nuclear-encoded complex IV subunits.

    PubMed

    Cesnekova, Jana; Rodinova, Marie; Hansikova, Hana; Houstek, Josef; Zeman, Jiri; Stiburek, Lukas

    2016-03-15

    Mitochondrial protein homeostasis is crucial for cellular function and integrity and is therefore maintained by several classes of proteins possessing chaperone and/or proteolytic activities. In the present study, we focused on characterization of LACE1 (lactation elevated 1) function in mitochondrial protein homeostasis. LACE1 is the human homologue of yeast mitochondrial Afg1 (ATPase family gene 1) ATPase, a member of the SEC18-NSF, PAS1, CDC48-VCP, TBP family. Yeast Afg1 was shown to mediate degradation of mitochondrially encoded complex IV subunits, and, on the basis of its similarity to CDC48 (p97/VCP), it was suggested to facilitate extraction of polytopic membrane proteins. We show that LACE1, which is a mitochondrial integral membrane protein, exists as part of three complexes of approximately 140, 400 and 500 kDa and is essential for maintenance of fused mitochondrial reticulum and lamellar cristae morphology. We demonstrate that LACE1 mediates degradation of nuclear-encoded complex IV subunits COX4 (cytochrome c oxidase 4), COX5A and COX6A, and is required for normal activity of complexes III and IV of the respiratory chain. Using affinity purification of LACE1-FLAG expressed in a LACE1-knockdown background, we show that the protein interacts physically with COX4 and COX5A subunits of complex IV and with mitochondrial inner-membrane protease YME1L. Finally, we demonstrate by ectopic expression of both K142A Walker A and E214Q Walker B mutants, that an intact ATPase domain is essential for LACE1-mediated degradation of nuclear-encoded complex IV subunits. Thus the present study establishes LACE1 as a novel factor with a crucial role in mitochondrial protein homeostasis. PMID:26759378

  4. Incidence and Level of Aflatoxins Contamination in Medicinal Plants in Korea

    PubMed Central

    Lee, Sung Deuk; Yu, In Sil; Jung, Kweon

    2014-01-01

    During 2011~2013, a total of 729 samples for 19 types of medicinal plant were collected from Seoulyekryungsi in Seoul, Korea, and investigated for the presence of aflatoxins. The samples were analyzed using immunoaffinity column cleanup and high-performance liquid chromatography coupled to a fluorescence detector after post-column derivatization. Aflatoxins were found in 124 out of the 729 analyzed samples: 65 containing aflatoxin B1 (AFB1), 24 with aflatoxin B2 (AFB2), 15 with aflatoxin G1 (AFG1), and 20 samples with aflatoxin G2 (AFG2). The ranges for positive samples were 0.1~404.7 µg/kg for AFB1, 0.1~10.0 µg/kg for AFB2, 0.1~635.3 µg/kg for AFG1, 0.1~182.5 µg/kg for AFG2, and 0.1~1,043.9 µg/kg for total aflatoxins. Most of the medicinal plant samples (721, 98.9%) were below legal limits, but 8 samples exceeded the legal limits of 10 and 15 µg/kg established by the Korean standard for AFB1 and total aflatoxins (the sum of AFB1, AFB2, AFG1 and AFG2), respectively. PMID:25606005

  5. Uncommon occurrence ratios of aflatoxin B1, B 2, G 1, and G 2 in maize and groundnuts from Malawi.

    PubMed

    Matumba, Limbikani; Sulyok, Michael; Njoroge, Samuel M C; Njumbe Ediage, Emmanuel; Van Poucke, Christof; De Saeger, Sarah; Krska, Rudolf

    2015-02-01

    We report an unusual aflatoxin profile in maize and groundnuts from Malawi, with aflatoxin G1 found routinely at equal or even higher levels than aflatoxin B1. Aflatoxin B1 (AFB1) ratio in a contaminated sample is generally greater than 50% of total aflatoxin (sum of aflatoxin B1, B2, G1, and G2). In Malawi, the aflatoxin occurrence ratios were determined by examining LC-MS/MS and HPLC fluorescence detection (FLD) data of 156 naturally contaminated raw maize and 80 groundnut samples collected in 2011 and 2012. Results showed that natural aflatoxin occurrence ratio differed. In 47% of the samples, the concentration of AFG1 was higher than that of AFB1. The mean concentration percentages of AFB1/AFB2/AFG1/AFG2 in reference to total aflatoxins were found to be 47:5:43:5%, respectively. The AFG1 and AFB1 50/50 trend was observed in maize and groundnuts and was consistent for samples collected in both years. If the AFB1 measurement was used to check compliance of total aflatoxin regulatory limit set at 10, 20, 100, and 200 μg/kg with an assumption that AFB1≥50% of the total aflatoxin content, 8, 13, 24, and 26% false negative rates would have occurred respectively. It is therefore important for legislation to consider total aflatoxins rather than AFB1 alone. PMID:25194830

  6. Error-prone replication bypass of the primary aflatoxin B1 DNA adduct, AFB1-N7-Gua.

    PubMed

    Lin, Ying-Chih; Li, Liang; Makarova, Alena V; Burgers, Peter M; Stone, Michael P; Lloyd, R Stephen

    2014-06-27

    Hepatocellular carcinomas (HCCs) are the third leading cause of cancer deaths worldwide. The highest rates of early onset HCCs occur in geographical regions with high aflatoxin B1 (AFB1) exposure, concomitant with hepatitis B infection. Although the carcinogenic basis of AFB1 has been ascribed to its mutagenic effects, the mutagenic property of the primary AFB1-DNA adduct, AFB1-N7-Gua, in mammalian cells has not been studied extensively. Taking advantage of the ability to create vectors containing a site-specific DNA adduct, the mutagenic potential was determined in primate cells. This adduct was highly mutagenic following replication in COS-7 cells, with a mutation frequency of 45%. The spectrum of mutations was predominantly G to T base substitutions, a result that is consistent with previous mutation data derived from aflatoxin-associated HCCs. To assess which DNA polymerases (pol) might contribute to the mutational outcome, in vitro replication studies were performed. Unexpectedly, replicative pol δ and the error-prone translesion synthesis pol ζ were able to accurately bypass AFB1-N7-Gua. In contrast, replication bypass using pol κ was shown to occur with low fidelity and could account for the commonly detected G to T transversions. PMID:24838242

  7. Determination of the aflatoxin AFB1 from corn by direct analysis in real time-mass spectrometry (DART-MS).

    PubMed

    Busman, Mark; Liu, Jihong; Zhong, Hongjian; Bobell, John R; Maragos, Chris M

    2014-01-01

    Direct analysis in real time (DART) ionisation coupled to a high-resolution mass spectrometer (MS) was used for screening of aflatoxins from a variety of surfaces and the rapid quantitative analysis of a common form of aflatoxin, AFB1, extracted from corn. Sample preparation procedure and instrument parameter settings were optimised to obtain sensitive and accurate determination of aflatoxin AFB1. 84:16 acetonitrile water extracts of corn were analysed by DART-MS. The lowest calibration level (LCL) for aflatoxin AFB1 was 4 μg kg⁻¹. Quantitative analysis was performed with the use of matrix-matched standards employing the ¹³C-labelled internal standard for AFB1. DART-MS of spiked corn extracts gave linear response in the range 4-1000 μg kg⁻¹. Good recoveries (94-110%) and repeatabilities (RSD = 0.7-6.9%) were obtained at spiking levels of 20 and 100 μg kg⁻¹ with the use of an isotope dilution technique. Trueness of data obtained for AFB1 in maize by DART-MS was demonstrated by analysis of corn certified reference materials. PMID:24588621

  8. Aptamer induced assembly of fluorescent nitrogen-doped carbon dots on gold nanoparticles for sensitive detection of AFB1.

    PubMed

    Wang, Bin; Chen, Yanfen; Wu, Yuanya; Weng, Bo; Liu, Yingshuai; Lu, Zhisong; Li, Chang Ming; Yu, Cong

    2016-04-15

    Novel fluorescent nitrogen-doped carbon dots (N,C-dots) were synthesized and assembled on aptamer modified gold nanoparticles (Aptamer/AuNPs) for the super sensitive detection of aflatoxin B1 (AFB1). Positively charged N,C-dots were synthesized by the hydrothermal treatment of pancreatin. The prepared N,C-dots were assembled on aptamer/AuNPs by electrostatic interactions. The fluorescence of the N,C-dots was efficiently quenched. When AFB1 was added to the assay solution, specific interactions between AFB1 and the aptamer caused release of the N,C-dots. The fluorescence of the N,C-dots recovered and the intensity increase could be used to calculate the amount of AFB1 added. The assay exhibits super-high sensitivity with a detection limit of 5 pg/mL (16 pM) and a wide range of linear response of 5 pg/mL to 2.00 ng/mL. A novel aptasensor is thus successfully constructed, it provides an efficient way for sensitive AFB1 sensing as well as a new technique for aptamer based novel sensor construction. PMID:26584079

  9. Immuno-physiological alterations from AFB1 in rats counteracted by treatments with Lactobacillus paracasei BEJ01 and montmorillonite clay mixture.

    PubMed

    Ben Salah-Abbès, Jalila; Jebali, Rania; Sharafi, Hakimeh; Akbari Noghabi, Kambiz; Oueslati, Ridha; Abbès, Samir

    2016-09-01

    High contamination by aflatoxin B1 (AFB1) has been detected in Beja province (Tunisia) in many dairy products and animal feed, which has resulted in many tons of cereals and cereals being removed from the market, causing economic loss. While removal represents a means of reducing risk, exposures still occur. Studies have increasingly focused on means of AFB1 biodegradation/elimination using lactic acid bacteria and clay mineral. In the study here, Lactobacillus paracasei BEJ01 (LP) and montmorilonite clay (MT) were used to reduce the physio-/immunotoxicologic disorders that could develop in rats that underwent AFB1 exposures for a total of 7 consecutive days. The results indicated that rats treated with AFB1 (80 μg/kg BW) alone had significant decreases in lymphocytes in their blood (including B-lymphocytes, CD3(+), CD4(+), and CD8(+) T-lymphocyte subtypes, and NK cells), immunoglobulins (IgA and IgG) and pro-inflammatory cytokines; these rats also had altered oxidative stress status. In contrast, in rats treated with LP + MT (2 × 10(9) cfu/ml [∼ 2 mg/kg] + 0.5 mg MT/kg BW) for a total of 7 days before, concurrent with or after AFB1 treatment, there was a significant blockade/mitigation of each AFB1-impacted parameter. Moreover, treatment with the mixture at any point in relation to AFB1 treatment expectedly caused enhanced TNFα and IL-1β expression relative to control values; all other parameters were comparable to values noted in control rats. Alone, the mixture had no impact on host parameters. From the results here it may be concluded the the LP + MT mixture was effective in protecting these hosts against AFB1-induced immunologic/physiologic disorders and that LP + MT could prevent and/or mitigate AFB1 toxicities in vivo. PMID:27294391

  10. Detection of serum AFB1-lysine adduct in Malaysia and its association with liver and kidney functions.

    PubMed

    Mohd Redzwan, S; Rosita, Jamaluddin; Mohd Sokhini, A M; Nurul 'Aqilah, A R; Wang, Jia-Sheng; Kang, Min-Su; Zuraini, Ahmad

    2014-01-01

    Aflatoxin is ubiquitously found in many foodstuffs and produced by Aspergillus species of fungi. Of many aflatoxin metabolites, AFB1 is classified by the International Agency for Research on Cancer (IARC) as group one carcinogen and linked to the development of hepatocellular carcinoma (HCC). The study on molecular biomarker of aflatoxin provides a better assessment on the extent of human exposure to aflatoxin. In Malaysia, the occurrences of aflatoxin-contaminated foods have been documented, but there is a lack of data on human exposure to aflatoxin. Hence, this study investigated the occurrence of AFB1-lysine adduct in serum samples and its association with liver and kidney functions. 5ml fasting blood samples were collected from seventy-one subjects (n=71) for the measurement of AFB1-lysine adduct, albumin, total bilirubin, AST (aspartate aminotransferase), ALT (alanine transaminase), ALP (alkaline phosphatase), GGT (gamma-glutamyl transpeptidase), creatinine and BUN (blood urea nitrogen). The AFB1-lysine adduct was detected in all serum samples (100% detection rate) with a mean of 6.85±3.20pg/mg albumin (range: 1.13-18.85pg/mg albumin). Male subjects (mean: 8.03±3.41pg/mg albumin) had significantly higher adduct levels than female subjects (mean: 5.64±2.46pg/mg albumin) (p<0.01). It was noteworthy that subjects with adduct levels greater than average (>6.85pg/mg albumin) had significantly elevated level of total bilirubin (p<0.01), GGT (p<0.05) and creatinine (p<0.01). Nevertheless, only the level of total bilirubin, (r=0.347, p-value=0.003) and creatinine (r=0.318, p-value=0.007) showed significant and positive correlation with the level of AFB1-lysine adduct. This study provides a valuable insight on human exposure to aflatoxin in Malaysia. Given that aflatoxin can pose serious problem to the health, intervention strategies should be implemented to limit/reduce human exposure to aflatoxin. Besides, a study with a big sample size should be warranted in

  11. Label Free QCM Immunobiosensor for AFB1 Detection Using Monoclonal IgA Antibody as Recognition Element.

    PubMed

    Ertekin, Özlem; Öztürk, Selma; Öztürk, Zafer Ziya

    2016-01-01

    This study introduces the use of an IgA isotype aflatoxin (AF) specific monoclonal antibody for the development of a highly sensitive Quartz Crystal Microbalance (QCM) immunobiosensor for the detection of AF in inhibitory immunoassay format. The higher molecular weight of IgA antibodies proved an advantage over commonly used IgG antibodies in label free immunobiosensor measurements. IgA and IgG antibodies with similar affinity for AF were used in the comparative studies. Sensor surface was prepared by covalent immobilization of AFB1, using self assembled monolayer (SAM) formed on gold coated Quartz Crystal, with 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide/N-hydroxy succinimide (EDC/NHS) method using a diamine linker. Nonspecific binding to the surface was decreased by minimizing the duration of EDC/NHS activation. Sensor surface was chemically blocked after AF immobilization without any need for protein blocking. This protein free sensor chip endured harsh solutions with strong ionic detergent at high pH, which is required for the regeneration of the high affinity antibody-antigen interaction. According to the obtained results, the detection range with IgA antibodies was higher than IgG antibodies in QCM immunosensor developed for AFB1. PMID:27529243

  12. Calcium montmorillonite clay reduces AFB1 and FB1 biomarkers in rats exposed to single and co-exposures of aflatoxin and fumonisin

    PubMed Central

    Mitchell, Nicole J.; Xue, Kathy S.; Lin, Shuhan; Marroquin-Cardona, Alicia; Brown, Kristal A.; Elmore, Sarah E.; Tang, Lili; Romoser, Amelia; Gelderblom, Wentzel C. A.; Wang, Jia-Sheng; Phillips, Timothy D.

    2014-01-01

    Aflatoxins (AFs) and fumonisins (FBs) can co-contaminate foodstuffs and have been associated with hepatocellular and esophageal carcinomas in humans at high risk for exposure. One strategy to reduce exposure (and toxicity) from contaminated foodstuffs is the dietary inclusion of a montmorillonite clay (UPSN) that binds AFs and FBs in the GI tract. In this study, the binding capacity of UPSN was evaluated for AFB1, FB1 and a combination thereof in Fischer-344 rats. Rats were pre-treated with different dietary levels of UPSN (0.25 or 2%) for 1 week. Rats were gavaged with a single dose of either 0.125 mg AFB1 or 25 mg FB1/kg b.w. and a combination thereof in the presence and absence of an aqueous solution of UPSN. The kinetics of mycotoxin excretion were monitored by analyzing serum AFB1-albumin, urinary AF (AFM1), and FB1 biomarkers over a period of 72 hr. UPSN decreased AFM1 excretion by 88-97%, indicating highly effective binding. FB1 excretion was reduced, to a lesser extent, ranging between 45 to 85%. When in combination, both AFB1 and FB1 binding occurred, but capacity was decreased by almost half. In the absence of UPSN, the combined AFB1 and FB1 treatment decreased the urinary biomarkers by 67 and 45% respectively, but increased levels of AFB1-albumin, presumably by modulating its cytochrome metabolism. UPSN significantly reduced bioavailability of both AFB1 and FB1 when in combination; suggesting that it can be utilized to reduce levels below their respective thresholds for affecting adverse biological effects. PMID:24193864

  13. Production of Group Specific Monoclonal Antibody to Aflatoxins and its Application to Enzyme-linked Immunosorbent Assay.

    PubMed

    Kim, Sung-Hee; Cha, Sang-Ho; Karyn, Bischoff; Park, Sung-Won; Son, Seong-Wan; Kang, Hwan-Goo

    2011-06-01

    Through the present study, we produced a monoclonal antibody against aflatoxin B1 (AFB1) using AFB1- carboxymethoxylamine BSA conjugates. One clone showing high binding ability was selected and it was applied to develop a direct competitive ELISA system. The epitope densities of AFB1-CMO against BSA and KLH were about 1 : 6 and 1 : 545, respectively. The monoclonal antibody (mAb) from cloned hybridoma cell was the IgG1 subclass with λ-type light chains. The IC50s of the monoclonal antibody developed for AFB1, AFB2, AFG1 and AFG2 were 4.36, 7.22, 6.61 and 29.41 ng/ml, respectively, based on the AFB1-KLH coated ELISA system and 15.28, 26.62, 32.75 and 56.67 ng/ml, respectively, based on the mAb coated ELISA. Cross-relativities of mAb to AFB1 for AFB2, AFG1 and AFG2 were 60.47, 65.97 and 14.83% in the AFB1-KLH coated ELISA, and 59.41, 46.66 and 26.97% in the mAb coated ELISA, respectively. Quantitative calculations for AFB1 from the AFB1-Ab ELISA and AFB1-Ag ELISA ranged from 0.25 to 25 ng/ml (R(2) > 0.99) and from 1 to 100 ng/ml (R(2) > 0.99), respectively. The intra- and inter-assay precision CVs were < 10% in both ELISA assay, representing good reproducibility of developed assay. Recoveries ranged from 79.18 to 91.27%, CVs ranged from 3.21 to 7.97% after spiking AFB1 at concentrations ranging from 5 to 50 ng/ml and following by extraction with 70% methanol solution in the Ab-coated ELISA. In conclusion, we produced a group specific mAb against aflatoxins and developed two direct competitive ELISAs for the detection of AFB1 in feeds based on a monoclonal antibody developed. PMID:24278561

  14. Production of Group Specific Monoclonal Antibody to Aflatoxins and its Application to Enzyme-linked Immunosorbent Assay

    PubMed Central

    Kim, Sung-Hee; Cha, Sang-Ho; Karyn, Bischoff; Park, Sung-Won; Son, Seong-Wan

    2011-01-01

    Through the present study, we produced a monoclonal antibody against aflatoxin B1 (AFB1) using AFB1- carboxymethoxylamine BSA conjugates. One clone showing high binding ability was selected and it was applied to develop a direct competitive ELISA system. The epitope densities of AFB1-CMO against BSA and KLH were about 1 : 6 and 1 : 545, respectively. The monoclonal antibody (mAb) from cloned hybridoma cell was the IgG1 subclass with λ-type light chains. The IC50s of the monoclonal antibody developed for AFB1, AFB2, AFG1 and AFG2 were 4.36, 7.22, 6.61 and 29.41 ng/ml, respectively, based on the AFB1-KLH coated ELISA system and 15.28, 26.62, 32.75 and 56.67 ng/ml, respectively, based on the mAb coated ELISA. Cross-relativities of mAb to AFB1 for AFB2, AFG1 and AFG2 were 60.47, 65.97 and 14.83% in the AFB1-KLH coated ELISA, and 59.41, 46.66 and 26.97% in the mAb coated ELISA, respectively. Quantitative calculations for AFB1 from the AFB1-Ab ELISA and AFB1-Ag ELISA ranged from 0.25 to 25 ng/ml (R2 > 0.99) and from 1 to 100 ng/ml (R2 > 0.99), respectively. The intra- and inter-assay precision CVs were < 10% in both ELISA assay, representing good reproducibility of developed assay. Recoveries ranged from 79.18 to 91.27%, CVs ranged from 3.21 to 7.97% after spiking AFB1 at concentrations ranging from 5 to 50 ng/ml and following by extraction with 70% methanol solution in the Ab-coated ELISA. In conclusion, we produced a group specific mAb against aflatoxins and developed two direct competitive ELISAs for the detection of AFB1 in feeds based on a monoclonal antibody developed. PMID:24278561

  15. Monoclonal IgA Antibodies for Aflatoxin Immunoassays

    PubMed Central

    Ertekin, Özlem; Pirinçci, Şerife Şeyda; Öztürk, Selma

    2016-01-01

    Antibody based techniques are widely used for the detection of aflatoxins which are potent toxins with a high rate of occurrence in many crops. We developed a murine monoclonal antibody of immunoglobulin A (IgA) isotype with a strong binding affinity to aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2) and aflatoxin M1 (AFM1). The antibody was effectively used in immunoaffinity column (IAC) and ELISA kit development. The performance of the IACs was compatible with AOAC performance standards for affinity columns (Test Method: AOAC 991.31). The total binding capacity of the IACs containing our antibody was 111 ng, 70 ng, 114 ng and 73 ng for AFB1, AFB2, and AFG1 andAFG2, respectively. Furthermore, the recovery rates of 5 ng of each AF derivative loaded to the IACs were determined as 104.9%, 82.4%, 85.5% and 70.7% for AFB1, AFB2, AFG1 and AFG2, respectively. As for the ELISA kit developed using non-oriented, purified IgA antibody, we observed a detection range of 2–50 µg/L with 40 min total test time. The monoclonal antibody developed in this research is hitherto the first presentation of quadruple antigen binding IgA monoclonal antibodies in mycotoxin analysis and also the first study of their utilization in ELISA and IACs. IgA antibodies are valuable alternatives for immunoassay development, in terms of both sensitivity and ease of preparation, since they do not require any orientation effort. PMID:27187470

  16. Monoclonal IgA Antibodies for Aflatoxin Immunoassays.

    PubMed

    Ertekin, Özlem; Pirinçci, Şerife Şeyda; Öztürk, Selma

    2016-01-01

    Antibody based techniques are widely used for the detection of aflatoxins which are potent toxins with a high rate of occurrence in many crops. We developed a murine monoclonal antibody of immunoglobulin A (IgA) isotype with a strong binding affinity to aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2) and aflatoxin M1 (AFM1). The antibody was effectively used in immunoaffinity column (IAC) and ELISA kit development. The performance of the IACs was compatible with AOAC performance standards for affinity columns (Test Method: AOAC 991.31). The total binding capacity of the IACs containing our antibody was 111 ng, 70 ng, 114 ng and 73 ng for AFB1, AFB2, and AFG1 andAFG2, respectively. Furthermore, the recovery rates of 5 ng of each AF derivative loaded to the IACs were determined as 104.9%, 82.4%, 85.5% and 70.7% for AFB1, AFB2, AFG1 and AFG2, respectively. As for the ELISA kit developed using non-oriented, purified IgA antibody, we observed a detection range of 2-50 µg/L with 40 min total test time. The monoclonal antibody developed in this research is hitherto the first presentation of quadruple antigen binding IgA monoclonal antibodies in mycotoxin analysis and also the first study of their utilization in ELISA and IACs. IgA antibodies are valuable alternatives for immunoassay development, in terms of both sensitivity and ease of preparation, since they do not require any orientation effort. PMID:27187470

  17. Acute effects of aflatoxins on guinea pig isolated ileum.

    PubMed

    Luzi, A; Cometa, M F; Palmery, M

    2002-10-01

    Previous studies on the aflatoxins have focused mainly on their chronic toxic effects. In this study we investigated the acute gastrointestinal effects of four common aflatoxins on isolated guinea pig ileum. AFB(1) (EC(50) 4.6+/-0.4 microM) and AFB(2) (EC(50)17+/-4.4 microM) contracted isolated guinea pig ileum in a dose-dependent manner, whereas AFG(1) and AFG(2) evoked no contractions. Atropine (5.9 nM 11.8 and 23.6 nM) antagonized AFB(1)-induced contractions in a dose-dependent manner. Pretreatment with the nicotinic ganglionic blocker, hexamethonium (up to 55 microM), left AFB(1)-induced contractions unchanged. In contrast, tetrodotoxin (0.3 microM), blocked AFB(1) contractile activity. The two inhibitors of ACh release, morphine (0.3 microM) and clonidine (0.4 microM), antagonized EC(50) AFB(1)-induced contractions, and apamin, a drug that increases neuronal excitability, facilitated the EC(50) AFB(1)-induced contractile effect. The choline uptake blocker, hemicholinium (17.4 microM) markedly reduced AFB(1)-induced contractions. These results suggest that aflatoxins induce their contractile effect indirectly through the cholinergic system by stimulating acetylcholine release from the postganglionic parasympathetic nerve endings. The acute actions of aflatoxins on isolated guinea pig ileum could explain their acute gastrointestinal effects in humans and animals. PMID:12206819

  18. Embryotoxicity assay of aflatoxin produced by Aspergillus parasiticus NRRL 2999.

    PubMed

    Celik, I; Oğuz, H; Demet, O; Boydak, M; Dönmez, H H; Sur, E; Nizamlioğlu, F

    2000-09-01

    1. The embryotoxicity of mixed aflatoxins (AF) and aflatoxin B1 (AFB1) were evaluated by a modified chick embryotoxicity screening test (CHEST). Adverse effects on the early embryonic development of thymus and bursa of Fabricius were also investigated by light microscopy. AF consisted of 83.06% AFB1, 12.98% AFB2, 2.84% AFG1 and 1.12% AFG2. 2. A total of 448 fertilised laying hens' eggs were used. AF and AFB1 were injected into the eggs at doses of 10, 100 and 1000 ng/egg. Embryonic developmental stages were evaluated according to the Hamburger-Hamilton scale (HH-scale). 3. The results showed that AFB1 given at 10 ng/egg had a significantly (P<0.05) greater embryotoxic effect than AF given at a similar dose. The higher doses of both AF and AFB1 caused higher embryonic mortality and also an increase in early deaths. 4. In the groups receiving 100 ng/egg AF and AFB1 an abnormal development was seen, with a protruded central region, corresponding to the area pellucida of the blastoderm. No other developmental abnormality attributable to AF or AFB1 was found. PMID:11128380

  19. Simultaneous detection of multiple mycotoxins in broiler feeds using a liquid chromatography tandem-mass spectrometry.

    PubMed

    Kongkapan, Jutamart; Poapolathep, Saranya; Isariyodom, Supaporn; Kumagai, Susumu; Poapolathep, Amnart

    2016-03-01

    Mycotoxins are secondary fungal metabolites that are typically present in grain and feed ingredients used for animal feeds. An analytical method using LC-ESI-MS/MS was developed to quantify nine mycotoxins, consisting of aflatoxin B1 (AFB1), AFB2, AFG1, AFG2, T-2 toxin, deoxynivalenol (DON), nivalenol (NIV), zearalenone (ZEA) and ochratoxin A (OTA) in broiler feeds. In total, 100 samples of broiler feeds were collected from poultry farms in Central Thailand. The survey found that AFB1 and ZEA were the most prevalent mycotoxins in the feed samples at percentages of 93% and 63%, respectively. The limit of detections (LODs) of investigated mycotoxins was 0.20-0.78 ng/g. AFB2, DON, AFG1, NIV and T-2 toxin were also detectable at low contamination levels with percentages of 20%, 9%, 7%, 5% and 1%, respectively, whereas OTA and AFG2 were not detected in any of the feed samples. These results suggest that there is a very low level of risk of the exposure to mycotoxins in feeds obtained from broiler farms in Central Thailand. PMID:26477362

  20. Simultaneous detection of multiple mycotoxins in broiler feeds using a liquid chromatography tandem-mass spectrometry

    PubMed Central

    KONGKAPAN, Jutamart; POAPOLATHEP, Saranya; ISARIYODOM, Supaporn; KUMAGAI, Susumu; POAPOLATHEP, Amnart

    2015-01-01

    Mycotoxins are secondary fungal metabolites that are typically present in grain and feed ingredients used for animal feeds. An analytical method using LC-ESI-MS/MS was developed to quantify nine mycotoxins, consisting of aflatoxin B1 (AFB1), AFB2, AFG1, AFG2, T-2 toxin, deoxynivalenol (DON), nivalenol (NIV), zearalenone (ZEA) and ochratoxin A (OTA) in broiler feeds. In total, 100 samples of broiler feeds were collected from poultry farms in Central Thailand. The survey found that AFB1 and ZEA were the most prevalent mycotoxins in the feed samples at percentages of 93% and 63%, respectively. The limit of detections (LODs) of investigated mycotoxins was 0.20–0.78 ng/g. AFB2, DON, AFG1, NIV and T-2 toxin were also detectable at low contamination levels with percentages of 20%, 9%, 7%, 5% and 1%, respectively, whereas OTA and AFG2 were not detected in any of the feed samples. These results suggest that there is a very low level of risk of the exposure to mycotoxins in feeds obtained from broiler farms in Central Thailand. PMID:26477362

  1. Microfluidic chip-based nano-liquid chromatography tandem mass spectrometry for quantification of aflatoxins in peanut products.

    PubMed

    Liu, Hsiang-Yu; Lin, Shu-Ling; Chan, Shan-An; Lin, Tzuen-Yeuan; Fuh, Ming-Ren

    2013-09-15

    Aflatoxins (AFs), a group of mycotoxins, are generally produced by fungi Aspergillus species. The naturally occurring AFs including AFB1, AFB2, AFG1, and AFG2 have been clarified as group 1 human carcinogen by International Agency for Research on Cancer. Developing a sensitive analytical method has become an important issue to accurately quantify trace amount of AFs in foodstuffs. In this study, we employed a microfluidic chip-based nano LC (chip-nanoLC) coupled to triple quadrupole mass spectrometer (QqQ-MS) system for the quantitative determination of AFs in peanuts and related products. Gradient elution and multiple reaction monitoring were utilized for chromatographic separation and MS measurements. Solvent extraction followed by immunoaffinity solid-phase extraction was employed to isolate analytes and reduce matrix effect from sample prior to chip-nanoLC/QqQ-MS analysis. Good recoveries were found to be in the range of 90.8%-100.4%. The linear range was 0.048-16 ng g(-1) for AFB1, AFB2, AFG1, AFG2 and AFM1. Limits of detection were estimated as 0.004-0.008 ng g(-1). Good intra-day/inter-day precision (2.3%-9.5%/2.3%-6.6%) and accuracy (96.1%-105.7%/95.5%-104.9%) were obtained. The applicability of this newly developed chip-nanoLC/QqQ-MS method was demonstrated by determining the AFs in various peanut products purchased from local markets. PMID:23708626

  2. Aflatoxins and ochratoxin a reduction in black and white pepper by gamma radiation

    NASA Astrophysics Data System (ADS)

    Jalili, M.; Jinap, S.; Noranizan, M. A.

    2012-11-01

    Irradiation is an important means of decontamination of food commodities, especially spices. The aim of the current study was to investigate the efficacy of gamma radiation (60Co) for decontaminating ochratoxin A (OTA) and aflatoxins B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) residues in artificially contaminated black and white pepper samples. The moisture content of the pepper samples was set at 12% or 18%, and the applied gamma dose ranged from 5 to 30 kGy. Mycotoxin levels were determined by high-performance liquid chromatography (HPLC) after immunoaffinity column (IAC) chromatography. Both the gamma irradiation dose and moisture content showed significant effects (P<0.05) on mycotoxin reduction. The maximum toxin reductions, found at 18% moisture content and 30 kGy, were 55.2%, 50.6%, 39.2%, 47.7% and 42.9% for OTA, AFB1, AFB2, AFG1 and AFG2, respectively.

  3. Mycoflora and Co-Occurrence of Fumonisins and Aflatoxins in Freshly Harvested Corn in Different Regions of Brazil

    PubMed Central

    Rocha, Liliana O.; Nakai, Viviane K.; Braghini, Raquel; Reis, Tatiana A.; Kobashigawa, Estela; Corrêa, Benedito

    2009-01-01

    Natural mycoflora and co-occurrence of fumonisins (FB1, FB2) and aflatoxins (AFB1, AFB2, AFG1 and AFG2) in freshly harvested corn grain samples from four regions of Brazil were investigated. Fusarium verticillioides was predominant in all samples. Analysis of fumonisins showed that 98% of the samples were contaminated with FB1 and 74.5% with FB1 + FB2, with toxin levels ranging from 0.015 to 9.67 μg/g for FB1 and from 0.015 to 3.16 μg/g for FB2. Twenty-one (10.5%) samples were contaminated with AFB1, seven (3.5%) with AFB2 and only one (0.5%) with AFG1 and AFG2 Co-contamination with aflatoxins and fumonisins was observed in 7% of the samples. The highest contamination of fumonisins and aflatoxins was observed in Nova Odessa (SP) and Várzea Grande (MT), respectively. The lowest contamination of these mycotoxins was found in Várzea Grande and Nova Odessa, respectively. PMID:20087478

  4. Mycobiota and Mycotoxins in Traditional Medicinal Seeds from China

    PubMed Central

    Chen, Amanda Juan; Jiao, Xiaolin; Hu, Yongjian; Lu, Xiaohong; Gao, Weiwei

    2015-01-01

    The multi-mycotoxin occurrence for internal and superficial fungi contamination were comprehensively assessed in medicinal seeds used as food or beverage. Based on a polyphasic approach using morphological characters, β-tubulin and ITS gene blast, a total of 27 species belonging to 12 genera were identified from surface-sterilized seeds. Chaetomium globosporum was most predominant (23%), followed by Microascus trigonosporus (12%) and Alternaria alternata (9%). With respect to superficial mycobiota, thirty-four species belonging to 17 genera were detected. Aspergillus niger and Penicillium polonicum were predominant (12% and 15%, respectively). Medicinal seed samples and potential toxigenic fungi were tested for ochratoxin A (OTA) and aflatoxins (AFB1, AFB2, AFG1, AFG2) using UPLC-MS/MS. Platycladi seeds were contaminated with AFB1 (52.0 µg/kg) and tangerine seed was contaminated with OTA (92.3 µg/kg). Subsequent analysis indicated that one A. flavus strain isolated from platycladi seed was able to synthesize AFB1 (102.0 µg/kg) and AFB2 (15.3 µg/kg). Two P. polonicum strains isolated from tangerine and lychee seeds were able to synthesize OTA (4.1 µg/kg and 14.8 µg/kg, respectively). These results identify potential sources of OTA and aflatoxins in medicinal seeds and allude to the need to establish permitted limits for these mycotoxins in these seeds that are commonly consumed by humans. PMID:26404373

  5. [Determination of aflatoxin B1, B2, G1, G2 in armeniacae semen amarum by high-performance liquid chromatography-tandem mass spectrometry].

    PubMed

    Zheng, Run-Sheng; Xu, Hui; Wang, Wen-Li; Zhan, Ruo-Ting; Chen, Wei-Wen

    2013-10-01

    A simple, rapid and cost-effective high-performance liquid chromatography-tandem mass spectrometry (LC-MS/ MS) method was established for simultaneous determination of aflatoxins (AFB1, AFB2, AFG1, AFG2) in Armeniacae Semen Amarum and the application was performance in 11 samples collected from different markets, medical stores and hospitals. The sample was extracted with 84% acetonitrile/water and 250 microL extraction was directly injected into a LC-MS/MS system without further purification procedure after being redissolved with methanol. The LC separation was performed on a C18 column with a linear gradient elution program of 4 mmol x L(-1) NH4 Ac-0.1% formic acid solution and menthol as the mobile phase. Selected reaction monitoring (SRM) was used for selective determination of the four aflatoxins on a triple quadruple mass spectrometer, which was operated in positive ionization modes. All the four aflatoxins showed a good linear relationship with r > 0.999 0, the average recoveries were between 87.88% and 102.9% and the matrix effect was ranged from 90.71% to 99.30% in low, intermediate and high levels. Furthermore, the higher recovery was obtained by the method reported in this study, comparing to the cleanup procedure with the Mycosep 226 purification column. Eleven samples collected were detected and the contamination levels of the AFB1 were between 1.590-2.340 microg x kg(-1) and the AF (B1 + B2 + G1 + G2) was ranged from 2.340 to 3.340 microg x kg(-1). In summary, the developed method was suitable to detect and screen AFB1, AFB2, AFG1, AFG2 in Armeniacae Semen Amarum. PMID:24490568

  6. Aflatoxins and ochratoxin A in stored barley grain in Spain and impact of PCR-based strategies to assess the occurrence of aflatoxigenic and ochratoxigenic Aspergillus spp.

    PubMed

    Mateo, Eva M; Gil-Serna, Jéssica; Patiño, Belén; Jiménez, Misericordia

    2011-09-15

    Contamination of barley by moulds and mycotoxins results in quality and nutritional losses and represents a significant hazard to the food chain. The presence of aflatoxin B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) and ochratoxin A (OTA) in stored barley in Spain has been studied. Species-specific PCR assays were used for detection of Aspergillus flavus, A. parasiticus, A. ochraceus, A. steynii, A. westerdijkiae, A. carbonarius and A. niger aggregate in mycotoxin-positive barley samples at different incubation times (0, 1 and 2 days). Classical enumeration techniques (CFU/g) in different culture media for evaluation of Aspergillus in sections Flavi, Circumdati and Nigri were also used. One hundred and five barley kernel samples were collected in Spanish grain stores from 2008 to 2010, and analyzed using a previously optimized method involving accelerated solvent extraction, cleanup by immunoaffinity column, liquid chromatographic separation, post-column derivatization with iodine and fluorescence detection. Twenty-nine samples were contaminated with at least one of the studied mycotoxins. AFB1, AFB2, AFG1, AFG2, and OTA were detected in 12.4%, 2.9%, 4.8%, 2.9%, and 20% of the samples, respectively. Aflatoxins and OTA co-occurred in 4.8% of the samples. Maximum mycotoxin levels (ng/g) were 0.61 (AFB1), 0.06 (AFB2), 0.26 (AFG1), 0.05 (AFG2), and 2.0 (OTA). The results of PCR assays indicated the presence of all the studied species, except A. westerdijkiae. The PCR assays showed high levels of natural contamination of barley with the studied species of Aspergillus which do not correspond to the expected number of CFU/g in the cultures. These results suggest that a high number of non-viable spores or hyphae may exist in the samples. This is the first study carried out on the levels of aflatoxins and OTA in barley grain in Spain. Likewise, this is the first report on the presence of aflatoxigenic and ochratoxigenic Aspergillus spp. in barley grain naturally

  7. Determination of aflatoxins B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil using immunoaffinity column cleanup, postcolumn derivatization, and liquid chromatography/fluorescence detection: collaborative study.

    PubMed

    Bao, Lei; Liang, Chengzhu; Trucksess, Mary W; Xu, Yanli; Lv, Ning; Wu, Zhenxing; Jing, Ping; Fry, Fred S

    2012-01-01

    The accuracy, repeatability, and reproducibility characteristics of a method using immunoaffinity column (IAC) cleanup with postcolumn derivatization and LC with a fluorescence detector (FLD) for determination of aflatoxins (AFs; sum of AFs B1, B2, G1, and G2) in olive oil, peanut oil, and sesame oil have been established in a collaborative study involving 15 laboratories from six countries. Blind duplicate samples of blank, spiked at levels ranging from 0.25 to 20.0 microg/kg for AF, were analyzed. A naturally contaminated peanut oil sample was also included. Test samples were extracted with methanol-water (55 + 45, v/v). After shaking and centrifuging, the lower layer was filtered, diluted with water, and filtered through glass microfiber filter paper. The filtrate was then passed through an IAC, and the toxins were eluted with methanol. The toxins were then subjected to RPLC-FLD analysis after postcolumn derivatization. Average recoveries of AFs from olive oil, peanut oil, and sesame oil ranged from 84 to 92% (at spiking levels ranging from 2.0 to 20.0 microg/kg); of AFB1 from 86 to 93% (at spiking levels ranging from 1.0 to 10.0 microg/kg); of AFB2 from 89 to 95% (at spiking levels ranging from 0.25 to 2.5 microg/kg); of AFG1 from 85 to 97% (at spiking levels ranging from 0.5 to 5.0 microg/kg); and of AFG2 from 76 to 85% (at spiking levels ranging from 0.25 to 2.5 microg/kg). RSDs for within-laboratory repeatability (RSD(r)) ranged from 3.4 to 10.2% for AF, from 3.5 to 10.9% for AFB1, from 3.2 to 9.5% for AFB2, from 6.5 to 14.9% for AFG1, and from 4.8 to 14.2% for AFG2. RSDs for between-laboratory reproducibility (RSDR) ranged from 6.1 to 14.5% for AF, from 7.5 to 15.4% for AFB1, from 7.1 to 14.6% for AFB2, from 10.8 to 18.1% for AFG1, and from 7.6 to 23.7% for AFG2. Horwitz ratio values were < or = 2 for the analytes in the three matrixes. PMID:23451385

  8. Development and validation of a high-performance liquid chromatography method with post-column derivatization for the detection of aflatoxins in cereals and grains.

    PubMed

    Asghar, Muhammad Asif; Iqbal, Javed; Ahmed, Aftab; Khan, Mobeen Ahmed; Shamsuddin, Zuzzer Ali; Jamil, Khalid

    2016-06-01

    A novel, reliable and rapid high-performance liquid chromatography (HPLC) method with post-column derivatization was developed and validated. The HPLC method was used for the simultaneous determination of aflatoxin B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) in various cereals and grains. Samples were extracted with 80:20 (v/v) methanol:water and purified using C18 (40-63 μm) solid-phase extraction cartridges. AFs were separated using a LiChroCART-RP-18 (5 μm, 250 × 4.0 mm(2)) column. The mobile phase consisted of methanol:acetonitrile:buffer (17.5:17.5:65 v/v) (pH 7.4) delivered at the flow rate of 1.0 mL min(-1) The fluorescence of each AF was detected at λex = 365 nm and λem = 435 nm. All four AFs were properly resolved within the total run time of 20 min. The established method was extensively validated as a final verification of the method development by the evaluation of selectivity (AFB1, AFB2, AFG1 and AFG2), linearity (R(2) ≥ 0.9994), precision (average SD ≤ 2.79), accuracy (relative mean error ≤ -5.51), robustness (p < 0.0080), ruggedness (p < 0.0100) and average recoveries (89.2-97.8%). The limits of quantification of AFB1, AFB2, AFG1 and AFG2 were 0.080, 0.073, 0.062 and 0.066 ng g(-1), respectively. Finally, the developed method was applied for the analysis of AFs in 45 samples comprising rice (n = 20), wheat (n = 15) and maize (n = 10). The results showed that 65% of rice, 20% of wheat and 80% of maize samples were found contaminated with AFs. Thus, according to the achieved results, it is suggested that the newly developed HPLC method could be effectively applied for the routine analysis of the AFs in different cereals and grains. PMID:25227226

  9. Aflatoxin levels and exposure assessment of Spanish infant cereals.

    PubMed

    Hernández-Martínez, Raquel; Navarro-Blasco, Iñigo

    2010-01-01

    Aflatoxins (AFB1, AFB2, AFG1 and AFG2) are immunosuppressant, mutagenic, teratogenic and carcinogenic agents with a widespread presence in foodstuffs. Since human exposure to aflatoxins occurs primarily by contaminated food intake, and given the greater susceptibility of infants to their adverse effects, the quantification of these mycotoxins in infant food based on cereals is of relevance. Aflatoxin levels were determined in 91 Spanish infant cereals classified in terms of non- and organically produced and several types from 10 different manufacturers, using a extraction procedure followed by inmunoaffinity column clean-up step and HPLC with fluorescence detection (FLD) and post-column derivatisation (Kobra Cell system). Daily aflatoxin intake was also assessed. Preliminary analysis showed a valuable incidence of detected infant cereal samples at an upper concentration level than the detection limit for total aflatoxin (66%), corresponding to a 46, 40, 34 and 11% for AFB1, AFB2, AFG1 and AFG2, respectively. Lower aflatoxin values (median, Q1, Q3) in conventional infant cereal (n = 74, AFB1: AFB2: n.d. (n.d.; 0.01), AFG1: AFB1: 0.02 (0.02; 0.21), AFB2: n.d. (n.d.; 0.03), AFG1: 0.02 (0.01; 0.05), and AFG2: 0.007 (n.d.; 0.02) and AFtotal: 0.05 (0.03; 0.31 µg kg(-1)) were found. In addition, five organic formulations (3.11, 1.98, 0.94, 0.47 and 0.21 µg kg(-1)) exceeded European AFB1 legislation (0.10 µg kg(-1)) versus two conventional cereals (0.35 and 0.12 µg kg(-1)). According to the type of infant cereal, those with cocoa had the highest aflatoxin levels. Gluten-free and cereals with dehydrated fruits had an intermediate level and milk- or honey-based cereals and multi-cereals contained the lowest levels. With the exception of the non-compliant cocoa-based organic formulation

  10. Survey of aflatoxins in maize tortillas from Mexico City.

    PubMed

    Castillo-Urueta, Pável; Carvajal, Magda; Méndez, Ignacio; Meza, Florencia; Gálvez, Amanda

    2011-01-01

    In Mexico, maize tortillas are consumed on a daily basis, leading to possible aflatoxin exposure. In a survey of 396 2-kg samples, taken over four sampling days in 2006 and 2007 from tortilla shops and supermarkets in Mexico City, aflatoxin levels were quantified by HPLC. In Mexico, the regulatory limit is 12 µg kg⁻¹ total aflatoxins for maize tortillas. In this survey, 17% of tortillas contained aflatoxins at levels of 3-385 µg kg⁻¹ or values below the limit of quantification (12 µg kg⁻¹ and 87% were below the regulatory limit. Average aflatoxin concentrations in 56 contaminated samples were: AFB1 (12.1 µg kg⁻¹); AFB2 (2.7 µg kg⁻¹); AFG1 (64.1 µg kg⁻¹) and AFG2 (3.7 µg kg⁻¹), and total AF (20.3 µg kg⁻¹). PMID:24779661

  11. Development and application of a method for the analysis of 9 mycotoxins in maize by HPLC-MS/MS.

    PubMed

    Wang, Yutang; Xiao, Chunxia; Guo, Jing; Yuan, Yahong; Wang, Jianguo; Liu, Laping; Yue, Tianli

    2013-11-01

    A reliable and sensitive liquid chromatography/tandem mass spectrometry (LC-MS/MS) method was developed for the simultaneous determination of aflatoxins (AFB1 , AFB2 , AFG1 , and AFG2 ), ochratoxin A (OTA), deoxynivalenol (DON), zearalenone (ZEA), fumonisin B1 (FB1 ), and T2-toxin in maize. The samples were first extracted using acetonitrile: water: acetic acid (79 : 20 : 1), and then further cleaned-up using OASIS HLB cartridge. Optimum conditions for the extraction and chromatographic separation were investigated. The mean recoveries of mycotoxins in spiked maize ranged from 68.3% to 94.3%. Limits of detection and quantification ranged from 0.01 to 0.64 μg/kg and from 0.03 to 2.12 μg/kg, respectively. The LC-MS/MS method has also been successfully applied to 60 maize samples, which were collected from Shaanxi Province of China. Twenty-four of the total 60 samples (40%) were contaminated with at least 1 of these 9 mycotoxins. Occurrence of mycotoxins were 6.7%, 1.7%, 3.3%, 6.7%, 1.7%, 23.3%, and 3.3% for AFB1 , AFB2 , OTA, ZEA, DON, FB1 , and T2-toxin, respectively. The results demonstrated that the procedure was suitable for the simultaneous determination of these mycotoxins in maize matrix. PMID:24245893

  12. [Determination of aflatoxins in cereals and oils by liquid chromatography-triple quadrupole tandem mass spectrometry].

    PubMed

    Wang, Xiupin; Li, Peiwu; Yang, Yang; Zhang, Wen; Zhang, Qi; Fan, Sufang; Yu, Li; Wang, Lin; Chen, Xiaomei; Li, Ying; Jiang, Jun

    2011-06-01

    The high performance liquid chromatography (HPLC)-triple quadrupole tandem mass spectrometry was applied for the determination of the aflatoxins: B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2), in cereals and oils. The samples were first extracted by ultrasonic method. The optimized conditions of ultrasonic extraction were as follows: temperature of 50 degrees C, extraction time of 3 min, methanol-water (containing 40 g/L NaCl) (80: 20, v/v) solution as the medium and a ratio of sample to solvent of 1 : 3 (g: mL). The extracts were then purified using an immunoaffinity column. The separation was performed on a C18 column with mobile phases of 10 mmol/L ammonium acetate and methanol in gradient elution. The sensitive detection of the four AFT compounds by electrospray ionization mass spectrometry (ESI-MS) was carried out in selected reaction monitoring (SRM) mode with aflatoxin M1 (AFM1) as the internal standard. Under the optimized conditions, the limits of detection of AFB1, AFB2, AFG1 and AFG2 were 0.002, 0.004, 0.004 and 0.012 microg/kg, respectively. The recoveries of aflatoxins in different spiked cereals and oils were in the range from 87% to 111%. The intra-day and inter-day precisions were not more than 6.7% and 5.6%, respectively. In comparison with the external standard method, this method can effectively inhibit the matrix effects, and greatly improve the accuracy. PMID:22032163

  13. Determination for multiple mycotoxins in agricultural products using HPLC-MS/MS via a multiple antibody immunoaffinity column.

    PubMed

    Zhang, Zhaowei; Hu, Xiaofeng; Zhang, Qi; Li, Peiwu

    2016-05-15

    Mycotoxins usually found in agricultural products such as peanut, corn, and wheat, are a serious threat to human health and their detection requires multiplexed and sensitive analysis methods. Herein, a simultaneous determination for aflatoxin B1, B2, G1, G2, ochratoxin A, zearalanone and T-2 toxin was investigated using high performance liquid chromatography coupled with tandem mass spectrometry in a single run via a home-made multiple immunoaffinity column. Four monoclonal antibodies were produced in our lab against aflatoxins, ochratoxin A, zearalanone and T-2 toxin, respectively, then combined as a pool and bound to Sepharose-4B for affinity chromatography. Seven mycotoxins were effectively extracted from the agricultural product samples by using acetonitrile/water/acetic acid (80:19:1, v/v/v) Then, the extraction was cleanup by multiple immunoaffinity column. This method demonstrated a considerable linear range of 0.30-25, 0.12-20, 0.30-20, 0.12-20, 0.60-30, 0.30-25, and 1.2-40μgkg(-1)and lower limits of detection at 0.1, 0.04, 0.1, 0.04, 0.2, 0.1 and 0.4μgkg(-1) for AFB1, AFB2, AFG1, AFG2, OTA, ZEN and T-2, respectively, in comparison with previously reported methods, as well as excellent recoveries. The mIAC capacity for AFB1, AFB2, AFG1, AFG2, OTA, ZEN, and T-2 were 187, 181, 153, 151, 105, 130, 88ng, respectively. It was found that all of the 7 mycotoxins were present in 90 agricultural product samples. The proposed method meets the requirements for rapid sample preparation and highly sensitive identification of multiple mycotoxins in agricultural product and food safety. This method provides a promising alternative with high throughput and high sensitivity for rapid analysis of seven mycotoxins in the monitoring of food safety. PMID:26948441

  14. Banana peel: an effective biosorbent for aflatoxins.

    PubMed

    Shar, Zahid Hussain; Fletcher, Mary T; Sumbal, Gul Amer; Sherazi, Syed Tufail Hussain; Giles, Cindy; Bhanger, Muhammad Iqbal; Nizamani, Shafi Muhammad

    2016-05-01

    This work reports the application of banana peel as a novel bioadsorbent for in vitro removal of five mycotoxins (aflatoxins (AFB1, AFB2, AFG1, AFG2) and ochratoxin A). The effect of operational parameters including initial pH, adsorbent dose, contact time and temperature were studied in batch adsorption experiments. Scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR) and point of zero charge (pHpzc) analysis were used to characterise the adsorbent material. Aflatoxins' adsorption equilibrium was achieved in 15 min, with highest adsorption at alkaline pH (6-8), while ochratoxin has not shown any significant adsorption due to surface charge repulsion. The experimental equilibrium data were tested by Langmuir, Freundlich and Hill isotherms. The Langmuir isotherm was found to be the best fitted model for aflatoxins, and the maximum monolayer coverage (Q0) was determined to be 8.4, 9.5, 0.4 and 1.1 ng mg(-1) for AFB1, AFB2, AFG1 and AFG2 respectively. Thermodynamic parameters including changes in free energy (ΔG), enthalpy (ΔH) and entropy (ΔS) were determined for the four aflatoxins. Free energy change and enthalpy change demonstrated that the adsorption process was exothermic and spontaneous. Adsorption and desorption study at different pH further demonstrated that the sorption of toxins was strong enough to sustain pH changes that would be experienced in the gastrointestinal tract. This study suggests that biosorption of aflatoxins by dried banana peel may be an effective low-cost decontamination method for incorporation in animal feed diets. PMID:27052947

  15. OsTIR1 and OsAFB2 Downregulation via OsmiR393 Overexpression Leads to More Tillers, Early Flowering and Less Tolerance to Salt and Drought in Rice

    PubMed Central

    Ou, Xiaojin; Fang, Zhongming; Tian, Changen; Duan, Jun; Wang, Yaqin; Zhang, Mingyong

    2012-01-01

    The microRNA miR393 has been shown to play a role in plant development and in the stress response by targeting mRNAs that code for the auxin receptors in Arabidopsis. In this study, we verified that two rice auxin receptor gene homologs (OsTIR1 and OsAFB2) could be targeted by OsmiR393 (Os for Oryza sativa). Two new phenotypes (increased tillers and early flowering) and two previously observed phenotypes (reduced tolerance to salt and drought and hyposensitivity to auxin) were observed in the OsmiR393-overexpressing rice plants. The OsmiR393-overexpressing rice demonstrated hyposensitivity to synthetic auxin-analog treatments. These data indicated that the phenotypes of OsmiR393-overexpressing rice may be caused through hyposensitivity to the auxin signal by reduced expression of two auxin receptor genes (OsTIR1 and OsAFB2). The expression of an auxin transporter (OsAUX1) and a tillering inhibitor (OsTB1) were downregulated by overexpression of OsmiR393, which suggested that a gene chain from OsmiR393 to rice tillering may be from OsTIR1 and OsAFB2 to OsAUX1, which affected the transportation of auxin, then to OsTB1, which finally controlled tillering. The positive phenotypes (increased tillers and early flowering) and negative phenotypes (reduced tolerance to salt and hyposensitivity to auxin) of OsmiR393-overexpressing rice present a dilemma for molecular breeding. PMID:22253868

  16. Occurrence of mycotoxins in refrigerated pizza dough and risk assessment of exposure for the Spanish population.

    PubMed

    Quiles, Juan Manuel; Saladino, Federica; Mañes, Jordi; Fernández-Franzón, Mónica; Meca, Giuseppe

    2016-08-01

    Mycotoxins are toxic metabolites produced by filamentous fungi, as Aspergillus, Penicillium and Fusarium. The first objective of this research was to study the presence of mycotoxins in 60 samples of refrigerated pizza dough, by extraction with methanol and determination by liquid chromatography associated with tandem mass spectrometry (LC-MS/MS). Then, the estimated dietary intakes (EDIs) of these mycotoxins, among the Spanish population, was calculated and the health risk assessment was performed, comparing the EDIs data with the tolerable daily intake values (TDIs). The mycotoxins detected in the analyzed samples were aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), zearalenone (ZEA), enniatin A (ENA), enniatin A1 (ENA1), enniatin (ENB), enniatin B1 (ENB1) and BEA (beauvericin) with average concentration of the positive samples of 4.09 μg/kg, 0.50 μg/kg, 0.79 μg/kg, 77.78 μg/kg, 14.96 μg/kg, 4.54 μg/kg, 3.37 μg/kg, 1.69 μg/kg and 22.39 μg/kg, respectively. The presence of ZEA, ENA1, ENB and ENB1 was detected in 100% of the samples, AFB2 in 32%, AFB1 in 23%, ENA in 8% and BEA in 3%. Twelve percent of the samples contaminated with AFB1 and 12% of the doughs contaminated with ZEA exceeded the EU legislated maximum limits. The dietary intakes were estimated considering three different age groups of population, and the EDIs calculated for the mycotoxins detected in the samples were all below the established TDI. PMID:27222027

  17. Reduction of Aflatoxins in Apricot Kernels by Electronic and Manual Color Sorting

    PubMed Central

    Zivoli, Rosanna; Gambacorta, Lucia; Piemontese, Luca; Solfrizzo, Michele

    2016-01-01

    The efficacy of color sorting on reducing aflatoxin levels in shelled apricot kernels was assessed. Naturally-contaminated kernels were submitted to an electronic optical sorter or blanched, peeled, and manually sorted to visually identify and sort discolored kernels (dark and spotted) from healthy ones. The samples obtained from the two sorting approaches were ground, homogenized, and analysed by HPLC-FLD for their aflatoxin content. A mass balance approach was used to measure the distribution of aflatoxins in the collected fractions. Aflatoxin B1 and B2 were identified and quantitated in all collected fractions at levels ranging from 1.7 to 22,451.5 µg/kg of AFB1 + AFB2, whereas AFG1 and AFG2 were not detected. Excellent results were obtained by manual sorting of peeled kernels since the removal of discolored kernels (2.6%–19.9% of total peeled kernels) removed 97.3%–99.5% of total aflatoxins. The combination of peeling and visual/manual separation of discolored kernels is a feasible strategy to remove 97%–99% of aflatoxins accumulated in naturally-contaminated samples. Electronic optical sorter gave highly variable results since the amount of AFB1 + AFB2 measured in rejected fractions (15%–18% of total kernels) ranged from 13% to 59% of total aflatoxins. An improved immunoaffinity-based HPLC-FLD method having low limits of detection for the four aflatoxins (0.01–0.05 µg/kg) was developed and used to monitor the occurrence of aflatoxins in 47 commercial products containing apricot kernels and/or almonds commercialized in Italy. Low aflatoxin levels were found in 38% of the tested samples and ranged from 0.06 to 1.50 μg/kg for AFB1 and from 0.06 to 1.79 μg/kg for total aflatoxins. PMID:26797635

  18. Phytohormone levels in germinating seeds of Zea mays L. exposed to selenium and aflatoxines.

    PubMed

    Ağar, Güleray; Türker, Musa; Battal, Peyami; Emre, Erez M

    2006-07-01

    Seeds of Zea mays L. were exposed to aflatoxine B1 (AFB1), aflatoxine G1 (AFG1) and selenium (Se) alone and in combination and allowed to germinate. Phytohormone levels of GA-like substances (GAs), trans-Zeatin (t-Z) and Indole-3-acetic acid (IAA) were determined by High Performance Liquid Chromatography (HPLC) when the roots of the germinating seeds reach 1.5-3.0 cm in length. The levels of endogenous hormones decreased in seeds treated with AFB1 and AFG1 compared to control; however an increase was noted in seeds exposed to AFG1 and Se together. AFB1 and Se treatment caused reduced hormone levels in most of the treatments. When plants were exposed to Se alone, the highest levels of GAs, t-Z and IAA were observed in the application of 800 ppm Se. The highest levels of GAs, t-Z and IAA were observed when seeds were treated with 0.2 ppm AFG1 + 8 ppm Se, 0.2 ppm AFG1 + 8 ppm Se and 0.2 ppm AFG1 + 0.08 ppm Se, respectively, whereas the lowest levels of the hormones were observed in 0.2 ppm AFB1 + 8 ppm Se, 0.2 ppm AFB1 + 0.08 ppm Se and 0.1 ppm AFB1, respectively. In conclusion, the levels of phytohormones were reduced by the treatment of AFB1 and AFG1 alone. However Se removed the negative effect of AFB1 on phytohormones, but not AFB1. PMID:16636889

  19. Simultaneous multi-mycotoxin determination in nutmeg by ultrasound-assisted solid-liquid extraction and immunoaffinity column clean-up coupled with liquid chromatography and on-line post-column photochemical derivatization-fluorescence detection.

    PubMed

    Kong, Wei-Jun; Liu, Shu-Yu; Qiu, Feng; Xiao, Xiao-He; Yang, Mei-Hua

    2013-05-01

    A simple and sensitive analytical method based on ultrasound-assisted solid-liquid extraction and immunoaffinity column clean-up coupled with high performance liquid chromatography and on-line post-column photochemical derivatization-fluorescence detection (USLE-IAC-HPLC-PCD-FLD) has been developed for simultaneous multi-mycotoxin determination of aflatoxins B1, B2, G1, G2 (AFB1, AFB2, AFG1, AFG2) and ochratoxin A (OTA) in 13 edible and medicinal nutmeg samples marketed in China. AFs and OTA were extracted from nutmeg samples by ultrasonication using a methanol : water (80 : 20, v/v) solution, followed by an IAC clean-up step. Different USL extraction conditions, pre-processing ways for nutmeg sample and clean-up columns for mycotoxins, as well as HPLC-PCD-FLD parameters (mobile phase, column temperature, elution procedure, excitation and emission wavelengths) were optimized. This method, which was appraised for analyzing nutmeg samples, showed satisfactory results with reference to limits of detection (LODs) (from 0.02 to 0.25 μg kg(-1)), limits of quantification (LOQs) (from 0.06 to 0.8 μg kg(-1)), linear ranges (up to 30 ng mL(-1) for AFB1, AFG1 and OTA and 9 ng mL(-1) for AFB2 and AFG2), intra- and inter-day variability (all <2%) and average recoveries (from 79.6 to 90.8% for AFs and from 93.6 to 97.3% for OTA, respectively). The results of the application of developed method in nutmeg samples have elucidated that four samples were detected with contamination of AFs and one with OTA. AFB1 was the most frequently found mycotoxin in 30.8% of nutmeg samples at contamination levels of 0.73-16.31 μg kg(-1). At least two different mycotoxins were co-occurred in three samples, and three AFs were simultaneously detected in one sample. PMID:23486692

  20. Use of multitoxin immunoaffinity columns for determination of aflatoxins and ochratoxin A in ginseng and ginger.

    PubMed

    Trucksess, Mary W; Weaver, Carol M; Oles, Carolyn J; Rump, Lydia V; White, Kevin D; Betz, Joseph M; Rader, Jeanne I

    2007-01-01

    Conditions were optimized for the simultaneous, alkaline, aqueous methanol extraction of aflatoxins (AFL), i.e., B1 (AFB1), B2 (AFB2), G1 (AFG1), and G2 (AFG2), and ochratoxin A (OTA) with subsequent purification, isolation, and determination of the toxins in ginseng and ginger. Powdered roots were extracted with methanol-0.5% NaHCO3 solution (7 + 3). After shaking and centrifugation, the supernatant was diluted with 100 mM phosphate buffer containing 1% Tween 20 and filtered through glass microfiber filter paper. The filtrate was then passed through an immunoaffinity column, and the toxins were eluted with methanol. The AFL were separated and determined by reversed-phase liquid chromatography (RPLC) with fluorescence detection after postcolumn UV photochemical derivatization. OTA was separated and determined by RPLC with fluorescence detection. Recoveries of AFL added at 2-16 ng/g and OTA added at 1-8 ng/g to ginseng were 72-80 and 86-95%, respectively. Recoveries of AFL and OTA added to ginger were similar to those for ginseng. A total of 39 commercially available ginger products from 6 manufacturers were analyzed. Twenty-six samples were found to be contaminated with AFL at 1-31 ng/g and 29 samples, with OTA at 1-10 ng/g. Ten samples contained no AFL or OTA. Ten ginseng finished products were also analyzed; 3 contained AFL at 0.1 ng/g and 4 contained OTA at levels ranging from 0.4 to 1.8 ng/g. LC/tandem mass spectrometry with multiple-reaction monitoring of 3 collisionally induced product ions from the protonated molecular ions of OTA, AFB1, and AFG1 was used to confirm the identities of the toxins in extracts of the finished products. PMID:17760342

  1. Simultaneous analysis of aflatoxins B1, B2, G1, G2, M1 and ochratoxin A in breast milk by high-performance liquid chromatography/fluorescence after liquid-liquid extraction with low temperature purification (LLE-LTP).

    PubMed

    Andrade, Patricia Diniz; Gomes da Silva, Julyane Laine; Caldas, Eloisa Dutra

    2013-08-23

    The aims of this study were to optimize and validate a methodology for the simultaneous analysis of aflatoxins B1, B2, G1, G2, M1 (AFB1, AFB2, AFG1, AFG2, AFM1) and ochratoxin A (OTA) in breast milk, and to analyze these mycotoxins in samples obtained from human milk banks in the Federal District, Brazil. The optimized analytical method was based on liquid-liquid extraction with low temperature purification (3.25mL of acidified acetonitrile+0.75mL of ethyl acetate), followed by analysis by high-performance liquid chromatography with fluorescence detector (HPLC/FLD) and a photochemical post-column reactor. Limits of quantification (LOQ) ranged from 0.005 to 0.03ng/mL, recoveries from 73 to 99.5%, and relative standard deviations (RSD) from 1.8 to 17.3%. The LLE-LTP extraction method was shown to be simple and cost-effective, since no columns were needed for clean-up. Only 2 of the 224 breast milk samples analyzed were positive for the mycotoxins, both samples containing AFB2 at the LOQ level (0.005ng/mL). The identity of the mycotoxin detected was confirmed by liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS). This result indicates that infants who are fed with breast milk from the milk banks are not at risk from aflatoxin and ochratoxin exposure. PMID:23871563

  2. A reliable liquid chromatography-tandem mass spectrometry method for simultaneous determination of multiple mycotoxins in fresh fish and dried seafoods.

    PubMed

    Sun, Wenshuo; Han, Zheng; Aerts, Johan; Nie, Dongxia; Jin, Mengtong; Shi, Wen; Zhao, Zhiyong; De Saeger, Sarah; Zhao, Yong; Wu, Aibo

    2015-03-27

    A reliable liquid chromatography-tandem mass spectrometry (LC-MS/MS) method was developed for simultaneous determination of nine mycotoxins, i.e., aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2), ochratoxin A (OTA), zearalenone (ZEN), T-2 toxin, HT2 toxin and deoxynivalenol (DON), in fresh fish (muscle and entrails) as well as dried seafoods. Special focus was given to sample pretreatment which is crucial for an accurate and reliable analytical method. With regards to the high complexity of the matrices, extraction solvent, time, and temperature as well as clean-up cartridges were optimized to improve extraction efficiency and reduce matrix effects. The optimum procedure included ultrasound-assisted extraction with acetonitrile/water/acetic acid (79/20/1, v/v/v) at 40 °C for 30 min, defatting with n-hexane and purification by Oasis HLB cartridges. The method was further validated by determining the linearity (R(2) ≥ 0.9989), sensitivity (limit of detection ≤ 2 μg/kg, limit of quantitation ≤ 3 μg/kg), recovery (72.2-119.9%) and precision (≤ 18.3%) in muscle and entrails of fresh crucian carp (Carassius carassius) as well as dried fish products. The method was proven to be suitable for its intended purposes. Mycotoxins of OTA, ZEN and AFB2 have been found in fresh fish and dried seafoods for the first time. PMID:25711425

  3. Aflatoxin and ochratoxin A contamination of retail foods and intake of these mycotoxins in Japan.

    PubMed

    Kumagai, S; Nakajima, M; Tabata, S; Ishikuro, E; Tanaka, T; Norizuki, H; Itoh, Y; Aoyama, K; Fujita, K; Kai, S; Sato, T; Saito, S; Yoshiike, N; Sugita-Konishi, Y

    2008-09-01

    A survey was undertaken of aflatoxin B1 (AFB1), B2 (AFB2), G1 (AFG1), G2 (AFG2), ochratoxin A (OTA), and fumonisin B1 (FB1), B2 (FB2) and B3 (FB3) contamination of various retail foods in Japan during 2004-05. The mycotoxins were analysed by high-performance liquid chromatography (HPLC), liquid chromatography/mass spectrometry (LC/MS) or high-performance thin-layer chromatography (HPTLC). Aflatoxins (AFs) were detected in ten of 21 peanut butter and in 22 of 44 bitter chocolate samples; the highest level of AFB1, 2.59 microg kg(-1), was found in peanut butter. Aflatoxin contamination was not observed in corn products (n = 55), corn (n = 110), peanuts (n = 120), buckwheat flour (n = 23), dried buckwheat noodles (n = 59), rice (n = 83) or sesame oil (n = 20). OTA was detected in 120 out of 192 samples of oatmeal, wheat flour, rye, buckwheat flour, raw coffee, roasted coffee, raisin, beer, wine and bitter chocolate, but not in rice or corn products. OTA levels in the positive samples were below 13 microg kg(-1). AFs and OTA intakes through the consumption of foods containing cacao were estimated using the data for mycotoxin contamination in bitter chocolate and those for the consumption of foods containing cacao in Japan. PMID:19238621

  4. Occurrence of Aflatoxins in Selected Processed Foods from Pakistan

    PubMed Central

    Mushtaq, Muhammad; Sultana, Bushra; Anwar, Farooq; Khan, Muhammad Zargham; Ashrafuzzaman, Muhammad

    2012-01-01

    A total of 125 (ready to eat) processed food samples (70 intended for infant and 55 for adult intake) belonging to 20 different food categories were analyzed for aflatoxins contamination using Reverse Phase High Performance Liquid Chromatography (RP-HPLC) with fluorescent detection. A solvent mixture of acetonitrile-water was used for the extraction followed by immunoaffinity clean-up to enhance sensitivity of the method. The limit of detection (LOD) (0.01–0.02 ng·g−1) and limit of quantification (LOQ) (0.02 ng·g−1) was established for aflatoxins based on signal to noise ratio of 3:1 and 10:1, respectively. Of the processed food samples tested, 38% were contaminated with four types of aflatoxins, i.e., AFB1 (0.02–1.24 μg·kg−1), AFB2 (0.02–0.37 μg·kg−1), AFG1 (0.25–2.7 μg·kg−1) and AFG2 (0.21–1.3 μg·kg−1). In addition, the results showed that 21% of the processed foods intended for infants contained AFB1 levels higher than the European Union permissible limits (0.1 μg·kg−1), while all of those intended for adult consumption had aflatoxin contamination levels within the permitted limits. PMID:22942705

  5. Mycological and aflatoxin contamination of peanuts sold at markets in Kinshasa, Democratic Republic of Congo, and Pretoria, South Africa.

    PubMed

    Kamika, Ilunga; Mngqawa, Pamella; Rheeder, John P; Teffo, Snow L; Katerere, David R

    2014-01-01

    Peanut (Arachis hypogaea L.) is an important food crop in sub-Saharan Africa. In this survey, the mycological and aflatoxin contamination of peanuts collected from Kinshasa, Democratic Republic of Congo, and Pretoria, South Africa, was assessed. Twenty peanut samples were purchased randomly at informal markets in the two cities and analysed for mycoflora and aflatoxins (AFB1, AFB2, AFG1 and AFG2) using standard methods. The results indicated that 95% of the Kinshasa samples and 100% of the Pretoria samples were contaminated with aflatoxigenic fungi in the ranges 20-49,000 and 40-21,000 CFU/g, respectively. Seventy-five per cent of the Kinshasa samples and 35% of the Pretoria samples exceeded the maximum limits of AFB1 as set by The Joint FAO/WHO Expert Committee on Food Additives. Residents of both cities are at a high risk of aflatoxin exposure despite their apparent cultural, socio-economic, geographic and climatic differences. Further work needs to be done to understand the supply chains of peanut trade in informal markets of the two countries so that interventions are well targeted on a regional rather than a national level. PMID:24914597

  6. Conversion of 11-hydroxy-O-methylsterigmatocystin to aflatoxin G1 in Aspergillus parasiticus.

    PubMed

    Zeng, Hongmei; Hatabayashi, Hidemi; Nakagawa, Hiroyuki; Cai, Jingjing; Suzuki, Ryoya; Sakuno, Emi; Tanaka, Toshitsugu; Ito, Yasuhiro; Ehrlich, Kenneth C; Nakajima, Hiromitsu; Yabe, Kimiko

    2011-04-01

    In aflatoxin biosynthesis, aflatoxins G(1) (AFG(1)) and B(1) (AFB(1)) are independently produced from a common precursor, O-methylsterigmatocystin (OMST). Recently, 11-hydroxy-O-methylsterigmatocystin (HOMST) was suggested to be a later precursor involved in the conversion of OMST to AFB(1), and conversion of HOMST to AFB(1) was catalyzed by OrdA enzyme. However, the involvement of HOMST in AFG(1) formation has not been determined. In this work, HOMST was prepared by incubating OrdA-expressing yeast with OMST. Feeding Aspergillus parasiticus with HOMST allowed production of AFG(1) as well as AFB(1). In cell-free systems, HOMST was converted to AFG(1) when the microsomal fraction, the cytosolic fraction from A. parasiticus, and yeast expressing A. parasiticus OrdA were added. These results demonstrated (1) HOMST is produced from OMST by OrdA, (2) HOMST is a precursor of AFG(1) as well as AFB(1), and (3) three enzymes, OrdA, CypA, and NadA, and possibly other unknown enzymes are involved in conversion of HOMST to AFG(1). PMID:21153813

  7. Conversion of 11-hydroxy-O-methylsterigmatocystin to aflatoxin G1 in Aspergillus parasiticus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In aflatoxin biosynthesis, aflatoxins G1 (AFG1) and B1 (AFB1) are independently produced from a common precursor, O-methylsterigmatocystin (OMST). Recently, 11-hydroxy-O-methylsterigmatocystin (HOMST) was identified as a later precursor involved in the conversion of OMST to AFB1. However, the invo...

  8. Vaccination of Lactating Dairy Cows for the Prevention of Aflatoxin B1 Carry Over in Milk

    PubMed Central

    Polonelli, Luciano; Giovati, Laura; Magliani, Walter; Conti, Stefania; Sforza, Stefano; Calabretta, Alessandro; Casoli, Claudio; Ronzi, Paola; Grilli, Ester; Gallo, Antonio; Masoero, Francesco; Piva, Gianfranco

    2011-01-01

    The potential of anaflatoxin B1 (AnAFB1) conjugated to keyhole limpet hemocyanin (KLH) as a vaccine (AnAFB1-KLH) in controlling the carry over of the aflatoxin B1 (AFB1) metabolite aflatoxin M1 (AFM1) in cow milk is reported. AFB1 is the most carcinogenic compound in food and foodstuffs amongst aflatoxins (AFs). AnAFB1 is AFB1 chemically modified as AFB1-1(O-carboxymethyl) oxime. In comparison to AFB1, AnAFB1 has proven to be non-toxic in vitro to human hepatocarcinoma cells and non mutagenic to Salmonella typhimurium strains. AnAFB1-KLH was used for immunization of cows proving to induce a long lasting titer of anti-AFB1 IgG antibodies (Abs) which were cross reactive with AFB1, AFG1, and AFG2. The elicited anti-AFB1 Abs were able to hinder the secretion of AFM1 into the milk of cows continuously fed with AFB1. Vaccination of lactating animals with conjugated AnAFB1 may represent a solution to the public hazard constituted by milk and cheese contaminated with AFs. PMID:22053212

  9. A new approach using micro HPLC-MS/MS for multi-mycotoxin analysis in maize samples.

    PubMed

    Hickert, Sebastian; Gerding, Johannes; Ncube, Edson; Hübner, Florian; Flett, Bradley; Cramer, Benedikt; Humpf, Hans-Ulrich

    2015-05-01

    Using micro high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) a simple and fast method for the quantitative determination of 26 mycotoxins was developed. Sample preparation consists of a single extraction step and a dilute-and-shoot approach without further cleanup. With a total run time of 9 min and solvent consumption below 0.3 mL per chromatographic run, the presented method is cost-effective. All toxins regulated by the European Commission with maximum or guidance levels in grain products (fumonisins B1 and B2 (FB1 and FB2)); deoxynivalenol (DON); aflatoxins B1, G1, B2, and G2 (AFB1, AFG1, AFB2, and AFG2); ochratoxin A (OTA); T-2 and HT-2 toxins; and zearalenone (ZEN) can be quantified with this method. Furthermore, the enniatins B, B1, A, and A1 (EnB, EnB1, EnA, and EnA1); beauvericin (BEA); 3-acetyl-deoxynivalenol (3-AcDON); fusarin C (FusC); sterigmatocystin (STC); gliotoxin (GT); and the Alternaria toxins alternariol (AOH), alternariol monomethyl ether (AME), altenuene (ALT), tentoxin (TEN), and altertoxin I (ATX I) can also be quantified. For all regulated compounds, recoveries ranged between 76 and 120%. For all other toxins, the recovery was at least 51%. The method was applied for the analysis of 42 maize samples from field trials in South Africa. PMID:25759213

  10. Brazil nuts are subject to infection with B and G aflatoxin-producing fungus, Aspergillus pseudonomius.

    PubMed

    Massi, Fernanda Pelisson; Vieira, Maria Lúcia Carneiro; Sartori, Daniele; Penha, Rafael Elias Silva; de Freitas Munhoz, Carla; Ferreira, Josué Maldonado; Iamanaka, Beatriz Thie; Taniwaki, Marta Hiromi; Frisvad, Jens C; Fungaro, Maria Helena Pelegrinelli

    2014-09-01

    The exploitation of the Brazil nut is one of the most important activities of the extractive communities of the Amazon rainforest. However, its commercialization can be affected by the presence of aflatoxins produced by fungi, namely Aspergillus section Flavi. In the present study, we investigated a collection of Aspergillus nomius strains isolated from Brazil nuts using different approaches, including morphological characters, RAPD and AFLP profiles, partial β-tubulin and calmodulin nucleotide sequences, aflatoxin patterns, as well as tolerance to low water activity in cultured media. Results showed that most of the isolates do belong to A. nomius species, but a few were re-identified as Aspergillus pseudonomius, a very recently described species. The results of the analyses of molecular variance, as well as the high pairwise FST values between A. nomius and A. pseudonomius suggested the isolation between these two species and the inexistence of gene flow. Fixed interspecific nucleotide polymorphisms at β-tubulin and calmodulin loci are presented. All A. pseudonomius strains analyzed produced aflatoxins AFB1, AFB2, AFG1 and AFG2. This study contains the first-ever report on the occurrence in Brazil nuts of A. pseudonomius. The G-type aflatoxins and the mycotoxin tenuazonic acid are reported here for the first time in A. pseudonomius. PMID:24974275

  11. Aflatoxins contamination and prevention in red chillies (Capsicum annuum L.) in Pakistan.

    PubMed

    Khan, Mobeen Ahmed; Asghar, Muhammad Asif; Iqbal, Javed; Ahmed, Aftab; Shamsuddin, Zuzzer Ali

    2014-01-01

    During 2006-2011, 331 red chilli samples (226 whole, 69 powdered and 36 crushed) were collected from all over Pakistan for the estimation of total aflatoxins (AFs = AFB1 + AFB2 + AFG1 + AFG2) contamination by thin layer chromatography (TLC). Mean AFs levels in whole, powdered and crushed chillies were 11.7, 27.8 and 31.2 µg kg(-1), respectively. AFs levels in 62.4% of whole, 26.1% of powdered and 19.4% of crushed chillies were found lower than the maximum limit (ML = 10 µg kg(-1)) as assigned by the European Union. Furthermore, whole (27.9%), powdered (28%) and crushed (27.8%) chillies showed AFs contamination which ranged between 10 and 20 µg kg(-1). However, 9.7% of whole, 46% of powdered and 52.8% of crushed chillies showed AFs levels beyond the ML of 20 µg kg(-1) as assigned by the USDA. It was concluded that AFs contamination in chillies requires further investigation, monitoring and routine analysis. Furthermore, proper harvesting, drying, handling, storage and transport conditions need to be employed. PMID:24779970

  12. Determination of Mycotoxins in Brown Rice Using QuEChERS Sample Preparation and UHPLC-MS-MS.

    PubMed

    Jettanajit, Adisorn; Nhujak, Thumnoon

    2016-05-01

    QuEChERS sample preparation was optimized and validated using solvent extraction with 10% (v/v) acetic acid-containing acetonitrile in the presence of four salts (anh. MgSO4, NaCl, sodium citrate tribasic dihydrate and sodium citrate dibasic sesquihydrate) and dispersive solid-phase extraction with mixed sorbents (octadecylsilane, primary and secondary amine and silica sorbents) for an ultra high performance liquid chromatography-tandem mass spectrometric determination of nine mycotoxins in brown rice: aflatoxins (AFB1, AFB2, AFG1 and AFG2), fumonisins (FB1 and FB2), deoxynivalenol, ochratoxin A and zearalenone (ZON). Our developed method allows for the determination of trace levels of mycotoxins with method detection limits in the range of 1.4-25 µg/kg, below the maximum limits of EU regulations, and with an acceptable accuracy and precision, and recoveries in the range of 81-101% with relative standard deviations of 5-19% over a mycotoxin concentration range of 5.0-1,000 µg/kg. Six out of fourteen real samples of brown rice were found to be contaminated with at least one of these mycotoxins, ranging from 2.49-5.41 µg/kg of FB1, 4.33 ± 0.04 µg/kg of FB2 and 6.10-14.88 µg/kg of ZON. PMID:26796964

  13. Micro-solid phase extraction with liquid chromatography-tandem mass spectrometry for the determination of aflatoxins in coffee and malt beverage.

    PubMed

    Khayoon, Wejdan Shakir; Saad, Bahruddin; Salleh, Baharuddin; Manaf, Normaliza Hj Abdul; Latiff, Aishah A

    2014-03-15

    A single step extraction-cleanup procedure using porous membrane-protected micro-solid phase extraction (μ-SPE) in conjunction with liquid chromatography-tandem mass spectrometry for the extraction and determination of aflatoxins (AFs) B1, B2, G1 and G2 from food was successfully developed. After the extraction, AFs were desorbed from the μ-SPE device by ultrasonication using acetonitrile. The optimum extraction conditions were: sorbent material, C8; sorbent mass, 20mg; extraction time, 90 min; stirring speed, 1,000 rpm; sample volume, 10 mL; desorption solvent, acetonitrile; solvent volume, 350 μL and ultrasonication period, 25 min without salt addition. Under the optimum conditions, enrichment factor of 11, 9, 9 and 10 for AFG2, AFG1, AFB2 and AFB1, respectively were achieved. Good linearity and correlation coefficient was obtained over the concentration range of 0.4-50 ng g(-1) (r(2) 0.9988-0.9999). Good recoveries for AFs ranging from 86.0-109% were obtained. The method was applied to 40 samples involving malt beverage (19) and canned coffee (21). No AFs were detected in the selected samples. PMID:24206720

  14. Aflatoxins B1, B2, G1, and G2 contamination in ground red peppers commercialized in Sanliurfa, Turkey.

    PubMed

    Karaaslan, Mehmet; Arslanğray, Yusuf

    2015-04-01

    Aflatoxins (AFs) are hepatogenic, teratogenic, imunosuppressive, and carcinogenic fungal metabolites found in feeds, nuts, wine-grapes, spices, and other grain crops. Humans are exposed to AFs via consumption of mycotoxin-contaminated foods. This study aimed to determine the prevalence of AF contamination in powdered red peppers sold in Sanliurfa. A total of 42 samples were randomly collected from retail shops, supermarkets, open bazaars, and apiaries and examined for the occurrence and levels of AFB1, AFB2, AFG1, and AFG2 toxins. AFs were determined by using an HPLC system after pre-separation utilizing immunoaffinity columns. AFs levels were below 2.5 μg/kg in 16 samples, between 2.5 and 10 μg/kg in 13 samples while 13 samples had AFs higher than the tolerable limit (10 μg/kg) according to the regulations of Turkish Food Codex and European Commission. The occurrence of AF fractions during powdered red pepper processing steps was also evaluated. According to the results obtained in this study, it was found that the highest AF accumulations in powdered red peppers start during perspiration and final drying of the products processed on soil contacted surfaces while there was no limit exceeding aflatoxin contamination in the samples produced on concrete surfaces. PMID:25773893

  15. Estimated exposure to EU regulated mycotoxins and risk characterization of aflatoxin-induced hepatic toxicity through the consumption of the toasted cereal flour called "gofio", a traditional food of the Canary Islands (Spain).

    PubMed

    Luzardo, Octavio P; Bernal-Suárez, María Del Mar; Camacho, María; Henríquez-Hernández, Luis Alberto; Boada, Luis D; Rial-Berriel, Cristian; Almeida-González, Maira; Zumbado, Manuel; Díaz-Díaz, Ricardo

    2016-07-01

    "Gofio" is a type of flour made from toasted grain, which is part of the staple food in the Canary Islands, Spain, in which the occurrence of Aflatoxins B1, B2, G1 and G2 (AFB1, AFB2, AFG1, AFG2), Fumonisins B1 and B2 (FB1 and FB2) Ochratoxin A (OTA), Deoxynivalenol (DNV) and Zearalenone (ZEA) was evaluated. 83% of the samples were contaminated with at least one mycotoxin and 69.2% of the analyzed samples showed co-occurrence of mycotoxins (range 2 to 8). All the concentrations were well below the established limits (maximum values of AFs=0.42 μg/kg; FBs=178.3 μg/kg; OTA=0.3 μg/kg; DON=92.5 μg/kg; and ZEA=9.9 μg/kg). The daily dietary exposure to total AFs was estimated to be 7.1% of the TDI. This value was almost double in children, and considering the upper-bound approach could reach 35% of the TDI. For the rest of mycotoxins, the consumers would be exposed to less than 2% of their TDIs. The risk characterization indicates that there is a potential risk in developing aflatoxin induced liver cancer due to gofio consumption in the subpopulation which is simultaneously exposed to other hepatocarcinogens, such as the hepatitis B virus. PMID:27132021

  16. Efficacy of polyvinylpolypyrrolidone in reducing the immunotoxicity of aflatoxin in growing broilers.

    PubMed

    Celik, I; Oğuz, H; Demet, O; Dönmez, H H; Boydak, M; Sur, E

    2000-09-01

    1. Protective action of an enzyme-linked polyvinylpolypyrrolidone (PVPP, Mycofix Plus) against the immunosuppressive effect of afatoxins (AF) was evaluated by determination of peripheral blood T-lymphocyte proportions and splenic plasma cell counts. Histological changes in lymphoid organs were also investigated by light microscopy. One-d-old broiler chicks (Hybro) received 2.5 mg/kg diet AF (83.06% AFB1, 12.98% AFB2, 2.84% AFG1, 1.12% AFG2) with or without PVPP (3g/kg diet) until 21 d of age. When compared with controls, AF treatment significantly decreased peripheral T-lymphocyte counts. AF caused a slight decrease in splenic plasma cell counts. The addition of PVPP to an AF-containing diet significantly increased T-lymphocyte counts. Splenic plasma cell counts were numerically intermediate between control and AF groups. 3. The dietary addition of PVPP to AF-free diet did not significantly alter either T-lymphocyte or splenic plasma cell counts. PMID:11215492

  17. Novel regulation of aflatoxin B1 biosynthesis in Aspergillus flavus by piperonal.

    PubMed

    Park, Eun-Sil; Bae, In Kyung; Kim, Ho Jin; Lee, Sung-Eun

    2016-08-01

    The present study investigated its inhibitory role in aflatoxin (AF) biosynthesis. Treating only AFB1- and B2-producing Aspergillus flavus with piperonal completely inhibited AFB1 production with high sclerotial formation, resulting in 20-fold higher AFG2 production. On the other hand, benzodioxole and eugenol suppressed AFB1 production without AFG formation, while methyleugenol showed potent inhibition of AFB1 production with slight production of AFG1. These results indicate that natural products may change aflatoxin biosynthesis, and highlight a novel regulation of AFG2 production by piperonal. It is the first report for chemical regulation on AFG2 production in non-AFG producing-aspergilli. PMID:26273991

  18. High-throughput determination of multi-mycotoxins in Chinese yam and related products by ultra fast liquid chromatography coupled with tandem mass spectrometry after one-step extraction.

    PubMed

    Li, Menghua; Kong, Weijun; Li, Yanjun; Liu, Hongmei; Liu, Qiutao; Dou, Xiaowen; Ou-Yang, Zhen; Yang, Meihua

    2016-06-01

    A simple, accurate and sensitive ultra fast liquid chromatography coupled with tandem mass spectrometry (UFLC-MS/MS) method was developed for high-throughput determination of aflatoxins (AFB1, AFB2, AFG1 and AFG2), ochratoxin A (OTA), fumonisins (FB1 and FB2) and zearalenone (ZEA) in Chinese yam, yam flours and yam-derived products. Mycotoxins were extracted from the samples with methanol-water-formic acid (79:20:1, v/v/v) and no further cleanup step before analysis. After optimization of some crucial parameters including sample preparation, chromatographic separation and MS/MS conditions, the method was successfully validated to exhibit excellent performance in terms of satisfactory linearity (r≥0.9977), limits of detection (≤0.15ngmL(-1)) and quantification (≤0.5ngmL(-1)) with good precision (RSD for intra- and inter-day variations of ≤4.65% and 6.31%, respectively), good accuracy (recoveries of 71.0-106.0%) and robustness, together with short run time (8min/sample). The developed method was applied for simultaneous detection and quantification of the above 8 mycotaxins in 27 batches of Chinese yam and related products collected from different markets and pharmacies in China. The results revealed that 1 normal sample and 4 moldy samples were found to be contaminated with different mycotoxins. The detected concentrations of AFB1 in 2 moldy samples exceeded the regulatory maximum residue levels. The proposed method was capable for simultaneous determination of mycotoxins in this and other types of complex matrices. PMID:27085799

  19. Potential for aflatoxin B1 and B2 production by Aspergillus flavus strains isolated from rice samples

    PubMed Central

    Lai, Xianwen; Zhang, He; Liu, Ruicen; Liu, Chenglan

    2014-01-01

    In this study, we investigated the potential for aflatoxin B1 (AFB1) and B2 (AFB2) production in rice grain by 127 strains of Aspergillus flavus isolated from rice grains collected from China. These strains were inoculated onto rice grains and incubated at 28 °C for 21 days. AFB1 and AFB2 were extracted and quantified by high-performance liquid chromatography coupled with fluorescence detection. Among the tested strains, 37% produced AFB1 and AFB2 with levels ranging from 175 to 124 101 μg kg−1 for AFB1 and from not detected to 10 329 μg kg−1 for AFB2. The mean yields of these isolates were 5884 μg kg−1 for AFB1 and 1968 μg kg−1 for AFB2. Overall, most of the aflatoxigenic strains produced higher levels of AFB1 than AFB2 in rice. The obtained information is useful for assessing the risk of aflatoxin contamination in rice samples. PMID:25737649

  20. Validation of a confirmatory analytical method for the determination of aflatoxins B₁, B₂, G₁ and G₂ in foods and feed materials by HPLC with on-line photochemical derivatization and fluorescence detection.

    PubMed

    Muscarella, Marilena; Iammarino, Marco; Nardiello, Donatella; Magro, Sonia Lo; Palermo, Carmen; Centonze, Diego; Palermo, Domenico

    2009-10-01

    A sensitive and selective analytical method for the simultaneous separation and quantitative determination of aflatoxins B1, B2, G1 and G2 in foodstuffs and materials for feed has been validated. The method is based on high performance liquid chromatography with on-line post-column photochemical derivatization and fluorescence detection. The chromatographic separation of aflatoxins was accomplished using a C18 column eluted with an isocratic mobile phase consisting of water, methanol and acetonitrile. The sample preparation required a simple extraction of aflatoxins with MeOH/H2O (80:20, v/v) and a purification step by immunoaffinity column cleanup. The total analysis time, including sample preparation and chromatographic separation, did not exceed 40 min with a run time of 10 min. The on-line photochemical derivatization ensures better results in terms of simplicity, sensitivity and reproducibility with respect to chemical derivatization techniques, and provides an increase of the peak resolution and an extent of automation in comparison with the electrochemical ones. The procedure for the determination of aflatoxins in food samples and cereals for animal consumption was extensively validated following Regulation (EC) No. 882/2004. Detection limits in wheat bran samples of 0.08 μg kg1 for AFB1, 0.02 μg kg1 for AFB2, 0.16 μg kg1 for AFG1 and 0.04 μg kg1 for AFG2 were attained. The method allows high recovery with mean values ranging from 72 to 94% and it satisfies the necessary requirements for sensitivity, linearity, selectivity, precision and ruggedness, demonstrating the conformity of the method with provisions of Regulation (EC) No. 401/2006. PMID:21462585

  1. Development of hyperbranched polymers with non-covalent interactions for extraction and determination of aflatoxins in cereal samples.

    PubMed

    Liu, Xiaoyan; Li, Huihui; Xu, Zhigang; Peng, Jialin; Zhu, Shuqiang; Zhang, Haixia

    2013-10-01

    A novel approach for assembling homogeneous hyperbranched polymers based on non-covalent interactions with aflatoxins was developed; the polymers were used to evaluate the extraction of aflatoxins B1, B2, G1 and G2 (AFB1, AFB2, AFG1 and AFG2) in simulant solutions. The results showed that the extraction efficiencies of three kinds of synthesized polymers for the investigated analytes were not statistically different; as a consequence, one of the representative polymers (polymer I) was used as the solid-phase extraction (SPE) sorbent to evaluate the influences of various parameters, such as desorption conditions, pH, ionic strength, concentration of methanol in sample solutions, and the mass of the sorbent on the extraction efficiency. In addition, the extraction efficiencies for these aflatoxins were compared between the investigated polymer and the traditional sorbent C18. The results showed that the investigated polymer had superior extraction efficiencies. Subsequently, the proposed polymer for the SPE packing material was employed to enrich and analyze four aflatoxins in the cereal powder samples. The limits of detection (LODs) at a signal-to-noise (S/N) ratio of 3 were in the range of 0.012-0.120 ng g(-1) for four aflatoxins, and the limits of quantification (LOQs) calculated at S/N=10 were from 0.04 to 0.40 ng g(-1) for four aflatoxins. The recoveries of four aflatoxins from cereal powder samples were in the range of 82.7-103% with relative standard deviations (RSDs) lower than 10%. The results demonstrate the suitability of the SPE approach for the analysis of trace aflatoxins in cereal powder samples. PMID:24050668

  2. Aflatoxins in food products consumed in Brazil: a preliminary dietary risk assessment.

    PubMed

    Andrade, P D; de Mello, M Homem; França, J A; Caldas, E D

    2013-01-01

    A preliminary dietary exposure assessment for aflatoxins (AFs; AFB1, AFB2, AFG1 and AFG2) was conducted to evaluate the potential carcinogenic risks for the Brazilian population. AF concentration data in food were obtained from analysis reports issued by the Central Public Health Laboratory of the Federal District (LACEN-DF) and from published work. Food consumption and body weight (bw) data were obtained from a national survey conducted in 2008/2009. Cancer risks arising from exposure to aflatoxins were assessed using the carcinogenic potency of AFs estimated by the JECFA, and hepatitis B virus prevalence in the Brazilian population. Additionally, margins of exposure (MOE) were also calculated for the various scenarios investigated. A total of 942 food samples were analysed for AFs in the Federal District between 2002 and 2011 with 4.5% of them being positive for at least one aflatoxin (LOQ = 2 µg kg(-1)). The highest percentage of contamination was found in peanuts (8.1%) and Brazil nuts (6.0%), with mean levels ranging from 6.7 µg kg(-1) in peanut products to 36.9 µg kg(-1) in Brazil nuts. Most of the studies conducted elsewhere in Brazil found similar results. Total AF intake for the total Brazilian population and high consumers of food relevant for AF contamination in Brazil (upper bound; samples < LOQ = 0.5 LOQ) were 6.8 and 27.6 ng kg(-1) bw day(-1), respectively. Cancer risk reached 0.0753 cancers year(-1) per 10(5) individuals for the total population and 0.3056 cancers year(-1) per 10(5) individuals for high consumers. MOE reached 25 and 6 for the total population and high consumers, respectively, indicating a potential risk for consumers. Aflatoxins are genotoxic carcinogens, and government action should be maintained and continuously improved in order to guarantee that human exposure levels are kept as low as possible. PMID:22963655

  3. Mycotoxigenic potential of fungi isolated from freshly harvested Argentinean blueberries.

    PubMed

    Munitz, Martin S; Resnik, Silvia L; Pacin, Ana; Salas, Paula M; Gonzalez, Hector H L; Montti, Maria I T; Drunday, Vanesa; Guillin, Eduardo A

    2014-11-01

    Alternaria alternata, A. tenuissima, Fusarium graminearum, F. semitectum, F. verticillioides, Aspergillus flavus, and Aspergillus section Nigri strains obtained from blueberries during the 2009 and 2010 harvest season from Entre Ríos, Argentina were analyzed to determine their mycotoxigenic potential. Taxonomy status at the specific level was determined both on morphological and molecular grounds. Alternariol (AOH), alternariol monomethyl ether (AME), aflatoxins (AFs), zearalenone (ZEA), fumonisins (FBs), and ochratoxin A (OTA) were analyzed by HPLC and the trichotecenes deoxynivalenol (DON), nivalenol (NIV), HT-2 toxin (HT-2), T-2 toxin (T-2), fusarenone X (FUS-X), 3-acetyl-deoxynivalenol (3-AcDON), and 15-acetyl-deoxynivalenol (15-AcDON) by GC. Twenty-five out of forty two strains were able to produce some of the mycotoxins analyzed. Fifteen strains of Aspergillus section Nigri were capable of producing Fumonisin B1 (FB1); two of them also produced Fumonisin B2 (FB2) and one Fumonisin B3 (FB3). One of the F. graminearum isolated produced ZEA, HT-2, and T-2 and the other one was capable of producing ZEA and DON. Two A. alternata isolates produced AOH and AME. Four A. tenuissima were capable of producing AOH and three of them produced AME as well. One Aspergillu flavus strain produced aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), and aflatoxin G1 (AFG1). To our knowledge, this is the first report showing mycotoxigenic capacity of fungal species isolated from blueberries that include other fungi than Alternaria spp. PMID:25098914

  4. The antioxidant effects of pumpkin seed oil on subacute aflatoxin poisoning in mice.

    PubMed

    Eraslan, Gökhan; Kanbur, Murat; Aslan, Öznur; Karabacak, Mürsel

    2013-12-01

    This study was aimed at the investigation of the antioxidant effect of pumpkin seed oil against the oxidative stress-inducing potential of aflatoxin. For this purpose, 48 male BALB/c mice were used. Four groups, each comprising 12 mice, were established. Group 1 was maintained as the control group. Group 2 was administered with pumpkin seed oil alone at a dose of 1.5 mL/kg.bw/day (∼1375mg/kg.bw/day). Group 3 received aflatoxin (82.45% AFB1 , 10.65% AFB2 , 4.13% AFG1, and 2.77% AFG2 ) alone at a dose of 625 μg/kg.bw/day. Finally, group 4 was given both 1.5 mL/kg.bw/day pumpkin seed oil and 625 μg/kg.bw/day aflatoxin. All administrations were oral, performed with the aid of a gastric tube and continued for a period of 21 days. At the end of day 21, the liver, lungs, kidneys, brain, heart, and spleen of the animals were excised, and the extirpated tissues were homogenized appropriately. Malondialdehyde (MDA) levels and catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) activities were determined in tissue homogenates. In conclusion, it was determined that aflatoxin exhibited adverse effects on most of the oxidative stress markers. The administration of pumpkin seed oil diminished aflatoxin-induced adverse effects. In other words, the values of the group, which was administered with both aflatoxin and pumpkin seed oil, were observed to have drawn closer to the values of the control group. PMID:24591108

  5. Efficient Conjugation of Aflatoxin M1 With Bovine Serum Albumin through Aflatoxin M1-(O-carboxymethyl) Oxime and Production of Anti-aflatoxin M1 Antibodies

    PubMed Central

    Khademi, Fatemeh; Mohammadi, Masoud; Kiani, Amir; Haji Hosseini Baghdadabadi, Reza; Parvaneh, Shahram; Mostafaie, Ali

    2015-01-01

    Background: Aflatoxins are the most extensively studied group of mycotoxins produced by molds, especially the Aspergillus group, which are highly toxic to animals and humans. Objectives: Since immunoassay is a simple and rapid method for the analysis of many toxic substances in comparison to the chromatographic methods, it is necessary to produce specific and sensitive antibodies for detection of Aflatoxin M1 (AFM1). The current study was conducted to produce bioconjugate of Aflatoxin M1 (AFM1) with Bovine Serum Albumin (BSA) as well as to generate specific antibodies against AFM1 for immunoassay of the mycotoxin. Materials and Methods: First, AFM1 was converted to AFM1-(O-carboxymethyl) oxime derivative. Then, AFM1-oxime was coupled with BSA and the product was assessed by UV-VIS spectrophotometry. In order to generate polyclonal antibodies against AFM1, rabbits were immunized with BSA-AFM1 conjugate. Produced antibodies were purified using ion exchange chromatography and BSA-Sepharose 4B affinity chromatography. The titers and specificity of the produced antibodies were determined by Enzyme-Linked Immunosorbent Assay (ELISA). Results: The results indicated that coupling of AFM1 with O-(Carboxymethyl) hydroxylamine hemihydrochloride was suitable and 12 moles of AFM1-oxime were successfully coupled to each mole of BSA. In addition, the titers and specificity of the prepared antibody were considerable compared to standard anti-AFM1 antibodies. The relative cross-reactivity of each toxin (relative to AFM1) with purified anti-AFM1 antibodies, as determined by the amount of aflatoxin necessary to cause 50% inhibition of enzyme activity, was 70, 105, 240, and 2500 ng/mL for AFB1, AFB2, AFG1, and AFG2, respectively. Conclusions: The prepared antibody can be used for the development of an ELISA kit to assay AFM1 in milk and other biological fluids. PMID:26034542

  6. Assessment of Mycotoxin Exposure in Côte d’ivoire (Ivory Coast) Through Multi-Biomarker Analysis and Possible Correlation with Food Consumption Patterns

    PubMed Central

    Kouadio, James Halbin; Lattanzio, Veronica M. T.; Ouattara, Djeneba; Kouakou, Brou; Visconti, Angelo

    2014-01-01

    Scope: The aim of the presented study was to investigate the mycotoxin exposure of Ivorian population related to the consumption patterns of maize, peanuts, millet, and cassava product (attiéké). Materials and Methods: Maize flour samples (n = 51) were purchased from all Abidjan local markets, in the south of Ivory Coast, and urine (n = 99) was collected during the same reference period (July–September 2011) from volunteers living in Abidjan and Daloa cities. Reversed-phase liquid chromatography coupled with electrospray ionization triple quadrupole mass spectrometry (LC-ESI-MS/MS) was used to analyze aflatoxins (AFB1, AFB2, AFG1, and AFG2), ochratoxin A (OTA), fumonisins (FB1, FB2), deoxynivalenol (DON), zearalenone (ZEA), and T-2 and HT-2 toxins in maize flour samples, and their relevant biomarkers (AFM1, DON, DON + de-epoxydeoxynivalenol (DOM-1), FB1, α-zearalenol (ZOL), β-ZOL, and OTA) in urine samples. Results: Critical maize contamination was observed by AFs occurrence (total AFs 4.5 – 330.0 μg/kg) while OTA was found in 13% of samples analyzed. AFM1 was detected in 40% of urines samples (0.06 – 14.11 ng/ml), OTA in 37% (0.01 – 0.42 ng/ml), FB1 in 27% (0.07 to 15.31 ng/ml) and, DON was found in 21% of samples at levels up to 10.0 ng/ml. The correlation coefficients (R2) obtained by plotting the percentage of biomarker occurrence (positive samples) versus the frequency of food consumption revealed maize, peanuts, millet and attiéké were strongly linked to AFB1 and OTA exposure with values of R2 ranged from 0.462 to 0.956. Conclusion: The present study provided data on mycotoxin risk in Ivory Coast, revealing a frequent co-exposure to the major mycotoxins such as AFs, OTA, and fumonisins, which appeared to be related to the frequency of peanuts, maize, millet and attiéké consumption. PMID:25948962

  7. Application of magnetic solid phase extraction for separation and determination of aflatoxins B ₁ and B₂ in cereal products by high performance liquid chromatography-fluorescence detection.

    PubMed

    Hashemi, Mahdi; Taherimaslak, Zohreh; Rashidi, Somayeh

    2014-06-01

    A simple and sensitive method based on the magnetic solid phase extraction with modified magnetic nanoparticles followed by high performance liquid chromatography with fluorescence detection has been developed for extraction and determination of aflatoxins B1 (AFB1) and B2 (AFB2) in cereal products. Magnetic nanoparticle coated with 3-(trimethoxysilyl)-1-propanthiol (TMSPT) and modified with 2-amino-5-mercapto-1,3,4-thiadiazole (AMT) was used as an antibody-free adsorbent. Under the optimal conditions, the calibration curves for AFB1 and AFB2 were linear in the ranges of 0.2-15 μg L(-1) and 0.04-3 μg L(-1), respectively. Detection limit was 0.041 μg L(-1) for AFB1 and 0.013 μg L(-1) for AFB2. The proposed method was successfully applied to the determination of AFB1 and AFB2 in spiked corn and rice samples with an average recovery of 93.5%. The results demonstrated that the developed method is simple, rapid, inexpensive, accurate and remarkably free from interference effects. PMID:24814005

  8. Degradation of Aflatoxin B1 during the Fermentation of Alcoholic Beverages

    PubMed Central

    Inoue, Tomonori; Nagatomi, Yasushi; Uyama, Atsuo; Mochizuki, Naoki

    2013-01-01

    Aflatoxin B1 (AFB1) is a contaminant of grain and fruit and has one of the highest levels of carcinogenicity of any natural toxin. AFB1 and the fungi that produce it can also contaminate the raw materials used for beer and wine manufacture, such as corn and grapes. Therefore, brewers must ensure strict monitoring to reduce the risk of contamination. In this study, the fate of AFB1 during the fermentation process was investigated using laboratory-scale bottom and top beer fermentation and wine fermentation. During fermentation, cool wort beer samples and wine must samples were artificially spiked with AFB1 and the levels of AFB1 remaining after fermentation were analyzed. AFB1 levels were unchanged during both types of fermentation used for beer but were reduced to 30% of their initial concentration in wine. Differential analysis of the spiked and unspiked wine samples showed that the degradation compound was AFB2a, a hydrated derivative of AFB1. Thus, the results showed that the risk of AFB1 carryover was still present for both types of beer fermentation but was reduced in the case of wine fermentation because of hydration. PMID:23812408

  9. Degradation of aflatoxin B1 during the fermentation of alcoholic beverages.

    PubMed

    Inoue, Tomonori; Nagatomi, Yasushi; Uyama, Atsuo; Mochizuki, Naoki

    2013-07-01

    Aflatoxin B1 (AFB1) is a contaminant of grain and fruit and has one of the highest levels of carcinogenicity of any natural toxin. AFB1 and the fungi that produce it can also contaminate the raw materials used for beer and wine manufacture, such as corn and grapes. Therefore, brewers must ensure strict monitoring to reduce the risk of contamination. In this study, the fate of AFB1 during the fermentation process was investigated using laboratory-scale bottom and top beer fermentation and wine fermentation. During fermentation, cool wort beer samples and wine must samples were artificially spiked with AFB1 and the levels of AFB1 remaining after fermentation were analyzed. AFB1 levels were unchanged during both types of fermentation used for beer but were reduced to 30% of their initial concentration in wine. Differential analysis of the spiked and unspiked wine samples showed that the degradation compound was AFB2a, a hydrated derivative of AFB1. Thus, the results showed that the risk of AFB1 carryover was still present for both types of beer fermentation but was reduced in the case of wine fermentation because of hydration. PMID:23812408

  10. Mass spectrometric identification and toxicity assessment of degraded products of aflatoxin B1 and B2 by Corymbia citriodora aqueous extracts

    PubMed Central

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen

    2015-01-01

    This study explores the detoxification potential of Corymbia citriodora plant extracts against aflatoxin B1 and B2 (AFB1; 100 μg L−1 and AFB2; 50 μg L−1) in In vitro and In vivo assays. Detoxification was qualitatively and quantitatively analyzed by TLC and HPLC, respectively. The study was carried out by using different parameters of optimal temperature, pH and incubation time period. Results indicated that C. citriodora leaf extract(s) more effectively degrade AFB1 and AFB2 i.e. 95.21% and 92.95% respectively than C. citriodora branch extract, under optimized conditions. The structural elucidation of degraded toxin products was done by LCMS/MS analysis. Ten degraded products of AFB1 and AFB2 and their fragmentation pathways were proposed based on molecular formulas and MS/MS spectra. Toxicity of these degraded products was significantly reduced as compared to that of parent compounds because of the removal of double bond in the terminal furan ring. The biological toxicity of degraded toxin was further analyzed by brine shrimps bioassay, which showed that only 17.5% mortality in larvae was recorded as compared to untreated toxin where 92.5% mortality was observed after 96hr of incubation. Therefore, our finding suggests that C. citriodora leaf extract can be used as an effective tool for the detoxification of aflatoxins. PMID:26423838

  11. Structural Elucidation and Toxicity Assessment of Degraded Products of Aflatoxin B1 and B2 by Aqueous Extracts of Trachyspermum ammi

    PubMed Central

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen

    2016-01-01

    In this study aqueous extract of seeds and leaves of Trachyspermum ammi were evaluated for their ability to detoxify aflatoxin B1 and B2 (AFB1; 100 μg L−1 and AFB2; 50 μg L−1) by in vitro and in vivo assays. Results indicated that T. ammi seeds extract was found to be significant (P < 0.05) in degrading AFB1 and AFB2 i.e., 92.8 and 91.9% respectively. However, T. ammi leaves extract proved to be less efficient in degrading these aflatoxins, under optimized conditions i.e., pH 8, temperature 30°C and incubation period of 72 h. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that eight degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that T. ammi seeds extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27064492

  12. Structural Elucidation and Toxicity Assessment of Degraded Products of Aflatoxin B1 and B2 by Aqueous Extracts of Trachyspermum ammi.

    PubMed

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen

    2016-01-01

    In this study aqueous extract of seeds and leaves of Trachyspermum ammi were evaluated for their ability to detoxify aflatoxin B1 and B2 (AFB1; 100 μg L(-1) and AFB2; 50 μg L(-1)) by in vitro and in vivo assays. Results indicated that T. ammi seeds extract was found to be significant (P < 0.05) in degrading AFB1 and AFB2 i.e., 92.8 and 91.9% respectively. However, T. ammi leaves extract proved to be less efficient in degrading these aflatoxins, under optimized conditions i.e., pH 8, temperature 30°C and incubation period of 72 h. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that eight degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that T. ammi seeds extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27064492

  13. Mass spectrometric identification and toxicity assessment of degraded products of aflatoxin B1 and B2 by Corymbia citriodora aqueous extracts.

    PubMed

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen

    2015-01-01

    This study explores the detoxification potential of Corymbia citriodora plant extracts against aflatoxin B1 and B2 (AFB1; 100 μg L(-1) and AFB2; 50 μg L(-1)) in In vitro and In vivo assays. Detoxification was qualitatively and quantitatively analyzed by TLC and HPLC, respectively. The study was carried out by using different parameters of optimal temperature, pH and incubation time period. Results indicated that C. citriodora leaf extract(s) more effectively degrade AFB1 and AFB2 i.e. 95.21% and 92.95% respectively than C. citriodora branch extract, under optimized conditions. The structural elucidation of degraded toxin products was done by LCMS/MS analysis. Ten degraded products of AFB1 and AFB2 and their fragmentation pathways were proposed based on molecular formulas and MS/MS spectra. Toxicity of these degraded products was significantly reduced as compared to that of parent compounds because of the removal of double bond in the terminal furan ring. The biological toxicity of degraded toxin was further analyzed by brine shrimps bioassay, which showed that only 17.5% mortality in larvae was recorded as compared to untreated toxin where 92.5% mortality was observed after 96hr of incubation. Therefore, our finding suggests that C. citriodora leaf extract can be used as an effective tool for the detoxification of aflatoxins. PMID:26423838

  14. Biosensor-based screening method for the detection of aflatoxins B1-G1.

    PubMed

    Cuccioloni, Massimiliano; Mozzicafreddo, Matteo; Barocci, Simone; Ciuti, Francesca; Pecorelli, Ivan; Eleuteri, Anna Maria; Spina, Michele; Fioretti, Evandro; Angeletti, Mauro

    2008-12-01

    Aflatoxins are extremely toxic metabolites from Aspergillus species that can adulterate a wide range of human foodstuff. Herein, we propose a novel assay designed as an analytical test for aflatoxin B1 and G1 (AFB1 and AFG1, respectively) that could represent an alternative screening technique for this class of mycotoxins. The approach for the determination of these toxins is based on surface plasmon resonance using neutrophil porcine elastase as a "bait" for these aflatoxins. The selection and optimization of the analytical procedure involved a preliminary investigation on the type of inhibition by AFB1: the level of the protease inhibition exerted by AFB1 depended upon the incubation time and the concentration of the binding partners, showing the competitiveness and the reversibility of the inhibition. A posteriori, the nature of the interaction granted a rapid analysis, a single detection test requiring only a few minutes. For the development of the assay, the experimental conditions were evaluated and optimized with both calibration solution and aflatoxin-spiked samples. To apply this method to aflatoxin-contaminated maize, a rapid solid-phase extraction treatment was developed. The proposed assay for AFB1 and AFG1 was validated by comparison with both a chromatographic reference method and a standard enzyme linked immunosorbent assay procedure. This enzyme-based biosensor represents a new approach for the detection of aflatoxins based on the reversible interaction between a blocked macromolecule and a soluble ligand, having the major advantages in the relative rapidity, the reusability of the capturing surface, and low cost per single test. PMID:19551989

  15. Adverse Outcome Pathway (AOP) for a Mutagenic Mode of Action for Cancer: AFB1 and Hepatocellular Carcinoma (HCC)

    EPA Science Inventory

    AOPs provide a framework to describe a sequence of measureable key events (KEs), beginning with a molecular initiating event (MIE), followed by a series of identified KEs linked to one another by KE Relationships (KERs), all anchored by a specific adverse outcome (AO). Each KE/KE...

  16. Structural Analysis and Biological Toxicity of Aflatoxins B1 and B2 Degradation Products Following Detoxification by Ocimum basilicum and Cassia fistula Aqueous Extracts.

    PubMed

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen; Khan, Abdul Muqeet

    2016-01-01

    This study showed the comparison between Ocimum basilicum and Cassia fistula (leaves and branch) aqueous extracts for their ability to detoxify of aflatoxins B1 and B2 (AFB1; 100 μg L(-1) and AFB2; 50 μg L(-1)) by In Vitro assays and decontamination studies. Results indicated that O. basilicum leaves extract was found to be highly significant (P < 0.05) in degrading AFB1 and AFB2, i.e., 90.4 and 88.6%, respectively. However, O. basilicum branch, C. fistula leaves and branch extracts proved to be less efficient in degrading these aflatoxins, under optimized conditions, i.e., pH 8, temperature 30°C and incubation period of 72 h. Moreover the antifungal activity of these plants extracts were also tested. The findings depicted that O. basilicum leaves extract showed maximum growth inhibition of aflatoxigenic isolates, i.e., 82-87% as compared to other tested plants extracts. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that nine degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that O. basilicum leaves extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27471501

  17. Structural Analysis and Biological Toxicity of Aflatoxins B1 and B2 Degradation Products Following Detoxification by Ocimum basilicum and Cassia fistula Aqueous Extracts

    PubMed Central

    Iram, Wajiha; Anjum, Tehmina; Iqbal, Mazhar; Ghaffar, Abdul; Abbas, Mateen; Khan, Abdul Muqeet

    2016-01-01

    This study showed the comparison between Ocimum basilicum and Cassia fistula (leaves and branch) aqueous extracts for their ability to detoxify of aflatoxins B1 and B2 (AFB1; 100 μg L-1 and AFB2; 50 μg L-1) by In Vitro assays and decontamination studies. Results indicated that O. basilicum leaves extract was found to be highly significant (P < 0.05) in degrading AFB1 and AFB2, i.e., 90.4 and 88.6%, respectively. However, O. basilicum branch, C. fistula leaves and branch extracts proved to be less efficient in degrading these aflatoxins, under optimized conditions, i.e., pH 8, temperature 30°C and incubation period of 72 h. Moreover the antifungal activity of these plants extracts were also tested. The findings depicted that O. basilicum leaves extract showed maximum growth inhibition of aflatoxigenic isolates, i.e., 82–87% as compared to other tested plants extracts. The structural elucidation of degraded toxin products by LCMS/MS analysis showed that nine degraded products of AFB1 and AFB2 were formed. MS/MS spectra showed that most of the products were formed by the removal of double bond in the terminal furan ring and modification of lactone group indicating less toxicity as compared to parent compounds. Brine shrimps bioassay further confirmed the low toxicity of degraded products, showing that O. basilicum leaves extract can be used as an effective tool for the detoxification of aflatoxins. PMID:27471501

  18. Aflatoxins in pozol, a nixtamalized, maize-based food.

    PubMed

    Méndez-Albores, J A; Arámbula-Villa, G; Preciado-Ortíz, R E; Moreno-Martínez, E

    2004-07-15

    To determine whether pozol, a nixtamalized maize-based food was contaminated with aflatoxins, samples of non-fermented pozol were collected during the period November 2002 to April 2003 from local markets at Comitan in Chiapas, Mexico. The samples were analyzed for the presence of aflatoxins. Nineteen out of one hundred and eleven samples were contaminated with aflatoxin B2 (AFB2) and traces of aflatoxin B1 (AFB1). The percentage of samples contaminated with AFB2 in pozol prepared with white maize was 5.4%. Pozol mixed with toasted cacao paste had a contamination rate of 41.5%. No aflatoxins were detected in pozol prepared with yellow maize. It was found that only 1 of 19 contaminated samples had aflatoxin concentrations above 20 ppb. PMID:15193807

  19. Biological control of AFB1-producing Aspergillus section Flavi strains isolated from brewer's grains, alternative feed intended for swine production in Argentina.

    PubMed

    Asurmendi, Paula; García, María J; Ruíz, Francisco; Dalcero, Ana; Pascual, Liliana; Barberis, Lucila

    2016-07-01

    The aim of the present study was to investigate the inhibitory activity of lactic acid bacteria (LAB) isolated from brewer's grains on Aspergillus section Flavi growth and aflatoxin B1 production. The Aspergillus strains tested were inhibited by all the LAB strains assayed. The isolates Lactobacillus brevis B20, P. pentosaceus B86, Lactococcus lactis subsp. lactis B87, L. brevis B131, and Lactobacillus sp. B144 completely suppressed the fungal growth and reduced aflatoxin B1 production. In conclusion, LAB isolated from brewer's grains show a high inhibitory activity on fungal growth and aflatoxin biosynthesis by Aspergillus flavus and Aspergillus parasiticus. Further studies must be conducted to evaluate the success of in vitro assays under food environment conditions and to elucidate the antifungal mechanism of these strains. PMID:27070819

  20. Mechanism of aflatoxin uptake in roots of intact groundnut (Arachis hypogaea L.) seedlings.

    PubMed

    Snigdha, M; Hariprasad, P; Venkateswaran, G

    2013-12-01

    Aflatoxins are one of the most potent toxic substances that occur naturally, which enter agricultural soils through the growth of aflatoxigenic fungi in rhizhosphere and nonrhizhosphere soils. Though several reports regarding the uptake of aflatoxin by plants are available, the mechanism of aflatoxin uptake remains unknown. This study characterized the aflatoxin uptake mechanism by in vitro hydroponic experiments under variable conditions. The uptake reached saturation after 48 h of incubation for AFB1 and B2 and 60 h for AFG1 and G2. A linear increase in uptake with increasing aflatoxin concentrations was observed, and it fits both linear and nonlinear regression. AFB1 uptake was directly proportional to transpiration rate, and blocking aquaporin activity using mercuric chloride revealed its involvement in the uptake. None of the metabolic inhibitors used to block active transport had any effect on aflatoxin uptake except for sodium azide. From the present study, it could be concluded that aflatoxin uptake by groundnut roots followed mainly a passive way and is facilitated through aquaporins. The involvement of active component should be studied in detail. PMID:23660803

  1. Fluorimetric Immunoassay for Multianalysis of Aflatoxins

    PubMed Central

    2013-01-01

    A sensitive fluorimetric ELISA was developed for the analysis of aflatoxins. The assay was performed in a 384 microwell plate, wherein high specificity monoclonal antibody against AFM1 (mAb-AFM1) was used as capture antibody and FITC conjugated secondary antibody was used for detection and quantification of the analyte. The linear range of the immunoassay was found to be 6.25–50 pg/mL. AFM1 as low as 1 pg/mL was detected by this method with assay volume 40 μL. The multi-analysis of different aflatoxins was also investigated in the microwell plate, based on the cross-reactivity (CR) approach. Real milk samples were tested along with certified reference material by standard addition method and recovery analysis was done. The mAb-AFM1 showed 23.2% CR with AFB1, 50% CR with respect to AFM2, and least CR towards AFG1 (<1%). Furthermore, mixture analysis of AFM2 and AFB1 was carried out at specific concentrations of AFM1. The advantages of this developed immunoassay are high sensitivity, high throughput, multianalyte detection, versatility, and ease of handling. PMID:24000318

  2. Toxigenic potentiality of Aspergillus flavus and Aspergillus parasiticus strains isolated from black pepper assessed by an LC-MS/MS based multi-mycotoxin method.

    PubMed

    Yogendrarajah, Pratheeba; Devlieghere, Frank; Njumbe Ediage, Emmanuel; Jacxsens, Liesbeth; De Meulenaer, Bruno; De Saeger, Sarah

    2015-12-01

    A liquid chromatography triple quadrupole tandem mass spectrometry method was developed and validated to determine mycotoxins, produced by fungal isolates grown on malt extract agar (MEA). All twenty metabolites produced by different fungal species were extracted using acetonitrile/1% formic acid. The developed method was applied to assess the toxigenic potentiality of Aspergillus flavus (n = 11) and Aspergillus parasiticus (n = 6) strains isolated from black peppers (Piper nigrum L.) following their growth at 22, 30 and 37 °C. Highest mean radial colony growth rates were observed at 30 °C for A. flavus (5.21 ± 0.68 mm/day) and A. parasiticus (4.97 ± 0.33 mm/day). All of the A. flavus isolates produced aflatoxin B1 and O-methyl sterigmatocystin (OMST) while 91% produced aflatoxin B2 (AFB2) and 82% of them produced sterigmatocystin (STERIG) at 30 °C. Except one, all the A. parasiticus isolates produced all the four aflatoxins, STERIG and OMST at 30 °C. Remarkably high AFB1 was produced by some A. flavus isolates at 22 °C (max 16-40 mg/kg). Production of mycotoxins followed a different trend than that of growth rate of both species. Notable correlations were found between different secondary metabolites of both species; R(2) 0.87 between AFB1 and AFB2 production. Occurrence of OMST could be used as a predictor for AFB1 production. PMID:26338134

  3. The role of pre-symbiotic auxin signaling in ectendomycorrhiza formation between the desert truffle Terfezia boudieri and Helianthemum sessiliflorum.

    PubMed

    Turgeman, Tidhar; Lubinsky, Olga; Roth-Bejerano, Nurit; Kagan-Zur, Varda; Kapulnik, Yoram; Koltai, Hinanit; Zaady, Eli; Ben-Shabat, Shimon; Guy, Ofer; Lewinsohn, Efraim; Sitrit, Yaron

    2016-05-01

    The ectendomycorrhizal fungus Terfezia boudieri is known to secrete auxin. While some of the effects of fungal auxin on the plant root system have been described, a comprehensive understanding is still lacking. A dual culture system to study pre mycorrhizal signal exchange revealed previously unrecognized root-fungus interaction mediated by the fungal auxin. The secreted fungal auxin induced negative taproot gravitropism, attenuated taproot growth rate, and inhibited initial host development. Auxin also induced expression of Arabidopsis carriers AUX1 and PIN1, both of which are involved in the gravitropic response. Exogenous application of auxin led to a root phenotype, which fully mimicked that induced by ectomycorrhizal fungi. Co-cultivation of Arabidopsis auxin receptor mutants tir1-1, tir1-1 afb2-3, tir1-1 afb1-3 afb2-3, and tir1-1 afb2-3 afb3-4 with Terfezia confirmed that auxin induces the observed root phenotype. The finding that auxin both induces taproot deviation from the gravity axis and coordinates growth rate is new. We propose a model in which the fungal auxin induces horizontal root development, as well as the coordination of growth rates between partners, along with the known auxin effect on lateral root induction that increases the availability of accessible sites for colonization at the soil plane of fungal spore abundance. Thus, the newly observed responses described here of the root to Terfezia contribute to a successful encounter between symbionts. PMID:26563200

  4. Mycoflora and natural aflatoxin contamination in dried quince seeds from Jammu, India.

    PubMed

    Bala, Pinky; Gupta, Dimple; Sharma, Y P

    2016-01-01

    Eighty two samples of dried quince seeds, obtained from the markets of Jammu province, were examined for mycoflora by different isolation techniques. A total of 27 fungal species belonging to 11 genera were recovered and identified from these samples. The predominant fungal genera encountered were Aspergillus, Penicillium and Fusarium. In view of the predominance of Aspergillus flavus, a known producer of aflatoxins, screening of the fungal contaminated samples was carried out for total aflatoxin levels using high performance liquid chromatography (HPLC). Twenty one aflatoxin positive samples contained 8.07-33.45 μg g(-1) and 0.05-3946.97 μg g(-1) AFB1 and AFB2 respectively. These results suggest that biochemical composition of dried quince seeds, along with climatic conditions of the region seem to be very favourable for aflatoxin production by toxigenic strains of A. flavus. Therefore, monitoring of aflatoxins in dried quince seeds is recommended for this region. PMID:26930866

  5. Chicken Fetal Liver DNA Damage and Adduct Formation by Activation-Dependent DNA-Reactive Carcinogens and Related Compounds of Several Structural Classes

    PubMed Central

    Williams, Gary M.; Duan, Jian-Dong; Brunnemann, Klaus D.; Iatropoulos, Michael J.; Vock, Esther; Deschl, Ulrich

    2014-01-01

    The chicken egg genotoxicity assay (CEGA), which utilizes the liver of an intact and aseptic embryo-fetal test organism, was evaluated using four activation-dependent DNA-reactive carcinogens and four structurally related less potent carcinogens or non-carcinogens. In the assay, three daily doses of test substances were administered to eggs containing 9–11-day-old fetuses and the fetal livers were assessed for two endpoints, DNA breaks using the alkaline single cell gel electrophoresis (comet) assay and DNA adducts using the 32P-nucleotide postlabeling (NPL) assay. The effects of four carcinogens of different structures requiring distinct pathways of bioactivation, i.e., 2-acetylaminofluorene (AAF), aflatoxin B1 (AFB1), benzo[a]pyrene (B[a]P), and diethylnitrosamine (DEN), were compared with structurally related non-carcinogens fluorene (FLU) and benzo[e]pyrene (B[e]P) or weak carcinogens, aflatoxin B2 (AFB2) and N-nitrosodiethanolamine (NDELA). The four carcinogens all produced DNA breaks at microgram or low milligram total doses, whereas less potent carcinogens and non-carcinogens yielded borderline or negative results, respectively, at higher doses. AAF and B[a]P produced DNA adducts, whereas none was found with the related comparators FLU or B[e]P, consistent with comet results. DEN and NDELA were also negative for adducts, as expected in the case of DEN for an alkylating agent in the standard NPL assay. Also, AFB1 and AFB2 were negative in NPL, as expected, due to the nature of ring opened aflatoxin adducts, which are resistant to enzymatic digestion. Thus, the CEGA, using comet and NPL, is capable of detection of the genotoxicity of diverse DNA-reactive carcinogens, while not yielding false positives for non-carcinogens. PMID:24973097

  6. Surveys of rice sold in Canada for aflatoxins, ochratoxin A and fumonisins

    PubMed Central

    Bansal, J.; Pantazopoulos, P.; Tam, J.; Cavlovic, P.; Kwong, K.; Turcotte, A.-M.; Lau, B.P.-Y.; Scott, P.M.

    2011-01-01

    Approximately 200 samples of rice (including white, brown, red, black, basmati and jasmine, as well as wild rice) from several different countries, including the United States, Canada, Pakistan, India and Thailand, were analysed for aflatoxins, ochratoxin A (OTA) and fumonisins by separate liquid Chromatographic methods in two different years. The mean concentrations for aflatoxin B1 (AFB1) were 0.19 and 0.17 ng g−1 with respective positive incidences of 56% and 43% (≥ the limit of detection (LOD) of 0.002 ng g−1). Twenty-three samples analysed in the second year also contained aflatoxin B2 (AFB2) at levels ≥LOD of 0.002 ng g−1 The five most contaminated samples in each year contained 1.44–7.14 ng AFB1 g−1 (year 1) and 1.45–3.48 ng AFB1 g−1 (year 2); they were mostly basmati rice from India and Pakistan and black and red rice from Thailand. The average concentrations of ochratoxin A (OTA) were 0.05 and 0.005 ng g−1 in year 1 and year 2, respectively; incidences of samples containing ≥LOD of 0.05 ng g−1 were 43% and 1%, respectively, in the 2 years. All positive OTA results were confirmed by LC-MS/MS. For fumonisins, concentrations of fumonisin B1 (FB1) averaged 4.5 ng g−1 in 15 positive samples (≥0.7 ng g−1) from year 1 (n = 99); fumonisin B2 (FB2) and fumonisin B3 (FB3) were also present (≥1 ng g−1). In the second year there was only one positive sample (14 ng g−1 FB1) out of 100 analysed. All positive FB1 results were confirmed by LC-MS/MS. PMID:21623501

  7. Biotransformation of aflatoxin B1 and aflatoxin G1 in peanut meal by anaerobic solid fermentation of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus.

    PubMed

    Chen, Yujie; Kong, Qing; Chi, Chen; Shan, Shihua; Guan, Bin

    2015-10-15

    The purpose of this study was to explore the ability of anaerobic solid fermentation of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus to biotransform aflatoxins in peanut meal. The pH of the peanut meal was adjusted above 10, and then heated for 10 min at 100 °C, 115 °C and 121 °C. The S. thermophilus and L. delbrueckii subsp. bulgaricus were precultured together in MRS broth for 48 h at 37 °C. The heated peanut meal was mixed with precultured MRS broth containing 7.0×10(8) CFU/mL of S. thermophilus and 3.0×10(3) CFU/mL of L. delbrueckii subsp. bulgaricus with the ratio of 1 to 1 (weight to volume) and incubated in anaerobic jars at 37 °C for 3 days. The aflatoxin content in the peanut meal samples was determined by HPLC. The results showed that the peanut meal contained mainly aflatoxin B1 (AFB1) (10.5±0.64 μg/kg) and aflatoxin G1 (AFG1) (18.7±0.55 μg/kg). When heat treatment was combined with anaerobic solid fermentation, the biotransformation rate of aflatoxins in peanut meal could attain 100%. The cytotoxicity of fermented peanut meal to L929 mouse connective tissue fibroblast cells was determined by MTT assay and no significant toxicity was observed in the fermented peanut meal. Furthermore, heat treatment and anaerobic solid fermentation did not change the amino acid concentrations and profile in peanut meal. PMID:26143229

  8. The toxic effects of combined aflatoxins and zearalenone in naturally contaminated diets on laying performance, egg quality and mycotoxins residues in eggs of layers and the protective effect of Bacillus subtilis biodegradation product.

    PubMed

    Jia, Ru; Ma, Qiugang; Fan, Yu; Ji, Cheng; Zhang, Jianyun; Liu, Tao; Zhao, Lihong

    2016-04-01

    The toxic effect of aflatoxins (AF) and zearalenone (ZEA) and their combination on laying performance, egg quality and toxins residues in eggs, as well as the efficacy of Bacillus subtilis biodegradation product (BDP) for ameliorating these effects in layers were evaluated. Layers were submitted to a two phase experiment. The first phase was an intoxication period (18-23 wk) with birds fed 7 (3 × 2 + 1) diets (3 treatments with mycotoxins: AF (123.0 μg/kg), ZEA (260.2 μg/kg), or AF + ZEA (123.0 + 260.2 μg/kg); 2 treatments with or without BDP (1000 g/t); and a control group contained no toxins nor BDP). The next phase was a recovery period (24-29 wk) in which birds were fed a toxin-free diet. In the intoxication period, AF and AF + ZEA groups exhibited lower egg production, feed intake and shell thickness, and higher AFB1, AFB2 and AFM1 residues as compared with the control group. In addition, AF and ZEA exerted synergistic effects on egg production and feed intake. Moreover, AF alone or combined with ZEA had a continuous toxic effect on laying performance in the recovery phase. Addition of BDP offset these negative effects, showing that BDP has a protective effect on layers fed contaminated diets. PMID:26891816

  9. Hydrogen sulfide regulates abiotic stress tolerance and biotic stress resistance in Arabidopsis.

    PubMed

    Shi, Haitao; Ye, Tiantian; Han, Ning; Bian, Hongwu; Liu, Xiaodong; Chan, Zhulong

    2015-07-01

    Hydrogen sulfide (H2S) is an important gaseous molecule in various plant developmental processes and plant stress responses. In this study, the transgenic Arabidopsis thaliana plants with modulated expressions of two cysteine desulfhydrases, and exogenous H2S donor (sodium hydrosulfide, NaHS) and H2S scavenger (hypotaurine, HT) pre-treated plants were used to dissect the involvement of H2S in plant stress responses. The cysteine desulfhydrases overexpressing plants and NaHS pre-treated plants exhibited higher endogenous H2S level and improved abiotic stress tolerance and biotic stress resistance, while cysteine desulfhydrases knockdown plants and HT pre-treated plants displayed lower endogenous H2S level and decreased stress resistance. Moreover, H2S upregulated the transcripts of multiple abiotic and biotic stress-related genes, and inhibited reactive oxygen species (ROS) accumulation. Interestingly, MIR393-mediated auxin signaling including MIR393a/b and their target genes (TIR1, AFB1, AFB2, and AFB3) was transcriptionally regulated by H2S, and was related with H2S-induced antibacterial resistance. Moreover, H2S regulated 50 carbon metabolites including amino acids, organic acids, sugars, sugar alcohols, and aromatic amines. Taken together, these results indicated that cysteine desulfhydrase and H2S conferred abiotic stress tolerance and biotic stress resistance, via affecting the stress-related gene expressions, ROS metabolism, metabolic homeostasis, and MIR393-targeted auxin receptors. PMID:25329496

  10. Aflatoxins in selected Thai commodities.

    PubMed

    Tansakul, Natthasit; Limsuwan, Sasithorn; Böhm, Josef; Hollmann, Manfred; Razzazi-Fazeli, Ebrahim

    2013-01-01

    Aflatoxin (AF) B1, B2, G1 and G2 were determined in 120 samples of selected Thai commodities including unpolished rice, unpolished glutinous rice, chilli powder, whole dried chilli pods and raw peanut. The mean concentrations of the total AFs for analysed samples were 0.16, 25.43, 14.18, 6.62 and 1.43 µg kg(-1) with positive incidences of 4%, 20%, 97%, 37% and 30%, respectively. Quantitative analysis was performed using HPLC equipped with post-column derivatisation and fluorescence detection. Sample clean-up was carried out using immunoaffinity columns for selective enrichment of AFs. The method was validated by using certified reference material, which showed recoveries over 85%. The limit of detections (LODs) and limit of quantifications (LOQs) were in a range between 0.01-0.11 µg kg(-1) and 0.03-0.38 µg kg(-1), respectively. The results clearly demonstrated that AFs were detectable in different matrices. Chilli powder was found to have the highest level of AFs contamination followed by chilli pods, peanut and rice, respectively. However, among the selected commodities, unpolished rice contained only trace levels of AFB1 and AFB2. With regard to the fact that AFs are a natural contaminant in commodities, this report calls to attention the regular monitoring and effective control of food commodities to prevent health hazards. PMID:24779933

  11. Antifungal properties and inhibitory effects upon aflatoxin production of Thymus vulgaris L. by Aspergillus flavus Link.

    PubMed

    Kohiyama, Cássia Yumie; Yamamoto Ribeiro, Milene Mayumi; Mossini, Simone Aparecida Galerani; Bando, Erika; Bomfim, Natália da Silva; Nerilo, Samuel Botião; Rocha, Gustavo Henrique Oliveira; Grespan, Renata; Mikcha, Jane Martha Graton; Machinski, Miguel

    2015-04-15

    The antifungal and antiaflatoxigenic properties of Thymus vulgaris essential oil (TEO) were evaluated upon Aspergillus flavus "in vitro". Suspension containing 10(6) of A. flavus were cultivated with TEO in concentrations ranging from 50 to 500 μg/mL. TEO reached minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) at 250 μg/mL. Inhibition of ergosterol biosynthesis was detected at a concentration of 100 μg/mL of TEO. Morphological evaluation performed by both light microscopy and scanning electron microscopy showed that antifungal activity of TEO could be detected starting at a concentration of 50 μg/mL and the fungicide effect at a concentration of 250 μg/mL. TEO completely inhibited production of both B1 and B2 aflatoxins (AFB1 and AFB2) at a concentration of 150 μg/mL. This way, fungal biomass development and aflatoxin production were dependent on TEO concentration. Therefore, TEO was capable of controlling the growth of A. flavus and its production of aflatoxins. PMID:25466118

  12. Biosorption of B-aflatoxins Using Biomasses Obtained from Formosa Firethorn [Pyracantha koidzumii (Hayata) Rehder

    PubMed Central

    Ramales-Valderrama, Rosa Adriana; Vázquez-Durán, Alma; Méndez-Albores, Abraham

    2016-01-01

    Mycotoxin adsorption onto biomaterials is considered as a promising alternative for decontamination without harmful chemicals. In this research, the adsorption of B-aflatoxins (AFB1 and AFB2) using Pyracantha koidzumii biomasses (leaves, berries and the mixture of leaves/berries) from aqueous solutions was explored. The biosorbent was used at 0.5% (w/v) in samples spiked with 100 ng/mL of B-aflatoxin standards and incubated at 40 °C for up to 24 h. A standard biosorption methodology was employed and aflatoxins were quantified by an immunoaffinity column and UPLC methodologies. The biosorbent-aflatoxin interaction mechanism was investigated from a combination of zeta potential (ζ), Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). The highest aflatoxin uptakes were 86% and 82% at 6 h using leaves and the mixture of leaves/berries biomasses, respectively. A moderate biosorption of 46% was attained when using berries biomass. From kinetic studies, the biosorption process is described using the first order adsorption model. Evidence from FTIR spectra suggests the participation of hydroxyl, amine, carboxyl, amide, phosphate and ketone groups in the biosorption and the mechanism was proposed to be dominated by the electrostatic interaction between the negatively charged functional groups and the positively charged aflatoxin molecules. Biosorption by P. koidzumii biomasses has been demonstrated to be an alternative to conventional systems for B-aflatoxins removal. PMID:27420096

  13. Fabrication of a novel nanocomposite based on sol-gel process for hollow fiber-solid phase microextraction of aflatoxins: B1 and B2, in cereals combined with high performane liquid chromatography-diode array detection.

    PubMed

    Es'haghi, Zarrin; Sorayaei, Hoda; Samadi, Fateme; Masrournia, Mahboubeh; Bakherad, Zohreh

    2011-10-15

    The new pre-concentration technique, hollow fiber-solid phase microextraction based on carbon nanotube reinforced sol-gel and liquid chromatography-photodiode array detection was applied to determination of aflatoxins B(1), B(2) (AFB(1), AFB(2)) in rice, peanut and wheat samples. This research provides an overview of trends related to synthesis of solid phase microextraction (SPME) sorbnents that improves the assay of aflatoxins as the semi-polar compounds in several real samples. It mainly includes summary and a list of the results for a simple carbon nanotube reinforced sol-gel in-fiber device. This device was used for extraction, pre-concentration and determination of aflatoxins B1, B2 in real samples. In this technique carbon nanotube reinforced sol was prepared by the sol-gel method via the reaction of phenyl trimethoxysilane (PTMS) with a basic catalyst (tris hydroxymethyl aminomethan). The influences of microextraction parameters such as pH, ageing time, carbon nanotube contents, desorption conditions, desorption solvent and agitation speed were investigated. Optimal HPLC conditions were: C(18) reversed phase column for separation, water-acetonitril-methanol (35:10:55) as the mobile phase and maximum wavelength for detection was 370 nm. The method was evaluated statistically and under optimized conditions, the detection limits for the analytes were 0.074 and 0.061 ng/mL for B1 and B2 respectively. Limit of quantification for B1 and B2 was 0.1 ng/mL too (n=7). The precisions were in the range of 2.829-2.976% (n=3), and linear ranges were within 0.1 and 400 ng/mL. The method was successfully applied to the analysis of cereals (peanut, wheat, rice) with the relative recoveries from 47.43% to 106.83%. PMID:21925977

  14. Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana.

    PubMed

    Vidal, Elena A; Araus, Viviana; Lu, Cheng; Parry, Geraint; Green, Pamela J; Coruzzi, Gloria M; Gutiérrez, Rodrigo A

    2010-03-01

    One of the most striking examples of plant developmental plasticity to changing environmental conditions is the modulation of root system architecture (RSA) in response to nitrate supply. Despite the fundamental and applied significance of understanding this process, the molecular mechanisms behind nitrate-regulated changes in developmental programs are still largely unknown. Small RNAs (sRNAs) have emerged as master regulators of gene expression in plants and other organisms. To evaluate the role of sRNAs in the nitrate response, we sequenced sRNAs from control and nitrate-treated Arabidopsis seedlings using the 454 sequencing technology. miR393 was induced by nitrate in these experiments. miR393 targets transcripts that code for a basic helix-loop-helix (bHLH) transcription factor and for the auxin receptors TIR1, AFB1, AFB2, and AFB3. However, only AFB3 was regulated by nitrate in roots under our experimental conditions. Analysis of the expression of this miR393/AFB3 module, revealed an incoherent feed-forward mechanism that is induced by nitrate and repressed by N metabolites generated by nitrate reduction and assimilation. To understand the functional role of this N-regulatory module for plant development, we analyzed the RSA response to nitrate in AFB3 insertional mutant plants and in miR393 overexpressors. RSA analysis in these plants revealed that both primary and lateral root growth responses to nitrate were altered. Interestingly, regulation of RSA by nitrate was specifically mediated by AFB3, indicating that miR393/AFB3 is a unique N-responsive module that controls root system architecture in response to external and internal N availability in Arabidopsis. PMID:20142497

  15. Portable visual quantitative detection of aflatoxin B1 using a target-responsive hydrogel and a distance-readout microfluidic chip.

    PubMed

    Ma, Yanli; Mao, Yu; Huang, Di; He, Zhe; Yan, Jinmao; Tian, Tian; Shi, Yuanzhi; Song, Yanling; Li, Xingrui; Zhu, Zhi; Zhou, Leiji; Yang, Chaoyong James

    2016-08-01

    Aflatoxin B1 (AFB1), as the secondary metabolite of molds, is the most predominant and toxic mycotoxin that seriously threatens the health of humans and animals. In this work, an AFB1-responsive hydrogel was synthesized for highly sensitive and portable detection of AFB1. The AFB1-responsive hydrogel was prepared using an AFB1 aptamer and its two short complementary DNA strands as cross-linkers. For visual detection of AFB1, the hydrogel is preloaded with gold nanoparticles (AuNPs). Upon introduction of AFB1, the AFB1 aptamer binds with AFB1, leading to the disruption of the hydrogel and release of the AuNPs with a distinct color change of the supernatant from colorless to red. In order to lower the detection limit and extend the method to quantitative analysis, a distance-readout volumetric bar chart chip (V-chip) was combined with an AFB1-responsive hydrogel preloaded with platinum nanoparticles (PtNPs). In the presence of AFB1, the hydrogel collapses and releases PtNPs which can catalyze the decomposition of H2O2 to generate O2. The increasing gas pressure moves a red ink bar in the V-chip and provides a quantitative relationship between the distance and the concentration of AFB1. The method was applied for detection of AFB1 in beer, with a detection limit of 1.77 nM (0.55 ppb) where an immunoaffinity column (IAC) of AFB1 was used to cleanup and pre-concentrate the sample, which satisfies the testing requirement of 2.0 ppb set by the European Union. The combination of an AFB1-responsive hydrogel with a distance-based readout V-chip offers a user-friendly POCT device, which has great potential for rapid, portable, selective, and quantitative detection of AFB1 in real samples to ensure food safety and avoid subsequent economic losses. PMID:27302553

  16. Aspergillus flavus Aflatoxin Occurrence and Expression of Aflatoxin Biosynthesis Genes in Soil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The carcinogen, aflatoxin B1 (AFB1) produced by Aspergillus flavus, is a major food safety concern in crops. However, information on AFB1 occurrence in soil and crop residue is scarce. A series of experiments investigated the occurrence of AFB1 in soil and corn residues, and ascertained the ecology ...

  17. Human health implications from co-exposure to aflatoxins and fumonisins in maize-based foods in Latin America: Guatemala as a case study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Co-occurence of fumonisin B1 (FB1) and aflatoxin B1 (AFB1) in maize has been demonstrated in many surveys. Combined-exposure to FB1 and AFB1 was of concern to the Joint FAO/WHO Expert Committee on Food Additives because of the known genotoxicity of AFB1 and the ability of FB1 to induce regenerative...

  18. Low cost quantitative digital imaging as an alternative to qualitative in vivo bioassays for analysis of active aflatoxin B1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin B1 (AFB1) producing fungi contaminate food and feed and are a major health concern. To minimize the sources and incidence of AFB1 illness there is a need to develop affordable, sensitive mobile devices for detection of active AFB1. In the present study we used a low cost fluorescence detec...

  19. Carcinogenic effects of aflatoxin B1 among wheat handlers

    PubMed Central

    Saad-Hussein, Amal; Taha, Mona M; Beshir, Safia; Shahy, Eman M; Shaheen, Weam; Elhamshary, Mohamed

    2014-01-01

    Background: Epidemiological studies have demonstrated that serum aflatoxin B1 (AFB1) is a hepatocarcinogenic mycotoxin and contributor to the high rate of hepatocellular carcinoma (HCC). The prevalence of liver cancer in Egypt is particularly worrisome. In a registry-based analysis of occupational risk for HCC, significant excesses were observed especially for grain mill workers. Objective: The aim of this study was to assess the hepatic carcinogenicity of AFB1 in wheat handlers. Methods: Serum AFB1/albumin (AFB1/Alb), alpha-fetoprotein (AFP), alpha-l-fucosidase (AFU), and arginase were estimated in exposed wheat handlers including millers and bakers. The control group was composed of non-occupationally exposed workers. Results: AFB1/Alb and AFU were significantly higher among workers employed as bakers compared to mill workers and controls. Mill workers had higher levels of AFB1/Alb than the controls. AFB1/Alb, AFP, and AFU were all significantly higher and arginase was significantly lower among HCC cases compared to the other groups. There was a significant correlation between AFU and AFB1/Alb in bakers and between AFP and AFB1/Alb in HCC cases. Arginase was inversely correlated with AFB1/Alb in HCC cases. AFB1/Alb was significantly correlated with the duration of exposure in bakers. Conclusion: Wheat handlers exposed to Aspergillus flavus have a high risk of elevated serum AFB1/Alb levels and AFU. PMID:25000109

  20. The effect of aflatoxin-B1 on red drum (Sciaenops ocellatus) and assessment of dietary supplementation of NovaSil for the prevention of aflatoxicosis.

    PubMed

    Zychowski, Katherine E; Hoffmann, Aline Rodrigues; Ly, Hoai J; Pohlenz, Camilo; Buentello, Alejandro; Romoser, Amelia; Gatlin, Delbert M; Phillips, Timothy D

    2013-09-01

    Aflatoxin B1 (AFB1) is a potent carcinogen that causes growth stunting, immunosuppression and liver cancer in multiple species. The recent trend of replacing fishmeal with plant-based proteins in fish feed has amplified the AFB1 exposure risk in farm-raised fish. NovaSil (NS), a calcium montmorillonite clay, has previously been shown to reduce AFB1 bioavailability safely and efficaciously in several mammalian species. This study was designed to: (1) evaluate AFB1 impact on cultured red drum, Sciaenops ocellatus, over the course of seven weeks; and (2) assess NS supplementation as a strategy to prevent aflatoxicosis. Fish were fed diets containing 0, 0.1, 0.25, 0.5, 1, 2, 3, or 5 ppm AFB1. Two additional treatment groups were fed either 5 ppm AFB1 + 1% NS or 5 ppm AFB1 + 2% NS. Aflatoxin B1 negatively impacted red drum weight gain, survival, feed efficiency, serum lysozyme concentration, hepatosomatic index (HSI), whole-body lipid levels, liver histopathological scoring, as well as trypsin inhibition. NovaSil inclusion in AFB1-contaminated diets improved weight gain, feed efficiency, serum lysozyme concentration, muscle somatic index, and intraperitoneal fat ratios compared to AFB1-treated fish. Although not significant, NS reduced AFB1-induced histopathological changes in the liver and decreased Proliferating Cell Nuclear Antigen (PCNA) staining. Importantly, NS supplementation improved overall health of AFB1-exposed red drum. PMID:24064717

  1. Temporary modulation of responses to common vaccines and serum cation status in broilers during exposure to low doses of aflatoxin B1.

    PubMed

    Yunus, A W; Böhm, J

    2013-11-01

    The purpose of this study was to observe the effects of low doses of aflatoxin B1 (AFB1) on responses to common vaccines and levels of serum cations in broilers. Male broilers at 7 d of age were fed control (no AFB1), a 75 µg of AFB1/kg (75 ppb of AFB1) diet, or a 750 µg of AFB1/kg (750 ppb of AFB1) diet. The 750 ppb of AFB1 diet resulted in a temporary increase in ELISA titers against Newcastle disease virus (P = 0.014) and infectious bursal disease virus (P = 0.005) during wk 2 and 4 of exposure, respectively, compared with the control diet. Conversely, lower (P ≤ 0.01) serum protein concentrations were found in broilers under the 750 ppb AFB1 diet during wk 2 and 4. During wk 2 of exposure, lower serum levels of potassium were noted in birds under both the 75 (P = 0.037) and 750 ppb (P = 0.000) AFB1 diets compared with those under the control diet. During wk 5, higher serum magnesium (P = 0.004), and sodium (P = 0.000) under the 750 ppb AFB1 diet were found compared with the control diet. These data indicate that low dietary levels of AFB1 can temporarily increase or decrease the studied serological variables in broilers depending upon the stage of exposure. PMID:24135593

  2. Electrochemical Immunosensor Based on Polythionine/Gold Nanoparticles for the Determination of Aflatoxin B1

    PubMed Central

    Owino, Joseph H.O.; Arotiba, Omotayo A.; Hendricks, Nicolette; Songa, Everlyne A.; Jahed, Nazeem; Waryo, Tesfaye T.; Ngece, Rachel F.; Baker, Priscilla G.L.; Iwuoha, Emmanuel I.

    2008-01-01

    An aflatoxin B1 (AFB1) electrochemical immunosensor was developed by the immobilisation of aflatoxin B1-bovine serum albumin (AFB1-BSA) conjugate on a polythionine (PTH)/gold nanoparticles (AuNP)-modified glassy carbon electrode (GCE). The surface of the AFB1-BSA conjugate was covered with horseradish peroxidase (HRP), in order to prevent non-specific binding of the immunosensors with ions in the test solution. The AFB1 immunosensor exhibited a quasi-reversible electrochemistry as indicated by a cyclic voltammetric (CV) peak separation (ΔEp) value of 62 mV. The experimental procedure for the detection of AFB1 involved the setting up of a competition between free AFB1 and the immobilised AFB1-BSA conjugate for the binding sites of free anti-aflatoxin B1 (anti-AFB1) antibody. The immunosensor's differential pulse voltammetry (DPV) responses (peak currents) decreased as the concentration of free AFB1 increased within a dynamic linear range (DLR) of 0.6 - 2.4 ng/mL AFB1 and a limit of detection (LOD) of 0.07 ng/mL AFB1. This immunosensing procedure eliminates the need for enzyme-labeled secondary antibodies normally used in conventional ELISA–based immunosensors.

  3. Protective Roles of Sodium Selenite against Aflatoxin B1-Induced Apoptosis of Jejunum in Broilers

    PubMed Central

    Peng, Xi; Zhang, Shengqiang; Fang, Jing; Cui, Hengmin; Zuo, Zhicai; Deng, Junliang

    2014-01-01

    The effects of aflatoxin B1 (AFB1) exposure and sodium selenite supplementation on cell apoptosis of jejunum in broilers were studied. A total of 240 one-day-old male AA broilers were randomly assigned four dietary treatments containing 0 mg/kg of AFB1 (control), 0.3 mg/kg AFB1 (AFB1), 0.4 mg/kg supplement Se (+ Se) and 0.3 mg/kg AFB1 + 0.4 mg/kg supplement Se (AFB1 + Se), respectively. Compared with the control broilers, the number of apoptotic cells, the expression of Bax and Caspase-3 mRNA were significantly increased, while the expression of Bcl-2 mRNA and the Bcl-2/Bax ratio were significantly decreased in AFB1 broilers. The number of apoptotic cells and the expression of Caspase-3 mRNA in AFB1 + Se broilers were significantly higher than those in the control broilers, but significantly lower than those in AFB1 broilers. There were no significant changes in the expression of Bax mRNA between AFB1 + Se and control broilers; the expression of Bcl-2 mRNA and the Bcl-2/Bax ratio in AFB1 + Se broilers were significantly lower than those in the control broilers, but significantly higher than those in AFB1 broilers. In conclusion, 0.3 mg/kg AFB1 in the diet can increase cell apoptosis, decrease Bcl-2 mRNA expression, and increase of Bax and Caspase-3 mRNA expression in broiler’s jejunum. However, supplementation of dietary sodium selenite at the concentration of 0.4 mg/kg Se may ameliorate AFB1-induced apoptosis by increasing Bcl-2 mRNA expression, and decreasing Bax and Caspase-3 mRNA expression. PMID:25526081

  4. Low cost quantitative digital imaging as an alternative to qualitative in vivo bioassays for analysis of active aflatoxin B1.

    PubMed

    Rasooly, Reuven; Do, Paula M; Hernlem, Bradley J

    2016-06-15

    Aflatoxin B1 (AFB1) producing fungi contaminate food and feed and are a major health concern. To minimize the sources and incidence of AFB1 illness there is a need to develop affordable, sensitive mobile devices for detection of active AFB1. In the present study we used a low cost fluorescence detector and describe two quantitative assays for detection of detoxified and active AFB1 demonstrating that AFB1 concentration can be measured as intensity of fluorescence. When the assay plate containing increasing concentrations of AFB1 is illuminated with a 366 nm ultraviolet lamp, AFB1 molecules absorb photons and emit blue light with peak wavelength of 432 nm. The fluorescence intensity increased in dose dependent manner. However, this method cannot distinguish between active AFB1 which poses a threat to health, and the detoxified AFB1 which exhibits no toxicity. To measure the toxin activity, we used a cell based assay that makes quantification more robust and is capable of detecting multiple samples simultaneously. It is an alternative to the qualitative duckling bioassay which is the "gold-standard" assay currently being used for quantitative analysis of active AFB1. AFB1 was incubated with transduced Vero cells expressing the green fluorescence protein (GFP) gene. After excitation with blue light at 475 nm, cells emitted green light with emission peak at 509 nm. The result shows that AFB1 inhibits protein expression in a concentration dependent manner resulting in proportionately less GFP fluorescence in cells exposed to AFB1. The result also indicates strong positive linear relationship with R(2)=0.90 between the low cost CCD camera and a fluorometer, which costs 100 times more than a CCD camera. This new analytical method for measuring active AFB1 is low in cost and combined with in vitro assay, is quantitative. It also does not require the use of animals and may be useful especially for laboratories in regions with limited resources. PMID:26874107

  5. Occupational Exposure to Aflatoxin B1 in a Portuguese Poultry Slaughterhouse.

    PubMed

    Viegas, Susana; Veiga, Luísa; Almeida, Ana; dos Santos, Mateus; Carolino, Elisabete; Viegas, Carla

    2016-03-01

    Aflatoxin B1 (AFB1) is a secondary metabolite produced by the fungi Aspergillus flavus and is the most potent hepatocarcinogen known in mammals and has been classified by the International Agency of Research on Cancer as Group 1 carcinogen. Although dietary exposure to AFB1 has been extensively documented, there are still few studies dedicated to the problem of occupational exposure. Considering recent findings regarding AFB1 occupational exposure in poultry production, it was considered relevant to clarify if there is also exposure in poultry slaughterhouses. Occupational exposure assessment to AFB1 was done with a biomarker of internal dose that measures AFB1 in the serum by enzyme-linked immunosorbent assay. Thirty workers from a slaughterhouse were enrolled in this study. A control group (n = 30) was also considered in order to know AFB1 background levels for Portuguese population. Fourteen workers (47.0%) showed detectable levels of AFB1 with values from 1.06 to 4.03ng ml(-1), with a mean value of 1.73ng ml(-1). No AFB1 was detected in serum of individuals used as controls. Despite uncertainties regarding the exposure route that is contributing more to exposure (inhalation or dermal) is possible to state that exposure to AFB1 is occurring in the slaughterhouse studied. It seems that reducing AFB1 contamination in poultry production can have a positive result in this occupational setting. PMID:26568583

  6. Aflatoxin B1, zearalenone and deoxynivalenol in feed ingredients and complete feed from central China.

    PubMed

    Liu, Jie; Sun, Lvhui; Zhang, Jiacai; Guo, Jiao; Chen, Lei; Qi, Desheng; Zhang, Niya

    2016-06-01

    Between 2012 and 2014, 2528 feed ingredient and complete feed samples were collected from central China. Numbers of 2083, 255 and 190 samples were analysed for aflatoxin B1 (AFB1), zearalenone (ZEN) and deoxynivalenol (DON), respectively, by high-performance liquid chromatography in combination with UV or fluorescence detection. The incidence rates of AFB1, ZEN and DON contamination of feed ingredients and complete feeds were 33.9%, 90.2% and 77.4%, respectively. The percentage of positive samples for AFB1 ranged from 13.1% to 97.1%. Cottonseed meal presented the most serious contamination by AFB1. ZEN and DON contamination levels of feeds ranged from 50% to 100%, indicating serious contamination over the studied 3-year period. This study demonstrates that AFB1, ZEN and DON contamination of feeds in central China is serious and differs over the years. Feeds are mostly contaminated with ZEN, followed by DON and AFB1. PMID:26771914

  7. Spectral characteristics of fluorescence and circular dichroism of aflatoxin B1 reaction with its anti-idiotypic antibody

    NASA Astrophysics Data System (ADS)

    Liu, Aiping; Yang, Hongxiu; Wang, Xiaohong; Chen, Fusheng

    2012-11-01

    Aflatoxin B1 (AFB1) is a toxic secondary metabolite and sensitive methods for its analysis have been developed. In our lab, a number of works have been carried out, including exploitation of detection methods and production of anti-idiotypic antibody (Ab2) against Fab fragment of anti-AFB1 antibody (Ab1). In this paper, Ab2 was generated upon the immunization of mice with F(ab')2 fragment, which was specific to AFB1 and obtained by pepsin digestion of Ab1. The characteristics of Ab2 was primarily investigated by indirect competitive enzyme-linked immunosorbent assay (icELISA), which indicated that Ab2, might bear an internal image of antigen AFB1 and was able to combine to F(ab')2 in competition with AFB1, and the concentration of Ab2 to cause 50% inhibition of binding (IC50) was 131.8 μg/mL. In addition, fluorescence and circular dichroism studies were designed to explore the mutual relationship among AFB1, F(ab')2 and Ab2. The fluorescence spectroscopy implied that both AFB1 and Ab2 act as a quencher upon F(ab')2, and the Ab2 could compete with AFB1 when both of Ab2 and AFB1 reacted with F(ab')2. The circular dichroism (CD) spectrum suggested that both the binding of Ab2 and AFB1 on F(ab')2 brought secondary conformation change of F(ab')2, especially in the changes of α helix and β sheet. The research performed would provide unique insight into the comprehension of interaction among AFB1, F(ab')2 and Ab2 as well as offer structural information for substitution researches of toxic antigen like AFB1.

  8. Analysis of aflatoxin b1 in Iranian foods using HPLC and a monolithic column and estimation of its dietary intake.

    PubMed

    Yazdanpanah, Hassan; Zarghi, Afshin; Shafaati, Ali Reza; Foroutan, Seyed Mohsen; Aboul-Fathi, Farshid; Khoddam, Arash; Nazari, Firoozeh; Shaki, Fatemeh

    2013-01-01

    A high performance liquid chromatographic method was developed for determination of aflatoxin B1 (AFB1) in foods using a monolithic column with sample clean up on an immunoaffinity column. The method was validated for analysis of AFB1 in rice, bread, puffed corn snack, wheat flour and peanut samples. The average recoveries for AFB1 in different foods ranged from 94.4 to 102.5% with the coefficient of variation lower than 10% for all foods. Limit of detection was 0.01 ng/g. A survey of AFB1 was performed on 90 samples collected from Tehran retail market in June 2005. The results showed that none of the bread and wheat flour samples were contaminated with AFB1. The mean AFB1 levels in rice, puffed corn snack and peanut samples were 4.17, 0.11, and 1.97 ng/g, respectively. The level of contamination of 3 samples (one rice sample and two peanuts samples) to AFB1 was found to be higher than 5 ng/g. Although all food samples had mean concentration of AFB1 below the maximum tolerated level in Iran, the mean intake of AFB1 from rice was estimated 3.49 times higher than the guidance value of 1 ng AFB1/Kg body weight/day. Therefore, it is strongly recommended to monitor AFB1 in foods, especially in rice, in Iran. This is the first study on exposure assessment of Iranian population to AFB1. PMID:24250676

  9. Analysis of Aflatoxin B1 in Iranian Foods Using HPLC and a Monolithic Column and Estimation of its Dietary Intake

    PubMed Central

    Yazdanpanah, Hassan; Zarghi, Afshin; Shafaati, Ali Reza; Foroutan, Seyed Mohsen; Aboul-Fathi, Farshid; Khoddam, Arash; Nazari, Firoozeh; Shaki, Fatemeh

    2013-01-01

    A high performance liquid chromatographic method was developed for determination of aflatoxin B1 (AFB1) in foods using a monolithic column with sample clean up on an immunoaffinity column. The method was validated for analysis of AFB1 in rice, bread, puffed corn snack, wheat flour and peanut samples. The average recoveries for AFB1 in different foods ranged from 94.4 to 102.5% with the coefficient of variation lower than 10% for all foods. Limit of detection was 0.01 ng/g. A survey of AFB1 was performed on 90 samples collected from Tehran retail market in June 2005. The results showed that none of the bread and wheat flour samples were contaminated with AFB1. The mean AFB1 levels in rice, puffed corn snack and peanut samples were 4.17, 0.11, and 1.97 ng/g, respectively. The level of contamination of 3 samples (one rice sample and two peanuts samples) to AFB1 was found to be higher than 5 ng/g. Although all food samples had mean concentration of AFB1 below the maximum tolerated level in Iran, the mean intake of AFB1 from rice was estimated 3.49 times higher than the guidance value of 1 ng AFB1/Kg body weight/day. Therefore, it is strongly recommended to monitor AFB1 in foods, especially in rice, in Iran. This is the first study on exposure assessment of Iranian population to AFB1. PMID:24250676

  10. Effect of Sodium Selenite on Pathological Changes and Renal Functions in Broilers Fed a Diet Containing Aflatoxin B1

    PubMed Central

    Liang, Na; Wang, Fengyuan; Peng, Xi; Fang, Jing; Cui, Hengmin; Chen, Zhengli; Lai, Weimin; Zhou, Yi; Geng, Yi

    2015-01-01

    To evaluate the renal toxicity of dietary aflatoxin B1 (AFB1) and ameliorating effects of added dietary sodium selenite in broiler, renal histopathological changes, ultrastructural changes, and renal function parameters were monitored at 7, 14, and 21 days of age. Two hundred one-day-old healthy male Avian broilers were divided into four groups, namely control group, AFB1 group (0.3 mg/kg AFB1), +Se group (0.4 mg/kg Se), and AFB1+Se group (0.3 mg/kg AFB1+0.4 mg/kg Se). Compared with that of the control group, the relative weight of kidney was increased in the AFB1 group. There were no significant differences between the AFB1+Se group and the control group. By histopathological observation, the renal epithelia were swelling and necrosis at 7 and 21 days of age. Ultrastructurally, the lipid droplets and expanded endoplasmic reticulum appeared in the plasma of epithelia cells in the AFB1 group. Enlarged mitochondria with degenerated cristae were observed in the +Se group. Compared with the control group, the contents of serum creatinine and serum uric acid in the AFB1 group were increased, while the activity of renal Na+-K+ ATPase was decreased. When 0.4 mg/kg selenium was added into the diet containing 0.3 mg/kg AFB1, there were no obvious histological changes in the AFB1+Se group, and the contents of the serum creatinine and serum uric acid contents and the activity of renal Na+-K+ ATPase were close to those in the control group. In conclusion, sodium selenite exhibited protective effects on AFB1-induced kidney toxicity in broilers. PMID:26371027

  11. Sulforaphane, a cancer chemopreventive agent, induces pathways associated with membrane biosynthesis in response to tissue damage by aflatoxin B1

    PubMed Central

    Techapiesancharoenkij, Nirachara; Fiala, Jeannette L. A.; Navasumrit, Panida; Croy, Robert G.; Wogan, Gerald N.; Groopman, John D.; Ruchirawat, Mathuros; Essigmann, John M.

    2015-01-01

    Aflatoxin B1 (AFB1) is one of the major risk factors for liver cancer globally. A recent study showed that sulforaphane (SF), a potent inducer of phase II enzymes that occurs naturally in widely consumed vegetables, effectively induces hepatic glutathione S-transferases (GSTs) and reduces levels of hepatic AFB1-DNA adducts in AFB1-exposed Sprague Dawley rats. The present study characterized the effects of SF pre-treatment on global gene expression in the livers of similarly treated male rats. Combined treatment with AFB1 and SF caused reprogramming of a network of genes involved in signal transduction and transcription. Changes in gene regulation were observable 4 h after AFB1 administration in SF-pretreated animals and may reflect regeneration of cells in the wake of AFB1-induced hepatotoxicity. At 24 h after AFB1 administration, significant induction of genes that play roles in cellular lipid metabolism and acetyl-CoA biosynthesis was detected in SF-pretreated AFB1-dosed rats. Induction of this group of genes may indicate a metabolic shift toward glycolysis and fatty acid synthesis to generate and maintain pools of intermediate molecules required for tissue repair, cell growth and compensatory hepatic cell proliferation. Collectively, gene expression data from this study provide insights into molecular mechanisms underlying the protective effects of SF against AFB1 hepatotoxicity and hepatocarcinogenicity, in addition to the chemopreventive activity of this compound as a GST inducer. PMID:25450479

  12. Genome-Wide and Differential Proteomic Analysis of Hepatitis B Virus and Aflatoxin B1 Related Hepatocellular Carcinoma in Guangxi, China

    PubMed Central

    Chen, Zhao-Hong; Bai, Tao; Xiang, Bang-De; Qin, Xiao; Xiao, Kai-Yin; Peng, Min-Hao; Liu, Zhi-Ming; Liu, Tang-Wei; Qin, Xue; Li, Shan; Han, Ze-Guang; Mo, Zeng-Nan; Santella, Regina M.; Winkler, Cheryl A.; O’Brien, Stephen J.; Peng, Tao

    2013-01-01

    Both hepatitis B virus (HBV) and aflatoxin B1 (AFB1) exposure can cause liver damage as well as increase the probability of hepatocellular carcinoma (HCC). To investigate the underlying genetic changes that may influence development of HCC associated with HBV infection and AFB1 exposure, HCC patients were subdivided into 4 groups depending upon HBV and AFB1 exposure status: (HBV(+)/AFB1(+), HBV(+)/AFB1(-), HBV(-)/AFB1(+), HBV(-)/AFB1(-)). Genetic abnormalities and protein expression profiles were analyzed by array-based comparative genomic hybridization and isobaric tagging for quantitation. A total of 573 chromosomal aberrations (CNAs) including 184 increased and 389 decreased were detected in our study population. Twenty-five recurrently altered regions (RARs; chromosomal alterations observed in ≥10 patients) in chromosomes were identified. Loss of 4q13.3-q35.2, 13q12.1-q21.2 and gain of 7q11.2-q35 were observed with a higher frequency in the HBV(+)/AFB1(+), HBV(+)/AFB1(-) and HBV(-)/AFB1(+) groups compared to the HBV(-)/AFB(-) group. Loss of 8p12-p23.2 was associated with high TNM stage tumors (P = 0.038) and was an unfavorable prognostic factor for tumor-free survival (P =0.045). A total of 133 differentially expressed proteins were identified in iTRAQ proteomics analysis, 69 (51.8%) of which mapped within identified RARs. The most common biological processes affected by HBV and AFB1 status in HCC tumorigenesis were detoxification and drug metabolism pathways, antigen processing and anti-apoptosis pathways. Expression of AKR1B10 was increased significantly in the HBV(+)/AFB1(+) and HBV(-)/AFB1(+) groups. A significant correlation between the expression of AKR1B10 mRNA and protein levels as well as AKR1B10 copy number was observered, which suggest that AKR1B10 may play a role in AFB1-related hepatocarcinogenesis. In summary, a number of genetic and gene expression alterations were found to be associated with HBV and AFB1- related HCC. The possible synergistic

  13. Effects of prolonged oral administration of aflatoxin B1 and fumonisin B1 in broiler chickens.

    PubMed

    Del Bianchi, M; Oliveira, C A F; Albuquerque, R; Guerra, J L; Correa, B

    2005-12-01

    The effects of prolonged oral administration of aflatoxin B1 (AFB1) and fumonisin B1 (FB1) mycotoxins were evaluated in broiler chickens from 21 to 42 d of age. A total of 192 birds were housed in experimental batteries and assigned to 32 cages, 6 birds per cage. The following treatments were applied: 1) 0 mycotoxins (control), 2) 10 mg of FB1, 3) 50 microg of AFB1, 4) 50 microg of AFB1 + 10 mg of FB1, 5) 350 microg of AFB1, 6) 350 microg of AFB1 + 10 mg of FB1, 7) 2,450 microg of AFB1, 8) 2,450 microg of AFB1 + 10 mg of FB1/kg of feed. Each treatment consisted of 4 replicates of 6 birds each. At the end of the trial, blood samples from 12 birds per treatment were collected, and the birds were necropsied. Compared with controls, the percentage of heterophils was lower (P < 0.05) in birds from groups receiving 50 microg of AFB1/kg + 10 mg of FB1/ kg and 2450 microg of AFB1/kg alone or in combination with FB1. A higher percentage of lymphocytes (P < 0.05) was observed in birds fed 50 microg of AFB1/kg + 10 mg of FB1/ kg, 350 microg of AFB1/kg, and 2,450 microg of AFB1/kg. A decrease in plasma albumin was observed only in birds fed 2,450 microg of AFB1/kg + 10 mg of FB1/kg. The liver of AFB1-treated birds had focal areas of necrosis and inflammatory infiltrates. In birds fed rations containing only 10 mg of FB1/kg, bile duct hyperplasia with fibrosis and a mononuclear infiltrate accompanied by trabecular derangement were observed. In contrast, in treatments in which FB1 was administered in combination, hepatic vacuolar degeneration was observed, and renal tissue presented corpuscles with increased cellular agglomeration, characterizing glomerulonephritis, and a clearly visible tubular epithelium with areas of degeneration and necrosis. The FB1 residues were detected in liver and in excreta of all FB1-treated groups, at levels that ranged from 0.013 to 0.051 mg/kg and from 1.19 to 2.79 mg/kg, respectively. Results indicated that FB1 and AFB1, singly or in combination

  14. Study of Protective Effect of Date and Nigella Sativa on Aflatoxin B1 Toxicity

    PubMed Central

    Al-Ghasham, Abdalla; Ata, Hesham Saad; El-Deep, Said; Meki, Abdel-Raheim; Shehada, Salah

    2008-01-01

    Background: Many medicinal plants and their purified constituents have been shown beneficial therapeutic potentials. Seeds of Nigella sativa, a dicotyledon of the Ranunculaceae family, have been utilized for thousands of years as a spice and food preservative. Methods: the toxic effect of aflatoxin-B1 (AFB1) and the possible cytoprotective effect of Nigella sativa (NS) oil and aqueous extract of date were studied on 40 male rats. The animals were divided into 4 groups (10 rats each) and treated daily for two weeks. Group 1 received normal saline as controls. Group 2 treated via intraperitoneal (IP) route with AFB1 (50μg/kg BW). Group 3 treated with AFB1 and NS oil via IP. Group 4 treated with AFB1 and received orally aqueous extract of date (15mg/15ml). The liver and kidneys of each animal were histological examined and biochemical evaluation of the liver and kidney functions was performed. Results: Group 2 showed severe degenerative and necrotic changes in the liver and kidney. The plasma levels of alanine transaminase (ALT), aspartate transaminase (AST), creatinine and urea in AFB1 group were significantly higher than the control group. Livers and kidneys of rats, treated with AFB1 and NS showed less histopathological changes in comparison with the AFB1 treated group. Livers and kidneys of rats treated with AFB1 and date group showed only mild histopathological changes in comparison with AFB1 treated group. These histopathological changes seen in animals treated with AFB1 and dates were associated with a significant reduction in levels of ALT, AST, creatinine and urea. Likewise, histopathological changes in the AFB1 and NS group were associated with significant reduction in the levels of beforementioned indices. Moreover, AFB1 and date group showed significant improvement in liver function comparing with AFB1 and NS group. Conclusion: our study revealed that treatment with AFB1 induced histopathological changes in the tissues of liver and kidney associated with

  15. Effect of 8-oxoguanine glycosylase deficiency on aflatoxin B1 tumourigenicity in mice

    PubMed Central

    Mulder, Jeanne E.; Turner, Patricia V.; Massey, Thomas E.

    2015-01-01

    The mycotoxin aflatoxin B1 (AFB1) may initiate cancer by causing oxidatively damaged DNA, specifically by causing 8-oxo-7,8-dihydro-2’-deoxyguanosine (8-oxodG) lesions. Base excision repair removes these lesions, with 8-oxoguanine glycosylase (OGG1) being the rate-limiting enzyme. The aim of this study was to determine the effect of ogg1 deficiency on AFB1-induced oxidatively damaged DNA and tumourigenesis. Female wild-type, heterozygous and homozygous ogg1 null mice were given a single dose of 50mg/kg AFB1 or 40 µl dimethyl sulfoxide (DMSO) ip. Neither ogg1 genotype nor AFB1 treatment affected levels of oxidised guanine in lung or liver 2h post-treatment. AFB1-treated ogg1 null mice showed exacerbated weight loss and mortality relative to DMSO-treated ogg1 null mice, but AFB1 treatment did not significantly increase lung or liver tumour incidence compared with controls, regardless of ogg1 genotype. Suspect lung masses from three of the AFB1-treated mice were adenomas, and masses from two of the mice were osteosarcomas. No osteosarcomas were observed in DMSO-treated mice. All liver masses from AFB1-treated mice were adenomas, and one also contained a hepatocellular carcinoma. In DNA from the lung tumours, the K-ras mutation pattern was inconsistent with initiation by AFB1. In conclusion, ogg1 status did not have a significant effect on AFB1-induced oxidatively damaged DNA or tumourigenesis, but deletion of one or both alleles of ogg1 did increase susceptibility to other aspects of AFB1 toxicity. PMID:25583175

  16. Protection of salvia miltiorrhiza against aflatoxin-B1-induced hepatocarcinogenesis in Fischer 344 rats dual mechanisms involved.

    PubMed

    Liu, J; Yang, C F; Wasser, S; Shen, H M; Tan, C E; Ong, C N

    2001-06-01

    Extract of Salvia Miltiorrhiza (SM) has been widely used in traditional Chinese medicine for treating liver diseases. Recent experimental evidence indicates that it has anti-tumor potential. In this study, the effect of SM on alfatoxin B1 (AFB1)-induced hepatocarcinogenesis was investigated in male Fischer 344 rats. AFB1 (40 microg/100 g body wt, by gavage) was administered once a week for 24 weeks. In SM treatment group, rats were given SM (0.25g/100g body wt, 5 days/week by gavage) for a total of 28 weeks, including 4 weeks before and 24 weeks during AFB1 exposure. Results showed that the elevation of serum alanine aminotransferase and aspartate aminotransferase activities due to AFB1 dosing was almost completely abolished by the treatment of SM, indicating that SM could prevent AFB1-induced liver cell injury. It was further observed that SM substantially reduced glutathione S-transferase placenta form (GST-P) positive foci formation and GST-P mRNA expression caused by AFB1, which clearly suggests that SM is effective in preventing AFB1-induced hepatocarcinogenesis. Furthermore, the inhibition on AFB1 hepatocarcinigenesis was associated with a corresponding decrease in AFB1-DNA adducts formation as well as AFB1-induced oxidative DNA damage (8-hydroxydeoxyguanosine) in rat liver. Our results also indicate that the protective effect of SM might be mediated through dual mechanisms: (i) the enhancement of AFB1 detoxification pathway, especially the induction of GST-Yc2 mRNA expression, and (ii) the antioxidant property of SM. PMID:11441922

  17. Inhibition of ebselen on aflatoxin B(1)-induced hepatocarcinogenesis in Fischer 344 rats.

    PubMed

    Yang, C F; Liu, J; Wasser, S; Shen, H M; Tan, C E; Ong, C N

    2000-12-01

    Aflatoxin B(1) (AFB(1)), a potent hepatocarcinogen, enhances ROS formation and causes oxidative DNA damage, which may play a role in its carcinogenicity. We have demonstrated recently that ebselen, an organic selenium compound, protects against the cytotoxicity of AFB(1) through its antioxidant capability. The present study was designed to investigate the effect of ebselen on AFB(1)-induced hepatocarcinogenesis in an animal model. Fischer 344 rats were first treated with either deionized water or ebselen (5 mg/kg, 5 days/week) via gavage for 4 weeks, then given AFB(1) (0.4 mg/kg, gavage, once a week) or AFB(1) plus ebselen (5 mg/kg, 5 days/week) for another 24 weeks. The results showed that the hepatocarcinogenicity of AFB(1) in rats was significantly reduced by ebselen treatment as indicated by a decrease in: (i) serum gamma-glutamyl transpeptidase activity; (ii) expression of mRNAs of liver alpha-fetoprotein and the placental form of glutathione S-transferase (GST-P); and (iii) the area and mean density of staining of liver GST-P foci. Ebselen treatment significantly reduced the formation of hepatic AFB(1)-DNA adducts and 8-hydroxydeoxyguanosine caused by AFB(1) exposure. These findings suggest that ebselen can inhibit the carcinogenicity of AFB(1). In addition to the reduction of AFB(1)-DNA adduct formation, the protective effect of ebselen against AFB(1)-induced oxidative DNA damage may also, at least in part, contribute to its anticarcinogenic property. PMID:11133813

  18. Stimulation of Sister Chromatid Exchanges and Mutation by Aflatoxin B1-DNA Adducts in Saccharomyces cerevisiae Requires MEC1 (ATR), RAD53, and DUN1

    PubMed Central

    Fasullo, Michael; Sun, Mingzeng; Egner, Patricia

    2008-01-01

    The hepatocarcinogen aflatoxin B1 (AFB1) is a potent recombinagen but weak mutagen in the yeast Saccharomyces cerevisiae. AFB1 exposure induces DNA damage-inducible genes, such as RAD51 and those encoding ribonucleotide reductase (RNR), through a MEC1 (ATR homolog)-dependent pathway. Previous studies have indicated that MEC1 is required for both AFB1-associated recombination and mutation, and suggested that AFB1-DNA adducts are common substrates for recombination and mutagenesis. However, little is known about the downstream effectors of MEC1 required for genotoxic events associated with AFB1 exposure. Here we show that AFB1 exposure increases frequencies of RAD51-dependent unequal sister chromatid exchange (SCE) and activates Rad53 (CHK2). We found that MEC1, RAD53, and DUN1 are required for both AFB1-associated mutation and SCE. Deletion of SML1, which encodes an inhibitor of RNR, did not suppress the DUN1-dependent requirement for AFB1-associated genetic events, indicating that higher dNTP levels could not suppress the dun1 phenotype. We identified AFB1-DNA adducts and show that approximately the same number of adducts are obtained in both wild type and rad53 mutants. Since DUN1 is not required for UV-associated mutation and recombination, these studies define a distinct role for DUN1 in AFB1-associated mutagenesis and recombination. We speculate that AFB1-associated DNA adducts stall DNA replication, a consequence of which can either be mutation or recombination. PMID:18228255

  19. Interactions between hepatitis B virus and aflatoxin B(1): effects on p53 induction in HepaRG cells.

    PubMed

    Lereau, Myriam; Gouas, Doriane; Villar, Stéphanie; Besaratinia, Ahmad; Hautefeuille, Agnès; Berthillon, Pascale; Martel-Planche, Ghislaine; Nogueira da Costa, André; Ortiz-Cuaran, Sandra; Hantz, Olivier; Pfeifer, Gerd P; Hainaut, Pierre; Chemin, Isabelle

    2012-03-01

    Infection by hepatitis B virus (HBV) and dietary exposure to aflatoxin B(1) (AFB(1)) are the main risk factors for the development of chronic liver disease and hepatocellular carcinoma (HCC). How these factors cooperate is still largely unknown. AFB(1) activation leads to DNA adduction and mutagenesis, with a specific mutation at codon 249 in TP53 (p.R249S). So far, only limited studies have addressed the effects of AFB(1) on HBV replication. We have analysed the effects of both risk factors on p53 induction during HBV infection in HepaRG, a cell line with hepatocyte-like morphology that metabolizes AFB(1) and supports HBV infection. Exposure to AFB(1) up to 5 µM induced a downregulation of HBV replication after 48 h, as measured by a decrease in viral antigens in the culture medium (HBsAg, HBeAg and large envelope protein) and in intracellular levels of HBV transcripts, DNA and HBsAg. Conversely, HBV infection did not significantly modify AFB(1)-DNA adduct formation or repair as assessed by immunodot-blot assay, and the induction of p53 in response to AFB(1) was similar in infected and non-infected HepaRG cells. Overall, our results suggest that AFB(1) exposure decreases HBV replication, whereas DNA damage by AFB(1) and subsequent p53 induction is not affected by the presence of the virus. Thus, in HepaRG cell line, AFB(1) and HBV do not cooperate to increase DNA damage by AFB(1). Further studies on the effects of both factors in a context of chronicity are needed to better understand synergistic effects. PMID:22113009

  20. Intervention of Grape Seed Proanthocyanidin Extract on the Subchronic Immune Injury in Mice Induced by Aflatoxin B1

    PubMed Central

    Long, Miao; Zhang, Yi; Li, Peng; Yang, Shu-Hua; Zhang, Wen-Kui; Han, Jian-Xin; Wang, Yuan; He, Jian-Bin

    2016-01-01

    The aim was to investigate the prevention of grape seed proanthocyanidin extract (GSPE) on the subchronic immune injury induced by aflatoxin B1 (AFB1) and the possible ameliorating effect of GSPE in mice. The subchronic AFB1-induced immune injury mice model was set up with the continuous administration of 100 μg/kg body weight (BW) AFB1 for six weeks by intragastric administration. Then, intervention with different doses (50 and 100 mg/kg BW) of GSPE was conducted on mice to analyze the changes of body weight, immune organ index, antioxidant capability of spleen, serum immunoglobulin content, and the expression levels of inflammatory cytokines. The prevention of GSPE on the immune injury induced by AFB1 was studied. The GSPE could relieve the AFB1-induced reduction of body weight gain and the atrophy of the immune organ. The malondialdehyde (MDA) level of the spleen in the AFB1 model group significantly increased, but levels of catalase (CAT), glutathione (GSH), glutathione peroxidase (GSH-PX), and superoxide dismutase (SOD) significantly decreased. The GSPE could significantly inhibit the oxidative stress injury of the spleen induced by AFB1. AFB1 exposure could not significantly change the contents of IgA, IgG, or IgM. AFB1 significantly improved the expression of interleukin 1β (IL-1β), IL-6, tumor necrosis factor α (TNF-α), and interferon γ (IFN-γ). Additionally, GSPE could decrease the expression of these four proinflammatory factors to different degrees and inhibit the inflammatory reaction of mice. The results suggest that GSPE alleviates AFB1-induced oxidative stress and significantly improves the immune injury of mice induced by AFB1. PMID:27070584

  1. In vitro studies on chemoprotective effect of borax against aflatoxin B1-induced genetic damage in human lymphocytes.

    PubMed

    Turkez, Hasan; Geyikoğlu, Fatime; Dirican, Ebubekir; Tatar, Abdulgani

    2012-12-01

    A common dietary contaminant, aflatoxin B1 (AFB1), has been shown to be a potent mutagen and carcinogen in humans and many animal species. Since the eradication of AFB1 contamination in agricultural products has been rare, the use of natural or synthetic free radical scavengers could be a potential chemopreventive strategy. Boron compounds like borax (BX) and boric acid are the major components of industry and their antioxidant role has recently been reported. In the present report, we evaluated the capability of BX to inhibit the rate of micronucleus (MN) and sister chromatid exchange (SCE) formations induced by AFB1. There were significant increases (P < 0.05) in both SCE and MN frequencies of cultures treated with AFB1 (3.12 ppm) as compared to controls. However, co-application of BX (1, 2 and 5 ppm) and AFB1 resulted in decreases of SCE and MN rates as compared to the group treated with AFB1 alone. Borax gave 30-50 % protection against AFB1 induced SCEs and MNs. In conclusion, the support of borax was especially useful in aflatoxin-toxicated blood tissue. Thus, the risk on target tissues of AFB1 could be reduced and ensured early recovery from its toxicity. PMID:22526492

  2. An aptamer-based dipstick assay for the rapid and simple detection of aflatoxin B1.

    PubMed

    Shim, Won-Bo; Kim, Min Jin; Mun, Hyoyoung; Kim, Min-Gon

    2014-12-15

    A rapid and simple dipstick assay based on an aptamer has been developed for the determination of aflatoxin B1 (AFB1). The dipstick assay format was based on a competitive reaction of the biotin-modified aptamer specific to AFB1 between target and cy5-modified DNA probes. Streptavidin and anti-cy5 antibody as capture reagents were immobilized at test and control lines on a membrane of the dipstick assay. After optimization, the limit of detection for the dipstick assay was 0.1 ng/ml AFB1 in buffer. The method was confirmed to be specific to AFB1, and the entire process of the assay can be completed within 30 min. Aqueous methanol (20%) provided a good extraction efficiency, and the matrix influence from corn extracts was successfully reduced through 2-fold dilution. The results of AFB1 analysis for corn samples spiked with known concentration of AFB1 by the dipstick assay and ELISA showed good agreement. The cut-off value of the dipstick assay for corn samples was 0.3 ng/g AFB1. Therefore, the dipstick assay is first reported and considered as a rapid, simple, on-site and inexpensive screening tool for AFB1 determination in grains as well as a corn. PMID:25032679

  3. DNA BINDING AND ADDUCT FORMATION OF AFLATOXIN B1 IN CULTURED HUMAN AND ANIMAL TRACHEOBRONCHIAL AND BLADDER TISSUES

    EPA Science Inventory

    DNA binding and adduct formation of aflatoxin B1 (AFB1) was studied in cultured bladder and tracheobronchial explants from human, monkey, dog, hamster and rat. Explants were exposed to (3H)AFB1 (1 micrometer final concentration) in PFHR-4 medium (pH 7.4) without serum for 24 h, a...

  4. Toxic effect of aflatoxin B1 and the role of recovery on the rat cerebral cortex and hippocampus.

    PubMed

    Bahey, Noha Gamal; Abd Elaziz, Hekmat Osman; Gadalla, Kamal Kamal El Sayed

    2015-12-01

    Aflatoxin B1 (AFB1) is the most toxic and well-known mycotoxin that exists in many food stuff. Exposure to AFB1 has been reported to produce serious biochemical and structural alterations in human and animal organs, however, its effect on the brain is not well studied. Therefore, this study was aimed to investigate the possible histopathological effect of AFB1 and its withdrawal on the cerebral cortex and hippocampus. Fifteen adult female Wistar rats were divided into 3 equal groups: control, AFB1 (15.75 μg/kg/orally, once weekly, for 8 weeks) and recovery groups. Brain sections were processed for hematoxylin and eosin staining as well as for NeuN and GFAP immunostaining. AFB1 administration resulted in several histopathological alterations including; cellular degeneration, dilatation of the blood vessels and significant decrease in the thickness of the frontal cortex and the hippocampal CA1 pyramidal cell layer. In the frontal cortex, there was a significant reduction in the percentage of astrocyte distribution without changes in neuronal numbers. On the other hand, in the hippocampal CA1 region, there was a significant reduction of neuronal number and a significant increase in the percentage of astrocyte distribution. Importantly, AFB1-induced structural alterations were rescued following AFB1 withdrawal. In conclusion, AFB1 induce histological alterations in the rat brain which are potentially reversible upon withdrawal. PMID:26380901

  5. Aflatoxicol-induced hepatocellular carcinoma in rainbow trout (Salmo gairdneri) and the synergistic effects of cyclopropenoid fatty acids.

    PubMed

    Schoenhard, G L; Hendricks, J D; Nixon, J E; Lee, D J; Wales, J H; Sinnhuber, R O; Pawlowski, N E

    1981-03-01

    Aflatoxicol (AFL), a major metabolite of aflatoxin B1 (AFB1) in the Mt. Shasta rainbow trout (Salmo gairdneri), was found to produce hepatocellular carcinoma in trout. It was administered in a casein diet to duplicate groups of 120 fingering trout. In the same manner, additional duplicate groups received one of the following: no toxicant; AFB1; the diastereomer of AFL (AFL'); cyclopropenoid fatty acids (CPFA); and CPFA plus AFB1, AFL, and AFL'. Eight months after the initiation of the study, the following incidences of carcinoma were observed: control (0%); 20 ppb AFB1 (56%); 29 ppb AFL (26%); 61 ppb AFL' (0%); 50 ppm CPFA (3%); 20 ppb AFB1 plus 50 ppm CPFA (96%); 29 ppb AFL plus 50 ppm CPFA (94%); and 61 ppb AFL' plus 50 ppm CPFA (55%), showing both the carcinogenicity of AFL and the synergistic effects of CPFA. Twelve-month incidences were correspondingly higher in all cases. Aflatoxin M1, another metabolite of AFB1 in rainbow trout, was reported previously to be carcinogenic in trout. These results support the hypothesis that metabolism in rainbow trout does not effectively detoxify AFB1, but rather the formation of AFL extends the carcinogenicity of AFB1 and may contribute to the high sensitivity of rainbow trout to AFB. PMID:7459848

  6. Aflatoxin B1 binding by dairy strains of lactic acid bacteria and bifidobacteria.

    PubMed

    Peltonen, K; el-Nezami, H; Haskard, C; Ahokas, J; Salminen, S

    2001-10-01

    Various food commodities including dairy products may be contaminated with aflatoxins, which, even in small quantities, have detrimental effects on human and animal health. Several microorganisms have been reported to bind or degrade aflatoxins in foods and feeds. This study assessed the binding of aflatoxin B1 (AFB1) from contaminated solution by 20 strains of lactic acid bacteria and bifidobacteria. The selected strains are used in the food industry and comprised 12 Lactobacillus, five Bifidobacterium, and three Lactococcus strains. Bacteria and AFB1 were incubated (24 h, +37 degrees C) and the amount of unbound AFB1 was quantitated by HPLC. Between 5.6 and 59.7% AFB1 was bound from solution by these strains. Two Lactobacillus amylovorus strains and one Lactobacillus rhamnosus strain removed more than 50% AFB1 and were selected for further study. Bacterial binding of AFB1 by these strains was rapid, and more than 50% AFB1 was bound throughout a 72-h incubation period. Binding was reversible, and AFB1 was released by repeated aqueous washes. These findings further support the ability of specific strains of lactic acid bacteria to bind selected dietary contaminants. PMID:11699445

  7. A novel strain of Cellulosimicrobium funkei can biologically detoxify aflatoxin B1 in ducklings

    PubMed Central

    Sun, Lv-Hui; Zhang, Ni-Ya; Sun, Ran-Ran; Gao, Xin; Gu, Changqin; Krumm, Christopher Steven; Qi, De-Sheng

    2015-01-01

    Two experiments were conducted to screen microorganisms with aflatoxin B1 (AFB1) removal potential from soils and to evaluate their ability in reducing the toxic effects of AFB1 in ducklings. In experiment 1, we screened 11 isolates that showed the AFB1 biodegradation ability, and the one exhibited the highest AFB1 removal ability (97%) was characterized and identified as Cellulosimicrobium funkei (C. funkei). In experiment 2, 80 day-old Cherry Valley ducklings were divided into four groups with four replicates of five birds each and were used in a 2 by 2 factorial trial design, in which the main factors included administration of AFB1 versus solvent and C. funkei versus solvent for 2 weeks. The AFB1 treatment significantly decreased the body weight gain, feed intake and impaired feed conversion ratio. AFB1 also decreased serum albumin and total protein concentration, while it increased activities of alanine aminotransferase and aspartate aminotransferase and liver damage in the ducklings. Supplementation of C. funkei alleviated the adverse effects of AFB1 on growth performance, and provided protective effects on the serum biochemical indicators, and decreased hepatic injury in the ducklings. Conclusively, our results suggest that the novel isolated C. funkei strain could be used to mitigate the negative effects of aflatoxicosis in ducklings. PMID:25616109

  8. Preparation and characterization of an immunoaffinity column for the selective extraction of aflatoxin B1 in 13 kinds of foodstuffs.

    PubMed

    Xie, Jie; Peng, Tao; He, Jian-Li; Shao, Yu; Fan, Chun-Lin; Chen, Ying; Jiang, Wen-Xiao; Chen, Min; Wang, Qi; Pei, Xing-Yao; Ding, Shuang-Yang; Jiang, Hai-Yang

    2015-08-15

    A rapid and reliable immunoaffinity column (IAC) clean-up based ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) method was developed for the determination of aflatoxin B1 (AFB1) in cereals, peanuts, vegetable oils and Chinese traditional food products like sufu and lobster sauce. The immunoaffinity column of AFB1 (AFB1-IAC) was prepared by coupling CNBr-activated Sepharose-4B with the anti-AFB1 monoclonal antibody. The column capacity of IAC was over 260ng/mL gel. Samples were extracted with methanol-water (60:40, v/v) and the extracts were then purified on an AFB1-IAC before UPLC-MS/MS analysis. The average recoveries of AFB1 in spiked samples at levels of 1.0, 5.0 and 10.0μg/kg ranged from 72% to 98%, with the relative standard deviations of 1.2-9.3% (n=6). The limits of qualification ranged from 0.07 to 0.23μg/kg, which were below the MRLs of AFB1 in the matrices evaluated. In this work, the developed method was suitable for the determination of trace AFB1 residues in 13 kinds of foodstuffs. PMID:26160471

  9. Co-occurence of aflatoxins and fumonisins in maize: guatemala as a case study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin B1 (AFB1) and fumonisin B1 (FB1) are found in maize. AFB1 is a genotoxic carcinogen (IARC Group 1) and FB1 a liver cancer promoter in rodents and trout (IARC Group 2B). Therefore, the possibility of co-exposure is a health concern, most notably in areas where maize serves as a dietary st...

  10. Effect of γ-radiation on the production of aflatoxin B1 by Aspergillus parasiticus in raisins (Vitis vinifera L.)

    NASA Astrophysics Data System (ADS)

    Kanapitsas, Alexandros; Batrinou, Anthimia; Aravantinos, Athanasios; Markaki, Panagiota

    2015-01-01

    Aflatoxin B1 (AFB1) mostly produced by Aspergillus flavus and Aspergillus parasiticus, is an extremely toxic and carcinogenic metabolite. The effect of gamma irradiation at dose of 10 kGy on the production of aflatoxin B1 (AFB1) inoculated by Aspergillus parasiticus in raisins (Vitis vinifera L.) and on AFB1 in contaminated samples, was investigated. Values of the amount of aflatoxin B1 produced on the 12th day of incubation, after irradiation, showed that gamma radiation exposure at 10 kGy decreased AFB1 production at 65% compared with the non-irradiated sample, on the same day. The application of 10 kGy gamma radiation directly on 100 ng of AFB1 which were spiked in raisins resulted in ~29% reduction of AFB1. According to the risk assessment analysis the Provisional Maximum Tolerable Daily Intake (PMTDI) of 1.0 ng AFB1 kg-1bw, indicates that consumers are less exposed to AFB1 from the irradiated raisins.

  11. Protective Effects of Sodium Selenite against Aflatoxin B1-Induced Oxidative Stress and Apoptosis in Broiler Spleen

    PubMed Central

    Wang, Fengyuan; Shu, Gang; Peng, Xi; Fang, Jing; Chen, Kejie; Cui, Hengmin; Chen, Zhengli; Zuo, Zhicai; Deng, Junliang; Geng, Yi; Lai, Weimin

    2013-01-01

    The aim of this study was to investigate the possible protective role of sodium selenite on aflatoxin B1-induced oxidative stress and apoptosis in spleen of broilers. Two hundred one-day-old male broilers, divided into five groups, were fed with basal diet (control group), 0.3 mg/kg AFB1 (AFB1 group), 0.3 mg/kg AFB1 + 0.2 mg/kg Se (+Se group I), 0.3 mg/kg AFB1 + 0.4 mg/kg Se (+Se group II) and 0.3 mg/kg AFB1 + 0.6 mg/kg Se (+Se group III), respectively. According to biochemical assays, AFB1 significantly decreased the activities of glutathione peroxidase, total superoxide dismutase, glutathione reductase, catalase and the level of glutathione hormone, while it increased the level of malondialdehyde. Moreover, AFB1 increased the percentage of apoptosis cells by flow cytometry and the occurrence of apoptotic cells by TUNEL assay. Simultaneous supplementation with sodium selenite restored these parameters to be close to those in control group. In conclusion, sodium selenite exhibited protective effects on AFB1-induced splenic toxicity in broilers by inhibiting oxidative stress and excessive apoptosis. PMID:23839060

  12. Comparison of nixtamalization and extrusion processes for a reduction in aflatoxin content.

    PubMed

    Elias-Orozco, R; Castellanos-Nava, A; Gaytán-Martínez, M; Figueroa-Cárdenas, J D; Loarca-Piña, G

    2002-09-01

    Traditional nixtamalization and an extrusion method for making the dough (masa) for corn tortillas that requires using lime and hydrogen peroxide were evaluated for the detoxification of aflatoxins. The traditional nixtamalization process reduced levels of aflatoxin B(1) (AFB(1)) by 94%, aflatoxin M(1) (AFM(1)) by 90% and aflatoxin B(1)-8,9-dihydrodiol (AFB(1)-dihydrodiol) by 93%. The extrusion process reduced levels of AFB(1) by 46%, AFM(1) by 20% and AFB(1)-dihydrodiol by 53%. Extrusion treatments with 0, 0.3 and 0.5% lime reduced AFB(1) levels by 46, 74 and 85%, respectively. The inactivation of AFB(1), AFM(1) and AFB(1)-dihydrodiol in the extrusion process using lime together with hydrogen peroxide showed higher elimination of AFB(1) than treatments with lime or hydrogen peroxide alone. The extrusion process with 0.3% lime and 1.5% hydrogen peroxide was the most effective process to detoxify aflatoxins in corn tortillas, but a high level of those reagents negatively affected the taste and aroma of the corn tortilla as compared with tortillas elaborated by the traditional nixtamalization process. PMID:12396399

  13. Aflatoxin B1 in sesame seeds and sesame products from the Greek market.

    PubMed

    Kollia, Eleni; Tsourouflis, Kyriakos; Markaki, Panagiota

    2016-09-01

    Aflatoxin B1 (AFB1) is considered as the most potent liver carcinogen for humans. A method for determination in sesame seeds was developed. AFB1 was extracted by methanol-water, cleaned by immunoaffinity columns and determined by high-performance liquid chromatography with fluorescence detection. The recovery factor and the limit of detection (LOD) of AFB1 in sesame seeds were 111.5% and 0.02 ng g(-1), respectively. Thirty samples of sesame products were examined for the presence of AFB1. After analysis, 77.6% of samples were found to be contaminated. Eight samples exceeded the European Union (EU) limit (2 µg AFB1 kg(-1)). In 15 samples, AFB1 was below the EU limit. Seven samples remained below the LOD. The most contaminated (14.49 ng AFB1 g(-1)) sample was unpeeled packaged sesame seeds. In all samples, aflatoxigenic Aspergilli fungi as well as the risk for AFB1 presence in sesame seed was investigated. PMID:27088795

  14. Response of the Hepatic Transcriptome to Aflatoxin B1 in Domestic Turkey (Meleagris gallopavo)

    PubMed Central

    Monson, Melissa S.; Settlage, Robert E.; McMahon, Kevin W.; Mendoza, Kristelle M.; Rawal, Sumit; El-Nezami, Hani S.; Coulombe, Roger A.; Reed, Kent M.

    2014-01-01

    Dietary exposure to aflatoxin B1 (AFB1) is detrimental to avian health and leads to major economic losses for the poultry industry. AFB1 is especially hepatotoxic in domestic turkeys (Meleagris gallopavo), since these birds are unable to detoxify AFB1 by glutathione-conjugation. The impacts of AFB1 on the turkey hepatic transcriptome and the potential protection from pretreatment with a Lactobacillus-based probiotic mixture were investigated through RNA-sequencing. Animals were divided into four treatment groups and RNA was subsequently recovered from liver samples. Four pooled RNA-seq libraries were sequenced to produce over 322 M reads totaling 13.8 Gb of sequence. Approximately 170,000 predicted transcripts were de novo assembled, of which 803 had significant differential expression in at least one pair-wise comparison between treatment groups. Functional analysis linked many of the transcripts significantly affected by AFB1 exposure to cancer, apoptosis, the cell cycle or lipid regulation. Most notable were transcripts from the genes encoding E3 ubiquitin-protein ligase Mdm2, osteopontin, S-adenosylmethionine synthase isoform type-2, and lipoprotein lipase. Expression was modulated by the probiotics, but treatment did not completely mitigate the effects of AFB1. Genes identified through transcriptome analysis provide candidates for further study of AFB1 toxicity and targets for efforts to improve the health of domestic turkeys exposed to AFB1. PMID:24979717

  15. Metabolomics of the Bio-Degradation Process of Aflatoxin B1 by Actinomycetes at an Initial pH of 6.0

    PubMed Central

    Eshelli, Manal; Harvey, Linda; Edrada-Ebel, RuAngelie; McNeil, Brian

    2015-01-01

    Contamination of food and feed by Aflatoxin B1 (AFB1) is a cause of serious economic and health problems. Different processes have been used to degrade AFB1. In this study, biological degradation of AFB1 was carried out using three Actinomycete species, Rhodococcus erythropolis ATCC 4277, Streptomyces lividans TK 24, and S. aureofaciens ATCC 10762, in liquid cultures. Biodegradation of AFB1 was optimised under a range of temperatures from 25 to 40 °C and pH values of 4.0 to 8.0. An initial concentration of 20 µg/mL of AFB1 was used in this study. The amount of AFB1 remaining was measured against time by thin layer chromatography (TLC) and high-performance liquid chromatography (HPLC), coupled with UV and mass spectrometry (LC-MS). All species were able to degrade the AFB1, and no significant difference was found between them. AFB1 remained in the liquid culture for R. erythropolis, S. lividans and S. aureofaciens were 0.81 µg/mL, 2.41 µg/mL and 2.78 µg/mL respectively, at the end of the first 24 h. Degradation occurred at all incubation temperatures and the pH with the optimal conditions for R. erythropolis was achieved at 30 °C and pH 6, whereas for S. lividans and S. aureofaciens the optimum conditions for degradation were 30 °C and pH 5. Analysis of the degradative route indicated that each microorganism has a different way of degrading AFB1. The metabolites produced by R. erythropolis were significantly different from the other two microorganisms. Products of degradation were identified through metabolomic studies by utilizing high-resolution mass spectral data. Mass spectrometric analysis indicated that the degradation of AFB1 was associated with the appearance of a range of lower molecular weight compounds. The pathway of degradation or chemical alteration of AFB1 was followed by means of high resolution Fourier transform mass spectrometry (HR-FTMS) analysis as well as through the MS2 fragmentation to unravel the degradative pathway for AFB1. AFB1 bio

  16. Effects of milk thistle seed against aflatoxin B1 in broiler model

    PubMed Central

    Amiridumari, Halimeh; Sarir, Hadi; Afzali, Nazar; FaniMakki, Omid

    2013-01-01

    Background: Consumption of aflatoxin B1 (AFB1) contaminated products can pose a risk of development of various diseases in human and animals due to radical production. The scope of this work is to evaluate the efficacy of milk thistle seed (MTS), as a radical scavenger, on serum biochemistry, lipid profile and liver enzymes against AFB1 in broiler chickens contaminated with AFB1. Materials and Methods: The effect of nine experimental treatments (3 × 3 factorial design) was assessed using 216 one-d-old Ross 308 male broiler chicks in a randomized complete design with four replicates of six birds for each dietary treatments: Control (T1), 250 ppb AFB1 (T2), 500 ppb AFB1 (T3), 0.5% MTS (T4), 0.5% MTS Plus 250 ppb AFB1 (T5), 0.5% MTS Plus 500 ppb AFB1 (T6), 1.0% MTS (T7), 1.0% MTS Plus 250 ppb AFB1 (T8), and 1.0% MTS Plus 500 ppb AFB1 (T9). The individual and combined effects of dietary AFB1 and MTS on serum biochemistry factors (Glucose, Calcium, Phosphorus, Iron, Creatinine, and Uric acid), lipid profile (Triglyceride, Cholesterol, Low density lipoprotein (LDL), and High density lipoprotein (HDL)) and liver enzymes aspartate amino-transferase and alanine amino-transaminase (ALT) in broilers were evaluated at 21 days of age. Also, statistical packages Macros-1.002 (2010) were used to perform the above analysis on computer. Results: Consumption of 500 ppb AFB1 in to the diet significantly decreased HDL (58.13 ± 2.65), Calcium (7.11 ± 0.13), and Glucose (197.1 ± 7.42) compared to the control group (85.12 ± 1.95, 9.45 ± 0.17 and 223.1 ± 6.61, respectively), (P < 0.05). In contrast, it significantly increased creatinine (2.25 ± 0.011) and AST (244.51 ± 4.91). Using MTS together with AFB1 significantly reduced the effect of AFB1 on the above parameters. Conclusion: MTS can provide protection against the negative effects of AFB1 on broiler chicks. PMID:24381623

  17. Cytochrome P450 2A13 enhances the sensitivity of human bronchial epithelial cells to aflatoxin B1-induced DNA damage

    SciTech Connect

    Yang, Xuejiao; Zhang, Zhan; Wang, Xichen; Wang, Yun; Zhang, Xiaoming; Lu, Huiyuan; Wang, Shou-Lin

    2013-07-15

    Cytochrome P450 2A13 (CYP2A13) mainly expresses in human respiratory system and mediates the metabolic activation of aflatoxin B1 (AFB1). Our previous study suggested that CYP2A13 could increase the cytotoxic and apoptotic effects of AFB1 in immortalized human bronchial epithelial cells (BEAS-2B). However, the role of CYP2A13 in AFB1-induced DNA damage is unclear. Using BEAS-2B cells that stably express CYP2A13 (B-2A13), CYP1A2 (B-1A2), and CYP2A6 (B-2A6), we compared their effects in AFB1-induced DNA adducts, DNA damage, and cell cycle changes. BEAS-2B cells that were transfected with vector (B-vector) were used as a control. The results showed that AFB1 (5–80 nM) dose- and time-dependently induced DNA damage in B-2A13 cells. AFB1 at 10 and 80 nM significantly augmented this effect in B-2A13 and B-1A2 cells, respectively. B-2A6 cells showed no obvious DNA damage, similar to B-vector cells and the vehicle control. Similarly, compared with B-vector, B-1A2 or B-2A6 cells, B-2A13 cells showed more sensitivity in AFB1-induced γH2AX expression, DNA adduct 8-hydroxy-deoxyguanosine formation, and S-phase cell-cycle arrest. Furthermore, AFB1 activated the proteins related to DNA damage responses, such as ATM, ATR, Chk2, p53, BRCA1, and H2AX, rather than the proteins related to DNA repair. These effects could be almost completely inhibited by 100 μM nicotine (a substrate of CYP2A13) or 1 μM 8-methoxypsoralen (8-MOP; an inhibitor of CYP enzyme). Collectively, these findings suggest that CYP2A13 plays an important role in low-concentration AFB1-induced DNA damage, possibly linking environmental airborne AFB1 to genetic injury in human respiratory system. - Highlights: • CYP2A13 plays a critical role in low concentration of AFB1-induced DNA damage. • B-2A13 cells were more sensitive to AFB1 than B-1A2 cells and B-2A6 cells. • AFB1 dose- and time-dependently induced DNA damage in B-2A13 cells • AFB1-induced DNA adducts and damage can be inhibited by nicotine and 8

  18. Clay-based affinity probes for selective cleanup and determination of aflatoxin B1 using nanostructured montmorillonite on quartz.

    PubMed

    Huebner, Henry J; Phillips, Timothy D

    2003-01-01

    A study was conducted to investigate the selective cleanup and determination of aflatoxin B1 (AfB1) from contaminated media. Composite adsorbents were formulated from calcium montmorillonite clay, which possesses a high affinity and enthalpy of adsorption for AfB1. Nanostructuring techniques were used to construct various formulations of the clay-based composite media. In AfB1 adsorption studies with prototypical affinity columns, these composites offered narrowly defined, reproducible capacity ranges. Composite recoveries of AfB1 from spiked grains exhibited linear trends that correlated well with the range of spike levels. Composite columns provided lower recoveries of AfB1 from naturally contaminated corn than did immunoaffinity columns; however, recoveries were consistent and purified extracts were free of interfering compounds, as determined by liquid chromatography with fluorescence detection. PMID:12852572

  19. Zinc inhibits aflatoxin B1-induced cytotoxicity and genotoxicity in human hepatocytes (HepG2 cells).

    PubMed

    Yang, Xuan; Lv, Yangjun; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-06-01

    Aflatoxin B1 (AFB1) has strong carcinogenicity. Consumption of AFB1-contaminated agricultural products and the occurrence of hepatocellular carcinoma have received widespread attention. The aim of this paper was to investigate whether zinc supplementation could inhibit AFB1-induced cytotoxicity and genotoxicity in HepG2 cells and the mechanism of this inhibition. Our data suggest that zinc sources can relieve a certain degree of AFB1-induced cytotoxicity and genotoxicity by protecting against apoptotic body formation and DNA strand breaks, affecting S phase cell cycle arrest, reducing 8-OHdG formation, inhibiting global DNA hypomethylation and regulating gene expression in antioxidation, zinc-association and apoptosis processes. Consequently, zinc stabilizes the integrity of DNA and improves cell survival. These data provides new insights into the protective role of zinc in alleviating AFB1-induced cytotoxicity and mediating epigenetic changes in hepatocytes, demonstrating that zinc sources have detoxification properties in mycotoxin-induced toxicity. PMID:27017951

  20. Monoclonal antibody-quantum dots CdTe conjugate-based fluoroimmunoassay for the determination of aflatoxin B1 in peanuts.

    PubMed

    Zhang, Zhaowei; Li, Yuanyuan; Li, Peiwu; Zhang, Qi; Zhang, Wen; Hu, Xiaofeng; Ding, Xiaoxia

    2014-03-01

    A fluoroimmunoassay towards aflatoxin B1 (AFB1) was presented using quantum dots as the fluorescent label. The CdTe QDs were successfully linked to the monoclonal antibody against AFB1. Based on the conjugated complexes, a novel direct competitive fluorescence-linked immunosorbent assay (cFLISA) was developed for AFB1 detection. The 50% inhibition value (IC50) of the cFLISA was 0.149ng/mL in peanuts matrix. The method performance included the limit of detection (LOD) of 0.016ng/mL and considerable recoveries of 85-117% at three fortification levels (0.075, 0.15, and 0.3ng/g) from spiked AFB1 blank peanuts samples, along with coefficients of variation (CVs) below 10%. The cFLISA provided an alternative of rapid and sensitive detection for AFB1 and, moreover provided great potential for multiplexed mycotoxins determination simultaneously. PMID:24176348

  1. Association between aflatoxin B1 occupational airway exposure and risk of hepatocellular carcinoma: a case-control study.

    PubMed

    Lai, Hao; Mo, Xianwei; Yang, Yang; He, Ke; Xiao, Jun; Liu, Chao; Chen, Jiansi; Lin, Yuan

    2014-10-01

    The aim of this study was to determine the airway exposure of sugar and papermaking factory workers to aflatoxin B1 (AFB1) and to explore the potential association between AFB1 airway exposure and the risk of hepatocellular carcinoma (HCC) in a case-control study. Dust samples were collected from the sugarcane bagasse warehouse, and presser and paper production workshops. Blood samples were collected from 181 workshop employees and 203 controls who worked outside the workshop. AFB1 albumin adducts were detected using a double antibody sandwich enzyme-linked immunosorbent assay (ELISA). To explore the association between AFB1 airway exposure and the risk of HCC, the medical records of 68 HCC patients who worked in a sugar and papermaking factory between January 1994 and December 2013 were analyzed. A questionnaire was used to collect information from 150 healthy controls who worked for the same company and lived near the factory. AFB1 was detected in the dust samples, but could not be detected in any of the rice samples. An analysis of serum samples revealed serum AFB1 albumin adducts in 102 (56.35 %) of the study participants. However, in the control group, only 12 (5.9 %) individuals had detectable levels of AFB1 albumin adducts. Those with airway exposure to Aspergillus flavus-contaminated dust had an elevated risk of HCC compared to those without exposure (odds ratio, 5.24; 95 % confidence interval, 2.77-9.88; P = 0.00). The findings of this study indicate that occupational AFB1 airway exposure might be associated with the risk of AFB1-related HCC among the population that was used in this study. Intervention programs aimed at reducing exposure to inhalational AFB1 are needed urgently. Additional suitably designed, multicenter, prospective studies using large samples are needed to further confirm the results. PMID:24961349

  2. Efficacy of sodium bentonite as a detoxifier of broiler feed contaminated with aflatoxin and fumonisin.

    PubMed

    Miazzo, R; Peralta, M F; Magnoli, C; Salvano, M; Ferrero, S; Chiacchiera, S M; Carvalho, E C Q; Rosa, C A R; Dalcero, A

    2005-01-01

    Sodium bentonite (SB) was evaluated for its ability to reduce the deleterious effects of fumonisin B1 (FB1) and aflatoxin B1 (AFB1) in broiler diets. It was incorporated into the diets (0.3%) containing 2.5 mg/kg AFB1, 200 mg/kg FB1, or a combination of 2.5 mg/kg AFB1 and 200 mg/kg FB1. Aflatoxin B1 significantly diminished body weight gain, whereas FB1 or the combination of FB1 and SB had no effect. Addition of SB in the diets significantly diminished the inhibitory effects of dietary AFB1. Feeding AFB1 alone caused significant increases in the relative weights of most observed organs. Feeding FB1 alone did not alter relative weights of any organs. In the combined diet (AFB1 plus FB1) relative weights of the liver, kidney, gizzard, and spleen were increased. Addition of SB to the diet containing AFB1 diminished the relative weights of liver, kidney, and spleen. Addition of SB to diets containing AFB1 and FB1 only decreased liver weights. In relation to the control, lower serum levels of total protein, albumin, and globulins were observed for all AFB, containing diets without SB addition, whereas all other treatments were not altered. Livers of birds fed diets containing AFB1 and a combination of AFB1 and FB1 were enlarged, yellowish, friable, and had rounded borders. The histopathology of them, stained with hematoxylin and eosin, showed multifocal and varied cytoplasmatic vacuolization with perilobular location. Incorporation of SB reduced the incidence and severity of the hepatic histopathology changes associated with aflatoxicosis. PMID:15685935

  3. Vaccination of Heifers with Anaflatoxin Improves the Reduction of Aflatoxin B1 Carry Over in Milk of Lactating Dairy Cows

    PubMed Central

    Giovati, Laura; Gallo, Antonio; Masoero, Francesco; Cerioli, Carla; Ciociola, Tecla; Conti, Stefania; Magliani, Walter; Polonelli, Luciano

    2014-01-01

    It was previously reported that injection of anaflatoxin B1 (AnAFB1) conjugated to keyhole limpet hemocyanin (KLH), together with Freund's adjuvant, was effective in inducing in cows a long lasting titer of anti-aflatoxin B1 (AFB1) antibodies (Abs), cross-reacting with other aflatoxins, which were able to hinder, proportionally to their titer, the secretion of aflatoxin M1 (AFM1) into the milk of cows continuously fed with AFB1. According to anti-AFB1 Ab titer, 50% of the vaccinated cows were recognized as high responder animals. In an attempt to prepare a more effective formulation for vaccination of cows, it was compared the immunogenicity, in Holstein Friesian heifers, of AnAFB1 covalently conjugated to KLH or to recombinant diphtheria toxin (CRM197) molecules, and injected together with various adjuvants. This study demonstrated that injection of AnAFB1 conjugated to KLH and mixed with complete (priming) and incomplete Freund's adjuvant (boosters), as in the previous schedule of immunization, was the most effective regimen for inducing Ab responses against AFB1, although pre-calving administration could increase the effectiveness of vaccination, resulting in 100% high responder animals. After one booster dose at the beginning of the milk production cycle, anti-AFB1 Ab titers were comparable to those recorded at the end of the immunization schedule, and proved to be effective in reducing significantly AFB1 carry over, as AFM1, from feed to milk. Pre-calving vaccination of dairy heifers with conjugated AnAFB1, adjuvated with complete and incomplete Freund's adjuvant, may represent the most effective tool for preventing the public health hazard constituted by milk and cheese contaminated with aflatoxins. PMID:24714096

  4. Effect of selenium supplementation on aflatoxin B₁-induced histopathological lesions and apoptosis in bursa of Fabricius in broilers.

    PubMed

    Chen, Kejie; Fang, Jing; Peng, Xi; Cui, Hengmin; Chen, Jin; Wang, Fengyuan; Chen, Zhengli; Zuo, Zhicai; Deng, Junliang; Lai, Weimin; Zhou, Yi

    2014-12-01

    To investigate the effects of sodium selenite against aflatoxin B1 (AFB 1), 200 male Avian broilers, divided into five groups, were fed with basal diet (control group), 0.3 mg/kg AFB1 (AFB1 group), 0.3 mg/kg AFB1 + 0.2 mg/kg Se (+Se group I), 0.3 mg/kg AFB1 + 0.4 mg/kg Se (+Se group II) and 0.3 mg/kg AFB1 + 0.6 mg/kg Se (+Se group III), respectively. Compared with the control group, decreased relative weight of bursa of Fabricius and contents of serum immunoglobulin, more vacuoles and debris in the bursal lymphoid follicle, and increased percentage of apoptotic bursal cells were observed in the AFB1 group. Sodium selenite, however, could increase the relative weight of bursa of Fabricius and contents of serum immunoglobulin, and ameliorate histopathological lesions. The percentages of apoptotic bursal cells, through flow cytometry and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling method, in the three +Se groups were lower than those in the AFB 1 group. Compared with the AFB 1 group, moreover, the mRNA expressions of Bax and Caspase-3 by qRT-PCR in the three +Se groups were decreased, while the expression of Bcl-2 was increased. The results indicate that sodium selenite in diet can protect chicken from AFB 1-induced impairment of humoral immune function by reducing bursal histopathological lesions and percentages of apoptotic bursal cells. PMID:25261862

  5. Vaccination of heifers with anaflatoxin improves the reduction of aflatoxin b1 carry over in milk of lactating dairy cows.

    PubMed

    Giovati, Laura; Gallo, Antonio; Masoero, Francesco; Cerioli, Carla; Ciociola, Tecla; Conti, Stefania; Magliani, Walter; Polonelli, Luciano

    2014-01-01

    It was previously reported that injection of anaflatoxin B1 (AnAFB1) conjugated to keyhole limpet hemocyanin (KLH), together with Freund's adjuvant, was effective in inducing in cows a long lasting titer of anti-aflatoxin B1 (AFB1) antibodies (Abs), cross-reacting with other aflatoxins, which were able to hinder, proportionally to their titer, the secretion of aflatoxin M1 (AFM1) into the milk of cows continuously fed with AFB1. According to anti-AFB1 Ab titer, 50% of the vaccinated cows were recognized as high responder animals. In an attempt to prepare a more effective formulation for vaccination of cows, it was compared the immunogenicity, in Holstein Friesian heifers, of AnAFB1 covalently conjugated to KLH or to recombinant diphtheria toxin (CRM197) molecules, and injected together with various adjuvants. This study demonstrated that injection of AnAFB1 conjugated to KLH and mixed with complete (priming) and incomplete Freund's adjuvant (boosters), as in the previous schedule of immunization, was the most effective regimen for inducing Ab responses against AFB1, although pre-calving administration could increase the effectiveness of vaccination, resulting in 100% high responder animals. After one booster dose at the beginning of the milk production cycle, anti-AFB1 Ab titers were comparable to those recorded at the end of the immunization schedule, and proved to be effective in reducing significantly AFB1 carry over, as AFM1, from feed to milk. Pre-calving vaccination of dairy heifers with conjugated AnAFB1, adjuvated with complete and incomplete Freund's adjuvant, may represent the most effective tool for preventing the public health hazard constituted by milk and cheese contaminated with aflatoxins. PMID:24714096

  6. Ability of Lactobacillus plantarum MON03 to mitigate aflatoxins (B1 and M1) immunotoxicities in mice.

    PubMed

    Jebali, Rania; Abbès, Samir; Salah-Abbès, Jalila Ben; Younes, Ridha Ben; Haous, Zohra; Oueslati, Ridha

    2015-01-01

    Aflatoxin B1 (AFB1) and M1 (AFM1) are mycotoxins produced by numerous Aspergillus species in pre- or post-harvest cereals and milk. AFB1 and AFM1 display a potent economic loss in livestock and also cause severe immunological problems. The aims of this study were to: evaluate a new AFB1 and AFM1-binding/degrading micro-organism for biological detoxification; examine its ability to degrade AFB1 and AFM1 in liquid medium; and evaluate its potential for in vivo preventative effects against AFB1- and AFM1-induced immunomodulation in mice. Lactobacillus plantarum MON03 (LP) isolated from Tunisian artisanal butter was found to display significant binding ability to AFB1 and AFM1 in PBS (i.e. 82% and 89%, respectively) within 24 h of incubation and able to tolerate gastric acidity, have strongly hydrophilic cells surface properties, and adhere efficacy to Caco-3 cells in vitro. The in vivo study was conducted using Balb/c mice that received by oral gavage vehicle (control), LP only (2 × 10(9) CFU/L, ~2 g/kg BW), AFB1 or AFM1 alone (0.25 and 0.27 mg/kg, respectively), or AFB1 + LP or AFM1 + LP daily for 15 days. Compared to in control mice, treatments with AFB1 and AFM1 led to significantly decreased body weight gains, histopathological changes, and decrements in all hematologic and immune parameters assessed. Co-treatment with LP strongly reduced the adverse effects of each mycotoxin. In fact, the mice receiving AFB1 + LP or AFM1 + LP co-treatment displayed no significant differences in the assayed parameters as compared to the control mice. By itself, the bacteria alone had no adverse effects in the mice. From these data, it is concluded that the tested bacteria could be beneficial in biotechnology detoxification of contaminated food and feed for humans and animals. PMID:25441623

  7. Interactive effects of dietary protein concentration and aflatoxin B1 on performance, nutrient digestibility, and gut health in broiler chicks.

    PubMed

    Chen, X; Naehrer, K; Applegate, T J

    2016-06-01

    A 20-day trial was conducted to determine the impact of aflatoxin B1 (AFB1) and dietary protein concentration on performance, nutrient digestibility, and gut health in broiler chicks. The 6 dietary treatments were arranged in a 2 × 3 factorial with 3 crude protein (CP) concentrations (16, 22, and 26%) with or without 1.5 mg/kg AFB1 Each diet was fed to 6 replicate cages (6 chicks per cage) from zero to 20 d of age. Endogenous N and amino acid loss were estimated from birds fed a N-free diet with or without 1.5 mg/kg AFB1 A significant interaction between AFB1 and CP concentration was observed for growth performance, where reduction of BW gain, feed intake, gain:feed ratio, and breast muscle weight by AFB1 were most profound in birds fed the 16%-CP diet, and were completely eliminated when birds were fed the 26%-CP diet (AFB1 by CP interaction; P ≤ 0.023). Similarly, AFB1 reduced serum albumin, total protein, and globulin concentrations in birds fed 16 and 22% CP diets, but not in those fed the 26%-CP (AFB1 by CP interaction; P ≤ 0.071). Gut permeability was increased in birds fed AFB1-contamiated diets as measured by serum lactulose/rhamnose ratio (main effect; P = 0.04). Additionally, AFB1 tended to increase endogenous N loss (P = 0.09), and significantly reduced apparent ileal digestible energy and standardized ileal N and amino acid digestibility in birds fed the 16%-CP diet, while birds fed higher dietary CP were not affected (AFB1 by CP interaction; P ≤ 0.01). Further, AFB1 increased the translation initiation factor 4E-binding protein (4EBP1), claudin1, and multiple jejunal amino acid transporters expression (main effect; P ≤ 0.04). Results from this study indicate that a 1.5 mg AFB1/kg diet significantly impairs growth, major serum biochemistry measures, gut barrier, endogenous loss, and energy and amino acid digestibility. Aflatoxicosis can be augmented by low dietary CP, while higher dietary CP completely eliminated the impairment of

  8. Efficacy of beer fermentation residue containing Saccharomyces cerevisiae cells for ameliorating aflatoxicosis in broilers.

    PubMed

    Bovo, F; Franco, L T; Kobashigawa, E; Rottinghaus, G E; Ledoux, D R; Oliveira, C A F

    2015-05-01

    This study aimed to determine the aflatoxin B1 (AFB1) binding capacity of a beer fermentation residue (BFR) containing Saccharomyces cerevisiae cells, and the efficacy of BFR to ameliorate the toxic effects of AFB1 on performance, serum biochemistry, and histology of broilers. The BFR was collected from a microbrewery, and the yeast cells were counted, dried, and milled before it was used in the study. In vitro evaluation of the BFR was conducted using different concentrations of AFB1 (2.0, 4.0, 8.0, 16.0, and 32.0 μg AFB1/mL) and 100 mg/10 mL of BFR at pH 3.0 or 6.0. Two hundred 1-day-old male broilers (Ross 308) were assigned to chick batteries and allowed ad libitum access to feed and water. A completely randomized design was used with 5 replicate pens of 5 chicks assigned to each of 4 dietary treatments from hatch to 21 d, which included: 1) basal diet (BD), with no BFR or AFB1; 2) BD supplemented with 1% BFR; 3) BD supplemented with 2 mg AFB1/kg of feed; and 4) BD supplemented with 2 mg AFB1/kg feed and 1% BFR. Performance variables were determined weekly, while serum analyses were performed on d 14 and 21. At the end of the study, chicks were anesthetized with carbon dioxide, euthanized by cervical dislocation, and the kidney, liver, and bursa of Fabricius were removed for determination of relative weights, and for histological evaluation. In vitro assays showed that the higher the initial AFB1 concentration in solution, the greater the AFB1 amount adsorbed by BFR at both pHs tested. Feed intake, BW gain, and concentrations of albumin, total protein, and globulin increased (P < 0.05) in broilers fed BFR+AFB1 (Diet 4), when compared to the birds receiving only AFB1 (Diet 2). Although BFR was not able to reduce or prevent the effects of AFB1 on relative weights of kidneys and liver, it reduced the severity of histological changes in the liver and kidney caused by AFB1. PMID:25743420

  9. Estimated exposure to zearalenone, ochratoxin A and aflatoxin B1 through the consume of bakery products and pasta considering effects of food processing.

    PubMed

    Bol, Emilli Keller; Araujo, Letícia; Veras, Flávio Fonseca; Welke, Juliane Elisa

    2016-03-01

    The objective of this research was to estimate the processing effect on mycotoxins levels and the exposure to zearalenone (ZEA), ochratoxin (OTA) and aflatoxin B1 (AFB1) through the consumption of pasta and bakery products. The higher reduction percentage of mycotoxins was observed in cake production (95, 90 and 70% for ZEA, OTA and AFB1, respectively). Bread and biscuit showed similar reduction in mycotoxins levels (89 and 90% for ZEA; 80 and 85% for OTA; 36 and 40% for AFB1, respectively). The lower reduction in the levels of mycotoxins has been observed for pasta (75, 65 and 10% for ZEA, OTA and AFB1, respectively). The consumption of these products could represent 12.6% of the maximum tolerable daily intake of ZEA and 30.5% of the tolerable weekly intake of OTA. The margin of exposure value related to the exposure to AFB1 was 24.6. The exposure to ZEA and OTA through the consumption of bakery products and pasta would not represent risk for consumer health, (although conjugated forms were not determined). However, the exposure to AFB1 represents a risk (even without considering the AFB1-conjugated forms). PMID:26807886

  10. Cobalt-Porphyrin-Platinum-Functionalized Reduced Graphene Oxide Hybrid Nanostructures: A Novel Peroxidase Mimetic System For Improved Electrochemical Immunoassay.

    PubMed

    Shu, Jian; Qiu, Zhenli; Wei, Qiaohua; Zhuang, Junyang; Tang, Dianping

    2015-01-01

    5,10,15,20-Tetraphenyl-21H,23H-porphine cobalt flat stacking on the reduced graphene oxide with platinum nanoparticles (PtNPs/CoTPP/rGO) were first synthesized and functionalized with monoclonal rabbit anti-aflatoxin B1 antibody (anti-AFB1) for highly efficient electrochemical immunoassay of aflatoxin B1 (AFB1) in this work. Transmission electron microscopy (TEM), atomic force microscope (AFM) and spectral techniques were employed to characterize the PtNPs/CoTPP/rGO hybrids. Using anti-AFB1-conjugated PtNPs/CoTPP/rGO as the signal-transduction tag, a novel non-enzymatic electrochemical immunosensing system was designed for detection of target AFB1 on the AFB1-bovine serum albumin-functionalized sensing interface. Experimental results revealed that the designed immunoassay could exhibit good electrochemical responses for target analyte and allowed the detection of AFB1 at a concentration as low as 5.0 pg mL(-1) (5.0 ppt). Intra- and inter-assay coefficients of variation were below 10%. Importantly, the methodology was further validated for analyzing naturally contaminated or spiked blank peanut samples with consistent results obtained by AFB1 ELISA kit, thus providing a promising approach for quantitative monitoring of organic pollutants. PMID:26462136

  11. Distinct response of the hepatic transcriptome to Aflatoxin B1 induced hepatocellular carcinogenesis and resistance in rats.

    PubMed

    Shi, Jiejun; He, Jiangtu; Lin, Jing; Sun, Xin; Sun, Fenyong; Ou, Chao; Jiang, Cizhong

    2016-01-01

    Aflatoxin is a natural potent carcinogen and a major cause of liver cancer. However, the molecular mechanisms of hepatocellular carcinogenesis remain largely unexplored. In this study, we profiled global gene expression in liver tissues of rats that developed hepatocellular carcinoma (HCC) from aflatoxin B1 (AFB1) administration and those that were AFB1-resistant, as well as rats without AFB1 exposure as a control. AFB1 exposure resulted in extensive perturbation in gene expression with different functions in HCC and AFB1 resistance (AR) samples. The differentially expressed genes (DEGs) in HCC sample were enriched for cell proliferation, cell adhesion and vasculature development that largely contribute to carcinogenesis. Anti-apoptosis genes were up-regulated in HCC sample whereas apoptosis-induction genes were up-regulated in AR sample. AFB1 exposure also caused extensive alteration in expression level of lncRNAs. Among all the 4511 annotated lncRNAs, half of them were highly expressed only in HCC sample and up-regulated a group of protein-coding genes with cancer-related functions: apoptosis regulation, DNA repair, and cell cycle. Intriguingly, these genes were down-regulated by lncRNAs highly expressed in AR sample. Collectively, apoptosis is the critical biological process for carcinogenesis in response to AFB1 exposure through changes in expression level of both protein-coding and lncRNA genes. PMID:27545718

  12. Effect of oral supplementation of Lactobacillus reuteri in reduction of intestinal absorption of aflatoxin B(1) in rats.

    PubMed

    Hernandez-Mendoza, Adrián; González-Córdova, Aarón Fernando; Vallejo-Cordoba, Belinda; Garcia, Hugo Sergio

    2011-06-01

    The goals of this work were to assess the ability of Lactobacillus reuteri to bind aflatoxin B(1) in the intestinal tract and determine its effect on intestinal absorption of the toxin dispensed in either single or multiple doses in a murine model. Male Wistar rats were used, and two experiments were conducted after bacteria were implanted. Experiment one involved a single-oral dose of toxin, and the subsequent flow cytometric analysis of bacteria isolated from the small intestine and treated with specific FITC-labeled AFB(1) antibodies. The second experiment was carried out supplying the toxin in 7 oral sub-doses, and the later quantification of AFB(1)-Lys adducts in blood samples by ELISA assay. The results demonstrated that L. reuteri was able to bind AFB(1) in the intestinal tract, mostly in the duodenum. Furthermore, the AFB(1)-Lys adducts were present at significantly lower levels in those animals receiving AFB(1) plus bacteria than in those receiving only AFB(1). Our findings confirm that probiotic bacteria could act as biological barriers in normal intestinal conditions thereby reducing the bioavailability of AFB(1) ingested orally in a single or multiple doses, thus avoiding its toxic effects. PMID:21298677

  13. Effects of Aflatoxin B1 and Fumonisin B1 on Blood Biochemical Parameters in Broilers

    PubMed Central

    Tessari, Eliana N. C.; Kobashigawa, Estela; Cardoso, Ana Lúcia S. P.; Ledoux, David R.; Rottinghaus, George E.; Oliveira, Carlos A. F.

    2010-01-01

    The individual and combined effects of dietary aflatoxin B1 (AFB1) and fumonisin B1 (FB1) on liver pathology, serum levels of aspartate amino-transferase (AST) and plasma total protein (TP) of broilers were evaluated from 8 to 41 days of age. Dietary treatments included a 3 × 3 factorial arrangement with three levels of AFB1 (0, 50 and 200 μg AFB1/kg), and three levels of FB1 (0, 50 and 200 mg FB1/kg). At 33 days post feeding, with the exception of birds fed 50 mg FB1 only, concentrations of AST were higher (p < 0.05) in all other treatment groups when compared with controls. Plasma TP was lower (p < 0.05) at six days post feeding in groups fed 200 μg AFB1/kg alone or in combination with FB1. At day 33 days post feeding, with the exception of birds fed the highest combination of AFB1 and FB1 which had higher plasma TP than control birds, plasma TP of birds fed other dietary treatments were similar to controls. Broilers receiving the highest levels of AFB1 and FB1 had bile duct proliferation and trabecular disorder in liver samples. AFB1 singly or in combination with FB at the levels studied, caused liver damage and an increase in serum levels of AST. PMID:22069595

  14. Distinct response of the hepatic transcriptome to Aflatoxin B1 induced hepatocellular carcinogenesis and resistance in rats

    PubMed Central

    Shi, Jiejun; He, Jiangtu; Lin, Jing; Sun, Xin; Sun, Fenyong; Ou, Chao; Jiang, Cizhong

    2016-01-01

    Aflatoxin is a natural potent carcinogen and a major cause of liver cancer. However, the molecular mechanisms of hepatocellular carcinogenesis remain largely unexplored. In this study, we profiled global gene expression in liver tissues of rats that developed hepatocellular carcinoma (HCC) from aflatoxin B1 (AFB1) administration and those that were AFB1-resistant, as well as rats without AFB1 exposure as a control. AFB1 exposure resulted in extensive perturbation in gene expression with different functions in HCC and AFB1 resistance (AR) samples. The differentially expressed genes (DEGs) in HCC sample were enriched for cell proliferation, cell adhesion and vasculature development that largely contribute to carcinogenesis. Anti-apoptosis genes were up-regulated in HCC sample whereas apoptosis-induction genes were up-regulated in AR sample. AFB1 exposure also caused extensive alteration in expression level of lncRNAs. Among all the 4511 annotated lncRNAs, half of them were highly expressed only in HCC sample and up-regulated a group of protein-coding genes with cancer-related functions: apoptosis regulation, DNA repair, and cell cycle. Intriguingly, these genes were down-regulated by lncRNAs highly expressed in AR sample. Collectively, apoptosis is the critical biological process for carcinogenesis in response to AFB1 exposure through changes in expression level of both protein-coding and lncRNA genes. PMID:27545718

  15. Hematological parameters and the state of liver cells of rats after oral administration of aflatoxin b1 alone and together with nanodiamonds.

    PubMed

    Mogilnaya, Oa; Puzyr, Ap; Baron, Av; Bondar, Vs

    2010-01-01

    Hematological parameters and the state of liver cells of rats were examined in vivo after the animals received aflatoxin B1 (AfB1) alone and together with modified nanodiamonds (MND) synthesized by detonation. The rats that had received the MND hydrosol had elevated leukocyte levels, mainly due to higher granulocyte counts and somewhat increased monocyte counts compared to control rats. Hematological parameters of the rats that had received AfB1 alone differed from those of the control rats in another way: total white blood cell counts were significantly lower due to the decreased lymphocyte counts. In rats that had consumed AfB1 with the MND hydrosol, changes in hematological parameters were less pronounced than in rats that had consumed either AfB1 or MND. Electron microscopy showed that hepatocytes of the rats that had received the MND hydrosol or AfB1 with the MND hydrosol contained elevated levels of lipid inclusions and lysosomes. Hyperplasia of the smooth endoplasmic reticulum (EPR) was revealed in liver specimens of the rats that had received AfB1. Results of the study suggest the conclusion about mutual mitigation of the effects of nanoparticles and the mycotoxin on rats blood and liver cells after AfB1 has adsorbed on MND. PMID:20672086

  16. Hematological Parameters and the State of Liver Cells of Rats After Oral Administration of Aflatoxin B1 Alone and Together with Nanodiamonds

    NASA Astrophysics Data System (ADS)

    Mogilnaya, O. A.; Puzyr, A. P.; Baron, A. V.; Bondar, V. S.

    2010-05-01

    Hematological parameters and the state of liver cells of rats were examined in vivo after the animals received aflatoxin B1 (AfB1) alone and together with modified nanodiamonds (MND) synthesized by detonation. The rats that had received the MND hydrosol had elevated leukocyte levels, mainly due to higher granulocyte counts and somewhat increased monocyte counts compared to control rats. Hematological parameters of the rats that had received AfB1 alone differed from those of the control rats in another way: total white blood cell counts were significantly lower due to the decreased lymphocyte counts. In rats that had consumed AfB1 with the MND hydrosol, changes in hematological parameters were less pronounced than in rats that had consumed either AfB1 or MND. Electron microscopy showed that hepatocytes of the rats that had received the MND hydrosol or AfB1 with the MND hydrosol contained elevated levels of lipid inclusions and lysosomes. Hyperplasia of the smooth endoplasmic reticulum (EPR) was revealed in liver specimens of the rats that had received AfB1. Results of the study suggest the conclusion about mutual mitigation of the effects of nanoparticles and the mycotoxin on rats blood and liver cells after AfB1 has adsorbed on MND.

  17. Aflatoxin B1-induced Hprt mutations in splenic lymphocytes of Fischer 344 rats. Results of an intermittent feeding trial.

    PubMed

    Morris, S M; Aidoo, A; Chen, J J; Chou, M W; Casciano, D A

    1999-01-25

    In a previous study, we found an increase in the mutant frequency at the Hypoxanthine phosphoribosyl transferase (Hprt) locus in the splenic lymphocytes of Fischer 344 rats acutely exposed to aflatoxin B1 (AFB1). Because an acute exposure may not reflect the exposure pattern of individuals whose diet may contain AFB1-contaminated foodstuffs, we sought to determine if the feeding regimen affected the induction of Hprt mutations in the rat splenic lymphocyte. Thus, Fischer 344 rats were fed either (A) a control diet, (B) various doses of AFB1 for three four-week periods interspersed with two four-week periods of the control diet, or (C) continuously fed 1.6 ppm of AFB1. Not only was a significant increase in the mutant frequency detected in the lymphocytes of rats fed a dose as low as 0. 01 ppm of AFB1, but the increase in the mutant frequency at the end of the 20-week experimental period was consistent with an accumulation of damage induced by AFB1. These results indicate that the rat lymphocyte/Hprt assay is useful for detecting chronic low level exposures. Further, these data suggest that an intermittent, low-level exposure to AFB1 may present a human health risk. PMID:10029671

  18. A simple aptamer-based fluorescent assay for the detection of Aflatoxin B1 in infant rice cereal.

    PubMed

    Chen, Lu; Wen, Fang; Li, Ming; Guo, Xiaodong; Li, Songli; Zheng, Nan; Wang, Jiaqi

    2017-01-15

    A fluorescent assay for the rapid, sensitive and specific detection of Aflatoxin B1 (AFB1) was developed in this study. Initially, a DNA/DNA duplex was formed between a fluorescein-labeled AFB1 aptamer and its partially complementary DNA strand containing a quencher moiety, resulting in fluorescence quenching due to the close proximity of fluorophore and quencher. Upon the addition of AFB1, an aptamer/AFB1 complex was generated to release the quencher-modified DNA strand, thus recovered the fluorescence of fluorescein and enabled quantitative detection for AFB1 by monitoring fluorescence enhancement. Under optimized conditions, this assay exhibited a linear response to AFB1 in the range of 5-100ng/mL with a detection limit down to 1.6ng/mL. Trials of this assay in infant rice cereal with satisfactory recovery in the range of 93.0%-106.8%, demonstrate that the new assay could be a potential sensing platform for AFB1 determination in food. PMID:27542489

  19. Effects of aflatoxin B(1) and fumonisin B(1) on blood biochemical parameters in broilers.

    PubMed

    Tessari, Eliana N C; Kobashigawa, Estela; Cardoso, Ana Lúcia S P; Ledoux, David R; Rottinghaus, George E; Oliveira, Carlos A F

    2010-04-01

    The individual and combined effects of dietary aflatoxin B(1 )(AFB(1)) and fumonisin B(1) (FB(1)) on liver pathology, serum levels of aspartate amino-transferase (AST) and plasma total protein (TP) of broilers were evaluated from 8 to 41 days of age. Dietary treatments included a 3 × 3 factorial arrangement with three levels of AFB(1 )(0, 50 and 200 μg AFB(1)/kg), and three levels of FB(1 )(0, 50 and 200 mg FB(1)/kg). At 33 days post feeding, with the exception of birds fed 50 mg FB(1 )only, concentrations of AST were higher (p < 0.05) in all other treatment groups when compared with controls. Plasma TP was lower (p < 0.05) at six days post feeding in groups fed 200 μg AFB(1)/kg alone or in combination with FB(1). At day 33 days post feeding, with the exception of birds fed the highest combination of AFB(1 )and FB(1 )which had higher plasma TP than control birds(, )plasma TP of birds fed other dietary treatments were similar to controls. Broilers receiving the highest levels of AFB(1) and FB(1) had bile duct proliferation and trabecular disorder in liver samples. AFB(1) singly or in combination with FB at the levels studied, caused liver damage and an increase in serum levels of AST. PMID:22069595

  20. Cobalt-Porphyrin-Platinum-Functionalized Reduced Graphene Oxide Hybrid Nanostructures: A Novel Peroxidase Mimetic System For Improved Electrochemical Immunoassay

    PubMed Central

    Shu, Jian; Qiu, Zhenli; Wei, Qiaohua; Zhuang, Junyang; Tang, Dianping

    2015-01-01

    5,10,15,20-Tetraphenyl-21H,23H-porphine cobalt flat stacking on the reduced graphene oxide with platinum nanoparticles (PtNPs/CoTPP/rGO) were first synthesized and functionalized with monoclonal rabbit anti-aflatoxin B1 antibody (anti-AFB1) for highly efficient electrochemical immunoassay of aflatoxin B1 (AFB1) in this work. Transmission electron microscopy (TEM), atomic force microscope (AFM) and spectral techniques were employed to characterize the PtNPs/CoTPP/rGO hybrids. Using anti-AFB1-conjugated PtNPs/CoTPP/rGO as the signal-transduction tag, a novel non-enzymatic electrochemical immunosensing system was designed for detection of target AFB1 on the AFB1-bovine serum albumin-functionalized sensing interface. Experimental results revealed that the designed immunoassay could exhibit good electrochemical responses for target analyte and allowed the detection of AFB1 at a concentration as low as 5.0 pg mL−1 (5.0 ppt). Intra- and inter-assay coefficients of variation were below 10%. Importantly, the methodology was further validated for analyzing naturally contaminated or spiked blank peanut samples with consistent results obtained by AFB1 ELISA kit, thus providing a promising approach for quantitative monitoring of organic pollutants. PMID:26462136

  1. Effects of Lipoic Acid on Immune Function, the Antioxidant Defense System, and Inflammation-Related Genes Expression of Broiler Chickens Fed Aflatoxin Contaminated Diets

    PubMed Central

    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng

    2014-01-01

    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  2. Aflatoxin B1 in eggs and chicken livers by dispersive liquid-liquid microextraction and HPLC.

    PubMed

    Amirkhizi, Behzad; Arefhosseini, Seyed Rafie; Ansarin, Masoud; Nemati, Mahboob

    2015-01-01

    A rapid, low-cost and simple technique has been developed for the determination of aflatoxin B1 (AFB1) in eggs and livers using high-performance liquid chromatography (HPLC) with UV detection. In this study, the presence of AFB1 was investigated in 150 eggs and 50 chicken livers from the local market of Tabriz, Iran. AFB1 was extracted with a mixture of acetonitrile:water (80:20) and cleaned up by dispersive liquid-liquid microextraction which is a very economical, fast and sensitive method. AFB1 was quantified by HPLC-UV without need for any complex derivatisation in samples to enhance the detection. The results showed that 72% of the liver and 58% of the egg samples were contaminated with AFB1 ranging from 0.30 to 16.36 µg kg (̶1). limit of detection and limit of quantification for AFB1 were 0.08 and 0.28 µg kg (̶ 1), respectively. The proposed method is suitable for fast analysing of AFB1 in egg and liver samples. PMID:26160230

  3. Sequential dietary exposure to aflatoxin B1 and fumonisin B1 in F344 rats increases liver preneoplastic changes indicative of a synergistic interaction.

    PubMed

    Qian, Guoqing; Tang, Lili; Lin, Shuhan; Xue, Kathy S; Mitchell, Nicole J; Su, Jianjia; Gelderblom, Wentzel C; Riley, Ronald T; Phillips, Timothy D; Wang, Jia-Sheng

    2016-09-01

    Dietary co-exposure to aflatoxin B1 (AFB1) and fumonisin B1 (FB1) and their interaction on hepatocellular carcinogenesis is of particular concern in toxicology and public health. In this study we evaluated the liver preneoplastic effects of single and sequential dietary exposure to AFB1 and FB1 in the F344 rat carcinogenesis model. Serum biochemical alterations, liver histopathological changes, and the formation of liver glutathione S transferase positive (GST-P+) foci were the major outcome parameters examined. Compared to the AFB1-only treatment, the FB1-only treatment induced less dysplasia, and more apoptosis and mitoses. Sequential AFB1 and FB1 treatment lead to increased numbers of dysplasia, apoptosis and foci of altered hepatocytes, as compared to either mycotoxin treatment alone. More importantly, sequential exposure to AFB1 and FB1 synergistically increased the numbers of liver GTP-P+ foci by approximately 7.3-and 12.9-fold and increased the mean sizes of GST-P+ foci by 6- and 7.5-fold, respectively, as compared to AFB1- or FB1-only treatment groups. In addition, liver ALT and AST levels were significantly increased after sequential treatment as compared to single treatment groups. The results demonstrate the interactive effect of dietary AFB1 and FB1 in inducing liver GST-P+ foci formation and provide information to model future intervention studies. PMID:27430420

  4. Response of the hepatic transcriptome to aflatoxin B1 in ducklings.

    PubMed

    Zhang, Ni-Ya; Qi, Ming; Gao, Xin; Zhao, Ling; Liu, Jie; Gu, Chang-Qin; Song, Wen-Jing; Krumm, Christopher Steven; Sun, Lv-Hui; Qi, De-Sheng

    2016-03-01

    This study was conducted to determine the effects of aflatoxin B1 (AFB1) on the hepatic transcriptome in ducklings through RNA-sequencing (RNA-Seq). Twenty four, 1-day-old ducklings were divided into 4 treatment groups. Each group received an oral dose of AFB1 at 0, 10, 20, 40 μg/kg BW per day for 2 weeks. Administration of 20 and 40 μg/kg BW of AFB1 significantly decreased body weight, feed intake, serum total protein and albumin, while increasing serum aspartate aminotransferase and alanine aminotransferase activities, and hepatic histopathological lesions. Furthermore, RNA was extracted from the liver of ducklings administrated 0 and 40 μg/kg BW of AFB1. Two RNA-Seq libraries were created from pooled samples and produced over 149 M reads, totaling 14.9 Gb of sequence. Approximately 96,953 predicted transcripts were assembled, 749 of which had significant differential expressions (≥ 2-fold) between the control and AFB1 treatment. GO and KEGG pathway analysis results showed that many genes involved in phase I metabolism, phase II detoxification, oxidation-reduction process, carcinogenesis, apoptosis and cell cycle, and fatty acid metabolism were affected by AFB1 exposure. Conclusion, this study determined the hepatic transcriptome responded to AFB1 exposure, and provide candidate genes can be targeted to prevent and/or reduce aflatoxicosis in ducklings. PMID:26763128

  5. Cobalt-Porphyrin-Platinum-Functionalized Reduced Graphene Oxide Hybrid Nanostructures: A Novel Peroxidase Mimetic System For Improved Electrochemical Immunoassay

    NASA Astrophysics Data System (ADS)

    Shu, Jian; Qiu, Zhenli; Wei, Qiaohua; Zhuang, Junyang; Tang, Dianping

    2015-10-01

    5,10,15,20-Tetraphenyl-21H,23H-porphine cobalt flat stacking on the reduced graphene oxide with platinum nanoparticles (PtNPs/CoTPP/rGO) were first synthesized and functionalized with monoclonal rabbit anti-aflatoxin B1 antibody (anti-AFB1) for highly efficient electrochemical immunoassay of aflatoxin B1 (AFB1) in this work. Transmission electron microscopy (TEM), atomic force microscope (AFM) and spectral techniques were employed to characterize the PtNPs/CoTPP/rGO hybrids. Using anti-AFB1-conjugated PtNPs/CoTPP/rGO as the signal-transduction tag, a novel non-enzymatic electrochemical immunosensing system was designed for detection of target AFB1 on the AFB1-bovine serum albumin-functionalized sensing interface. Experimental results revealed that the designed immunoassay could exhibit good electrochemical responses for target analyte and allowed the detection of AFB1 at a concentration as low as 5.0 pg mL-1 (5.0 ppt). Intra- and inter-assay coefficients of variation were below 10%. Importantly, the methodology was further validated for analyzing naturally contaminated or spiked blank peanut samples with consistent results obtained by AFB1 ELISA kit, thus providing a promising approach for quantitative monitoring of organic pollutants.

  6. Aflatoxin B1 binding capacity of autochthonous strains of lactic acid bacteria.

    PubMed

    Fazeli, Mohammad R; Hajimohammadali, M; Moshkani, Azamossadat; Samadi, Nasrin; Jamalifar, Hossein; Khoshayand, Mohammad R; Vaghari, Elham; Pouragahi, Samieh

    2009-01-01

    Some foods are prone to contamination with aflatoxins, with detrimental effect on human health. Lactic acid bacteria have been reported to bind aflatoxins and remove them from foods and feeds. Reduction of aflatoxin B1 (AFB1) from the liquid media by the autochthonous lactic acid bacteria (Lactobacillus casei, Lactobacillus plantarum, and Lactobacillus fermentum) isolated from traditional Iranian sourdough and dairy products is reported in the current study. The effect of incubation time on the binding capacity of the strains to AFB1 was also investigated. Duplicates of individual bacteria with population equivalent to 2 X 10(10) CFU/ml were incubated in the presence of AFB1 at 37 degrees C for a period of 72 h, and the amounts of unbound AFB1 were quantitated by reverse-phase high-performance liquid chromatography. All the strains were capable of removal of AFB1, and the reduction of AFB1 ranged from 25 to 61% throughout the incubation period. Removal of AFB1 was a rapid process, with approximately 61 and 56% of the toxin taken instantly by L. fermentum and L. plantarum, respectively. Binding was of a reversible nature, and some of the bound AFB1 was released into the media by the repeated centrifugation and resuspension of the cell pellets. The stability of the bacteria-toxin complex was strain dependent, and L. casei was a stronger binder of AFB1 compared with the other bacteria. No toxin release was observed after 24 h. These findings tend to suggest that certain novel probiotic bacteria with high aflatoxin binding capacity could be selected for detoxification of foods. PMID:19205485

  7. Efficacy of adsorbents (bentonite and diatomaceous earth) and turmeric (Curcuma longa) in alleviating the toxic effects of aflatoxin in chicks.

    PubMed

    Dos Anjos, F R; Ledoux, D R; Rottinghaus, G E; Chimonyo, M

    2015-01-01

    A study was conducted to determine the efficacy of bentonite clay (BC), diatomaceous earth (DE) and turmeric powder (TUM) in alleviating the toxic effects of aflatoxin B1 (AFB1). A total of 250 Ross-308 d-old male broiler chicks were assigned to 10 dietary treatments (5 replicates of 5 chicks) from hatch to d 21. Dietary treatments were: basal diet; basal diet plus AFB1 (2 mg) or BC (0.75%), or DE (0.75%), or TUM (200 mg/kg curcuminoids) and different combinations of AFB1, BC, DE and TUM. Feed intake (FI), body weight gain (BWG) and feed gain (FG) of the birds fed on BC or DE separately were not different from control birds. Birds fed on TUM only had similar FI and FG but lower BWG than control chicks. Aflatoxin B1 reduced FI, BWG and serum concentrations of glucose, albumin, total protein calcium, but increased FG and relative liver and kidney weights. Chicks fed on the combination of AFB1 and BC had similar FI and FG to control chicks. Chicks fed on the combination of DE and AFB1 had lower FI (23.1%) and BWG (28.6%) compared with control chicks. Chicks fed on the combination of TUM and AFB1 also had decreased FI (26.2 %) and BWG (31%) compared with control chicks. Chicks fed on the combination of AFB1, BC and TUM consumed significantly higher amounts of feed compared with chicks fed on only AF, but gained less when compared with control diet chicks. Chicks fed on the combination of AFB1, DE and TUM diet had poorer growth performance than those fed on AFB1 alone. None of the combination diets reduced the severity of liver lesions. PMID:25990012

  8. Transfer of aflatoxin B1 from feed to milk and from milk to curd and whey in dairy sheep fed artificially contaminated concentrates.

    PubMed

    Battacone, G; Nudda, A; Palomba, M; Pascale, M; Nicolussi, P; Pulina, G

    2005-09-01

    An experiment was carried out using dairy ewes to study the transfer of aflatoxin B1 (AFB1) from feed to milk and from milk to cheese. The effects of AFB1 on liver function and hematological parameters were also investigated. Fifteen ewes were assigned to treatments in replicated 3 x 3 Latin squares. The experimental groups received 32, 64, or 128 microg/d of pure AFB1 for 7 d followed by 5 d of clearance. On the sixth day of the first period, the total daily milk produced by each ewe was collected separately and processed into cheese. The results indicate that the level of AFB1 used did not adversely affect animal health and milk production traits. The aflatoxin M1 (AFM1) concentrations in milk approached a steady-state condition in all treated groups between 2 and 7 d after the start of treatment. The mean AFM1 concentrations of treated groups in steady-state condition (184.4, 324.7, and 596.9 ng/kg in ewes fed 32, 64, or 128 microg of AFB1, respectively) were significantly affected by the AFB1 doses. The AFM1 concentration was linearly related to the AFB1 intake/kg of BW. The carry-over values of AFB1 from feed into AFM1 in milk (0.26 to 0.33%) were not influenced by the AFB1 doses. The AFM1 concentrations in curd and whey were linearly related to the AFM1 concentrations in the unprocessed milk. PMID:16107394

  9. Efficiency of hydrated sodium calcium aluminosilicate to ameliorate the adverse effects of graded levels of aflatoxin B1 in broiler chicks.

    PubMed

    Chen, X; Horn, N; Applegate, T J

    2014-08-01

    The objective of this study was to evaluate the efficiency of a hydrated sodium calcium aluminosilicate (HSCAS) adsorbent to ameliorate the adverse effects of 0.5 to 2 mg of aflatoxin B1 (AFB1)/kg in broiler chicks. The study consisted of 8 dietary treatments, including 4 concentrations of AFB1 (0, 0.5, 1, and 2 mg/kg) with or without HSCAS (0.5%) fed to 8 replicate cages per diet (6 males chicks per cage) from 0 to 21 d of age. Cumulative feed intake, BW gain (P < 0.0001), and G:F (P = 0.004) of birds fed the 2 mg of AFB1/kg of diet were significantly lower in comparison with birds fed 0 to 1 mg of AFB1/kg. Relative liver weight was increased in the 2 mg of AFB1/kg group (P < 0.0001). Dietary HSCAS improved cumulative BW gain (main effect P = 0.06), particularly from 14 to 21 d of age (P = 0.037). Dietary HSCAS also reversed the increase in relative liver weight for birds fed AFB1 (P = 0.019). Dietary AFB1 negatively affected major serum parameters (albumin, total protein, globulin, phosphorus, glucose, alkaline phosphatase, and creatine phosphokinase), whereas supplementation with HSCAS partially alleviated the affected serum biochemistry. In addition, serum complement activity and liver gene expression were negatively affected by 2 mg of AFB1/kg. The HSCAS supplement increased the liver expression of catalase and superoxide dismutase (P < 0.05). Results from this study indicate that dietary supplementation with HSCAS can effectively improve BW gain and partially ameliorate aflatoxicosis for broiler chicks fed AFB1-contaminated feeds. PMID:24894529

  10. In Vitro Efficacy of Myxococcus fulvus ANSM068 to Biotransform Aflatoxin B1

    PubMed Central

    Guan, Shu; Zhao, Lihong; Ma, Qiugang; Zhou, Ting; Wang, Ning; Hu, Xinxu; Ji, Cheng

    2010-01-01

    Aflatoxin B1 (AFB1) is commonly found in cereals and animal feeds and causes a significant threat to the food industry and animal production. Several microbial isolates with high AFB1 transformation ability have been identified in our previous studies. The aim of this research was to characterize one of those isolates, Myxococcus fulvus ANSM068, and to explore its biotransformation mechanism. The bacterial isolate of M. fulvus ANSM068, isolated from deer feces, was able to transform AFB1 by 80.7% in liquid VY/2 medium after incubation at 30 °C for 72 h. The supernatant of the bacterial culture was more effective in transforming AFB1 as compared to the cells alone and the cell extract. The transformation activity was significantly reduced and eradicated after the culture supernatant was treated with proteinase K, proteinase K plus SDS and heating. Culture conditions, including nitrogen source, initial pH and incubation temperature were evaluated for an optimal AFB1 transformation. Liquid chromatography mass spectrometry (LCMS) analyses showed that AFB1 was transformed to a structurally different compound. Infrared analysis (IR) indicated that the lactone ring on the AFB1 molecule was modified by the culture supernatant. Chromatographies on DEAE-Ion exchange and Sephadex-Molecular sieve and SDS-PAGE electrophoresis were used to determine active components from the culture supernatant, indicating that enzyme(s) were responsible for the AFB1 biotransformation. This is the first report on AFB1 transformation by a strain of myxobacteria through enzymatic reaction(s). PMID:21152320

  11. Suppression of aflatoxin B1- or methyl methanesulfonate-induced chromosome aberrations in rat bone marrow cells after treatment with S-methyl methanethiosulfonate.

    PubMed

    Ito, Y; Nakamura, Y; Nakamura, Y

    1997-10-24

    The suppressive effect of S-methyl methanethiosulfonate (MMTS) on aflatoxin B1 (AFB1)- or methyl methanesulfonate (MMS)-induced chromosome aberrations (CA) in rat bone marrow cells was studied. MMTS significantly suppressed CA induced by both AFB1 (an indirect-acting carcinogen) and MMS (a direct-acting carcinogen). Suppression was observed at all periods (6, 12, 18, 24 and 48 h) after AFB1 or MMS treatment and in all doses of AFB1 (5, 10 and 20 mg/kg) or MMS (50, 75 and 100 mg/kg) investigated. AFB1-induced CA was potently suppressed by MMTS given between 2 h before and 6 h after the AFB1 injection. The suppression of AFB1-induced CA by MMTS paralleled the dose of MMTS when MMTS was given in a dose range of 1-20 mg/kg body weight. MMS-induced CA was potently suppressed by MMTS given between 2 h before and 2 h after the MMS injection. The suppressive effect of MMTS on MMS-induced CA paralleled the dose of MMTS when MMTS was given in a dose range of 1-15 mg/kg body weight. Diphenyl disulfide, which modifies -SH groups in proteins like MMTS, also significantly suppressed both AFB1- and MMS-induced CA. Although other mechanisms are not excluded, the suppression of carcinogen-induced CA by MMTS may result from the ability of MMTS to modify -SH groups in proteins. The juices of cabbage and onion, which contain considerable amounts of MMTS and S-methyl-L-cysteinesulfoxide (the precursor of MMTS), also significantly suppressed AFB1- or MMS-induced CA. These results suggest that MMTS is a possible chemopreventive agent against cancer. PMID:9393623

  12. Impact of dietary branched chain amino acids concentration on broiler chicks during aflatoxicosis.

    PubMed

    Chen, X; Zhang, Q; Applegate, T J

    2016-06-01

    A 20-day trial was conducted to determine the effects of dietary branched-chain amino acids (BCAA) on performance, nutrient digestibility, and gene expression of the mTOR pathway in broiler chicks when exposed to aflatoxin B1 (AFB1). The 6 dietary treatments were arranged in a 2 × 3 factorial with 3 BCAA concentrations (1.16, 1.94, and 2.73%) with or without 1.5 mg/kg AFB1 (1.77 mg/kg analyzed). Each diet was fed to 8 replicate cages (6 chicks per cage) from 6 to 20 d of age. Exposure to AFB1 significantly reduced gain:feed ratio and breast muscle weight (P < 0.05), and tended to decrease cumulative BW gain (P = 0.087), while increasing dietary BCAA improved all performance measures (P ≤ 0.0002), except relative breast muscle weight. Apparent ileal digestibility of N and 9 amino acids were increased by AFB1 (P ≤ 0.05), but were reduced by higher dietary BCAA (P ≤ 0.023). Jejunum histology was not affected by AFB1, while higher dietary BCAA tended to increase villus height (P = 0.08). Additionally, the gene expression of mTOR pathway (mTOR, 4EBP1, and S6K1) from liver and jejunum were not affected by dietary treatments, while muscle expression of S6K1 tended to be increased by AFB1 (P = 0.07). No significant interaction between AFB1 and dietary BCAA were observed for any measures in the current study. Results from this study suggested that feed AFB1 contamination can significantly reduce growth performance and breast muscle growth in broiler chicks at 20 d. Higher BCAA supply may have beneficial impact on bird performance, but this effect is independent of AFB1 exposure. PMID:26957625

  13. Effect of dietary resveratrol in ameliorating aflatoxin B1-induced changes in broiler birds.

    PubMed

    Sridhar, M; Suganthi, R U; Thammiaha, V

    2015-12-01

    Consumption of aflatoxin B1 (AFB1) contaminated feed by poultry affects the health of broiler birds causing severe economic losses. The use of phytochemicals is a safe, effective, alternative and practical approach to combat the toxic effect of AF in broilers. Resveratrol, a polyphenol derived from red grapes, berries and peanuts, exerts anti-inflammatory, antioxidant and immunomodulatory effects. Our study was aimed at evaluating the possible protective effects of resveratrol against the adverse effects of AFB1 in broiler birds. A feeding trial of 42 days of duration was undertaken in a completely randomized design with five dietary treatments: G1-AFB1(1.0 ppm); G2-CTR (basal diet alone); G3-AFB1(1.0 ppm)+Resv 0.5%; G4-AFB1(1.0 ppm)+Resv 1%; and G5-Resv 1%. Gain in body weight (BWG) and feed intake (FI) was observed to be highest (p < 0.05) in the AFB1 birds followed by the control group. Feed conversion ratio was lowest in G2-CTR birds and failed to record any significant variation (p > 0.05) between groups as well as within groups. Birds fed resveratrol at both 0.5% and 1.0% levels in combination with AFB1 as well as alone along with basal diet had lower BWG and FI between the fourth and fifth week and also at the fifth week (p < 0.05). No variation (p > 0.05) was obtained in the FCR of AFB1 and resveratrol group of broiler birds. AFB1 feeding significantly increased the activities of aspartate-(AST) and alanine-(ALT) amino transferase, superoxide dismutase (SOD) and catalase (CAT) activities (p < 0.05) but lowered glucose, cholesterol and triglyceride levels in serum. Supplementation of resveratrol helped in increasing the activities of the oxidative enzymes and in improving the plasma total antioxidant capacity (TAOC) and total protein (TP) significantly (p < 0.05) and protein values. The livers of AFB1 group showed degeneration of hepatocytes, bile duct hyperplasia and microgranuloma formation. In resveratrol supplemented birds, the severity and degree of the

  14. Survey of aflatoxins in watermelon seeds from Iran using immunoaffinity column cleanup and HPLC with fluorescence detection.

    PubMed

    Feizy, J; Beheshti, H R; Fakoor Janati, S S; Khoshbakht Fahim, N

    2011-01-01

    This survey was undertaken to determine the levels of aflatoxins in melon seeds. Among 65 samples analyzed by liquid chromatography (LC), the results showed that aflatoxin B1 (AFB1) was the major toxins in melon seeds, detected in 58 samples (89.2% of the total) at an average concentration of 8.5 ng g(-1). The level of AFB1 in 12 samples exceeded the maximum tolerated level for AFB1 in Iranian (5 ng g(-1)) regulations; in other words, 18.5% of samples were unfit for human consumption. PMID:24785721

  15. Comparative study of in vitro prooxidative properties and genotoxicity induced by aflatoxin B1 and its laccase-mediated detoxification products.

    PubMed

    Zeinvand-Lorestani, Hamed; Sabzevari, Omid; Setayesh, Neda; Amini, Mohsen; Nili-Ahmadabadi, Amir; Faramarzi, Mohammad Ali

    2015-09-01

    In this paper, the enzymatic detoxification of aflatoxin B1 (AFB1) by laccase was studied, and the prooxidant properties and mutagenicity of the detoxification products were compared with those of AFB1. The optimal enzymatic reaction occurred in 0.1M of citrate buffer containing 20% DMSO at 35 °C, a pH of 4.5, and a laccase activity of 30 U mL(-1). After 2 d, sixty-seven percent of the toxic substrate was removed. The prooxidative properties of the detoxified products (27% versus 86%) and the mutagenicity were significantly decreased in comparison with the parent toxin. Unlike AFB1, which promoted metabolism-dependent genetic mutations by base-pair substitution, the detoxified products did not induce genotoxicity. Comparison of the Km values for AFB1 and riboflavin, a valuable food nutrient, indicated that laccase showed greater affinity for the toxin than for riboflavin. PMID:25876029

  16. Hepatitis B virus infection contributes to oxidative stress in a population exposed to aflatoxin B1 and high-risk for hepatocellular carcinoma

    PubMed Central

    Liu, Zhi-Ming; Li, Le-Qun; Peng, Min-Hao; Liu, Tang-Wei; Qin, Zhong; Guo, Ya; Xiao, Kai-Yin; Ye, Xin-Ping; Mo, Xin-Shao; Qin, Xue; Li, Shan; Yan, Lu-Nan; Shen, Han-Ming; Wang, LianWen; Wang, Qiao; Wang, Kai-bo; Liang, Ren-xiang; Wei, Zong-liang; Ong, Choon Nam; Santella, Regina M.; Peng, Tao

    2009-01-01

    Biomarkers of Hepatitis B Virus (HBV) infection, aflatoxin B1 (AFB1) exposure and oxidative stress were detected in 71 hepatocellular carcinoma (HCC) patients and 694 controls from southern China. Plasma level of AFB1-Albumin-Adducts (AAA) and protein carbonyl content (PCC) were significantly higher in the 71 HCC cases than in any age/gender matched HBV sero-status groups (P<0.001). HCC patients positive for the p53-249 G-T mutation had a marginally higher level of PCC than those negative for the mutation (p=0.077). HBV infection had a prominent influence on the association between AFB1 exposure and oxidative stress biomarkers in the controls. Our study indicates a significant contribution from HBV infection to oxidative stress in a population with AFB1 exposure which might substantially increase risk for HCC in this region. PMID:18280645

  17. Metabolism and DNA binding of aflatoxicol and aflatoxin B1 in vivo and in isolated hepatocytes from rainbow trout (Salmo gairdneri).

    PubMed

    Loveland, P M; Wilcox, J S; Pawlowski, N E; Bailey, G S

    1987-08-01

    The purpose of this study was to compare the metabolism and DNA binding of aflatoxicol (AFL) with that of aflatoxin B1 (AFB1) in vivo and in isolated hepatocytes from Mt Shasta strain rainbow trout (Salmo gairdneri). Maximum total binding of [3H]AFL to liver DNA from trout exposed by intraperitoneal injection was 38-47% of that of [3H]AFB1 over a 1-7 day period. The average AFL/AFB1 DNA binding ratio in 1-h incubations with isolated hepatocytes was 0.67 +/- 0.36 (n = 13). In freshly isolated hepatocytes, substantial interconversion between AFB1 and AFL via reductase and dehydrogenase enzymes was observed. Total in vivo excretion of conjugates in bile over 4 days was greater for [3H]AFL substrate than for [3H]AFB1. To determine if AFL binding was due to direct activation or to prior metabolism to AFB1 followed by activation, AFL with a tritium atom on the carbon containing the cyclopentenol function [1-3H]AFL, was synthesized and incubated with hepatocytes. Binding of [1-3H]AFL was 3% that of [3H]AFB1 and represents only direct binding of the intact cyclopentenol epoxide molecule before transformation to AFB1 and consequent loss of 3H. H.p.l.c. analysis of DNA hydrolyzed after incubation with [1-3H]AFL resulted primarily in production of non-radioactive 8,9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 (AFB1-N7-guanine). A radioactive peak estimated to be 1% as abundant as the AFB1-N7-guanine was also observed. The overall binding of generally labeled [3H]AFL to trout liver DNA in vivo and in freshly prepared hepatocytes correlates well with available tumor incidence and mutagenicity data. Conclusions from these findings are that direct interaction of AFL-8,9-epoxide with DNA is of relatively minor quantitative importance in rainbow trout hepatocytes and that the major adduct results from conversion of AFL to AFB1 prior to epoxide formation. PMID:3111740

  18. Chemopreventive effect of cactus Opuntia ficus indica on oxidative stress and genotoxicity of aflatoxin B1

    PubMed Central

    2011-01-01

    Background Aflatoxin B1 (AFB1) is potent hepatotoxic and hepatocarcinogenic agent. In aflatoxicosis, oxidative stress is a common mechanism contributing to initiation and progression of hepatic damage. The aim of this work was to evaluate the hepatoprotective effect of cactus cladode extract (CCE) on aflatoxin B1-induced liver damage in mice by measuring malondialdehyde (MDA) level, the protein carbonyls generation and the heat shock proteins Hsp 70 and Hsp 27 expressions in liver. We also looked for an eventual protective effect against AFB1-induced genotoxicity as determined by chromosome aberrations test, SOS Chromotest and DNA fragmentation assay. We further evaluated the modulation of p53, bax and bcl2 protein expressions in liver. Methods Adult, healthy balbC (20-25 g) male mice were pre-treated by intraperitonial administration of CCE (50 mg/Kg.b.w) for 2 weeks. Control animals were treated 3 days a week for 4 weeks by intraperitonial administration of 250 μg/Kg.b.w AFB1. Animals treated by AFB1 and CCE were divided into two groups: the first group was administrated CCE 2 hours before each treatment with AFB1 3 days a week for 4 weeks. The second group was administrated without pre-treatment with CCE but this extract was administrated 24 hours after each treatment with AFB1 3 days a week for 4 weeks. Results Our results clearly showed that AFB1 induced significant alterations in oxidative stress markers. In addition, it has a genotoxic potential and it increased the expression of pro apoptotic proteins p53 and bax and decreased the expression of bcl2. The treatment of CCE before or after treatment with AFB1, showed (i) a total reduction of AFB1 induced oxidative damage markers, (ii) an anti-genotoxic effect resulting in an efficient prevention of chromosomal aberrations and DNA fragmentation compared to the group treated with AFB1 alone (iii) restriction of the effect of AFB1 by differential modulation of the expression of p53 which decreased as well as its

  19. Removal of aflatoxin B1 and inhibition of Aspergillus flavus growth by the use of Lactobacillus plantarum on olives.

    PubMed

    Kachouri, Faten; Ksontini, Hamida; Hamdi, Moktar

    2014-10-01

    Olives can be contaminated with a wide variety of molds (Aspergillus and/or Penicillium) that can be occurring naturally on fresh and processed olives and could support mycotoxin production. The aim of this work was to investigate aflatoxin B1 (AFB1) production by fungi and its bioaccumulation in olives during storage and to study the impact of the application of Lactobacillus plantarum on the inhibition of mold development and production of AFB1. Two different treatments were applied: (i) olives with natural microflora and (ii) olives inoculated with Aspergillus flavus after elimination of natural microflora. AFB1 has been extracted from olives and quantitated by high-performance liquid chromatography using a fluorescence detector. Results showed the absence of this metabolite in the olives for the season 2008 to 2009. In 2009 to 2010, AFB1 was detected at the level of 11 μg/kg. The application of L. plantarum during the storage of olives favors the reduction of the level of AFB1 to 5.9 μg/kg correlated with a decrease in the amount of molds (86.3%). The images obtained by environmental scanning electron microscopy showed that L. plantarum was able to adhere to the olive surface and probably produce a biofilm that inhibits the multiplication of yeast and fungi by oxygen competition. Results showed an increase of antioxidant activity and amount of total phenolic compounds of olives, respectively, by 24 and 8.6%. In many olives contaminated with A. flavus, AFB1 was present at an initial level of 5.15 μg/kg and increased to 6.55 μg/kg after 8 days of storage. The biological detoxification of AFB1 in olives by L. plantarum is confirmed by the reduction of the level of AFB1 to 2.12 μg/kg on day 0 and its absence after 4 days of storage. PMID:25285494

  20. Effects of Aflatoxin B1 on T-Cell Subsets and mRNA Expression of Cytokines in the Intestine of Broilers

    PubMed Central

    Jiang, Min; Peng, Xi; Fang, Jing; Cui, Hengmin; Yu, Zhengqiang; Chen, Zhengli

    2015-01-01

    This study was conducted to investigate the effects of aflatoxin B1 (AFB1) on T-cell subsets and mRNA expression of cytokines in the small intestine of broilers. One hundred and fifty-six one-day-old healthy Cobb broilers were randomly divided into control group (0 mg/kg AFB1) and AFB1 group (0.6 mg/kg AFB1) with three replicates per group and 26 birds per replicate for 21 days, respectively. At 7, 14, and 21 days of age, the duodenum, jejunum and ileum were sampled for analyzing T cell subsets (CD3+, CD3+CD4+ and CD3+CD8+) by flow cytometry as well as IL-2, IL-4, IL-6, IL-10, IL-17, IFN-γ and TNF-α mRNA expression by qRT-PCR. The percentages of T-cells in the intra-epithelial lymphocytes (IELs) and lamina propria lymphocytes (LPLs) of duodenum, jejunum and ileum in the AFB1 group showed a decreased tendency in comparison to the control group. The mRNA expression of cytokines in the three intestinal segments in the AFB1 group presented a general decline compared with the control groups. Our data demonstrated that 0.6 mg/kg AFB1 in the broilers diet could reduce the percentages of T-cell subsets and the expression level of cytokine mRNA in the small intestine, implying that the immune function of the intestinal mucosa might be affected. The reduction of cytokines mRNA expression may be closely associated with the decreased proportions of T cells subsets induced by AFB1. PMID:25826527

  1. Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

    PubMed Central

    Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

    2013-01-01

    Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854

  2. Effects of dietary protein concentration on performance and nutrient digestibility in Pekin ducks during aflatoxicosis.

    PubMed

    Chen, X; Murdoch, R; Zhang, Q; Shafer, D J; Applegate, T J

    2016-04-01

    A 14-d study was conducted to determine the impact of dietary crude protein concentration on performance, serum biochemistry, and nutrient digestive functions in Pekin ducklings during aflatoxicosis. A total of 144 male Pekin ducklings were randomly allotted to 4 dietary treatments arranged in a 2×2 factorial with 2 crude protein (CP) (20 and 24% on an analyzed basis) with or without 0.2 mg/kg aflatoxin B1 (AFB1) (0.21 mg/kg analyzed). The AFB1 reduced BW gain, feed intake, and breast muscle weight by 33 to 43% (P<0.0001). Serum concentration of protein, glucose, and Ca were also decreased by AFB1 (P≤0.0015), while pancreatic activities of amylase and lipase were increased by AFB1 (P<0.005). Apparent N digestibility was not affected by dietary treatment, whereas apparent ileal digestible energy was reduced 7.6% by AFB1 (P=0.0003). Higher dietary CP improved BW gain, gain:feed ratio, and breast muscle weight (P≤0.021), and tended to improve feed intake (P=0.094), but did not improve serum measures, digestive enzyme activity, or nutrient digestibility. No statistical interaction of AFB1 by CP was observed for any measures. Results from the current study suggest that AFB1 at low concentration can significantly impair performance of Pekin ducklings primarily through inhibited feed intake, as well as influence nutrient digestion processes (jejunum morphology, digestive enzyme activity, and apparent energy digestibility). Higher dietary CP can improve growth performance of ducklings regardless of AF exposure, but did not interact with dietary AFB1 on performance, serum biochemistry, or nutrient digestion in Pekin ducklings from hatch to 14 d. PMID:26740138

  3. β-1,3-Glucan reverses aflatoxin B1-mediated suppression of immune responses in mice.

    PubMed

    Bakheet, Saleh A; Attia, Sabry M; Alwetaid, Mohammad Y; Ansari, Mushtaq Ahmad; Zoheir, Khairy M A; Nadeem, Ahmed; Al-Shabanah, Othman A; Al-Harbi, Mohammed M; Ahmad, Sheikh Fayaz

    2016-05-01

    Aflatoxin B1 (AFB1) is immunotoxic to animals and is a suspected immunosuppressant in humans. β-1,3-Glucan (BG) consists of glucose polymers and has a variety of stimulatory effects on the immune system. In this study, we investigated the role of BG on the expression of phenotypic markers and cytokine secretion in mice exposed to AFB1. We treated animals with BG (150mg/kg, p.o., once daily) for 7days beginning at the onset of AFB1 exposure. Exposure of animals to AFB1 alone (1250μg/kg, p.o, once daily) for 7days resulted in a decrease in the percentages of lymphocyte subsets (CD4(+), GITR(+), CD8(+), TCR β(+), CD3(+), Foxp3(+), CD4(+)Foxp3(+), and CD127(+)) as compared to an normal control (NC). However, both BG alone and BG given in conjunction with exposure to AFB1 significantly increased the percentages of these lymphocyte subsets in blood. We also observed that mice exposed to AFB1 showed reduced IL-2, TNF-α, IL-17, and IFN-γ production in the spleen and serum. In contrast, oral administration of BG alone and in conjunction with AFB1 exposure augmented the levels of these cytokines. Moreover, this finding was confirmed through RT-PCR and western blot analysis of mRNA and protein expression in the spleen. Altogether, it can be concluded from these studies that BG enhances the responses of lymphocyte subsets, including cytokine production, even when given following exposure to AFB1 immunotoxin. These data demonstrate that BG carries out its immunomodulating activity by regulating cytokine production. Our findings also provide a direction for development of specific immunomodulating therapy. PMID:26997472

  4. Exposure to aflatoxin B1 in Thailand by consumption of brown and color rice.

    PubMed

    Panrapee, Iamtaweejaroen; Phakpoom, Kooprasertying; Thanapoom, Maneeboon; Nampeung, Anukul; Warapa, Mahakarnchanakul

    2016-02-01

    This study assessed the aflatoxin B1 (AFB1) intake of the Thai population through consumption of contaminated brown and color rice. A total of 240 rice samples from two harvesting periods were collected in June/July 2012 (period I) and in December 2012/January 2013 (period II) and analyzed for AFB1 by HPLC with fluorescence detection (limit of detection (LOD) = 0.093 ng/g). Exposure assessment was based on AFB1 levels in rice and food intake data for rice according to Thai National Consumption. Frequency and levels of AFB1 were higher in period I (59%, AFB1 of 2 μg kg(-1). The data showed that the quality and safety of Thai rice largely comply with the requirement for both exports and domestic consumption. According to the Thai National Consumption data, the estimated AFB1 intake via rice consumption in period I and period II was 0.80 and 0.12 μg kg(-1) bw day(-1), respectively. The potential risk for cancer, based on the recommendation of the JECFA, was estimated to be 0.011 person/year/100,000 people at a mean consumption. Although the risk via consumption of Thai rice seems to be low, the maximum levels of AFB1 in this staple food suggest that careful monitoring and surveillance of AFB1 contamination in rice is essential to ensure the safety of rice. PMID:26686516

  5. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    SciTech Connect

    Meissonnier, Guylaine M.; Pinton, Philippe; Laffitte, Joelle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P.; Bertin, Gerard; Galtier, Pierre; Oswald, Isabelle P.

    2008-09-01

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  6. Removal of aflatoxin B1-DNA adducts and in vitro transformation in mouse embryo fibroblasts C3H/10T1 1/2

    SciTech Connect

    Amstad, P.A.; Wang, T.V.; Cerutti, P.A.

    1983-01-01

    The mechanism of in vitro transformation of the mouse embryo fibroblast C3H/10T 1/2 clone 8 by aflatoxin B1 (AFB1) was studied in confluent holding (CH) experiments. Confluent cultures of C3H/10T 1/2 cells were treated with AFB1 for 16 hours, and the DNA adduct composition and concentration were determined by chromatographic procedures after 0, 8, 16, and 40 hours of CH when the cells were replated at low density for the expression of their colony-forming ability and the formation of transformed foci. Total adduct concentration and the concentration of the major primary adduct 2,3-dihydro-2-(N7-guanyl)-3-hydroxyaflatoxin B1 (AFB1-N7-Gua) decreased continuously during CH due to spontaneous decomposition and probably also due to enzymatic repair processes. In contrast, the more chemically stable secondary product 2,3-dihydro-2-(N5-formyl-2',5',6'-triamino-4'-oxo-N5-pyrimidyl)-3-hydroxyaflatoxin B1 (AFB1-triamino-Py) accumulated in the DNA and reached its maximum concentration after 16 hours of CH. While the loss of total AFB1-DNA adducts during CH was reflected in recovery of viability, the potential to form transformed foci reached a maximum after 16 hours of CH and then decreased with continued CH below the initial value. Therefore, no simple relationship exists between the concentration of the total adducts AFB1-N7-Gua and AFB1-triamino-Py at the time of release from CH and the potential to form transformed foci. However, DNA lesions or abnormal DNA configurations formed during CH as a consequence of the cellular processing of AFB1-DNA adducts may play a role in the transformation process.

  7. Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

    PubMed

    Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

    2014-01-01

    Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. PMID:23047854

  8. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.

    2014-01-01

    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  9. Aflatoxin B1 Detection Using a Highly-Sensitive Molecularly-Imprinted Electrochemical Sensor Based on an Electropolymerized Metal Organic Framework.

    PubMed

    Jiang, Mengjuan; Braiek, Mohamed; Florea, Anca; Chrouda, Amani; Farre, Carole; Bonhomme, Anne; Bessueille, Francois; Vocanson, Francis; Zhang, Aidong; Jaffrezic-Renault, Nicole

    2015-09-01

    A sensitive electrochemical molecularly-imprinted sensor was developed for the detection of aflatoxin B1 (AFB1), by electropolymerization of p-aminothiophenol-functionalized gold nanoparticles in the presence of AFB1 as a template molecule. The extraction of the template leads to the formation of cavities that are able to specifically recognize and bind AFB1 through π-π interactions between AFB1 molecules and aniline moities. The performance of the developed sensor for the detection of AFB1 was investigated by linear sweep voltammetry using a hexacyanoferrate/hexacyanoferrite solution as a redox probe, the electron transfer rate increasing when the concentration of AFB1 increases, due to a p-doping effect. The molecularly-imprinted sensor exhibits a broad linear range, between 3.2 fM and 3.2 µM, and a quantification limit of 3 fM. Compared to the non-imprinted sensor, the imprinting factor was found to be 10. Selectivity studies were also performed towards the binding of other aflatoxins and ochratoxin A, proving good selectivity. PMID:26371042

  10. Hepatic Transcriptome Responses of Domesticated and Wild Turkey Embryos to Aflatoxin B1

    PubMed Central

    Monson, Melissa S.; Cardona, Carol J.; Coulombe, Roger A.; Reed, Kent M.

    2016-01-01

    The mycotoxin, aflatoxin B1 (AFB1) is a hepatotoxic, immunotoxic, and mutagenic contaminant of food and animal feeds. In poultry, AFB1 can be maternally transferred to embryonated eggs, affecting development, viability and performance after hatch. Domesticated turkeys (Meleagris gallopavo) are especially sensitive to aflatoxicosis, while Eastern wild turkeys (M. g. silvestris) are likely more resistant. In ovo exposure provided a controlled AFB1 challenge and comparison of domesticated and wild turkeys. Gene expression responses to AFB1 in the embryonic hepatic transcriptome were examined using RNA-sequencing (RNA-seq). Eggs were injected with AFB1 (1 μg) or sham control and dissected for liver tissue after 1 day or 5 days of exposure. Libraries from domesticated turkey (n = 24) and wild turkey (n = 15) produced 89.2 Gb of sequence. Approximately 670 M reads were mapped to a turkey gene set. Differential expression analysis identified 1535 significant genes with |log2 fold change| ≥ 1.0 in at least one pair-wise comparison. AFB1 effects were dependent on exposure time and turkey type, occurred more rapidly in domesticated turkeys, and led to notable up-regulation in cell cycle regulators, NRF2-mediated response genes and coagulation factors. Further investigation of NRF2-response genes may identify targets to improve poultry resistance. PMID:26751476

  11. Effects of Nutrients in Substrates of Different Grains on Aflatoxin B1 Production by Aspergillus flavus

    PubMed Central

    Liu, Jie; Sun, Lvhui; Zhang, Niya; Zhang, Jiacai; Guo, Jiao; Li, Chong; Rajput, Shahid Ali; Qi, Desheng

    2016-01-01

    The current study was to better understand the potential factors affecting aflatoxin B1 (AFB1) accumulation varies between different grains. The nutrient composition and contents of defatted substrates were determined; additionally, according to the nutrient content of the substrates, the effects of starch, soluble sugars, amino acids, and trace elements on AFB1 production and mycelial growth in Czapek-Dox medium were examined. These results verified that removal of lipids from ground substrates significantly reduced the substrate's potential for AFB1 production by Aspergillus flavus. Maltose, glucose, sucrose, arginine, glutamic acid, aspartic acid, and zinc significantly induced AFB1 production up to 1.7- to 26.6-fold. And stachyose more significantly promoted A. flavus growth than the other nutrients. Thus, this study demonstrated that, combined with the nutrients content of grains, in addition to lipids, sucrose, stachyose, glutamic acid, and zinc might play key roles in various grains that are differentially infected by A. flavus. Particularly, two new nutrients (arginine and stachyose) of the grains we found significantly stimulate AFB1 production and A. flavus growth, respectively. The results provide new concepts for antifungal methods to protect food and animal feed from AFB1 contamination. PMID:27294129

  12. Magnetic bead-based fluorescence immunoassay for aflatoxin B1 in food using biofunctionalized rhodamine B-doped silica nanoparticles.

    PubMed

    Tang, Dianping; Yu, Yongliang; Niessner, Reinhard; Miró, Manuel; Knopp, Dietmar

    2010-10-01

    A simple and sensitive fluorescence immunoassay for the detection of aflatoxin B(1) (AFB(1), as a model compound) in food was developed using AFB(1)-bovine serum albumin conjugate (AFB(1)-BSA)-functionalized magnetic beads as immunosensing probes. The recognition elements were prepared by doping of rhodamine B (RB) fluorophore into silica nanoparticles followed by immobilization of monoclonal anti-AFB(1) antibodies on the silica shell. Based on a competitive-type immunoassay format, the assay was performed both in low-binding polypropylene 96-well microtiter plates (MTPs) and in an automated sequential injection (SI) format. Similar detection limit (LOD) of 0.2 ng mL(-1)vs. 0.1 ng mL(-1) but narrower dynamic working linear range of 0.5-7 ng mL(-1)vs. 0.5-30 ng mL(-1) was obtained toward AFB(1) standards with the flow setup compared to the MTP format. Intra-batch assay precision was substantially improved (≤5.3% vs.≤8.7%) by resorting to the SI manifold. The proposed method features unbiased identification of negative (blank) and positive samples. No significant differences at the 95% confidence level were encountered in the analysis of naturally contaminated peanut samples between the proposed immunoassay and liquid chromatography for determination of AFB(1). PMID:20820489

  13. Aflatoxin B1 Detection Using a Highly-Sensitive Molecularly-Imprinted Electrochemical Sensor Based on an Electropolymerized Metal Organic Framework

    PubMed Central

    Jiang, Mengjuan; Braiek, Mohamed; Florea, Anca; Chrouda, Amani; Farre, Carole; Bonhomme, Anne; Bessueille, Francois; Vocanson, Francis; Zhang, Aidong; Jaffrezic-Renault, Nicole

    2015-01-01

    A sensitive electrochemical molecularly-imprinted sensor was developed for the detection of aflatoxin B1 (AFB1), by electropolymerization of p-aminothiophenol-functionalized gold nanoparticles in the presence of AFB1 as a template molecule. The extraction of the template leads to the formation of cavities that are able to specifically recognize and bind AFB1 through π-π interactions between AFB1 molecules and aniline moities. The performance of the developed sensor for the detection of AFB1 was investigated by linear sweep voltammetry using a hexacyanoferrate/hexacyanoferrite solution as a redox probe, the electron transfer rate increasing when the concentration of AFB1 increases, due to a p-doping effect. The molecularly-imprinted sensor exhibits a broad linear range, between 3.2 fM and 3.2 µM, and a quantification limit of 3 fM. Compared to the non-imprinted sensor, the imprinting factor was found to be 10. Selectivity studies were also performed towards the binding of other aflatoxins and ochratoxin A, proving good selectivity. PMID:26371042

  14. Determination of Aflatoxin B1 Levels in Organic Spices and Herbs

    PubMed Central

    Tosun, Halil; Arslan, Recep

    2013-01-01

    Organically produced spices and herbs were analyzed for determination of aflatoxin B1 (AFB1) by ELISA using immunoaffinity column. For this purpose 93 organic spices and 37 organic herbs were randomly selected from organic markets and organic shops in Turkey. AFB1 was detected in 58 organic spice and 32 organic herb samples. Among organic spice samples, the maximum value was detected in cinnamon sample (53 μg/kg). AFB1 was not detected in thyme samples. AFB1 levels of 41 organic spice samples were above the EU regulatory limit (5 μg/kg). Among organic herb samples the highest concentration of AFB1 (52.5 μg/kg) was detected in a rosehip sample. AFB1 levels of 21 organic herb samples were above the regulatory limits of the European Union. These results showed that more stringent measures must be taken for the prevention of mold contamination in the production of organic spices and herbs. PMID:23766719

  15. Quality Evaluation of Five Commercial Enzyme Linked Immunosorbent Assay Kits for Detecting Aflatoxin B1 in Feedstuffs

    PubMed Central

    Sun, Dan-dan; Gu, Xu; Li, Jun-guo; Yao, Ting; Dong, Ying-chao

    2015-01-01

    The objective of this study was to evaluate the quality of five commercial enzyme linked immunosorbent assay (ELISA) kits (A, B, C, D, and E) from different suppliers for detecting aflatoxin B1 (AFB1). AFB1-free corn samples supplemented with different levels of AFB1 (5, 10, and 20 μg/kg) were used as positive controls and 6 replicates of each control sample were tested to evaluate the accuracy and precision of these kits. In addition, we also evaluated the performance of these ELISA kits for AFB1 in 30 feed samples, including corn, distillers dried grains with soluble, wheat samples, soybean meal, and poultry feed, which were verified by high performance liquid chromatography. Results showed that the coefficients of variation ranged from 1.18% to 16.22% in intra-plate and 2.85% to 18.04% in inter-plate for the determination of AFB1. The half maximal inhibitory concentration for five kits ranged from 3.72 to 7.22 μg/kg. The quantitation limits of AFB1 were all under the legal limit in China but somewhat inconsistent with kit instructions. Although the recovery rate of four of the five kits were either less than 90% or more than 110%, all these values were acceptable in practice. Two kits had high false positive rates (C and E). In conclusion, our results revealed that the qualities of five tested ELISA kits were significantly different. PMID:25924961

  16. Size-dependent modulation of graphene oxide-aptamer interactions for an amplified fluorescence-based detection of aflatoxin B1 with a tunable dynamic range.

    PubMed

    Zhang, JingJing; Li, Zengmei; Zhao, Shancang; Lu, Yi

    2016-06-20

    Aflatoxin B1 (AFB1) is a common toxin found in many foods. While AFB1 sensors have been reported, few studies have shown amplified detection with tunable dynamic ranges. We herein report a simple and highly sensitive amplified aptamer-based fluorescent sensor for AFB1, which relies on the ability of nano-graphene oxide (GO) to protect aptamers from nuclease cleavage for amplified detection and on the nanometer size effect of GO to tune the dynamic range and sensitivity. The assay was performed by simply mixing the carboxyl-X-rhodamine (ROX)-labeled AFB1 aptamer, the GO, the nuclease, and the AFB1 samples. Modulating the size of the GO nanosheet resulted in three dynamic ranges, i.e., 12.5 to 312.5 ng mL(-1), 1.0 to 100 ng mL(-1), and 5.0 to 50 ng mL(-1), with corresponding limits of detection of 10.0 ng mL(-1), 0.35 ng mL(-1) and 15.0 ng mL(-1), respectively. The sensor was highly selective against other aflatoxins and common molecules in foods, and its performance was verified in corn samples spiked with known concentration of AFB1. PMID:27137348

  17. An ethoxyquin-inducible aldehyde reductase from rat liver that metabolizes aflatoxin B1 defines a subfamily of aldo-keto reductases.

    PubMed Central

    Ellis, E M; Judah, D J; Neal, G E; Hayes, J D

    1993-01-01

    Protection of liver against the toxic and carcinogenic effects of aflatoxin B1 (AFB1) can be achieved through the induction of detoxification enzymes by chemoprotectors such as the phenolic antioxidant ethoxyquin. We have cloned and sequenced a cDNA encoding an aldehyde reductase (AFB1-AR), which is expressed in rat liver in response to dietary ethoxyquin. Expression of the cDNA in Escherichia coli and purification of the recombinant enzyme reveals that the protein exhibits aldehyde reductase activity and is capable of converting the protein-binding dialdehyde form of AFB1-dihydrodiol to the nonbinding dialcohol metabolite. We show that the mRNA encoding this enzyme is markedly elevated in the liver of rats fed an ethoxyquin-containing diet, correlating with acquisition of resistance to AFB1. AFB1-AR represents the only carcinogen-metabolizing aldehyde reductase identified to date that is induced by a chemoprotector. Alignment of the amino acid sequence of AFB1-AR with other known and putative aldehyde reductases shows that it defines a subfamily within the aldo-keto reductase superfamily. Images Fig. 2 Fig. 3 Fig. 4 PMID:8234296

  18. Hetero-enzyme-based two-round signal amplification strategy for trace detection of aflatoxin B1 using an electrochemical aptasensor.

    PubMed

    Zheng, Wanli; Teng, Jun; Cheng, Lin; Ye, Yingwang; Pan, Daodong; Wu, Jingjing; Xue, Feng; Liu, Guodong; Chen, Wei

    2016-06-15

    An electrochemical aptasensor for trace detection of aflatoxin B1 (AFB1) was developed by using an aptamer as the recognition unit while adopting the telomerase and EXO III based two-round signal amplification strategy as the signal enhancement units. The telomerase amplification was used to elongate the ssDNA probes on the surface of gold nanoparticles, by which the signal response range of the signal-off model electrochemical aptasensor could be correspondingly enlarged. Then, the EXO III amplification was used to hydrolyze the 3'-end of the dsDNA after the recognition of target AFB1, which caused the release of bounded AFB1 into the sensing system, where it participated in the next recognition-sensing cycle. With this two-round signal amplified electrochemical aptasensor, target AFB1 was successfully measured at trace concentrations with excellent detection limit of 0.6*10(-4)ppt and satisfied specificity due to the excellent affinity of the aptamer against AFB1. Based on this designed two-round signal amplification strategy, both the sensing range and detection limit were greatly improved. This proposed ultrasensitive electrochemical aptasensor method was also validated by comparison with the classic instrumental methods. Importantly, this hetero-enzyme based two-round signal amplified electrochemical aptasensor offers a great promising protocol for ultrasensitive detection of AFB1 and other mycotoxins by replacing the core recognition sequence of the aptamer. PMID:26896792

  19. Alleviation of aflatoxin B1-induced oxidative stress in HepG2 cells by volatile extract from Allii Fistulosi Bulbus.

    PubMed

    Lee, Joon-Kyoung; Choi, Eun Hye; Lee, Kwang-Geun; Chun, Hyang Sook

    2005-10-21

    The volatile extract from Allii Fistulosi Bulbus (VEAF) was isolated by steam distillation under reduced pressure, followed by continuous liquid-liquid extraction, and its effects on aflatoxin B1 (AFB1)-induced oxidative stress were investigated in human hepatoma cells (HepG2). The main constituents of the VEAF, identified by gas chromatography/mass spectrometry, were 2-octyl-5-methyl-3(2H)-furanone, 2-hexyl-5-methyl-3(2H)-furanone, 2,5-dimethylthiophene, 3,5-diethyl-1,2,4-trithiolane and 3,4-dimethyl-2,5-dihydro-thiophene-2-one. VEAF significantly inhibited the formation of intracellular reactive oxygen species caused by AFB1 in a dose-dependent manner, concomitant with a significant decrease in the AFB1-induced cytotoxicity. VEAF pretreatment significantly reduced the levels of thiobarbituric acid reactive substances, an indicator of lipid peroxidation, whereas increased the level of reduced glutathione. The level of 8-hydroxy-2'-deoxyguanosine, a DNA oxidative stress marker, was also decreased by 49-59% with pretreatment of VEAF. With respect to the activity of AFB1 metabolizing enzymes, VEAF significantly increased the activity of glutathione S-transferase, and significantly decreased the cytochrome (CYP) P450 3A4 activity, but had a little effect on the CYP1As. These results suggest that VEAF may be selectively effective in alleviating the AFB1-induced oxidative stress, and lead to cytoprotection against AFB1 exposure. PMID:15970298

  20. Simple and sensitive detection of aflatoxin B1 within five minute using a non-conventional competitive immunosensing mode.

    PubMed

    Lin, Youxiu; Zhou, Qian; Lin, Yuping; Tang, Dianyong; Chen, Guonan; Tang, Dianping

    2015-12-15

    A novel competitive-type immunosensing strategy based on target-induced displacement reaction with antibody-functionalized mesoporous carbon (MSC) nanoparticles was designed for sensitive and rapid electrochemical detection of aflatoxin B1 (AFB1, used as a model) on the Nafion-functionalized sensing interface. Electroactive thionine molecules were initially decorated to the mesoporous carbon, and polyclonal anti-AFB1 antibody was then covalently conjugated to the nanostructures. The immunosensor was simply prepared via the electrostatic interaction between negatively charged Nafion film and positively charged anti-AFB1 antibody accompanying the nanostructures. The electrochemical signal originated from the carried thionine to mesoporous carbon. Upon target AFB1 introduction, the analyte reacted with the labeled anti-AFB1 antibody on the MSC based on specific antigen-antibody reaction and induced the dissociation of thionine-MSN nanostructures from the sensing interface, thus decreasing the cathodic current of the carried thionine molecules. Under optimal conditions, the immunosensor exhibited good electrochemical responses for determination of target AFB1 at a concentration as low as 3.0 pg mL(-1) (3.0 ppt). Importantly, the non-conventional sensing system provides a promising immunosensing strategy for rapid screening of small molecules because of its simplicity, low cost and sensitivity without the needs of sample separation and washing step. PMID:26208172

  1. Effects of Nutrients in Substrates of Different Grains on Aflatoxin B1 Production by Aspergillus flavus.

    PubMed

    Liu, Jie; Sun, Lvhui; Zhang, Niya; Zhang, Jiacai; Guo, Jiao; Li, Chong; Rajput, Shahid Ali; Qi, Desheng

    2016-01-01

    The current study was to better understand the potential factors affecting aflatoxin B1 (AFB1) accumulation varies between different grains. The nutrient composition and contents of defatted substrates were determined; additionally, according to the nutrient content of the substrates, the effects of starch, soluble sugars, amino acids, and trace elements on AFB1 production and mycelial growth in Czapek-Dox medium were examined. These results verified that removal of lipids from ground substrates significantly reduced the substrate's potential for AFB1 production by Aspergillus flavus. Maltose, glucose, sucrose, arginine, glutamic acid, aspartic acid, and zinc significantly induced AFB1 production up to 1.7- to 26.6-fold. And stachyose more significantly promoted A. flavus growth than the other nutrients. Thus, this study demonstrated that, combined with the nutrients content of grains, in addition to lipids, sucrose, stachyose, glutamic acid, and zinc might play key roles in various grains that are differentially infected by A. flavus. Particularly, two new nutrients (arginine and stachyose) of the grains we found significantly stimulate AFB1 production and A. flavus growth, respectively. The results provide new concepts for antifungal methods to protect food and animal feed from AFB1 contamination. PMID:27294129

  2. Comparative Hepatotoxicity of Aflatoxin B1 among Workers Exposed to Different Organic Dust with Emphasis on Polymorphism Role of Glutathione S-Transferase Gene

    PubMed Central

    Saad-Hussein, Amal; Shahy, Eman M.; Shaheen, Weam; Taha, Mona M.; Mahdy-Abdallah, Heba; Ibrahim, Khadiga S.; Hafez, Salwa F.; Fadl, Nevein N.; El-Shamy, Karima A.

    2016-01-01

    AIM: The study aimed to investigate effects of organic dust exposure from different sources on aflatoxin B1-albumin adducts (AFB1/Alb), and role of glutathione S-transferase (GST) gene polymorphism in hepatotoxicity of (AFB1) among exposed workers. MATERIAL AND METHODS: Liver enzymes, AFB1/Alb, and GST polymorphism were estimated in 132 wheat flour dust and 87 woods sawmill workers, and 156 controls. RESULTS: Results revealed that AFB1/Alb and liver enzymes were significantly elevated in exposed workers compared to controls, and were significantly higher in sawmill workers compared to flour workers. AFB1/Alb in flour and sawmill workers with GSTT1 and GSTM1&GSTT1 null genotypes were significantly higher than controls, and in sawmill workers with GSTM1&GSTT1 null than flour workers. Liver enzymes (ALT and AST) in sawmill workers were significantly higher than flour workers and controls in all GST polymorphism; except in GSTT1 polymorphism, where these enzymes were significantly higher in the two exposed groups than controls. CONCLUSIONS: In conclusion, organic dust exposure may cause elevation in AFB1/Alb and liver enzymes of exposed workers, and GST gene polymorphism plays an important role in susceptibility to hepatic parenchymal cell injury; except in workers with GSTT1&GSTM1 null genotype, gene susceptibility seemed to have little role and the main role was for environmental exposures. PMID:27335608

  3. A novel electrochemical immunosensor for highly sensitive detection of aflatoxin B1 in corn using single-walled carbon nanotubes/chitosan.

    PubMed

    Zhang, Xian; Li, Chao-Rui; Wang, Wei-Cheng; Xue, Jian; Huang, Ya-Ling; Yang, Xian-Xian; Tan, Bin; Zhou, Xi-Peng; Shao, Chuang; Ding, Shi-Jia; Qiu, Jing-Fu

    2016-02-01

    A sensitive electrochemical immunosensor for aflatoxin B1 (AFB1) detection based on single-walled carbon nanotubes/chitosan was presented. The immunosensor was based on an indirect competitive binding to a fixed amount of anti-AFB1 between free AFB1 and AFB1-bovine serum albumin, which conjugate immobilized on covalently functionalized nanotubes/chitosan laid on the glass carbon electrode. Then, the anti-mouse immunoglobulin G secondary antibody labeled with alkaline phosphatase was bound to the electrode surface through reacting with primary antibody. Finally, alkaline phosphatase catalyzes the hydrolysis of the substrate α-naphthyl phosphate, which produced electrochemical signal. Compared with conventional methods, the established immunosensor was more sensitive and simple. Under optimal conditions, this method could quantitatively detect AFB1 from 0.01 to 100 ng mL(-1) with a detection limit of 3.5 pg mL(-1). Moreover, the immunosensor was successfully applied to assay AFB1 in corn powder, which showed good correlation with the results obtained from high performance liquid chromatography. PMID:26304338

  4. A SERS-active sensor based on heterogeneous gold nanostar core-silver nanoparticle satellite assemblies for ultrasensitive detection of aflatoxinB1

    NASA Astrophysics Data System (ADS)

    Li, Aike; Tang, Lijuan; Song, Dan; Song, Shanshan; Ma, Wei; Xu, Liguang; Kuang, Hua; Wu, Xiaoling; Liu, Liqiang; Chen, Xin; Xu, Chuanlai

    2016-01-01

    A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL-1 with the limit of detection (LOD) of 0.48 pg mL-1. The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection.A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL-1 with the limit of detection (LOD) of 0.48 pg mL-1. The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr08372a

  5. Glutathione-S-transferase A3 knockout mice are sensitive to acute cytotoxic and genotoxic effects of aflatoxin B1

    SciTech Connect

    Ilic, Zoran; Crawford, Dana; Egner, Patricia A.; Sell, Stewart

    2010-02-01

    Aflatoxin B1 (AFB1) is a major risk factor for hepatocellular carcinoma (HCC) in humans. However, mice, a major animal model for the study of AFB1 carcinogenesis, are resistant, due to high constitutive expression, in the mouse liver, of glutathione S-transferase A3 subunit (mGSTA3) that is lacking in humans. Our objective was to establish that a mouse model for AFB1 toxicity could be used to study mechanisms of toxicity that are relevant for human disease, i.e., an mGSTA3 knockout (KO) mouse that responds to toxicants such as AFB1 in a manner similar to humans. Exons 3-6 of the mGSTA3 were replaced with a neomycin cassette by homologous recombination. Southern blotting, RT-PCR, Western blotting, and measurement of AFB1-N{sup 7}-DNA adduct formation were used to evaluate the mGSTA3 KO mice. The KO mice have deletion of exons 3-6 of the mGSTA3 gene, as expected, as well as a lack of mGSTA3 expression at the mRNA and protein levels. Three hours after injection of 5 mg/kg AFB1, mGSTA3 KO mice have more than 100-fold more AFB1-N{sup 7}-DNA adducts in their livers than do similarly treated wild-type (WT) mice. In addition, the mGSTA3 KO mice die of massive hepatic necrosis, at AFB1 doses that have minimal toxic effects in WT mice. We conclude that mGSTA3 KO mice are sensitive to the acute cytotoxic and genotoxic effects of AFB1, confirming the crucial role of GSTA3 subunit in protection of normal mice against AFB1 toxicity. We propose the mGSTA3 KO mouse as a useful model with which to study the interplay of risk factors leading to HCC development in humans, as well as for testing of additional possible functions of mGSTA3.

  6. Enzymatic hydrolysate-induced displacement reaction with multifunctional silica beads doped with horseradish peroxidase-thionine conjugate for ultrasensitive electrochemical immunoassay.

    PubMed

    Lin, Youxiu; Zhou, Qian; Lin, Yuping; Tang, Dianping; Niessner, Reinhard; Knopp, Dietmar

    2015-08-18

    A novel (invertase) enzymatic hydrolysate-triggered displacement reaction strategy with multifunctional silica beads, doped with horseradish peroxidase-thionine (HRP-Thi) conjugate, was developed for competitive-type electrochemical immunoassay of small molecular aflatoxin B1 (AFB1). The competitive-type displacement reaction was carried out on the basis of the affinity difference between enzymatic hydrolysate (glucose) and its analogue (dextran) for concanavalin A (Con A) binding sites. Initially, thionine-HRP conjugates were doped into nanometer-sized silica beads using the reverse micelle method. Then monoclonal anti-AFB1 antibody and Con A were covalently conjugated to the silica beads. The immunosensor was prepared by means of immobilizing the multifunctional silica beads on a dextran-modified sensing interface via the dextran-Con A binding reaction. Gold nanoparticles functionalized with AFB1-bovine serum albumin conjugate (AFB1-BSA) and invertase were utilized as the trace tag. Upon target AFB1 introduction, a competitive-type immunoreaction was implemented between the analyte and the labeled AFB1-BSA on the nanogold particles for the immobilized anti-AFB1 antibody on the electrode. The invertase followed by gold nanoparticles hydrolyzed sucrose into glucose and fructose. The produced glucose displaced the multifunctional silica beads from the electrode based on the classical dextran-Con A-glucose system, thus decreasing the catalytic efficiency of the immobilized HRP on the electrode relative to that of the H2O2-thionine system. Under optimal conditions, the detectable electrochemical signal increased with the increasing target AFB1 in a dynamic working range from 3.0 pg mL(-1) to 20 ng mL(-1) with a detection limit of 2.7 pg mL(-1). The strong bioconjugation with two nanostructures also resulted in a good repeatability and interassay precision down to 9.3%. Finally, the methodology was further validated for analysis of naturally contaminated or spiked AFB1

  7. Growth, serum biochemistry, complement activity, and liver gene expression responses of Pekin ducklings to graded levels of cultured aflatoxin B1.

    PubMed

    Chen, X; Horn, N; Cotter, P F; Applegate, T J

    2014-08-01

    A 14-d study was conducted to evaluate the effects of cultured aflatoxin B1 (AFB1) on performance, serum biochemistry, serum natural antibody and complement activity, and hepatic gene expression parameters in Pekin ducklings. A total of 144 male Pekin ducklings were weighed, tagged, and randomly allotted to 4 dietary treatments containing 4 concentrations of AFB1 (0, 0.11, 0.14, and 0.21 mg/kg) from 0 to 14 d of age (6 cages per diet; 6 ducklings per cage). Compared with the control group, there was a 10.9, 31.7, and 47.4% (P < 0.05) decrease in cumulative BW gain with 0.11, 0.14, and 0.21 mg of AFB1/kg of diet, respectively, but feed efficiency was not affected. Increasing concentrations of AFB1 reduced cumulative BW gain and feed intake both linearly and quadratically, and regression equations were developed with r(2) ≥0.73. Feeding 0.11 to 0.21 mg of AFB1/kg reduced serum glucose, creatinine, albumin, total protein, globulin, Ca, P, and creatine phosphokinase linearly, whereas serum urea N, Cl, alkaline phosphatase, and aspartate amino transferase concentrations increased linearly with increasing AFB1 (P < 0.05). Additionally, 0.11 to 0.21 mg of AFB1/kg diets impaired classical and alternative complement pathways in the duckling serum when tested by lysis of rabbit, human type O, and horse erythrocytes, and decreased rabbit and horse agglutinins (P < 0.05). Liver peroxisome proliferator activated receptor α (PPARα) expression was linearly downregulated by AFB1 (P < 0.01). Results from this study indicate that for every 0.10 mg/kg increase in dietary AFB1, cumulative feed intake and BW gain decrease approximately 230 and 169 g per duckling from hatch to 14 d; and that AFB1 at very low concentrations can significantly impair liver function and gene expression, and innate immune dynamics in Pekin ducklings. PMID:24902705

  8. Aspergillus flavus aflatoxin occurrence and expression of aflatoxin biosynthesis genes in soil.

    PubMed

    Accinelli, Cesare; Abbas, H K; Zablotowicz, R M; Wilkinson, J R

    2008-05-01

    The carcinogen aflatoxin B1 (AFB1) produced by Aspergillus flavus is a major food safety concern in crops. However, information on AFB1 occurrence in soil and crop residue is scarce. A series of experiments investigated the occurrence of AFB1 in soil and corn residues and ascertained the ecology of A. flavus in a Dundee silt loam soil. Samples of untilled soil (0-2 cm) and residues were collected in March 2007 from plots previously planted with a corn isoline containing the Bacillus thuringiensis (Bt) endotoxin gene or the parental non-Bt isoline. AFB1 levels were significantly different in various corn residues. The highest AFB1 levels were observed in cobs containing grain, with 145 and 275 ng.g-1 in Bt and non-Bt, respectively (P > or = F = 0.001). Aflatoxin levels averaged 3.3 and 9.6 ng.g-1 in leaves and (or) stalks and cobs without grain, respectively. All soils had AFB1 ranging from 0.6 to 5.5 ng.g-1 with similar levels in plots from Bt and non-Bt corn. Based on cultural methods, soil contained from log10 3.1 to 4.5 A. flavus cfu.g-1 with about 60% of isolates producing aflatoxin. Laboratory experiments demonstrated that AFB1 is rapidly degraded in soil at 28 degrees C (half-life < or = 5 days). The potential of the soil A. flavus to produce aflatoxins was confirmed by molecular methods. Transcription of 5 aflatoxin biosynthesis genes, including aflD, aflG, aflP, aflR, and aflS, were detected by reverse transcription - polymerase chain reaction analysis in soil. Although AFB1 appears to be transient in soils, it is clear that AFB1 is produced in surface soil in the presence of corn residues, as indicated by A. flavus cfu levels, AFB1 detection, and expression of aflatoxin biosynthetic genes. PMID:18449222

  9. Rapid and label-free detection of ochratoxin A and aflatoxin B1 using an optical portable instrument.

    PubMed

    Arduini, Fabiana; Neagu, Daniela; Pagliarini, Valeria; Scognamiglio, Viviana; Leonardis, Maria Antonietta; Gatto, Emanuela; Amine, Aziz; Palleschi, Giuseppe; Moscone, Danila

    2016-04-01

    In this study, we report a novel assay for the combined on site detection of aflatoxin B1 (AFB1) and ochratoxin A (OTA), through a colorimetric biosensing system for AFB1 and a fluorimetric detection for OTA, exploiting the capability of the portable fibre optic spectrometer to perform both analyses. AFB1 was detected using the acetylcholinesterase (AChE) enzyme that is inhibited by this toxin, and the degree of inhibition was quantified by the Ellman's spectrophotometric method, obtaining a detection limit of 10 µg L(-1). OTA quantification was performed by monitoring its intrinsic fluorescence in methanol, reaching a detection limit of 0.1 µg L(-1). In order to successfully apply the analytical tool in the food analysis, immunoaffinity columns were used. Clean-up and quantification of both AFB1 and OTA in millet samples was obtained by HPLC-dedicated AflaOchra-Test HPLC™ (Vicam™) and Afla-OtaCLEAN™ (LC-Tech) immunoaffinity columns, followed by absorption/fluorescence detection. Millet samples which were fortified with both OTA (50 µg kg(-1)) and AFB1 (20 µg kg(-1)), gave recovery values of 100 ± 6% for OTA, and 110 ± 10% for AFB1, using AflaOchra-Test HPLC™. Single OTA clean-up and quantification in wine samples was obtained, using an OchraTest immunoaffinity column (Vicam™), reaching a detection limit of 0.3 µg L(-1) and recovery values between 80% and 120%. These results demonstrated the possibility of employing a single clean-up and a cost-effective, and easy to use analytical system for both AFB1 and OTA detection at µg kg(-1) (ppb) level. Furthermore, in the case of positive samples, they could be analysed further, using standard chromatographic procedures, without any additional clean-up step, since the same extraction procedure of standard method is proposed in our method. PMID:26838428

  10. Effect of gamma radiation on the inactivation of aflatoxin B1 in food and feed crops

    PubMed Central

    Ghanem, I.; Orfi, M.; Shamma, M.

    2008-01-01

    Samples of food crops (peanut, peeled pistachio, unpeeled pistachio, rice, and corn) and feed (barley, bran, corn) were autoclave-sterilized, and inoculated with 106 of spore suspension of an isolate of Aspergillus flavus fungus known to produce aflatoxin B1 (AFB1) . Following a 10-day period of incubation at 27 C to allow for fungal growth, food and feed samples were irradiated with gamma radiation at the doses 4, 6, and 10 kGy. Results indicated that degradation of AFB1 was positively correlated with the increase in the applied dose of gamma ray for each tested sample. At a dose of 10 kGy percentages of AFB1 degradation reached highest values at 58.6, 68.8, 84.6, 81.1 and 87.8% for peanuts, peeled pistachios, unpeeled pistachios, corn and rice samples, respectively. In feed samples percentages of AFB1 degradation were 45, 66, and 90% in barley, 47, 75, and 86% in bran, and 31, 72, and 84% in corn for the doses of 4, 6, and 10 kGy, respectively. AFB1 degradation in food samples correlated negatively with oil content in irradiated samples. Thus, in peanuts, which contained the highest oil content, percentage of AFB1 degradation at 10 kGy was not more than 56.6%, whereas, the corresponding value in corn, which contained the lowest oil content, reached as high as 80%. The above results indicate the possibility of using gamma radiation as a means of degradation of AFB1 in food and feed crops to levels lower than the maximum allowed levels. PMID:24031308

  11. Aflatoxin B1 degradation by liquid cultures and lysates of three bacterial strains.

    PubMed

    Adebo, Oluwafemi Ayodeji; Njobeh, Patrick Berka; Sidu, Sibusiso; Tlou, Matsobane Godfrey; Mavumengwana, Vuyo

    2016-09-16

    Aflatoxin contamination remains a daunting issue to address in food safety. In spite of the efforts geared towards prevention and elimination of this toxin, it still persists in agricultural commodities. This has necessitated the search for other measures such as microbial degradation to combat this hazard. In this study, we investigated the biodegradation of aflatoxin B1 (AFB1), using lysates of three bacterial strains (Pseudomonas anguilliseptica VGF1, Pseudomonas fluorescens and Staphylococcus sp. VGF2) isolated from a gold mine aquifer. The bacterial cells were intermittently lysed in the presence and absence of protease inhibitors to obtain protease free lysates, subsequently incubated with AFB1 for 3, 6, 12, 24, and 48h to investigate whether any possible AFB1 degradation occurred using high performance liquid chromatography (HPLC) for detection. Results obtained revealed that after 6h of incubation, protease inhibited lysates of Staphylococcus sp. VGF2 demonstrated the highest degradation capacity of 100%, whereas P. anguilliseptica VGF1 and P. fluorescens lysates degraded AFB1 by 66.5 and 63%, respectively. After further incubation to 12h, no residual AFB1 was detected for all the lysates. Lower degrading ability was however observed for liquid cultures and uninhibited lysates. Data on cytotoxicity studies against human lymphocytes showed that the degraded products were less toxic than the parent AFB1. From this study, it can thus be deduced that the mechanism of degradation by these bacterial lysates is enzymatic. This study shows the efficacy of crude bacterial lysates for detoxifying AFB1 indicating potential for application in the food and feed industry. PMID:27294556

  12. Aflatoxin B(1) degradation by Stenotrophomonas maltophilia and other microbes selected using coumarin medium.

    PubMed

    Guan, Shu; Ji, Cheng; Zhou, Ting; Li, Junxia; Ma, Qiugang; Niu, Tiangui

    2008-08-01

    Aflatoxin B(1) (AFB(1)) is one of the most harmful mycotoxins in animal production and food industry. A safe, effective and environmentally sound detoxification method is needed for controlling this toxin. In this study, 65 samples were screened from various sources with vast microbial populations using a newly developed medium containing coumarin as the sole carbon source. Twenty five single-colony bacterial isolates showing AFB(1) reduction activity in a liquid culture medium were selected from the screen. Isolate 35-3, obtained from tapir feces and identified to be Stenotrophomonas maltophilia, reduced AFB(1) by 82.5% after incubation in the liquid medium at 37 degrees C for 72 h. The culture supernatant of isolate 35-3 was able to degrade AFB(1) effectively, whereas the viable cells and cell extracts were far less effective. Factors influencing AFB(1) degradation by the culture supernatant were investigated. Activity was reduced to 60.8% and 63.5% at 20 degrees C and 30 degrees C, respectively, from 78.7% at 37 degrees C. The highest degradation rate was 84.8% at pH 8 and the lowest was only 14.3% at pH 4.0. Ions Mg(2+) and Cu(2+) were activators for AFB(1) degradation, however ion Zn(2+) was a strong inhibitor. Treatments with proteinase K, proteinase K plus SDS and heating significantly reduced or eradicated the degradation activity of the culture supernatant. The results indicated that the degradation of AFB(1) by S. maltophilia 35-3 was enzymatic and could have a great potential in industrial applications. PMID:19325817

  13. Mycotoxin-producing ability and chemotype diversity of Aspergillus section flavi from soils of peanut-growing regions in iran.

    PubMed

    Amani, S; Shams-Ghahfarokhi, M; Banasaz, M; Razzaghi-Abyaneh, M

    2012-12-01

    Invasion of crops with Aspergillus flavus may result in contamination of food and feed with carcinogenic mycotoxins such as aflatoxins (AF) and cyclopiazonic acid (CPA). In the present study, distribution and toxigenicity of Aspergillus flavus and A. parasiticus in soils of five peanut fields located in Guilan province, Northern Iran was investigated. From a total of 30 soil samples, 53 strains were isolated which all of them were finally identified as A. flavus by a combination of colony morphology, microscopic criteria and mycotoxin profiles. Chromatographic analysis of fungal cultures on yeast extract sucrose broth by tip culture method showed that 45 of the 53 A. flavus isolates (84.9 %) were able to produce either CPA or AFB1, while eight of the isolates (15.1 %) were non-toxigenic. The amounts of CPA and AFB1 produced by the isolates were reported in the range of 18.2-403.8 μg/g and 53.3-7446.3 μg/g fungal dry weights, respectively. Chemotype classification of A. flavus isolates based on the ability for producing mycotoxins and sclerotia showed that 43.4 % were producers of CPA, AFB1 and sclerotia (group I), 13.2 % of CPA and AFB1 (group II), 9.4 % of AFB1 and sclerotia (group III), 13.2 % of AFB1 (group IV), 5.7 % of CPA and sclerotia (group V) and 15.1 % were non-toxigenic with no sclerotia (group VI). No strain was found as producer of only CPA or sclerotia. These results indicate different populations of mycotoxigenic A. flavus strains enable to produce hazardous amounts of AFB1 and CPA are present in peanuts field soils which can be quite important regard to their potential to contaminate peanuts as a main crop consumed in human and animal nutrition. PMID:24293709

  14. Initiation, promotion, and inhibition of carcinogenesis in rainbow trout

    SciTech Connect

    Bailey, G.; Selivonchick, D.; Hendricks, J.

    1987-04-01

    The identification of etiological agents in feral fish neoplasia epizootics has been hampered in part by the lack of suitable fish models, and complicated by the likely existence of environmental agents which can act to stimulate or reduce population responses to genotoxin insult. The response of fish to tumor inhibitors and promoters, and the underlying mechanisms of modulation, have been studied in the rainbow trout model. Dietary treatment of trout with the compounds indole-3-carbinol (I3C), ..beta..-napthroflavone (BNF), or the polychlorinated biphenyl (PCB) complex Aroclor 1254, before and during exposure to aflatoxin B/sub 1/ (AFB1), was shown to reduce the final incidence of hepatocellular carcinoma after 12 months, compared to fish receiving AFB1 only. By contrast, treatment of trout with BNF or I3C following AFB1 initiation led to a significant enhancement of ultimate tumor response, Similarly, simultaneous treatment of trout with PCB and the carcinogen N-nitrosodiethylamine led to syncarcinogenic enhancement, rather than inhibition, of tumor response. Mechanisms of inhibition of AFB1 carcinogenesis by PCB, BNF, and I3C were investigated. PCB and BNF, but not I3C, are known to be strong inducers of trout cytochrome P448 and associated activities. Dietary induction by BNF or PCB was shown to be accompanied in solvated hepatocytes by considerably altered AFB1 metabolism, and by significantly reduced rates of DNA adduct formation for all three agents. All agents differentially altered in vivo AFB1 pharmacokinetics, enhanced bile elimination of AFB1 as the aflatoxicol-M1 glucuronide, and significantly reduced peak levels of liver DNA adduct formation.

  15. Aflatoxin B1 Degradation by Stenotrophomonas Maltophilia and Other Microbes Selected Using Coumarin Medium#

    PubMed Central

    Guan, Shu; Ji, Cheng; Zhou, Ting; Li, Junxia; Ma, Qiugang; Niu, Tiangui

    2008-01-01

    Aflatoxin B1 (AFB1) is one of the most harmful mycotoxins in animal production and food industry. A safe, effective and environmentally sound detoxification method is needed for controlling this toxin. In this study, 65 samples were screened from various sources with vast microbial populations using a newly developed medium containing coumarin as the sole carbon source. Twenty five single-colony bacterial isolates showing AFB1 reduction activity in a liquid culture medium were selected from the screen. Isolate 35-3, obtained from tapir feces and identified to be Stenotrophomonas maltophilia, reduced AFB1 by 82.5% after incubation in the liquid medium at 37 °C for 72 h. The culture supernatant of isolate 35-3 was able to degrade AFB1 effectively, whereas the viable cells and cell extracts were far less effective. Factors influencing AFB1 degradation by the culture supernatant were investigated. Activity was reduced to 60.8% and 63.5% at 20 °C and 30 °C, respectively, from 78.7% at 37 °C. The highest degradation rate was 84.8% at pH 8 and the lowest was only 14.3% at pH 4.0. Ions Mg2+ and Cu2+ were activators for AFB1 degradation, however ion Zn2+ was a strong inhibitor. Treatments with proteinase K, proteinase K plus SDS and heating significantly reduced or eradicated the degradation activity of the culture supernatant. The results indicated that the degradation of AFB1 by S. maltophilia 35-3 was enzymatic and could have a great potential in industrial applications. PMID:19325817

  16. Curcumin nanoparticles loaded hydrogels protects against aflatoxin B1-induced genotoxicity in rat liver.

    PubMed

    Abdel-Wahhab, Mosaad A; Salman, Asmaa S; Ibrahim, Mohamed I M; El-Kady, Ahmed A; Abdel-Aziem, Sekena H; Hassan, Nabila S; Waly, Ahmed I

    2016-08-01

    The current study aimed to evaluate the protective role of curcumin nanoparticles loaded hydrogels (Cur-NPs-Hgs) against AFB1-induced genotoxicity in rat liver. Animals were divided into 7 treatment groups and treated orally for 3 weeks as follow: the control group, the group treated with Hgs alone (0.5 ml/rat), the groups treated with low or high dose of Cur-NPs-Hgs (100 or 200 mg/kg b.w), the group treated with AFB1 (0.125 mg/kg b.w) and the groups treated with AFB1 plus the low or high dose of Cur-NPs-Hgs. Blood ant liver samples were collected for different biochemical, genetical, histological and histochemical analysis. The results revealed that the prepared Cur-NPs have nearly spherical shape with average size of 140 ± 20 nm and negative zeta potential value of 30.7 ± 2.57 mV. The in vivo results showed that treatment with AFB1 decreased the body weight accompanied biochemical, genotoxicity and histological disturbances. The combined treatment with AFB1 and Cur-Nps-Hgs at the two tested doses succeeded to induce a significant protection against AFB1. It could be concluded that Cur-NPs-Hgs is a promise candidate to protect against AFB1-induce liver damage in the high incidence area. Moreover, Hgs are excellent candidates as drug delivery system. PMID:27288928

  17. Aflatoxin B1 is toxic to porcine oocyte maturation.

    PubMed

    Liu, Jun; Wang, Qiao-Chu; Han, Jun; Xiong, Bo; Sun, Shao-Chen

    2015-07-01

    As a toxic secondary metabolite of Aspergillus species, Aflatoxin B1 (AFB1) is a major food and feed contaminant in tropical and sub-tropical regions with high temperature and humidity. It has been reported to be toxic to the female reproductive system in laboratory and domestic animals. In the present study, the influence of acute exposure to AFB1 (10 and 50 μM, 44h) on porcine oocyte maturation and its possible mechanism were investigated. The maturation rates of oocytes decreased significantly in the presence of 50 μM of AFB1. Cell cycle analysis showed that most oocytes were arrested at germinal vesicle breakdown or meosis I stage. However, actin assembly, spindle structure and chromosome alignment were not disrupted after exposure to 50 μM AFB1. Further study showed that DNA methylation levels increased in treated oocytes (50 μM). Histone methylation levels were also analysed after treatment (50 μM): H3K27me3 and H3K4me2 levels decreased, whereas H3K9me3 level increased, indicating that epigenetic modification was affected. AFB1 treatment (50 μM) also induced oxidative stress and further led to autophagy, as shown by accumulation of reactive oxygen species, up-regulated LC3 protein expression and increased mRNA levels of ATG3, ATG5 and ATG7. Annexin V-FITC staining assay revealed that AFB1 treatment (50 μM) resulted in oocyte early apoptosis, which was confirmed by increased Bak, Bax, Bcl-xl mRNA levels. Collectively, our results suggest that AFB1 disrupts porcine oocyte maturation through changing epigenetic modifications as well as inducing oxidative stress, excessive autophagy and apoptosis. PMID:25778688

  18. Effect of the inclusion of adsorbents on aflatoxin B1 quantification in animal feedstuffs.

    PubMed

    Gallo, A; Masoero, F; Bertuzzi, T; Piva, G; Pietri, A

    2010-01-01

    The extraction efficiency of aflatoxin B1 (AFB1) in cattle feed containing nine adsorbents (ADSs) was investigated using two organic/aqueous solvents composed of methanol/water (80/20 v/v; MeOH) and acetone/water (85/15 v/v; AC). Samples were obtained including a highly AFB1-contaminated (HC) and a low-level AFB(1)-contaminated (LC) feedstuff (15.33 and 7.57 microg kg(-1), respectively), nine ADSs (four clay minerals; one yeast cell wall-based product; one activated carbon and three commercial ADS products) at two different levels of inclusion (10 and 20 g kg(-1)). After solvent extraction and immunoaffinity column clean-up, all samples were analysed for AFB1 by high-performance liquid chromatography (HPLC) with fluorescence detection. For each contamination level (HC and LC), the data obtained were analysed using a factorial arrangement in a completely randomized design. Means were compared with the correspondent controls using the Dunnett's test. No statistical difference was found in AFB1 levels of feedstuffs not containing ADSs when extracted with AC or MeOH, even if numerically higher values were obtained with AC. A dose-dependent effect (p < 0.01) of ADSs inclusion was observed on AFB1 recoveries that were lower when the higher ADS level (20 g kg(-1)) was included in the HC and LC feedstuffs. Higher AFB(1) recoveries were obtained using AC compared with MeOH, both in HC (75.0% versus 12.0%, respectively) and in LC (84.0% versus 22.8%, respectively) ADSs containing feedstuffs. However, when the activated carbon and the sodium bentonite were included in feeds, lower AFB1 concentrations with respect to control values (p < 0.001 and <0.05, respectively) were obtained also using AC. The data obtained in this study indicate that routine use of the MeOH solvent for AFB1 analysis of unknown feedstuffs, can produce misleading results if they contain an ADS. PMID:19750400

  19. Associations of serum aflatoxin B1-lysine adduct level with socio-demographic factors and aflatoxins intake from nuts and related nut products in Malaysia.

    PubMed

    Leong, Yin-Hui; Rosma, Ahmad; Latiff, Aishah A; Izzah, A Nurul

    2012-04-01

    Aflatoxins are one of the major risk factors in the multi-factorial etiology of human hepatocellular carcinoma. Therefore, the information on aflatoxins exposure is very important in the intervention planning in order to reduce the dietary intake of aflatoxins, especially among the children. This study investigated the relationship between aflatoxin B(1) (AFB(1)) lysine adduct levers in serum and socio-demographic factors and dietary intake of aflatoxins from nuts and nut products in Penang, Malaysia. A cross-sectional field study was conducted in five districts of Penang. A survey on socio-demographic characteristics was administered to 364 healthy adults from the three main ethnic groups (Malay, Chinese and Indian). A total of 170 blood samples were successfully collected and tested for the level of AFB(1)-lysine adduct. 97% of the samples contained AFB(1)-lysine adduct above the detection limit of 0.4 pg/mg albumin and ranged from 0.20 to 23.16 pg/mg albumin (mean±standard deviation=7.67±4.54 pg/mg albumin; median=7.12 pg/mg albumin). There was no significant association between AFB(1)-lysine adduct levels with gender, district, education level, household number and occupation when these socio-demographic characteristics were examined according to high or low levels of AFB(1)-lysine. However, participants in the age group of 31-50 years were 3.08 times more likely to have high AFB(1) levels compared to those aged between 18 and 30 years (P=0.026). Significant difference (P=0.000) was found among different ethnic groups. Chinese and Indian participants were 3.05 and 2.35 times more likely to have high AFB(1) levels than Malay. The result of AFB(1)-lysine adduct suggested that Penang adult population is likely to be exposed to AFB(1) but at a level of less than that needed to cause direct acute illness or death. PMID:22230243

  20. Carcinogen-nucleic acid interactions: Equilibrium binding studies of aflatoxin B sub 1 with the oligodeoxynucleotide d(ATGCAT) sub 2 and with plasmid pBR322 support intercalative association with the B-DNA helix

    SciTech Connect

    Gopalakrishnan, S.; Byrd, S.; Stone, M.P.; Harris, T.M. )

    1989-01-24

    Equilibrium binding of aflatoxin B{sub 1} (AFB1) to the oligodeoxynucleotide d(ATGCAT){sub 2} was examined by using {sup 1}H NMR. AFB1 binds to double-stranded d(ATGCAT){sub 2} with an apparent binding constant of 3.7 {times} 10{sup 3} M{sup {minus}1}. The equilibrium is rapid on the NMR time scale; the observed {sup 1}H NMR spectrum represents the population-weighted average of the chemical shifts arising from the free and bound states of the oligodeoxynucleotide and the AFB1. The spectrum of d(ATGCAT){sub 2} exhibits exchange broadening in the presence of AFB1, manifested as decreases in apparent T{sub 2} relaxation times for the d(ATGCAT){sub 2} base protons. Upon binding to d(ATGCAT){sub 2}, the AFB1 signals are shifted upfield, indicative of increased shielding. The adenine H2 protons are also shifted upfield in the presence of the carcinogen. Small changes in chemical shift are observed for other d(ATGCAT){sub 2} protons. Proton NOESY experiments confirmed that the overall conformation for the d(ATGCAT){sub 2} duplex was right-handed both in the absence and in the presence of AFB1. Equilibrium binding of AFB1 to d(ATGCAT){sub 2} is greatly diminished at higher temperatures at which the oligodeoxynucleotide is single-stranded. A series of experiments were performed in which the T{sub m} of d(ATGCAT){sub 2} was increased by increasing the total oligodeoxynucleotide concentration; these experiments showed that AFB1 would bind to d(ATGCAT){sub 2} at higher temperatures provided that the DNA was in double-stranded form. The results of these experiments provide strong evidence that noncovalent binding of AFB1 to B-form DNA involves the intercalation of the mycotoxin between base pairs; this intercalation could direct subsequent covalent attachment of the carcinogen at the N7 position of guanine.

  1. cDNA cloning, expression and activity of a second human aflatoxin B1-metabolizing member of the aldo-keto reductase superfamily, AKR7A3.

    PubMed

    Knight, L P; Primiano, T; Groopman, J D; Kensler, T W; Sutter, T R

    1999-07-01

    The aflatoxin B1 (AFB1) aldehyde metabolite of AFB1 may contribute to the cytotoxicity of this hepatocarcinogen via protein adduction. Aflatoxin B1 aldehyde reductases, specifically the NADPH-dependent aldo-keto reductases of rat (AKR7A1) and human (AKR7A2), are known to metabolize the AFB1 dihydrodiol by forming AFB1 dialcohol. Using a rat AKR7A1 cDNA, we isolated and characterized a distinct aldo-keto reductase (AKR7A3) from an adult human liver cDNA library. The deduced amino acid sequence of AKR7A3 shares 80 and 88% identity with rat AKR7A1 and human AKR7A2, respectively. Recombinant rat AKR7A1 and human AKR7A3 were expressed and purified from Escherichia coli as hexa-histidine tagged fusion proteins. These proteins catalyzed the reduction of several model carbonyl-containing substrates. The NADPH-dependent formation of AFB1 dialcohol by recombinant human AKR7A3 was confirmed by liquid chromatography coupled to electrospray ionization mass spectrometry. Rabbit polyclonal antibodies produced using recombinant rat AKR7A1 protein were shown to detect nanogram amounts of rat and human AKR7A protein. The amount of AKR7A-related protein in hepatic cytosols of 1, 2-dithiole-3-thione-treated rats was 18-fold greater than in cytosols from untreated animals. These antibodies detected AKR7A-related protein in normal human liver samples ranging from 0.3 to 0.8 microg/mg cytosolic protein. Northern blot analysis showed varying levels of expression of AKR7A RNA in human liver and in several extrahepatic tissues, with relatively high levels in the stomach, pancreas, kidney and liver. Based on the kinetic parameters determined using recombinant human AKR7A3 and AFB1 dihydrodiol at pH 7.4, the catalytic efficiency of this reaction (k2/K, per M/s) equals or exceeds those reported for other enzymes, for example cytochrome P450s and glutathione S-transferases, known to metabolize AFB1 in vivo. These findings indicate that, depending on the extent of AFB1 dihydrodiol formation, AKR

  2. Reduction of aflatoxins (B₁, B₂, G₁, and G₂) in soybean-based model systems.

    PubMed

    Lee, Jongin; Her, Jae-Young; Lee, Kwang-Geun

    2015-12-15

    The effects of chemical, physical, and cooking treatments on the reduction of aflatoxin B1 (AFB1), B2, G1, and G2 in soybean matrix were investigated. A HPLC-FLD with a Kobra cell system was used for the quantitative analysis of aflatoxins (AFs). To decrease the level of AFs during the soaking process, the contaminated soybeans were submerged in organic acid solutions. The reduction rates of AFB1 in 1.0N citric acid, lactic acid, succinic acid, and tartaric acid for 18h were 94.1%, 92.7%, 62.0%, and 95.1%, respectively. In the case of pH and autoclave treatment, the level of AFB1 was significantly decreased during autoclaving process at pH 7.4, 9.0, and 11.1, compared with the non-autoclaved samples (p<0.05). In the case of physical treatment, the heating process at 100 and 150°C for 90min significantly decreased the level of AFB1 by 41.9% and 81.2%, respectively (p<0.05). The reduction rate of AFB1 after cooking was 97.9% for soybean milk and 33.6% for steamed soybeans. PMID:26190599

  3. Survey on the occurrence of aflatoxins in rice from different provinces of Iran.

    PubMed

    Rahmani, Anosheh; Soleimany, Farhang; Hosseini, Hedayat; Nateghi, Leila

    2011-01-01

    Aflatoxins were surveyed in 256 rice samples taken from retail markets in different provinces of Iran during October 2007 and July 2008. A methanol/water (80 : 20, v/v) mixture and an aflatoxin immunoaffinity column (IAC) were used for extraction and clean-up. Mycotoxins were determined using HPLC with fluorescence detection and post-column derivatization using a photo-ionization cell. Levels of contamination ranged 0.0-5.8 ng g(-1) (mean, 1.4 ng g(-1)) and 0.1-6.3 ng g(-1) (mean, 1.6 ng g(-1)) for AFB1 and total aflatoxins, respectively. AFB1 was detected in almost all samples. Results showed that 55 samples (21.5%) were contaminated with more than 2 µg kg(-1) of AFB1, while seven samples (2.7 %) contained more than 4 µg kg(-1) total aflatoxins. The calculated probable daily intake of AFB1 from rice for Iranians ranged 1.4-5.8 ng AFB1 per kg body weight per day for average consumers and, hence. exceeding the estimated provisional maximum tolerable daily intake. PMID:24786005

  4. An attempt to model the probability of growth and aflatoxin B1 production of Aspergillus flavus under non-isothermal conditions in pistachio nuts.

    PubMed

    Aldars-García, Laila; Ramos, Antonio J; Sanchis, Vicente; Marín, Sonia

    2015-10-01

    Human exposure to aflatoxins in foods is of great concern. The aim of this work was to use predictive mycology as a strategy to mitigate the aflatoxin burden in pistachio nuts postharvest. The probability of growth and aflatoxin B1 (AFB1) production of aflatoxigenic Aspergillus flavus, isolated from pistachio nuts, under static and non-isothermal conditions was studied. Four theoretical temperature scenarios, including temperature levels observed in pistachio nuts during shipping and storage, were used. Two types of inoculum were included: a cocktail of 25 A. flavus isolates and a single isolate inoculum. Initial water activity was adjusted to 0.87. Logistic models, with temperature and time as explanatory variables, were fitted to the probability of growth and AFB1 production under a constant temperature. Subsequently, they were used to predict probabilities under non-isothermal scenarios, with levels of concordance from 90 to 100% in most of the cases. Furthermore, the presence of AFB1 in pistachio nuts could be correctly predicted in 70-81 % of the cases from a growth model developed in pistachio nuts, and in 67-81% of the cases from an AFB1 model developed in pistachio agar. The information obtained in the present work could be used by producers and processors to predict the time for AFB1 production by A. flavus on pistachio nuts during transport and storage. PMID:26187836

  5. An in vitro study of alkaline phosphatase sensitivity to mixture of aflatoxin B1 and fumonisin B1 in the hepatopancreas of coastal lagoon wild and farmed shrimp Litopenaeus vannamei.

    PubMed

    Pérez-Acosta, Jesús A; Burgos-Hernandez, Armando; Velázquez-Contreras, Carlos A; Márquez-Ríos, Enrique; Torres-Arreola, Wilfrido; Arvizu-Flores, Aldo A; Ezquerra-Brauer, J Marina

    2016-08-01

    This study aimed to establish the combined effect of aflatoxin B1 (AFB1) and fumonisin B1 (FB1) on wild Litopenaeus vannamei hepatopancreas alkaline phosphatase (AP) activity compared with that of farmed shrimp. AP activity in hepatopancreas extract was confirmed by several specific inhibitor assays. AP activity of wild shrimp was higher than that of farmed shrimp (p < 0.05). However, AP activity from both wild and farmed shrimp was inhibited when incubated with AFB1 and FB1. The greatest inhibition occurred when AP was incubated with a mixture of AFB1 and FB1. The IC50 for AFB1 on AP activity of wild and farmed shrimp hepatopancreases was 0.790 and 0.398 μg/mL, respectively. The IC50 of FB1 was 0.87 μg/mL for wild shrimp and 0.69 μg/mL for farmed shrimp. These results suggest that, at the mycotoxins concentrations used in the study, AP from farmed L. vannamei was sensitive to the presence of both mycotoxins; however, AP is more sensitive to the combination of AFB1 + FB1 suggesting a possible synergistic or potentiating inhibitory effect. PMID:27040818

  6. Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

    PubMed Central

    Madrigal-Bujaidar, Eduardo; Morales-González, José Antonio; Sánchez-Gutiérrez, Manuel; Izquierdo-Vega, Jeannett A.; Reyes-Arellano, Alicia; Álvarez-González, Isela; Pérez-Pasten, Ricardo; Madrigal-Santillán, Eduardo

    2015-01-01

    Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1) is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-d-glucan (Glu) to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively) and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-d-glucan. PMID:26110504

  7. Performance improvement of the one-dot lateral flow immunoassay for aflatoxin B1 by using a smartphone-based reading system.

    PubMed

    Lee, Sangdae; Kim, Giyoung; Moon, Jihea

    2013-01-01

    This study was conducted to develop a simple, rapid, and accurate lateral flow immunoassay (LFIA) detection method for point-of-care diagnosis. The one-dot LFIA for aflatoxin B1 (AFB1) was based on the modified competitive binding format using competition between AFB1 and colloidal gold-AFB1-BSA conjugate for antibody binding sites in the test zone. A Smartphone-based reading system consisting of a Samsung Galaxy S2 Smartphone, a LFIA reader, and a Smartphone application for the image acquisition and data analysis. The detection limit of one-dot LFIA for AFB1 is 5 μg/kg. This method provided semi-quantitative analysis of AFB1 samples in the range of 5 to 1,000 μg/kg. Using combination of the one-dot LFIA and the Smartphone-based reading system, it is possible to conduct a more fast and accurate point-of-care diagnosis. PMID:23598499

  8. Aflatoxin B1 Induced Compositional Changes in Gut Microbial Communities of Male F344 Rats.

    PubMed

    Wang, Jincheng; Tang, Lili; Glenn, Travis C; Wang, Jia-Sheng

    2016-03-01

    Aflatoxins are a group of potent foodborne toxicants naturally occurring in maize and groundnuts. Differential species-specific sensitivity to aflatoxins has been documented but cannot be fully explained by the differences in metabolism of these toxicants among animal species. Commensal microbial communities (microbiota) are critical to human and animal health, but few studies have assessed interactions between xenobiotic toxins and those microbiota, and its potential effects to humans and animals. Here, an exploratory dosing experiment was conducted to explore effects of Aflatoxin B1 (AFB1) on the gut microbiota in a commonly used rat model. Male F344 rats were randomly divided into groups and treated with different concentrations of AFB1. Microbial communities in fecal samples were assessed using 16S rRNA sequence analysis. We found that samples from the control group had a phylogenetically diverse community, and that increasing AFB1 doses decreased this diversity but increased evenness of community composition. In addition, the gut microbiota from different samples was clustered according to their dosing regimens. There is no community shift at the phylum level but some lactic acid bacteria were significantly depleted by AFB1. These findings suggested that AFB1 could modify the gut microbiota in a dose-dependent manner. PMID:26612839

  9. Prevention of Aflatoxin B₁-Induced DNA Breaks by β-D-Glucan.

    PubMed

    Madrigal-Bujaidar, Eduardo; Morales-González, José Antonio; Sánchez-Gutiérrez, Manuel; Izquierdo-Vega, Jeannett A; Reyes-Arellano, Alicia; Álvarez-González, Isela; Pérez-Pasten, Ricardo; Madrigal-Santillán, Eduardo

    2015-06-01

    Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1) is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu) to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively) and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan. PMID:26110504

  10. A fabricated electro-spun sensor based on Lake Red C pigments doped into PAN (polyacrylonitrile) nano-fibers for electrochemical detection of Aflatoxin B1 in poultry feed and serum samples.

    PubMed

    Babakhanian, Arash; Momeneh, Tahereh; Aberoomand-azar, Parviz; Kaki, Samineh; Torki, Mehran; Hossein Kiaie, Seyed; Sadeghi, Ehsan; Dabirian, Farzad

    2015-11-21

    The aim of this work was to fabricate a novel nano-fiber modified electrode, involving Lake Red C (LRC) pigments doped into electrospun polyacrylonitrile (PAN) fibrous films. Cyclic voltammetry (CV), scanning electron microscopy (SEM), electrochemical impedance spectroscopy (EIS) and differential pulse voltammetry (DPV) techniques were used for electrochemical and morphological characterization of the composite fibers. This sensor responds to Aflatoxin B1 (AFB1) over the concentration range of 40-120 nM with high accuracy and precision in analysis. The modified electrode exhibited an excellent electrocatalytic ability (α = 0.42, log K(s) = 4.21 s(-1), and Γ = 1.49 × 10(-5) mmol cm(-2)) for reduction of AFB1 at the optimum pH of 6 and working potential of -0.75 V (vs. SCE). The common substances accompanying AFB1 had no serious interferences on the response of the modified electrode to AFB1. The modified electrode indicated reproducible behavior and a high level stability during the experiments, making it particularly suitable for the analytical determination of AFB1 in poultry feed and serum samples. PMID:26460282

  11. Application of essential oils in maize grain: impact on Aspergillus section Flavi growth parameters and aflatoxin accumulation.

    PubMed

    Bluma, Romina V; Etcheverry, Miriam G

    2008-04-01

    The antifungal activity of Pimpinella anisum L. (anise), Pëumus boldus Mol (boldus), Hedeoma multiflora Benth (mountain thyme), Syzygium aromaticum L. (clove), and Lippia turbinate var. integrifolia (griseb) (poleo) essential oils (EOs) against Aspergillus section Flavi was evaluated in sterile maize grain under different water activity (a(w)) condition (0.982, 0.955, and 0.90). The effect of EOs added to maize grains on growth rate, lag phase, and aflatoxin B(1) (AFB(1)) accumulation of Aspergillus section Flavi were evaluated at different water activity conditions. The five EOs analyzed have been shown to influence lag phase and growth rate. Their efficacy depended mainly on the essential oil concentrations and substrate water activity conditions. All EOs showed significant impact on AFB(1) accumulation. This effect was closely dependent on the water activity, concentration, and incubation periods. Important reduction of AFB(1) accumulation was observed in the majority of EO treatments at 11 days of incubation. Boldus, poleo, and mountain thyme EO completely inhibited AFB(1) at 2000 and 3000 microg g(-1). Inhibition of AFB(1) accumulation was also observed when aflatoxigenic isolates grew with different concentration of EOs during 35 days. PMID:18206775

  12. Activated carbons as potentially useful non-nutritive additives to prevent the effect of fumonisin B1 on sodium bentonite activity against chronic aflatoxicosis.

    PubMed

    Monge, María Del Pilar; Magnoli, Alejandra Paola; Bergesio, Maria Virginia; Tancredi, Nestor; Magnoli, Carina E; Chiacchiera, Stella Maris

    2016-06-01

    Aflatoxin B1 (AFB1) and fumonisin B1 (FB1) are mycotoxins that often co-occur in feedstuffs. The ingestion of AFB1 causes aflatoxicosis in humans and animals. Sodium bentonite (NaB), a cheap non-nutritive unselective sequestering agent incorporated in animal diets, can effectively prevent aflatoxicosis. Fumonisins are responsible for equine leukoencephalomalacia and porcine pulmonary oedema, and often have subclinical toxic effects in poultries. Fumonisin B1 and aflatoxin B1 are both strongly adsorbed in vitro on sodium bentonite. Co-adsorption studies, carried out with a weight ratio of FB1 to AFB1 that mimics the natural occurrence (200:1), showed that FB1 greatly decreases the in vitro ability of NaB to adsorb AFB1. The ability of two activated carbons to adsorb FB1 was also investigated. Both carbons showed high affinity for FB1. A complex behaviour of the FB1 adsorption isotherms with pH was observed. In vitro results suggest that under natural contamination levels of AFB1 and FB1, a mixture of activated carbon and sodium bentonite might be potentially useful for prevention of sub-acute aflatoxicosis. PMID:27159550

  13. Immunochemical and genetic analysis of the p53 gene in liver preneoplastic nodules from aflatoxin-induced rats in one year.

    PubMed

    Liu, Y P; Lin, Y; Ng, M L

    1996-01-01

    Mutations of the p53 tumour-suppressor gene in human hepatocellular carcinomas from certain geographic areas appear to be associated with high dietary exposure to aflatoxin B1 (AFB1). In this study, the effects of AFB1 on p53 locus at the preneoplastic stage of rat liver oncogenesis were assessed. Male Wistar rats were treated with a single dose of 1.5 mg AFB1/kg body weight by a gastric tube. Liver biopsies over a period of one year were examined for aberrations of the p53 gene together with the expression of placental glutathione-S transferase (GST-P), a marker for preneoplasia. Immunohistochemistry, Western blot, polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing techniques were used. AFB1 induction resulted in GST-P overexpression, forming GST-P-positive multi-foci and nodules of hepatocytes, but no aberrations in the p53 expression and the microstructure of exons 5-8 of the p53 gene. These results suggested that p53 mutation(s) might not occur at this early stage of AFB1-induced hepatocarcinogenesis. PMID:8779543

  14. Quantifying Aflatoxin B1 in peanut oil using fabricating fluorescence probes based on upconversion nanoparticles.

    PubMed

    Sun, Cuicui; Li, Huanhuan; Koidis, Anastasios; Chen, Quansheng

    2016-08-01

    Rare earth doped upconversion nanoparticles convert near-infrared excitation light into visible emission light. Compared to organic fluorophores and semiconducting nanoparticles, upconversion nanoparticles (UCNPs) offer high photochemical stability, sharp emission bandwidths, and large anti-Stokes shifts. Along with the significant light penetration depth and the absence of autofluorescence in biological samples under infrared excitation, these UCNPs have attracted more and more attention on toxin detection and biological labelling. Herein, the fluorescence probe based on UCNPs was developed for quantifying Aflatoxin B1 (AFB1) in peanut oil. Based on a specific immunity format, the detection limit for AFB1 under optimal conditions was obtained as low as 0.2ng·ml(-1), and in the effective detection range 0.2 to 100ng·ml(-1), good relationship between fluorescence intensity and AFB1 concentration was achieved under the linear ratios up to 0.90. Moreover, to check the feasibility of these probes on AFB1 measurements in peanut oil, recovery tests have been carried out. A good accuracy rating (93.8%) was obtained in this study. Results showed that the nanoparticles can be successfully applied for sensing AFB1 in peanut oil. PMID:27124091

  15. Quantifying Aflatoxin B1 in peanut oil using fabricating fluorescence probes based on upconversion nanoparticles

    NASA Astrophysics Data System (ADS)

    Sun, Cuicui; Li, Huanhuan; Koidis, Anastasios; Chen, Quansheng

    2016-08-01

    Rare earth doped upconversion nanoparticles convert near-infrared excitation light into visible emission light. Compared to organic fluorophores and semiconducting nanoparticles, upconversion nanoparticles (UCNPs) offer high photochemical stability, sharp emission bandwidths, and large anti-Stokes shifts. Along with the significant light penetration depth and the absence of autofluorescence in biological samples under infrared excitation, these UCNPs have attracted more and more attention on toxin detection and biological labelling. Herein, the fluorescence probe based on UCNPs was developed for quantifying Aflatoxin B1 (AFB1) in peanut oil. Based on a specific immunity format, the detection limit for AFB1 under optimal conditions was obtained as low as 0.2 ng·ml- 1, and in the effective detection range 0.2 to 100 ng·ml- 1, good relationship between fluorescence intensity and AFB1 concentration was achieved under the linear ratios up to 0.90. Moreover, to check the feasibility of these probes on AFB1 measurements in peanut oil, recovery tests have been carried out. A good accuracy rating (93.8%) was obtained in this study. Results showed that the nanoparticles can be successfully applied for sensing AFB1 in peanut oil.

  16. Tetramethyl-6-carboxyrhodamine quenching-based aptasensing platform for aflatoxin B1: Analytical performance comparison of two aptamers.

    PubMed

    Goud, K Yugender; Sharma, Atul; Hayat, Akhtar; Catanante, Gaëlle; Gobi, K Vengatajalabathy; Gurban, Ana Maria; Marty, Jean Louis

    2016-09-01

    In this study, a simple TAMRA (tetramethyl-6-carboxyrhodamine) quenching-based aptasensing platform was designed for the detection of aflatoxin B1 (AFB1). Here, we compared the analytical performance of two aptamer sequences: seqA and seqB. The AFB1 detection was based on the interactions of FAM (carboxyfluorescein)-labeled aptamer with TAMRA-labeled DNA complementary strand in the presence and absence of target analyte. Under optimized experimental conditions, TAMRA-labeled strand quenched the fluorescence response of FAM-labeled aptamer due to the noncovalent interaction between the two DNA strands. The binding of AFB1 induced the complex formation and weakened the interaction between FAM-labeled aptamer and TAMRA-labeled complementary strand, resulting in the fluorescence recovery. By using this principle concept, an assay was constructed for the detection of AFB1. The method exhibited good sensitivity, good selectivity with a limit of detection of 0.2 ng ml(-1), and a wide linear range from 0.25 to 32 ng ml(-1). For real sample application, the aptasensors were tested in beer and wine samples, with good recovery rates obtained for AFB1 detection. PMID:27251432

  17. Affinity improvement by fine tuning of single-chain variable fragment against aflatoxin B1.

    PubMed

    Min, Won-Ki; Na, Kang-In; Yoon, Jung-Hyun; Heo, Yoon-Jee; Lee, Daesang; Kim, Sung-Gun; Seo, Jin-Ho

    2016-10-15

    Aflatoxin B1 (AFB1) produced in Aspergillus flavus is a major hepatocarcinogen found in foods and feed. For effective immunological detection of AFB1 at low concentrations, the development of high affinity antibody for AFB1 is required. Previously, an affinity-maturated single-chain variable fragment containing 6 mutations (scFv-M37) was isolated from an artificial mutagenic library, which showed a 9-fold higher affinity than its wild type scFv. In this study, the effect of the 6 mutated residues on the affinity improvement was characterized using surface plasmon resonance analysis, which identified a deleterious mutation (VH-A110T) located on a framework region of the scFv-M37. The back mutation of VH-A110T resulted in a 3.2-fold affinity improvement, which was attributed to decrease of dissociation rate constant (kd) in interaction between AFB1 and the back mutant scFv. The biophysical analyses using circular dichroism and gel filtration revealed that the back mutation of VH-A110T caused a subtle conformational change of the scFv toward tighter binding to AFB1. PMID:27173568

  18. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers

    PubMed Central

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun

    2015-01-01

    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B1 (AFB1). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB1. In the AFB1 group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB1 group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  19. A SERS-active sensor based on heterogeneous gold nanostar core-silver nanoparticle satellite assemblies for ultrasensitive detection of aflatoxinB1.

    PubMed

    Li, Aike; Tang, Lijuan; Song, Dan; Song, Shanshan; Ma, Wei; Xu, Liguang; Kuang, Hua; Wu, Xiaoling; Liu, Liqiang; Chen, Xin; Xu, Chuanlai

    2016-01-28

    A surface-enhanced Raman scattering (SERS) sensor based on gold nanostar (Au NS) core-silver nanoparticle (Ag NP) satellites was fabricated for the first time to detect aflatoxinB1 (AFB1). We constructed the SERS sensor using AFB1 aptamer (DNA1)-modified Ag satellites and a complementary sequence (DNA2)-modified Au NS core. The Raman label (ATP) was modified on the surface of Ag satellites. The SERS signal was enhanced when the satellite NP was attached to the Au core NS. The AFB1 aptamer on the surface of Ag satellites would bind to the targets when AFB1 was present in the system, Ag satellites were then removed and the SERS signal decreased. This SERS sensor showed superior specificity for AFB1 and the linear detection range was from 1 to 1000 pg mL(-1) with the limit of detection (LOD) of 0.48 pg mL(-1). The excellent recovery experiment using peanut milk demonstrated that the sensor could be applied in food and environmental detection. PMID:26732202

  20. Performance Improvement of the One-Dot Lateral Flow Immunoassay for Aflatoxin B1 by Using a Smartphone-Based Reading System

    PubMed Central

    Lee, Sangdae; Kim, Giyoung; Moon, Jihea

    2013-01-01

    This study was conducted to develop a simple, rapid, and accurate lateral flow immunoassay (LFIA) detection method for point-of-care diagnosis. The one-dot LFIA for aflatoxin B1 (AFB1) was based on the modified competitive binding format using competition between AFB1 and colloidal gold-AFB1-BSA conjugate for antibody binding sites in the test zone. A Smartphone-based reading system consisting of a Samsung Galaxy S2 Smartphone, a LFIA reader, and a Smartphone application for the image acquisition and data analysis. The detection limit of one-dot LFIA for AFB1 is 5 μg/kg. This method provided semi-quantitative analysis of AFB1 samples in the range of 5 to 1,000 μg/kg. Using combination of the one-dot LFIA and the Smartphone-based reading system, it is possible to conduct a more fast and accurate point-of-care diagnosis. PMID:23598499

  1. Highly sensitive SERS-based immunoassay of aflatoxin B1 using silica-encapsulated hollow gold nanoparticles.

    PubMed

    Ko, Juhui; Lee, Chankil; Choo, Jaebum

    2015-03-21

    Aflatoxin B1 (AFB1) is a well-known carcinogenic contaminant in foods. It is classified as an extremely hazardous compound because of its potential toxicity to the human nervous system. AFB1 has also been extensively used as a biochemical marker to evaluate the degree of food spoilage. In this study, a novel surface-enhanced Raman scattering (SERS)-based immunoassay platform using silica-encapsulated hollow gold nanoparticles (SEHGNs) and magnetic beads was developed for highly sensitive detection of AFB1. SEHGNs were used as highly stable SERS-encoding nano tags, and magnetic beads were used as supporting substrates for the high-density loading of immunocomplexes. Quantitative analysis of AFB1 was performed by monitoring the intensity change of the characteristic peaks of Raman reporter molecules. The limit of detection (LOD) of AFB1, determined by this SERS-based immunoassay, was determined to be 0.1 ng/mL. This method has some advantages over other analytical methods with respect to rapid analysis (less than 30 min), good selectivity, and reproducibility. The proposed method is expected to be a new analytical tool for the trace analysis of various mycotoxins. PMID:25462866

  2. The mycotoxin aflatoxin B1 stimulates Epstein-Barr virus-induced B-cell transformation in in vitro and in vivo experimental models.

    PubMed

    Accardi, Rosita; Gruffat, Henri; Sirand, Cécilia; Fusil, Floriane; Gheit, Tarik; Hernandez-Vargas, Hector; Le Calvez-Kelm, Florence; Traverse-Glehen, Alexandra; Cosset, François-Loïc; Manet, Evelyne; Wild, Christopher P; Tommasino, Massimo

    2015-11-01

    Although Epstein-Barr virus (EBV) infection is widely distributed, certain EBV-driven malignancies are geographically restricted. EBV-associated Burkitt's lymphoma (eBL) is endemic in children living in sub-Saharan Africa. This population is heavily exposed to food contaminated with the mycotoxin aflatoxin B1 (AFB1). Here, we show that exposure to AFB1 in in vitro and in vivo models induces activation of the EBV lytic cycle and increases EBV load, two events that are associated with an increased risk of eBL in vivo. AFB1 treatment leads to the alteration of cellular gene expression, with consequent activations of signaling pathways, e.g. PI3K, that in turn mediate reactivation of the EBV life cycle. Finally, we show that AFB1 triggers EBV-driven cellular transformation both in primary human B cells and in a humanized animal model. In summary, our data provide evidence for a role of AFB1 as a cofactor in EBV-mediated carcinogenesis. PMID:26424750

  3. Modulation of the spleen transcriptome in domestic turkey (Meleagris gallopavo) in response to aflatoxin B1 and probiotics.

    PubMed

    Monson, Melissa S; Settlage, Robert E; Mendoza, Kristelle M; Rawal, Sumit; El-Nezami, Hani S; Coulombe, Roger A; Reed, Kent M

    2015-03-01

    Poultry are highly susceptible to the immunotoxic effects of the food-borne mycotoxin aflatoxin B1 (AFB1). Exposure impairs cell-mediated and humoral immunity, limits vaccine efficacy, and increases the incidence of costly secondary infections. We investigated the molecular mechanisms of AFB1 immunotoxicity and the ability of a Lactobacillus-based probiotic to protect against aflatoxicosis in the domestic turkey (Meleagris gallopavo). The spleen transcriptome was examined by RNA sequencing (RNA-seq) of 12 individuals representing four treatment groups. Sequences (6.9 Gb) were de novo assembled to produce over 270,000 predicted transcripts and transcript fragments. Differential expression analysis identified 982 transcripts with statistical significance in at least one comparison between treatment groups. Transcripts with known immune functions comprised 27.6 % of significant expression changes in the AFB1-exposed group. Short exposure to AFB1 suppressed innate immune transcripts, especially from antimicrobial genes, but increased the expression of transcripts from E3 ubiquitin-protein ligase CBL-B and multiple interleukin-2 response genes. Up-regulation of transcripts from lymphotactin, granzyme A, and perforin 1 could indicate either increased cytotoxic potential or activation-induced cell death in the spleen during aflatoxicosis. Supplementation with probiotics was found to ameliorate AFB1-induced expression changes for multiple transcripts from antimicrobial and IL-2-response genes. However, probiotics had an overall suppressive effect on immune-related transcripts. PMID:25597949

  4. Multi-Toxic Endpoints of the Foodborne Mycotoxins in Nematode Caenorhabditis elegans

    PubMed Central

    Yang, Zhendong; Xue, Kathy S.; Sun, Xiulan; Tang, Lili; Wang, Jia-Sheng

    2015-01-01

    Aflatoxins B1 (AFB1), deoxynivalenol (DON), fumonisin B1 (FB1), T-2 toxin (T-2), and zearalenone (ZEA) are the major foodborne mycotoxins of public health concerns. In the present study, the multiple toxic endpoints of these naturally-occurring mycotoxins were evaluated in Caenorhabditis elegans model for their lethality, toxic effects on growth and reproduction, as well as influence on lifespan. We found that the lethality endpoint was more sensitive for T-2 toxicity with the EC50 at 1.38 mg/L, the growth endpoint was relatively sensitive for AFB1 toxic effects, and the reproduction endpoint was more sensitive for toxicities of AFB1, FB1, and ZEA. Moreover, the lifespan endpoint was sensitive to toxic effects of all five tested mycotoxins. Data obtained from this study may serve as an important contribution to knowledge on assessment of mycotoxin toxic effects, especially for assessing developmental and reproductive toxic effects, using the C. elegans model. PMID:26633509

  5. Determination of aflatoxin B1 in cereals by homogeneous liquid-liquid extraction coupled to high performance liquid chromatography-fluorescence detection.

    PubMed

    Sheijooni-Fumani, Neda; Hassan, Jalal; Yousefi, Seyed R

    2011-06-01

    A simple and rapid method based on homogeneous liquid-liquid extraction coupled to HPLC with fluorescence detection was developed for the determination of aflatoxin B1 (AFB1) in the rice and grain samples after post-column derivatization. The proposed method eliminated the use of immunoaffinity columns for clean-up in the determination of AFB1. The parameters affecting recovery and preconcentration such as type and volume of organic solvent, volume ratio of water/methanol, concentration of phase separator reagent and extraction time were optimized. Under the optimized conditions, the calibration graph was linear in the concentration range of 0.01-1.0 ng/g with the detection limit of 0.003 ng/g. This method was successfully applied for the analysis of AFB1 in different cereal samples. PMID:21491592

  6. The mycotoxin zearalenone enhances cell proliferation, colony formation and promotes cell migration in the human colon carcinoma cell line HCT116.

    PubMed

    Abassi, Haila; Ayed-Boussema, Imen; Shirley, Sarah; Abid, Salwa; Bacha, Hassen; Micheau, Olivier

    2016-07-01

    Zearalenone (ZEN) and Aflatoxin B1 (AFB1) are fungal secondary metabolites produced by Fusarium and Aspergillus genera, respectively. These mycotoxins are found world-wide as corn and wheat contaminants. AFB1 is probably the most toxic and carcinogenic mycotoxin. It has been demonstrated to be mutagenic, genotoxic, and hepatocarcinogenic. ZEN is a non-steroidal estrogenic mycotoxin that displays hepatotoxicity, immunotoxicity and genotoxicity. Its mutagenic and carcinogenic properties have so far remained controversial and questionable. Using the colon carcinoma cell line HCT116, we will show here that ZEN, at low concentrations, enhances cell proliferation, increases colony formation and fastens cell migration after wound healing. The highest effect of ZEN was observed at a concentration 10 times lower as compared to AFB1. Our findings suggest thus that this mycotoxin exhibits carcinogenesis-like properties in HCT116 cells. PMID:27084041

  7. Regulation of aflatoxin B1-metabolizing aldehyde reductase and glutathione S-transferase by chemoprotectors.

    PubMed Central

    McLellan, L I; Judah, D J; Neal, G E; Hayes, J D

    1994-01-01

    Ingestion of aflatoxin B1 (AFB1) represents a major risk factor in the aetiology of human hepatocellular carcinoma. In the rat, the harmful effects of AFB1 can be prevented by the administration of certain drugs which induce hepatic detoxification enzymes. We have previously shown that treatment of rats with the chemoprotector ethoxyquin (EQ) results in a marked increase in expression of the Alpha-class glutathione S-transferase (GST) Yc2 subunit which has high activity towards AFB1-8,9-epoxide [Hayes, Judah, McLellan, Kerr, Peacock and Neal (1991) Biochem. J. 279, 385-398]. To allow an assessment of whether the increased expression of GST Yc2 represents a general adaptive resistance mechanism to chemical stress, that is invoked by both chemoprotectors and carcinogens, we have examined the effects of EQ, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), phenobarbital (PB), AFB1, 3-methylcholanthrene (3-MC) and clofibrate on the AFB1-glutathione-conjugating activity and the GST subunit levels in rat liver. In addition, the effect of these drugs on the hepatic levels of an aldehyde reductase (AFB1-AR) that metabolizes the cytotoxic dialdehydic form of AFB1 has been studied as this enzyme also appears to be important in chemoprotection. Administration of the antioxidants EQ, BHA or BHT, as well as PB, led to a marked increase in levels of the GST Yc2 subunit in rat liver, and this increase coincided with a substantial rise in the GST activity towards AFB1-8,9-epoxide; neither AFB1, 3-MC nor clofibrate caused induction of Yc2 or any of the GST subunits examined. Among the xenobiotics studied, EQ was found to be the most effective inducing agent for the Yc2 subunit as well as Yc1, Yb1 and Yf. However, PB was equally as effective as EQ in increasing levels of the Ya-type subunits, although it was not found to be as potent an inducer of the other GST subunits, including Yc2. In addition to induction of GST, EQ caused a substantial increase in the hepatic

  8. Developmental exposure of aflatoxin B1 reversibly affects hippocampal neurogenesis targeting late-stage neural progenitor cells through suppression of cholinergic signaling in rats.

    PubMed

    Tanaka, Takeshi; Mizukami, Sayaka; Hasegawa-Baba, Yasuko; Onda, Nobuhiko; Sugita-Konishi, Yoshiko; Yoshida, Toshinori; Shibutani, Makoto

    2015-10-01

    To elucidate the maternal exposure effects of aflatoxin B1 (AFB1) and its metabolite aflatoxin M1, which is transferred into milk, on postnatal hippocampal neurogenesis, pregnant Sprague-Dawley rats were provided a diet containing AFB1 at 0, 0.1, 0.3, or 1.0 ppm from gestational day 6 to day 21 after delivery on weaning. Offspring were maintained through postnatal day (PND) 77 without AFB1 exposure. Following exposure to 1.0 ppm AFB1, offspring showed no apparent systemic toxicity at weaning, whereas dams showed increased liver weight and DNA repair gene upregulation in the liver. In the hippocampal dentate gyrus of male PND 21 offspring, the number of doublecortin(+) progenitor cells were decreased, which was associated with decreased proliferative cell population in the subgranular zone at ≥ 0.3 ppm, although T-box brain 2(+) cells, tubulin beta III(+) cells, gamma-H2A histone family, member X(+) cells, and cyclin-dependent kinase inhibitor 1A(+) cells did not fluctuate in number. AFB1 exposure examined at 1.0 ppm also resulted in transcript downregulation of the cholinergic receptor subunit Chrna7 and dopaminergic receptor Drd2 in the dentate gyrus, although there was no change in transcript levels of DNA repair genes. In the hippocampal dentate hilus, interneurons expressing CHRNA7 or phosphorylated tropomyosin receptor kinase B (TRKB) decreased at ≥ 0.3 ppm. On PND 77, there were no changes in neurogenesis-related parameters. These results suggested that maternal AFB1 exposure reversibly affects hippocampal neurogenesis targeting type-3 progenitor cells. This mechanism likely involves suppression of cholinergic signals on hilar GABAergic interneurons and brain-derived neurotrophic factor-TRKB signaling from granule cells. The no-observed-adverse-effect level for offspring neurogenesis was determined to be 0.1 ppm (7.1-13.6 mg/kg body weight/day). PMID:26260870

  9. Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.

    PubMed

    Taguchi, Keiko; Takaku, Misaki; Egner, Patricia A; Morita, Masanobu; Kaneko, Takehito; Mashimo, Tomoji; Kensler, Thomas W; Yamamoto, Masayuki

    2016-07-01

    THE TRANSCRIPTION FACTOR NRF2: (NF-E2-related-factor 2) REGULATES A BATTERY OF ANTIOXIDATIVE STRESS-RESPONSE GENES AND DETOXICATION GENES, AND NRF2 KNOCKOUT LINES OF MICE HAVE BEEN CONTRIBUTING CRITICALLY TO THE CLARIFICATION OF ROLES THAT NRF2 PLAYS FOR CELL PROTECTION HOWEVER, THERE ARE APPARENT LIMITATIONS IN USE OF THE MOUSE MODELS FOR INSTANCE, RATS EXHIBIT MORE SUITABLE FEATURES FOR TOXICOLOGICAL OR PHYSIOLOGICAL EXAMINATIONS THAN MICE IN THIS STUDY, WE GENERATED 2 LINES OF NRF2 KNOCKOUT RATS BY USING A GENOME EDITING TECHNOLOGY; 1 LINE HARBORS A 7-BP DELETION Δ7 AND THE OTHER LINE HARBORS A 1-BP INSERTION +1 IN THE NRF2 GENE IN THE LIVERS OF RATS HOMOZYGOUSLY DELETING THE NRF2 GENE, AN ACTIVATOR OF NRF2 SIGNALING, CDDO-IM, COULD NOT INDUCE EXPRESSION OF REPRESENTATIVE NRF2 TARGET GENES TO EXAMINE ALTERED TOXICOLOGICAL RESPONSE, WE TREATED THE NRF2 KNOCKOUT RATS WITH AFLATOXIN B1 AFB1, A CARCINOGENIC MYCOTOXIN THAT ELICITS GENE MUTATIONS THROUGH BINDING OF ITS METABOLITES TO DNA AND FOR WHICH THE RAT HAS BEEN PROPOSED AS A REASONABLE SURROGATE FOR HUMAN TOXICITY INDEED, IN THE NRF2 KNOCKOUT RAT LIVERS THE ENZYMES OF THE AFB1 DETOXICATION PATHWAY WERE SIGNIFICANTLY DOWNREGULATED SINGLE DOSE ADMINISTRATION OF AFB1 INCREASED HEPATOTOXICITY AND BINDING OF AFB1-N7-GUANINE TO HEPATIC DNA IN NRF2 KNOCKOUT RATS COMPARED WITH WILD-TYPE NRF2 KNOCKOUT RATS REPEATEDLY TREATED WITH AFB1 WERE PRONE TO LETHALITY AND CDDO-IM WAS NO LONGER PROTECTIVE THESE RESULTS DEMONSTRATE THAT NRF2 KNOCKOUT RATS ARE QUITE SENSITIVE TO AFB1 TOXICITIES AND THIS RAT GENOTYPE EMERGES AS A NEW MODEL ANIMAL IN TOXICOLOGY. PMID:27071940

  10. Involvement of cytochrome P450, glutathione S-transferase, and epoxide hydrolase in the metabolism of aflatoxin B1 and relevance to risk of human liver cancer.

    PubMed Central

    Guengerich, F P; Johnson, W W; Ueng, Y F; Yamazaki, H; Shimada, T

    1996-01-01

    In recent years there has been considerable interest in the effect of variations in activities of xenobiotic-metabolizing enzymes on cancer incidence. This interest has accelerated with the development of methods for analyzing genetic polymorphisms. However, progress in epidemiology has been slow and the contributions of polymorphisms to risks from individual chemicals and mixtures are often controversial. A series of studies is presented to show the complexities encountered with a single chemical, aflatoxin B1 (AFB1). AFB1 is oxidized by human cytochrome P450 enzymes to several products. Only one of these, the 8,9-exo-epoxide, appears to be mutagenic and the others are detoxication products. P450 3A4, which can both activate and detoxicate AFB1, is found in the liver and the small intestine. In the small intestine, the first contact after oral exposure, epoxidation would not lead to liver cancer. The (nonenzymatic) half-life of the epoxide has been determined to be approximately 1 sec at 23 degrees C and neutral pH. Although the half-life is short, AFB1-8,9-exo-epoxide does react with DNA and glutathione S-transferase. Levels of these conjugates have been measured and combined with the rate of hydrolysis in a kinetic model to predict constants for binding of the epoxide with DNA and glutathione S-transferase. A role for epoxide hydrolase in alteration of AFB1 hepatocarcinogenesis has been proposed, although experimental evidence is lacking. Some inhibition of microsome-generated genotoxicity was observed with rat epoxide hydrolase; further information on the extent of contribution of this enzyme to AFB1 metabolism is not yet available. PMID:8781383

  11. Challenging Role of Dietary Aflatoxin B1 Exposure and Hepatitis B Infection on Risk of Hepatocellular Carcinoma

    PubMed Central

    Kucukcakan, Basak; Hayrulai-Musliu, Zehra

    2015-01-01

    Aflatoxins (AFT) are poisonous substances which are classified in Group 1 carcinogenic agents to humans by International Agency for Research on Cancer (IARC). AFT can occur naturally in food commodities (maize, corn, rice) as a result of fungal contamination in hot and humid environments. In the food, toxin contamination can remain during manufacturing and long after fungi have stopped being biologically active. Aflatoxin B1 (AFB1) is the most dominant and potent agent from all AFT. In developing countries, high exposure to AFB1 can cause chronic toxicity and usually increases the incidence of Hepatocellular Carcinoma (HCC). However, in these regions hepatitis B is the most common risk factor for HCC cases. Many researches were aimed to enlighten the mechanism and the role of two etiological agents on risk of HCC, but the obtained data was conflicting with each other. It was uncertain that the indicators/biomarkers might be the contribution of the carcinogenic status of the patient; and, the biomarker samples from the subject may only reflect the recent effects of the toxin exposure after consumption of AFB1 contaminated commodities. The studies were facing with the errors of methods which were un-fit to enlighten the possible interaction between Hepatitis B and AFB1 on contribution to HCC. It was pivotal to understand the effect of each risk factor in order to prevent and improve public health in poor and undeveloped regions. Although some of the studies evaluate AFB1 alone as a considerable factor on HCC risk, according to this review it was concluded vice versa. This study was aimed to clarify the main etiological agent of HCC where AFB1 and HBV are endangering public health. In additionally, the purpose was to enlighten the possible synergistic effect between these two factors among HCC pathogenesis. Hence forth, appropriate and right applications could be conducted in undeveloped countries in order to protect public health. PMID:27275251

  12. Lipopolysaccharide augments aflatoxin B(1)-induced liver injury through neutrophil-dependent and -independent mechanisms.

    PubMed

    Barton, C C; Ganey, P E; Roth, R A

    2000-11-01

    Exposure to small, noninjurious doses of the inflammagen, bacterial endotoxin (lipopolysaccharide, LPS) augments the toxicity of certain hepatotoxicants including aflatoxin B(1) (AFB(1)). Mediators of inflammation, in particular neutrophils (PMNs), are responsible for tissue injury in a variety of animal models. This study was conducted to examine the role of PMNs in the pathogenesis of hepatic injury after AFB(1)/LPS cotreatment. Male, Sprague-Dawley rats (250-350 g) were treated with either 1 mg AFB(1)/kg, ip or its vehicle (0.5% DMSO/saline), and 4 h later with either E. coli LPS (7. 4 x 10(6) EU/kg, iv) or its saline vehicle. Over a course of 6 to 96 h after AFB(1) administration, rats were killed and livers were stained immunohistochemically for PMNs. LPS resulted in an increase in PMN accumulation in the liver that preceded the onset of liver injury. To assess if PMNs contributed to the pathogenesis, an anti-PMN antibody was administered to reduce PMN numbers in blood and liver, and injury was evaluated. Hepatic parenchymal cell injury was evaluated as increased alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in serum and from histologic examination of liver sections. Biliary tract alterations were evaluated as increased concentration of serum bile acids and activities of gamma-glutamyltransferase (GGT), alkaline phosphatase (ALP), and 5'-nucleotidase (5'-ND) in serum. Neutrophil depletion protected against hepatic parenchymal cell injury caused by AFB(1)/LPS cotreatment but not against markers of biliary tract injury. This suggests that LPS augments AFB(1) hepatotoxicity through two mechanisms: one of which is PMN-dependent, and another that is not. PMID:11053557

  13. Effects of aflatoxin B1 and fumonisin B1 on body weight, antibody titres and histology of broiler chicks.

    PubMed

    Tessari, E N C; Oliveira, C A F; Cardoso, A L S P; Ledoux, D R; Rottinghaus, G E

    2006-06-01

    1. Our objective was to evaluate the toxic effects of aflatoxin B1 (AFB1) and fumonisin B1 (FB1), administered singly or in combination to broilers. 2. Feeds were prepared with concentrations equal to 0, 50 and 200 microg AFB1/kg, and/or 0, 50 and 200 mg FB1/kg, and offered to broiler chicks from 8 to 41 d of age. The experimental design was totally randomised, in a 3 x 3 factorial arrangement with 9 treatments and 12 birds per treatment. Animals were vaccinated against Newcastle disease on d 14 of life and killed at 41 d. 3. Compared with controls, all mycotoxin-treated groups at 41 d had lower body weight and weight gain, and higher relative heart weight. The relative weight of the liver increased only in birds fed diets containing 200 mg FB1, singly or in combination with AFB1. 4. At 35 d, all groups receiving mycotoxin-treated rations had reduced geometrical mean antibody titres, with birds from groups fed combinations of AFB1 and FB1/kg having even lower values, when compared to the other groups. 5. Histological changes were observed only in liver from birds fed mycotoxin-contaminated rations, and in kidneys of birds fed the diet containing 200 microg AFB1 and 200 mg FB1/kg. Main alterations included vacuolar degeneration and cell proliferation of bile ducts in the liver, and hydropic degeneration in renal tubules in the kidneys. 6. We concluded that AFB1 and FB1 in combination have primarily additive effects on body weight, liver structure and immunological response of broilers at the concentrations used. PMID:16787861

  14. In vitro inhibitory effect of aflatoxin B1 on acetylcholinesterase activity in mouse brain.

    PubMed

    Cometa, Maria Francesca; Lorenzini, Paola; Fortuna, Stefano; Volpe, Maria Teresa; Meneguz, Annarita; Palmery, Maura

    2005-01-01

    Growing concern on the problem of mycotoxins in the alimentary chain underlines the need to investigate the mechanisms explaining the cholinergic effects of aflatoxin B(1) (AFB(1)). We examined the effect of AFB(1), a mycotoxin produced by Aspergillus flavus, on mouse brain acetylcholinesterase (AChE) and specifically on its molecular isoforms (G(1) and G(4)) after in vitro exposure. AFB(1) (from 10(-9) to 10(-4)M), inhibited mouse brain AChE activity (IC(50) = 31.6 x 10(-6)M) and its G(1) and G(4) molecular isoforms in a dose-dependent manner. Michaelis-Menten parameters indicate that the K(m) value increased from 55.2 to 232.2% whereas V(max) decreased by 46.2-75.1%. The direct, the Lineweaver-Burk and the secondary plots indicated a non-competitive-mixed type antagonism, induced when the inhibitor binds to the free enzyme and to the enzyme-substrate complex. AFB(1)-inhibited AChE was partially reactivated by pyridine 2-aldoxime (2-PAM) (10(-4)M) but the AChE-inhibiting time courses of AFB(1) (10(-4)M) and diisopropylfluorophosphate (DFP) (2 x 10(-7)M) differed. Overall these data suggest that AFB(1) non-competitively inhibits mouse brain AChE by blocking access of the substrate to the active site or by inducing a defective conformational change in the enzyme through non-covalent binding interacting with the AChE peripheral binding site, or through both mechanisms. PMID:15590113

  15. Synergistic effect of black tea and curcumin in improving the hepatotoxicity induced by aflatoxin B1 in rats.

    PubMed

    Alm-Eldeen, Abeer A; Mona, Mohamed H; Shati, Ali A; El-Mekkawy, Haitham I

    2015-12-01

    Aflatoxin B1 (AFB1) is a toxic compound commonly found as a contaminant in human food. It is carcinogenic due its potential in inducing the oxidative stress and distortion of the most antioxidant enzymes. Since black tea possesses strong antioxidant activity, it protects cells and tissues against oxidative stress. Curcumin (CMN), a naturally occurring agent, has a combination of biological and pharmacological properties that include antioxidant activity. Therefore, the present study was carried out to investigate the possible role of separate and mixed supplementation of black tea extract and CMN in the hepatotoxicity induced by AFB1 in rats. A total of 48: adult male Sprague Dawley rats were randomly divided into eight groups with six rats in each group. Group 1 (normal control) includes rats that received no treatment. Groups 2, 3, and 4 (positive control) include rats that received olive oil, black tea extract, and CMN, respectively. Group 5 includes rats that received AFB1 at a dose of 750 μg/kg body weight (b.w.) dissolved in olive oil. Groups 6, 7, and 8 include rats that received AFB1 along with 2% black tea extract, CMN at a dose of 200 mg/kg b.w., and both black tea extract and CMN at the same previous doses, respectively. After 90 days, biochemical and histopathological examination was carried out for the blood samples and liver tissues. A significant decrease in the antioxidant enzymes and a significant increase in the lipid peroxidation and hydrogen peroxide in the rats treated with AFB1 were observed. Moreover, there were dramatic changes in the liver function biomarkers, lipid profile, and liver architecture. Supplementation of black tea extract or CMN showed an efficient role in repairing the distortion of the biochemical and histological changes induced by AFB1 in liver. This improvement was more pronounced when both CMN and black tea were used together. PMID:23796760

  16. In vitro ability of beer fermentation residue and yeast-based products to bind aflatoxin B1.

    PubMed

    Bovo, Fernanda; Franco, Larissa Tuanny; Rosim, Roice Eliana; Barbalho, Ricardo; de Oliveira, Carlos Augusto Fernandes

    2015-06-01

    This study aimed to verify the in vitro ability of beer fermentation residue (BFR) containing Saccharomyces cerevisiae cells and five commercial products that differed in the viability and integrity of S. cerevisiae cells to remove aflatoxin B1 (AFB1) from a citrate-phosphate buffer solution (CPBS). BFR was collected at a microbrewery and prepared by drying and milling. The commercial yeast-based products were as follows: inactive intact yeast cells from beer alcoholic fermentation, inactive intact yeast cells from sugarcane alcoholic fermentation, hydrolyzed yeast cells, yeast cell walls and active yeast cells. Adsorption assays were performed in CPBS spiked with 1.0 μg AFB1/mL at pH 3.0 and 6.0 for a contact time of 60 min at room temperature. Analysis of AFB1 in the samples was performed by high performance liquid chromatography. AFB1 adsorption by the products ranged from 45.5% to 69.4% at pH 3.0 and from 24.0% to 63.8% at pH 6.0. The higher percentages (p < 0.05) of AFB1 binding at both pH values were achieved with products containing hydrolyzed yeast cells or yeast cell walls rather than intact cells. The AFB1 binding percentages of BFR were 55.0 ± 5.0% at pH 3.0 and 49.2 ± 4.5% at pH 6.0, which was not significantly different (p > 0.05) from commercial products containing inactive intact yeast cells. The results of this trial indicate that the yeast-based products tested, especially the BFR, have potential applications in animal feeds as a suitable biological method for reducing the adverse effects of aflatoxins. PMID:26273277

  17. Panax ginseng extract modulates oxidative stress, DNA fragmentation and up-regulate gene expression in rats sub chronically treated with aflatoxin B1 and fumonisin B 1.

    PubMed

    Hassan, Aziza M; Abdel-Aziem, Sekena H; El-Nekeety, Aziza A; Abdel-Wahhab, Mosaad A

    2015-10-01

    Aflatoxins and fumonisins are important food-borne mycotoxins implicated in human health and have cytotoxic effects. The aims of the current study were to evaluate the protective role of Panax ginseng extract (PGE) against the synergistic effect of subchronic administration of aflatoxin B1 (AFB1) and fumonisin B1 (FB1) on DNA and gene expression in rat. Female Sprague-Dawley rats were divided into eight groups (ten rats/group) and treated for 12 weeks including the control group, the group having received AFB1 (80 µg/kg bw), the group having received FB1 (100 µg/kg bw), the group having received AFB1 plus FB1 and the groups having received PGE (20 mg/kg bw) alone or with AFB1 and/or FB1. At the end of experiment, liver and kidney were collected for the determination of DNA fragmentation, lipid peroxidation (LP), glutathione (GSH) contents and alterations in gene expression. The results indicated that these mycotoxins increased DNA fragmentation, LP and decreased GSH content in liver and kidney and down-regulated gene expression of antioxidants enzymes. The combined treatments with AFB1 and/or FB1 plus PGE suppressed DNA fragmentation only in the liver, normalized LP and increased GSH in the liver and kidney as well as up-regulated the expression of GPx, SOD1 and CAT mRNA. It could be concluded that AFB1 and FB1 have synergistic genotoxic effects. PGE induced protective effects against their oxidative stress and genotoxicity through its antioxidant properties. PMID:24748134

  18. Detoxification and antioxidant effects of garlic and curcumin in Oreochromis niloticus injected with aflatoxin B1 with reference to gene expression of glutathione peroxidase (GPx) by RT-PCR.

    PubMed

    El-Barbary, Manal I

    2016-04-01

    The present study aims to investigate the effects of both garlic and curcumin through evaluating their therapeutic properties as antioxidants on liver and kidney functions, hepatic antioxidants and GPx gene expression against aflatoxicosis of O. niloticus. In total, 180 of tilapia were divided into ten groups; T1 represented the negative control fed on a basal diet, and T2 was injected with a single intraperitoneal (i.p.) dose of AFB1 (6 mg/kg b.w.). Fish in T3-T6 were fed on a basal diet supplemented with both garlic (T3 and T4) and curcumin (T5 and T6) at the two concentrations of 10 and 20 g/kg diet, respectively. Fish in T7-T10 groups were injected with AFB1 and fed on the garlic (T7 and T8) and curcumin (T9 and T10) dietaries. The results showed that AFB1 has significant potency for increasing the activity of plasma AST, ALT, creatinine and uric acid values, and hepatic MDA as well as for reducing the concentrations of plasma TP, AL, GL and hepatic activity of TAC, while AFB1 led to up-regulated GPx gene expression when compared to the control (T1). These harmful effects of AFB1 were alleviated due to the garlic and curcumin dietaries in some studied parameters. Garlic reflected the highest induction of gene expression (T7); however, curcumin showed significant down-regulated (T9). These results concluded that the effects of garlic were better than curcumin at the two concentrations and the low concentration of them is more beneficial than the high concentration when it used against AFB1 in O. niloticus. PMID:26590820

  19. Development of the custom polymeric materials specific for aflatoxin B1 and ochratoxin A for application with the ToxiQuant T1 sensor tool.

    PubMed

    Piletska, Elena; Karim, Kal; Coker, Raymond; Piletsky, Sergey

    2010-04-16

    Two polymers were computationally designed with affinity to two of the most abundant mycotoxins aflatoxin B1 (AFB1) and ochratoxin A (OTA) for application in the ToxiQuant T1 System. The principle of quantification of AFB1 and OTA using the ToxiQuant T1 instrument comprised of a fluorimetric analysis of mycotoxins adsorbed on the polymer upon exposure to UV light. High affinity of the developed resins allowed the adsorption of both toxins as discrete bands on the top of the cartridge with detection limit as low as 1ng quantity of mycotoxins. PMID:20015499

  20. Prenatal exposure to aflatoxin B1: developmental, behavioral, and reproductive alterations in male rats

    NASA Astrophysics Data System (ADS)

    Supriya, Ch.; Reddy, P. Sreenivasula

    2015-06-01

    Previous studies have shown that aflatoxin B1 (AfB1) inhibits androgen biosynthesis as a result of its ability to form a high-affinity complex with the steroidogenic acute regulatory protein. The results of the present study demonstrate the postnatal effects of in utero exposure to AfB1 in the rat. Pregnant Wistar rats were given 10, 20, or 50 μg AfB1/kg body weight daily from gestation day (GD) 12 to GD 19. At parturition, newborns were observed for clinical signs and survival. All animals were born alive and initially appeared to be active. Male pups from control and AfB1-exposed animals were weaned and maintained up to postnatal day (PD) 100. Litter size, birth weight, sex ratio, survival rate, and crown-rump length of the pups were significantly decreased in AfB1-exposed rats when compared to controls. Elapsed time (days) for testes to descend into the scrotal sac was significantly delayed in experimental pups when compared to control pups. Behavioral observations such as cliff avoidance, negative geotaxis, surface rightening activity, ascending wire mesh, open field behavior, and exploratory and locomotory activities were significantly impaired in experimental pups. Body weights and the indices of testis, cauda epididymis, prostate, seminal vesicles, and liver were significantly reduced on PD 100 in male rats exposed to AfB1 during embryonic development when compared with controls. Significant reduction in the testicular daily sperm production, epididymal sperm count, and number of viable, motile, and hypo-osmotic tail coiled sperm was observed in experimental rats. The levels of serum testosterone and activity levels of testicular hydroxysteroid dehydrogenases were significantly decreased in a dose-dependent manner with a significant increase in the serum follicle-stimulating hormone and luteinizing hormone in experimental rats. Deterioration in the testicular and cauda epididymal architecture was observed in experimental rats. The results of fertility studies revealed a significant decrease in the mating index in experimental rats with an increase in the pre- and post-implantation losses in rats mated with prenatal AfB1-exposed males, indicating poor male reproductive performance. These results indicate that in utero exposure to AfB1 severely compromised postnatal development of neonatal rats, and caused a delay in testes descent and reduction in steroidogenesis and spermatogenesis that were accomplished by suppressed reproduction at adulthood.

  1. Effect of p53 Arg72Pro polymorphism on the induction of micronucleus by aflatoxin B1 in in vitro in human blood lymphocytes.

    PubMed

    Bayram, Süleyman; Rencüzoğulları, Eyyüp; Almas, Abdullah Muttalip; Genç, Ahmet

    2016-07-01

    Aflatoxin B1 (AFB1) is a class 1 carcinogen produced by Aspergillus flavus and Aspergillus parasiticus that can contaminate a variety of food substances, the liver being its target organ. A common p53 Arg72Pro polymorphism resulting in the substitution of an arginine amino acid by proline amino acid in the transactivating domain has been demonstrated to affect p53 function. The aim of this study is to investigate association between p53 Arg72Pro polymorphism and the frequencies of spontaneous and AFB1-induced DNA damage in peripheral blood lymphocytes from 100 healthy individuals in Turkish population. In vitro cytokinesis-blocked micronucleus (CBMN) assay was used to detect the spontaneous and AFB1-induced DNA damage whereas, genotyping of p53 Arg72Pro polymorphism was carried out by using a polymerase chain reaction restriction fragment length polymorphism assay. During 68 h incubation time, lymphocytes treated with AFB1 (1.56 μg/mL) and S9 mix for a total of 3 h (48-51 h). Treatment of the lymphocytes with AFB1significantly increased the overall frequencies of micronucleus (MN) when compared to untreated cultures (1.23 ± 0.05 versus 0.55 ± 0.02; p < 0.001). Moreover, genotype analysis revealed a statistically significant association between Pro/Pro genotype of p53 Arg72Pro polymorphism and increased frequencies of MN both spontaneous and AFB1-induced cultures when compared Arg/Arg genotype (0.69 ± 0.19 versus 0.46 ± 0.13, p < 0.001; 1.59 ± 0.65 versus 1.01 ± 0.41 p < 0.001; respectively). Our data indicate that p53 Arg72Pro polymorphism plays a significant role in human sensitivity to the genotoxic effects of AFB1. Further investigations in larger sample size and with different ethnic origins as well as including more functional single nucleotide polymorphisms might lead to the identification of novel genetic factors responsible for susceptibility to human carcinogens such as AFB1. PMID:26738694

  2. Interaction of aflatoxin B1 and fumonisin B1 in mice causes immunotoxicity and oxidative stress: Possible protective role using lactic acid bacteria.

    PubMed

    Abbès, Samir; Ben Salah-Abbès, Jalila; Jebali, Rania; Younes, Ridha Ben; Oueslati, Ridha

    2016-01-01

    Aflatoxins (AF) are important foodborne mycotoxins implicated in human health and have immunocytotoxic effects. The aims of this study were to evaluate a new aflatoxin B1 (AFB1) and fumonisin B1 (FB1)-binding/degrading micro-organism for biological detoxification, to examine its ability to degrade AFB1 and FB1 in liquid medium, and to evaluate its potential in vivo protective role against any combined effects from AFB1 and FB1 on host splenocyte caspase-3 activity (reflecting DNA damage/cell death) and mRNA levels of select inflammation-regulating cytokines. Balb/c mice were divided into groups (10/group) and treated daily for 2 weeks by oral gavage with AFB1 (80 µg/kg BW), FB1 (100 µg/kg), AFB1 + FB1, or lactic acid bacteria (Lactobacillus paracasei BEJ01, 2 × 10(9) CFU/L, ∼2 mg/kg) - alone or in combination with the AFB1 and/or FB1. After the exposures, spleens were collected for measures of caspase-3 activity, lipid peroxidation (LP), and glutathione (GSH) content, expression of anti-oxidation protective enzymes (GPx and SOD), and mRNA levels of inflammation-regulating cytokines (e.g. IL-10, IL-4, IFNγ, TNFα). Thymii were also removed for analysis of apoptosis. The results indicated that, in the spleen, exposure to the mycotoxins led to increased caspase-3 activity, LP, and IL-10 and IL-4 mRNA levels, but decreased GSH content and down-regulated expression of GPx and SOD, and of IFNγ and TNFα mRNA. Co-treatment using Lactic Acid Bacteria (LAB) with AFB1 or FB1 suppressed levels of DNA fragmentation, normalized splenic LP and increased GSH levels, up-regulated expression of GPx and SOD, and normalized mRNA levels of the analyzed cytokines. It is concluded that AFB1 and FB1 might have combinational (synergistic moreso than additive) toxic effects in situ. Further, it can be seen that use of LAB induced protective effects against the oxidative stress and (immuno)toxicity of these agents in part through adhesion (and so likely diminished

  3. Ultrasensitive food toxin biosensor using frequency based signals of silicon oxide nanoporous structure

    NASA Astrophysics Data System (ADS)

    Ghosh, H.; RoyChaudhuri, C.

    2013-06-01

    We report an electrochemically fabricated silicon oxide nanoporous structure for ultrasensitive detection of AfB1 in food by shift in peak frequency corresponding to maximum sensitivity. It has been observed that the impedance sensitivity changes from 19% to 40% (which is only twice) where as the peak frequency shifts from 500 Hz to 50 kHz, for a change in concentration from 1 fg/ml to 1 pg/ml. This has been attributed to the combined effect of the significant pore narrowing with increasing AfB1 concentration and the opposing nature of impedance change within the nanopores and the conducting substrate immediately below the nanoporous layer.

  4. Identification of early target genes of aflatoxin B1 in human hepatocytes, inter-individual variability and comparison with other genotoxic compounds

    SciTech Connect

    Josse, Rozenn; Dumont, Julie; Fautrel, Alain; Robin, Marie-Anne; Guillouzo, André

    2012-01-15

    Gene expression profiling has recently emerged as a promising approach to identify early target genes and discriminate genotoxic carcinogens from non-genotoxic carcinogens and non-carcinogens. However, early gene changes induced by genotoxic compounds in human liver remain largely unknown. Primary human hepatocytes and differentiated HepaRG cells were exposed to aflatoxin B1 (AFB1) that induces DNA damage following enzyme-mediated bioactivation. Gene expression profile changes induced by a 24 h exposure of these hepatocyte models to 0.05 and 0.25 μM AFB1 were analyzed by using oligonucleotide pangenomic microarrays. The main altered signaling pathway was the p53 pathway and related functions such as cell cycle, apoptosis and DNA repair. Direct involvement of the p53 protein in response to AFB1 was verified by using siRNA directed against p53. Among the 83 well-annotated genes commonly modulated in two pools of three human hepatocyte populations and HepaRG cells, several genes were identified as altered by AFB1 for the first time. In addition, a subset of 10 AFB1-altered genes, selected upon basis of their function or tumor suppressor role, was tested in four human hepatocyte populations and in response to other chemicals. Although they exhibited large variable inter-donor fold-changes, several of these genes, particularly FHIT, BCAS3 and SMYD3, were found to be altered by various direct and other indirect genotoxic compounds and unaffected by non-genotoxic compounds. Overall, this comprehensive analysis of early gene expression changes induced by AFB1 in human hepatocytes identified a gene subset that included several genes representing potential biomarkers of genotoxic compounds. -- Highlights: ► Gene expression profile changes induced by aflatoxin B1 in human hepatocytes. ► AFB1 modulates various genes including tumor suppressor genes and proto-oncogenes. ► Important inter-individual variations in the response to AFB1. ► Some genes also altered by other

  5. Prenatal exposure to aflatoxin B1: developmental, behavioral, and reproductive alterations in male rats.

    PubMed

    Supriya, Ch; Reddy, P Sreenivasula

    2015-06-01

    Previous studies have shown that aflatoxin B1 (AfB1) inhibits androgen biosynthesis as a result of its ability to form a high-affinity complex with the steroidogenic acute regulatory protein. The results of the present study demonstrate the postnatal effects of in utero exposure to AfB1 in the rat. Pregnant Wistar rats were given 10, 20, or 50 μg AfB1/kg body weight daily from gestation day (GD) 12 to GD 19. At parturition, newborns were observed for clinical signs and survival. All animals were born alive and initially appeared to be active. Male pups from control and AfB1-exposed animals were weaned and maintained up to postnatal day (PD) 100. Litter size, birth weight, sex ratio, survival rate, and crown-rump length of the pups were significantly decreased in AfB1-exposed rats when compared to controls. Elapsed time (days) for testes to descend into the scrotal sac was significantly delayed in experimental pups when compared to control pups. Behavioral observations such as cliff avoidance, negative geotaxis, surface rightening activity, ascending wire mesh, open field behavior, and exploratory and locomotory activities were significantly impaired in experimental pups. Body weights and the indices of testis, cauda epididymis, prostate, seminal vesicles, and liver were significantly reduced on PD 100 in male rats exposed to AfB1 during embryonic development when compared with controls. Significant reduction in the testicular daily sperm production, epididymal sperm count, and number of viable, motile, and hypo-osmotic tail coiled sperm was observed in experimental rats. The levels of serum testosterone and activity levels of testicular hydroxysteroid dehydrogenases were significantly decreased in a dose-dependent manner with a significant increase in the serum follicle-stimulating hormone and luteinizing hormone in experimental rats. Deterioration in the testicular and cauda epididymal architecture was observed in experimental rats. The results of fertility studies revealed a significant decrease in the mating index in experimental rats with an increase in the pre- and post-implantation losses in rats mated with prenatal AfB1-exposed males, indicating poor male reproductive performance. These results indicate that in utero exposure to AfB1 severely compromised postnatal development of neonatal rats, and caused a delay in testes descent and reduction in steroidogenesis and spermatogenesis that were accomplished by suppressed reproduction at adulthood. PMID:25911313

  6. Leaky Gut and Mycotoxins: Aflatoxin B1 Does Not Increase Gut Permeability in Broiler Chickens.

    PubMed

    Galarza-Seeber, Rosario; Latorre, Juan D; Bielke, Lisa R; Kuttappan, Vivek A; Wolfenden, Amanda D; Hernandez-Velasco, Xochitl; Merino-Guzman, Ruben; Vicente, Jose L; Donoghue, Annie; Cross, David; Hargis, Billy M; Tellez, Guillermo

    2016-01-01

    Previous studies conducted in our laboratory have demonstrated that intestinal barrier function can be adversely affected by diet ingredients or feed restriction, resulting in increased intestinal inflammation-associated permeability. Two experiments were conducted in broilers to evaluate the effect of three concentrations of Aflatoxin B1 (AFB1; 2, 1.5, or 1 ppm) on gastrointestinal leakage and liver bacterial translocation (BT). In experiment 1, 240 day-of-hatch male broilers were allocated in two groups, each group had six replicates of 20 chickens (n = 120/group): Control feed or feed + 2 ppm AFB1. In experiment 2, 240 day-of-hatch male broilers were allocated in three groups, each group had five replicates of 16 chickens (n = 80/group): Control feed; feed + 1 ppm AFB1; or feed + 1.5 ppm AFB1. In both experiments, chickens were fed starter (days 1-7) and grower diets (days 8-21) ad libitum and performance parameters were evaluated every week. At day 21, all chicks received an oral gavage dose of FITC-d (4.16 mg/kg) 2.5 h before collecting blood samples to evaluate gastrointestinal leakage of FITC-d. In experiment 2, a hematologic analysis was also performed. Liver sections were aseptically collected and cultured using TSA plates to determine BT. Cecal contents were collected to determine total colony-forming units per gram of Gram-negative bacteria, lactic acid bacteria (LAB), or anaerobes by plating on selective media. In experiment 2, liver, spleen, and bursa of Fabricius were removed to determine organ weight ratio, and also intestinal samples were obtained for morphometric analysis. Performance parameters, organ weight ratio, and morphometric measurements were significantly different between Control and AFB1 groups in both experiments. Gut leakage of FITC-d was not affected by the three concentrations of AFB1 evaluated (P > 0.05). Interestingly, a significant reduction in BT was observed in chickens that received 2 and 1

  7. Assessment of aflatoxin exposure using serum and urinary biomarkers in São Paulo, Brazil: A pilot study.

    PubMed

    Jager, Alessandra V; Tonin, Fernando G; Baptista, Gabriela Z; Souto, Pollyana C M C; Oliveira, Carlos A F

    2016-05-01

    The aim of this study was to evaluate the human exposure of individuals from Pirassununga, Brazil, to dietary aflatoxins B1 (AFB1) and M1 (AFM1) by determination of serum AFB1-lysine and urinary aflatoxin biomarkers (AFM1 and AFB1-N(7)-guanine). The participants were recruited among employees from a Campus of the University of São Paulo, which provided food samples from their homes, as well as serum and urine samples four times every three months, from June 2011 until March 2012. The probable daily intake (PDI) of aflatoxin was estimated by using the results from analysis of food products collected by the time of samples collection, and data from a 24-hour dietary recall questionnaire. Analyses of AFB1 and AFM1 in food samples were conducted by high-performance liquid chromatography with fluorescence detection. Biomarkers in serum and urine were determined by tandem mass spectrometry. AFB1 and AFM1 were detected in 38 samples of cereals (28%, N=136) and 31 milk products (36%, N=86), respectively. AFB1-lysine and AFB1-N(7)-guanine and were not detected in serum or urine samples, respectively. However, AFM1 was found in 74 urine samples (65%), at mean levels in the 4 sampling times ranging from 0.37±0.23 to 1.70±2.88pg/mg creatinine. The mean PDI varied among different sampling times, ranging from 0.09±0.09 to 1.35±5.98ng/kg body weight/day. A modest though significant correlation (r=0.45; p=0.03; N=23) was found for the first time in Brazil between the AFM1 concentration in urine and the PDI for total aflatoxins (AFB1+AFM1) in sampling 1 (June 2011). Urinary AFM1 was confirmed as very sensitive for monitoring the human exposure to dietary aflatoxin. Further studies using serum and urinary biomarkers are needed to estimate the aflatoxin exposure of populations in higher risk areas in Brazil. PMID:26740158

  8. Leaky Gut and Mycotoxins: Aflatoxin B1 Does Not Increase Gut Permeability in Broiler Chickens

    PubMed Central

    Galarza-Seeber, Rosario; Latorre, Juan D.; Bielke, Lisa R.; Kuttappan, Vivek A.; Wolfenden, Amanda D.; Hernandez-Velasco, Xochitl; Merino-Guzman, Ruben; Vicente, Jose L.; Donoghue, Annie; Cross, David; Hargis, Billy M.; Tellez, Guillermo

    2016-01-01

    Previous studies conducted in our laboratory have demonstrated that intestinal barrier function can be adversely affected by diet ingredients or feed restriction, resulting in increased intestinal inflammation-associated permeability. Two experiments were conducted in broilers to evaluate the effect of three concentrations of Aflatoxin B1 (AFB1; 2, 1.5, or 1 ppm) on gastrointestinal leakage and liver bacterial translocation (BT). In experiment 1, 240 day-of-hatch male broilers were allocated in two groups, each group had six replicates of 20 chickens (n = 120/group): Control feed or feed + 2 ppm AFB1. In experiment 2, 240 day-of-hatch male broilers were allocated in three groups, each group had five replicates of 16 chickens (n = 80/group): Control feed; feed + 1 ppm AFB1; or feed + 1.5 ppm AFB1. In both experiments, chickens were fed starter (days 1–7) and grower diets (days 8–21) ad libitum and performance parameters were evaluated every week. At day 21, all chicks received an oral gavage dose of FITC-d (4.16 mg/kg) 2.5 h before collecting blood samples to evaluate gastrointestinal leakage of FITC-d. In experiment 2, a hematologic analysis was also performed. Liver sections were aseptically collected and cultured using TSA plates to determine BT. Cecal contents were collected to determine total colony-forming units per gram of Gram-negative bacteria, lactic acid bacteria (LAB), or anaerobes by plating on selective media. In experiment 2, liver, spleen, and bursa of Fabricius were removed to determine organ weight ratio, and also intestinal samples were obtained for morphometric analysis. Performance parameters, organ weight ratio, and morphometric measurements were significantly different between Control and AFB1 groups in both experiments. Gut leakage of FITC-d was not affected by the three concentrations of AFB1 evaluated (P > 0.05). Interestingly, a significant reduction in BT was observed in chickens that received 2 and

  9. Chronic aflatoxin exposure in children living in Bhaktapur, Nepal: Extension of the MAL-ED study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fumonisin B1 (FB1) and aflatoxin B1 (AFB1) are toxic chemicals produced by molds. The molds that produce these two toxic chemicals are commonly found in corn and their co-occurence in corn has been demonstrated in many surveys. This study was conducted because it is suspected that exposure to eith...

  10. The master transcription factor MtfA governs aflatoxin production, morphological development, and pathogenicity in the fungus Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus produces a variety of toxic secondary metabolites, among them the aflatoxins (AFs) are the most well-known. These compounds are highly mutagenic and carcinogenic, particularly AFB1. A. flavus is capable of colonizing economically important crops contaminating them with AFs. Molecu...

  11. Validation of a UHPLC-FLD analytical method for the simultaneous quantification of aflatoxin B1 and ochratoxin a in rat plasma, liver and kidney.

    PubMed

    Corcuera, Laura-Ana; Ibáñez-Vea, María; Vettorazzi, Ariane; González-Peñas, Elena; Cerain, Adela López de

    2011-09-15

    A rapid and simple method for the simultaneous quantification of AFB1 and OTA in rat plasma, liver and kidney by UHPLC-FLD has been successfully validated according to the following criteria: selectivity, stability, linearity, precision, accuracy, recovery, robustness and limits of quantification and detection. The extraction method, calibration curves and chromatographic conditions are common for the three matrices. Plasma and homogenized tissue samples (100 μL) were extracted with acetonitrile:formic acid mixture (99:1) (300 μL). Chromatographic separation was performed with a mixture of water and acetonitrile:methanol (50:50), both acidified with 0.5% of formic acid using a gradient profile. The method avoids the use of immunoaffinity columns and allows reduction of sample and solvent volumes as well as toxic wastes. The detection is based on a photochemical reaction which enhances the AFB1 response without affecting the OTA signal before reaching the fluorescent detector. The mycotoxin recovery for each matrix was very efficient, between 93% and 96% for AFB1 and between 94% and 96% for OTA. For both mycotoxins the LOQs were 2μg/L in plasma and 8μg/kg in liver and kidney. The method has successfully been applied to rat samples after a single oral administration of a mixture of AFB1 and OTA and it could be a useful tool in toxicokinetic and toxicological studies. PMID:21868292

  12. Aflatoxin B₁ and aflatoxins in ground red chilli pepper after drying.

    PubMed

    Özkan, Ali; Bindak, Recep; Erkmen, Osman

    2015-01-01

    In this study, 180 red chilli pepper (RCP) berry samples were obtained from two different croplands of Gaziantep and Kahramanmaraş (Turkey) in August, September and October. RCP berry samples were dried under sunlight and grinded. Ground red chilli pepper (GRCP) samples were analysed for aflatoxins (AFs, sum of B1, B2, G1 and G2) and AFB1 contamination. According to the results, in 49 of 180 samples, AFB1 and in 37 samples, AFs were higher than legal limits. The lowest amounts of AFs and AFB1 were obtained in August and the highest amounts in October. χ(2) analysis showed that there were no significant differences (p > 0.05) between cities among 3 months according to number of samples with AFs and AFB1 above legal limits. According to the Duncan multiple-range test, there was no significant difference between all months. Strict measures are necessary to produce high-quality GRCP. RCP berry must be treated to reduce moulds before production of GRCP. PMID:26099014

  13. Longitudinal metabolic imaging of hepatocellular carcinoma in transgenic mouse models identifies acylcarnitine as a potential biomarker for early detection

    PubMed Central

    Yaligar, Jadegoud; Teoh, Wei Wei.; Othman, Rashidah; Verma, Sanjay Kumar; Phang, Beng Hooi; Lee, Swee Shean; Wang, Who Whong; Toh, Han Chong; Gopalan, Venkatesh; Sabapathy, Kanaga; Velan, S. Sendhil

    2016-01-01

    The cumulative effects of hepatic injury due to hepatitis B virus (HBV) infections and aflatoxin-B1 (AFB1) exposure are the major risk factors of HCC. Understanding early metabolic changes involving these risk factors in an animal model closely resembling human hepatocellular carcinoma (HCC) is critical for biomarker discovery and disease therapeutics. We have used the hepatitis B surface antigen (HBsAg) transgenic mouse model that mimics HBV carriers with and without AFB1 treatment. We investigated early metabolic changes from preneoplastic state to HCC by non-invasive longitudinal imaging in three HCC groups of mice: HBsAg + AFB1(Gp-I), AFB1 alone (Gp-II), HBsAg alone (Gp-III) and a control group (wild-type untreated; Gp-IV). For the first time, we have identified acylcarnitine signals in vivo in the liver prior to the histological manifestation of the tumors in all three groups. Acylcarnitine concentration increased with increase in tumor growth in all HCC mouse models, indicating elevated metabolic activity and increased cell turnover. This was confirmed in a pilot study using human serum from HCC patients, which revealed a higher concentration of acylcarnitine compared with normal subjects. Translational clinical studies can be designed to detect acylcarnitine in patients with high risk factors for HCC. PMID:26831370

  14. Expression of V(H)-linker-V(L) orientation-dependent single-chain Fv antibody fragment derived from hybridoma 2E6 against aflatoxin B1 in Escherichia coli.

    PubMed

    Liu, Aiping; Ye, Yang; Chen, Weifeng; Wang, Xiaohong; Chen, Fusheng

    2015-02-01

    Aflatoxin B1 (AFB1) is a toxic secondary metabolic product, which threatens human and animal health. Antibody is a key factor for immunoassay against toxic stuff like AFB1, and single-chain Fv antibody fragment (scFv) has become a popular format of genetically engineered antibody. In this study, four hybridoma cell lines against AFB1 were obtained, and then scFvs 2E6 derived from hybridoma cell line 2E6 were constructed in different V(H)/V(L) orientations. Subsequently, scFvs 2E6 were expressed in E. coli BL21(DE3) mainly in the form of inclusion body. SDS-PAGE, Western blot and ELISA were employed to characterize scFvs 2E6. The results revealed that the yield of inclusion body of scFvs 2E6 in either V(H)/V(L) orientation was similar; however, only the scFv in V(H)-linker-V(L) orientation showed anti-AFB1 bioactivity after refolding. The present study underscores the importance of choosing optimal V(H)/V(L) orientation for scFv construction, and scFv may be favorable for immunoassays in food industry. PMID:25540048

  15. High sensitive and throughput screening of Aflatoxin using MALDI-TOF-TOF-PSD-MS/MS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have achieved sensitive and efficient detection of aflatoxin B1(AFB1) through matrix-assisted laser desorption/ionization time-of-flight-time-of-flight mass spectrometry (MALDI-TOF-TOF) and post-source decay (PSD) tandem mass spectrometry (MS/MS) using an acetic acid – a-cyano-4-hydroxycinnamic a...

  16. Survey of Deoxynivalenol and Aflatoxin B1 in Instant Noodles and Bread Consumed in Thailand by Using Liquid Chromatography-Tandem Mass Spectrometry.

    PubMed

    Pralatnet, Sasithorn; Poapolathep, Saranya; Giorgi, Mario; Imsilp, Kanjana; Kumagai, Susumu; Poapolathep, Amnart

    2016-07-01

    One hundred wheat product samples (50 instant noodle samples and 50 bread samples) were collected from supermarkets in Bangkok, Thailand. Deoxynivalenol (DON) and aflatoxin B1 (AFB1) contamination in these products was analyzed using a validated liquid chromatography-tandem mass spectrometry method. The limit of quantification values of DON and AFB1 in the instant noodles and bread were 2 and 1 ng g(-1), respectively. The survey found that DON was quantifiable in 40% of collected samples, in 2% of noodles (0.089 μg g(-1)), and in 78% of breads (0.004 to 0.331 μg g(-1)). AFB1 was below the limit of quantification of the method in all of the tested samples. The results suggest that the risk of DON exposure via noodles and breads is very low in urban areas of Thailand. No risk can be attributable to AFB1 exposure in the same food matrices, but further studies with a larger sample size are needed to confirm these data. PMID:27357050

  17. RAINBOW TROUT EMBRYOS: ADVANTAGES AND LIMITATIONS FOR CARCINOGENESIS RESEARCH

    EPA Science Inventory

    Rainbow trout embryos are sensitive to the initiation of neoplasms in various tissues by brief exposures to solutions of water-soluble carcinogens. This characteristic was first demonstrated with the sparingly soluble liver carcinogen, aflatoxin B1(AFB1). A 30-minute exposure of ...

  18. The mitochondrial and death receptor pathways involved in the thymocytes apoptosis induced by aflatoxin B1.

    PubMed

    Peng, Xi; Yu, Zhengqiang; Liang, Na; Chi, Xiaofeng; Li, Xiaochong; Jiang, Min; Fang, Jing; Cui, Hengmin; Lai, Weimin; Zhou, Yi; Zhou, Shan

    2016-03-15

    Aflatoxin B1 (AFB1) is a potent immunosuppressive agent in endotherms, which can be related to the up-regulated apoptosis of immune organs. In this study, we investigated the roles of the mitochondrial, death receptor, and endoplasmic reticulum pathways in Aflatoxin B1 induced thymocytes apoptosis. Chickens were fed an aflatoxin B1 containing diet (0.6 mg/kg AFB1) for 3 weeks. Our results showed that (1) AFB1 diet induced the decrease of T-cell subsets, morphological changes, and excessive apoptosis of thymus. (2) The excessive apoptosis involved the mitochondrial pathway (up-regulation of Bax, Bak, cytC and down-regulation of Bcl-2 and Bcl-xL) and death receptor pathway (up-regulation of FasL, Fas and FADD). (3) Oxidative stress, an apoptosis inducer, was confirmed in the thymus. In conclusion, this is the first study to demonstrate that mitochondrial and death receptor pathways involved in AFB1 induced thymocytes apoptosis in broilers. PMID:26933817

  19. The efficacy of bamboo charcoal in comparison with smectite to reduce the detrimental effect of aflatoxin B1 on in vitro rumen fermentation of a hay-rich feed mixture.

    PubMed

    Jiang, Ya-Hui; Wang, Ping; Yang, Hong-Jian; Chen, Ying

    2014-01-01

    Two commercial materials, a bamboo charcoal (BC) and a smectite clay (SC), were assessed in vitro with aflatoxin B1 (AFB1) in an equilibrium adsorption test. The adsorption capacity and proportion adsorbed (0.381 μg/mg, 0.955) for BC were greater than for SC (0.372 μg/mg, 0.931). The effects of in vitro ruminal fermentation of hay-rich feed incubated with 1.0 μg/mL AFB1 for 0-10 g/L doses of BC and SC were measured at 39 °C for 72 h. The BC and SC binders increased AFB1 loss at dosages ≥1.0 g/L (p < 0.0001). Average AFB1 loss (p < 0.0001) was greater for SC (0.904) than BC (0.881). Both SC and SC addition increased in vitro dry matter loss, and the average dry matter losses were similar. Asymptotic gas volume and volatile fatty acid production were greater for BC than for SC (p < 0.0001). Thus, BC may be as effective as SC in removing aflatoxin B1's detrimental effects on rumen degradability and fermentation under the occurrence of microbial aflatoxin degradation. PMID:25014194

  20. BIOCHEMICAL CHANGES IN DEHYDROGENASE, HYDROXYLASE AND TYROSINASE OF A PERMETHRIN-RESISTANT STRAIN OF HOUSEFLY LARVAE, MUSCA DOMESTICA L.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Permethrin-resistant (ALHF) and susceptible (aabys) strains of housefly were used to understand enzymic changes in biosynthetic pathways after insecticide selection. Aflatoxin B1 (AFB1) as a natural substrate was used to verify the changes in cytochrome P450-dependent monooxygenases and oxido-reduct...

  1. Inhibition of the Aspergillus flavus Growth and Aflatoxin B1 Contamination on Pistachio Nut by Fengycin and Surfactin-Producing Bacillus subtilis UTBSP1

    PubMed Central

    Farzaneh, Mohsen; Shi, Zhi-Qi; Ahmadzadeh, Masoud; Hu, Liang-Bin; Ghassempour, Alireza

    2016-01-01

    In this study, the treatment of pistachio nuts by Bacillus subtilis UTBSP1, a promising isolate to degrade aflatoxin B1 (AFB1), caused to reduce the growth of Aspergillus flavus R5 and AFB1 content on pistachio nuts. Fluorescence probes revealed that the cell free supernatant fluid from UTBSP1 affects spore viability considerably. Using high-performance liquid chromatographic (HPLC) method, 10 fractions were separated and collected from methanol extract of cell free supernatant fluid. Two fractions showed inhibition zones against A. flavus. Mass spectrometric analysis of the both antifungal fractions revealed a high similarity between these anti-A. flavus compounds and cyclic-lipopeptides of surfactin, and fengycin families. Coproduction of surfactin and fengycin acted in a synergistic manner and consequently caused a strong antifungal activity against A. flavus R5. There was a positive significant correlation between the reduction of A. flavus growth and the reduction of AFB1 contamination on pistachio nut by UTBSP1. The results indicated that fengycin and surfactin-producing B. subtilis UTBSP1 can potentially reduce A. flavus growth and AFB1 content in pistachio nut. PMID:27298596

  2. The furofuran-ring selectivity, hydrogen peroxide-production and low Km value are the three elements for highly effective detoxification of aflatoxin oxidase.

    PubMed

    Wu, Yuan-Zhen; Lu, Fu-Pu; Jiang, Hai-Lan; Tan, Cui-Ping; Yao, Dong-Sheng; Xie, Chun-Fang; Liu, Da-Ling

    2015-02-01

    AFO (aflatoxin oxidase), an enzyme from Armillariella tabescens previously named aflatoxin detoxifizyme, exhibits oxidative detoxification activity toward aflatoxin B1 and sterigmatocystin. Bioinformatics reveals that AFO is a newly discovered oxidase because AFO does not share any significant similarities with any known oxidase. It is critically important to understand how AFO acts on aflatoxin B1. In this study, in addition to aflatoxin B1 (AFB1) and sterigmatocystin (ST), five other chemicals that have furan or pyran structures were investigated. The results indicated that in addition to AFB1 and ST, AFO is also able to act on versicolorin A, 3,4-dihydro-2H-pyran and furan. These results suggested that 8,9-unsaturated carboncarbon bond of aflatoxin B1 is the potential reactive site for AFO. Further findings indicated that the action of AFO is oxygen-dependent and hydrogen peroxide-producing. The simultaneously produced-hydrogen peroxide possibly plays the essential role in detoxification of AFO. In addition, the extremely low Km value of 0.33 µmol/l for AFO-AFB1 and 0.11 µmol/l for AFO-ST signifies that AFO is highly selective for AFB1 as well as ST. PMID:25533793

  3. On the occurrence of aflatoxin M1 in milk and dairy products.

    PubMed

    Prandini, A; Tansini, G; Sigolo, S; Filippi, L; Laporta, M; Piva, G

    2009-05-01

    Aflatoxins are toxic fungal metabolites found in foods and feeds. When ruminants eat AFB(1)-feedstuffs, they metabolise the toxin and excrete AFM(1) in milk. To control AFM(1) in foods it is necessary to reduce AFB(1) contamination of feeds for dairy cattle by preventing fungal growth and AFB(1) formation in agricultural commodities intended for animal use. Corn and corn-based products are one of the most contaminated feedstuffs; therefore risk factor analysis of AFB(1) contamination in corn is necessary to evaluate risk of AFM(1) contamination in milk and milk products. During the corn silage production, the aflatoxins production is mostly influenced by: harvest time; fertilization; irrigation; pest control; silage moisture; and storage practices. Due to the lower moisture at harvest and to the conservation methods, the corn grain is mostly exposed to the contamination by Aspergillus species. Therefore, it is necessary to reduce the probability of this contaminant through choice of: hybrids; seeding time and density; suitable ploughing and fertirrigation; and chemical or biological control. Grains harvested with the lowest possible moisture and conservation moisture close to or less than 14% are necessary to reduce contamination risks, as is maintaining mass to homogeneous moisture. Kernel mechanical damage, grain cleaning practices and conservation temperature are also factors which need to be carefully controlled. PMID:18037552

  4. Purple rice bran extract attenuates the aflatoxin B1-induced initiation stage of hepatocarcinogenesis by alteration of xenobiotic metabolizing enzymes.

    PubMed

    Suwannakul, Nattawan; Punvittayagul, Charatda; Jarukamjorn, Kanokwan; Wongpoomchai, Rawiwan

    2015-01-01

    Pigmented rice bran has been suggested to be a valuable source of beneficial phytochemicals. We investigated genotoxic and anti-genotoxic effects of purple rice bran extract (PRBE) in rats using a liver micronucleus assay. Purple rice bran was extracted with methanol, obtaining large amounts of phenolic compounds, including anthocyanins and small amounts of gamma-oryzanol. The experimental protocols were divided into two sets. Male rats were divided into three groups. Group 1 was a negative control, while Groups 2 and 3 were fed with 100 and 500 mg/kg bw of PRBE, respectively, for 28 days. PRBE had no effect on micronucleus formation or xenobiotic metabolizing enzymes in rat liver. Experiments concerning the effect of PRBE on AFB1 showed that PRBE significantly lessened the amount of micronucleated hepatocytes in AFB1 treated rats. Furthermore, it modulated metabolic activation of AFB1 metabolism in the liver by suppressing activity and protein expression of CYP1A2, CYP3A and CYP 450 reductase, and enhancing phase II enzymes including GST and UGT. Overall, purple rice bran extract was not genotoxic in rats. It exhibited anti-genotoxicity by modulation some xenobiotic enzymes active in AFB1 metabolism. PMID:25921147

  5. The effect of NovaSil dietary supplementation on the growth and health performance of Nile tilapia (Oreochromis niloticus) fed aflatoxin-B1 contaminated feed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this study was to evaluate the ability of NovaSil (NS) clay to sorb and mitigate the toxic effects of aflatoxin B1 (AFB1) in Nile tilapia (Oreochromis niloticus). Growth performance, specific innate immunological function, intestinal microbial community, and histology were evaluate...

  6. Functional and phylogenetic analysis of the Aspergillus ochraceoroseus aflQ (ordA) gene ortholog

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Within the Aspergillus parasiticus and A. flavus aflatoxin (AF) biosynthetic gene cluster the aflQ (ordA) and aflP (omtA) genes encode an oxidoreductase and methyltransferase, respectively. These genes are required for the final steps in the conversion of sterigmatocystin (ST) to aflatoxin B1 (AFB1...

  7. Public health risk associated with the co-occurrence of mycotoxins in spices consumed in Sri Lanka.

    PubMed

    Yogendrarajah, Pratheeba; Jacxsens, Liesbeth; Lachat, Carl; Walpita, Chaminda Niroshan; Kolsteren, Patrick; De Saeger, Sarah; De Meulenaer, Bruno

    2014-12-01

    A quantitative risk assessment of mycotoxins due to the consumption of chilli (Capsicum annum L.) and black pepper (Piper nigrum L.) was performed in Sri Lanka. A food frequency questionnaire was administered in order to collect the data on consumption of spices by households in the Northern and Southern region (n = 249). The mean chilli consumption in the North was significantly higher (p < 0.001) compared to the South. Mean exposure to aflatoxin B1 (AFB1) in the North (3.49 ng/kg BW/day) and South (2.13 ng/kg BW/day) have exceeded the tolerable daily intake due to chilli consumption at the lower bound scenario, while exposure to OTA was small. Dietary exposure to other mycotoxins, fumonisin B1, fumonisin B2, sterigmatocystin and citrinin due to spices were estimated. Margin of exposure estimations at the mean exposure to AFB1 were remarkably lower due to chilli (45-78) than for pepper (2315–10,857). Moreover, the hepato cellular carcinoma (HCC) risk associated with the mean AFB1 exposure through chilli at the lower bound was 0.046 and 0.028 HCC cases/year/100,000 based on the North and South consumption, respectively. AFB1 exposure via chilli should be considered as a great public health concern in Sri Lanka due to both high mycotoxin concentration and high consumption. PMID:25455891

  8. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin (AF)-producing fungi contaminate food and feed during preharvest, storage and processing periods. Once consumed, AF accumulates in tissues, causing illnesses in animals and humans. At least 20 different types of AFs have been identified, and of these, aflatoxin B1 (AFB1) is the most ubiqui...

  9. Low levels of aflatoxin B1, ricin and milk enhance recombinant protein production in mammalian cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Changing the optimal tissue culture medium by adding low levels of environmental stress such as 1 µM of the fungal toxin aflatoxin B1 (AFB1), 1 ng of the castor bean protein toxin ricin in transduced mammalian cells or 1% reconstituted milk enhances transcription and increases production of the foll...

  10. Co-exposure to fumonisins and aflatoxins in maize-based foods in central america: guatemala as a case study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin B1 (AFB1) is a human liver carcinogen having a genotoxic mechanism of action. The ceramide synthase inhibitor fumonisin B1 (FB1) is a liver cancer promoter in rats and trout. Both mycotoxins are found in maize so that the possibility of co-exposure is a health concern, especially in Centra...

  11. Absence of the Aflatoxin Biosynthesis Gene, norA, allows accumulation of deoxyaflatoxin B1 in Aspergillus flavus cultures

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Conversion of O-methylsterigmatocystin (OMST) to aflatoxin B1 (AFB1), a highly toxic and carcinogenic fungal metabolite of some Aspergillus species, begins with its oxidation catalyzed by the cytochrome P450 monooxygenase, OrdA (AflQ). The complexity of the subsequent oxidation, hydration, ring-ope...

  12. A novel method for determination of aflatoxin B1 mediated by FCLA + BSA

    NASA Astrophysics Data System (ADS)

    Chen, WenLi; Xing, Da

    2005-02-01

    As a chemiluminescence (CL) probe, 3,7-dihydro-6-{4-{2-(N"-(5-fluoresceinyl) thioureido)ethoxy}phenyl}-2-met -hylimi-dazo{1,2-a}pyrazin-3-one dosium salt (FCLA) can sensitively and specifically react with singlet oxygen (1O2 ) and superoxide(O2""). BSA (Bovine Serum Albumin) can enlarge the CL intensity of FCLA to 860%. This report presents a novel method for determination of Aflatoxin B1 (AfB1) mediated by FCLA+BSA. The concentration of AFB1 showed an obvious positive correlation with the CL intensity mediated by FCLA+BSA. This method could measure accurately ng/ml of AfB1 concentration. At the same time, the fluorescence spectrum of FCLA+BSA and FCLA+BSA+AfB1 were measured respectively, which showed that the fluorescence intensity of FCLA+BSA+AfB1 was higher than FCLA+BSA. Comparing the peak value of FCLA, FCLA+BSA and FCLA+BSA+AfB1 had a 6nm Einstein shift (red shift). The study suggested that CL method mediated by FCLA+BSA might be applicable to the determination of AfB1 concentration.

  13. The Efficacy of Bamboo Charcoal in Comparison with Smectite to Reduce the Detrimental Effect of Aflatoxin B1 on In Vitro Rumen Fermentation of a Hay-Rich Feed Mixture

    PubMed Central

    Jiang, Ya-Hui; Wang, Ping; Yang, Hong-Jian; Chen, Ying

    2014-01-01

    Two commercial materials, a bamboo charcoal (BC) and a smectite clay (SC), were assessed in vitro with aflatoxin B1 (AFB1) in an equilibrium adsorption test. The adsorption capacity and proportion adsorbed (0.381 μg/mg, 0.955) for BC were greater than for SC (0.372 μg/mg, 0.931). The effects of in vitro ruminal fermentation of hay-rich feed incubated with 1.0 μg/mL AFB1 for 0–10 g/L doses of BC and SC were measured at 39 °C for 72 h. The BC and SC binders increased AFB1 loss at dosages ≥1.0 g/L (p < 0.0001). Average AFB1 loss (p < 0.0001) was greater for SC (0.904) than BC (0.881). Both SC and SC addition increased in vitro dry matter loss, and the average dry matter losses were similar. Asymptotic gas volume and volatile fatty acid production were greater for BC than for SC (p < 0.0001). Thus, BC may be as effective as SC in removing aflatoxin B1’s detrimental effects on rumen degradability and fermentation under the occurrence of microbial aflatoxin degradation. PMID:25014194

  14. Feasibility of detecting Aflatoxin B1 in single maize kernels using hyperspectral imaging

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The feasibility of detecting Aflatoxin B1 (AFB1) in single maize kernel inoculated with Aspergillus flavus conidia in the field, as well as its spatial distribution in the kernels, was assessed using near-infrared hyperspectral imaging (HSI) technique. Firstly, an image mask was applied to a pixel-b...

  15. Inhibition of the Aspergillus flavus Growth and Aflatoxin B1 Contamination on Pistachio Nut by Fengycin and Surfactin-Producing Bacillus subtilis UTBSP1.

    PubMed

    Farzaneh, Mohsen; Shi, Zhi-Qi; Ahmadzadeh, Masoud; Hu, Liang-Bin; Ghassempour, Alireza

    2016-06-01

    In this study, the treatment of pistachio nuts by Bacillus subtilis UTBSP1, a promising isolate to degrade aflatoxin B1 (AFB1), caused to reduce the growth of Aspergillus flavus R5 and AFB1 content on pistachio nuts. Fluorescence probes revealed that the cell free supernatant fluid from UTBSP1 affects spore viability considerably. Using high-performance liquid chromatographic (HPLC) method, 10 fractions were separated and collected from methanol extract of cell free supernatant fluid. Two fractions showed inhibition zones against A. flavus. Mass spectrometric analysis of the both antifungal fractions revealed a high similarity between these anti-A. flavus compounds and cyclic-lipopeptides of surfactin, and fengycin families. Coproduction of surfactin and fengycin acted in a synergistic manner and consequently caused a strong antifungal activity against A. flavus R5. There was a positive significant correlation between the reduction of A. flavus growth and the reduction of AFB1 contamination on pistachio nut by UTBSP1. The results indicated that fengycin and surfactin-producing B. subtilis UTBSP1 can potentially reduce A. flavus growth and AFB1 content in pistachio nut. PMID:27298596

  16. Comparison of S9 mix and hepatocytes as external metabolizing systems in mammalian cell cultures: cytogenetic effects of 7,12-dimethylbenzanthracene and aflatoxin B1

    SciTech Connect

    Madle, E.; Tiedemann, G.; Madle, S.; Oett, A.; Kaufmann, G.

    1986-01-01

    Two external metabolizing systems, S9 mix from Aroclor-induced rat livers and freshly isolated hepatocytes, were used for activation in cultures of human lymphocytes and V79 cells. 7, 12-dimethylbenzanthracene (DMBA) and aflatoxin B1 (AFB1) were employed as indirectly acting reference mutagens. Mutagenic effects were measured by induction of sister chromatid exchange (SCE). With DMBA, SCE-inducing effects were found to be quite similar after activation by S9 mix and activation by hepatocytes. In contrast with AFB1, S9 activation led to a stronger SCE induction than hepatocyte activation in both target cells. The induction of chromosomal aberrations by AFB1 after activation by the two metabolizing systems was also analyzed in V79 cells. This experiment again revealed that AFB1 was more efficiently activated by S9 mix than by hepatocytes. The experiments have shown that the suitability of hepatocytes as an activation system is not restricted to microbial or eukaryotic point mutation assays, but that hepatocyte metabolism can also be successfully included in cytogenetic tests with short- and long-term cultures of mammalian target cells.

  17. Transport via xylem and accumulation of aflatoxin in seeds of groundnut plant.

    PubMed

    Snigdha, M; Hariprasad, P; Venkateswaran, G

    2015-01-01

    Aflatoxin contamination in groundnut seeds in the absence of any aflatoxigenic fungi leads to a hypothesis that aflatoxins are present naturally in soil and is transferred to seeds through uptake by roots. A survey was conducted on the natural occurrence of aflatoxins in agricultural soils, among nine main groundnut-growing regions of Karnataka state, India. All 71 soil samples collected in this survey were contaminated with aflatoxins esp. AFB1. An in vitro xylem sap experiment proved the ability of groundnut plant roots to absorb AFB1, and transport to aerial plant parts via the xylem. Hydroponics experiment also proved the uptake of AFB1 by the roots and their translocation to shoot. Uptake was affected by the initial concentration of toxin and pH of the medium. Among the 14 varieties screened, GPBD4 and MLT.K.107 (III) recorded highest and least AFB1 uptake, respectively. The above results were validated using a greenhouse experiment. Here, the aflatoxin absorbed by root gradually transferred to shoot that was later found in seeds towards the end of experiment. Thus, the groundnut seeds can also get contaminated with aflatoxin by direct uptake of aflatoxin through conducting tissue in addition to fungal infection. The present study revealed the novel mode of aflatoxin contamination in groundnut seeds without fungal infection. PMID:25112578

  18. Mycotoxins modify the barrier function of Caco-2 cells through differential gene expression of specific claudin isoforms: Protective effect of illite mineral clay.

    PubMed

    Romero, Alejandro; Ares, Irma; Ramos, Eva; Castellano, Víctor; Martínez, Marta; Martínez-Larrañaga, María-Rosa; Anadón, Arturo; Martínez, María-Aránzazu

    2016-04-15

    Aflatoxin B1 (AFB1), fumonisin B1 (FB1), ochratoxin A (OTA) and T-2 toxin (T2) are mycotoxins that commonly contaminate the food chain and cause various toxicological effects. Their global occurrence is regarded as an important risk factor for human and animal health. In this study, the results demonstrate that, in human Caco-2 cells, AFB1, FB1, OTA and T2 origin cytotoxic effects, determining cell viability through MTT assay and LDH leakage, and decrease trans-epithelial electrical resistance (TEER). The decrease in barrier properties is concomitant with a reduction in the expression levels of the tight junction constituents claudin-3, claudin-4 and occludin. The protective effect of mineral clays (diosmectite, montmorillonite and illite) on alterations in cell viability and epithelial barrier function induced by the mycotoxins was also evaluated. Illite was the best clay to prevent the mycotoxin effects. Illite plus mycotoxin co-treatment completely abolished AFB1 and FB1-induced cytotoxicity. Also, the decreases in the gene expression of claudins and the reduction of TEER induced by mycotoxins were reversed by the illite plus mycotoxin co-treatment. In conclusion, these results demonstrated that mycotoxins AFB1, FB1, T2 and OTA disrupt the intestinal barrier permeability by a mechanism involving reduction of claudin isoform expressions, and illite counteracts this disruption. PMID:27153755

  19. The mitochondrial and death receptor pathways involved in the thymocytes apoptosis induced by aflatoxin B1

    PubMed Central

    Chi, Xiaofeng; Li, Xiaochong; Jiang, Min; Fang, Jing; Cui, Hengmin; Lai, Weimin; Zhou, Yi; Zhou, Shan

    2016-01-01

    Aflatoxin B1 (AFB1) is a potent immunosuppressive agent in endotherms, which can be related to the up-regulated apoptosis of immune organs. In this study, we investigated the roles of the mitochondrial, death receptor, and endoplasmic reticulum pathways in Aflatoxin B1 induced thymocytes apoptosis. Chickens were fed an aflatoxin B1 containing diet (0.6 mg/kg AFB1) for 3 weeks. Our results showed that (1) AFB1 diet induced the decrease of T-cell subsets, morphological changes, and excessive apoptosis of thymus. (2) The excessive apoptosis involved the mitochondrial pathway (up-regulation of Bax, Bak, cytC and down-regulation of Bcl-2 and Bcl-xL) and death receptor pathway (up-regulation of FasL, Fas and FADD). (3) Oxidative stress, an apoptosis inducer, was confirmed in the thymus. In conclusion, this is the first study to demonstrate that mitochondrial and death receptor pathways involved in AFB1 induced thymocytes apoptosis in broilers. PMID:26933817

  20. A graphene field effect capacitive Immunosensor for sub-femtomolar food toxin detection.

    PubMed

    Basu, J; Datta, S; RoyChaudhuri, C

    2015-06-15

    In this paper we report the sensing of aflatoxin B1(AFB1) by field effect capacitive method using electrophoretically deposited reduced graphene oxide (RGO) films for the first time. The RGO film has been characterized using SEM, surface profilometer and Raman spectroscopy. It has been observed that both quantum capacitance of RGO (Cq) and effective electrical double layer capacitance (C(EDL)) contribute significantly towards the overall sensitivity for molar concentration in the range of 20-50 mM. As Cq and CEDL changes in opposite direction after AFB1 capture and the nature of frequency dependence of Cq and CEDL are different, the sensitivity shows a minima at a particular frequency. Interestingly, the sensitivity minima is also dependent on AFB1 concentration. Further, the maximum sensitivity obtained is around 30% for 10(-4) ppt (0.1 fg/ml) AFB1 which is greater than 1.5 times that of previous reports. This has been possible through the enhanced biomolecule immobilization capability of RGO. Thus the RGO based field effect capacitive sensor provides a combined advantage of both a high sensitivity and concentration dependent frequency behavior. PMID:25638796

  1. A fungal enzyme with the ability of aflatoxin B₁ conversion: purification and ESI-MS/MS identification.

    PubMed

    Cao, Hong; Liu, Daling; Mo, Xuemei; Xie, Chunfang; Yao, Dongsheng

    2011-09-20

    Armillariella tabescens, a Chinese edible and medicinal fungus, whose multienzyme exist ability of AFB(1)-converting, and ADTZ (aflatoxin-detoxizyme) had previously purified from the A. tabescens multienzyme monitored by AFB(1) conversion(.) However, the enzyme now confirmed an oxidase and renamed aflatoxin-oxidase (AFO). In this paper, AFO was purified by an economical and practical three-step procedure monitored by AFB(1) conversion. And ESI-MS/MS analysis was done for identification of AFO. The following database searching (Protein Blast on NCBI) results did not show any homologous oxidase protein, which implied that AFO was mostly a new oxidase differing from other reported aflatoxin-converting enzymes such as fungal laccase and horse radish peroxidase. HPTLC analysis of the purified AFO activity suggested that the enzyme reacted at the bisfuran ring of AFB(1) which was the key toxic structure. Therefore, all these investigations implied a new choice for biodegradation of aflatoxin in foods and feeds with the practical application of AFO. PMID:21239152

  2. Characterization of toxigenic and atoxigenic Aspergillus flavus isolates from pistachio

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thirty eight Aspergillus flavus isolates collected from a pistachio orchard in California were analyzed for production of aflatoxin (AF), cyclopiazonic acid (CPA), vegetative compatibility groups (VCGs) and mating types. All toxigenic isolates produced both AFB1 and CPA. Twenty-one percent of the i...

  3. In vitro and in vivo temperature modulation of hepatic metabolism and DNA adduction of aflatoxin B1 in rainbow trout.

    PubMed

    Carpenter, H M; Zhang, Q; el Zahr, C; Selivonchick, D P; Brock, D E; Curtis, L R

    1995-02-01

    Alterations in membrane lipid composition during temperature acclimation of poikilotherms is hypothesized to compensate for direct effects of temperature on membrane fluidity. Temperature also influences disposition and actions of some xenobiotics. This suggests the potential for complex interactions between temperature and metabolism of chemical carcinogens. Whole livers and hepatic microsomes from rainbow trout acclimated at 18 degrees C have more saturated fatty acids and less mono- and polyunsaturated fatty acids than those from fish acclimated at 10 degrees C. Such changes are consistent with a role for membrane lipid fluidity in temperature compensation. When 10 and 18 degrees C acclimated fish are ip injected with 0.4 mg/kg [3H]aflatoxin B1 (AFB1) at their respective acclimation temperatures, hepatic disposition of AFB1, DNA adduction, and biliary metabolites are similar. An acute shift of 18 degrees C acclimated trout to 14 degrees C reduces [3H]AFB-DNA adduct formation, while [3H]AFB1 adduction after acute shift of 10 degrees C acclimated fish to 14 degrees C is no different than in non-shifted fish. Hepatic microsomes isolated from 10 or 18 degrees C acclimated trout, incubated with 10 microM [3H]AFB1 and calf thymus DNA between 6 and 22 degrees C exhibit no differences in the "break points" of Arrhenius plots (16 degrees C in both groups). There is, however, more in vitro DNA adduction of [3H]AFB1 by microsomes from 18 degrees C acclimated fish, a difference abolished by 0.5 mM alpha-naphthoflavone (ANF). These results suggest that temperature acclimation of trout differentially modifies activities of cytochrome P-450 isozymes. When assayed at respective acclimation temperatures, hepatic cytosol from 18 degrees C fish produces more aflatoxicol, a detoxication product of AFB1, than cytosol from 10 degree C fish. Therefore, this soluble enzyme does not exhibit ideal temperature compensation. Such temperature-induced differences in microsomal cytochrome P

  4. Low-cost and highly sensitive immunosensing platform for aflatoxins using one-step competitive displacement reaction mode and portable glucometer-based detection.

    PubMed

    Tang, Dianping; Lin, Youxiu; Zhou, Qian; Lin, Yuping; Li, Peiwu; Niessner, Reinhard; Knopp, Dietmar

    2014-11-18

    Aflatoxins are highly toxic secondary metabolites produced by a number of different fungi and present in a wide range of food and feed commodities. Herein, we designed a simple and low-cost immunosensing platform for highly sensitive detection of mycotoxins (aflatoxin B1, AFB1, used as a model) on polyethylenimine (PEI)-coated mesoporous silica nanocontainers (PEI-MSN). The assay was carried out by using a portable personal glucometer (PGM) as the readout based on a competitive displacement reaction mode between target AFB1 and its pseudo-hapten (PEI-MSN) for monoclonal anti-AFB1 antibody (mAb). To construct such an assay protocol, two nanostructures including mAb-labeled gold nanoparticle (mAb-AuNP) and PEI-MSN were initially synthesized, and then numerous glucose molecules were gated into the pores based on the interaction between negatively charged mAb-AuNP and positively charged PEI-MSN. In the presence of target AFB1, a competitive-type displacement reaction was implemented between mAb-AuNP and PEI-MSN by target AFB1 through the specific antigen-antibody reaction. Accompanying the reaction, target AFB1 could displace the mAb-AuNP from the surface of PEI-MSN, resulting in the release of the loading glucose from the pores due to the gate opened. The released glucose molecules could be quantitatively determined by using a portable PGM. Under optimal conditions, the PGM signal increased with the increment of AFB1 concentration in the range from 0.01 to 15 μg/kg (ppb) with a detection limit (LOD) of 5 ng/kg (5 ppt) at the 3sblank criterion. The selectivity and precision were acceptable. Importantly, the methodology was further validated for assaying naturally contaminated or spiked blank peanut samples, and consistent results between the PGM-based immunoassay and the referenced enzyme-linked immunosorbent assay (ELISA) were obtained. Therefore, the developed immunoassay provides a promising approach for rapid screening of organic pollutants because it is simple

  5. Biodegradation of aflatoxin B1 in contaminated rice straw by Pleurotus ostreatus MTCC 142 and Pleurotus ostreatus GHBBF10 in the presence of metal salts and surfactants.

    PubMed

    Das, Arijit; Bhattacharya, Sourav; Palaniswamy, Muthusamy; Angayarkanni, Jayaraman

    2014-08-01

    Aflatoxin B1 (AFB1) is a highly toxic fungal metabolite having carcinogenic, mutagenic and teratogenic effects on human and animal health. Accidental feeding of aflatoxin-contaminated rice straw may be detrimental for ruminant livestock and can lead to transmission of this toxin or its metabolites into the milk of dairy cattle. White-rot basidiomycetous fungus Pleurotus ostreatus produces ligninolytic enzymes like laccase and manganese peroxidase (MnP). These extracellular enzymes have been reported to degrade many environmentally hazardous compounds. The present study examines the ability of P. ostreatus strains to degrade AFB1 in rice straw in the presence of metal salts and surfactants. Laccase and MnP activities were determined spectrophotometrically. The efficiency of AFB1 degradation was evaluated by high performance liquid chromatography. Highest degradation was recorded for both P. ostreatus MTCC 142 (89.14 %) and P. ostreatus GHBBF10 (91.76 %) at 0.5 µg mL(-1) initial concentration of AFB1. Enhanced degradation was noted for P. ostreatus MTCC 142 in the presence of Cu(2+) and Triton X-100, at toxin concentration of 5 µg mL(-1). P. ostreatus GHBBF10 showed highest degradation in the presence of Zn(2+) and Tween 80. Liquid chromatography-mass spectrometric analysis revealed the formation of hydrated, decarbonylated and O-dealkylated products. The present findings suggested that supplementation of AFB1-contaminated rice straw by certain metal salts and surfactants can improve the enzymatic degradation of this mycotoxin by P. ostreatus strains. PMID:24770873

  6. Effect of Aflatoxin B1 on Growth of Bovine Mammary Epithelial Cells in 3D and Monolayer Culture System

    PubMed Central

    Forouharmehr, Ali; Harkinezhad, Taher; Qasemi-Panahi, Babak

    2013-01-01

    Purpose: Many studies have been showed transfer of aflatoxins, toxins produced by Aspergillus flvaus and Aspergillus parasiticus fungi, into milk. These toxins are transferred into the milk through digestive system by eating contaminated food. Due to the toxicity of these materials, it seems that it has side effects on the growth of mammary cells. Therefore, the present work aimed to investigate possible toxic effects of aflatoxin B1 (AFB1) on bovine mammary epithelial cells in monolayer and three-dimensional cultures. Methods: Specimens of the mammary tissue of bovine were sized out in size 2×2 cm in slaughterhouse. After disinfection and washing in sterile PBS, primary cell culture was performed by enzymatic digestion of tissue with collagenase. When proper numbers of cells were achieved in monolayer culture, cells were seeded in a 24-well culture plate for three-dimensional (3D) culture in Matrigel matrix. After 21 days of 3D culture and reaching the required number of cells, the concentrations of 15, 25 and 35 µL of AFB1 were added to the culture in quadruplicate and incubated for 8 hours. Cellular cytotoxicity was examined using standard colorimetric assay and finally, any change in the morphology of the cells was studied by microscopic technique. Results: Microscopic investigations showed necrosis of the AFB1-exposed cells compared to the control cells. Also, bovine mammary epithelial cells were significantly affected by AFB1 in dose and time dependent manner in cell viability assays. Conclusion: According to the results, it seems that AFB1 can induce cytotoxicity and necrosis in bovine mammary epithelial cells. PMID:24312827

  7. Non-linear relationships between aflatoxin B₁ levels and the biological response of monkey kidney vero cells.

    PubMed

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel

    2013-08-01

    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B₁ (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  8. Silver Nanolabels-Assisted Ion-Exchange Reaction with CdTe Quantum Dots Mediated Exciton Trapping for Signal-On Photoelectrochemical Immunoassay of Mycotoxins.

    PubMed

    Lin, Youxiu; Zhou, Qian; Tang, Dianping; Niessner, Reinhard; Yang, Huanghao; Knopp, Dietmar

    2016-08-01

    Mycotoxins, highly toxic secondary metabolites produced by many invading species of filamentous fungi, contaminate different agricultural commodities under favorable temperature and humidity conditions. Herein, we successfully devised a novel signal-on photoelectrochemical immunosensing platform for the quantitative monitoring of mycotoxins (aflatoxin B1, AFB1, used as a model) in foodstuffs on the basis of silver nanolabels-assisted ion-exchange reaction with CdTe quantum dots (QDs) mediated hole-trapping. Initially, a competitive-type immunoreaction was carried out on a high-binding microplate by using silver nanoparticle (AgNP)-labeled AFB1-bovine serum albumin (AFB1-BSA) conjugates as the tags. Then, the carried AgNPs with AFB1-BSA were dissolved by acid to release numerous silver ions, which could induce ion-exchange reaction with the CdTe QDs immobilized on the electrode, thus resulting in formation of surface exciton trapping. Relative to pure CdTe QDs, the formed exciton trapping decreased the photocurrent of the modified electrode. In contrast, the detectable photocurrent increased with the increase of target AFB1 in a dynamic working range from 10 pg mL(-1) to 15 ng mL(-1) at a low limit of detection (LOD) of 3.0 pg mL(-1) under optimal conditions. In addition, the as-prepared photoelectrochemical immunosensing platform also displayed high specificity, good reproducibility, and acceptable method accuracy for detecting naturally contaminated/spiked blank peanut samples with consistent results obtained from the referenced enzyme-linked immunosorbent assay (ELISA) method. PMID:27348353

  9. Organophilic treatments of bentonite increase the adsorption of aflatoxin B1 and protect stem cells against cellular damage.

    PubMed

    Nones, Janaína; Nones, Jader; Poli, Anicleto; Trentin, Andrea Gonçalves; Riella, Humberto Gracher; Kuhnen, Nivaldo Cabral

    2016-09-01

    Bentonite clays exhibit high adsorptive capacity for contaminants, including aflatoxin B1 (AFB1), a mycotoxin responsible for causing severe toxicity in several species including pigs, poultry and man. Organophilic treatments is known to increase the adsorption capacity of bentonites, and the primary aim of this study was to evaluate the ability of Brazilian bentonite and two organic salts - benzalkonium chloride (BAC) and cetyltrimethylammonium bromide (CTAB) to adsorb AFB1. For this end, 2(2) factorial designs were used in order to analyze if BAC or CTAB was able to increase AFB1 adsorption when submitted in different temperature and concentration. Both BAC and CTAB treatment (at 30°C and 2% of salt concentration) were found to increase the adsorption of AFB1 significantly compared with untreated bentonite. After organophilic bentonite treatments with BAC or CTAB, a vibration of CH stretch (2850 and 2920cm(-1)) were detected. A frequency of the SiO stretch (1020 and 1090cm(-1)) was changed by intercalation of organic cation. Furthermore, the interlayer spacing of bentonite increases to 1.23nm (d001 reflection at 2θ=7.16) and 1.22 (d001 reflection at 2θ=7.22) after the addition of BAC and CTAB, respectively. Another aim of the study was to observe the effects of these two bentonite salts in neural crest stem cell cultures. The two materials that were created by organophilic treatments were not found to be toxic to stem cells. Furthermore the results indicate that the two materials tested may protect the neural crest stem cells against damage caused by AFB1. PMID:27281241

  10. Comparative Measurement of In Vitro Paraquat and Aflatoxin B1 Cytotoxicity Using Three Different Cytotoxicity Assays in Pheochromocytoma Cells (PC-12).

    PubMed

    Mohammadi-Bardbori, Afshin; Nejati, Majid; Esmaeili, Jamileh; Ghafari, Homanaz; Ghazi-Khansari, Mahmoud

    2008-01-01

    ABSTRACT Among the herbicides and mycotoxins, paraquat (PQ) and aflatoxin B1 (AFB1) are highly cytotoxic. In this study the toxicity of PQ and AFB1 in the cultured cell were determined using MTT [3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide], JG-B (Janus green B), and NR (neutral red) assay by multiwell scanning spectophotometry. JG-B was used not only for the vital staining of mitochondria but also for viability assay and was compared to MTT and NR assay. Various concentrations of paraquat (0.1 mM to 100 mM) and AFB1 (0.001 nM to 10 nM) on the PC-12 cells were investigated. The 50% lethal concentration of toxins (LC50) were determined for PQ (7.70 +/- 2.50, 3.67 +/- 1.53, 4.85 +/- 2.44) and AFB1 (0.16 +/- 0.01, 0.13 +/- 0.04, 0.14 +/- 0.02) as determined by these methods (JG-B, NR, and MTT, respectively). A significant correlation was found among the JG-B and MTT using PQ (r(2) = 0.99, p < 0.05) and significant correlation was also found among the three methods (r(2) = 0.95, 0.93, and 0.92, p < 0.05) using AFB1. No significant correlation was found between JG-B and MTT with NR (r(2) = 0.34 and 0.35, p < 0.05, respectively) using PQ. These results suggest that both methods (MTT assay and JG-B assay) are reliable and are comparable for determining the cytotoxicity. It is concluded that the JG-B assay may be preferable to MTT assay methods because of its simplicity, low cost, sensitivity, and objectivity; in addition, this method takes little time to be done. PMID:20020925

  11. Carry-over of aflatoxin B1 to aflatoxin M1 in high yielding Israeli cows in mid- and late-lactation.

    PubMed

    Britzi, Malka; Friedman, Shmulik; Miron, Joshua; Solomon, Ran; Cuneah, Olga; Shimshoni, Jakob A; Soback, Stefan; Ashkenazi, Rina; Armer, Sima; Shlosberg, Alan

    2013-01-01

    The potent hepatotoxin and carcinogen aflatoxin B1 (AFB1) is a common mycotoxin contaminant of grains used in animal feeds. Aflatoxin M1 (AFM1) is the major metabolite of AFB1 in mammals, being partially excreted into milk, and is a possible human carcinogen. The maximum permitted concentration of AFM1 in cows' milk is 0.05 μg/kg in Israel and the European Union. Since milk yield and the carry-over of AFB1 in the feed to AFM1 in the milk are highly correlated, it was considered important to determine the AFM1 carry-over in Israeli-Holstein dairy cows, distinguished by world record high milk production. Twelve such cows were used to determine AFM1 carry-over following daily oral administration of feed containing ~86 μg AFB1 for 7 days. The mean carry-over rate at steady-state (Days 3-7) was 5.8% and 2.5% in mid-lactation and late-lactation groups, respectively. The carry-over appears to increase exponentially with milk yield and could be described by the equation: carry-over% = 0.5154 e(0.0521 × milk yield), with r(2) = 0.6224. If these data truly reflect the carry-over in the national Israeli dairy herd, the maximum level of AFB1 in feed should not exceed 1.4 μg/kg, a value 3.6 times lower than the maximum residue level currently applied in Israel. PMID:23325299

  12. Deciphering the Anti-Aflatoxinogenic Properties of Eugenol Using a Large-Scale q-PCR Approach

    PubMed Central

    Caceres, Isaura; El Khoury, Rhoda; Medina, Ángel; Lippi, Yannick; Naylies, Claire; Atoui, Ali; El Khoury, André; Oswald, Isabelle P.; Bailly, Jean-Denis; Puel, Olivier

    2016-01-01

    Produced by several species of Aspergillus, Aflatoxin B1 (AFB1) is a carcinogenic mycotoxin contaminating many crops worldwide. The utilization of fungicides is currently one of the most common methods; nevertheless, their use is not environmentally or economically sound. Thus, the use of natural compounds able to block aflatoxinogenesis could represent an alternative strategy to limit food and feed contamination. For instance, eugenol, a 4-allyl-2-methoxyphenol present in many essential oils, has been identified as an anti-aflatoxin molecule. However, its precise mechanism of action has yet to be clarified. The production of AFB1 is associated with the expression of a 70 kB cluster, and not less than 21 enzymatic reactions are necessary for its production. Based on former empirical data, a molecular tool composed of 60 genes targeting 27 genes of aflatoxin B1 cluster and 33 genes encoding the main regulatory factors potentially involved in its production, was developed. We showed that AFB1 inhibition in Aspergillus flavus following eugenol addition at 0.5 mM in a Malt Extract Agar (MEA) medium resulted in a complete inhibition of the expression of all but one gene of the AFB1 biosynthesis cluster. This transcriptomic effect followed a down-regulation of the complex composed by the two internal regulatory factors, AflR and AflS. This phenomenon was also influenced by an over-expression of veA and mtfA, two genes that are directly linked to AFB1 cluster regulation. PMID:27128940

  13. Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

    PubMed Central

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel

    2013-01-01

    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  14. Are the Genes nadA and norB Involved in Formation of Aflatoxin G1?

    PubMed Central

    Ehrlich, Kenneth C.; Scharfenstein, Leslie L.; Montalbano, Beverly G.; Chang, Perng-Kuang

    2008-01-01

    Aflatoxins, the most toxic and carcinogenic family of fungal secondary metabolites, are frequent contaminants of foods intended for human consumption. Previous studies showed that formation of G-group aflatoxins (AFs) from O-methylsterigmatocystin (OMST) by certain Aspergillus species involves oxidation by the cytochrome P450 monooxygenases, OrdA (AflQ) and CypA (AflU). However, some of the steps in the conversion have not yet been fully defined. Extracts of Aspergillus parasiticus disruption mutants of the OYE-FMN binding domain reductase-encoding gene nadA (aflY) contained a 386 Da AFG1 precursor. A compound with this mass was predicted as the product of sequential OrdA and CypA oxidation of OMST. Increased amounts of a 362 Da alcohol, the presumptive product of NadA reduction, accumulate in extracts of fungi with disrupted aryl alcohol dehydrogenase-encoding gene norB. These results show that biosynthesis of AFG1 involves NadA reduction and NorB oxidation. PMID:19325828

  15. Polymorphisms in the precursor microRNAs and aflatoxin B1-related hepatocellular carcinoma.

    PubMed

    Long, Xi-Dai; Huang, Xiao-Ying; Yao, Jin-Guang; Liao, Pinhu; Tang, Yu-Jin; Ma, Yun; Xia, Qiang

    2016-06-01

    The altered expression of some microRNAs (miRNAs) is observed in hepatocellular carcinoma (HCC); however, the genetic polymorphisms in the precursor miRNAs (pre-miRNAs) in aflatoxin B1 (AFB1)-related HCC have not yet been investigated. A hospital-based case-control study, including 1,706 HCC cases and 2,270 controls without any liver diseases or tumors, was conducted in a high AFB1 exposure area of China to assess the relationship between 48 polymorphisms in the pre-miRNAs and AFB1-related HCC risk and prognosis. Among 48 polymorphisms, only rs28599926 (in the miRNA 1268a) affected HCC risk. Compared with the homozygote of rs28599926C alleles (rs28599926-CC), the genotypes of rs28599926 T alleles (namely rs28599926-CT or -TT) increased HCC risk (odds ratio [OR]: 1.63 and 5.52, 95% confidence interval [CI]: 1.40-1.90 and 4.27-7.14, respectively). Significant interactive effects between risk genotypes and AFB1 exposure status were also observed in the joint effects analysis. This polymorphism was associated not only with larger tumor size, higher portal vein tumor risk, and tumor dedifferentiation, but also with higher AFB1 adducts levels and increasing the mutation risk of TP53 gene. Furthermore, rs28599926 modified the tumor recurrence-free survival (hazard ratio [HR]: 2.86, 95% CI: 2.36-3.43) and overall survival (HR: 2.12, 95% CI: 1.86-2.41) of cases. Additionally, one target of miR-1268a was show to be the ADAMTS4 mRNA and rs28599926 polymorphism might modify ADAMTS4 expression. These findings indicate that polymorphisms in the pre-miRNAs may be risk and prognostic biomarkers of AFB1-related HCC, and rs28599926 in miR-1268a is such a potential candidate. © 2015 Wiley Periodicals, Inc. PMID:26152337

  16. Alpha-class glutathione S-transferases in wild turkeys (Meleagris gallopavo): characterization and role in resistance to the carcinogenic mycotoxin aflatoxin B1.

    PubMed

    Kim, Ji Eun; Bunderson, Brett R; Croasdell, Amanda; Reed, Kent M; Coulombe, Roger A

    2013-01-01

    Domestic turkeys (Meleagris gallopavo) are one of the most susceptible animals known to the toxic effects of the mycotoxin aflatoxin B1 (AFB1), a potent human hepatocarcinogen, and universal maize contaminant. We have demonstrated that such susceptibility is associated with the inability of hepatic glutathione S-transferases (GSTs) to detoxify the reactive electrophilic metabolite exo-AFB1-8,9-epoxide (AFBO). Unlike their domestic counterparts, wild turkeys, which are relatively AFB1-resistant, possess hepatic GST-mediated AFBO conjugating activity. Here, we characterized the molecular and functional properties of hepatic alpha-class GSTs (GSTAs) from wild and domestic turkeys to shed light on the differences in resistance between these closely related strains. Six alpha-class GST genes (GSTA) amplified from wild turkeys (Eastern and Rio Grande subspecies), heritage breed turkeys (Royal Palm) and modern domestic (Nicholas strain) turkeys were sequenced, and catalytic activities of heterologously-expressed recombinant enzymes determined. Alpha-class identity was affirmed by conserved GST domains and four signature motifs. All GSTAs contained single nucleotide polymorphisms (SNPs) in their coding regions: GSTA1.1 (5 SNPs), GSTA1.2 (7), GSTA1.3 (3), GSTA2 (3), GSTA3 (1) and GSTA4 (2). E. coli-expressed GSTAs possessed varying activities toward GST substrates 1-chloro-2,4-dinitrobenzene (CDNB), 1,2-dichloro-4-nitrobenzene (DCNB), ethacrynic acid (ECA), cumene hydroperoxide (CHP). As predicted by their relative resistance, livers from domestic turkeys lacked detectable GST-mediated AFBO detoxification activity, whereas those from wild and heritage birds possessed this critical activity, suggesting that intensive breeding and selection resulted in loss of AFB1-protective alleles during domestication. Our observation that recombinant tGSTAs detoxify AFBO, whereas their hepatic forms do not, implies that the hepatic forms of these enzymes are down-regulated, silenced, or

  17. DNA Sequence Modulates Geometrical Isomerism of the trans-8,9-Dihydro-8-(2,6-diamino-4-oxo-3,4-dihydropyrimid-5-yl-formamido)-9-hydroxy Aflatoxin B1 Adduct

    PubMed Central

    2016-01-01

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus, is oxidized by cytochrome P450 enzymes to aflatoxin B1-8,9-epoxide, which alkylates DNA at N7-dG. Under basic conditions, this N7-dG adduct rearranges to yield the trans-8,9-dihydro-8-(2,6-diamino-4-oxo-3,4-dihydropyrimid-5-yl-formamido)-9-hydroxy aflatoxin B1 (AFB1–FAPY) adduct. The AFB1–FAPY adduct exhibits geometrical isomerism involving the formamide moiety. NMR analyses of duplex oligodeoxynucleotides containing the 5′-XA-3′, 5′-XC-3′, 5′-XT-3′, and 5′-XY-3′ sequences (X = AFB1–FAPY; Y = 7-deaza-dG) demonstrate that the equilibrium between E and Z isomers is controlled by major groove hydrogen bonding interactions. Structural analysis of the adduct in the 5′-XA-3′ sequence indicates the preference of the E isomer of the formamide group, attributed to formation of a hydrogen bond between the formyl oxygen and the N6 exocyclic amino group of the 3′-neighbor adenine. While the 5′-XA-3′ sequence exhibits the E isomer, the 5′-XC-3′ sequence exhibits a 7:3 E:Z ratio at equilibrium at 283 K. The E isomer is favored by a hydrogen bond between the formyl oxygen and the N4-dC exocyclic amino group of the 3′-neighbor cytosine. The 5′-XT-3′ and 5′-XY-3′ sequences cannot form such a hydrogen bond between the formyl oxygen and the 3′-neighbor T or Y, respectively, and in these sequence contexts the Z isomer is favored. Additional equilibria between α and β anomers and the potential to exhibit atropisomers about the C5–N5 bond do not depend upon sequence. In each of the four DNA sequences, the AFB1–FAPY adduct maintains the β deoxyribose configuration. Each of these four sequences feature the atropisomer of the AFB1 moiety that is intercalated above the 5′-face of the damaged guanine. This enforces the Ra axial conformation for the C5–N5 bond. PMID:25587868

  18. Effects of 3 sequestering agents on milk aflatoxin M1 concentration and the performance and immune status of dairy cows fed diets artificially contaminated with aflatoxin B1.

    PubMed

    Ogunade, I M; Arriola, K G; Jiang, Y; Driver, J P; Staples, C R; Adesogan, A T

    2016-08-01

    This study examined whether adding 3 mycotoxin-sequestering agents to diets contaminated with aflatoxin B1 (AFB1) would reduce milk aflatoxin M1 (AFM1) concentration, and improve the performance and alter immune status of dairy cows. Fifteen lactating dairy cows were used in an experiment with an incomplete crossover design including four 28-d periods. Treatments included a control diet (C), a toxin diet (T; 1,725µg of AFB1/head per day; 75µg/kg), and diets containing the toxin and 20g/head per day of a proprietary mixture of Saccharomyces cerevisiae fermentation product containing a low (SEQ1) or high (SEQ2) dose of a chlorophyll-based additive, or a low dose of the chlorophyll-based additive and sodium bentonite clay (SEQ3). Sequestering agents were top-dressed on the total mixed ration (TMR) daily in each period, and AFB1 was dosed orally in gelatin capsules before the TMR was fed on d 21 to 25. Milk was sampled twice daily on d 20 to 28 and plasma was sampled on d 20 and 25. Sequestering agents did not affect milk AFM1 concentration during the toxin-dosing period. However, after AFB1 was withdrawn, the sequestering agents reduced the time required (24 vs. 48h) to reduce the milk AFM1 concentration below the Food and Drug Administration action level of 0.5µg/kg. Feeding T instead of C tended to reduce milk and fat-corrected milk yields, but feeding SEQ1 prevented these effects. Red blood cell count and hemoglobin concentration were reduced by feeding T instead of C, but not by feeding SEQ1, SEQ2, or SEQ3. The mean fluorescence intensity of antibody staining for 2 leukocyte adhesion molecules, L-selectin (CD62L) and β-integrin (CD18), tended to be greatest when SEQ1 and SEQ3 were fed. Plasma acid-soluble protein concentration was decreased by feeding SEQ1, SEQ2, and SEQ3 instead of T. Sequestering agents had no effect on milk AFM1 concentration, but they reduced the time required to reduce milk AFM1 concentration to a safe level after withdrawal of AFB1 from

  19. Phytic Acid Exposure Alters AflatoxinB1-induced Reproductive and Oxidative Toxicity in Albino Rats (Rattus norvegicus)

    PubMed Central

    Abu El-Saad, Abdelaziz S.

    2009-01-01

    The increased use of feed in Egypt's aquaculture and animal industries raises concerns about the possible presence of mycotoxins in feedstuffs. The use of alternative medicine, such as botanicals and nutritional supplements, has become popular with inflammatory cases. The present study aimed to testify the role played by phytic acid (IP6) in enhancing the reproductive and oxidative toxicity induced in aflatoxinB1 (AFB1) treated white male albino rats (Rattus norvegicus) throughout treatment and withdrawal periods. One hundred and twenty white male albino rats were grouped into four groups. Group 1, was injected with 300 μg kg−1 body wt of AFB1 once every 3 days for 15 days and left uninjected for another 15 days to study the withdrawal effect. Group 2, was injected with 300 μg kg−1 body wt of AFB1 once every 3 days for 15 days and treated simultaneously with IP6 daily for another 15 days. Group 3, was treated daily with IP6 (40 mg kg−1 body wt) for 15 days and with no treatment for other 15 days. Group 4, injected with equivalent volume of sterile phosphate buffer saline solution as a control group. Sera were taken at the experimental intervals and assayed for testosterone hormone, follicular-stimulating hormone (FSH) and luteinizing hormone (LH) to determine the toxicological impact of AFB1 and the possibility of amelioration by phytic acid on the reproductive performance of the studied animal. The effects of AFB1 treatment on the absolute and relative weight of testis as well as its histopathologic effect on the testis and the possibility of amelioration by IP6 treatment were evaluated. The activities of enzymatic and non-enzymatic anti-oxidants, in addition to lipid peroxidation were measured in the testis’ homogenate of AFB1-treated rats. A decrease in sex hormone levels, an increase in testicular lipid peroxidation product levels and a significant decrease in testicular glutathione content, catalase and total peroxidase and superoxide dismutase

  20. Toxicity of increasing aflatoxin B1 concentrations from contaminated corn with or without clay adsorbent supplementation in ducklings.

    PubMed

    Wan, X L; Yang, Z B; Yang, W R; Jiang, S Z; Zhang, G G; Johnston, S L; Chi, F

    2013-05-01

    A total of 1,280 1-d-old ducks were used in a study to investigate the effects of increasing aflatoxin B1 (AFB1) concentrations from naturally contaminated corn on young ducklings, and the effectiveness of a clay adsorbent (CA) to protect against those effects. Ducks were randomly allotted to 8 treatments (TRT) in a 4 × 2 factorial arrangement with 4 levels of AFB1 (0, 25, 50, and 100 μg/kg) and 2 levels of CA (0 and 0.1%) with 8 pens per TRT and 20 ducks per pen. All ducks were allowed ad libitum access to feed and water during the 21-d experiment. The ADG, ADFI, feed conversion rate, mortality, bill color, and CV of BW of each replicate were measured at the end of the study. Blood and tissue samples from 8 ducks per TRT were obtained on d 21 of the experiment to determine the serum immunoglobulin and protein concentrations, relative organ weights, and intestinal morphology. Average daily gain and relative weights of the liver, spleen, thymus, and bursa of Fabricius decreased linearly (P < 0.05) as dietary AFB1 increased. Serum proteins and intestinal villi heights and villus/crypt ratio followed the same pattern. Bill decolorization ratio, CV of BW, and mortality increased linearly (P < 0.05) as dietary AFB1 increased. Adding 0.1% CA to the diet improved (P < 0.05) the relative weights of the small intestine, spleen, and thymus, and the villus height and villus/crypt ratio of the duodenum and jejunum, as well as the serum IgG and IgM concentrations. Adding CA also reduced (P < 0.05) bill decolorization ratio, CV of BW, mortality, and serum IgA concentration. Therefore, duck performance was negatively affected by increasing AFB1 concentrations in diets. But the addition of 0.1% CA can protect against the detrimental effects caused by AFB1-contaminated corn in diets for ducks. PMID:23571334

  1. Effect of temperature and water activity on gene expression and aflatoxin biosynthesis in Aspergillus flavus on almond medium.

    PubMed

    Gallo, Antonia; Solfrizzo, Michele; Epifani, Filomena; Panzarini, Giuseppe; Perrone, Giancarlo

    2016-01-18

    Almonds are among the commodities at risk of aflatoxin contamination by Aspergillus flavus. Temperature and water activity are the two key determinants in pre and post-harvest environments influencing both the rate of fungal spoilage and aflatoxin production. Varying the combination of these parameters can completely inhibit or fully activate the biosynthesis of aflatoxin, so it is fundamental to know which combinations can control or be conducive to aflatoxin contamination. Little information is available about the influence of these parameters on aflatoxin production on almonds. The objective of this study was to determine the influence of different combinations of temperature (20 °C, 28 °C, and 37 °C) and water activity (0.90, 0.93, 0.96, 0.99 aw) on growth, aflatoxin B1 (AFB1) production and expression of the two regulatory genes, aflR and aflS, and two structural genes, aflD and aflO, of the aflatoxin biosynthetic cluster in A. flavus grown on an almond medium solidified with agar. Maximum accumulation of fungal biomass and AFB1 production was obtained at 28 °C and 0.96 aw; no fungal growth and AFB1 production were observed at 20 °C at the driest tested conditions (0.90 and 0.93 aw). At 20° and 37 °C AFB1 production was 70-90% lower or completely suppressed, depending on aw. Reverse transcriptase quantitative PCR showed that the two regulatory genes (aflR and aflS) were highly expressed at maximum (28 °C) and minimum (20 °C and 37 °C) AFB1 production. Conversely the two structural genes (aflD and aflO) were highly expressed only at maximum AFB1 production (28 °C and 0.96-0.99 aw). It seems that temperature acts as a key factor influencing aflatoxin production which is strictly correlated to the induction of expression of structural biosynthesis genes (aflD and aflO), but not to that of aflatoxin regulatory genes (aflR and aflS), whose functional products are most likely subordinated to other regulatory processes acting at post-translational level

  2. Screening antimutagenic and antiproliferative properties of extracts isolated from Jackfruit pulp (Artocarpus heterophyllus Lam).

    PubMed

    Ruiz-Montañez, G; Burgos-Hernández, A; Calderón-Santoyo, M; López-Saiz, C M; Velázquez-Contreras, C A; Navarro-Ocaña, A; Ragazzo-Sánchez, J A

    2015-05-15

    The present focused on the study of the antimutagenic and antiproliferative potential of pulp Jackfruit (Artocarpus heterophyllus Lam) extract, using Salmonella typhimurium tester strains TA98 and TA100 with metabolic activation (S9) and a cancer cell line M12.C3.F6 (murine B-cell lymphoma), respectively. Jackfruit pulp extract was sequentially fractionated by chromatography (RP-HPLC) and each fraction was tested for antimutagenic and antiproliferative activities. The organic extracts obtained from Jackfruit pulp reduced the number of revertants caused by aflatoxin B1 (AFB1) and proliferation of cells M12.C3.F6; a dose-response relationship was showed. Sequential RP-HPLC fractionation of the active extracts produced both antimutagenic and/or antiproliferative fractions. These results suggested that the Jackfruit contained compounds with chemoprotective properties to reduce the mutagenicity of AFB1, also proliferation of a cancer cell line. PMID:25577099

  3. Fungi and Mycotoxins from Pre- and Poststorage Brewer's Grain Intended for Bovine Intensive Rearing

    PubMed Central

    Keller, L. A. M.; Pereyra, C. M.; Cavaglieri, L. R.; Dalcero, A. M.; Rosa, C. A. R.

    2012-01-01

    The aim of the study was to determine the mycobiota and natural levels of mycotoxins such as aflatoxin B1 (AFB1), ochratoxin A (OTA), fumonisin B1 (FB1), and deoxynivalenol (DON) present in brewers grains pre- and poststored intended for bovine intensive rearing. Poststored (80%) samples had counts higher than 1 × 104 colony-forming units (CFU/g). Cladosporium spp. and Aspergillus spp. were isolated at high frequencies. Aspergillus flavus was the prevalent isolated species. Prestored (70%) and poststored (100%) samples showed AFB1 levels over the recommended limits (20 μg/Kg), and OTA levels were below the recommended limits (50 μg/Kg) while pre- and poststored samples did not show FB1 and DON natural contamination levels. The presence of mycotoxins in this substrate indicates the existence of contamination. Regular monitoring of feeds is required in order to prevent chronic and acute toxic syndromes related to this kind of contamination. PMID:23762582

  4. Effect of γ irradiation on fungal load and aflatoxins reduction in red chillies

    NASA Astrophysics Data System (ADS)

    Iqbal, Shahzad Zafar; Bhatti, Ijaz Ahmad; Asi, Muhammad Rafique; Zuber, Mohammad; Shahid, Muhammad; Parveen, Ishrat

    2013-01-01

    Chillies are a very important cash crop of Pakistan. The effects of gamma irradiation on microbial load, aflatoxin B1 (AFB1) and total aflatoxins have been studied in chillies samples, collected from different districts of Punjab, Pakistan. Aflatoxins were analyzed using HPLC equipped with a fluorescence detector. The results revealed that among the Aspergillus species isolated, those belonging to section parasiticus were predominant. Gamma radiations of doses 2, 4 and 6 kGy were employed on fungi and chilli samples. The results have demonstrated that the dose of 6 kGy reduced the fungal load by 5 logs. Furthermore, 6 kGy reduced the level of AFB1 and total AFs in ground and whole chillies by 1-2 logs (α < 0.05).

  5. Highly Sensitive Electrochemical Determination of Alfatoxin B1 Using Quantum Dots-Assembled Amplification Labels

    PubMed Central

    Zeng, Xiaoqun; Gao, Huiju; Pan, Daodong; Sun, Yangying; Cao, Jinxuan; Wu, Zhen; Pan, Zhenyu

    2015-01-01

    A competitive electrochemical immunoassay for highly sensitive detection of AFB1 is demonstrated using layer-by-layer (LBL) assembled quantum dots (QDs) as labels. To investigate the effects of the higher sensitivity of square wave voltammetric stripping (SWV) and of the LBL technique on the proposed immunoassays, the proposed assay was compared to electrochemical (EC) and fluorescent immunoassays, which did not use LBL technology. Peanut samples were analyzed using the three immunoassays. The limits of detection (LODs) were 0.018, 0.046 and 0.212 ng/mL, respectively, while the sensitivities were 0.308, 1.011 and 4.594 ng/mL, respectively. The proposed electrochemical immunoassay displayed a significant improvement in sensitivity, thereby providing a simple and sensitive alternative strategy for determining AFB1 levels in peanut samples. PMID:26307990

  6. Aflatoxins in retail food products in Bursa, Turkey.

    PubMed

    Günsen, Ugur; Büyükyörük, Ilhan

    2002-10-01

    Aflatoxin B1 (AFB1) in 25 cacao hazelnut cream and 15 dried apricot samples and aflatoxin M1 (AFM1) in 130 cheese samples (35 full fatty Turkish white cheeses, 35 fresh kashars, 25 old kashars, 20 Gravyer cheeses and 15 cream cheeses) randomly collected from traditional retail markets with insufFicient chilling facilities in Bursa, Turkey, were determined by ELISA. Mean AFB1 and AFM1 in the cacao hazelnut cream, dried apricot and cheese were 1,076.5 +/- 194.4 ng/kg, 1,441.3 +/- 331.9 ng/kg and 142.2 +/- 18.7 ng/kg, respectively; 15.45% of the cheese samples exceeded the Turkish AFM1 tolerance limit of 250 ng/kg. PMID:12361114

  7. Changes in moisture content, mycoflora and aflatoxin content of rice bran during storage.

    PubMed

    Jayaraman, P; Kalyanasundaram, I

    1994-05-01

    The changes in moisture content, storage mycoflora and aflatoxin B1 (AFB1) in bran from untreated or raw rice (Rr) and parboiled rice (Pbr) stored in small lots in polyethylene bags were studied at 15-day intervals up to 60 days, using five lots of each type of bran. Deterioration was more rapid with reference to all the three parameters, in Rr bran compared to Pbr bran, the former becoming completely overgrown and caked with fungi by the end of 60 days. Aspergillus flavus was the dominant fungus in Pbr bran, whereas A. candidus and Trichoderma viride were abundant in Rr bran. The frequency of incidence as well as concentration of AFB1 increased with storage time in both types of bran, but the rate of increase as well as overall concentration were much higher in Rr bran. Thus raw rice bran is unsuitable for prolonged storage. PMID:8065431

  8. Highly Sensitive Electrochemical Determination of Alfatoxin B1 Using Quantum Dots-Assembled Amplification Labels.

    PubMed

    Zeng, Xiaoqun; Gao, Huiju; Pan, Daodong; Sun, Yangying; Cao, Jinxuan; Wu, Zhen; Pan, Zhenyu

    2015-01-01

    A competitive electrochemical immunoassay for highly sensitive detection of AFB1 is demonstrated using layer-by-layer (LBL) assembled quantum dots (QDs) as labels. To investigate the effects of the higher sensitivity of square wave voltammetric stripping (SWV) and of the LBL technique on the proposed immunoassays, the proposed assay was compared to electrochemical (EC) and fluorescent immunoassays, which did not use LBL technology. Peanut samples were analyzed using the three immunoassays. The limits of detection (LODs) were 0.018, 0.046 and 0.212 ng/mL, respectively, while the sensitivities were 0.308, 1.011 and 4.594 ng/mL, respectively. The proposed electrochemical immunoassay displayed a significant improvement in sensitivity, thereby providing a simple and sensitive alternative strategy for determining AFB1 levels in peanut samples. PMID:26307990

  9. The origin of the Japanese race based on genetic markers of immunoglobulin G

    PubMed Central

    Matsumoto, Hideo

    2009-01-01

    This review addresses the distribution of genetic markers of immunoglobulin G (Gm) among 130 Mongoloid populations in the world. These markers allowed the populations to be clearly divided into 2 groups, the northern and southern groups. The northern group is characterized by high frequencies of 2 marker genes, ag and ab3st, and an extremely low frequency of the marker gene afb1b3; and the southern group, in contrast, is indicated by a remarkably high frequency of afb1b3 and low frequencies of ag and ab3st. Based on the geographical distribution of the markers and gene flow of Gm ag and ab3st (northern Mongoloid marker genes) from northeast Asia to the Japanese archipelago, the Japanese population belongs basically to the northern Mongoloid group and is thus suggested to have originated in northeast Asia, most likely in the Baikal area of Siberia. PMID:19212099

  10. Chromosome instability in human hepatocellular carcinoma depends on p53 status and aflatoxin exposure.

    PubMed

    Pineau, Pascal; Marchio, Agnès; Battiston, Carlo; Cordina, Emilie; Russo, Alessandro; Terris, Benoît; Qin, Lun-Xiu; Turlin, Bruno; Tang, Zhao-You; Mazzaferro, Vincenzo; Dejean, Anne

    2008-05-31

    Hepatocellular carcinoma (HCC) is a heterogeneous disease triggered by various risk factors and frequently characterized by chromosome instability. This instability is considered to be caused primarily by Hepatitis B virus (HBV), although aflatoxin B1 (AFB1), a potent fungal mutagen is also suspected to influence chromosomal repair. We studied 90 HCCs from Italy, the country with the highest incidence of hepatocellular carcinoma in Europe, 81 samples from France and 52 specimens from Shanghai, in a region where intake of AFB1 via the diet is known to be high. All 223 tumours were characterized for 15 different genomic targets, including allelic loss at 13 chromosome arms and mutations of beta-catenin and p53 genes. Despite disparity in risk-factor distribution, Italian and French cases did not significantly differ for 14 of the 15 targets tested. beta-Catenin and p53 displayed moderate and similar mutation rates (18-29% of cases) in European series. By contrast, tumours from Shanghai were significantly different, with a lower mutation rate for beta-catenin (4% vs. 26%, p<0.0003) and a higher mutation rate for p53 (48% vs. 22%, p<0.0001) when compared with tumours of European origin. The Arg249Ser mutation, hallmark of exposure to AFB1, represented half of the changes in p53 in Shanghai. Furthermore, when stratified for the presence of HBV or p53 mutations, chromosome instability was always higher in Chinese than in European patients. This difference was particularly strong in p53-wildtype tumours (fractional allelic loss, 29.4% vs. 16.7%, p<0.0001). We suggest that AFB1-associated mutagenesis represents a plausible cause for the higher chromosome instability observed in Chinese HCCs, when compared with European primary liver carcinomas. PMID:18467159

  11. High sensitive immunoassay for multiplex mycotoxin detection with photonic crystal microsphere suspension array.

    PubMed

    Deng, Guozhe; Xu, Kun; Sun, Yue; Chen, Yu; Zheng, Tiesong; Li, Jianlin

    2013-03-01

    A novel, sensitive, and high throughput competitive immunoassay for multiplex mycotoxins was established by immobilizing the artificial antigens (Ags) of mycotoxins on the surfaces of three kinds of silica photonic crystal microsphere (SPCM) suspension arrays. The SPCMs were encoded by their reflectance peak positions. Aflatoxin B1 (AFB1), fumonisin B1 (FB1), and citrinin (CIT) spiked in the cereals were extracted, and the fluorescein isothiocyanate (FITC) labeled antibodies (Abs) of these mycotoxins were added into the centrifuge tube which contained the SPCMs of the modified artificial antigens (Ags). The fluorescence signal was collected by an array fluorescent scanner. The limit of detection (LOD) was as low as 0.5, 1, and 0.8 pg/mL for AFB1, FB1, and CIT, respectively. The new method provided a wide linear detection range from 0.001 to 10, 0.001 to 10, and 0.001 to 1 ng/mL for AFB1, FB1, and CIT, respectively. The mean recovery rates are in range of 74.7 ± 4.0% to 127.9 ± 4.4% for the three mycotoxins in corn, peanuts, and wheat. The developed method for mycotoxins was used to assay the AFB1, FB1, and CIT level in 10 naturally contaminated cereal samples, and the results of detection were in agreement with that of a classic enzyme-linked immunosorbent assay (ELISA) method. This method saves a large amount of reagents (10 μL volume) and detection time (<3 h) for multiplex mycotoxin assay. PMID:23350906

  12. Induction of Nrf2-mediated cellular defenses and alteration of phase I activities as mechanisms of chemoprotective effects of coffee in the liver.

    PubMed

    Cavin, C; Marin-Kuan, M; Langouët, S; Bezençon, C; Guignard, G; Verguet, C; Piguet, D; Holzhäuser, D; Cornaz, R; Schilter, B

    2008-04-01

    Coffee consumption has been associated with a significant decrease in the risk of developing chronic diseases such as Parkinson disease, diabetes type-2 and several types of cancers (e.g. colon, liver). In the present study, a coffee-dependent induction of enzymes involved in xenobiotic detoxification processes was observed in rat liver and primary hepatocytes. In addition, coffee was found to induce the mRNA and protein expression of enzymes involved in cellular antioxidant defenses. These inductions were correlated with the activation of the Nrf2 transcription factor as shown using an ARE-reporter luciferase assay. The induction of detoxifying enzymes GSTs and AKR is compatible with a protection against both genotoxicity and cytotoxicity of aflatoxin B1 (AFB1). This hypothesis was confirmed in in vitro and ex vivo test systems, where coffee reduced both AFB1-DNA and protein adducts. Interestingly, coffee was also found to inhibit cytochrome CYP1A1/2, indicating that other mechanisms different from a stimulation of detoxification may also play a significant role in the chemoprotective effects of coffee. Further investigations in either human liver cell line and primary hepatocytes indicated that the chemoprotective effects of coffee against AFB1 genotoxicity are likely to be of relevance for humans. These data strongly suggest that coffee may protect against the adverse effects of AFB1. In addition, the coffee-mediated stimulation of the Nrf2-ARE pathway resulting in increased endogenous defense mechanisms against electrophilic but also oxidative insults further support that coffee may be associated with a protection against various types of chemical stresses. PMID:17976884

  13. Aflatoxin Toxicity Reduction in Feed by Enhanced Binding to Surface-Modified Clay Additives

    PubMed Central

    Jaynes, William F.; Zartman, Richard E.

    2011-01-01

    Animal feeding studies have demonstrated that clay additives, such as bentonites, can bind aflatoxins in ingested feed and reduce or eliminate the toxicity. Bentonite deposits are found throughout the world and mostly consist of expandable smectite minerals, such as montmorillonite. The surfaces of smectite minerals can be treated with organic compounds to create surface-modified clays that more readily bind some contaminants than the untreated clay. Montmorillonites treated with organic cations, such as hexadecyltrimethylammonium (HDTMA) and phenyltrimethylammonium (PTMA), more effectively remove organic contaminants, such as benzene and toluene, from water than untreated clay. Similarly, montmorillonite treated with PTMA (Kd = 24,100) retained more aflatoxin B1 (AfB1) from aqueous corn flour than untreated montmorillonite (Kd = 944). Feed additives that reduced aflatoxin toxicity in animal feeding studies adsorbed more AfB1 from aqueous corn flour than feed additives that were less effective. The organic cations HDTMA and PTMA are considered toxic and would not be suitable for clay additives used in feed or food, but other non-toxic or nutrient compounds can be used to prepare surface-modified clays. Montmorillonite (SWy) treated with choline (Kd = 13,800) and carnitine (Kd = 3960) adsorbed much more AfB1 from aqueous corn flour than the untreated clay (Kd = 944). A choline-treated clay prepared from a reduced-charge, high-charge montmorillonite (Kd = 20,100) adsorbed more AfB1 than the choline-treated high-charge montmorillonite (Kd = 1340) or the untreated montmorillonite (Kd = 293). Surface-modified clay additives prepared using low-charge smectites and nutrient or non-toxic organic compounds might be used to more effectively bind aflatoxins in contaminated feed or food and prevent toxicity. PMID:22069725

  14. Novel glucometer-based immunosensing strategy suitable for complex systems with signal amplification using surfactant-responsive cargo release from glucose-encapsulated liposome nanocarriers.

    PubMed

    Tang, Juan; Huang, Yapei; Liu, Huiqiong; Zhang, Cengceng; Tang, Dianping

    2016-05-15

    Methods based on surfactant-responsive controlled release systems of cargoes from nanocontainers have been developed for bioanalytical applications, but most were utilized for drug delivery and a few reports were focused on immunoassays. Herein we design an in situ amplified immunoassay protocol for high-efficient detection of aflatoxins (aflatoxin B1, AFB1 used in this case) based on surfactant-responsive cargo release from glucose-encapsulated liposome nanocarriers with sensitivity enhancement. Initially, biotinylated liposome nanocarrier encapsulated with glucose was synthesized using a reverse-phase evaporation method. Thereafter, the nanocarrier was utilized as the signal-generation tag on capture antibody-coating microplate through classical biotin-avidin linkage after reaction with biotinylated detection antibody. Upon addition of buffered surfactant (1X PBS-Tween 20 buffer) into the medium, the surfactant immediately hydrolyzed the conjugated liposome, and released the encapsulated glucose from the nanocarriers, which could be quantitatively determined by using a low-cost personal glucometer (PGM). The detectable signal increased with the increment of target analyte. Under the optimal conditions, the assay could allow PGM detection toward target AFB1 as low as 0.6 pg mL(-1) (0.6 ppt). Moreover, the methodology also showed good reproducibility and high specificity toward target AFB1 against other mycotoxins and proteins, and was applicable for quantitatively monitoring target AFB1 in the complex systems, e.g., naturally contaminated/spiked peanut samples and serum specimens, with the acceptable results. Taking these advantages of simplification, low cost, universality and sensitivity, our design provides a new horizon for development of advanced immunoassays in future point-of-care testing. PMID:26748368

  15. High content analysis: a sensitive tool to detect and quantify the cytotoxic, synergistic and antagonistic effects of chemical contaminants in foods.

    PubMed

    Clarke, R; Connolly, L; Frizzell, C; Elliott, C T

    2015-03-18

    Aflatoxin B1 (AFB1), ochratoxin A (OTA) and fumonisin B1 (FB1) are important mycotoxins in terms of human exposure via food, their toxicity and regulatory limits that exist worldwide. Mixtures of toxins can frequently be present in foods, however due to the complications of determining their combined toxicity, legal limits of exposure are determined for single compounds, based on long standing toxicological techniques. High content analysis (HCA) may be a useful tool to determine total toxicity of complex mixtures of mycotoxins. Endpoints including cell number (CN), nuclear intensity (NI), nuclear area (NA), plasma membrane permeability (PMP), mitochondrial membrane potential (MMP) and mitochondrial mass (MM) were compared to the conventional 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide (MTT) and neutral red (NR) endpoints in MDBK cells. Individual concentrations of each mycotoxin (OTA 3 μg/ml, FB1 8 μg/ml and AFB1 1.28 μg/ml) revealed no cytotoxicity with MTT or NR but HCA showed significant cytotoxic effects up to 41.6% (p≤0.001) and 10.1% (p≤0.05) for OTA and AFB1, respectively. The tertiary mixture (OTA 3 μg/ml, FB1 8 μg/ml and AFB1 1.28 μg/ml) detected up to 37.3% and 49.8% more cytotoxicity using HCA over MTT and NR, respectively. Whilst binary combinations of OTA (3 μg/ml) and FB1 (8 μg/ml) revealed synergistic interactions using HCA (MMP, MM, NI endpoints) not detected using MTT or NR. HCA is a highly novel and sensitive tool that could substantially help determine future regulatory limits, for single and combined toxins present in food, ensuring legislation is based on true risks to human health exposure. PMID:25623391

  16. Intervention trial with calcium montmorillonite clay in a south Texas population exposed to aflatoxin.

    PubMed

    Pollock, Brad H; Elmore, Sarah; Romoser, Amelia; Tang, Lili; Kang, Min-Su; Xue, Kathy; Rodriguez, Marisa; Dierschke, Nicole A; Hayes, Holly G; Hansen, H Andrew; Guerra, Fernando; Wang, Jia-Sheng; Phillips, Timothy

    2016-08-01

    South Texas currently has the highest incidence of hepatocellular carcinoma (HCC) in the United States, a disease that disproportionately affects Latino populations in the region. Aflatoxin B1 (AFB1) is a potent liver carcinogen that has been shown to be present in a variety of foods in the United States, including corn and corn products. Importantly, it is a dietary risk factor contributing to a higher incidence of HCC in populations frequently consuming AFB1-contaminated diets. In a randomised double-blind placebo controlled trial, we evaluated the effects of a 3-month administration of ACCS100 (refined calcium montmorillonite clay) on serum AFB1-lysine adduct (AFB-Lys) level and serum biochemistry in 234 healthy men and women residing in Bexar and Medina counties, Texas. Participants recruited from 2012 to 2014 received either a placebo, 1.5 g or 3 g ACCS100 each day for 3 months, and no treatment during the fourth month. Adverse event rates were similar across treatment groups and no significant differences were observed for serum biochemistry and haematology parameters. Differences in levels of AFB-Lys at 1, 3 and 4 months were compared between placebo and active treatment groups. Although serum AFB-Lys levels were decreased by month 3 for both treatment groups, the low dose was the only treatment that was significant (p = 0.0005). In conclusion, the observed effect in the low-dose treatment group suggests that the use of ACCS100 may be a viable strategy to reduce dietary AFB1 bioavailability during aflatoxin outbreaks and potentially in populations chronically exposed to this carcinogen. PMID:27321368

  17. Inhibitory Effects of Silver Nanoparticles on Growth and Aflatoxin B1 Production by Aspergillus Parasiticus

    PubMed Central

    Mousavi, Seyyed Amin Ayatollahi; Pourtalebi, Somayyeh

    2015-01-01

    Background: Aflatoxins (AFs) are secondary hazardous fungal metabolites that are produced by strains of some Aspergillus species on food and feedstuffs. Aflatoxin B1 (AFB1) is one of the most important AF with high toxicity. Prevention of AF production and their elimination from food products is a matter of importance for many researchers in the last decades. Nanomaterials applications in medical science have been widely studied in the recent years. Most of existing researches seek the effect of nanoparticles on bacteria, fungi, and viruses. The aim of this study was to determine the effects of silver nanoparticles (AgNPs) on growth and AFB1 production of AF-producing Aspergillus parasiticus. Methods: A parasiticus was inoculated (106 conidia per ml of medium) to potato dextrose broth (PDB) medium and then AgNPs was added and incubated with shaking at 130 rpm and 28°C for 7 days. AF was assayed by high performance liquid chromatography (HPLC). Microbiological assay (MBA) on microplates contained potato dextrose broth (PDB) medium (4 days at 28°C) at different concentrations of AgNPs (60, 80, 100, 120, 140, 160, 180 and 200 μg/ml) was measured. Results: The results demonstrated that a minimum inhibition concentration (MIC) equal to 180 μg/ml was determined for AgNPs against A. parasiticus. The AgNPs effectively inhibited AFB1 production at a concentration of 90 μg/ml. Conclusion: The results obtained in this study show AgNPs at concentrations lower than the MIC drastically inhibited production of AFB1 by A. parasiticus in culture medium. The AgNPs may be useful to control AF contamination of susceptible crops in the field. PMID:26538778

  18. Response of a Mu-class glutathione S-transferase from black tiger shrimp Penaeus monodon to aflatoxin B1 exposure.

    PubMed

    Wang, Yun; Liu, Lihui; Huang, Jianhua; Duan, Yafei; Wang, Jun; Fu, Mingjun; Lin, Heizhao

    2016-01-01

    Glutathione S-transferases (GSTs) are a family of multifunctional phase II enzymes that are involved in the detoxification of exogenous and endogenous compounds. In this study, a full-length cDNA of Mu-class GST (PmMuGST) was isolated from the hepatopancreas of Penaeus monodon using rapid amplification of cDNA ends method. The full length cDNA of PmMuGST is 867 bp, contains an open read frame of 660 bp, and encodes a polypeptide of 219 amino acids with a molecular mass of 25.61 kDa and pI of 6.15. Sequence analysis indicated that the predicted protein sequence of PmMuGST was very similar to (86 %) that of Litopenaeus vannamei. A conserved domain of GST_N_Mu_like (PSSM: cd03075) and GST_C_family_superfamily_like (PSSM: cl02776) was indentified in PmMuGST. Real time quantitative RT-PCR analysis indicated that PmMuGST was present in all of the tested tissues. PmMuGST transcripts both in the hepatopancreas and in the muscle were significantly induced after 14 days of treatment with a low dosage of AFB1 (50 μg/kg) exposure and were significantly inhibited after 42 and 56 days of a high dosage of AFB1 (1000, 2500 μg/kg AFB1) exposure. Taken together, the Mu-class GST from P. monodon was inducible and was involved in the response to AFB1 exposure. PMID:27386274

  19. Aflatoxin M1 in raw milk and aflatoxin B1 in feed from household cows in Singida, Tanzania.

    PubMed

    Mohammed, Salum; Munissi, Joan J E; Nyandoro, Stephen S

    2016-06-01

    Aflatoxin M1 (AFM1) contamination in raw milk from household cows fed with sunflower seedcakes or sunflower-based seedcake feeds was determined in 37 milk samples collected randomly from different locations in Singida region, Tanzania. Aflatoxin B1 (AFB1) contamination in sunflower-based seedcake feed was determined in 20 feed samples collected from the same household dairy farmers. The samples were analysed by RP-HPLC using fluorescent detection after immunoaffinity column clean-up. Recoveries were 88.0% and 94.5%, while the limits of detection (LOD) were 0.026 ng mL(-1) and 0.364 ng g(-1) for AFM1 and AFB1, respectively. Of the analysed cow's milk samples, 83.8% (31/37) contained AFM1, with levels ranging from LOD to 2.007 ng mL(-1), exceeding both the European Commission (EC) and Tanzania Food and Drug Authority (TFDA) limit of 0.05 ng mL(-1). Of the contaminated samples, 16.1% exceeded the Codex Alimentarius limit of 0.5 ng mL(-1). AFB1 was present in 65% (13/20) of the feed samples with levels ranging from LOD to 20.47 ng g(-1), 61.53% exceeding the TFDA and EC maximum limits of 5 ng g(-1) for complete dairy animal feed. The observed AFM1 and AFB1 contamination necessitates the need to raise awareness to dairy farmers in Tanzania to safeguard the health of the end-users. PMID:26756100

  20. The Rainbow Trout Liver Cancer Model: Response to Environmental Chemicals and Studies on Promotion and Chemoprevention✰

    PubMed Central

    Williams, David E.

    2011-01-01

    Rainbow trout (Oncorhynchus mykiss) are an outstanding model of liver cancer induction by environmental chemicals and development of strategies for chemoprevention. Trout have critical and unique advantages allowing for cancer studies with 40,000 animals to determine dose-response at levels orders of magnitude lower than possible in rodents. Examples of two promoters in this model, the dietary supplement dehydroepiandrosterone (DHEA) and industrial chemical perfluorooctanoic acid (PFOA), are presented. In addition, indole-3-carbinol (I3C) and chlorophyllin (CHL) inhibit initiation following exposure to potent human chemical carcinogens (e.g., aflatoxin B1 (AFB1). Two “ED001” cancer studies have been conducted, utilizing approximately 40,000 trout, by dietary exposure to AFB1 and dibenzo[d,e,f,p]chrysene (DBC). These studies represent the two largest cancer studies ever performed and expand the dose-response dataset generated by the 25,000 mouse “ED01” study over an order of magnitude. With DBC, the liver tumor response fell well below the LED10 line, often used for risk assessment, even though the biomarker (liver DBC-DNA adducts) remained linear. Conversely, the response with AFB1 remained relatively linear throughout the entire dose range. These contributions to elucidation of mechanisms of liver cancer, induced by environmental chemicals and the remarkable datasets generated with ED001 studies, make important contributions to carcinogenesis and chemoprevention. PMID:21704190

  1. Anti-genotoxic and free-radical scavenging activities of extracts from (Tunisian) Myrtus communis.

    PubMed

    Hayder, N; Abdelwahed, A; Kilani, S; Ammar, R Ben; Mahmoud, A; Ghedira, K; Chekir-Ghedira, L

    2004-11-14

    The effect of extracts from leaves of Myrtus communis on the SOS reponse induced by Aflatoxin B1 (AFB1) and Nifuroxazide was investigated in a bacterial assay system, i.e. the SOS chromotest with Escherichia coli PQ37. Aqueous extract, the total flavonoids oligomer fraction (TOF), hexane, chloroform, ethyl acetate and methanol extracts and essential oil obtained from M. communis significantly decreased the SOS response induced by AFB1 (10 microg/assay) and Nifuroxazide (20 microg/assay). Ethyl acetate and methanol extracts showed the strongest inhibition of the induction of the SOS response by the indirectly genotoxic AFB1. The methanol and aqueous extracts exhibited the highest level of protection towards the SOS-induced response by the directly genotoxic Nifuroxazide. In addition to anti-genotoxic activity, the aqueous extract, the TOF, and the ethyl acetate and methanol extracts showed an important free-radical scavenging activity towards the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical. These results suggest the future utilization of these extracts as additives in chemoprevention studies. PMID:15474415

  2. Mutagenic, antimutagenic, cytotoxic, and apoptotic activities of extracts from Pituranthos tortuosus.

    PubMed

    Abdelwahed, Afef; Skandrani, Ines; Kilani, Soumaya; Neffati, A; Sghaier, Mohamed Ben; Bouhlel, Ines; Boubaker, Jihed; Ammar, Rebaï Ben; Mahmoud, Amor; Ghedira, Kamel; Chekir-Ghedira, Leila

    2008-01-01

    Mutagenic and antimutagenic activities against direct acting mutagens, nifuroxazide (NF) and sodium azide (SA), and indirect acting mutagen aflatoxin B1 (AFB1) of extracts prepared from aerial parts of Pituranthos tortuosus were investigated in bacterial assay systems (i.e., the Ames test with Salmonella typhimurium TA100, TA98, TA1538, TA1535, and the SOS chromotest with Escherichia coli PQ 37). It was found that all extracts obtained from P. tortuosus decreased the mutagenicity induced by AFB1 (10 microg/assay), SA (1.5 microg/assay), and NF (20 microg/assay). Ethyl acetate, acetone, methanol, and total oligomer flavenoid extracts exhibited the highest inhibition level of mutagenicity induced by the indirect mutagen AFB1. In addition, antiproliferative and apoptotic properties of these extracts have also been reported using two leukemia cell lines, L1210 and K562. The results revealed that all extracts showed a significant cytotoxic effect on these cell lines, and the effect was greater in the presence of human K562 chronic myelogenous leukemia cells, whereas they do not induce apoptosis. PMID:18161507

  3. Label-free immunosensor based on one-step electrodeposition of chitosan-gold nanoparticles biocompatible film on Au microelectrode for determination of aflatoxin B1 in maize.

    PubMed

    Ma, Haihua; Sun, Jizhou; Zhang, Yuan; Bian, Chao; Xia, Shanhong; Zhen, Tong

    2016-06-15

    Gold nanoparticles (AuNPs) embedded in chitosan (CHI) film, well-dispersed and smaller in size (about 10 nm), were fabricated by one-step electrodeposion on Au microelectrode in solution containing chitosan and chloride trihydrate. The nano-structure CHI-AuNPs composite film offers abundant amine groups, good conductivity, excellent biocompatibility and stability for antibody immobilization. The combination of aflatoxin B1 (AFB1) with immobilized antibody introduces a barrier to electron transfer, resulting in current decreasement. The morphologies and characterizations of modified microelectrodes were investigated by scanning electron microscope (SEM), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and Fourier transform infrared spectroscopy (FT-IR). The proposed non-enzyme and label-free immunosensor exhibited high sensitive amperometric response to AFB1 concentration in two linear ranges of 0.1 to 1 ng mL(-1) and 1 to 30 ng mL(-1), with the detection limit of 0.06 ng mL(-1) (S/N=3). The immunoassay was also applied for analysis of maize samples spiked with AFB1. Considering the sample extraction procedure, the linear range and limit of detection were assessed to be 1.6-16 ng mL(-1) and 0.19 ng mL(-1) respectively. The simple method showed good fabrication controllability and reproducibility for immunosensor design. PMID:26851579

  4. Ozonolysis efficiency and safety evaluation of aflatoxin B1 in peanuts.

    PubMed

    Diao, Enjie; Hou, Hanxue; Chen, Bin; Shan, Changpo; Dong, Haizhou

    2013-05-01

    Ozonolysis efficiency of aflatoxin-contaminated peanuts (ACPs) was investigated, and the safety of ACPs untreated/treated by ozone was evaluated after 28-day intragastrically administration in male and female Wistar rats. 89.40% of aflatoxin B1 (AFB1) in peanuts was decomposed by ozone with a concentration of 50mg/L, flow rate of 5L/min for 60h. After 60h, the ozonolysis efficiency of AFB1 was not further improved. In the subchronic toxicity experiment, all rats did not have unusual changes in behavior, and no signs of intoxication were observed except for several dead rats due to inappropriate gavage or anesthesia. The results of subchronic toxicity indicated that rats fed on ACPs alone had significantly decreased in body weight gain and feed conversion efficiency. Most serum biochemical indexes of rats had apparently changed compared with those in the negative control, and gender difference significantly affected most indexes of subchronic toxicity except for the ratios of organ to body weight and histopathological observation. Rats fed on ACPs treated by ozone showed significant beneficial health effects. All the results suggested that the deleterious effects of AFB1 could be highly reduced by ozone, and ozone itself did not show any toxic effects on animals in this processing. PMID:23395718

  5. Lack of an Apparent Association between Mycotoxin Concentrations in Red Chili Peppers and Incidence of Gallbladder Cancer in India : an Ecological Study.

    PubMed

    Ikoma, Toshikazu; Kapoor, Vinay Kumar; Behari, Anu; Mishra, Kumudesh; Tsuchiya, Yasuo; Asai, Takao; Endoh, Kazuo; Okano, Kiyoshi; Nakamura, Kazutoshi

    2016-01-01

    Our recent studies conducted in South America have shown that mycotoxin contamination of red chili peppers (RCPs) may be associated with an increased risk of gallbladder cancer (GBC). Whether this relationship exists in India, a country with a high incidence of GBC and high consumption of RCPs, is unclear. We therefore measured concentrations of aflatoxins (AFs) and ochratoxin A (OTA) in RCPs from areas of low, medium, and high incidence of GBC in India, and compared these concentrations with GBC incidence in each area. Twentyone RCP samples were collected from nine cities (eight from a lowincidence area, five from a mediumincidence area, and eight from a highincidence area). Concentrations of AFs and OTA were measured using highperformance liquid chromatography. No significant differences in mean concentrations of AFs and OTA were found in the three areas. AFB1 levels in the lowincidence area (10.81 ?g/kg) and highincidence area (12.00 ?g/kg) were more than 2.2 and 2.4 times higher compared with the maximum permitted level of AFB1 in spices (5.0 ?g/kg) set by the Commission of the European Communities, or that (4.4 ?g/kg) obtained in our previous study in Chile. Our results show that the mean concentrations of mycotoxins in RCPs are similar among the three areas in India with different incidences of GBC. Further studies with human subjects are needed to evaluate any association between AFB1 and GBC. PMID:27509999

  6. DNA-damaging potency and genotoxicity of aflatoxin M1 in somatic cells in vivo of Drosophila melanogaster.

    PubMed

    Shibahara, T; Ogawa, H I; Ryo, H; Fujikawa, K

    1995-05-01

    Aflatoxin M1 (AFM1), a metabolic hydroxylation product of aflatoxin B1 (AFB1), and the parent compound were comparatively assayed for DNA-damaging potency and genotoxicity in vivo in Drosophila melanogaster using, respectively, the mei-9a mei-41D5 DNA repair test and the mwh/flr3 wing spot test. In the repair test, larval stock, consisting of meiotic recombination-deficient double mutant mei-9a mei-41D5 males and repair-proficient females, was exposed to the test agents, and the preferential killing of the mutant larvae was taken as evidence of the DNA-damaging effect. In this test, AFM1 was registered as a DNA-damaging agent with an activity approximately 3-fold lower than that of AFB1. In the wing spot test, where larval flies, trans-heterozygous for the somatic cell markers mwh and flr3, were treated and the wings were inspected at adulthood for spots manifesting the phenotypes of the markers, AFM1 exerted a genotoxic effect compatible to that of AFB1. Based on these results and other data, we predict that AFM1 may be genotoxic in mammalian in-vivo systems as well. PMID:7666765

  7. Toxic effects of aflatoxin B1 on embryonic development of zebrafish (Danio rerio): potential activity of piceatannol encapsulated chitosan/poly (lactic acid) nanoparticles.

    PubMed

    Dhanapal, Jeevitha; Ravindrran, Malathy Balaraman; Baskar, Santhosh K

    2015-01-01

    The aim was to analyse the efficacy of piceatannol (PIC) loaded chitosan (CS)/poly(lactic acid)(PLA) nanoparticles (CS/PLA-PIC NPs) in zebra fish embryos exposed to aflatoxin B1 (AFB1). FTIR confirmed the chemical interaction between the polymers and drug. SEM showed the size of CS/PLA-PIC NPs approximately 87 to 200nm, compared to CS-PLA NPs of 150nm size. The size was further affirmed as 127nm (CS-PLA NPs) and 147nm (CS/PLA-PIC NPs) by zetasizer depiction. CS/PLA-PIC NPs have not illustrated toxicity at high concentrations when tested in zebrafish embryos. AFB1 wielded their toxic effects on the survival, spontaneous movement, hatching and heart rate and development of embryos were observed in both time and dose-dependent manner at 4μM. Our results suggested that the addition of CS/PLA-PIC NPs increases the survival, heart rate and hatching in time dependent manner at the dosage of 20μg/ml. These hopeful results may prompt the advancement of drug encapsulated polymeric nanoparticles which may have the potential role in improving the AFB1 induced toxicity in humans as well. PMID:25322988

  8. Co-occurrence of aflatoxins, ochratoxin A and citrinin in "egusi" melon (Colocynthis citrullus L.) seeds consumed in Ireland and the United Kingdom.

    PubMed

    Somorin, Yinka; Akinyemi, Adeyemi; Bertuzzi, Terenzio; Pietri, Amedeo

    2016-09-01

    The natural co-occurrence of aflatoxins (AFs), ochratoxin A (OTA) and citrinin (CIT) in melon seed samples obtained from retailers and households in Ireland and the United Kingdom (UK) was evaluated. AFs and OTA were determined by HPLC with fluorescence detection while CIT was analysed by HPLC-MS/MS. AFB1 was detected in all (100%) samples (mean = 9.7 μg kg(-1); range = 0.2-66.5 μg kg(-1)). Mean total AFs was 12.0 μg kg(-1) (range = 0.3-82 μg kg(-1)). Commercially retailed samples showed a significantly higher AFB1 contamination (p < 0.05) than the household samples. OTA occurred in 3 (13.6%) samples, while 4 (18.2%) were contaminated with CIT at very low levels. In this study, 68% of the melon seed samples were contaminated above the 2 μg kg(-1) EU limit for AFB1 in oilseeds. These results highlight the need for the development of strategies to reduce AF contamination in "egusi" for human consumption. PMID:27134068

  9. Phlomis mauritanica extracts reduce the xanthine oxidase activity, scavenge the superoxide anions, and inhibit the aflatoxin B1-, sodium azide-, and 4-nitrophenyldiamine-induced mutagenicity in bacteria.

    PubMed

    Limem, Ilef; Bouhlel, Ines; Bouchemi, Meriem; Kilani, Soumaya; Boubaker, Jihed; Ben-Sghaier, Mohamed; Skandrani, Ines; Behouri, Wissem; Neffati, Aicha; Ghedira, Kamel; Chekir-Ghedira, Leila

    2010-06-01

    Four extracts were prepared from the leaves of Phlomis mauritanica: lyophilized infusion, total oligomer flavonoids, methanol, and ethyl acetate extracts. The antimutagenic properties of these extracts were investigated by assessing the inhibition of the mutagenic effects of direct-acting mutagens such as sodium azide and 4-nitrophenylenediamine and indirect-acting mutagens like aflatoxin B1 (AFB1) using the Ames assay. The four extracts prepared from P. mauritanica strongly inhibit the mutagenicity induced by AFB1 in both Salmonella typhimurium TA 100 and TA 98 assay systems. Lyophilized infusion and methanol extracts at the dose of 250 microg per plate reduced AFB1 mutagenicity by 93% and 91%, respectively, in S. typhymurium strain TA 100. We examined also the antioxidant effect of these extracts by the enzymatic xanthine/xanthine oxidase assay. Result indicated that total oligomer flavonoids and ethyl acetate and methanol extracts were potent inhibitors of xanthine oxidase activity. In contrast, lyophilized infusion, total oligomer flavonoids, and methanol extracts exhibited a high degree of superoxide anion scavenging. Our findings emphasize the potential of P. mauritanica extracts to prevent mutations and oxidant effects. Furthermore, the results presented here could be an additional argument to support the use of this species as a medicinal and dietary plant. PMID:20406134

  10. The presence of aflatoxins and ochratoxin A in rice and rice products; and evaluation of dietary intake.

    PubMed

    Iqbal, Shahzad Zafar; Asi, Muhammad Rafique; Hanif, Usman; Zuber, Muhammad; Jinap, S

    2016-11-01

    In present study aflatoxins (AFs) and ochratoxin A (OTA) were analysed in 208 samples of rice and products collected from central areas of Punjab, Pakistan. The analysis was carried out using HPLC equipped with fluorescence detector. The results have shown that 35% of the samples were found contaminated with AFs, out of which 19% and 24% samples were found to be above the European Union (EU) maximum content for AFB1 and total AFs, respectively. About 19% samples were found contaminated with OTA and 14% samples were found to be above the EU maximum content. The highest mean level of AFB1 and total AFs were found in brown rice samples i.e. 8.91 and 12.4μg/kg, respectively. However, white rice samples have shown the highest mean level of OTA (8.50μg/kg) with highest level of 24.9μg/kg. The high mean dietary exposure 22.2 and 24.2ngkg(-1)bwday(-1) to AFB1 and OTA, respectively poses significant health hazard for local population. PMID:27211631

  11. Natural occurrence of mycotoxins in staple cereals from Ethiopia.

    PubMed

    Ayalew, Amare; Fehrmann, Hartmut; Lepschy, Johann; Beck, Robert; Abate, Dawit

    2006-07-01

    The occurrence of mycotoxins in barley, sorghum, teff (Eragrostis tef) and wheat from Ethiopia has been studied. Samples were analyzed for aflatoxin B(1) (AFB1), ochratoxin A (OTA), deoxynivalenol (DON), nivalenol (NIV) and zearalenone (ZEN) using high performance liquid chromatography (HPLC) and for fumonisins (FUM) using enzyme linked immunosorbent assay (ELISA). AFB1 and OTA were detected in samples of all the four crops. AFB1 was detected in 8.8% of the 352 samples analyzed at concentrations ranging from trace to 26 microg kg(-1). OTA occurred in 24.3% of 321 samples at a mean concentration of 54.1 microg kg(-1) and a maximum of 2106 microg kg(-1). DON occurred in barley, sorghum and wheat at 40-2340 microg kg(-1) with an overall incidence of 48.8% among the 84 mainly 'suspect' samples analyzed; NIV was co-analyzed with DON and was detected at 40 microg kg(-1) in a wheat sample and at 50, 380, and 490 microg kg(-1) in three sorghum samples. FUM and ZEN occurred only in sorghum samples with low frequencies at concentrations reaching 2117 and 32 microg kg(-1), respectively. The analytical results indicate higher mycotoxin contamination in sorghum, which could be related to the widespread storage of sorghum grain in underground pits leading to elevated seed moisture contents. This is the first report on the occurrence of OTA in teff. PMID:16830193

  12. Multiplex lateral flow immunoassay for mycotoxin determination.

    PubMed

    Song, Suquan; Liu, Na; Zhao, Zhiyong; Njumbe Ediage, Emmanuel; Wu, Songling; Sun, Changpo; De Saeger, Sarah; Wu, Aibo

    2014-05-20

    A new lateral flow immunoassay (LFA) is proposed for qualitative and/or semiquantitative determination of aflatoxin B1 (AFB1), zearalenone (ZEA), deoxynivalenol (DON), and their analogues (AFs, ZEAs, DONs) in cereal samples. Each of the mycotoxin specific antibody was class specific and there was no cross reactivity to other groups of compounds. The visual limits of detection (vLOD) of the strip were 0.03, 1.6, and 10 μg/kg for AFB1, ZEA and DON, respectively. The calculated limits of detection (cLOD) were 0.05, 1, and 3 μg/kg, respectively. Meanwhile the cutoff values were achieved at 1, 50, and 60 μg/kg for AFB1, ZEA and DON, respectively. Recoveries ranged from 80% to 122% and RSD from 5% to 20%. Both the vLOD and cLOD for the three mycotoxins were lower than the EU maximum levels. Analysis of naturally contaminated maize samples resulted in a good agreement between the multiplex LFA and LC-MS/MS (100% for DONs and AFs, and 81% for ZEAs). Careful analysis of the results further explained the general overestimation of LFA compared to chromatographic methods for quantification of mycotoxins. PMID:24745689

  13. Restricted access supramolecular solvents for sample treatment in enzyme-linked immuno-sorbent assay of mycotoxins in food.

    PubMed

    García-Fonseca, Sergio; Ballesteros-Gómez, Ana; Rubio, Soledad

    2016-09-01

    A restricted access supramolecular solvent (SUPRAS-RAM) made up of tetradecanoic acid reverse micelles is proposed as a wide-scope and low-cost strategy for the treatment of agrifood samples prior to enzyme-linked immunosorbent assays (ELISA). The approach was assessed for the determination of ochratoxin A (OTA) in wines and spices and aflatoxin B1 (AFB1) in cereals, two ubiquitous mycotoxins that were selected as representative contaminants for this study. The samples were selected to cover a variety of matrices in terms diverse composition and high complexity. Macromolecules such as proteins and carbohydrates were not-co-extracted due to the restricted access properties of the SUPRAS that are provided by chemical and physical mechanisms. In this sense, analyte extraction and clean-up were carried out in a single step. Parameters determining the extraction efficiency were studied and optimized. Certified reference materials were used for method validation. Recoveries of OTA ranged between 83% and 96% in wines (with relative standard deviation, RSD, of about 10%) and between 81% and 93% in spices (RSD 7%). Recoveries for AFB1 in wheat ranged from 75% to 85% (RSD 8%). The detection limits were all below the maximum levels established for OTA and for AFB1 by EU directives. This method offers a green and low-cost alternative to the organic solvent-based extraction and/or immunoaffinity columns-based cleanup of complex samples prior to ELISA. PMID:27543022

  14. Current trends and perspectives in nutrition and cancer prevention.

    PubMed

    Bárta, I; Smerák, P; Polívková, Z; Sestáková, H; Langová, M; Turek, B; Bártová, J

    2006-01-01

    There is an increasing evidence that dietary phytochemicals may play important roles as chemopreventive or chemotherapeutic agents in prevention of many diseases, including tumors. The purpose of this study was to examine antimutagenic effects and effect on the immune response of representative series of substances which commonly occur in human diet. Using the Ames bacterial mutagenicity test and in vivo chemiluminescence test, we investigated antigenotoxic and immunomodulatory effects of juices and vegetable homogenates (carrot + cauliflower, cauliflower, red cabbage, broccoli, onion, garlic) on the genotoxicity of AFB1 and pyrolysates of aminoacids. Using the Ames test and in vivo micronucleus, the chemiluminescence test, the blastic transformation test and the comet assay we examined antimutagenic effects of chemically identified chemoprotective substances in the pure form (resveratrol, diallylsulphide, phenethyl isothiocyanate, ellagic acid, epigallocatechin gallate, genistein and curcumin) on mutagenicity induced by three reference mutagens: aflatoxin B1 (AFB1), 2-amino-3-metylimidazo[4,5,-f] chinolin (IQ) and N-nitroso- N-metylurea (MNU) and effect of phytochemicals on the immunosuppression caused by these mutagens. All complete vegetable homogenates and substances of plant origin tested, showed a clear antimutagenic and immunomodulatory activities on mutagenicity and immunosuppression induced by reference mutagens. Only in the Ames test the effect of some phytochemicals against direct mutagen MNU was lower compared to indirect mutagens AFB1 and IQ. Similarly, resveratrol and epigallocatechin gallate had no inhibitory effect on mutagenicity MNU in the Ames test. PMID:16416008

  15. Occurrence of mycotoxins in feed ingredients and complete feeds obtained from the Beijing region of China

    PubMed Central

    2014-01-01

    Background The current study was carried out to provide a reference for the control of mycotoxin contamination in feed ingredients and complete feeds for swine. Methods A total of 55 feed ingredients, including 14 corn, 13 wheat bran, 11 soybean meal and 17 dried distillers grains with solubles (DDGS) as well as 76 complete swine feeds including 7 creep feeds, 14 starter feeds, 14 grower feeds, 18 grower-finisher feeds, 10 gestating sow feeds, and 13 lactating sow feeds were randomly collected from 15 swine farms located in the Beijing region of China from July to August 2011. Immunoaffinity clean-up, using High-Performance Liquid Chromatography (HPLC) in combination with UV or Fluorescence Detection, was used for quantitative analysis of aflatoxin B1 (AFB1), deoxynivalenol (DON), zearalenone (ZEA) and ochratoxin A (OTA) in the ingredients and complete feeds. Results DON and ZEA were the most prevalent mycotoxins found. DON was detected at percentages of 93, 92, 54, 100 and 97% with a mean level of 1.01, 0.44, 0.05, 1.36 and 0.65 ppm in the samples of corn, wheat bran, soybean meal, DDGS and complete feeds, respectively. The detected percentages of ZEA were 100, 100, 54, 100 and 100 with mean levels of 109.1, 14.9, 9.2, 882.7 and 58.9 ppb in the same samples. In the wheat bran and soybean meal samples, the content of all four mycotoxins were below the maximum limits set by Chinese regulations while the percentage of samples that exceeded regulatory limits were 7, 57 and 7% for corn, and 7, 14 and 3% for the complete feeds for AFB1, DON and OTA respectively. DDGS showed the most serious mycotoxin contamination and the percentage of samples that exceeded regulatory limits were 6, 88 and 41%, for AFB1, DON and ZEA, respectively. Conclusions This paper is the first to present data on the natural occurrence of AFB1, DON, ZEA and OTA in ingredients and complete feeds obtained from swine farms in China’s Beijing region. The data shows that feed ingredients and

  16. MiR393 regulation of auxin signaling and redox-related components during acclimation to salinity in Arabidopsis.

    PubMed

    Iglesias, María José; Terrile, María Cecilia; Windels, David; Lombardo, María Cristina; Bartoli, Carlos Guillermo; Vazquez, Franck; Estelle, Mark; Casalongué, Claudia Anahí

    2014-01-01

    One of the most striking aspects of plant plasticity is the modulation of development in response to environmental changes. Plant growth and development largely depend on the phytohormone auxin that exerts its function through a partially redundant family of F-box receptors, the TIR1-AFBs. We have previously reported that the Arabidopsis double mutant tir1 afb2 is more tolerant to salt stress than wild-type plants and we hypothesized that down-regulation of auxin signaling might be part of Arabidopsis acclimation to salinity. In this work, we show that NaCl-mediated salt stress induces miR393 expression by enhancing the transcription of AtMIR393A and leads to a concomitant reduction in the levels of the TIR1 and AFB2 receptors. Consequently, NaCl triggers stabilization of Aux/IAA repressors leading to down-regulation of auxin signaling. Further, we report that miR393 is likely involved in repression of lateral root (LR) initiation, emergence and elongation during salinity, since the mir393ab mutant shows reduced inhibition of emergent and mature LR number and length upon NaCl-treatment. Additionally, mir393ab mutant plants have increased levels of reactive oxygen species (ROS) in LRs, and reduced ascorbate peroxidase (APX) enzymatic activity compared with wild-type plants during salinity. Thus, miR393 regulation of the TIR1 and AFB2 receptors could be a critical checkpoint between auxin signaling and specfic redox-associated components in order to coordinate tissue and time-specific growth responses and tolerance during acclimation to salinity in Arabidopsis. PMID:25222737

  17. MiR393 Regulation of Auxin Signaling and Redox-Related Components during Acclimation to Salinity in Arabidopsis

    PubMed Central

    Iglesias, María José; Lombardo, María Cristina; Bartoli, Carlos Guillermo; Vazquez, Franck; Estelle, Mark; Casalongué, Claudia Anahí

    2014-01-01

    One of the most striking aspects of plant plasticity is the modulation of development in response to environmental changes. Plant growth and development largely depend on the phytohormone auxin that exerts its function through a partially redundant family of F-box receptors, the TIR1-AFBs. We have previously reported that the Arabidopsis double mutant tir1 afb2 is more tolerant to salt stress than wild-type plants and we hypothesized that down-regulation of auxin signaling might be part of Arabidopsis acclimation to salinity. In this work, we show that NaCl-mediated salt stress induces miR393 expression by enhancing the transcription of AtMIR393A and leads to a concomitant reduction in the levels of the TIR1 and AFB2 receptors. Consequently, NaCl triggers stabilization of Aux/IAA repressors leading to down-regulation of auxin signaling. Further, we report that miR393 is likely involved in repression of lateral root (LR) initiation, emergence and elongation during salinity, since the mir393ab mutant shows reduced inhibition of emergent and mature LR number and length upon NaCl-treatment. Additionally, mir393ab mutant plants have increased levels of reactive oxygen species (ROS) in LRs, and reduced ascorbate peroxidase (APX) enzymatic activity compared with wild-type plants during salinity. Thus, miR393 regulation of the TIR1 and AFB2 receptors could be a critical checkpoint between auxin signaling and specfic redox-associated components in order to coordinate tissue and time-specific growth responses and tolerance during acclimation to salinity in Arabidopsis. PMID:25222737

  18. Detection of aflatoxin B₁ with immunochromatographic test strips: Enhanced signal sensitivity using gold nanoflowers.

    PubMed

    Ji, Yanwei; Ren, Meiling; Li, Yanping; Huang, Zhibing; Shu, Mei; Yang, Hongwei; Xiong, Yonghua; Xu, Yang

    2015-09-01

    Immunochromatographic test strips (ICTS) are commonly limited to higher concentrations of analytes. This limitation stems from the relatively low sensitivity of conventional gold nanospheres (AuNSs with a diameter of 20 nm) to emit detectable brightness values. The larger multi-branched gold nanoflowers (AuNFs) with a higher optical brightness as well as good colloidal stability exhibit significant improvements over conventional AuNSs for enhanced sensitivity of ICTS. In this study, blue AuNFs with an average diameter of 75±5 nm were synthetized and employed as a signal amplification probe for ultrasensitive and quantitative detection of aflatoxin B1 (AFB1) in rice. A portable optical strip reader was used to record the optical densities of test and control lines of the strip. Under the optimal conditions, the AuNF based ICTS system accurately detected AFB1 linearly and dynamically over the range of 0.5-25 pg/mL with a half maximal inhibitory concentration at 4.17 pg/mL. The inhibitory concentration was achieved 10 times lower than that of the traditional AuNS based ICTS systems (41.25 pg/mL). The limit of detection for AFB1 in rice extract was achieved at 0.32 pg/mL. In summary, AuNFs are a novel probe that exhibited excellent sensitivity in the ICTS system and could be used for ultrasensitive detection of other analytes in food safety monitoring, and even medical diagnostics. PMID:26003713

  19. The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus

    PubMed Central

    Zhuang, Zhenhong; Lohmar, Jessica M.; Satterlee, Timothy; Cary, Jeffrey W.; Calvo, Ana M.

    2016-01-01

    Aspergillus flavus produces a variety of toxic secondary metabolites; among them, the aflatoxins (AFs) are the most well known. These compounds are highly mutagenic and carcinogenic, particularly AFB1. A. flavus is capable of colonizing a number of economically-important crops, such as corn, cotton, peanut and tree nuts, and contaminating them with AFs. Molecular genetic studies in A. flavus could identify novel gene targets for use in strategies to reduce AF contamination and its adverse impact on food and feed supplies worldwide. In the current study, we investigated the role of the master transcription factor gene mtfA in A. flavus. Our results revealed that forced overexpression of mtfA results in a drastic decrease or elimination of several secondary metabolites, among them AFB1. The reduction in AFB1 was accompanied by a decrease in aflR expression. Furthermore, mtfA also regulates development; conidiation was influenced differently by this gene depending on the type of colonized substrate. In addition to its effect on conidiation, mtfA is necessary for the normal maturation of sclerotia. Importantly, mtfA positively affects the pathogenicity of A. flavus when colonizing peanut seeds. AF production in colonized seeds was decreased in the deletion mtfA strain and particularly in the overexpression strain, where only trace amounts were detected. Interestingly, a more rapid colonization of the seed tissue occurred when mtfA was overexpressed, coinciding with an increase in lipase activity and faster maceration of the oily part of the seed. PMID:26805883

  20. A Case for Regular Aflatoxin Monitoring in Peanut Butter in Sub-Saharan Africa: Lessons from a 3-Year Survey in Zambia.

    PubMed

    Njoroge, Samuel M C; Matumba, Limbikani; Kanenga, Kennedy; Siambi, Moses; Waliyar, Farid; Maruwo, Joseph; Monyo, Emmanuel S

    2016-05-01

    A 3-year comprehensive analysis of aflatoxin contamination in peanut butter was conducted in Zambia, sub-Saharan Africa. The study analyzed 954 containers of 24 local and imported peanut butter brands collected from shops in Chipata, Mambwe, Petauke, Katete, and Nyimba districts and also in Lusaka from 2012 to 2014. For analysis, a sample included six containers of a single brand, from the same processing batch number and the same shop. Each container was quantitatively analyzed for aflatoxin B1 (AFB1) in six replicates by using competitive enzyme-linked immunosorbent assay; thus, aflatoxin contamination level of a given sample was derived from an average of 36 test values. Results showed that 73% of the brands tested in 2012 were contaminated with AFB1 levels >20 μg/kg and ranged up to 130 μg/kg. In 2013, 80% of the brands were contaminated with AFB1 levels >20 μg/kg and ranged up to 10,740 μg/kg. Compared with brand data from 2012 and 2013, fewer brands in 2014, i.e., 53%, had aflatoxin B1 levels >20 μg/kg and ranged up to 1,000 μg/kg. Of the eight brands tested repeatedly across the 3-year period, none consistently averaged ≤20 μg/kg. Our survey clearly demonstrates the regular occurrence of high levels of AF B1 in peanut butter in Zambia. Considering that some of the brands tested originated from neighboring countries such as Malawi, Zimbabwe, and South Africa, the current findings provide a sub-Saharan regional perspective regarding the safety of peanut butter. PMID:27296427

  1. Variation in fungal microbiome (mycobiome) and aflatoxin in stored in-shell peanuts at four different areas of China.

    PubMed

    Ding, Ning; Xing, Fuguo; Liu, Xiao; Selvaraj, Jonathan N; Wang, Limin; Zhao, Yueju; Wang, Yan; Guo, Wei; Dai, Xiaofeng; Liu, Yang

    2015-01-01

    The contamination of peanuts with Aspergillus sp. and subsequently aflatoxins is considered to be one of the most serious safety problems in the world. Mycobiome in peanuts is critical for aflatoxin production and food safety. To evaluate the biodiversity and ecological characteristics of whole communities in stored peanuts, the barcoded Illumina paired-end sequencing of the internal transcribed spacer 2 (ITS2) region of rDNA was used to characterize the peanut mycobiome monthly over a period of 1 year at four main peanut grown areas, i.e., Liaoning (LN, North East), Shandong (SD, East), Hubei (HB, Central), and Guangdong (GD, South) provinces. The fungal diversity of peanuts stored in SD was the highest with 98 OTUs and 43 genera, followed by LN, HB and GD. In peanuts stored in SD, Rhizopus, Emericella, and Clonostachys were predominant. In peanuts from LN, Penicillium, Eurotium, and Clonostachys were abundant. In peanuts from HB, Penicillium, Eurotium, and Aspergillus were higher. In GD peanuts, Eurotium, Aspergillus, and Emericella were mainly seen. The abundances of Aspergillus in LN, SD, HB, and GD were 0.53, 6.29, 10.86, and 25.75%, respectively. From the North of China to the South, that increased over the latitude, suggesting that the higher temperature and relative humidity might increase the risk of peanuts contaminated with Aspergillus and aflatoxins. During the storage, Aspergillus levels were higher at 7-12 months than in 0-6 months, suggesting that the risk increases over storage time. At 7-10 months, AFB1 was higher in four areas, while declined further. The reduction of AFB1 might be attributed to the inhibition and degradation of AFB1 by Aspergillus niger or to the combination with the compounds of peanuts. This is the first study that identified the mycobiome and its variation in stored peanuts using ITS2 sequencing technology, and provides the basis for a detailed characterization of whole mycobiome in peanuts. PMID:26557107

  2. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P

    1998-01-01

    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  3. Novel B melatonin-loaded chitosan microcapsules: in vitro characterization and antiapoptosis efficacy for aflatoxin B1-induced apoptosis in rat liver.

    PubMed

    El-Gibaly, I; Meki, A M A; Abdel-Ghaffar, S K

    2003-07-01

    The aim of this study was to prepare buoyant (B) melatonin (MT)-loaded chitosan microcapsules having favourable sustained release characteristics (in simulated gastric fluid (SGF), pH 1.2) in comparison with non-buoyant (NB) chitosan particles. The new buoyant microcapsules were prepared by the ionotropic gelation method using sodium lauryl sulfate (NaLS) for coagulation. The microcapsule characteristics were affected by the initial drug and NaLS concentrations, as well as the presence of sodium dioctyl sulfosuccinate (DOS) or pectin with NaLS in the external phase. In general, spherical microcapsules with 36.90-56.23% encapsulation efficiencies, hollow core and satisfactory release properties were produced. The best sustained release profiles (t(50%): 5h) with near zero-order kinetics were observed with the higher theoretical payload microcapsules prepared with both NaLS and DOS in a 1:2 ratio. In vivo studies were also carried out to exploit the protective effect of the MT-loaded NaLS-DOS microcapsules against aflatoxin B1 (AFB1)-induced toxicity (liver apoptosis) in male rats. The results implied that apoptotic rate was significantly reduced when MT or its microcapsules formulation was co-administered with AFB1. The levels of the oxidative stress indices (malondialdehyde (MDA), a lipid peroxidation product and nitric oxide (NO)) in liver tissues were significantly reduced, while the levels of the hepatic antioxidants (glutathione (GSH) and zinc (Zn), as well as the enzyme activities of glutathione reductase (GR), glutathione peroxidase (GSPx) and glutathione-S-transferase (GST)) which act as antiapoptosis were significantly increased as compared to AFB1 group (without MT). MT microcapsules appeared more effective in reduction of apoptotic rate than free MT as indicated by the decline of caspase-3 activities (an apoptotic marker) and confirmed by histopathology. PMID:12818806

  4. Immunochromatographic assay for ultrasensitive detection of aflatoxin B₁ in maize by highly luminescent quantum dot beads.

    PubMed

    Ren, Meiling; Xu, Hengyi; Huang, Xiaolin; Kuang, Min; Xiong, Yonghua; Xu, Hong; Xu, Yang; Chen, Hongyu; Wang, Andrew

    2014-08-27

    Highly luminescent quantum dot beads (QBs) were synthesized by encapsulating CdSe/ZnS and used for the first time as immunochromatographic assay (ICA) signal amplification probe for ultrasensitive detection of aflatoxin B1 (AFB1) in maize. The challenges to using high brightness QBs as probes for ICA are smooth flow of QBs and nonspecific binding on nitrocellulose (NC) membrane, which are overcome by unique polymer encapsulation of quantum dots (QDs) and surface blocking method. Under optimal conditions, the QB-based ICA (QB-ICA) sensor exhibited dynamic linear detection of AFB1 in maize extract from 5 to 60 pg mL(-1), with a median inhibitory concentration (IC50) of 13.87 ± 0.16 pg mL(-1), that is significantly (39-fold) lower than those of the QD as a signal probe (IC50 = 0.54 ± 0.06 ng mL(-1)). The limit of detection (LOD) for AFB1 using QB-ICA sensor was 0.42 pg mL(-1) in maize extract, which is approximately 2 orders of magnitude better than those of previously reported gold nanoparticle based immunochromatographic assay (AuNP-ICA) and is even comparable with or better than the conventional enzyme-linked immunosorbent assay (ELISA) method. The performance and practicability of our QB-ICA sensor were validated with a commercial ELISA kit and further confirmed with liquid chromatography tandem mass spectrometry (LC-MS/MS). Given its efficient signal amplification performance, the proposed QB-ICA offers great potential for rapid, sensitive, and cost-effective quantitative detection of analytes in food safety monitoring. PMID:25109633

  5. Common African cooking processes do not affect the aflatoxin binding efficacy of refined calcium montmorillonite clay.

    PubMed

    Elmore, Sarah E; Mitchell, Nicole; Mays, Travis; Brown, Kristal; Marroquin-Cardona, Alicia; Romoser, Amelia; Phillips, Timothy D

    2014-03-01

    Aflatoxins are common contaminants of staple crops, such as corn and groundnuts, and a significant cause of concern for food safety and public health in developing countries. Aflatoxin B1 (AFB1) has been implicated in the etiology of acute and chronic disease in humans and animals, including growth stunting, liver cancer and death. Cost effective and culturally acceptable intervention strategies for the reduction of dietary AFB1 exposure are of critical need in populations at high risk for aflatoxicosis. Fermented gruels consisting of cornmeal are a common source for such exposure and are consumed by both children and adults in many countries with a history of frequent, high-level aflatoxin exposure. One proposed method to reduce aflatoxins in the diet is to include a selective enterosorbent, Uniform Particle Size NovaSil (UPSN), as a food additive in contaminated foods. For UPSN to be effective in this capacity, it must be stable in complex, acidic mixtures that are often exposed to heat during the process of fermented gruel preparation. Therefore, the objective of the present study was to test the ability of UPSN to sorb aflatoxin while common cooking conditions were applied. The influence of fermentation, heat treatment, acidity, and processing time were investigated with and without UPSN. Analyses were performed using the field-practical Vicam assay with HPLC verification of trends. Our findings demonstrated that UPSN significantly reduced aflatoxin levels (47-100%) in cornmeal, regardless of processing conditions. Upon comparison of each element tested, time appeared to be the primary factor influencing UPSN efficacy. The greatest decreases in AFB1 were reported in samples allowed to incubate (with or without fermentation) for 72 hrs. This data suggests that addition of UPSN to staple corn ingredients likely to contain aflatoxins would be a sustainable approach to reduce exposure. PMID:24311894

  6. Common African cooking processes do not affect the aflatoxin binding efficacy of refined calcium montmorillonite clay

    PubMed Central

    Elmore, Sarah E.; Mitchell, Nicole; Mays, Travis; Brown, Kristal; Marroquin-Cardona, Alicia; Romoser, Amelia; Phillips, Timothy D.

    2013-01-01

    Aflatoxins are common contaminants of staple crops, such as corn and groundnuts, and a significant cause of concern for food safety and public health in developing countries. Aflatoxin B1 (AFB1) has been implicated in the etiology of acute and chronic disease in humans and animals, including growth stunting, liver cancer and death. Cost effective and culturally acceptable intervention strategies for the reduction of dietary AFB1 exposure are of critical need in populations at high risk for aflatoxicosis. Fermented gruels consisting of cornmeal are a common source for such exposure and are consumed by both children and adults in many countries with a history of frequent, high-level aflatoxin exposure. One proposed method to reduce aflatoxins in the diet is to include a selective enterosorbent, Uniform Particle Size NovaSil (UPSN), as a food additive in contaminated foods. For UPSN to be effective in this capacity, it must be stable in complex, acidic mixtures that are often exposed to heat during the process of fermented gruel preparation. Therefore, the objective of the present study was to test the ability of UPSN to sorb aflatoxin while common cooking conditions were applied. The influence of fermentation, heat treatment, acidity, and processing time were investigated with and without UPSN. Analyses were performed using the field-practical Vicam assay with HPLC verification of trends. Our findings demonstrated that UPSN significantly reduced aflatoxin levels (47-100%) in cornmeal, regardless of processing conditions. Upon comparison of each element tested, time appeared to be the primary factor influencing UPSN efficacy. The greatest decreases in AFB1 were reported in samples allowed to incubate (with or without fermentation) for 72 hrs. This data suggests that addition of UPSN to staple corn ingredients likely to contain aflatoxins would be a sustainable approach to reduce exposure. PMID:24311894

  7. Variation in fungal microbiome (mycobiome) and aflatoxin in stored in-shell peanuts at four different areas of China

    PubMed Central

    Ding, Ning; Xing, Fuguo; Liu, Xiao; Selvaraj, Jonathan N.; Wang, Limin; Zhao, Yueju; Wang, Yan; Guo, Wei; Dai, Xiaofeng; Liu, Yang

    2015-01-01

    The contamination of peanuts with Aspergillus sp. and subsequently aflatoxins is considered to be one of the most serious safety problems in the world. Mycobiome in peanuts is critical for aflatoxin production and food safety. To evaluate the biodiversity and ecological characteristics of whole communities in stored peanuts, the barcoded Illumina paired-end sequencing of the internal transcribed spacer 2 (ITS2) region of rDNA was used to characterize the peanut mycobiome monthly over a period of 1 year at four main peanut grown areas, i.e., Liaoning (LN, North East), Shandong (SD, East), Hubei (HB, Central), and Guangdong (GD, South) provinces. The fungal diversity of peanuts stored in SD was the highest with 98 OTUs and 43 genera, followed by LN, HB and GD. In peanuts stored in SD, Rhizopus, Emericella, and Clonostachys were predominant. In peanuts from LN, Penicillium, Eurotium, and Clonostachys were abundant. In peanuts from HB, Penicillium, Eurotium, and Aspergillus were higher. In GD peanuts, Eurotium, Aspergillus, and Emericella were mainly seen. The abundances of Aspergillus in LN, SD, HB, and GD were 0.53, 6.29, 10.86, and 25.75%, respectively. From the North of China to the South, that increased over the latitude, suggesting that the higher temperature and relative humidity might increase the risk of peanuts contaminated with Aspergillus and aflatoxins. During the storage, Aspergillus levels were higher at 7–12 months than in 0–6 months, suggesting that the risk increases over storage time. At 7–10 months, AFB1 was higher in four areas, while declined further. The reduction of AFB1 might be attributed to the inhibition and degradation of AFB1 by Aspergillus niger or to the combination with the compounds of peanuts. This is the first study that identified the mycobiome and its variation in stored peanuts using ITS2 sequencing technology, and provides the basis for a detailed characterization of whole mycobiome in peanuts. PMID:26557107

  8. Effect of supplementation of fermented milk drink containing probiotic Lactobacillus casei Shirota on the concentrations of aflatoxin biomarkers among employees of Universiti Putra Malaysia: a randomised, double-blind, cross-over, placebo-controlled study.

    PubMed

    Mohd Redzwan, Sabran; Abd Mutalib, Mohd Sokhini; Wang, Jia-Sheng; Ahmad, Zuraini; Kang, Min-Su; Abdul Rahman, Nurul 'Aqilah; Nikbakht Nasrabadi, Elham; Jamaluddin, Rosita

    2016-01-14

    Human exposure to aflatoxin is through the diet, and probiotics are able to bind aflatoxin and prevent its absorption in the small intestine. This study aimed to determine the effectiveness of a fermented milk drink containing Lactobacillus casei Shirota (LcS) (probiotic drink) to prevent aflatoxin absorption and reduce serum aflatoxin B1-lysine adduct (AFB1-lys) and urinary aflatoxin M1 concentrations. The present study was a randomised, double-blind, cross-over, placebo-controlled study with two 4-week intervention phases. In all, seventy-one subjects recruited from the screening stage were divided into two groups--the Yellow group and the Blue group. In the 1st phase, one group received probiotic drinks twice a day and the other group received placebo drinks. Blood and urine samples were collected at baseline, 2nd and 4th week of the intervention. After a 2-week wash-out period, the treatments were switched between the groups, and blood and urine samples were collected at the 6th, 8th and 10th week (2nd phase) of the intervention. No significant differences in aflatoxin biomarker concentrations were observed during the intervention. A within-group analysis was further carried out. Aflatoxin biomarker concentrations were not significantly different in the Yellow group. Nevertheless, ANOVA for repeated measurements indicated that AFB1-lys concentrations were significantly different (P=0·035) with the probiotic intervention in the Blue group. The 2nd week AFB1-lys concentrations (5·14 (SD 2·15) pg/mg albumin (ALB)) were significantly reduced (P=0·048) compared with the baseline (6·24 (SD 3·42) pg/mg ALB). Besides, the 4th week AFB1-lys concentrations were significantly lower (P<0·05) with probiotic supplementation than with the placebo. Based on these findings, a longer intervention study is warranted to investigate the effects of continuous LcS consumption to prevent dietary aflatoxin exposure. PMID:26490018

  9. A systems approach to model the relationship between aflatoxin gene cluster expression, environmental factors, growth and toxin production by Aspergillus flavus

    PubMed Central

    Abdel-Hadi, Ahmed; Schmidt-Heydt, Markus; Parra, Roberto; Geisen, Rolf; Magan, Naresh

    2012-01-01

    A microarray analysis was used to examine the effect of combinations of water activity (aw, 0.995–0.90) and temperature (20–42°C) on the activation of aflatoxin biosynthetic genes (30 genes) in Aspergillus flavus grown on a conducive YES (20 g yeast extract, 150 g sucrose, 1 g MgSO4·7H2O) medium. The relative expression of 10 key genes (aflF, aflD, aflE, aflM, aflO, aflP, aflQ, aflX, aflR and aflS) in the biosynthetic pathway was examined in relation to different environmental factors and phenotypic aflatoxin B1 (AFB1) production. These data, plus data on relative growth rates and AFB1 production under different aw × temperature conditions were used to develop a mixed-growth-associated product formation model. The gene expression data were normalized and then used as a linear combination of the data for all 10 genes and combined with the physical model. This was used to relate gene expression to aw and temperature conditions to predict AFB1 production. The relationship between the observed AFB1 production provided a good linear regression fit to the predicted production based in the model. The model was then validated by examining datasets outside the model fitting conditions used (37°C, 40°C and different aw levels). The relationship between structural genes (aflD, aflM) in the biosynthetic pathway and the regulatory genes (aflS, aflJ) was examined in relation to aw and temperature by developing ternary diagrams of relative expression. These findings are important in developing a more integrated systems approach by combining gene expression, ecophysiological influences and growth data to predict mycotoxin production. This could help in developing a more targeted approach to develop prevention strategies to control such carcinogenic natural metabolites that are prevalent in many staple food products. The model could also be used to predict the impact of climate change on toxin production. PMID:21880616

  10. Molecular cloning and heterologous expression of a cDNA encoding a mouse glutathione S-transferase Yc subunit possessing high catalytic activity for aflatoxin B1-8,9-epoxide.

    PubMed Central

    Hayes, J D; Judah, D J; Neal, G E; Nguyen, T

    1992-01-01

    Resistance to the carcinogenic effects of aflatoxin B1 (AFB1) in the mouse is due to the constitutive expression of an Alpha-class glutathione S-transferase (GST), YcYc, with high detoxification activity towards AFB1-8,9-epoxide. A cDNA clone (pmusGST Yc) for a murine GST Yc polypeptide has been isolated. Sequencing has shown the cDNA insert of pmusGST Yc to be 922 bp in length, with an open reading frame of 663 bp that encodes a polypeptide of M(r) 25358. The primary structure of the murine GST Yc subunit predicted by pmusGST Yc is in complete agreement with the partial amino acid sequence of the aflatoxin-metabolizing mouse liver GST described previously [McLellan, Kerr, Cronshaw & Hayes (1991) Biochem. J. 276, 461-469]. A plasmid, termed pKK-musGST Yc, which permits the expression of the murine Yc subunit in Escherichia coli, has been constructed. The murine GST expressed in E. coli was purified and found to be catalytically active towards several GST substrates, including AFB1-8,9-epoxide. This enzyme was also found to possess electrophoretic and immunochemical properties closely similar to those of the GST Yc subunit from mouse liver. However, the GST synthesized in E. coli and the constitutive mouse liver Alpha-class GST exhibited small differences in their chromatographic behaviour during reverse-phase h.p.l.c. Automated Edman degradation revealed alanine to be the N-terminal amino acid in the GST Yc subunit expressed in E. coli, whereas the enzyme in mouse liver possesses a blocked N-terminus. Although sequencing showed that the purified Yc subunit from E. coli lacked the initiator methionine, the amino acid sequence obtained over the first eleven N-terminal residues agreed with that predicted from the cDNA clone, pmusGST Yc. Comparison of the deduced amino acid sequence of the mouse Yc polypeptide with the primary structures of the rat Alpha-class GST enzymes revealed that it is more closely related to the ethoxyquin-induced rat liver Yc2 subunit than to

  11. Determinants of formation of aflatoxin-albumin adducts: a seven-township study in Taiwan

    PubMed Central

    Sun, C-A; Wu, D-M; Wang, L-Y; Chen, C-J; You, S-L; Santella, R M

    2002-01-01

    Dietary exposure to aflatoxins is one of the major risk factors for hepatocellular carcinoma. Individual susceptibility to aflatoxin-induced hepatocarcinogenesis may be modulated by both genetic and environmental factors affecting metabolism. A cross-sectional study was performed to evaluate determinants of the formation of aflatoxin covalently bound to albumin (AFB1-albumin adducts). A total of 474 subjects who were free of liver cancer and cirrhosis and were initially selected as controls for previous case–control studies of aflatoxin-induced hepatocarcinogenesis in Taiwan, were employed in this study. Aflatoxin-albumin adducts were determined by competitive enzyme-linked immunosorbent assay, hepatitis B surface antigen and antibodies to hepatitis C virus by enzyme immunoassay, as well as genotypes of glutathione S-transferase M1-1 and T1-1 by polymerase chain reaction. The detection rate of AFB1-albumin adducts was significantly higher in males (42.5%) than in females (21.6%) (multivariate-adjusted odds ratio=2.6, 95% confidence interval=1.4–5.0). The formation of detectable albumin adducts was moderately higher in hepatitis B surface antigen carriers (42.8%) than in non-carriers (36.6%) (multivariate-adjusted odds ratio=1.4, 95% confidence interval=1.0–2.1). In addition, the detection rate of AFB1-albumin adducts tended to increase with the increasing number of null genotypes of glutathione S-transferase M1-1 and glutathione S-transferase T1-1. In conclusion, this cross-sectional study has assessed the relative contributions of environmental exposure and host susceptibility factors in the formation of AFB1-albumin adducts in a well characterised Chinese adult population. This study further emphasises the necessity to reduce aflatoxin exposure in people living in an area endemic for chronic hepatitis B virus infection. British Journal of Cancer (2002) 87, 966–970. doi:10.1038/sj.bjc.6600584 www.bjcancer.com © 2002 Cancer Research UK PMID:12434285

  12. Protective effect of Ocimum sanctum on 3-methylcholanthrene, 7,12-dimethylbenz(a)anthracene and aflatoxin B1 induced skin tumorigenesis in mice

    SciTech Connect

    Rastogi, Shipra; Shukla, Yogeshwer; Paul, Bhola N.; Chowdhuri, D. Kar; Khanna, Subhash K.; Das, Mukul

    2007-11-01

    A study on the protective effect of alcoholic extract of the leaves of Ocimum sanctum on 3-mthylcholanthrene (MCA), 7,12-dimethylbenzanthracene (DMBA) and aflatoxin B{sub 1} (AFB{sub 1}) induced skin tumorigenesis in a mouse model has been investigated. The study involved pretreatment of mice with the leaf extract prior to either MCA application or tetradecanoyl phorbol acetate (TPA) treatment in a two-stage tumor protocol viz a viz, DMBA/TPA and AFB1/TPA. The results of the present study indicate that the pretreatment with alcoholic extract of the leaves of O. sanctum decreased the number of tumors in MCA, DMBA/TPA and AFB1/TPA treated mice. The skin tumor induced animals pretreated with alcoholic extract led to a decrease in the expression of cutaneous {gamma}-glutamyl transpeptidase (GGT) and glutathione-S-transferase-P (GST-P) protein. The histopathological examination of skin tumors treated with leaf extract showed increased infiltration of polymorphonuclear, mononuclear and lymphocytic cells, decreased ornithine decarboxylase activity with concomitant enhancement of interleukin-1{beta} (IL-1{beta}) and tumor necrosis factor-{alpha} (TNF-{alpha}) in the serum, implying the in vivo antiproliferative and immunomodulatory activity of leaf extract. The decrease in cutaneous phase I enzymes and elevation of phase II enzymes in response to topical application of leaf extract prior to MCA, AFB1, DMBA/TPA and AFB1/TPA treatment indicate the possibility of impairment in reactive metabolite(s) formation and thereby reducing skin carcinogenicity. Furthermore, pretreatment of leaf extract in the carcinogen induced animals resulted in elevation of glutathione levels and decrease in lipid peroxidation along with heat shock protein expression, indicating a scavenging or antioxidant potential of the extract during chemical carcinogenesis. Thus it can be concluded that leaf extract of O. sanctum provides protection against chemical carcinogenesis in one or more of the

  13. Occurrence of aflatoxin M1 in urines from rural and urban adult cohorts in Bangladesh.

    PubMed

    Ali, Nurshad; Hossain, Khaled; Blaszkewicz, Meinolf; Rahman, Mashiur; Mohanto, Nayan Chandra; Alim, Abdul; Degen, Gisela H

    2016-07-01

    Aflatoxins are important mycotoxins produced by Aspergillus flavus and A. parasiticus, moulds which contaminate mainly grains and nuts, especially in hot and humid climate. Presence of aflatoxin B1 (AFB1), the most toxic one and a potent hepatocarcinogen, has been reported in food and feed in Bangladesh and raised concerns about mycotoxin exposure in the population. Biomonitoring provides the best approach to assess human exposure from various sources and by all routes. Part of the ingested AFB1 is converted in the body to aflatoxin M1 (AFM1), a metabolite that has served as biomarker of AFB1 exposure, as it is excreted in urine, and thus enables non-invasive sampling, a relevant aspect in field studies. This investigation measured the AFM1 concentration in urines collected from adult residents of a rural (n = 52) and an urban (n = 43) area in the Rajshahi district of Bangladesh. The urinary levels of AFM1 were determined by enzyme-linked immunosorbent assay. AFM1 was detected in 46 % of all urine samples at a range of 31-348 pg/mL. The median and mean concentration of AFM1 in urine was 61 and 80 ± 60 pg/mL, respectively. A significant difference (p < 0.05) was found at the mean level of AFM1 between the rural (99 ± 71 pg/mL) and urban (54 ± 15 pg/mL) cohort. Urinary AFM1 levels did not show significant correlations with food frequency data or age, gender and body mass index of the participants. Among them, the highest mean AFM1 level (101 ± 71 pg/mL) was observed in the 50-60 years age group. In conclusion, detection frequency and urinary AFM1 levels in the Bangladeshi adults support concerns regarding their dietary exposure to AFB1. These first data warrant further biomarker-based studies in children and in cohorts of other parts of the country. PMID:26391179

  14. MicroRNA393 is involved in nitrogen-promoted rice tillering through regulation of auxin signal transduction in axillary buds

    PubMed Central

    Li, Xiang; Xia, Kuaifei; Liang, Zhen; Chen, Kunling; Gao, Caixia; Zhang, Mingyong

    2016-01-01

    Rice tillering has an important influence on grain yield, and is promoted by nitrogen (N) fertilizer. Several genes controlling rice tillering, which are regulated by poor N supply, have been identified. However, the molecular mechanism associated with the regulation of tillering based on N supply is poorly understood. Here, we report that rice microRNA393 (OsmiR393) is involved in N-mediated tillering by decreasing auxin signal sensitivity in axillary buds. Expression analysis showed that N fertilizer causes up-regulation of OsmiR393, but down-regulation of two target genes (OsAFB2 and OsTB1). In situ expression analysis showed that OsmiR393 is highly expressed in the lateral axillary meristem. OsmiR393 overexpression mimicked N-mediated tillering in wild type Zhonghua 11 (ZH11). Mutation of OsMIR393 in ZH11 repressed N-promoted tillering, which simulated the effects of limited N, and this could not be restored by supplying N fertilizer. Western blot analysis showed that OsIAA6 was accumulated in both OsmiR393-overexpressing lines and N-treated wild type rice, but was reduced in the OsMIR393 mutant. Therefore, we deduced that N-induced OsmiR393 accumulation reduces the expression of OsTIR1 and OsAFB2, which alleviates sensitivity to auxin in the axillary buds and stabilizes OsIAA6, thereby promoting rice tillering. PMID:27574184

  15. The Arabidopsis Auxin Receptor F-Box Proteins AFB4 and AFB5 Are Required for Response to the Synthetic Auxin Picloram

    PubMed Central

    Prigge, Michael J.; Greenham, Kathleen; Zhang, Yi; Santner, Aaron; Castillejo, Cristina; Mutka, Andrew M.; O’Malley, Ronan C.; Ecker, Joseph R.; Kunkel, Barbara N.; Estelle, Mark

    2016-01-01

    The plant hormone auxin is perceived by a family of F-box proteins called the TIR1/AFBs. Phylogenetic studies reveal that these proteins fall into four clades in flowering plants called TIR1, AFB2, AFB4, and AFB6. Genetic studies indicate that members of the TIR1 and AFB2 groups act as positive regulators of auxin signaling by promoting the degradation of the Aux/IAA transcriptional repressors. In this report, we demonstrate that both AFB4 and AFB5 also function as auxin receptors based on in vitro assays. We also provide genetic evidence that AFB4 and AFB5 are targets of the picloram family of auxinic herbicides in addition to indole-3-acetic acid. In contrast to previous studies we find that null afb4 alleles do not exhibit obvious defects in seedling morphology or auxin hypersensitivity. We conclude that AFB4 and AFB5 act in a similar fashion to other members of the family but exhibit a distinct auxin specificity. PMID:26976444

  16. MicroRNA393 is involved in nitrogen-promoted rice tillering through regulation of auxin signal transduction in axillary buds.

    PubMed

    Li, Xiang; Xia, Kuaifei; Liang, Zhen; Chen, Kunling; Gao, Caixia; Zhang, Mingyong

    2016-01-01

    Rice tillering has an important influence on grain yield, and is promoted by nitrogen (N) fertilizer. Several genes controlling rice tillering, which are regulated by poor N supply, have been identified. However, the molecular mechanism associated with the regulation of tillering based on N supply is poorly understood. Here, we report that rice microRNA393 (OsmiR393) is involved in N-mediated tillering by decreasing auxin signal sensitivity in axillary buds. Expression analysis showed that N fertilizer causes up-regulation of OsmiR393, but down-regulation of two target genes (OsAFB2 and OsTB1). In situ expression analysis showed that OsmiR393 is highly expressed in the lateral axillary meristem. OsmiR393 overexpression mimicked N-mediated tillering in wild type Zhonghua 11 (ZH11). Mutation of OsMIR393 in ZH11 repressed N-promoted tillering, which simulated the effects of limited N, and this could not be restored by supplying N fertilizer. Western blot analysis showed that OsIAA6 was accumulated in both OsmiR393-overexpressing lines and N-treated wild type rice, but was reduced in the OsMIR393 mutant. Therefore, we deduced that N-induced OsmiR393 accumulation reduces the expression of OsTIR1 and OsAFB2, which alleviates sensitivity to auxin in the axillary buds and stabilizes OsIAA6, thereby promoting rice tillering. PMID:27574184

  17. The Arabidopsis Auxin Receptor F-Box Proteins AFB4 and AFB5 Are Required for Response to the Synthetic Auxin Picloram.

    PubMed

    Prigge, Michael J; Greenham, Kathleen; Zhang, Yi; Santner, Aaron; Castillejo, Cristina; Mutka, Andrew M; O'Malley, Ronan C; Ecker, Joseph R; Kunkel, Barbara N; Estelle, Mark

    2016-01-01

    The plant hormone auxin is perceived by a family of F-box proteins called the TIR1/AFBs. Phylogenetic studies reveal that these proteins fall into four clades in flowering plants called TIR1, AFB2, AFB4, and AFB6. Genetic studies indicate that members of the TIR1 and AFB2 groups act as positive regulators of auxin signaling by promoting the degradation of the Aux/IAA transcriptional repressors. In this report, we demonstrate that both AFB4 and AFB5 also function as auxin receptors based on in vitro assays. We also provide genetic evidence that AFB4 and AFB5 are targets of the picloram family of auxinic herbicides in addition to indole-3-acetic acid. In contrast to previous studies we find that null afb4 alleles do not exhibit obvious defects in seedling morphology or auxin hypersensitivity. We conclude that AFB4 and AFB5 act in a similar fashion to other members of the family but exhibit a distinct auxin specificity. PMID:26976444

  18. Fungal Aflatoxins Reduce Respiratory Mucosal Ciliary Function.

    PubMed

    Lee, Robert J; Workman, Alan D; Carey, Ryan M; Chen, Bei; Rosen, Phillip L; Doghramji, Laurel; Adappa, Nithin D; Palmer, James N; Kennedy, David W; Cohen, Noam A

    2016-01-01

    Aflatoxins are mycotoxins secreted by Aspergillus flavus, which can colonize the respiratory tract and cause fungal rhinosinusitis or bronchopulmonary aspergillosis. A. flavus is the second leading cause of invasive aspergillosis worldwide. Because many respiratory pathogens secrete toxins to impair mucociliary immunity, we examined the effects of acute exposure to aflatoxins on airway cell physiology. Using air-liquid interface cultures of primary human sinonasal and bronchial cells, we imaged ciliary beat frequency (CBF), intracellular calcium, and nitric oxide (NO). Exposure to aflatoxins (0.1 to 10 μM; 5 to 10 minutes) reduced baseline (~6-12%) and agonist-stimulated CBF. Conditioned media (CM) from A. fumigatus, A. niger, and A. flavus cultures also reduced CBF by ~10% after 60 min exposure, but effects were blocked by an anti-aflatoxin antibody only with A. flavus CM. CBF reduction required protein kinase C but was not associated with changes in calcium or NO. However, AFB2 reduced NO production by ~50% during stimulation of the ciliary-localized T2R38 receptor. Using a fluorescent reporter construct expressed in A549 cells, we directly observed activation of PKC activity by AFB2. Aflatoxins secreted by respiratory A. flavus may impair motile and chemosensory functions of airway cilia, contributing to pathogenesis of fungal airway diseases. PMID:27623953

  19. Aflatoxin B1-induced hepatocellular carcinoma in developing countries: Geographical distribution, mechanism of action and prevention

    PubMed Central

    HAMID, ABDU SELIM; TESFAMARIAM, ISAIAS GOITOM; ZHANG, YUCHENG; ZHANG, ZHEN GUI

    2013-01-01

    Hepatocellular carcinoma (HCC) is the most well-known primary liver malignancy worldwide. Its incidence is rising at alarming rates and has become a public concern globally. It is more frequent in developing countries than in industrialized countries with respect to geographical variation, ethnic disparities and socioeconomic status. Dietary exposure to aflatoxins is among the major HCC risk factors. Aflatoxin B1, which is a genotoxic hepatocarcinogen, which presumptively causes cancer by inducing DNA adducts leading to genetic changes in target liver cells. AFB1 is metabolized by cytochrome-P450 enzymes to the reactive intermediate AFB1-8, 9 epoxide (AFBO) which binds to liver cell DNA, resulting in DNA adducts. DNA adducts interact with the guanine bases of liver cell DNA and cause a mutational effect in the P53 tumor suppressor gene at the codon 249 hotspot in exon 7, which may lead to HCC. Approximately 4.5 billion of the world’s population is exposed to aflatoxin-contaminated food, particularly in low-income countries. Prevention involves treating crops that are susceptible to fungal contamination, appropriate handling of foodstuffs and the use of chemopreventive intervention. Moreover, an integrated network collaboration of different sectors, including public health, agricultural departments and mass media, is required to ensure effective food regulation systems so as to minimize the contamination of food by aflatoxins. PMID:23599745

  20. Correlation between mixed-function oxidase enzyme induction and aflatoxin B1-induced unscheduled DNA synthesis in the chick embryo, in vivo.

    PubMed

    Hamilton, J W; Bloom, S E

    1984-01-01

    The unscheduled DNA synthesis (UDS) technique has been adapted for use in the chick embryo, in vivo, to determine the relationship between induction of the mixed-function oxidase (MFO) enzyme system and genetic damage from an indirect-acting mutagen-carcinogen. Embryos were injected at 6 days of incubation (DI) with either phenobarbital (PB), a specific inducer of P-450-associated enzyme activities, or 3,4,3',4'-tetrachlorobiphenyl (TCB), a specific inducer of P1-450-associated enzyme activities. Aflatoxin B1 (AFB1) was injected 24 hr later (7 DI), followed by a 5-hr continuous 3H-thymidine exposure. The livers were removed, prepared for autoradiography, and hepatocytes were scored for an increase in grains/nucleus, indicative of UDS. Aflatoxin B1 caused a dose-related increase in UDS in all control and induction groups. Phenobarbital-induced embryos had an increased UDS response while TCB-induced embryos had a decreased UDS response, relative to noninduced embryos, for each dosage of AFB1. This suggests that the genotoxicity of an indirect-acting mutagen-carcinogen can be either increased or decreased, in vivo, depending on the inducer used. The chick embryo provides an excellent system for studying the effect of MFO induction on the genotoxicity of promutagen-carcinogens in a developing system. PMID:6420149

  1. The role of aflatoxin-contaminated food materials and HCV in developing hepatocellular carcinoma in Al-Sharkia Governorate, Egypt.

    PubMed

    Hifnawy, M S; Mangoud, Amal M; Eissa, Mostafa H; Nor Edin, Essam; Mostafa, Yousry; Abouel-Magd, Yousry; Sabee, Essam I; Amin, Ibrahem; Ismail, Alla; Morsy, Tosson A; Mahrous, Seham; Afefy, Afefy F; el-Shorbagy, Eman; el-Sadawy, Mohamoud; Ragab, Hosenia; Hassan, Mostafa I; el-Hady, Gaber; Saber, Mohamoud

    2004-04-01

    Aflatoxins, particularly aflatoxin B1 (AFB1) have been recognized as one of the most potent chemical carcinogen. In Egypt, HCV is prevalent. The progressive nature of HCV-related liver diseases was found to be influenced by other factors. In this paper, the role of aflatoxin contamination in the onset of liver cancer in HCV-infected patients was studied. The quantitative identification of the possible aflatoxins contamination in six urban and eleven rural areas using high performance liquid chromatography technique, revealed that corn, wheat, pea nut, lupine "termis", white rice, cowpea "lobiya", fava bean and brown rice showed the prevalence of AFB1 to be 64.7%, 53%, 53%, 47%, 47%, 41%, 29.4% & 29.4% respectively. A positive correlation was found between aflatoxin and positive HCV-PCR together with liver disease progression to G3S3, the indicative of hepatocellular carcinoma. Such correlation was not fully understood, but the oncogene amplification caused by HCV-infection may be aggravated by the consumption of aflatoxin contaminated raw food materials or their products. PMID:15124754

  2. Antioxidant capacity and antimutagenic activity of natural oleoresin from greenhouse grown tomatoes (Lycopersicon esculentum).

    PubMed

    Rodríguez-Muñoz, Eustolia; Herrera-Ruiz, Gilberto; Pedraza-Aboytes, Gustavo; Loarca-Piña, Guadalupe

    2009-03-01

    Natural oleoresins rich in lycopene were obtained from two varieties of tomato (Zedona and Gironda) and their nutraceutical potential (antioxidant and antimutagenic capacity) was evaluated. Both oleoresins had a high content of lycopene, 58.33+/-1.67 mg/g (Zedona) and 63.97+/-0.80 mg/g (Gironda). The antioxidant activity (AA) of the oleoresins by beta-carotene method were 56.4-74.5% (Zedona) and 51-72.8% (Gironda), while when using the free radical stable 2,2-diphenyl-picryl-hydrazyl (DPPH) method, the antiradical activity (ARA) was determined to be 18.2-32.7% (Zedona) and 16.6-26.7% (Gironda) for the concentrations tested that of 200-400 microM equivalents of lycopene. The antimutagenic activity of the oleoresins was tested against aflatoxin B1 (AFB1) using the microsuspension assay, both varieties had a very high antimutagenic potential against AFB1 (60-66%).These results suggest the NCRT can be taken advantage to obtaining rich oleoresin in lycopene with a nutraceutical value. PMID:19020978

  3. Synthesis of improved upconversion nanoparticles as ultrasensitive fluorescence probe for mycotoxins.

    PubMed

    Chen, Quansheng; Hu, Weiwei; Sun, Cuicui; Li, Huanhuan; Ouyang, Qin

    2016-09-28

    Rare earth-doped upconversion nanoparticles (UCNPs) have promising potentials in biodetection due to their unique frequency upconverting capability and high detection sensitivity. This paper reports an improved UCNPs-based fluorescence probe for dual-sensing of Aflatoxin B1 (AFB1) and Deoxynivalenol (DON) using a magnetism-induced separation and the specific formation of antibody-targets complex. Herein, the improved UCNPs, which were namely NaYF4:Yb/Ho/Gd and NaYF4:Yb/Tm/Gd, were systematically studied based on the optimization of reaction time, temperature and the concentration of dopant ions with simultaneous phase and size controlled NaYF4 nanoparticles; and the targets were detected using the pattern of competitive combination assay. Under an optimized condition, the advanced fluorescent probes revealed stronger fluorescent properties, broader biological applications and better storage stabilities compared to traditional UCNPs-based ones; and ultrasensitive determinations of AFB1 and DON were achieved under a wide sensing range of 0.001-0.1 ng ml(-1) with the limit of detection (LOD) of 0.001 ng ml(-1). Additionally, the applicability of the improved nanosensor for the detection of mycotoxins was also confirmed in adulterated oil samples. PMID:27619096

  4. Single-compound and cumulative risk assessment of mycotoxins present in breakfast cereals consumed by children from Lisbon region, Portugal.

    PubMed

    Assunção, Ricardo; Vasco, Elsa; Nunes, Baltazar; Loureiro, Susana; Martins, Carla; Alvito, Paula

    2015-12-01

    Humans can be exposed to multiple chemicals, but current risk assessment is usually carried out on one chemical at a time. Mycotoxins are commonly found in a variety of foods including those intended to consumption by children namely breakfast cereals. The present study aims to perform, the risk assessment of single and multiple mycotoxins present in breakfast cereals consumed by children (1-3 years old) from Lisbon region, Portugal. Daily exposure of children to ochratoxin A, fumonisins and trichothecenes showed no health risks to the children population considering individual mycotoxins, while exposure to aflatoxin B1 (AFB1) suggested a potential health concern for the high percentiles of intake (P90, P95 and P99). The combined exposure to fumonisins and trichothecenes are not expected to be of health concern. The combined margin of exposure (MoET) for the aflatoxins group could constitute a potential health concern and AFB1 was the main contributor for MoET. Legal limits and control strategies regarding the presence of multiple mycotoxins in foodstuffs is an urgent need. To the best of our knowledge, this is the first time a cumulative risk assessment was performed on multiple mycotoxins present in breakfast cereals consumed by children. PMID:26545619

  5. The antioxidant and antigenotoxic potential of methanol extract of Cladonia foliacea (Huds.) Willd.

    PubMed

    Anar, Mustafa; Orhan, Furkan; Alpsoy, Lokman; Gulluce, Medine; Aslan, Ali; Agar, Guleray

    2016-04-01

    In this article, the genotoxic and antigenotoxic effects of methanol extract of of Cladonia foliacea (Huds.) Willd. (CME) were studied using WP2, Ames (TA1535 and TA1537), and sister chromatid exchange (SCE) test systems. The results of our studies showed that 5 µM concentration of aflatoxin B1(AFB1) changed the frequencies of SCE and malondialdehyde (MDA) levels, superoxide dismutase (SOD), glutathione (GSH), and glutathione peroxidase (GPx) activities. When 5 and 10 µg/mL concentrations of CME was added to AFB1, the frequencies of SCE and MDA level were decreased and SOD, GSH, and GPx levels were increased. The extract CME did not show any mutagenicity on Ames (Salmonella typhimurium TA1535, TA1537) and WP2 (Escherichia coli) test systems. On the other hand, CME has antimutagenicity on the mentioned test systems. The results of this experiment have clearly shown that CME has a significant antioxidative and antigenotoxic effect, which is thought to be due to the antigenotoxic activities of antioxidant enzymes. PMID:24193055

  6. Nanocapsular dispersion of cinnamaldehyde for enhanced inhibitory activity against aflatoxin production by Aspergillus flavus.

    PubMed

    Li, Hongbo; Shen, Qingshan; Zhou, Wei; Mo, Haizhen; Pan, Daodong; Hu, Liangbin

    2015-01-01

    Cinnamaldehyde (CA) is marginally soluble in water, making it challenging to evenly disperse it in foods, and resulting in lowered anti-A. flavus efficacy. In the present study, nano-dispersed CA (nano-CA) was prepared to increase its aqueous solubility. Free and nano-dispersed CA were compared in terms of their inhibitory activity against fungal growth and aflatoxin production of A. flavus both in Sabouraud Dextrose (SD) culture and in peanut butter. Our results indicated that free CA inhibited the mycelia growth and aflatoxin production of A. flavus with a minimal inhibitory concentration (MIC) value of 1.0 mM, but promoted the aflatoxin production at some concentrations lower than the MIC. Nano-CA had a lower MIC value of 0.8 mM against A. flavus, and also showed improved activity against aflatoxin production without the promotion at lower dose. The solidity of peanut butter had an adverse impact on the antifungal activity of free CA, whereas nano-dispersed CA showed more than 2-fold improved activity against the growth of A. flavus. Free CA still promoted AFB1 production at the concentration of 0.25 mM, whereas nano-CA showed more efficient inhibition of AFB1 production in the butter. PMID:25853318

  7. Effects of temperature, water activity and incubation time on fungal growth and aflatoxin B1 production by toxinogenic Aspergillus flavus isolates on sorghum seeds.

    PubMed

    Lahouar, Amani; Marin, Sonia; Crespo-Sempere, Ana; Saïd, Salem; Sanchis, Vicente

    2016-01-01

    Sorghum, which is consumed in Tunisia as human food, suffers from severe colonization by several toxigenic fungi and contamination by mycotoxins. The Tunisian climate is characterized by high temperature and humidity that stimulates mold proliferation and mycotoxin accumulation in foodstuffs. This study investigated the effects of temperature (15, 25 and 37°C), water activity (aw, between 0.85 and 0.99) and incubation time (7, 14, 21 and 28 d) on fungal growth and aflatoxin B1 (AFB1) production by three Aspergillus flavus isolates (8, 10 and 14) inoculated on sorghum grains. The Baranyi model was applied to identify the limits of growth and mycotoxin production. Maximum diameter growth rates were observed at 0.99 a(w) at 37°C for two of the isolates. The minimum aw needed for mycelial growth was 0.91 at 25 and 37°C. At 15°C, only isolate 8 grew at 0.99 a(w). Aflatoxin B1 accumulation could be avoided by storing sorghum at low water activity levels (≤0.91 a(w)). Aflatoxin production was not observed at 15°C. This is the first work on the effects of water activity and temperature on A. flavus growth and AFB1 production by A. flavus isolates on sorghum grains. PMID:26920121

  8. The major volatile compound 2-phenylethanol from the biocontrol yeast, Pichia anomala, inhibits growth and expression of aflatoxin biosynthetic genes of Aspergillus flavus.

    PubMed

    Hua, Sui Sheng T; Beck, John J; Sarreal, Siov Bouy L; Gee, Wai

    2014-05-01

    Aspergillus flavus is a ubiquitous saprophyte that is able to produce the most potent natural carcinogenic compound known as aflatoxin B1 (AFB1). This toxin frequently contaminates crops including corn, cotton, peanuts, and tree nuts causing substantial economic loss worldwide. Consequently, more than 100 countries have strict regulations limiting AFB1 in foodstuffs and feedstuffs. Plants and microbes are able to produce volatile compounds that act as a defense mechanism against other organisms. Pichia anomala strain WRL-076 is a biocontrol yeast currently being tested to reduce AF contamination of tree nuts in California. We used the SPME-GC/MS analysis and identified the major volatile compound produced by this strain to be 2-phenylethanol (2-PE). It inhibited spore germination and AF production of A. flavus. Inhibition of AF formation by 2-PE was correlated with significant down regulation of clustering AF biosynthesis genes as evidenced by several to greater than 10,000-fold decrease in gene expression. In a time-course analysis we found that 2-PE also altered the expression patterns of chromatin modifying genes, MYST1, MYST2, MYST3, gcn5, hdaA and rpdA. The biocontrol capacity of P. anomala can be attributed to the production of 2-PE, which affects spore germination, growth, toxin production, and gene expression in A. flavus. PMID:24504634

  9. Ameliorative Effects of Tinospora Cordifolia Root Extract on Histopathological and Biochemical Changes Induced by Aflatoxin-B1 in Mice Kidney

    PubMed Central

    Gupta, Rekha; Sharma, Veena

    2011-01-01

    The present study was planned to investigate the ability of the Tinospora cordifolia to scavenge free radicals generated during aflatoxicosis. A total no. of 48 male Swiss albino mice (30 ± 5 g) were exposed to Aflatoxin B1(AFB1) (2 μg/30 g b.wt, orally) either individually or in combination with T. cordifolia (50, 100, 200 mg/kg, orally) once daily for 25 days. AFB1 exposure led to significant rise in thiobarbituric acid reactive substances (TBARS) and fall in superoxide dismutase (SOD), catalase (CAT), reduced glutathione (GSH), glutathione-S-transferase (GST), glutathione peroxidase (GPx), glutathione reductase (GR), ascorbic acid, and protein content. T. cordifolia was found to show protective effect by lowering down the content of TBARS and enhancing the GSH, ascorbic acid, protein, and the activities of antioxidant enzymes viz., SOD, CAT, glutathione peroxidase, GST, and GR in kidney. Histopathological analysis of kidney samples also confirmed the protective values and antioxidant activity of ethanolic extract of herb. T. cordifolia showed protection against aflatoxin-induced nephrotoxicity due to the presence of alkaloids such as a choline, tinosporin, isocolumbin, palmatine, tetrahydropalmatine, and magnoflorine. PMID:21976812

  10. Multi-component immunochromatographic assay for simultaneous detection of aflatoxin B1, ochratoxin A and zearalenone in agro-food.

    PubMed

    Li, Xin; Li, Peiwu; Zhang, Qi; Li, Ran; Zhang, Wen; Zhang, Zhaowei; Ding, Xiaoxia; Tang, Xiaoqian

    2013-11-15

    Mycotoxins are highly toxic contaminants and have induced health threat to human and animals. Aflatoxin B1 (AFB1), ochratoxin A (OTA) and zearalenone (ZEA) commonly occur in food and feed. A multi-component immunochromatographic assay (ICA) was developed for rapid and simultaneous determination of these three mycotoxins in agro-food. The strategy was performed based on the competitive immunoreactions between antibody-colloidal gold nanoparticle conjugate probes and mycotoxins or mycotixin antigens. Each monoclonal antibody specially recognize its corresponding mycotoxin and antigen, and there was no cross reactivity in the assay. Three mycotixin antigens were immobilized as three test lines in the nitrocellulose membrane reaction zone, which enable the simultaneous detection in one single test. The visible ICA results were obtained in 20 min. The visual detection limits of this strip test for the AFB1, OTA and ZEA were 0.25 ng/mL, 0.5 ng/mL and 1 ng/mL, respectively. The assay was evaluated using spiked and naturally contaminated peanuts, maize and rice samples. The results were in accordance with those obtained using enzyme-linked immunosorbent assay. In summary, this developed ICA could provide an effective and rapid approach for onsite detection of multi-mycotoxin in agro-food samples without any expensive instrument. PMID:23807236

  11. Application of lactic acid bacteria in removing heavy metals and aflatoxin B1 from contaminated water.

    PubMed

    Elsanhoty, Rafaat M; Al-Turki, I A; Ramadan, Mohamed Fawzy

    2016-01-01

    In this study selected lactic acid bacteria (LAB, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus plantrium and Streptococcus thermophiles) and probiotic bacteria (Bifidobacterium angulatum) were tested for their ability in removing heavy metals (HM) including cadmium (Cd), lead (Pb) and arsenic (As) as well as aflatoxin B1 (AFB1) from contaminated water. The biosorption parameters (pH, bacterial concentration, contact time and temperature) of removal using individual as well as mixed LAB and probiotic bacteria were studied. Removal of HM and AFB1 depended on the strain, wherein the process was strongly pH-dependent with high removal ability at a pH close to neutral. The increase in bacterial concentration enhanced the removal of Cd, Pb and As. Also, increasing of contact time and temperature increased the ability of LAB to remove HM. The effect of contact time on Cd removal was slightly different when freshly cultured cells were used. The removal of Cd, Pb and As decreased with the increase in the initial metal concentration. The most effective HM removers were Lactobacillus acidophilus and Bifidobacterium angulatum. The system was found to be adequate for concentrations of HM under investigation. At the end of the operation, the concentration of HM reached the level allowed by the World Health Organization regulations. PMID:27508367

  12. Effect of Carum copticum essential oil on growth and aflatoxin formation by Aspergillus strains.

    PubMed

    Kazemi, M

    2015-01-01

    The objectives of this study were to determine the antiaflatoxin B1 activity in vitro of the essential oil (EO) extracted from the seeds of Carum copticum and to evaluate its antifungal activity in vivo as a potential food preservative. The C. copticum EO exhibited noticeable inhibition on dry mycelium and synthesis of aflatoxin B1 (AFB1) by Aspergillus flavus, completely inhibiting AFB1 production at 4 μL/mL. C. copticum EOs showed the lowest percentages of decayed cherry tomatoes for all fungi compared with the control at 100 μL/mL with values of 5.01 ± 67% for A. flavus and 5.98 ± 54% for Aspergillus niger. The results indicated that the percentage of infected fruits is significantly (p < 0.01) reduced by the EO at 16°C for 30 days. In this case, the oil at 100 μL/mL concentration showed the highest inhibition of fungal infection with a value of 80.45% compared with the control. Thus, the EO of dill could be used to control food spoilage and as a potential source of food preservative. PMID:25342249

  13. Aflatoxin B1 induced hepatic neoplasia in Great Lakes coho salmon

    SciTech Connect

    Black, J.J.; Maccubbin, A.E.; Myers, H.K.; Zeigel, R.F.

    1988-11-01

    There is considerable interest in the development of fish models for carcinogen bioassays and the study of chemically induced cancer in wild fish species. Among salmonid species, rainbow trout have mainly been used for carcinogenesis research, in part due to the role played by this species in the discovery of the carcinogenic action of aflatoxin B1 (AFB1). Recently, apparatus and methodology for microinjection of salmonid fish embryos with chemical carcinogens has been described. Because eggs produced by Pacific salmon are relatively much larger than those of rainbow trout, they would provide an attractive subject for embryo microinjection. The Great Lakes are annually stocked with large numbers of coho salmon. It has been recommended to use coho salmon as an indicator for monitoring ecosystem health in the Great Lakes, because stockings throughout health in the Great Lakes, because stockings throughout the Great Lakes are from a common genetic strain and in the lake environment they have a defined food source and life cycle. These considerations led the authors to test coho salmon for their sensitivity to the potent hepatocarcinogen, AFB1. The present report describes in preliminary form, the results of these experiments.

  14. Infants’ Exposure to Aflatoxin M1 from Mother’s Breast Milk in Iran

    PubMed Central

    Ghiasian, SA; Maghsood, AH

    2012-01-01

    Background The occurrence of aflatoxin M1 (AFM1) in milk, especially breast milk, is a valuable biomarker for exposure determination to aflatoxin B1 (AFB1). In the present study, the risk of exposure to AFM1 in infants fed breast milk was investigated. Methods: An enzyme-linked immunosorbent assay (ELISA) was used for the analysis of AFM1 in breast milk samples from 132 lactating mothers referred to four urban Mothers and Babies Care Unit of Hamadan, western Iran. Results: AFM1 was detected in eight samples (6.06%) at mean concentration of 9.45 ng/L. The minimum and maximum of concentration was 7.1 to 10.8 ng/L, respectively. Although the concentration of AFM1 in none of the samples was higher than the maximum tolerance limit accepted by USA and European Union (25 ng/kg) however, 25% had a level of AFM1 above the allowable level of Australia and Switzerland legal limit (10 ng/L). Conclusions: Lactating mothers and infants in western parts of Iran could be at risk for AFB1 and AFM1 exposure, respectively. Considering all this information, the investigation of AFM1 in lactating mothers as a biomarker for post-natal exposure of infants to this carcinogen deserves further studies in various seasons and different parts of Iran. PMID:23113156

  15. Inhibition of aflatoxin metabolism and growth of Aspergillus flavus in liquid culture by a DNA methylation inhibitor.

    PubMed

    Yang, Kunlong; Zhuang, Zhenhong; Zhang, Feng; Song, Fengqin; Zhong, Hong; Ran, Fanlei; Yu, Song; Xu, Gaopo; Lan, Faxiu; Wang, Shihua

    2015-01-01

    Aflatoxins (AFs) are a group of highly oxygenated polyketidese-derived toxins mainly produced by Aspergillus flavus and A. parasiticus, whose biosynthesis mechanisms are extremely sophisticated. Methylation is known as the major form of epigenetic regulation, which is correlated with gene expression. As the DNA methylation inhibitor 5-azacytidine (5-AC) blocks AF production, we studied AFB1 metabolism and morphological changes of A. flavus by treatment with 5-AC in liquid culture. The results show that 5-AC caused a decrease in AF production and concurrent changes in morphology. In addition, we isolated a non-aflatoxigenic mutant of A. flavus, showing a significant reduction in pigment production, after 5-AC treatment. This mutant showed significant reduction in the expression of genes in the AF biosynthesis pathway, and conidia formation. Furthermore, as AF biosynthesis and oxidative stress are intimately related events, we assessed the viability of A. flavus to oxidative stress after treatment with 5-AC, which showed that the mutant was more sensitive to the strong oxidant hydrogen peroxide. We found that the non-aflatoxigenic mutant showed a decrease in reactive oxygen species (ROS) and metabolites indicative of oxidative stress, which may be caused by the disruption of the defence system against excessive ROS formation after 5-AC treatment. These data indicate that 5-AC, as an inactivator of DNA methyltransferase, plays a very important role in AFB1 metabolism and the development of A. flavus, which might provide an effective strategy to pre- or post-harvest control of AFs. PMID:25312249

  16. Investigations on the Antifungal Effect of Nerol against Aspergillus flavus Causing Food Spoilage

    PubMed Central

    Tian, Jun; Zeng, Xiaobin; Zeng, Hong; Feng, Zhaozhong; Miao, Xiangmin; Peng, Xue

    2013-01-01

    The antifungal efficacy of nerol (NEL) has been proved against Aspergillus flavus by using in vitro and in vivo tests. The mycelial growth of A. flavus was completely inhibited at concentrations of 0.8 μL/mL and 0.1 μL/mL NEL in the air at contact and vapor conditions, respectively. The NEL also had an evident inhibitory effect on spore germination in A. flavus along with NEL concentration as well as time-dependent kinetic inhibition. The NEL presented noticeable inhibition on dry mycelium weight and synthesis of aflatoxin B1 (AFB1) by A. flavus, totally restraining AFB1 production at 0.6 μL/mL. In real food system, the efficacy of the NEL on resistance to decay development in cherry tomatoes was investigated in vivo by exposing inoculated and control fruit groups to NEL vapor at different concentration. NEL vapors at 0.1 μL/mL air concentration significantly reduced artificially contaminated A. flavus and a broad spectrum of fungal microbiota. Results obtained from presented study showed that the NEL had a great antifungal activity and could be considered as a benefit and safe tool to control food spoilage. PMID:24453813

  17. Mycotoxin contamination of home-grown maize in rural northern South Africa (Limpopo and Mpumalanga Provinces).

    PubMed

    Mngqawa, P; Shephard, G S; Green, I R; Ngobeni, S H; de Rijk, T C; Katerere, D R

    2016-01-01

    The aim of this study was to assess mycotoxin contamination of crops grown by rural subsistence farmers over two seasons (2011 and 2012) in two districts, Vhembe District Municipality (VDM, Limpopo Province) and Gert Sibande District Municiality (GSDM, Mpumalanga Province), in northern South Africa and to evaluate its impact on farmers' productivity and human and animal health. A total of 114 maize samples were collected from 39 households over the two seasons and were analysed using a validated liquid chromatography-tandem mass spectrometry mycotoxins method. Aflatoxin B1 (AFB1) occurrence ranged from 1 to 133 µg kg(-1) in VDM while AFB1 levels in GSDM were less than 1.0 µg kg(-1) in all maize samples. Fumonisin B1 levels ranged from 12 to 8514 µg kg(-1) (VDM) and 11-18924 µg kg(-1) (GSDM) in 92% and 47% positive samples, respectively, over both seasons. Natural occurrence and contamination with both fumonisins and aflatoxins in stored home-grown maize from VDM was significantly (p < 0.0001) higher than from GSDM over both seasons. PMID:26600208

  18. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators.

    PubMed

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui

    2016-05-14

    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples. PMID:27119550

  19. Effect of climate change on Aspergillus flavus and aflatoxin B1 production

    PubMed Central

    Medina, Angel; Rodriguez, Alicia; Magan, Naresh

    2014-01-01

    This review considers the available information on the potential impact of key environmental factors and their interactions on the molecular ecology, growth and aflatoxin production by Aspergillus flavus in vitro and in maize grain. The recent studies which have been carried out to examine the impact of water activity × temperature on aflatoxin biosynthesis and phenotypic aflatoxin production are examined. These have shown that there is a direct relationship between the relative expression of key regulatory and structural genes under different environmental conditions which correlate directly with aflatoxin B1 production. A model has been developed to integrate the relative expression of 10 biosynthetic genes in the pathway, growth and aflatoxin B1 (AFB1) production which was validated under elevated temperature and water stress conditions. The effect of interacting conditions of aw × temperature × elevated CO2 (2 × and 3 × existing levels) are detailed for the first time. This suggests that while such interacting environmental conditions have little effect on growth they do have a significant impact on aflatoxin biosynthetic gene expression (structural aflD and regulatory aflR genes) and can significantly stimulate the production of AFB1. While the individual factors alone have an impact, it is the combined effect of these three abiotic factors which have an impact on mycotoxin production. This approach provides data which is necessary to help predict the real impacts of climate change on mycotoxigenic fungi. PMID:25101060

  20. Aflatoxin metabolism in humans: detection of metabolites and nucleic acid adducts in urine by affinity chromatography

    SciTech Connect

    Groopman, J.D.; Donahue, P.R.; Zhu, J.Q.; Chen, J.S.; Wogan, G.N.

    1985-10-01

    A high-affinity IgM monoclonal antibody specific for aflatoxins was covalently bound to Sepharose 4B and used as a preparative column to isolate aflatoxin derivatives from the urine of people and experimental animals who had been exposed to the carcinogen environmentally or under laboratory conditions. Aflatoxin levels were quantified by radioimmunoassay and high-performance liquid chromatography after elution from the affinity column. In studies on rats injected with ( UC)aflatoxin B1, the authors identified the major aflatoxin-DNA adduct, 2,3-dihydro-2-(N7-guanyl)-3-hydroxy-aflatoxin B1 (AFB1-N7-Gua), and the oxidative metabolites M1 and P1 as the major aflatoxin species present in the urine. When this methodology was applied to human urine samples obtained from people from the Guangxi Province of China exposed to aflatoxin B1 through dietary contamination, the aflatoxin metabolites detected were also AFB1-N7-Gua and aflatoxins M1 and P1. Therefore, affinity chromatography using a monoclonal antibody represents a useful and rapid technique with which to isolate this carcinogen and its metabolites in biochemical epidemiology and for subsequent quantitative measurements, providing exposure information that can be used for risk assessment.

  1. Modeling kinetics of aflatoxin production by Aspergillus flavus in maize-based medium and maize grain.

    PubMed

    Garcia, Daiana; Ramos, Antonio J; Sanchis, Vicente; Marín, Sonia

    2013-03-15

    Predictive mycology has dealt mainly with germination, growth and inactivation of fungi while the issue of mycotoxin production remains relatively unexplored. Very few studies provide biomass dry weight/colony size data along with mycotoxin data for the same sample times, thus the ratio mycotoxin accumulation per fungal biomass dry weight/colony size has rarely been reported. For this reason, the objective of the present study was to model the kinetics of mycotoxin production under the assumption of existing both no-growth-associated and growth-associated production. Aspergillus flavus was chosen as a model mycotoxigenic microorganism, and it was grown in maize agar medium and maize grain at 0.90 and 0.99 aw at 25°C. A significant positive correlation (p<0.05) was observed among the biomass responses (colony radius and biomass dry weight) in agar medium and colony radius in maize at both aw levels assayed. The Luedeking-Piret model was used to model AFB1 production and reasonable percentages of variability were explained. Moreover, AFB1 production was in general slightly better predicted through colony area. As conclusion, aflatoxin production may follow a mixed-growth associated trend, confirming that toxin formation does not present a clear delay in relation to growth under certain conditions. PMID:23422844

  2. Rapid screening of aflatoxin B1 in beer by fluorescence polarization immunoassay.

    PubMed

    Beloglazova, N V; Eremin, S A

    2015-09-01

    This manuscript describes the development of a sensitive, fast and easily-performed fluorescence polarization immunoassay (FPIA) for the mycotoxin aflatoxin B1 (AFB1) in various beer samples, both lager and dark. The highest sensitivity was determined for six poly- and monoclonal antibodies selective towards aflatoxins. The sample pretreatment design was emphasized since beer samples are characterized by extremely diverse matrices. Herein, the choice of sorbent for effective removal of matrix interferences prior to analysis was crucial. The samples were diluted with a borate buffer solution containing 1% PEG 6000 and passed through the clean-up column packed with NH2-derivated silica. This sample pretreatment technique was perfectly suitable for the FPIA of lager beer samples, but for dark beer and ale it did not suffice. An artificial matrix was constructed to plot a calibration curve and quantify the results of the latter samples. The developed immunoassay was characterized by a limit of detection of 1 ng mL(-1). Apparent recovery values of 89-114% for lager and 80-125% for dark beer were established. The FPIA data for AFB1 was characterized by elevated linear regression coefficients, 0.9953 for spiked lager and 0.9895 for dark beer samples respectively. PMID:26003708

  3. AFM1 in Milk: Physical, Biological, and Prophylactic Methods to Mitigate Contamination

    PubMed Central

    Giovati, Laura; Magliani, Walter; Ciociola, Tecla; Santinoli, Claudia; Conti, Stefania; Polonelli, Luciano

    2015-01-01

    Aflatoxins (AFs) are toxic, carcinogenic, immunosuppressive secondary metabolites produced by some Aspergillus species which colonize crops, including many dietary staple foods and feed components. AFB1 is the prevalent and most toxic among AFs. In the liver, it is biotransformed into AFM1, which is then excreted into the milk of lactating mammals, including dairy animals. AFM1 has been shown to be cause of both acute and chronic toxicoses. The presence of AFM1 in milk and dairy products represents a worldwide concern since even small amounts of this metabolite may be of importance as long-term exposure is concerned. Contamination of milk may be mitigated either directly, decreasing the AFM1 content in contaminated milk, or indirectly, decreasing AFB1 contamination in the feed of dairy animals. Current strategies for AFM1 mitigation include good agricultural practices in pre-harvest and post-harvest management of feed crops (including storage) and physical or chemical decontamination of feed and milk. However, no single strategy offers a complete solution to the issue. PMID:26512694

  4. Aflatoxins ingestion and canine mammary tumors: There is an association?

    PubMed

    Frehse, M S; Martins, M I M; Ono, E Y S; Bracarense, A P F R L; Bissoqui, L Y; Teixeira, E M K; Santos, N J R; Freire, R L

    2015-10-01

    The aim of this study was to determine the presence of mycotoxins on dogs feed and to explore the potential association between mycotoxins exposure and the chance of mamary tumors in a case-control study. The study included 256 female dogs from a hospital population, 85 with mammary tumors (case group) and 171 without mammary tumors (control group). An epidemiological questionnaire was applied to both groups, and the data were analyzed by the EpiInfo statistical package. For the study, 168 samples of the feed offered to dogs were analyzed for the presence of aflatoxins, fumonisins and zearalenone by high-performance liquid chromatography. Mycotoxins were found in 79 samples (100%) in the case group and 87/89 (97.8%) in the control group. Mycotoxins were detected in all types of feed, regardless feed quality. Level of aflatoxin B1 (p = 0.0356, OR = 2.74, 95%, CI 1.13 to 6.60), aflatoxin G1 (AFG1) (p = 0.00007, OR = 4.60, 95%, CI = 2.16 to 9.79), and aflatoxin G2 (AFG2) (p = 0.0133, OR = 9.91, 95%, CI 1.21 to 81.15) were statistically higher in case of mammary cancer. In contrast, neutering was a protective factor for mammary cancer (p = 0.0004, OR = 0.32, 95%, CI = 0.17 to 0.60). PMID:26271706

  5. A Rapid and Sensitive Detection of Aflatoxin-producing Fungus Using an Optimized Polymerase Chain Reaction (PCR)

    PubMed Central

    Bintvihok, Anong; Treebonmuang, Supitchaya; Srisakwattana, Kitiya; Nuanchun, Wisut; Patthanachai, Koranis; Usawang, Sungworn

    2016-01-01

    Aflatoxin B1 (AFB1) is produced by Aspergillus flavus growing in feedstuffs. Early detection of maize contamination by aflatoxigenic fungi is advantageous since aflatoxins exert adverse health effects. In this study, we report the development of an optimized conventional PCR for AFB1 detection and a rapid, sensitive and simple screening Real-time PCR (qPCR) with SYBR Green and two pairs of primers targeting the aflR genes which involved aflatoxin biosynthesis. AFB1 contaminated maize samples were divided into three groups by the toxin concentration. Genomic DNA was extracted from those samples. The target genes for A. flavus were tested by conventional PCR and the PCR products were analyzed by electrophoresis. A conventional PCR was carried out as nested PCR to verify the gene amplicon sizes. PCR-RFLP patterns, obtained with Hinc II and Pvu II enzyme analysis showed the differences to distinguish aflatoxin-producing fungi. However, they are not quantitative and need a separation of the products on gel and their visualization under UV light. On the other hand, qPCR facilitates the monitoring of the reaction as it progresses. It does not require post-PCR handling, which reduces the risk of cross-contamination and handling errors. It results in a much faster throughout. We found that the optimal primer annealing temperature was 65°C. The optimized template and primer concentration were 1.5 μL (50 ng/μL) and 3 μL (10 μM/μL) respectively. SYBR Green qPCR of four genes demonstrated amplification curves and melting peaks for tub1, afIM, afIR, and afID genes are at 88.0°C, 87.5°C, 83.5°C, and 89.5°C respectively. Consequently, it was found that the four primers had elevated annealing temperatures, nevertheless it is desirable since it enhances the DNA binding specificity of the dye. New qPCR protocol could be employed for the determination of aflatoxin content in feedstuff samples. PMID:26977262

  6. Multiplex surface plasmon resonance biosensing and its transferability towards imaging nanoplasmonics for detection of mycotoxins in barley.

    PubMed

    Joshi, Sweccha; Segarra-Fas, Anna; Peters, Jeroen; Zuilhof, Han; van Beek, Teris A; Nielen, Michel W F

    2016-02-21

    A 6-plex competitive inhibition immunoassay for mycotoxins in barley was developed on a prototype portable nanostructured imaging surface plasmon resonance (iSPR) instrument, also referred to as imaging nanoplasmonics. As a benchmark for the prototype nanoplasmonics instrument, first a double 3-plex assay was developed for the detection of deoxynivalenol (DON), zearalenone (ZEA), T-2 toxin (T-2), ochratoxin A (OTA), fumonisin B1 (FB1) and aflatoxin B1 (AFB1) using a well-established benchtop SPR instrument and two biosensor chips. To this end, ovalbumin (OVA) conjugates of mycotoxins were immobilized on the chip via amine coupling. The SPR response was then recorded upon injection of a mixture of antibodies at a fixed concentration and the sample (or matrix-matched standard) over a chip with immobilized mycotoxin-OVA conjugates. The chips were regenerated after each sample using 10 mM HCl and 20 mM NaOH and could be used for at least 60 cycles. The limits of detection in barley (in μg kg(-1)) were determined to be 26 for DON, 6 for ZEA, 0.6 for T-2, 3 for OTA, 2 for FB1 and 0.6 for AFB1. Preliminary in-house validation showed that DON, T-2, ZEA and FB1 can be detected at the European Union regulatory limits, while for OTA and AFB1 sensitivities should be improved. Furthermore, measurement of naturally contaminated barley showed that the assay can be used as a semi-quantitative screening method for mycotoxins prior to liquid chromatography tandem mass spectrometry (LC-MS/MS). Finally, using the same bio-reagents the assay was transferred to a 6-plex format in the nanoplasmonics instrument and subsequently the two assays were compared. Although less sensitive, the 6-plex portable iSPR assay still allowed detection of DON, T-2, ZEA and FB1 at relevant levels. Therefore, the prototype iSPR shows potential for future applications in rapid in-field and at-line screening of multiple mycotoxins. PMID:26763589

  7. Cytochrome P450 2A of nasal epithelium: regulation and role in carcinogen metabolism.

    PubMed

    Béréziat, J C; Raffalli, F; Schmezer, P; Frei, E; Geneste, O; Lang, M A

    1995-10-01

    In this study, we found that rat nasal coumarin-7-hydroxylase (COH) activity was two orders of magnitude higher than rat hepatic COH activity and could be induced by adding coumarin to the rats' drinking water. In western blot analysis, an anti-cytochrome P450 (Cyp) 2a-5 (mouse liver COH) antibody recognized a sharp band in the microsomal fraction of rat nasal epithelium but not of the liver; the band comigrated with Cyp2a-5. The intensity of the band was increased by the coumarin treatment. Similarly, in northern blot analysis, a cDNA probe specific for Cyp2a-5 recognized an mRNA in the nasal epithelium having the same size as mouse liver Cyp2a-5 mRNA; however, no hybridizable mRNA was recognized in liver preparations. Unlike the protein level, the level of the mRNA was not increased by coumarin. When northern blot analyses were performed with two oligoprobes specific for rat lung CYP2A3, an mRNA of similar size to Cyp2a-5 mRNA was recognized. In immunoinhibition analysis, anti-Cyp2a-5 antibody inhibited rat nasal COH activity and aflatoxin B1 (AFB1) metabolism completely. It inhibited N-nitrosodiethylamine (NDEA) and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) metabolism by 80-90%. In contrast, the hepatic metabolism of the four compounds was not affected by the antibody. When coumarin instead of anti-Cyp2a-5 antibody was used, a strong but variable inhibition of the nasal metabolism of AFB1, NDEA, and NNK was seen. The results suggest that an enzyme or enzymes similar to mouse liver Cyp2a-5, one of which may be CYP2A3, is expressed at high levels in rat nasal epithelium but not in the liver and that its expression is increased by coumarin, an odorant and a substrate of Cyp2a-5. The increase probably occurs by protein stabilization or stimulation of translation. The results also show that the enzyme has a key role in the nasal metabolism of three well-known carcinogens, AFB1, NDEA, and NNK and may therefore be an important contributing factor in nasal

  8. Assessment of isorhamnetin 3-O-neohesperidoside from Acacia salicina: protective effects toward oxidation damage and genotoxicity induced by aflatoxin B1 and nifuroxazide.

    PubMed

    Bouhlel, Ines; Limem, Ilef; Skandrani, Ines; Nefatti, Aicha; Ghedira, Kamel; Dijoux-Franca, Marie-Genevieve; Leila, Chekir-Ghedira

    2010-08-01

    Antioxidant activity of isorhamnetin 3-O-neohesperidoside, isolated from the leaves of Acacia salicina, was determined by the ability of this compound to inhibit xanthine oxidase activity and to scavenge the free radical 2,2'-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS(.-)) diammonium salt. Antigenotoxic activity was assessed using the SOS chromotest assay. This compound has the ability to scavenge the ABTS(.+) radical by a hydrogen donating mechanism. We also envisaged the study of the antioxidant effect of this compound by the enzymatic xanthine/xanthine oxidase (X/XOD) assay. Results indicated that isorhamnetin 3-O-neohesperidoside was a potent inhibitor of xanthine oxidase and superoxide anion scavengers. Moreover, this compound induced an inhibitory activity against nifuroxazide and aflatoxine B1 (AFB1) induced genotoxicity. Taken together, these observations provide evidence that isorhamnetin 3-O-neohesperidoside isolated from the leaves of A. salicina is able to protect cells against the consequences of oxidative stress. PMID:20809543

  9. Aflatoxins in dairy cow feed, raw milk and milk products from Turkey.

    PubMed

    Sahin, Hilal Zeynep; Celik, Mehtap; Kotay, Seda; Kabak, Bulent

    2016-06-01

    This study aims to detect aflatoxins (AFs) in dairy cow feed, milk and milk products using a high-performance liquid chromatography coupled with fluorescence detection (HPLC-FLD) method. All the validation parameters met the method performance criteria of the European Union. The samples comprised 76 dairy cow feeds and 205 milk and milk products (including yoghurt and yoghurt-based beverage, ayran). AFs were present in 26.3% of the feed samples. Two feed samples exceeded the maximum limit (ML) of 5 µg kg(-1) for AFB1 as established by the EU. Nineteen milk samples (21.1%) contained aflatoxin M1 (AFM1) of which three exceeded the EU ML of 0.05 µg l(-1). In addition, only two yoghurt samples and one ayran sample contained AFM1, but the levels were lower than the EU ML. PMID:26883580

  10. Antimutagenicity and antiproliferative studies of lipidic extracts from white shrimp (Litopenaeus vannamei).

    PubMed

    Wilson-Sanchez, Griselda; Moreno-Félix, Carolina; Velazquez, Carlos; Plascencia-Jatomea, Maribel; Acosta, Anita; Machi-Lara, Lorena; Aldana-Madrid, María-Lourdes; Ezquerra-Brauer, Josafat-Marina; Robles-Zepeda, Ramón; Burgos-Hernandez, Armando

    2010-01-01

    An organic extract from fresh shrimp (Litopenaeus vannamei) was studied for antimutagenic and antiproliferative properties using Salmonella typhimurium tester strains TA98 and TA100 with metabolic activation (S9) and a cancer cell line (B-cell lymphoma), respectively. Shrimp extract was sequentially fractionated by thin layer chromatography (TLC) and each fraction was tested for antimutagenic and antiproliferative activities. Crude organic extracts obtained from shrimp reduced the number of revertants caused by aflatoxina B(1), showing a dose-response type of relationship. Sequential TLC fractionation of the active extracts produced several antimutagenic and/or antiproliferative fractions. These results suggested that the lipid fraction of the tested species contained compounds with chemoprotective properties that reduce the mutagenicity of AFB(1) and proliferation of a cancer cell line. PMID:21139845

  11. Bioactive Lipidic Extracts from Octopus (Paraoctopus limaculatus): Antimutagenicity and Antiproliferative Studies.

    PubMed

    Moreno-Félix, Carolina; Wilson-Sánchez, Griselda; Cruz-Ramírez, Susana-Gabriela; Velázquez-Contreras, Carlos; Plascencia-Jatomea, Maribel; Acosta, Ana; Machi-Lara, Lorena; Aldana-Madrid, María-Lourdes; Ezquerra-Brauer, Josafat-Marina; Rocha-Alonzo, Fernando; Burgos-Hernández, Armando

    2013-01-01

    Fractions from an organic extract from fresh octopus (Paraoctopus limaculatus) were studied for biological activities such as antimutagenic and antiproliferative properties using Salmonella tester strains TA98 and TA100 with metabolic activation (S9) and a cancer cell line (B-cell lymphoma), respectively. A chloroform extract obtained from octopus tentacles was sequentially fractionated using thin layer chromatography (TLC), and each fraction was tested for antimutagenic and antiproliferative activities. Organic extract reduced the number of revertants caused by aflatoxin B(1) showing a dose-response type of relationship. Sequential TLC fractionation of the active extracts produced several antimutagenic and/or antiproliferative fractions. Based on the results obtained, the isolated fractions obtained from octopus contain compounds with chemoprotective properties that reduce the mutagenicity of AFB(1) and proliferation of cancer cell lines. PMID:23401709

  12. Effect of ozone on aflatoxins detoxification and nutritional quality of peanuts.

    PubMed

    Chen, Ran; Ma, Fei; Li, Pei-Wu; Zhang, Wen; Ding, Xiao-Xia; Zhang, Qi; Li, Min; Wang, Yan-Ru; Xu, Bao-Cheng

    2014-03-01

    Aflatoxins are a group of secondary metabolites produced by Aspergillus flavus and Aspergillus parasiticus with carcinogenicity, teratogenicity, and mutagenicity. Aflatoxins may be found in a wide range of agri-products, especially in grains, oilseeds, corns, and peanuts. In this study, the conditions for detoxifying peanuts by ozonation were optimised. Aflatoxins in peanuts at moisture content of 5% (w/w) were sensitive to ozone and easily degraded when reacted with 6.0mg/l of ozone for 30min at room temperature. The detoxification rates of the total aflatoxins and aflatoxin B1 (AFB1) were 65.8% and 65.9%, respectively. The quality of peanut samples was also evaluated in this research. No significant differences (P>0.05) were found in the polyphenols, resveratrol, acid value (AV), and peroxide value (PV) between treated and untreated samples. The results suggested that ozonation was a promising method for aflatoxin detoxification in peanuts. PMID:24176344

  13. Aflatoxins in various food from Istanbul, Turkey.

    PubMed

    Hacıbekiroğlu, I; Kolak, U

    2013-01-01

    The present work reports the total aflatoxin and aflatoxin B1 levels in 62 food samples from Istanbul, Turkey. The total aflatoxin content in dried American cucumber, squash, tomato, okra and saffron samples was found to be 1.7 μg/kg. AFB1 levels in five dried vegetables (red bell pepper, American cucumber, squash, tomato and okra), two tea (linden and jasmine flower) and three spice samples (cardamom, galangal and saffron) were 1 μg/kg. Of the tested samples, 76% exceeded legal limits of total aflatoxin. The highest levels were determined in chestnut (232.9 μg/kg), nutmeg (206.1 μg/kg) and sumac (182.5 μg/kg). These findings confirm the existing knowledge that food should be regularly and effectively controlled. PMID:24779934

  14. Optical waveguide lightmode spectroscopy technique-based immunosensor development for aflatoxin B1 determination in spice paprika samples.

    PubMed

    Majer-Baranyi, Krisztina; Zalán, Zsolt; Mörtl, Mária; Juracsek, Judit; Szendrő, István; Székács, András; Adányi, Nóra

    2016-11-15

    Optical waveguide lightmode spectroscopy (OWLS) technique has been applied to label-free detection of aflatoxin B1 in a competitive immunoassay format, with the aim to compare the analytical goodness of the developed OWLS immunosenor with HPLC and enzyme-linked immunosorbent assay (ELISA) methods for the detection of aflatoxin in spice paprika matrix. We have also assessed applicability of the QuEChERS method prior to ELISA measurements, and the results were compared to those obtained by traditional solvent extraction followed by immunoaffinity clean-up. The AFB1 content of sixty commercial spice paprika samples from different countries were measured with the developed and optimized OWLS immunosensor. Comparing the results from the indirect immunosensor to that obtained by HPLC or ELISA provided excellent correlation (with regression coefficients above 0.94) indicating that the competitive OWLS immunosensor has a potential for quick determination of aflatoxin B1 in paprika samples. PMID:27283719

  15. Predicted Roles of the Uncharacterized Clustered Genes in Aflatoxin Biosynthesis

    PubMed Central

    Ehrlich, Kenneth C.

    2009-01-01

    Biosynthesis of the toxic and carcinogenic aflatoxins (AFs) requires the activity of more than 27 enzymes. The roles in biosynthesis of newly described enzymes are discussed in this review. We suggest that HypC catalyzes the oxidation of norsolorinic acid anthrone; AvfA (AflI), the ring-closure step in formation of hydroxyversicolorone; HypB, the second oxidation step in conversion of O-methylsterigmatocystin to AF; and HypE and NorA (AflE), the final two steps in AFB1 formation. HypD, an integral membrane protein, affects fungal development and lowers AF production while AflJ (AflS), has a partial methyltransferase domain that may be important in its function as a transcriptional co-activator. PMID:22069531

  16. Antimutagenicity and Antiproliferative Studies of Lipidic Extracts from White Shrimp (Litopenaeus vannamei)

    PubMed Central

    Wilson-Sanchez, Griselda; Moreno-Félix, Carolina; Velazquez, Carlos; Plascencia-Jatomea, Maribel; Acosta, Anita; Machi-Lara, Lorena; Aldana-Madrid, María-Lourdes; Ezquerra-Brauer, Josafat-Marina; Robles-Zepeda, Ramón; Burgos-Hernandez, Armando

    2010-01-01

    An organic extract from fresh shrimp (Litopenaeus vannamei) was studied for antimutagenic and antiproliferative properties using Salmonella typhimurium tester strains TA98 and TA100 with metabolic activation (S9) and a cancer cell line (B-cell lymphoma), respectively. Shrimp extract was sequentially fractionated by thin layer chromatography (TLC) and each fraction was tested for antimutagenic and antiproliferative activities. Crude organic extracts obtained from shrimp reduced the number of revertants caused by aflatoxina B1, showing a dose-response type of relationship. Sequential TLC fractionation of the active extracts produced several antimutagenic and/or antiproliferative fractions. These results suggested that the lipid fraction of the tested species contained compounds with chemoprotective properties that reduce the mutagenicity of AFB1 and proliferation of a cancer cell line. PMID:21139845

  17. Modified Nanodiamonds for Detoxification

    NASA Astrophysics Data System (ADS)

    Gibson, Natalie Marie

    Nanodiamonds (NDs) are an emerging class of biomaterials that are reaching worldwide attention due to their biocompatible, nontoxic properties and abundant surface chemistries that lend them to a wide range of biomedical applications. Furthermore, surface functional groups of NDs can easily be tailored to exhibit desirable chemical, physical and biological properties. Such characteristics naturally allow for NDs' surface to be considered as ideal carriers for various molecules and biomolecules intended for the delivery or removal of molecules in vivo. NDs have already shown to have a high affinity for various biological molecules, including DNA and proteins. This dissertation, however, expands NDs' use to the adsorption of carcinogenic mycotoxins, aflatoxin B1 (AfB1) and ochratoxin A (OTA). It has been estimated that myocotoxins are found in approximately 25 % of the world's crops each year. Ingestion of mycotoxins contaminated crops has been linked to hepatocellular carcinoma, disease and death. Therefore, we aim to develop ND enterosorbents, for the binding and removal of mycotoxins within the gastrointestinal (GI) tract, thereby eliminating the effects of these toxins. While NDs are readily available, raw, unmodified NDs, like those typically received from vendors, possess inhomogeneous aggregate sizes and surface characteristics. Our research first explored several ND modification techniques to enhance ND's adsorption of AfB1 and OTA. Modification methods assessed in this research include size reduction techniques, plasma treatments, silane surface coatings and homogenous surface group termination, including carboxylation, hydrogenation and hydroxylation. The effectiveness of these NDs for mycotoxins removal was determined by calculations of maximum capacities and binding constants, as obtained through the Langmuir isotherm and related transform equations. Several of these treatments also showed heightening of the NDs' inherent zeta potentials (ZPs), which were essential for interacting with charged molecules, like OTA. Furthermore, the increased ZPs lead to improved colloidal stabilities over a wide range of pH, which is important for their interaction in the GI tract. While the dyes and OTA illustrated primarily electrostatic adsorption mechanisms, neutrally charged AfB1's adsorption was predominantly based upon the aggregate size of the ND substrate. In addition to mycotoxins, fluorescent dyes, including propidium iodide, pyranine and 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), were initially utilized during methodological development. Fluorescent dye investigations helped assesses the adsorption mechanisms of NDs and demonstrated the significance of electrostatic interactions. Beyond electrostatic adsorption mechanisms, surface functional groups were also responsible for the amount of dye adsorbed, as was also true in OTA adsorption. Therefore, surface characterization was carried out for several ND samples by FTIR, TOF-SIMS and TDMS analysis. Final results of our studies show that our modified NDs perform better than yeast cells walls and other NDs but comparable to activated charcoal in the adsorption of AfB1, and outperform clay minerals in OTA studies. Moreover, it was demonstrated that adsorption can be maintained in a wide range of pH, thereby, increasing the possibility of NDs use in mycotoxins enterosorbent applications.

  18. An enzyme-free catalytic DNA circuit for amplified detection of aflatoxin B1 using gold nanoparticles as colorimetric indicators

    NASA Astrophysics Data System (ADS)

    Chen, Junhua; Wen, Junlin; Zhuang, Li; Zhou, Shungui

    2016-05-01

    An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the individual nanoparticles (red) aggregate into a cross-linked network of nanoparticles (blue) via biotin-streptavidin coupling. The colorimetric assay is ultrasensitive, enabling the visual detection of trace levels of aflatoxin B1 (AFB1) as low as 10 pM without instrumentation. The calculated limit of detection (LOD) is 2 pM in terms of 3 times standard deviation over the blank response. The sensor is robust and works even when challenged with complex sample matrices such as rice samples. Our sensing platform is simple and convenient in operation, requiring only the mixing of several solutions at room temperature to achieve visible and intuitive results, and holds great promise for the point-of-use monitoring of AFB1 in environmental and food samples.An enzyme-free biosensor for the amplified detection of aflatoxin B1 has been constructed based on a catalytic DNA circuit. Three biotinylated hairpin DNA probes (H1, H2, and H3) were designed as the assembly components to construct the sensing system (triplex H1-H2-H3 product). Cascaded signal amplification capability was obtained through toehold-mediated strand displacement reactions to open the hairpins and recycle the trigger DNA. By the use of streptavidin-functionalized gold nanoparticles as the signal indicators, the colorimetric readout can be observed by the naked eye. In the presence of a target, the

  19. Promotion of Hepatocarcinogenesis by Perfluoroalkyl Acids in Rainbow Trout

    PubMed Central

    Benninghoff, Abby D.; Orner, Gayle A.; Buchner, Clarissa H.; Hendricks, Jerry D.; Duffy, Aaron M.; Williams, David E.

    2012-01-01

    Previously, we reported that perfluorooctanoic acid (PFOA) promotes liver cancer in a manner similar to that of 17β-estradiol (E2) in rainbow trout. Also, other perfluoroalkyl acids (PFAAs) are weakly estrogenic in trout and bind the trout liver estrogen receptor. The primary objective of this study was to determine whether multiple PFAAs enhance hepatic tumorigenesis in trout, an animal model that represents human insensitivity to peroxisome proliferation. A two-stage chemical carcinogenesis model was employed in trout to evaluate PFOA, perfluorononanoic acid (PFNA), perfluorodecanoic acid (PFDA), perfluorooctane sulfonate (PFOS), and 8:2 fluorotelomer alcohol (8:2FtOH) as complete carcinogens or promoters of aflatoxin B1 (AFB1)- and/or N-methyl-N′-nitro-N-nitrosoguanidine (MNNG)-induced liver cancer. A custom trout DNA microarray was used to assess hepatic transcriptional response to these dietary treatments in comparison with E2 and the classic peroxisome proliferator, clofibrate (CLOF). Incidence, multiplicity, and size of liver tumors in trout fed diets containing E2, PFOA, PFNA, and PFDA were significantly higher compared with AFB1-initiated animals fed control diet, whereas PFOS caused a minor increase in liver tumor incidence. E2 and PFOA also enhanced MNNG-initiated hepatocarcinogenesis. Pearson correlation analyses, unsupervised hierarchical clustering, and principal components analyses showed that the hepatic gene expression profiles for E2 and PFOA, PFNA, PFDA, and PFOS were overall highly similar, though distinct patterns of gene expression were evident for each treatment, particularly for PFNA. Overall, these data suggest that multiple PFAAs can promote liver cancer and that the mechanism of promotion may be similar to that of E2. PMID:21984479

  20. Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells.

    PubMed

    Buick, Julie K; Moffat, Ivy; Williams, Andrew; Swartz, Carol D; Recio, Leslie; Hyduke, Daniel R; Li, Heng-Hong; Fornace, Albert J; Aubrecht, Jiri; Yauk, Carole L

    2015-07-01

    The use of integrated approaches in genetic toxicology, including the incorporation of gene expression data to determine the molecular pathways involved in the response, is becoming more common. In a companion article, a genomic biomarker was developed in human TK6 cells to classify chemicals as genotoxic or nongenotoxic. Because TK6 cells are not metabolically competent, we set out to broaden the utility of the biomarker for use with chemicals requiring metabolic activation. Specifically, chemical exposures were conducted in the presence of rat liver S9. The ability of the biomarker to classify genotoxic (benzo[a]pyrene, BaP; aflatoxin B1, AFB1) and nongenotoxic (dexamethasone, DEX; phenobarbital, PB) agents correctly was evaluated. Cells were exposed to increasing chemical concentrations for 4 hr and collected 0 hr, 4 hr, and 20 hr postexposure. Relative survival, apoptosis, and micronucleus frequency were measured at 24 hr. Transcriptome profiles were measured with Agilent microarrays. Statistical modeling and bioinformatics tools were applied to classify each chemical using the genomic biomarker. BaP and AFB1 were correctly classified as genotoxic at the mid- and high concentrations at all three time points, whereas DEX was correctly classified as nongenotoxic at all concentrations and time points. The high concentration of PB was misclassified at 24 hr, suggesting that cytotoxicity at later time points may cause misclassification. The data suggest that the use of S9 does not impair the ability of the biomarker to classify genotoxicity in TK6 cells. Finally, we demonstrate that the biomarker is also able to accurately classify genotoxicity using a publicly available dataset derived from human HepaRG cells. PMID:25733247

  1. Ontogeny of the chicken cytochrome P-450 enzyme system. Expression and development of responsiveness to phenobarbital induction.

    PubMed

    Lorr, N A; Bloom, S E

    1987-09-15

    The sensitivity of the developing embryo to toxins and drugs is highly dependent on the state of development of the cytochrome P-450 system. Previous work in this laboratory has demonstrated the genotoxicity of aflatoxin B1 (AFB1) to the chicken embryo at 3 days of incubation (DI) and induction of AFB1 genotoxicity by phenobarbital at 7 DI. In this study, the basal and 24-hr phenobarbital (PB) induced levels of aminopyrine-N-demethylase (AMPD) and cytochrome P-450 were assayed in hepatic microsomes from 7 DI to 36 days posthatching (PH) and in microsomes from whole embryos at 5 DI. A dose-response for induction by PB was observed in embryonic hepatic microsomes as early as 7 DI, whereas a low level of cytochrome P-450 was detected in control 7 DI microsomes using the reduced CO vs oxidized CO difference spectrum. Basal levels of AMPD and cytochrome P-450 in hepatic microsomes increased steadily throughout development as did the responsiveness of the embryonic liver to induction with PB. Hepatic microsomes from control and PB-induced chickens had the highest AMPD activities posthatching particularly from 1 to 3 days PH. Maximal induced levels, which were 2- to 3-fold over control throughout development, ranged from 1.22 at 7 DI to 12.72 nmol HCHO/mg protein/min at 2 days PH. The potency of PB as an inducer increased about 1000-fold between 7 DI and hatching. PB induction did not increase the specific activity of AMPD at any period of development. The specific activity of AMPD posthatching increased about 3-fold above embryonic levels, indicating the development of a cytochrome P-450 complex more active toward aminopyrine in the neonatal period. PMID:3632724

  2. Aflatoxins and ochratoxin A in tea prepared from naturally contaminated powdered ginger.

    PubMed

    Iha, M H; Trucksess, M W

    2010-08-01

    The migration of several major mycotoxins, aflatoxins B(1) (AFB(1)), B(2), G(1), and G(2) (AFT, total of the aflatoxins) and ochratoxin A (OTA), from naturally contaminated powdered ginger to surrounding liquid (tea) was investigated. The toxins are commonly found in cereal grains and are toxic, carcinogenic and thermostable. Ginger root is widely used for digestive problems. Powdered ginger (2 g) found to contain AFT and OTA was placed in an empty heat sealable tea bag. The tea bag was heat-sealed and used to prepare tea under different conditions: temperature (50 and 100 degrees C), time (5 and 10 min) and volume (100 and 200 ml). The tea bag was placed in hot water and stirred every 1 min for 5 s during the first 5 min of steeping. After steeping, the tea bag was removed and the tea and ginger residue (in the tea bag) were analysed separately for AFT and OTA. After extraction and immunoaffinity column (IAC) clean-up, the isolated AFT and OTA were separated by reversed-phase liquid chromatography and quantified using a fluorescence detector. At 100 degrees C, approximately 30-40% of AFB(1) and AFT and 20-30% of OTA in the contaminated ginger were found in the ginger tea; the total amounts of AFT and OTA in tea varied less than 5% under the three conditions of preparation. At 50 degrees C, about 10% of OTA and AFT were found in tea. This is the first study on the migration of AFT from botanicals to tea. It is also the first to study the distribution of AFT and OTA from powdered ginger to tea and ginger residue. PMID:20589549

  3. Anticarcinogenic effect of probiotic fermented milk and chlorophyllin on aflatoxin-B₁-induced liver carcinogenesis in rats.

    PubMed

    Kumar, M; Verma, V; Nagpal, R; Kumar, A; Behare, P V; Singh, B; Aggarwal, P K

    2012-04-01

    The present investigation was carried out to evaluate the hepatoprotective effect of probiotic fermented milk (FM) containing Lactobacillus rhamnosus GG and Lactobacillus casei strain Shirota, alone as well as in combination with chlorophyllin (CHL) as an antioxidant agent in male Wistar rats administered aflatoxin-B₁ (AFB₁). AFB₁ was injected intraperitoneally at the rate of 450 μg/kg body weight per animal twice a week for 6 weeks, maintaining an equal time interval between the two consecutive AFB₁ administrations. A total of 125 male Wistar rats were randomly allocated to five groups, each group having twenty-five animals. Group I was offered FM containing L. rhamnosus GG and L. casei strain Shirota. Group II was administered AFB1 and served as the control group; group III was administered FM-AFB₁, in which besides administering AFB₁, FM was also offered. Group IV was offered CHL and AFB₁, and group V was offered both FM and CHL along with AFB₁. The rats were euthanised at the 15th and 25th week of the experiment and examined for the biochemical and hepatopathological profile. A significant reduction in thiobarbituric acid-reactive substances (TBARS) was observed in the FM-CHL-AFB₁ group compared with the AFB1 control group. FM alone or in combination with CHL was found to show a significant (P < 0·05) hepatoprotective effect by lowering the levels of TBARS and by enhancing the activities of antioxidant enzymes such as glutathione peroxidase, superoxide dismutase, catalase and glutathione-S-transferase, indicating that probiotic FM alone or in combination with CHL possesses a potent protective effect against AFB₁-induced hepatic damage. PMID:21816119

  4. Transcriptional response of genes involved in cell defense system in human cells stressed by H2O2 and pre-treated with (Tunisian) Rhamnus alaternus extracts: combination with polyphenolic compounds and classic in vitro assays.

    PubMed

    Ammar, Rebai Ben; Bouhlel, Ines; Valenti, Kita; Sghaier, Mohamed Ben; Kilani, Soumaya; Mariotte, Anne-Marie; Dijoux-Franca, Marie-Geneviève; Laporte, François; Ghedira, Kamel; Chekir-Ghedira, Leila

    2007-07-20

    The ability of three Rhamnus alaternus leaves extracts on antigenotoxic and gene expression level effects was respectively investigated in a bacterial assay system, i.e. the SOS chromotest with Escherichia coli PQ37 and in human K562 lymphoblast cell line. Total oligomers flavonoids (TOF) enriched, methanol and ethyl acetate extracts were prepared from powdered R. alaternus leaves and characterized quantitatively for the presence of polyphenolic compounds. We explored the response to oxidative stress using the transcriptional profile of genes in K562 cells stressed with H2O2 after incubation with plant extracts. For this purpose, we used a cDNA microarrays containing 82 genes related to cell defense, essentially represented by antioxidant and DNA repair genes. Analysis revealed that SOD1, AOE 372, TXN genes involved in the antioxidant defense system and XPC, LIG4, POLD2, PCNA genes implied in the DNA repair system were among the most expressed ones in the presence of the tested extracts. These results were in accordance with those obtained when we tested the antigenotoxic and antioxidant effects of the same extracts with, respectively the SOS chromotest and the xanthine/xanthine oxidase enzymatic assay system. The effect of the tested extracts on SOS response induced by both Aflatoxin B1 (AFB1: 10 microg/assay) and nifuroxazide (20 microg/assay) showed that the TOF extract exhibited the highest antimutagenic level towards the indirect mutagen AFB1. Whereas ethyl acetate extract showed the highest antimutagenic effect towards the direct mutagen, nifuroxazide. None of the tested extracts induced mutagenic activity. However all the tested extracts exhibited xanthine oxidase inhibiting and superoxide anions scavenging effects. R. alaternus extracts contain compounds with significant antioxidant and antigenotoxic activities. These compounds modulate gene expression as detected by using cDNA arrays. PMID:17512922

  5. Investigation of biological activity of polar extracts isolated from Phlomis crinita Cav ssp. mauritanica Munby.

    PubMed

    Limem-Ben Amor, Ilef; Skandrani, Ines; Boubaker, Jihed; Ben Sghaïer, Mohamed; Neffati, Aicha; Bhouri, Wissem; Bouhlel, Ines; Chouchane, Nabil; Kilani, Soumaya; Guedon, Emmanuel; Ghoul, Mohamed; Ghedira, Kamel; Chekir-Ghedira, Leila

    2009-01-01

    The lyophilized infusion, the methanol, the ethyl acetate, and the total oligomer flavonoid (TOF)-enriched extracts prepared from the dried leaves of Phlomis crinita Cav. ssp. mauritanica Munby were investigated for the contents of flavonoids, tannins, coumarines and steroids. Antibacterial activity was investigated toward five bacterial strains. An inhibitory effect was observed against Staphyllococcus aureus and Enterococcus feacalis, and the minimal inhibitory concentrations ranged from 2.5 to 5 mg/mL of extract. The tested extracts exhibit an important free radical scavenging activity toward the 1,1-diphenyl 2-picrylhydrazyl (DPPH) free radical; with IC(50) values of 30.5, 6, 32, and 31.5 microg/mL, respectively, in the presence of lyophilized infusion, the TOF, the methanol, and the ethyl acetate extracts. Genotoxic and antigenotoxic properties of the different extracts were studied by using the SOS chromotest with Escherichia coli PQ37. The lyophilized infusion and TOF extracts obtained from P. crinita ssp. mauritanica showed no genotoxicity, whereas methanol and ethyl acetate extracts are considered as marginally genotoxic. On the other hand, we showed that each extract inhibited the mutagenicity induced by aflatoxin B1 (AFB1) (10 microg/assay) and nifuroxazide (NF) (10 microg/assay). The ethyl acetate extract showed the strongest level of protection toward the genotoxicity induced by both directly and indirectly genotoxic NF and AFB1. These tests proved that the lyophilized infusion possesses an antiradical activity likewise, it showed no genotoxic effect; that is why we choose this extract to assess its antiulcerogenic activity by using an ethanol-induced ulcerogenesis model in the rat. This test demonstrates that 300 mg/kg of a P. crinita ssp. mauritanica lyophilized infusion was more effective than the reference compound, cimetidine. PMID:19514937

  6. Gut microbes define liver cancer risk in mice exposed to chemical and viral transgenic hepatocarcinogens

    PubMed Central

    Fox, J G; Feng, Y; Theve, E J; Raczynski, A R; Fiala, J L A; Doernte, A L; Williams, M; McFaline, J L; Essigmann, J M; Schauer, D B; Tannenbaum, S R; Dedon, P C; Weinman, S A; Lemon, S M; Fry, R C; Rogers, A B

    2013-01-01

    Background and aims Hepatocellular carcinoma (HCC) frequently results from synergism between chemical and infectious liver carcinogens. Worldwide, the highest incidence of HCC is in regions endemic for the foodborne contaminant aflatoxin B1 (AFB1) and hepatitis B virus (HBV) infection. Recently, gut microbes have been implicated in multisystemic diseases including obesity and diabetes. Here, the hypothesis that specific intestinal bacteria promote liver cancer was tested in chemical and viral transgenic mouse models. Methods Helicobacter-free C3H/HeN mice were inoculated with AFB1 and/or Helicobacter hepaticus. The incidence, multiplicity and surface area of liver tumours were quantitated at 40 weeks. Molecular pathways involved in tumourigenesis were analysed by microarray, quantitative real-time PCR, liquid chromatography/mass spectrometry, ELISA, western blot and immunohistochemistry. In a separate experiment, C57BL/6 FL-N/35 mice harbouring a full-length hepatitis C virus (HCV) transgene were crossed with C3H/HeN mice and cancer rates compared between offspring with and without H hepaticus. Results Intestinal colonisation by H hepaticus was sufficient to promote aflatoxin- and HCV transgene-induced HCC. Neither bacterial translocation to the liver nor induction of hepatitis was necessary. From its preferred niche in the intestinal mucus layer, H hepaticus activated nuclear factor-κB (NF-κB)-regulated networks associated with innate and T helper 1 (Th1)-type adaptive immunity both in the lower bowel and liver. Biomarkers indicative of tumour progression included hepatocyte turnover, Wnt/β-catenin activation and oxidative injury with decreased phagocytic clearance of damaged cells. Conclusions Enteric microbiota define HCC risk in mice exposed to carcinogenic chemicals or hepatitis virus transgenes. These results have implications for human liver cancer risk assessment and prevention. PMID:19850960

  7. Short communication: investigation of aflatoxin M1 levels in infant follow-on milks and infant formulas sold in the markets of Ankara, Turkey.

    PubMed

    Er, B; Demirhan, B; Yentür, G

    2014-01-01

    Aflatoxins are fungal toxins known to be carcinogenic and are classified as food contaminants. This study was performed to investigate aflatoxin (AF) M1 levels in baby foods sold in Ankara (Turkey) and to evaluate the obtained results according to the Turkish Food Codex (TFC). For this purpose, a total of 84 baby food samples (50 follow-on milks and 34 infant formulas) were obtained from different markets in Ankara and the presence of AFM1 in the samples was analyzed by ELISA. In 32 (38.1%) of 84 infant food samples, the presence of AFM1 was detected in concentrations ranging between 0.0055 and 0.0201 µg/kg. The mean level (± standard error) of AFM1 was found to be 0.0089 ± 0.0006 µg/kg in positive infant follow-on milks. Aflatoxin M1 was detected in only 1 infant formula sample (2.94%) at a concentration of 0.0061 µg/kg. The extrapolated levels of AFB1 contamination in feedstuffs were calculated based on levels of AFM1 in baby food samples. The data estimating AFB1 contamination in dairy cattle feedstuff indicate that contamination may range from 0.3410 to 1.2580 µg/kg, with the mean level (± standard error) being 0.5499 ± 0.0385 µg/kg, which is lower than the level set by the TFC and European Union regulations (5 µg/kg). According to the obtained results, the levels of AFM1 in analyzed samples were within the allowed limit (0.025 µg/kg) set in the TFC. Low levels of AFM1 in infant follow-on milks and infant formula samples obtained during the study do not pose a health risk to infants. PMID:24731644

  8. Effects of the TP53 p.R249S mutant on proliferation and clonogenic properties in human hepatocellular carcinoma cell lines: interaction with hepatitis B virus X protein.

    PubMed

    Gouas, Doriane A; Shi, Hong; Hautefeuille, Agnès H; Ortiz-Cuaran, Sandra L; Legros, Pénélope C; Szymanska, Katarzyna J; Galy, Olivier; Egevad, Lars A; Abedi-Ardekani, Behnoush; Wiman, Klas G; Hantz, Olivier; Caron de Fromentel, Claude; Chemin, Isabelle A; Hainaut, Pierre L

    2010-08-01

    Aflatoxin B(1) (AFB(1)) is a risk factor for hepatocellular carcinoma (HCC) in many low-resource countries. Although its metabolites bind at several positions in TP53, a mutation at codon 249 (AGG to AGT, arginine to serine, p.R249S) accounts for 90% of TP53 mutations in AFB(1)-related HCC. This specificity suggests that p.R249S confers a selective advantage during hepatocarcinogenesis. Using HCC cell lines, we show that p.R249S has lost the capacity to bind to p53 response elements and to transactivate p53 target genes. In p53-null Hep3B cells, stable transfection of p.R249S or of another mutant, p.R248Q, did not induce significant changes in cell proliferation and survival after cytotoxic stress. In contrast, in a cell line that constitutively expresses both p.R249S and the hepatitis B virus antigen HBx (PLC/PRF/5), silencing of either p.R249S or HBx by RNA interference slowed down proliferation, with no additive effects when both factors were silenced. Furthermore, the two proteins appear to form a complex. In human HCC samples, mutation at codon 249 did not correlate with p.R249S protein accumulation or HBx truncation status. We suggest that p.R249S may contribute to hepatocarcinogenesis through interaction with HBx, conferring a subtle growth advantage at early steps of the transformation process, but that this interaction is not required for progression to advanced HCC. PMID:20538734

  9. Natural occurrence of aflatoxins and ochratoxin A in processed spices marketed in Malaysia.

    PubMed

    Ali, Norhayati; Hashim, Noor Hasani; Shuib, Nor Shifa

    2015-01-01

    The analysis of aflatoxins (B1, B2, G1 and G2) and ochratoxin A (OTA) was performed in processed spices marketed in Penang, Malaysia, using immunoaffinity columns and HPLC equipped with fluorescence detector (HPLC-FD). The processed powdered spices analysed include dried chilli, fennel, cumin, turmeric, black and white pepper, poppy seed, coriander, 'garam masala', and mixed spices for fish, meat and chicken curry. Two different studies were carried out. The limit of detection (LOD) was 0.01 ng g(-1) for each aflatoxin (AF) and 0.10 ng g(-1) for OTA (signal-to-noise ratio = 3:1). In the first study, 34 commercial processed spices analysed with a mean level, range and incidence of positive samples for total AF were 1.61 ng g(-1), 0.01-9.34 ng g(-1) and 85%, respectively, and for AFB1 were 1.38 ng g(-1), 0.01-7.68 ng g(-1) and 85%, respectively. The mean level, range and incidence of positive samples for OTA were 2.21 ng g(-1), 0.14-20.40 ng g(-1) and 79%, respectively. Natural co-occurrence of AF and OTA was found in 25 (74%) samples. In the second study of 24 commercial processed spices, the mean level, range and incidence of positive samples for total AF were 8.38 ng g(-1), 0.32-31.17 ng g(-1) and 88%, respectively, and for AFB1 were 7.31 ng g(-1), 0.32-28.43 ng g(-1) and 83%, respectively. Fifteen positive samples for total AF and two positive samples for OTA exceeded the permissible Malaysian limit of 5 ng g(-1). Contamination of both mycotoxins in spices may represent another route of exposure to consumers due to their frequent and prolonged consumption, as spices are common ingredients in popular dishes among Asian countries. PMID:25658149

  10. Influence of dietary fat and selenium fed during initiation or promotion on the development of preneoplastic lesions in rat liver

    SciTech Connect

    Baldwin, S.; Parker, R.S.

    1986-03-05

    Aflatoxin B/sub 1/ (AFB1)-induced ..gamma..-glutamyl transpeptidase (GGT)-positive foci in rat liver were assessed in animals fed different levels of fat and selenium (Se) during either initiation (IN) or promotion (PR). Male Sprague Dawley rats (50g) were divided into 12 groups. One of six modified AIN-76 experimental diets were fed to groups 1-6 during weeks 1-4.5 (IN) and to groups 7-12 during weeks 4.5-15 (PR). During weeks 3-4, 13 rats/group received 10 daily doses of AFB1 (.4 mg/kg bwt/dose, i.g.). Two levels of corn oil (2% and 20%) were fed, each containing 3 levels of Se: < 0.02; 0.15; 2.5 (IN) or 1.9 (PR) ppm. When not fed the experimental diets rats were fed a standard AIN-76 diet. In groups 1-6, 0.03% phenobarbital was added to the standard diet. At week 15 rats were sacrificed. Compared to all low-fat groups, the high-fat diets with either < 0.02 or 0.15 ppm Se fed during IN resulted in a marked increase in mean diameter of GGT-positive foci and % liver section occupied by foci. In rats fed high-fat 2.5 ppm Se, preneoplastic development was decreased below all low-fat groups. During PR, Se status but not dietary fat level influenced foci formation. Rats fed < 0.02 ppm Se had greater mean diameter of foci and % section occupied by foci than either 0.15 or 1.9 ppm Se. Thus, an interaction was observed between dietary fat and selenium during IN, but not during PR.

  11. Prevention of benzene-induced genotoxicity in bone marrow and lung cells: superiority of polyphenolic acetates to polyphenols.

    PubMed

    Kumar, Ajit; Sushama, Anupam; Rohil, Vishwajeet; Manral, Sushma; Gangopadhyay, Sukanya; Prasad, Ashok K; Raj, Hanumantharao G; Parmar, Virender S

    2011-09-01

    Previous investigations carried out in our laboratory have highlighted that 7,8-diacetoxy-4-methylcoumarin demonstrates a mechanism-based inhibition of cytochrome P450 (Cyt-P450) activities such as microsome-mediated aflatoxin B1 (AFB1) epoxidation, dealkylation of alkylated resorufin, and toxicokinetics of benzene. 7,8-Diacetoxy-4-methylcoumarin, quercetin pentaacetate, and ellagic acid peracetate were also found to be effective in giving the protection of AFB1-induced genotoxicity in rat's bone marrow and lung cells possibly due to acetylation of Cyt-P450 apoprotein mediated by acetoxy drug: protein transacetylase. Later, this transacetylase was identified as calreticulin, and the acetyltransferase function of calreticulin was appropriately termed calreticulin transacetylase. In this communication, we have focused on the superiority of several classes of polyphenolic acetates to polyphenols in the modification of Cyt-P450-linked mixed function oxidases (MFOs) such as 7-ethoxyresorufin O-deethylase (EROD) and pentoxyresorufin O-dealkylase (PROD). Special attention has also been focused on benzene-induced genotoxicity in bone marrow and lung cells. Results clearly indicated that polyphenolic acetates demonstrated time-dependent inhibition of Cyt-P450-linked MFOs, while parent polyphenols failed to demonstrate the same. Polyphenolic acetates were found to be more superior to polyphenols in preventing benzene-induced micronuclei formation. The pattern of inhibition of Cyt-P450-dependent MFOs and benzene-induced micronuclei formation by polyphenolic acetates was found in tune with their specificities to calreticulin transacetylase. These results further substantiated that inhibition of Cyt-P450-linked MFOs and benzene-induced genotoxicity in bone marrow and lung cells by polyphenolic acetates are mediated by the action of calreticulin transacetylase that catalyzes the acetylation of concerned proteins. PMID:21267547

  12. Grape Pomace, an Agricultural Byproduct Reducing Mycotoxin Absorption: In Vivo Assessment in Pig Using Urinary Biomarkers.

    PubMed

    Gambacorta, Lucia; Pinton, Philippe; Avantaggiato, Giuseppina; Oswald, Isabelle P; Solfrizzo, Michele

    2016-09-01

    The efficacy of four agricultural byproducts (ABPs) and two commercial binders (CBs) to reduce the gastrointestinal absorption of a mixture of mycotoxins was tested in piglets using urinary mycotoxin biomarkers as indicator of the absorbed mycotoxins. Twenty-eight piglets were administered a bolus contaminated with the mycotoxin mixture containing or not ABP or CB. Twenty-four hour urine was collected and analyzed for mycotoxin biomarkers by using a multiantibody immunoaffinity-based LC-MS/MS method. Each bolus contained 769 μg of fumonisin B1 (FB1), 275 μg of deoxynivalenol (DON), 29 μg of zearalenone (ZEN), 6.5 μg of aflatoxin B1 (AFB1) and 6.6 μg of ochratoxin A (OTA) corresponding to 2.2, 0.8, 0.08, 0.02, and 0.02 μg/g in the daily diet, respectively. The percentage of ABP in each bolus was 50%, whereas for the two CBs the percentages were 5.2 and 17%, corresponding to 2.8, 0.3, and 0.9% in the daily diet, respectively. The reduction of mycotoxin absorption was up to 69 and 54% for ABPs and CBs, respectively. White grape pomace of Malvasia was the most effective material as it reduced significantly (p < 0.05) urinary mycotoxin biomarker of AFB1 (67%) and ZEN (69%), whereas reductions statistically not significant were observed for FB1 (57%), DON (40%), and OTA (27%). This study demonstrates that grape pomace reduces the gastrointestinal absorption of mycotoxins. This agricultural byproduct can be considered an alternative to commercial products and used in the feed industries as an effective, cheap, and natural binder for multiple mycotoxins. PMID:27509142

  13. [Simultaneous determination of 11 mycotoxins in malt by isotope internal standard-UPLC-MS/MS].

    PubMed

    Wang, Sha; Kong, Wei-jun; Yang, Mei-hua

    2016-01-01

    A suitable ultra-high performance liquid chromatography coupled with tandem mass spectrometry (UPLC-MS/MS) method was developed for the determination of 11 mycotoxins with isotope internal standard in malt. The mycotoxins in malt were extracted and purified by one-step ultrasonic extraction procedure using acetonitrile/water/acetic acid (80 : 19 : 1), and then detected and confirmed by UPLC-MS/MS, and quantified by isotope labeled AFB1 ([13C17]-AFB1) and ZEN ([13C18]-ZEN) internal standards. Rapid separation of the 11 mycotoxins was successfully achieved on a Phenomenex Kinetex C18 column (100 mm x 2.1 mm, 2.6 μm) with gradient elution using the mobile phase of methanol containing 0.1% formic acid and 2 mmol x L(-1) ammonium acetate in water. Simultaneous acquisition was performed in multiple reaction monitoring (MRM) mode with electrospray ionization (ESI) source operated in both positive and negative ionization modes. The established method provided a good linearity for the 11 mycotoxins within their respective linear ranges with correlation coefficients all higher than 0.999 1. The average recoveries ranged from 75.0% to 117.0% with relative standard deviations (RSDs) below 5.1%. The limits of detection (LODs) and quantitation (LOQs) ranged from 0.05 to 30 μg x kg(-1) and 0.15 to 87.5 μg x kg(-1), respectively, which were below the maximum residue levels (MRLs) set by the European Union. Twenty malt samples were analyzed and nine samples were detected with mycotoxins, which were confirmed according to the same fragment ions found in positive samples and the standards at the same retention time. This study has demonstrated that the one-step extraction procedure of mycotoxins from complex matrices coupled to UPLC-MS/MS method is simple, quick, accurate and sensitive for quantitative and qualitative analysis of multiple mycotoxins in malt. PMID:27405171

  14. Markers of exposure to carcinogens.

    PubMed Central

    Wogan, G N

    1989-01-01

    Methods have been developed for the detection of exposure to carcinogens and other DNA damaging agents in experimental animals and man through the detection of carcinogens or their metabolic derivatives in body fluids, or through adducts bound covalently to DNA or hemoglobin. The successful use of urinary markers of genotoxic exposures has been reported with respect to nitrosoproline as an indicator of exposure to N-nitroso compounds. The same approach has been used to detect AFB1 and AFB1-N7-Gua as markers of exposure to aflatoxin B1; of 3-methyladenine produced as a result of exposure to methylating agents; and thymine glycol as an indicator of exposure to agents causing oxidative damage to DNA. Detection of adducts formed between genotoxic agents and hemoglobin has been reported in studies of populations occupationally exposed to ethylene oxide, in which 3-hydroxyhistidine and 3-hydroxyvaline have been measured, and in smokers, whose hemoglobin has been found to contain levels of 4-aminobiphenyl and 3-hydroxyvaline that were correlated with the frequency of cigarette smoking. Detection of DNA adducts of genotoxic agents in the cells and tissues of exposed individuals has also been accomplished through the use of several types of analytical methods. Immunoassays and physicochemical methods have been applied to detect adducts formed through the major intermediate in the activation of benzo(a)pyrene, the 7,8-diol-9,10-epoxide (BPDE). This adduct has been found in the DNA of peripheral leukocytes of workers in foundries, aluminum manufacturing plants, roofers, and coke oven plants, and also in cigarette smokers.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2667991

  15. Buckwheat achenes antioxidant profile modulates Aspergillus flavus growth and aflatoxin production.

    PubMed

    Chitarrini, G; Nobili, C; Pinzari, F; Antonini, A; De Rossi, P; Del Fiore, A; Procacci, S; Tolaini, V; Scala, V; Scarpari, M; Reverberi, M

    2014-10-17

    Buckwheat (Fagopyrum spp.) is a "pseudo-cereal" of great interest in the production of healthy foods since its flour, derived from achenes, is enriched with bioactive compounds and, due to the absence of gluten, may be used in composition of celiac diets. Amongst buckwheat species, F. tataricum achenes possess a larger amount of the antioxidant flavenol rutin than the common buckwheat F. esculentum. Ongoing climate change may favor plant susceptibility to the attack by pathogenic, often mycotoxigenic, fungi with consequent increase of mycotoxins in previously unexploited feeds and foodstuffs. In particular, Aspergillus flavus, under suitable environmental conditions such as those currently occurring in Italy, may produce aflatoxin B1 (AFB1), the most carcinogenic compound of fungal origin which is classified by IARC as Category 1. In this study, the viable achenes of two buckwheat species, F. tataricum (var. Golden) and F. esculentum (var. Aelita) were inoculated with an AFB1-producing A. flavus NRRL 3357 to analyze their relative performances against fungal invasion and toxin contamination. Notably, we sought the existence of a correlation between the amount of tocols/flavonols in the achenes of buckwheat, infected and non-infected with A. flavus, and to analyze the ability of the pathogen to grow and produce toxin during achene infection. Results suggest that achenes of F. tataricum, the best producer of antioxidant compounds in this study, are less susceptible to A. flavus infection and consequently, but not proportionally, to mycotoxin contamination compared with F. esculentum. Moreover, rutin-derived quercetin appears to be more efficient in inhibiting aflatoxin biosynthesis than the parent compound. PMID:25108759

  16. Lab-on-a-chip based biosensor for the real-time detection of aflatoxin.

    PubMed

    Uludag, Yıldız; Esen, Elif; Kokturk, Guzin; Ozer, Hayrettin; Muhammad, Turghun; Olcer, Zehra; Basegmez, H Imge Oktay; Simsek, Senay; Barut, Serkan; Gok, M Yagmur; Akgun, Mete; Altintas, Zeynep

    2016-11-01

    Polymers were synthesized and utilized for aflatoxin detection coupled with a novel lab-on-a-chip biosensor: MiSens and high performance liquid chromatography (HPLC). Non-imprinted polymers (NIPs) were preferred to be designed and used due to the toxic nature of aflatoxin template and also to avoid difficult clean-up protocols. Towards an innovative miniaturized automated system, a novel biochip has been designed that consists of 6 working electrodes (1mm diameter) with shared reference and counter electrodes. The aflatoxin detection has been achieved by a competition immunoassay that has been performed using the new biochips and the automated MiSens electrochemical biosensor device. For the assay, aflatoxin antibody has been captured on the Protein A immobilized electrode. Subsequently the sample and the enzyme-aflatoxin conjugate mixture has been injected to the electrode surfaces. The final injection of the enzyme substrate results in an amperometric signal. The sensor assays for aflatoxin B1 (AFB1) in different matrices were also performed using enzyme link immunosorbent assay (ELISA) and HPLC for confirmation. High recovery was successfully achieved in spiked wheat samples using NIP coupled HPLC and NIP coupled MiSens biosensor [2ppb of aflatoxin was determined as 1.86ppb (93% recovery), 1.73ppb (86.5% recovery), 1.96ppb (98% recovery) and 1.88ppb (94.0% recovery) for immunoaffinity column (IAC)-HPLC, NIP-HPLC, Supel™ Tox SPE Cartridges (SUP)-HPLC and NIP-MiSens, respectively]. Aflatoxin detection in fig samples were also investigated with MiSens biosensor and the results were compared with HPLC method. The new biosensor allows real-time and on-site detection of AFB1 in foods with a rapid, sensitive, fully automated and miniaturized system and expected to have an immense economic impact for food industry. PMID:27591628

  17. Development of nanogold-based lateral flow immunoassay for the detection of ochratoxin A in buffer systems.

    PubMed

    Moon, Jihea; Kim, Giyoung; Lee, Sangdae

    2013-11-01

    Ochratoxin A (OTA), classified as a possible human renal carcinogen (group 2B), is a potent toxin as to cause the nephropathy. Many methods have been proposed and reviewed for OTA determination in food and agricultural products. However, current analytical procedures of mycotoxin are based on the time-delayed analysis. To reduce the contamination of OTA during distribution and storage of food and feeds, a rapid and easy-to-use detection method is required. The strip assay is an easy and fast detection method that is very reliable and cheap in production. The purpose of this study was to improve the sensitivity of strip sensor by simplifying the manufacturing steps and detection reading. Feasibility of strip assay detection of OTA was determined by color appearance of test line that was produced by the binding between OTA-BSA conjugates and gold antibody particles. However, in this study, strip assays were improved the efficacy of detection by conjugating with nanoparticles and OTA-BSA conjugates, instead of antibody. By different optimization steps in strip manufacturing and the application of the label on the strips, an increase in sensitivity and applicability was accomplished. The method uses a low cost test device consisting of a conjugation pad, membrane, sample pad, and absorbent pad. OTA-BSA and their conjugates with colloidal gold nanoparticles were prepared. The detection was based on the competition of OTA in a sample and an OTA-BSA on the colloidal particle surfaces for the binding to antibody of OTA immobilized on a membrane. It allows direct analysis of sample containing 10% methanol in phosphate buffered saline. The limit of detection obtained was 10 ng/ml for OTA. The cross reactivity of OTA strip assays with Aflatoxin B1 (AFB1) was examined. When 10, 100 ng/ml of AFB1 was tested, non-specific binding was not observed in the test strip. PMID:24245237

  18. Mycotoxigenic fungi and mycotoxins associated with stored maize from different regions of Lesotho.

    PubMed

    Mohale, Sejakhosi; Medina, Angel; Rodríguez, Alicia; Sulyok, Michael; Magan, Naresh

    2013-11-01

    Samples of stored maize from villages located in five different agroecological zones (southern lowlands, northern lowlands, Senqu river valley, foothills and mountains) of Lesotho were collected in 2009/10 and 2010/11 and assessed for contamination with toxigenic fungi. The water activity of all samples collected during the two seasons was <0.70. The total fungal populations of the maize from different regions in the two seasons was not significantly different (p > 0.05). Fusarium verticillioides, F. proliferatum and F. subglutinans predominated in different regions in both seasons based on molecular analyses. In the 2009/10 season, the isolates of these species all produced FB1, while in the 2010/11 season, very few produced FB1. A. flavus isolates (2009/10) were recovered from mountains and Senqu river valley samples while the 2010/11 isolates were predominantly from the foothills and northern lowlands. The mountain isolates of Aspergillus section Flavi produced the highest levels of AFB1 (20 mg kg(-1)). Aspergillus parasiticus was only isolated from the foothills, Senqu river valley and southern lowlands samples, and the AFB1 levels produced ranged from 'none detected' to 3.5 mg kg(-1). The Aspergillus ochraceous isolates were least frequently encountered in both seasons. In the 2009/10 season, the isolates from the northern lowlands produced ochratoxin A (OTA) in culture. No isolates of A. niger from different regions in both seasons produced any OTA. Multi-mycotoxin analyses of the maize samples were done for a range of mycotoxins. At least one sample from each region in both seasons was FB1-positive. FB1 levels for 2010/11 samples (7-936 μg kg(-1)) were higher than in the 2009/10 season (2-3 μg kg(-1)). In both seasons, the mountains registered the highest levels of FB1. Deoxynivalenol (DON) was recovered from all the samples analysed, with the highest mean contamination of 1,469 μg kg(-1) in samples from the northern lowlands. Moniliformin

  19. Evaluating microRNA profiles reveals discriminative responses following genotoxic or non-genotoxic carcinogen exposure in primary mouse hepatocytes.

    PubMed

    Rieswijk, Linda; Brauers, Karen J J; Coonen, Maarten L J; van Breda, Simone G J; Jennen, Danyel G J; Kleinjans, Jos C S

    2015-11-01

    Chemical carcinogenesis can be induced by genotoxic (GTX) or non-genotoxic (NGTX) carcinogens. GTX carcinogens have a well-described mode of action. However, the complex mechanisms by which NGTX carcinogens act are less clear and may result in conflicting results between species [e.g. Wy-14,643 (Wy)]. We hypothesise that common microRNA response pathways exist for each class of carcinogenic agents. Therefore, this study compares and integrates mRNA and microRNA expression profiles following short term acute exposure (24 and 48h) to three GTX [aflatoxin B1 (AFB1), benzo[a]pyrene (BaP) and cisplatin (CisPl)] or three NGTX (2,3,7,8-tetrachloordibenzodioxine (TCDD), cyclosporine A (CsA) and Wy) carcinogens in primary mouse hepatocytes. Discriminative gene sets, microRNAs (not for 24h) and processes were identified following 24 and 48h of exposure. From the three discriminative microRNAs found following 48h of exposure, mmu-miR-503-5p revealed to have an interaction with mRNA target gene cyclin D2 (Ccnd2 - 12444) which was involved in the discriminative process of p53 signalling and metabolism. Following exposure to NGTX carcinogens Mmu-miR-503-5p may have an oncogenic function by stimulating Ccnd2 possibly leading to a tumourigenic cell cycle progression. By contrast, after GTX carcinogen exposure it may have a tumour-suppressive function (repressing Ccnd2) leading to cell cycle arrest and to increased DNA repair activities. In addition, compound-specific microRNA-mRNA interactions [mmu-miR-301b-3p-Papss2 (for AFB1), as well as mmu-miR-29b-3p-Col4a2 and mmu-miR-24-3p-Flna (for BaP)] were found to contribute to a better understanding of microRNAs in cell cycle arrest and the impairment of the DNA damage repair, an important hallmark of GTX-induced carcinogenesis. Overall, our results indicate that microRNAs represent yet another relevant intracellular regulatory level in chemical carcinogenesis. PMID:25976910

  20. Expression of Genes by Aflatoxigenic and Nonaflatoxigenic Strains of Aspergillus flavus Isolated from Brazil Nuts.

    PubMed

    Baquião, Arianne Costa; Rodriges, Aline Guedes; Lopes, Evandro Luiz; Tralamazza, Sabina Moser; Zorzete, Patricia; Correa, Benedito

    2016-08-01

    The aims of the present study were to monitor the production of aflatoxin B1 (AFB1) and mycelial growth, and to evaluate the expression of genes directly and indirectly involved in the biosynthesis of aflatoxins by Aspergillus flavus isolated from Brazil nuts. Six previously identified A. flavus strains were grown on coconut agar at 25°C for up to 10 days. Mycotoxins were separated by high-performance liquid chromatography and fungal growth was measured daily using the diametric mycelial growth rate. Transcriptional analysis was performed by real-time polymerase chain reaction (PCR) after 2 and 7 d of incubation using specific primers (aflR, aflD, aflP, lipase, metalloprotease, and LaeA). Three (50%) of the six A. flavus isolates produced AFB1 (ICB-1, ICB-12, and ICB-54) and three (50%) were not aflatoxigenic (ICB-141, ICB-161, and ICB-198). Aflatoxin production was observed fro