Science.gov

Sample records for affect disease resistance

  1. Dietary supplementation of probiotics affects growth, immune response and disease resistance of Cyprinus carpio fry.

    PubMed

    Gupta, Akhil; Gupta, Paromita; Dhawan, Asha

    2014-12-01

    The effects of dietary Bacillus coagulans (MTCC 9872), Bacillus licheniformis (MTCC 6824) and Paenibacillus polymyxa (MTCC 122) supplementation on growth performance, non-specific immunity and protection against Aeromonas hydrophila infection were evaluated in common carp, Cyprinus carpio fry. Laboratory maintained B. coagulans, B. licheniformis and P. polymyxa were used to study antagonistic activity against fish pathogenic bacteria by agar well diffusion assay. Healthy fish fry were challenged by this bacterium for determination of its safety. Fish were fed for 80 days with control basal diet (B0) and experimental diets containing B. coagulans (B1), B. licheniformis (B2) and P. polymyxa (B3) at 10(9) CFU/g diet. Fish fry (mean weight 0.329 ± 0.01 g) were fed these diets and growth performance, various non-specific immune parameters and disease resistance study were conducted at 80 days post-feeding. The antagonism study showed inhibition zone against A. hydrophila and Vibrio harveyi. All the probiotic bacterial strains were harmless to fish fry as neither mortality nor morbidities were observed of the challenge. The growth-promoting influences of probiotic supplemented dietary treatments were observed with fish fry and the optimum survival, growth and feed utilization were obtained with P. polymyxa (B3) supplemented diet. Study of different non-specific innate immunological parameters viz. lysozyme activity, respiratory burst assay and myeloperoxidase content showed significant (p < 0.05) higher values in fish fry fed B3 diet at 10(9) CFU/g. The challenge test showed dietary supplementation of B. coagulans, B. licheniformis and P. polymyxa significantly (p < 0.05) enhanced the resistance of fish fry against bacterial challenge. These results collectively suggests that P. polymyxa is a potential probiotic species and can be used in aquaculture to improve growth, feed utilization, non-specific immune responses and disease resistance of fry common carp, C. carpio.

  2. Disease severity of organic rice as affected by host resistance, fertility and tillage

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several studies were conducted to determine the effect of fertilizer inputs and tillage methods on disease incidence in an organic rice production system. The results of these studies suggest that organically produced rice is more vulnerable to infection of narrow brown leaf spot and brown spot. Thi...

  3. Evidence of major genes affecting bacterial cold water disease resistance in rainbow trout using Bayesian methods of complex segregation analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial cold water disease (BCWD) causes significant economic loss in salmonid aquaculture. We previously detected genetic variation for BCWD resistance in our rainbow trout population, and a family-based selection program to improve resistance was initiated at the NCCCWA in 2005. The main objec...

  4. Evidence of major genes affecting resistance to bacterial cold water disease in rainbow trout using Bayesian methods of segregation analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial cold water disease (BCWD) causes significant economic loss in salmonid aquaculture. We previously detected genetic variation for BCWD resistance in our rainbow trout population, and a family-based selection program to improve resistance was initiated at the National Center for Cool and Col...

  5. Extreme Air Pollution Conditions Adversely Affect Blood Pressure and Insulin Resistance: The Air Pollution and Cardiometabolic Disease Study.

    PubMed

    Brook, Robert D; Sun, Zhichao; Brook, Jeffrey R; Zhao, Xiaoyi; Ruan, Yanping; Yan, Jianhua; Mukherjee, Bhramar; Rao, Xiaoquan; Duan, Fengkui; Sun, Lixian; Liang, Ruijuan; Lian, Hui; Zhang, Shuyang; Fang, Quan; Gu, Dongfeng; Sun, Qinghua; Fan, Zhongjie; Rajagopalan, Sanjay

    2016-01-01

    Mounting evidence supports that fine particulate matter adversely affects cardiometabolic diseases particularly in susceptible individuals; however, health effects induced by the extreme concentrations within megacities in Asia are not well described. We enrolled 65 nonsmoking adults with metabolic syndrome and insulin resistance in the Beijing metropolitan area into a panel study of 4 repeated visits across 4 seasons since 2012. Daily ambient fine particulate matter and personal black carbon levels ranged from 9.0 to 552.5 µg/m(3) and 0.2 to 24.5 µg/m(3), respectively, with extreme levels observed during January 2013. Cumulative fine particulate matter exposure windows across the prior 1 to 7 days were significantly associated with systolic blood pressure elevations ranging from 2.0 (95% confidence interval, 0.3-3.7) to 2.7 (0.6-4.8) mm Hg per SD increase (67.2 µg/m(3)), whereas cumulative black carbon exposure during the previous 2 to 5 days were significantly associated with ranges in elevations in diastolic blood pressure from 1.3 (0.0-2.5) to 1.7 (0.3-3.2) mm Hg per SD increase (3.6 µg/m(3)). Both black carbon and fine particulate matter were significantly associated with worsening insulin resistance (0.18 [0.01-0.36] and 0.22 [0.04-0.39] unit increase per SD increase of personal-level black carbon and 0.18 [0.02-0.34] and 0.22 [0.08-0.36] unit increase per SD increase of ambient fine particulate matter on lag days 4 and 5). These results provide important global public health warnings that air pollution may pose a risk to cardiometabolic health even at the extremely high concentrations faced by billions of people in the developing world today.

  6. Grafting for disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary purpose of grafting vegetables worldwide has been to provide resistance to soilborne diseases. The potential loss of methyl bromide as a soil fumigant combined with pathogen resistance to commonly used pesticides will make resistance to soil born pathogens even more important in the futu...

  7. Grafting for disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary purpose of grafting vegetables worldwide has been to provide resistance to soil-borne diseases. The potential loss of methyl bromide as a soil fumigant combined with pathogen resistance to commonly used pesticides will make resistance to soil-borne pathogens even more important in the fu...

  8. Selenium Supplementation Affects Insulin Resistance and Serum hs-CRP in Patients with Type 2 Diabetes and Coronary Heart Disease.

    PubMed

    Farrokhian, A; Bahmani, F; Taghizadeh, M; Mirhashemi, S M; Aarabi, M H; Raygan, F; Aghadavod, E; Asemi, Z

    2016-04-01

    To our knowledge, this study is the first indicating the effects of selenium supplementation on metabolic status of patients with type 2 diabetes mellitus (T2DM) and coronary heart disease (CHD). This study was conducted to evaluate the effects of selenium supplementation on metabolic profiles, biomarkers of inflammation, and oxidative stress of patients with T2DM and CHD. This randomized, double-blind, placebo-controlled trial was performed among 60 patients with T2DM and CHD aged 40-85 years. Participants were randomly divided into 2 groups. Group A received 200 μg selenium supplements (n=30) and group B received placebo per day (n=30) for 8 weeks. Fasting blood samples were taken at the beginning of the study and after 8-week intervention to quantify metabolic profiles. After 8 weeks, compared with the placebo, selenium supplementation resulted in a significant decrease in serum insulin levels (- 2.2±4.6 vs. + 3.6±8.4 μIU/ml, p=0.001), homeostasis model of assessment-insulin resistance (HOMA-IR) (- 0.7±1.3 vs. + 0.9±2.4, p=0.004), homeostatic model assessment-beta cell function (HOMA-B) (- 7.5±17.2 vs. + 15.1±34.5, p=0.002) and a significant increase in quantitative insulin sensitivity check index (QUICKI) (+0.01±0.03 vs. - 0.01±0.03, p=0.02). In addition, patients who received selenium supplements had a significant reduction in serum high-sensitivity C-reactive protein (hs-CRP) (- 1 372.3±2 318.8 vs. - 99.8±1 453.6 ng/ml, p=0.01) and a significant rise in plasma total antioxidant capacity (TAC) concentrations (+ 301.3±400.6 vs. - 127.2±428.0 mmol/l, p<0.001) compared with the placebo. A 200 μg/day selenium supplementation among patients with T2DM and CHD resulted in a significant decrease in insulin, HOMA-IR, HOMA-B, serum hs-CRP, and a significant increase in QUICKI score and TAC concentrations.

  9. Reconceptualizing resistance: sociology and the affective dimension of resistance.

    PubMed

    Hynes, Maria

    2013-12-01

    This paper re-examines the sociological study of resistance in light of growing interest in the concept of affect. Recent claims that we are witness to an 'affective turn' and calls for a 'new sociological empiricism' sensitive to affect indicate an emerging paradigm shift in sociology. Yet, mainstream sociological study of resistance tends to have been largely unaffected by this shift. To this end, this paper presents a case for the significance of affect as a lens by which to approach the study of resistance. My claim is not simply that the forms of actions we would normally recognize as resistance have an affective dimension. Rather, it is that the theory of affect broadens 'resistance' beyond the purview of the two dominant modes of analysis in sociology; namely, the study of macropolitical forms, on the one hand, and the micropolitics of everyday resistance on the other. This broadened perspective challenges the persistent assumption that ideological forms of power and resistance are the most pertinent to the contemporary world, suggesting that much power and resistance today is of a more affective nature. In making this argument, it is a Deleuzian reading of affect that is pursued, which opens up to a level of analysis beyond the common understanding of affect as emotion. I argue that an affective approach to resistance would pay attention to those barely perceptible transitions in power and mobilizations of bodily potential that operate below the conscious perceptions and subjective emotions of social actors. These affective transitions constitute a new site at which both power and resistance operate.

  10. Powdery Mildew Disease Resistance

    SciTech Connect

    Somerville, Shauna C.

    2010-08-31

    The overall goal of this project was to characterize the PMR5 protein, a member of the DUF231/TBR family, and to determine its role in plant cell wall biogenesis. Since the pmr5 mutants are also resistant to the fungal powdery mildew pathogen, we wished to determine what specific cell wall changes are associated with disease resistance and why. The graduate student working on this project made mutations in the putative active site of PMR5, assuming it is a member of the SGNH/GDSL esterase superfamily (Anantharaman and Aravind, 2010, Biology Direct 5, 1). These mutants were inactive in planta suggesting that PMR5 is a functional enzyme and not a binding protein or chaperone. In addition, she determined that cell wall preparations from the pmr5 mutant exhibited a modest reduction (13%) in total acetyl groups. To pursue characterization further, the graduate student expressed the PMR5 protein in a heterologous E. coli system. She could purify PMR5 using a two step protocol based on tags added to the N and C terminus of the protein. She was able to show the PMR5 protein bound to pectins, including homogalacturonan, but not to other cell wall components (e.g., xyloglucans, arabinans). Based on these observations, a postdoctoral fellow is currently developing an enzyme assay for PMR5 based on the idea that it may be acetylating the homogalacturonic acid pectin fraction. Our initial experiments to localize PMR5 subcellularly suggested that it occurred in the endoplasmic reticulum. However, since the various pectins are believed to be synthesized in the Golgi apparatus, we felt it necessary to repeat our results using a native promoter expression system. Within the past year, we have demonstrated conclusively that PMR5 is localized to the endoplasmic reticulum, a location that sets it apart from most cell wall biogenesis and modification enzymes. The graduate student contributed to the characterization of two suppressor mutants, which were selected as restoring powdery

  11. Detection and Validation of QTL Affecting Bacterial Cold Water Disease Resistance in Rainbow Trout Using Restriction-Site Associated DNA Sequencing

    PubMed Central

    Gao, Guangtu; Liu, Sixin; Hernandez, Alvaro G.; Rexroad, Caird E.

    2015-01-01

    Bacterial cold water disease (BCWD) causes significant economic loss in salmonid aquaculture. Using microsatellite markers in a genome scan, we previously detected significant and suggestive QTL affecting phenotypic variation in survival following challenge with Flavobacterium psychrophilum, the causative agent of BCWD in rainbow trout. In this study, we performed selective genotyping of SNPs from restriction-site associated DNA (RAD) sequence data from two pedigreed families (2009070 and 2009196) to validate the major QTL from the previous work and to detect new QTL. The use of RAD SNPs in the genome scans increased the number of mapped markers from ~300 to ~5,000 per family. The significant QTL detected in the microsatellites scan on chromosome Omy8 in family 2009070 was validated explaining up to 58% of the phenotypic variance in that family, and in addition, a second QTL was also detected on Omy8. Two novel QTL on Omy11 and 14 were also detected, and the previously suggestive QTL on Omy1, 7 and 25 were also validated in family 2009070. In family 2009196, the microsatellite significant QTL on Omy6 and 12 were validated and a new QTL on Omy8 was detected, but none of the previously detected suggestive QTL were validated. The two Omy8 QTL from family 2009070 and the Omy12 QTL from family 2009196 were found to be co-localized with handling and confinement stress response QTL that our group has previously identified in a separate pedigreed family. With the currently available data we cannot determine if the co-localized QTL are the result of genes with pleiotropic effects or a mere physical proximity on the same chromosome segment. The genetic markers linked to BCWD resistance QTL were used to query the scaffolds of the rainbow trout reference genome assembly and the QTL-positive scaffold sequences were found to include 100 positional candidate genes. Several of the candidate genes located on or near the two Omy8 QTL detected in family 2009070 suggest potential

  12. Geminivirus Management: Disease Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Begomoviruses are a major constraint for tomato production in many parts of the subtropic and tropics; and the most efficient way to increase tomato production is to use resistant cultivars in association with an IPM program. The Middle East (MERC) and a Guatemalan (CDR) project involved involved d...

  13. Insulin Resistance in Alzheimer's Disease

    PubMed Central

    Dineley, Kelly T; Jahrling, Jordan B; Denner, Larry

    2014-01-01

    Insulin is a key hormone regulating metabolism. Insulin binding to cell surface insulin receptors engages many signaling intermediates operating in parallel and in series to control glucose, energy, and lipids while also regulating mitogenesis and development. Perturbations in the function of any of these intermediates, which occur in a variety of diseases, cause reduced sensitivity to insulin and insulin resistance with consequent metabolic dysfunction. Chronic inflammation ensues which exacerbates compromised metabolic homeostasis. Since insulin has a key role in learning and memory as well as directly regulating ERK, a kinase required for the type of learning and memory compromised in early Alzheimer's disease (AD), insulin resistance has been identified as a major risk factor for the onset of AD. Animal models of AD or insulin resistance or both demonstrate that AD pathology and impaired insulin signaling form a reciprocal relationship. Of note are human and animal model studies geared toward improving insulin resistance that have led to the identification of the nuclear receptor and transcription factor, peroxisome proliferator-activated receptor gamma (PPARγ) as an intervention tool for early AD. Strategic targeting of alternate nodes within the insulin signaling network has revealed disease-stage therapeutic windows in animal models that coalesce with previous and ongoing clinical trial approaches. Thus, exploiting the connection between insulin resistance and AD provides powerful opportunities to delineate therapeutic interventions that slow or block the pathogenesis of AD. PMID:25237037

  14. Genomics and disease resistance studies in livestock☆

    PubMed Central

    Bishop, Stephen C; Woolliams, John A

    2014-01-01

    This paper considers the application of genetic and genomic techniques to disease resistance, the interpretation of data arising from such studies and the utilisation of the research outcomes to breed animals for enhanced resistance. Resistance and tolerance are defined and contrasted, factors affecting the analysis and interpretation of field data presented, and appropriate experimental designs discussed. These general principles are then applied to two detailed case studies, infectious pancreatic necrosis in Atlantic salmon and bovine tuberculosis in dairy cattle, and the lessons learnt are considered in detail. It is concluded that the rate limiting step in disease genetic studies will generally be provision of adequate phenotypic data, and its interpretation, rather than the genomic resources. Lastly, the importance of cross-disciplinary dialogue between the animal health and animal genetics communities is stressed. PMID:26339300

  15. Developing disease resistant stone fruits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stone fruit (Prunus spp.) (peach, nectarine, plum, apricot, cherry) and almonds are susceptible to a number of pathogens. These pathogens can cause extensive losses in the field, during transport and storage, and in the market. Breeding for disease resistance requires an extensive knowledge of the...

  16. Heart Disease Affects Women of All Ages

    MedlinePlus

    ... Home Current Issue Past Issues Heart Disease Affects Women of All Ages Past Issues / Winter 2007 Table ... of this page please turn Javascript on. Young Women: Lifestyle-related factors that increase heart disease risk ...

  17. Affective cycling in thyroid disease

    SciTech Connect

    Tapp, A.

    1988-05-01

    Depression in an elderly man with primary recurrent unipolar depression responded to radioactive iodine treatment of a thyrotoxic nodule, without the addition of psychotropic medications. Two months later, manic symptoms developed concomitant with the termination of the hyperthyroid state secondary to the radioactive iodine treatment. Clinical implications of these findings in relation to the possible mechanism of action of thyroid hormones on affective cycling are discussed.

  18. Everolimus affects vasculogenic mimicry in renal carcinoma resistant to sunitinib

    PubMed Central

    Serova, Maria; Tijeras-Raballand, Annemilaï; Santos, Celia Dos; Martinet, Matthieu; Neuzillet, Cindy; Lopez, Alfred; Mitchell, Dianne C.; Bryan, Brad A.; Gapihan, Guillaume; Janin, Anne; Bousquet, Guilhem; Riveiro, Maria Eugenia; Bieche, Ivan; Faivre, Sandrine

    2016-01-01

    Angiogenesis is hallmark of clear cell renal cell carcinogenesis. Anti-angiogenic therapies have been successful in improving disease outcome; however, most patients treated with anti-angiogenic agents will eventually progress. In this study we report that clear cell renal cell carcinoma was associated with vasculogenic mimicry in both mice and human with tumor cells expressing endothelial markers in the vicinity of tumor vessels. We show that vasculogenic mimicry was efficiently targeted by sunitinib but eventually associated with tumor resistance and a more aggressive phenotype both in vitro and in vivo. Re-challenging these resistant tumors in mice, we showed that second-line treatment with everolimus particularly affected vasculogenic mimicry and tumor cell differentiation compared to sorafenib and axitinib. Finally, our results highlighted the phenotypic and genotypic changes at the tumor cell and microenvironment levels during sunitinib response and progression and the subsequent improvement second-line therapies bring to the current renal cell carcinoma treatment paradigm. PMID:27509260

  19. Insulin Resistance and Skin Diseases

    PubMed Central

    Napolitano, Maddalena; Megna, Matteo; Monfrecola, Giuseppe

    2015-01-01

    In medical practice, almost every clinician may encounter patients with skin disease. However, it is not always easy for physicians of all specialties to face the daily task of determining the nature and clinical implication of dermatologic manifestations. Are they confined to the skin, representing a pure dermatologic event? Or are they also markers of internal conditions relating to the patient's overall health? In this review, we will discuss the principal cutaneous conditions which have been linked to metabolic alterations. Particularly, since insulin has an important role in homeostasis and physiology of the skin, we will focus on the relationships between insulin resistance (IR) and skin diseases, analyzing strongly IR-associated conditions such as acanthosis nigricans, acne, and psoriasis, without neglecting emerging and potential scenarios as the ones represented by hidradenitis suppurativa, androgenetic alopecia, and hirsutism. PMID:25977937

  20. Detection and validation of QTL affecting bacterial cold water disease resistance in rainbow trout using restriction-site associated DNA sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial cold water disease (BCWD) causes significant economic loss in salmonid aquaculture. Using microsatellites genome scan we have previously detected significant and suggestive QTL with major effects on the phenotypic variation of survival following challenge with Flavobacterium psychrophilum...

  1. Cotton GhMKK5 affects disease resistance, induces HR-like cell death, and reduces the tolerance to salt and drought stress in transgenic Nicotiana benthamiana

    PubMed Central

    Zhang, Liang; Li, Yuzhen; Lu, Wenjing; Meng, Fei; Wu, Chang-ai; Guo, Xingqi

    2012-01-01

    Mitogen-activated protein kinase (MAPK) cascades are involved in various processes from plant growth and development to biotic and abiotic stress responses. MAPK kinases (MAPKKs), which link MAPKs and MAPKK kinases (MAPKKKs), play crucial roles in MAPK cascades to mediate a variety of stress responses in plants. However, few MAPKKs have been functionally characterized in cotton (Gossypium hirsutum). In this study, a novel gene, GhMKK5, from cotton belonging to the group C MAPKKs was isolated and characterized. The expression of GhMKK5 can be induced by pathogen infection, abiotic stresses, and multiple defence-related signal molecules. The overexpression of GhMKK5 in Nicotiana benthamiana enhanced the plants’ resistance to the bacterial pathogen Ralstonia solanacearum by elevating the expression of pathogen resistance (PR) genes, including PR1a, PR2, PR4, PR5, and NPR1, but increased the plants’ sensitivity to the oomycete pathogen Phytophthora parasitica var. nicotianae Tucker. Importantly, GhMKK5-overexpressing plants displayed markedly elevated expression of reactive oxygen species-related and cell death marker genes, such as NtRbohA and NtCDM, and resulted in hypersensitive response (HR)-like cell death characterized by the accumulation of H2O2. Furthermore, it was demonstrated that GhMKK5 overexpression in plants reduced their tolerance to salt and drought stresses, as determined by statistical analysis of seed germination, root length, leaf water loss, and survival rate. Drought obviously accelerated the cell death phenomenon in GhMKK5-overexpressing plants. These results suggest that GhMKK5 may play an important role in pathogen infection and the regulation of the salt and drought stress responses in plants. PMID:22442420

  2. Spatial variation in disease resistance: from molecules to metapopulations

    PubMed Central

    Laine, Anna-Liisa; Burdon, Jeremy J.; Dodds, Peter N.; Thrall, Peter H.

    2010-01-01

    Summary Variation in disease resistance is a widespread phenomenon in wild plant-pathogen associations. Here, we review current literature on natural plant-pathogen associations to determine how diversity in disease resistance is distributed at different hierarchical levels – within host individuals, within host populations, among host populations at the metapopulation scale and at larger regional scales. We find diversity in resistance across all spatial scales examined. Furthermore, variability seems to be the best counter-defence of plants against their rapidly evolving pathogens. We find that higher diversity of resistance phenotypes also results in higher levels of resistance at the population level. Overall, we find that wild plant populations are more likely to be susceptible than resistant to their pathogens. However, the degree of resistance differs strikingly depending on the origin of the pathogen strains used in experimental inoculation studies. Plant populations are on average 16% more resistant to allopatric pathogen strains than they are to strains that occur within the same population (48 % vs. 32 % respectively). Pathogen dispersal mode affects levels of resistance in natural plant populations with lowest levels detected for hosts of airborne pathogens and highest for waterborne pathogens. Detailed analysis of two model systems, Linum marginale infected by Melampsora lini, and Plantago lanceolata infected by Podosphaera plantaginis, show that the amount of variation in disease resistance declines towards higher spatial scales as we move from individual hosts to metapopulations, but evaluation of multiple spatial scales is needed to fully capture the structure of disease resistance. Synthesis: Variation in disease resistance is ubiquitous in wild plant-pathogen associations. While the debate over whether the resistance structure of plant populations is determined by pathogen-imposed selection versus non-adaptive processes remains unresolved, we do

  3. LMM5.1 and LMM5.4, two eukaryotic translation elongation factor 1A-like gene family members, negatively affect cell death and disease resistance in rice.

    PubMed

    Zhao, Jiying; Liu, Pengcheng; Li, Chunrong; Wang, Yanyan; Guo, Lequn; Jiang, Guanghuai; Zhai, Wenxue

    2017-02-20

    Lesion mimic mutant (LMM) genes, stimulating lesion formation in the absence of pathogens, play significant roles in immune response. In this study, we characterized a rice lesion mimic mutant, lmm5, which displayed light-dependent spontaneous lesions. Additionally, lmm5 plants exhibited enhanced resistance to all of the tested races of Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae (Xoo) by increasing the expression of defense-related genes and the accumulation of hydrogen peroxide. Genetic analysis showed that the lesion mimic phenotype of lmm5 was controlled by two genes, lmm5.1 and lmm5.4, which were isolated with a map-based cloning strategy. Remarkably, LMM5.1 and LMM5.4 share a 97.4% amino acid sequence identity, and they each encode a eukaryotic translation elongation factor 1A (eEF1A)-like protein. Besides, LMM5.1 and LMM5.4 were expressed in a tissue-specific and an indica-specific manner, respectively. In addition, high-throughput mRNA sequencing analysis confirmed that the basal immunity was constitutively activated in the lmm5 mutant. Taken together, these results suggest that the homologous eEF1A-like genes, LMM5.1 and LMM5.4, negatively affect cell death and disease resistance in rice.

  4. Molecular Genetics of Plant Disease Resistance

    NASA Astrophysics Data System (ADS)

    Staskawicz, Brian J.; Ausubel, Frederick M.; Baker, Barbara J.; Ellis, Jeffrey G.; Jones, Jonathan D. G.

    1995-05-01

    Plant breeders have used disease resistance genes (R genes) to control plant disease since the turn of the century. Molecular cloning of R genes that enable plants to resist a diverse range of pathogens has revealed that the proteins encoded by these genes have several features in common. These findings suggest that plants may have evolved common signal transduction mechanisms for the expression of resistance to a wide range of unrelated pathogens. Characterization of the molecular signals involved in pathogen recognition and of the molecular events that specify the expression of resistance may lead to novel strategies for plant disease control.

  5. Disease resistance: Molecular mechanisms and biotechnological applications

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This special issue “Disease resistance: molecular mechanisms and biotechnological applications” contains 11 review articles and four original research papers. Research in the area of engineering for disease resistance continues to progress although only 10% of the transgenic plants registered for ...

  6. Natural Disease Resistance in Threatened Staghorn Corals

    PubMed Central

    Vollmer, Steven V.; Kline, David I.

    2008-01-01

    Disease epidemics have caused extensive damage to tropical coral reefs and to the reef-building corals themselves, yet nothing is known about the abilities of the coral host to resist disease infection. Understanding the potential for natural disease resistance in corals is critically important, especially in the Caribbean where the two ecologically dominant shallow-water corals, Acropora cervicornis and A. palmata, have suffered an unprecedented mass die-off due to White Band Disease (WBD), and are now listed as threatened under the US Threatened Species Act and as critically endangered under the IUCN Red List criteria. Here we examine the potential for natural resistance to WBD in the staghorn coral Acropora cervicornis by combining microsatellite genotype information with in situ transmission assays and field monitoring of WBD on tagged genotypes. We show that six percent of staghorn coral genotypes (3 out of 49) are resistant to WBD. This natural resistance to WBD in staghorn corals represents the first evidence of host disease resistance in scleractinian corals and demonstrates that staghorn corals have an innate ability to resist WBD infection. These resistant staghorn coral genotypes may explain why pockets of Acropora have been able to survive the WBD epidemic. Understanding disease resistance in these corals may be the critical link to restoring populations of these once dominant corals throughout their range. PMID:19005565

  7. Teaching the Factors Affecting Resistance Using Pencil Leads

    NASA Astrophysics Data System (ADS)

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A). Additionally, the resistance depends on the type of conductor. Resistance R can be thus be expressed as R = ρL/A, where ρ is the resistivity of the conductor.

  8. Factors Affecting Sulfate Resistance of Mortars.

    DTIC Science & Technology

    1980-10-01

    sulfate des mortiers est affected par le rapport eau/ciment et la teneur en ciment (dont il n’ei;t pas parl4) ainsi que par la quantite d’aluminate...la pouzzolane, y compris les cendres volantes produites par ]a combustion de charbons bitumineux, subbitumineux et lignitiques, le verre volcanique...pour cent de SiO2 ; elles sont un sous-produit de la production de metal au silicium. Les cendres volantes produites par les charbons subbitumineux et

  9. Teaching the Factors Affecting Resistance Using Pencil Leads

    ERIC Educational Resources Information Center

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A).…

  10. Ohmic resistance affects microbial community and ...

    EPA Pesticide Factsheets

    Multi-anode microbial electrochemical cells (MXCs) are considered as one of the most promising configurations for scale-up of MXCs, but fundamental understanding of anode kinetics governing current density is limited in the MXCs. In this study we first assessed microbial community and electrochemical kinetic parameters for biofilms on individual anodes in a multi-anode MXC to better comprehend anode fundamentals. Microbial community analysis using 16S rRNA illumine sequencing showed that Geobactor genus, one of the most kinetically efficient anode-respiring bacteria (ARB), was abundant (87%) only on the biofilm anode closest to a reference electrode in which current density was the highest among four anodes. In comparison, Geobacter populations were less than 11% for other three anodes more distant from the reference electrode, generating small current density. Half-saturation anode potential (EKA) was the lowest at -0.251 to -0.242 V (vs. standard hydrogen electrode) for the closest anode, while EKA was as high as -0.134 V for the farthest anode. Our study clearly proves that ohmic resistance changes anode potential which mainly causes different biofilm communities on individual anodes and consequently influences anode kinetics. This study explored the use of multiple anodes in microelectrochemical cells and the microbial community on these anodes, as a function of the efficiency in producing hydrogen peroxide.

  11. Does natural variation in diversity affect biotic resistance?

    USGS Publications Warehouse

    Harrison, Susan; Cornell, Howard; Grace, James B.

    2015-01-01

    Theories linking diversity to ecosystem function have been challenged by the widespread observation of more exotic species in more diverse native communities. Few studies have addressed the key underlying process by dissecting how community diversity is shaped by the same environmental gradients that determine biotic and abiotic resistance to new invaders. In grasslands on highly heterogeneous soils, we used addition of a recent invader, competitor removal and structural equation modelling (SEM) to analyse soil influences on community diversity, biotic and abiotic resistance and invader success. Biotic resistance, measured by reduction in invader success in the presence of the resident community, was negatively correlated with species richness and functional diversity. However, in the multivariate SEM framework, biotic resistance was independent of all forms of diversity and was positively affected by soil fertility via community biomass. Abiotic resistance, measured by invader success in the absence of the resident community, peaked on infertile soils with low biomass and high community diversity. Net invader success was determined by biotic resistance, consistent with this invader's better performance on infertile soils in unmanipulated conditions. Seed predation added slightly to biotic resistance without qualitatively changing the results. Soil-related genotypic variation in the invader also did not affect the results. Synthesis. In natural systems, diversity may be correlated with invasibility and yet have no effect on either biotic or abiotic resistance to invasion. More generally, the environmental causes of variation in diversity should not be overlooked when considering the potential functional consequences of diversity.

  12. Disease Resistance Gene Analogs (RGAs) in Plants

    PubMed Central

    Sekhwal, Manoj Kumar; Li, Pingchuan; Lam, Irene; Wang, Xiue; Cloutier, Sylvie; You, Frank M.

    2015-01-01

    Plants have developed effective mechanisms to recognize and respond to infections caused by pathogens. Plant resistance gene analogs (RGAs), as resistance (R) gene candidates, have conserved domains and motifs that play specific roles in pathogens’ resistance. Well-known RGAs are nucleotide binding site leucine rich repeats, receptor like kinases, and receptor like proteins. Others include pentatricopeptide repeats and apoplastic peroxidases. RGAs can be detected using bioinformatics tools based on their conserved structural features. Thousands of RGAs have been identified from sequenced plant genomes. High-density genome-wide RGA genetic maps are useful for designing diagnostic markers and identifying quantitative trait loci (QTL) or markers associated with plant disease resistance. This review focuses on recent advances in structures and mechanisms of RGAs, and their identification from sequenced genomes using bioinformatics tools. Applications in enhancing fine mapping and cloning of plant disease resistance genes are also discussed. PMID:26287177

  13. Improved genetic disease resistance solutions for potato

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Halterman Lab research program is focused on understanding the genetic basis of disease resistance in potato. Several diseases, such as late blight, early blight, potato virus Y, and verticillium wilt, are particularly problematic in Wisconsin. With the exception of early blight, major genes hav...

  14. Rosai-Dorfman disease affecting the maxilla

    PubMed Central

    Miniello, Thaís Gimenez; Araujo, Juliane Piragine; Sugaya, Norberto Nobuo; Elias, Fernando Melhem; de Almeida, Oslei Paes

    2016-01-01

    Rosai-Dorfman disease (RDD), formerly called sinus histiocytosis with massive lymphadenopathy, is a non-neoplastic proliferative histiocytic disorder with behavior ranging from highly aggressive to spontaneous remission. Although the lymph nodes are more commonly involved, any organ can be affected. This study aimed to describe the features and the follow-up of a case of extranodal RDD. Our patient was a 39-year-old woman who was referred with an 11-month history of pain in the right maxilla. On clinical examination, some upper right teeth presented full mobility with normal appearance of the surrounding gingiva. Radiographic exams showed an extensive bone reabsorption and maxillary sinus filled with homogeneous tissue, which sometimes showed polypoid formation. An incisional biopsy demonstrated a diffuse inflammatory infiltrate rich in foamy histiocytes displaying lymphocytes emperipolesis. Immunohistochemistry showed positivity for CD68 and S-100, and negativity for CD3, CD20, and CD30. Such features were consistent with the RDD diagnosis. The patient was referred to a hematologist and corticotherapy was administrated for 6 months. RDD is an uncommon disease that rarely affects the maxilla. In the present case, the treatment was conservative, and the patient is currently asymptomatic after 5 years of follow-up. PMID:28210574

  15. Elevating crop disease resistance with cloned genes

    PubMed Central

    Jones, Jonathan D. G.; Witek, Kamil; Verweij, Walter; Jupe, Florian; Cooke, David; Dorling, Stephen; Tomlinson, Laurence; Smoker, Matthew; Perkins, Sara; Foster, Simon

    2014-01-01

    Essentially all plant species exhibit heritable genetic variation for resistance to a variety of plant diseases caused by fungi, bacteria, oomycetes or viruses. Disease losses in crop monocultures are already significant, and would be greater but for applications of disease-controlling agrichemicals. For sustainable intensification of crop production, we argue that disease control should as far as possible be achieved using genetics rather than using costly recurrent chemical sprays. The latter imply CO2 emissions from diesel fuel and potential soil compaction from tractor journeys. Great progress has been made in the past 25 years in our understanding of the molecular basis of plant disease resistance mechanisms, and of how pathogens circumvent them. These insights can inform more sophisticated approaches to elevating disease resistance in crops that help us tip the evolutionary balance in favour of the crop and away from the pathogen. We illustrate this theme with an account of a genetically modified (GM) blight-resistant potato trial in Norwich, using the Rpi-vnt1.1 gene isolated from a wild relative of potato, Solanum venturii, and introduced by GM methods into the potato variety Desiree. PMID:24535396

  16. Molecular markers for resistance against infectious diseases of economic importance

    PubMed Central

    Prajapati, B. M.; Gupta, J. P.; Pandey, D. P.; Parmar, G. A.; Chaudhari, J. D.

    2017-01-01

    Huge livestock population of India is under threat by a large number of endemic infectious (bacterial, viral, and parasitic) diseases. These diseases are associated with high rates of morbidity and mortality, particularly in exotic and crossbred cattle. Beside morbidity and mortality, economic losses by these diseases occur through reduced fertility, production losses, etc. Some of the major infectious diseases which have great economic impact on Indian dairy industries are tuberculosis (TB), Johne’s disease (JD), mastitis, tick and tick-borne diseases (TTBDs), foot and mouth disease, etc. The development of effective strategies for the assessment and control of infectious diseases requires a better understanding of pathogen biology, host immune response, and diseases pathogenesis as well as the identification of the associated biomarkers. Indigenous cattle (Bos indicus) are reported to be comparatively less affected than exotic and crossbred cattle. However, genetic basis of resistance in indigenous cattle is not well documented. The association studies of few of the genes associated with various diseases, namely, solute carrier family 11 member 1, Toll-like receptors 1, with TB; Caspase associated recruitment domain 15, SP110 with JD; CACNA2D1, CD14 with mastitis and interferon gamma, BoLA­-DRB3.2 alleles with TTBDs, etc., are presented. Breeding for genetic resistance is one of the promising ways to control the infectious diseases. High host resistance is the most important method for controlling such diseases, but till today no breed is total immune. Therefore, work may be undertaken under the hypothesis that the different susceptibility to these diseases are exhibited by indigenous and crossbred cattle is due to breed-specific differences in the dealing of infected cells with other immune cells, which ultimately influence the immune response responded against infections. Achieving maximum resistance to these diseases is the ultimate goal, is technically

  17. Molecular markers for resistance against infectious diseases of economic importance.

    PubMed

    Prajapati, B M; Gupta, J P; Pandey, D P; Parmar, G A; Chaudhari, J D

    2017-01-01

    Huge livestock population of India is under threat by a large number of endemic infectious (bacterial, viral, and parasitic) diseases. These diseases are associated with high rates of morbidity and mortality, particularly in exotic and crossbred cattle. Beside morbidity and mortality, economic losses by these diseases occur through reduced fertility, production losses, etc. Some of the major infectious diseases which have great economic impact on Indian dairy industries are tuberculosis (TB), Johne's disease (JD), mastitis, tick and tick-borne diseases (TTBDs), foot and mouth disease, etc. The development of effective strategies for the assessment and control of infectious diseases requires a better understanding of pathogen biology, host immune response, and diseases pathogenesis as well as the identification of the associated biomarkers. Indigenous cattle (Bos indicus) are reported to be comparatively less affected than exotic and crossbred cattle. However, genetic basis of resistance in indigenous cattle is not well documented. The association studies of few of the genes associated with various diseases, namely, solute carrier family 11 member 1, Toll-like receptors 1, with TB; Caspase associated recruitment domain 15, SP110 with JD; CACNA2D1, CD14 with mastitis and interferon gamma, BoLA--DRB3.2 alleles with TTBDs, etc., are presented. Breeding for genetic resistance is one of the promising ways to control the infectious diseases. High host resistance is the most important method for controlling such diseases, but till today no breed is total immune. Therefore, work may be undertaken under the hypothesis that the different susceptibility to these diseases are exhibited by indigenous and crossbred cattle is due to breed-specific differences in the dealing of infected cells with other immune cells, which ultimately influence the immune response responded against infections. Achieving maximum resistance to these diseases is the ultimate goal, is technically

  18. Unmasking levodopa resistance in Parkinson's disease.

    PubMed

    Nonnekes, Jorik; Timmer, Monique H M; de Vries, Nienke M; Rascol, Olivier; Helmich, Rick C; Bloem, Bastiaan R

    2016-11-01

    Some motor and nonmotor features associated with Parkinson's disease (PD) do not seem to respond well to levodopa (or other forms of dopaminergic medication) or appear to become resistant to levodopa treatment with disease progression and longer disease duration. In this narrative review, we elaborate on this issue of levodopa resistance in PD. First, we discuss the possibility of pseudoresistance, which refers to dopamine-sensitive symptoms or signs that falsely appear to be (or have become) resistant to levodopa, when in fact other mechanisms are at play, resulting in suboptimal dopaminergic efficacy. Examples include interindividual differences in pharmacodynamics and pharmacokinetics and underdosing because of dose-limiting side effects or because of levodopa phobia. Moreover, pseudoresistance can emerge as not all features of PD respond adequately to the same dosage of levodopa. Second, we address that for several motor features (eg, freezing of gait or tremor) and several nonmotor features (eg, specific cognitive functions), the response to levodopa is fairly complex, with a combination of levodopa-responsive, levodopa-resistant, and even levodopa-induced characteristics. A possible explanation relates to the mixed presence of underlying dopaminergic and nondopaminergic brain lesions. We suggest that clinicians take these possibilities into account before concluding that symptoms or signs of PD are totally levodopa resistant. © 2016 International Parkinson and Movement Disorder Society.

  19. Developing disease resistance in CP-Cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Disease resistance is an important selection criterion in the Canal Point (CP) Sugarcane Cultivar Development Program. Ratoon stunt (RSD, caused by Leifsonia xyli subsp. Xyli Evtsuhenko et al.), leaf scald (caused by Xanthomonas albilineans Ashby, Dowson), mosaic (caused by Sugarcane mosaic virus st...

  20. Treatment of affective disorders in cardiac disease.

    PubMed

    Mavrides, Nicole; Nemeroff, Charles B

    2015-06-01

    Patients with cardiovascular disease (CVD) commonly have syndromal major depression, and depression has been associated with an increased risk of morbidity and mortality. Prevalence of depression is between 17% and 47% in CVD patients. Pharmacologic and psychotherapeutic interventions have long been studied, and in general are safe and somewhat efficacious in decreasing depressive symptoms in patients with CVD. The impact on cardiac outcomes remains unclear. The evidence from randomized controlled clinical trials indicates that antidepressants, especially selective serotonin uptake inhibitors, are overwhelmingly safe, and likely to be effective in the treatment of depression in patients with CVD. This review describes the prevalence of depression in patients with CVD, the physiological links between depression and CVD, the treatment options for affective disorders, and the clinical trials that demonstrate efficacy and safety of antidepressant medications and psychotherapy in this patient population. Great progress has been made in understanding potential mediators between major depressive disorder and CVD--both health behaviors and shared biological risks such as inflammation.

  1. Treatment of affective disorders in cardiac disease

    PubMed Central

    Mavrides, Nicole; Nemeroff, Charles B.

    2015-01-01

    Patients with cardiovascular disease (CVD) commonly have syndromal major depression, and depression has been associated with an increased risk of morbidity and mortality. Prevalence of depression is between 17% and 47% in CVD patients. Pharmacologic and psychotherapeutic interventions have long been studied, and in general are safe and somewhat efficacious in decreasing depressive symptoms in patients with CVD. The impact on cardiac outcomes remains unclear. The evidence from randomized controlled clinical trials indicates that antidepressants, especially selective serotonin uptake inhibitors, are overwhelmingly safe, and likely to be effective in the treatment of depression in patients with CVD. This review describes the prevalence of depression in patients with CVD, the physiological links between depression and CVD, the treatment options for affective disorders, and the clinical trials that demonstrate efficacy and safety of antidepressant medications and psychotherapy in this patient population. Great progress has been made in understanding potential mediators between major depressive disorder and CVD—both health behaviors and shared biological risks such as inflammation. PMID:26246788

  2. Abiotic stresses affect Trichoderma harzianum T39-induced resistance to downy mildew in grapevine.

    PubMed

    Roatti, Benedetta; Perazzolli, Michele; Gessler, Cesare; Pertot, Ilaria

    2013-12-01

    Enhancement of plant defense through the application of resistance inducers seems a promising alternative to chemical fungicides for controlling crop diseases but the efficacy can be affected by abiotic factors in the field. Plants respond to abiotic stresses with hormonal signals that may interfere with the mechanisms of induced systemic resistance (ISR) to pathogens. In this study, we exposed grapevines to heat, drought, or both to investigate the effects of abiotic stresses on grapevine resistance induced by Trichoderma harzianum T39 (T39) to downy mildew. Whereas the efficacy of T39-induced resistance was not affected by exposure to heat or drought, it was significantly reduced by combined abiotic stresses. Decrease of leaf water potential and upregulation of heat-stress markers confirmed that plants reacted to abiotic stresses. Basal expression of defense-related genes and their upregulation during T39-induced resistance were attenuated by abiotic stresses, in agreement with the reduced efficacy of T39. The evidence reported here suggests that exposure of crops to abiotic stress should be carefully considered to optimize the use of resistance inducers, especially in view of future global climate changes. Expression analysis of ISR marker genes could be helpful to identify when plants are responding to abiotic stresses, in order to optimize treatments with resistance inducers in field.

  3. Development of disease-resistant rice using regulatory components of induced disease resistance.

    PubMed

    Takatsuji, Hiroshi

    2014-01-01

    Infectious diseases cause huge crop losses annually. In response to pathogen attacks, plants activate defense systems that are mediated through various signaling pathways. The salicylic acid (SA) signaling pathway is the most powerful of these pathways. Several regulatory components of the SA signaling pathway have been identified, and are potential targets for genetic manipulation of plants' disease resistance. However, the resistance associated with these regulatory components is often accompanied by fitness costs; that is, negative effects on plant growth and crop yield. Chemical defense inducers, such as benzothiadiazole and probenazole, act on the SA pathway and induce strong resistance to various pathogens without major fitness costs, owing to their 'priming effect.' Studies on how benzothiadiazole induces disease resistance in rice have identified WRKY45, a key transcription factor in the branched SA pathway, and OsNPR1/NH1. Rice plants overexpressing WRKY45 were extremely resistant to rice blast disease caused by the fungus Magnaporthe oryzae and bacterial leaf blight disease caused by Xanthomonas oryzae pv. oryzae (Xoo), the two major rice diseases. Disease resistance is often accompanied by fitness costs; however, WRKY45 overexpression imposed relatively small fitness costs on rice because of its priming effect. This priming effect was similar to that of chemical defense inducers, although the fitness costs were amplified by some environmental factors. WRKY45 is degraded by the ubiquitin-proteasome system, and the dual role of this degradation partly explains the priming effect. The synergistic interaction between SA and cytokinin signaling that activates WRKY45 also likely contributes to the priming effect. With a main focus on these studies, I review the current knowledge of SA-pathway-dependent defense in rice by comparing it with that in Arabidopsis, and discuss potential strategies to develop disease-resistant rice using signaling components.

  4. Transgenic animals resistant to infectious diseases.

    PubMed

    Tiley, L

    2016-04-01

    The list of transgenic animals developed to test ways of producing livestock resistant to infectious disease continues to grow. Although the basic techniques for generating transgenic animals have not changed very much in the ten years since they were last reviewed for the World Organisation for Animal Health, one recent fundamental technological advance stands to revolutionise genome engineering. The advent of technically simple and efficient site-specific gene targeting has profound implications for genetically modifying livestock species.

  5. Partial aphid resistance in lettuce negatively affects parasitoids.

    PubMed

    Lanteigne, Marie-Eve; Brodeur, Jacques; Jenni, Sylvie; Boivin, Guy

    2014-10-01

    This study investigated the effects of partial plant resistance on the lettuce aphid Nasonovia ribisnigri (Mosley) (Hemiptera: Aphididae), a major pest of cultivated lettuce (Lactuca sativa L.), and one of its parasitoids, Aphidius ervi Haliday (Hymenoptera: Braconidae). Aphids were reared on susceptible (L. sativa variety Estival; S) or partially resistant (Lactuca serriola L. PI 491093; PR) lettuce, and next parasitized by A. ervi females. Fitness proxies were measured for both aphids and parasitoids. Developmental time to adult stage took longer for alate and apterous aphids (an average of 3.5 and 1.5 additional days, respectively) on PR than on S lettuce, and fecundity of alate aphids reared on PR lettuce was reduced by 37.8% relative to those reared on S lettuce. Size (tibia length) and weight of aphids reared on PR lettuce were lower than for aphids reared on S lettuce from the third and second instar onward, respectively. Parasitism of aphids reared on PR plants resulted in lower parasitoid offspring emergence (-49.9%), lower adult female (-30.3%) and male (-27.5%) weight, smaller adult female (-17.5%) and male (-11.9%) size, and lower female fecundity (37.8% fewer eggs) than when parasitoids developed from aphids reared on S plants. Our results demonstrate that partial aphid resistance in lettuce negatively affects both the second and third trophic levels. Host plant resistance in cultivated lettuce may therefore create an ecological sink for aphid parasitoids.

  6. Exposure to Corticosterone Affects Host Resistance, but Not Tolerance, to an Emerging Fungal Pathogen

    PubMed Central

    Murone, Julie; DeMarchi, Joseph A.; Venesky, Matthew D.

    2016-01-01

    Host responses to pathogens include defenses that reduce infection burden (i.e., resistance) and traits that reduce the fitness consequences of an infection (i.e., tolerance). Resistance and tolerance are affected by an organism's physiological status. Corticosterone (“CORT”) is a hormone that is associated with the regulation of many physiological processes, including metabolism and reproduction. Because of its role in the stress response, CORT is also considered the primary vertebrate stress hormone. When secreted at high levels, CORT is generally thought to be immunosuppressive. Despite the known association between stress and disease resistance in domesticated organisms, it is unclear whether these associations are ecologically and evolutionary relevant in wildlife species. We conducted a 3x3 fully crossed experiment in which we exposed American toads (Anaxyrus [Bufo] americanus) to one of three levels of exogenous CORT (no CORT, low CORT, or high CORT) and then to either low or high doses of the pathogenic chytrid fungus Batrachochytrium dendrobatidis (“Bd”) or a sham exposure treatment. We assessed Bd infection levels and tested how CORT and Bd affected toad resistance, tolerance, and mortality. Exposure to the high CORT treatment significantly elevated CORT release in toads; however, there was no difference between toads given no CORT or low CORT. Exposure to CORT and Bd each increased toad mortality, but they did not interact to affect mortality. Toads that were exposed to CORT had higher Bd resistance than toads exposed to ethanol controls/low CORT, a pattern opposite that of most studies on domesticated animals. Exposure to CORT did not affect toad tolerance to Bd. Collectively, these results show that physiological stressors can alter a host’s response to a pathogen, but that the outcome might not be straightforward. Future studies that inhibit CORT secretion are needed to better our understanding of the relationship between stress physiology

  7. Ticks and Tickborne Diseases Affecting Military Personnel

    DTIC Science & Technology

    1989-09-01

    by disease transmission. Various bacteria , rickettsiae , viruses, and protozoans are transmitted to people via tick bites (see Chapter 4). Relatively...Ticks may harbor and transmit to people various disease agents such as protozoa, viruses, bacteria , rickettsiae , and toxins. Several factors are...Natural history. The causative agent of RMSF, Rickettsia rickettsii , is transmitted to man by several species of ticks. In the U.S., 2 of the most

  8. Genetic improvement for disease resistance in oysters: A review.

    PubMed

    Dégremont, Lionel; Garcia, Céline; Allen, Standish K

    2015-10-01

    Oyster species suffer from numerous disease outbreaks, often causing high mortality. Because the environment cannot be controlled, genetic improvement for disease resistance to pathogens is an attractive option to reduce their impact on oyster production. We review the literature on selective breeding programs for disease resistance in oyster species, and the impact of triploidy on such resistance. Significant response to selection to improve disease resistance was observed in all studies after two to four generations of selection for Haplosporidium nelsoni and Roseovarius crassostrea in Crassostrea virginica, OsHV-1 in Crassostrea gigas, and Martelia sydneyi in Saccostrea glomerata. Clearly, resistance in these cases was heritable, but most of the studies failed to provide estimates for heritability or genetic correlations with other traits, e.g., between resistance to one disease and another. Generally, it seems breeding for higher resistance to one disease does not confer higher resistance or susceptibility to another disease. For disease resistance in triploid oysters, several studies showed that triploidy confers neither advantage nor disadvantage in survival, e.g., OsHV-1 resistance in C. gigas. Other studies showed higher disease resistance of triploids over diploid as observed in C. virginica and S. glomerata. One indirect mechanism for triploids to avoid disease was to grow faster, thus limiting the span of time when oysters might be exposed to disease.

  9. Transposon tagging of disease resistance genes

    SciTech Connect

    Michelmore, R.W. . Dept. of Physics)

    1989-01-01

    We are developing a transposon mutagenesis system for lettuce to clone genes for resistance to the fungal pathogen, Bremia lactucae. Activity of heterologous transposons is being studied in transgenic plants. Southern analysis of T{sub 1} and T{sub 2} plants containing Tam3 from Antirrhinum provided ambiguous results. Multiple endonuclease digests indicated that transposition had occurred; however, in no plant were all endonuclease digests consistent with a simple excision event. Southern or PCR analysis of over 50 plans containing Ac from maize have also failed to reveal clear evidence of transposition; this is contrast to experiments by others with the same constructs who have observed high rates of Ac excision in other plant species. Nearly all of 65 T{sub 2} families containing Ac interrupting a chimeric streptomycin resistance gene (Courtesy J. Jones, Sainsbury Lab., UK) clearly segregated for streptomycin resistance. Southern analyses, however, showed no evidence of transposition, indicating restoration of a functional message by other mechanisms, possibly mRNA processing. Transgenic plants have also been generated containing CaMV 35S or hsp70 promoters fused to transposase coding sequences or a Ds element interrupting a chimeric GUS gene (Courtesy M. Lassner, UC Davis). F{sub 1} plants containing both constructs were analyzed for transposition. Only two plants containing both constructs were obtained from 48 progeny, far fewer than expected, and neither showed evidence of transposition in Southerns and GUS assays. We are currently constructing further chimeric transposase fusions. To test for the stability of the targeted disease resistance genes, 50,000 F{sub 1} plants heterozygous for three resistance genes were generated; no mutants have been identified in the 5000 so far screened.

  10. Rainbow trout (Oncorhynchus mykiss) resistance to columnaris disease is heritable and favorably correlated with bacterial cold water disease resistance.

    PubMed

    Evenhuis, J P; Leeds, T D; Marancik, D P; LaPatra, S E; Wiens, G D

    2015-04-01

    Columnaris disease (CD), caused by Flavobacterium columnare, is an emerging disease affecting rainbow trout aquaculture. Objectives of this study were to 1) estimate heritability of CD resistance in a rainbow trout line (ARS-Fp-R) previously selected 4 generations for improved bacterial cold water disease (BCWD) resistance; 2) estimate genetic correlations among CD resistance, BCWD resistance, and growth to market BW; and 3) compare CD resistance among the ARS-Fp-R, ARS-Fp-S (selected 1 generation for increased BCWD susceptibility), and ARS-Fp-C (selection control) lines. Heritability of CD resistance was estimated using data from a waterborne challenge of 44 full-sib ARS-Fp-R families produced using a paternal half-sib mating design, and genetic correlations were estimated using these data and 5 generations of BCWD resistance, 9-mo BW (approximately 0.5 kg), and 12-mo BW (approximately 1.0 kg) data from 405 ARS-Fp-R full-sib families. The CD and BCWD challenges were initiated at approximately 52 and 84 d posthatch, or approximately 650 and 1,050 degree days (°C × d), respectively. Survival of ARS-Fp-R families ranged from 0 to 48% following CD challenge and heritability estimates were similar between CD (0.17 ± 0.09) and BCWD (0.18 ± 0.03) resistance, and the genetic correlation between these 2 traits was favorable (0.35 ± 0.25). Genetic correlations were small and antagonistic (-0.15 ± 0.08 to -0.19 ± 0.24) between the 2 resistance traits and 9- and 12-mo BW. Two challenges were conducted in consecutive years to compare CD resistance among ARS-Fp-R, ARS-Fp-C, and ARS-Fp-S families. In the first challenge, ARS-Fp-R families (83% survival) had greater CD resistance than ARS-Fp-C (73.5%; P = 0.02) and ARS-Fp-S (68%; P < 0.001) families, which did not differ (P = 0.16). In the second challenge, using an approximately 2.5-fold greater challenge dose, ARS-Fp-R families exhibited greater CD resistance (56% survival) than ARS-Fp-S (38% survival; P = 0.02) families

  11. Screening and evaluation of molecular markers linked with the factors affected Verticillium wilt resistance in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The purpose of this study is to search the consistency of the factors affecting Verticillium wilt resistance and resistant levels in cotton to further study the wilt resistant genes and genetic mechanism of resistance. Method: Thirty-seven pairs of primers derived from Verticillium wilt resistance ...

  12. Therapy-resistant symptoms in Parkinson's disease.

    PubMed

    Vorovenci, Ruxandra Julia; Biundo, Roberta; Antonini, Angelo

    2016-01-01

    In recent years, the management of Parkinson's disease (PD) has come a long way, leading to an increase in therapeutic options that now include oral and transdermal drug delivery, infusion as well as surgical treatments. Nonetheless, in the evolution of this complex neurodegenerative disorder, several symptoms remain refractory to dopaminergic therapy. It is our aim to review the literature to date and to bring them into focus, as well as emphasizing on pathophysiological mechanisms, profile of risk factors in their development, and therapeutic options. We will focus on freezing of gait, camptocormia, dysphagia and dysphonia, as well as cognitive impairment and dementia because they represent the far end of therapy-resistant symptoms, encompassing poor health-related quality of life and often a more reserved prognosis with either a rapid evolution of the disease, and/or merely a more severe clinical picture. Pathophysiological mechanisms and brain neurotransmitter abnormalities behind these symptoms seem to overlap to some extent, and a better understanding of these correlations is desirable. We believe that further research is paramount to expand our knowledge of the dopamine-resistant symptoms and, consequently, to develop specific therapeutic strategies.

  13. How glyphosate affects plant disease development: it is more than enhanced susceptibility.

    PubMed

    Hammerschmidt, Ray

    2017-01-09

    Glyphosate has been shown to affect the development of plant disease in several ways. Plants utilize phenolic and other shikimic acid pathway-derived compounds as part of their defense against pathogens, and glyphosate inhibits the biosynthesis of these compounds via its mode of action. Several studies have shown a correlation between enhanced disease and suppression of phenolic compound production after glyphosate. Glyphosate-resistant crop plants have also been studied for changes in resistance as a result of carrying the glyphosate resistance trait. The evidence indicates that neither the resistance trait nor application of glyphosate to glyphosate-resistant plants increases susceptibility to disease. The only exceptions to this are cases where glyphosate has been shown to reduce rust diseases on glyphosate-resistant crops, supporting a fungicidal role for this chemical. Finally, glyphosate treatment of weeds or volunteer crops can cause a temporary increase in soil-borne pathogens that may result in disease development if crops are planted too soon after glyphosate application. © 2017 Society of Chemical Industry.

  14. Omics Approach to Identify Factors Involved in Brassica Disease Resistance.

    PubMed

    Francisco, Marta; Soengas, Pilar; Velasco, Pablo; Bhadauria, Vijai; Cartea, Maria E; Rodríguez, Victor M

    2016-01-01

    Understanding plant's defense mechanisms and their response to biotic stresses is of fundamental meaning for the development of resistant crop varieties and more productive agriculture. The Brassica genus involves a large variety of economically important species and cultivars used as vegetable source, oilseeds, forage and ornamental. Damage caused by pathogens attack affects negatively various aspects of plant growth, development, and crop productivity. Over the last few decades, advances in plant physiology, genetics, and molecular biology have greatly improved our understanding of plant responses to biotic stress conditions. In this regard, various 'omics' technologies enable qualitative and quantitative monitoring of the abundance of various biological molecules in a high-throughput manner, and thus allow determination of their variation between different biological states on a genomic scale. In this review, we have described advances in 'omic' tools (genomics, transcriptomics, proteomics and metabolomics) in the view of conventional and modern approaches being used to elucidate the molecular mechanisms that underlie Brassica disease resistance.

  15. Resistant Hypertension in Nondialysis Chronic Kidney Disease

    PubMed Central

    Stanzione, Giovanna; Conte, Giuseppe

    2013-01-01

    Resistant hypertension (RH) is defined as blood pressure (BP) that remains above the target of less than 140/90 mmHg in the general population and 130/80 mmHg in people with diabetes mellitus or chronic kidney disease (CKD) in spite of the use of at least three full-dose antihypertensive drugs including a diuretic or as BP that reaches the target by means of four or more drugs. In CKD, RH is a common condition due to a combination of factors including sodium retention, increased activity of the renin-angiotensin system, and enhanced activity of the sympathetic nervous system. Before defining the hypertensive patient as resistant it is mandatory to exclude the so-called “pseudoresistance.” This condition, which refers to the apparent failure to reach BP target in spite of an appropriate antihypertensive treatment, is mainly caused by white coat hypertension that is prevalent (30%) in CKD patients. Recently we have demonstrated that “true” RH represents an independent risk factor for renal and cardiovascular outcomes in CKD patients. PMID:23710342

  16. Evaluation of soybean genotypes for resistance to three seed borne diseases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seed-borne diseases of soybeans caused by Phomopsis longicolla (Phomopsis seed decay), Cercospora kukuchii (purple seed stain), and M. phaseolina (charcoal rot) are economically important seed-borne diseases that affect seed quality. Commercial cultivars marketed as resistant to all the three disea...

  17. [New therapies for children affected by bone diseases].

    PubMed

    Ballhausen, Diana; Dépraz, Nuria Garcia; Kern, Ilse; Unger, Sheila; Bonafé, Luisa

    2012-02-22

    Considerable progress has been achieved in recent years in treating children affected by bone diseases. Advances in the understanding of the molecular pathophysiology of genetic bone diseases have led to the development of enzyme replacement therapies for various lysosomal storage diseases, following the breakthrough initiated in treating Gaucher disease. Clinical studies are underway with tailored molecules correcting bone fragility and alleviating chronic bone pain and other manifestations of hypophosphatasia, or promoting growth of long bones in achondroplasia patients. We further report our very encouraging experience with intravenous bisphosphonate treatment in children suffering from secondary osteopenia and the high prevalence of calcium and vitamin D deficits in these severely disabled children.

  18. Working Towards Disease Resistance in Peanuts Through Biotechnology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistant cultivars are the most desirable approach to disease control in agriculture. Early and late leaf spot are the most important foliar diseases of peanut worldwide. Significant progress for leaf spot resistance in peanut can be achieved through biotechnology. The National Peanut Research ...

  19. Defense mechanisms involved in disease resistance of grafted vegetables

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vegetable grafting with resistant rootstocks is an effective strategy to control a variety of soil-borne diseases and root-knot nematodes in the Cucurbitaceae and Solanaceae. In addition, improved resistance to some foliar diseases and viruses has also been reported in grafted plants. Hence, graft...

  20. Modeling deployment of Pierce’s disease resistant grapevines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Deployment of Pierce’s disease resistant grapevines is a key solution to mitigating economic losses caused by Xylella fastidiosa. While Pierce’s disease resistant grapevines under development display mild symptoms and have lower bacterial populations than susceptible varieties, all appear to remain ...

  1. Genomic selection for genetic resistance to Marek's disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enhancing genetic resistance to Marek’s disease (MD) is another control strategy to augment MD vaccines. Ideally selection would use genetic markers linked to the underlying genes that confer MD genetic resistance, which would avoid having to expose elite lines to Marek’s disease virus (MDV). To ide...

  2. The form of nitrogen nutrition affects resistance against Pseudomonas syringae pv. phaseolicola in tobacco

    PubMed Central

    Gupta, Kapuganti J.; Mur, Luis A. J.

    2013-01-01

    Different forms of nitrogen (N) fertilizer affect disease development; however, this study investigated the effects of N forms on the hypersensitivity response (HR)—a pathogen-elicited cell death linked to resistance. HR-eliciting Pseudomonas syringae pv. phaseolicola was infiltrated into leaves of tobacco fed with either or . The speed of cell death was faster in -fed compared with -fed plants, which correlated, respectively, with increased and decreased resistance. Nitric oxide (NO) can be generated by nitrate reductase (NR) to influence the formation of the HR. NO generation was reduced in -fed plants where N assimilation bypassed the NR step. This was similar to that elicited by the disease-forming P. syringae pv. tabaci strain, further suggesting that resistance was compromised with feeding. PR1a is a biomarker for the defence signal salicylic acid (SA), and expression was reduced in -fed compared with fed plants at 24h after inoculation. This pattern correlated with actual SA measurements. Conversely, total amino acid, cytosolic and apoplastic glucose/fructose and sucrose were elevated in - treated plants. Gas chromatography/mass spectroscopy was used to characterize metabolic events following different N treatments. Following nutrition, polyamine biosynthesis was predominant, whilst after nutrition, flux appeared to be shifted towards the production of 4-aminobutyric acid. The mechanisms whereby feeding enhances SA, NO, and polyamine-mediated HR-linked defence whilst these are compromised with , which also increases the availability of nutrients to pathogens, are discussed. PMID:23230025

  3. Do Xylem Fibers Affect Vessel Cavitation Resistance?1

    PubMed Central

    Jacobsen, Anna L.; Ewers, Frank W.; Pratt, R. Brandon; Paddock, William A.; Davis, Stephen D.

    2005-01-01

    Possible mechanical and hydraulic costs to increased cavitation resistance were examined among six co-occurring species of chaparral shrubs in southern California. We measured cavitation resistance (xylem pressure at 50% loss of hydraulic conductivity), seasonal low pressure potential (Pmin), xylem conductive efficiency (specific conductivity), mechanical strength of stems (modulus of elasticity and modulus of rupture), and xylem density. At the cellular level, we measured vessel and fiber wall thickness and lumen diameter, transverse fiber wall and total lumen area, and estimated vessel implosion resistance using (t/b)h2, where t is the thickness of adjoining vessel walls and b is the vessel lumen diameter. Increased cavitation resistance was correlated with increased mechanical strength (r2 = 0.74 and 0.76 for modulus of elasticity and modulus of rupture, respectively), xylem density (r2 = 0.88), and Pmin (r2 = 0.96). In contrast, cavitation resistance and Pmin were not correlated with decreased specific conductivity, suggesting no tradeoff between these traits. At the cellular level, increased cavitation resistance was correlated with increased (t/b)h2 (r2 = 0.95), increased transverse fiber wall area (r2 = 0.89), and decreased fiber lumen area (r2 = 0.76). To our knowledge, the correlation between cavitation resistance and fiber wall area has not been shown previously and suggests a mechanical role for fibers in cavitation resistance. Fiber efficacy in prevention of vessel implosion, defined as inward bending or collapse of vessels, is discussed. PMID:16100359

  4. Nanotechnology and pulmonary delivery to overcome resistance in infectious diseases.

    PubMed

    Andrade, Fernanda; Rafael, Diana; Videira, Mafalda; Ferreira, Domingos; Sosnik, Alejandro; Sarmento, Bruno

    2013-11-01

    Used since ancient times especially for the local treatment of pulmonary diseases, lungs and airways are a versatile target route for the administration of both local and systemic drugs. Despite the existence of different platforms and devices for the pulmonary administration of drugs, only a few formulations are marketed, partly due to physiological and technological limitations. Respiratory infections represent a significant burden to health systems worldwide mainly due to intrahospital infections that more easily affect immune-compromised patients. Moreover, tuberculosis (TB) is an endemic infectious disease in many developing nations and it has resurged in the developed world associated with the human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) epidemic. Currently, medicine faces the specter of antibiotic resistance. Besides the development of new anti-infectious drugs, the development of innovative and more efficient delivery systems for drugs that went off patent appears as a promising strategy pursued by the pharmaceutical industry to improve the therapeutic outcomes and to prolong the utilities of their intellectual property portfolio. In this context, nanotechnology-based drug delivery systems (nano-DDS) emerged as a promising approach to circumvent the limitations of conventional formulations and to treat drug resistance, opening the hypothesis for new developments in this area.

  5. Role of sodium restriction and diuretic therapy for "resistant" hypertension in chronic kidney disease.

    PubMed

    Sinnakirouchenan, Ramapriya; Kotchen, Theodore A

    2014-01-01

    In patients with chronic kidney disease, an impaired capacity of the kidney to excrete sodium is a major contributor to hypertension. We discuss the role of sodium restriction and diuretic therapy for resistant hypertension in chronic kidney disease. Independent of increasing blood pressure, a sustained high sodium intake also may affect the progression of renal disease adversely. Consequently, dietary sodium restriction and appropriate diuretic therapy are the foundation for the treatment of resistant hypertension. Thiazide-like diuretics have decreasing effectiveness in patients with advancing renal disease; however, they may augment the effectiveness of the more potent loop diuretics. Increasing evidence suggests that spironolactone is an effective adjunct for the treatment of resistant hypertension. Inclusion of other classes of antihypertensive agents to the treatment regimen generally is necessary to counterbalance other mechanisms contributing to resistant hypertension. The effectiveness of these agents is enhanced by dietary sodium restriction and diuretic therapy.

  6. Plant-pathogen interactions: disease resistance in modern agriculture.

    PubMed

    Boyd, Lesley A; Ridout, Christopher; O'Sullivan, Donal M; Leach, Jan E; Leung, Hei

    2013-04-01

    The growing human population will require a significant increase in agricultural production. This challenge is made more difficult by the fact that changes in the climatic and environmental conditions under which crops are grown have resulted in the appearance of new diseases, whereas genetic changes within the pathogen have resulted in the loss of previously effective sources of resistance. To help meet this challenge, advanced genetic and statistical methods of analysis have been used to identify new resistance genes through global screens, and studies of plant-pathogen interactions have been undertaken to uncover the mechanisms by which disease resistance is achieved. The informed deployment of major, race-specific and partial, race-nonspecific resistance, either by conventional breeding or transgenic approaches, will enable the production of crop varieties with effective resistance without impacting on other agronomically important crop traits. Here, we review these recent advances and progress towards the ultimate goal of developing disease-resistant crops.

  7. Genetic analysis of resistance gene analogues from a sugarcane cultivar resistant to red rot disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One of the important approaches for disease control in sugarcane is to develop a disease resistant variety; this may be accomplished through identification of resistance genes in sugarcane. In this study, PCR primers targeting the conserved motifs of the nucleotide-binding site (NBS) class and kinas...

  8. Latin America: native populations affected by early onset periodontal disease.

    PubMed

    Nowzari, Hessam; Botero, Javier Enrique

    2011-06-01

    Millions of individuals are affected by early onset periodontal disease in Latin America, a continent that includes more than 20 countries. The decision-makers claim that the disease is not commonly encountered. In 2009, 280,919 authorized immigrants were registered in the United States versus 5,460,000 unauthorized (2,600,000 in California). The objective of the present article is to raise awareness about the high prevalence of the disease among Latin Americans and the good prognosis of preventive measures associated with minimal financial cost.

  9. Insecticide resistance in vector Chagas disease: evolution, mechanisms and management.

    PubMed

    Mougabure-Cueto, Gastón; Picollo, María Inés

    2015-09-01

    Chagas disease is a chronic parasitic infection restricted to America. The disease is caused by the protozoa Trypanosoma cruzi, which is transmitted to human through the feces of infected triatomine insects. Because no treatment is available for the chronic forms of the disease, vector chemical control represents the best way to reduce the incidence of the disease. Chemical control has been based principally on spraying dwellings with insecticide formulations and led to the reduction of triatomine distribution and consequent interruption of disease transmission in several areas from endemic region. However, in the last decade it has been repeatedly reported the presence triatomnes, mainly Triatoma infestans, after spraying with pyrethroid insecticides, which was associated to evolution to insecticide resistance. In this paper the evolution of insecticide resistance in triatomines is reviewed. The insecticide resistance was detected in 1970s in Rhodnius prolixus and 1990s in R. prolixus and T. infestans, but not until the 2000s resistance to pyrthroids in T. infestans associated to control failures was described in Argentina and Bolivia. The main resistance mechanisms (i.e. enhanced metabolism, altered site of action and reduced penetration) were described in the T. infestans resistant to pyrethrods. Different resistant profiles were demonstrated suggesting independent origin of the different resistant foci of Argentina and Bolivia. The deltamethrin resistance in T. infestans was showed to be controlled by semi-dominant, autosomally inherited factors. Reproductive and developmental costs were also demonstrated for the resistant T. infestans. A discussion about resistance and tolerance concepts and the persistence of T. infestans in Gran Chaco region are presented. In addition, theoretical concepts related to toxicological, evolutionary and ecological aspects of insecticide resistance are discussed in order to understand the particular scenario of pyrethroid

  10. Inoculation of Transgenic Resistant Potato by Phytophthora infestans Affects Host Plant Choice of a Generalist Moth.

    PubMed

    Abreha, Kibrom B; Alexandersson, Erik; Vossen, Jack H; Anderson, Peter; Andreasson, Erik

    2015-01-01

    Pathogen attack and the plant's response to this attack affect herbivore oviposition preference and larval performance. Introduction of major resistance genes against Phytophthora infestans (Rpi-genes), the cause of the devastating late blight disease, from wild Solanum species into potato changes the plant-pathogen interaction dynamics completely, but little is known about the effects on non-target organisms. Thus, we examined the effect of P. infestans itself and introduction of an Rpi-gene into the crop on host plant preference of the generalist insect herbivore, Spodoptera littoralis (Lepidoptera: Noctuidae). In two choice bioassays, S. littoralis preferred to oviposit on P. infestans-inoculated plants of both the susceptible potato (cv. Desiree) and an isogenic resistant clone (A01-22: cv. Desiree transformed with Rpi-blb1), when compared to uninoculated plants of the same genotype. Both cv. Desiree and clone A01-22 were equally preferred for oviposition by S. littoralis when uninoculated plants were used, while cv. Desiree received more eggs compared to the resistant clone when both were inoculated with the pathogen. No significant difference in larval and pupal weight was found between S. littoralis larvae reared on leaves of the susceptible potato plants inoculated or uninoculated with P. infestans. Thus, the herbivore's host plant preference in this system was not directly associated with larval performance. The results indicate that the Rpi-blb1 based resistance in itself does not influence insect behavior, but that herbivore oviposition preference is affected by a change in the plant-microbe interaction.

  11. Nitric oxide functions as a signal in plant disease resistance.

    PubMed

    Delledonne, M; Xia, Y; Dixon, R A; Lamb, C

    1998-08-06

    Recognition of an avirulent pathogen triggers the rapid production of the reactive oxygen intermediates superoxide (O2-) and hydrogen peroxide (H2O2). This oxidative burst drives crosslinking of the cell wall, induces several plant genes involved in cellular protection and defence, and is necessary for the initiation of host cell death in the hypersensitive disease-resistance response. However, this burst is not enough to support a strong disease-resistance response. Here we show that nitric oxide, which acts as a signal in the immune, nervous and vascular systems, potentiates the induction of hypersensitive cell death in soybean cells by reactive oxygen intermediates and functions independently of such intermediates to induce genes for the synthesis of protective natural products. Moreover, inhibitors of nitric oxide synthesis compromise the hypersensitive disease-resistance response of Arabidopsis leaves to Pseudomonas syringae, promoting disease and bacterial growth. We conclude that nitric oxide plays a key role in disease resistance in plants.

  12. Current advances on genetic resistance to rice blast disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast disease caused by the fungal pathogen Magnaporthe oryzae is one of the most threatening fungal diseases resulting in significant annual crop losses worldwide. Blast disease has been effectively managed by a combination of resistant (R) gene deployment, application of fungicides, and suita...

  13. Glyphosate resistance does not affect Palmer amaranth seedbank longevity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A greater understanding of the factors that regulate weed seed return to and persistence in the soil seedbank is needed for the management of difficult to control herbicide resistant weeds. Studies were conducted in Tifton, GA to evaluate the longevity of buried Palmer amaranth seeds and estimate t...

  14. Identification of mutations in Colombian patients affected with Fabry disease.

    PubMed

    Uribe, Alfredo; Mateus, Heidi Eliana; Prieto, Juan Carlos; Palacios, Maria Fernanda; Ospina, Sandra Yaneth; Pasqualim, Gabriela; da Silveira Matte, Ursula; Giugliani, Roberto

    2015-12-15

    Fabry Disease (FD) is an X-linked inborn error of glycosphingolipid catabolism, caused by a deficiency of the lisosomal α-galactosidase A (AGAL). The disorder leads to a vascular disease secondary to the involvement of kidney, heart and the central nervous system. The mutation analysis is a valuable tool for diagnosis and genetic counseling. Although more than 600 mutations have been identified, most mutations are private. Our objective was to describe the analysis of nine Colombian patients with Fabry disease by automated sequencing of the seven exons of the GLA gene. Two novel mutations were identified in two patients affected with the classical subtype of FD, in addition to other 6 mutations previously reported. The present study confirms the heterogeneity of mutations in Fabry disease and the importance of molecular analysis for genetic counseling, female heterozygotes detection as well as therapeutic decisions.

  15. Graft-versus-host disease affecting oral cavity. A review.

    PubMed

    Margaix-Muñoz, Maria; Bagán, José V; Jiménez, Yolanda; Sarrión, María-Gracia; Poveda-Roda, Rafael

    2015-02-01

    Graft versus host disease (GVHD) is one of the most frequent and serious complications of hematopoietic stem cell transplantation, and is regarded as the leading cause of late mortality unrelated to the underlying malignant disease. GVHD is an autoimmune and alloimmune disorder that usually affects multiple organs and tissues, and exhibits a variable clinical course. It can manifest in either acute or chronic form. The acute presentation of GVHD is potentially fatal and typically affects the skin, gastrointestinal tract and liver. The chronic form is characterized by the involvement of a number of organs, including the oral cavity. Indeed, the oral cavity may be the only affected location in chronic GVHD. The clinical manifestations of chronic oral GVHD comprise lichenoid lesions, hyperkeratotic plaques and limited oral aperture secondary to sclerosis. The oral condition is usually mild, though moderate to severe erosive and ulcerated lesions may also be seen. The diagnosis is established from the clinical characteristics, though confirmation through biopsy study is sometimes needed. Local corticosteroids are the treatment of choice, offering overall response rates of close to 50%. Extracorporeal photopheresis and systemic corticosteroids in turn constitute second line treatment. Oral chronic GVHD is not considered a determinant factor for patient survival, which is close to 52% five years after diagnosis of the condition. Key words:Chronic graft-versus-host disease, oral chronic graft-versus-host disease, pathogenics, management, survival.

  16. On the Spread of Drug-Resistant Diseases

    NASA Astrophysics Data System (ADS)

    Schinazi, Rinaldo B.

    1999-10-01

    We introduce an interacting particle system to model the emergence of drug-resistant diseases, one of the most serious health problems in modern society. We are interested in diseases for which a natural strain may mutate into a drug-resistant strain. This happens, for instance, when antibiotics are misused. The main result of our analysis is that with an efficient drug against the natural strain, if there is even a small chance that the natural strain mutates into the drug-resistant one, then there will eventually be an outbreak of the drug-resistant strain throughout the population. In that case the natural strain disappears and is replaced by the drug-resistant strain. The disturbing part of this is that an efficient treatment of the natural strain gives an edge to the drug-resistant strain.

  17. The impact of insecticide-resistance on control of vectors and vector-borne diseases

    PubMed Central

    Busvine, J. R.; Pal, R.

    1969-01-01

    A questionnaire inquiring into the nature of schemes for the insecticidal control of disease vectors, the development of resistance in these vectors, and the effect of any such resistance on their control and on the extent of disease was sent to more than 100 health authorities throughout the world. The replies to the questionnaire are summarized in this paper. Until recently, the use of insecticides in public health has been largely based on three organochlorine compounds—DDT, HCH and dieldrin. However, in some countries resistance to these has now severely affected control both of many insect species and of the diseases they transmit (e.g., malaria, yellow fever, filariasis, typhus, plague). Certain other public health problems (onchocerciasis, Chagas' disease, trypanosomiasis, leishmaniasis) have not so far been greatly affected by resistance, but it is difficult to be sure of the continued reliability of the organochlorines. Research in the past 5 years, much of it sponsored by WHO, has shown the value of various organophosphorus and carbamate insecticides as replacements for the organochlorines, although resistance to them, too, can occur. Attention must therefore be focused on all facets of the use of these newer compounds and particular scrutiny made of possible instances of resistance to them. PMID:5307234

  18. Shades of gray: The world of quantitative disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantitative disease resistance, conditioned by many loci of relatively small effect, is important in ecological and agricultural systems. The importance of quantitative resistance in agricultural systems has lead to much applied research in this area and the accumulation of a building body of kno...

  19. Field evaluation of rice varieties for resistance to major diseases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The development and use of improved disease resistant rice varieties remains of foremost importance to rice producers, with field evaluation under local environments essential. In this study, we evaluated new and existing varieties, potential releases, and Texas elite breeding lines for resistance t...

  20. Engineering disease resistance with pectate lyase-like genes

    DOEpatents

    Vogel, John; Somerville, Shauna

    2005-03-08

    A mutant gene coding for pectate lyase and homologs thereof is provided, which when incorporated in transgenic plants effect an increased level disease resistance in such plants. Also is provided the polypeptide sequence for the pectate lyase of the present invention. Methods of obtaining the mutant gene, producing transgenic plants which include the nucleotide sequence for the mutant gene and producing improved disease resistance in a crop of such transgenic plants are also provided.

  1. Activity of Crohn's disease assessed by colour Doppler ultrasound analysis of the affected loops.

    PubMed

    Esteban, J M; Maldonado, L; Sanchiz, V; Minguez, M; Benages, A

    2001-01-01

    The aim of this study was to evaluate with colour Doppler ultrasound the vascular changes in the wall of the loops affected by Crohn's disease, and to establish whether these changes reflects clinical or biochemical activity of Crohn's disease. Seventy-nine patients with Crohn's disease (44 with active disease and 35 inactive patients) were studied with frequency- and amplitude-encoded duplex Doppler sonography. A group of 35 healthy volunteers were also included. The exam consisted of the search for colour signals in the walls of the loops affected by Crohn's disease, classifying the degree of vascularity with a simple scoring system into three groups: absence of colour signal (score of 0); weak or scattered colour signals (score of 1); and multiple colour signals or clear identification of vessels in the loops walls (score of 2). Doppler curves were obtained of the detected vessels with measurement of the resistive index (RI). There was a visible increase in the gut walls' vascularity in the active patients compared with those with inactive disease. The mean RI was statistically significantly lower in the gut wall vessels of the patients with active illness than that obtained in the inactive patients. Colour Doppler ultrasound is a useful tool in the assessment of activity in Crohn's disease.

  2. Visceral disease in castration-resistant prostate cancer.

    PubMed

    Pezaro, Carmel J; Omlin, Aurelius; Lorente, David; Nava Rodrigues, Daniel; Ferraldeschi, Roberta; Bianchini, Diletta; Mukherji, Deborah; Riisnaes, Ruth; Altavilla, Amelia; Crespo, Mateus; Tunariu, Nina; de Bono, Johann S; Attard, Gerhardt

    2014-02-01

    Metastatic involvement of the viscera in men with advanced castration-resistant prostate cancer (CRPC) has been poorly characterised to date. In 359 CRPC patients treated between June 2003 and December 2011, the frequency of radiologically detected visceral metastases before death was 32%. Of the 92 patients with computed tomography performed within 3 mo of death, 49% had visceral metastases. Visceral metastases most commonly involved the liver (20%) and lung (13%). Median survival from diagnosis of visceral disease was 7.1 mo (95% confidence interval, 5.9-8.3). Survival was affected by the degree of bone involvement at detection of visceral disease, varying from 6.1 mo in men with more than six bone metastases to 18.2 mo in men with no bone metastases (p=0.001). Heterogeneity was noted in clinical phenotypes and prostate-specific antigen trends at development of visceral metastases. Visceral metastases are now more commonly detected in men with CRPC, likely due to the introduction of novel survival-prolonging treatments.

  3. Evolution of antibiotic resistance is linked to any genetic mechanism affecting bacterial duration of carriage

    PubMed Central

    Lehtinen, Sonja; Blanquart, François; Croucher, Nicholas J.; Turner, Paul; Lipsitch, Marc; Fraser, Christophe

    2017-01-01

    Understanding how changes in antibiotic consumption affect the prevalence of antibiotic resistance in bacterial pathogens is important for public health. In a number of bacterial species, including Streptococcus pneumoniae, the prevalence of resistance has remained relatively stable despite prolonged selection pressure from antibiotics. The evolutionary processes allowing the robust coexistence of antibiotic sensitive and resistant strains are not fully understood. While allelic diversity can be maintained at a locus by direct balancing selection, there is no evidence for such selection acting in the case of resistance. In this work, we propose a mechanism for maintaining coexistence at the resistance locus: linkage to a second locus that is under balancing selection and that modulates the fitness effect of resistance. We show that duration of carriage plays such a role, with long duration of carriage increasing the fitness advantage gained from resistance. We therefore predict that resistance will be more common in strains with a long duration of carriage and that mechanisms maintaining diversity in duration of carriage will also maintain diversity in antibiotic resistance. We test these predictions in S. pneumoniae and find that the duration of carriage of a serotype is indeed positively correlated with the prevalence of resistance in that serotype. These findings suggest heterogeneity in duration of carriage is a partial explanation for the coexistence of sensitive and resistant strains and that factors determining bacterial duration of carriage will also affect the prevalence of resistance. PMID:28096340

  4. Evolution of antibiotic resistance is linked to any genetic mechanism affecting bacterial duration of carriage.

    PubMed

    Lehtinen, Sonja; Blanquart, François; Croucher, Nicholas J; Turner, Paul; Lipsitch, Marc; Fraser, Christophe

    2017-01-31

    Understanding how changes in antibiotic consumption affect the prevalence of antibiotic resistance in bacterial pathogens is important for public health. In a number of bacterial species, including Streptococcus pneumoniae, the prevalence of resistance has remained relatively stable despite prolonged selection pressure from antibiotics. The evolutionary processes allowing the robust coexistence of antibiotic sensitive and resistant strains are not fully understood. While allelic diversity can be maintained at a locus by direct balancing selection, there is no evidence for such selection acting in the case of resistance. In this work, we propose a mechanism for maintaining coexistence at the resistance locus: linkage to a second locus that is under balancing selection and that modulates the fitness effect of resistance. We show that duration of carriage plays such a role, with long duration of carriage increasing the fitness advantage gained from resistance. We therefore predict that resistance will be more common in strains with a long duration of carriage and that mechanisms maintaining diversity in duration of carriage will also maintain diversity in antibiotic resistance. We test these predictions in S. pneumoniae and find that the duration of carriage of a serotype is indeed positively correlated with the prevalence of resistance in that serotype. These findings suggest heterogeneity in duration of carriage is a partial explanation for the coexistence of sensitive and resistant strains and that factors determining bacterial duration of carriage will also affect the prevalence of resistance.

  5. Breeding for disease resistance in cacao

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cacao production must increase in order to meet the projected rise in the demand for chocolate. Approximately one-third of global production is lost annually to diseases and insects. Four diseases account for the greatest losses worldwide: black pod, caused by four Phytophthora spp; witches’ broom...

  6. Antimicrobial resistance in bacteria associated with porcine respiratory disease in Australia.

    PubMed

    Dayao, Denise Ann E; Gibson, Justine S; Blackall, Patrick J; Turni, Conny

    2014-06-25

    The porcine respiratory disease complex greatly affects the health and production of pigs. While antimicrobial agents are used to treat the respiratory infections caused by bacterial pathogens, there is no current information on antimicrobial resistance in Australian pig respiratory bacterial isolates. The aim of this study was to determine the antimicrobial resistance profiles, by determining the minimum inhibitory concentration of nine antimicrobial agents for 71 Actinobacillus pleuropneumoniae, 51 Pasteurella multocida and 18 Bordetella bronchiseptica cultured from Australian pigs. The majority of A. pleuropneumoniae isolates were resistant to erythromycin (89%) and tetracycline (75%). Resistance to ampicillin (8.5%), penicillin (8.5%) and tilmicosin (25%) was also identified. The P. multocida isolates exhibited resistance to co-trimoxazole (2%), florfenicol (2%), ampicillin (4%), penicillin (4%), erythromycin (14%) and tetracycline (28%). While all the B. bronchiseptica isolates showed resistance to beta-lactams (ampicillin, ceftiofur and penicillin), some were resistant to erythromycin (94%), florfenicol (6%), tilmicosin (22%) and tetracycline (39%). The incidence of multiple drug resistance (MDR) varied across the species - in B. bronchiseptica, 27.8% of resistant isolates showed MDR, while 9.1% of the resistant isolates in A. pleuropneumoniae, and 4.8% in P. multocida showed MDR. This study illustrated that Australian pig strains of bacterial respiratory pathogens exhibited low levels of resistance to antimicrobial agents commonly used in the pig industry.

  7. The double challenge of resistant hypertension and chronic kidney disease.

    PubMed

    Rossignol, Patrick; Massy, Ziad A; Azizi, Michel; Bakris, George; Ritz, Eberhard; Covic, Adrian; Goldsmith, David; Heine, Gunnar H; Jager, Kitty J; Kanbay, Mehmet; Mallamaci, Francesca; Ortiz, Alberto; Vanholder, Raymond; Wiecek, Andrzej; Zoccali, Carmine; London, Gérard Michel; Stengel, Bénédicte; Fouque, Denis

    2015-10-17

    Resistant hypertension is defined as blood pressure above goal despite adherence to a combination of at least three optimally dosed antihypertensive medications, one of which is a diuretic. Chronic kidney disease is the most frequent of several patient factors or comorbidities associated with resistant hypertension. The prevalence of resistant hypertension is increased in patients with chronic kidney disease, while chronic kidney disease is associated with an impaired prognosis in patients with resistant hypertension. Recommended low-salt diet and triple antihypertensive drug regimens that include a diuretic, should be complemented by the sequential addition of other antihypertensive drugs. New therapeutic innovations for resistant hypertension, such as renal denervation and carotid barostimulation, are under investigation especially in patients with advanced chronic kidney disease. We discuss resistant hypertension in chronic kidney disease stages 3-5 (ie, patients with an estimated glomerular filtration rate below 60 mL/min per 1·73 m(2) and not on dialysis), in terms of worldwide epidemiology, outcomes, causes and pathophysiology, evidence-based treatment, and a call for action.

  8. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    PubMed

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  9. Markers associated with disease resistance in Eastern oysters, Crassostrea virginica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Eastern oyster, Crassostrea viginica, is an economically important aquaculture species in the USA, but production has been impacted by diseases such as dermo and MSX. Efforts have been put into the development of disease-resistant oyster lines using selective breeding techniques. However, these met...

  10. Marker-assisted selection for disease resistance in lettuce

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lettuce (Lactuca sativa L.) is the most popular leafy vegetable that is cultivated mainly in moderate climate. Consumers demand lettuce with good visual appearance and free of disease. Improved disease resistance of new cultivars is achieved by combining desirable genes (or alleles) from existing cu...

  11. Lipoprotein metabolism differs between Marek's disease susceptible and resistant chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marek’s disease (MD) is a lymphoproliferative disease of chickens caused by MD virus and has an important impact on the poultry industry worldwide.There have been reports showing different physiological characteristics between MD susceptible and resistant chickens. However, little is known about whe...

  12. The reproduction in women affected by cooley disease

    PubMed Central

    Pafumi, Carlo; Leanza, Vito; Coco, Luana; Vizzini, Stefania; Ciotta, Lilliana; Messina, Alessandra; Leanza, Gianluca; Zarbo, Giuseppe; D'Agati, Alfio; Palumbo, Marco Antonio; Iemmola, Alessandra; Gulino, Ferdinando Antonio; Teodoro, Maria Cristina; Attard, Matthew; Plesca, Alina Cristina; Soares, Catarina; Kouloubis, Nina; Chammas, Mayada

    2011-01-01

    The health background management and outcomes of 5 pregnancies in 4 women affected by Cooley Disease, from Paediatric Institute of Catania University, are described, considering the preconceptual guidances and cares for such patients. These patients were selected among a group of 100 thalassemic women divided into three subgroups, according to their first and successive menstruation characteristics: i) patients with primitive amenorrhoea, ii) patients with secondary amenorrhoea and iii) patients with normal menstruation. Only one woman, affected by primitive amenorrhoea, needed the induction of ovulation. A precise and detailed pre-pregnancy assessment was effected before each conception. This was constituted by a series of essays, including checks for diabetes and hypothyroidism, for B and C hepatitis and for blood group antibodies. Moreover were evaluated: cardiac function, rubella immunity and transaminases. Other pregnancy monitoring, and cares during labour and delivery were effected according to usual obstetrics practice. All the women were in labour when she were 38 week pregnant, and the outcome were five healthy babies born at term, weighting between 2600 and 3200gs. The only complication was the Caesarean section. The improvements of current treatments, especially in the management of iron deposits, the prolongation of survival rate, will result in a continuous increase of pregnancies in thalassemic women. Pregnancy is now a real possibility for women affected by such disease. We are furthermore studying the possibility to collect the fetus' umbilical cord blood, after the delivery, to attempt eterologus transplantation to his mother trying to get a complete marrow reconstitution. PMID:22184526

  13. Microsatellite mapping of QTLs affecting resistance to coccidiosis (Eimeria tenella) in a Fayoumi × White Leghorn cross

    PubMed Central

    Pinard-van der Laan, Marie-Hélène; Bed'hom, Bertrand; Coville, Jean-Luc; Pitel, Frédérique; Feve, Katia; Leroux, Sophie; Legros, Hélène; Thomas, Aurélie; Gourichon, David; Repérant, Jean-Michel; Rault, Paul

    2009-01-01

    Background Avian coccidiosis is a major parasitic disease of poultry, causing severe economical loss to poultry production by affecting growth and feed efficiency of infected birds. Current control strategies using mainly drugs and more recently vaccination are showing drawbacks and alternative strategies are needed. Using genetic resistance that would limit the negative and very costly effects of the disease would be highly relevant. The purpose of this work was to detect for the first time QTL for disease resistance traits to Eimeria tenella in chicken by performing a genome scan in an F2 cross issued from a resistant Fayoumi line and a susceptible Leghorn line. Results The QTL analysis detected 21 chromosome-wide significant QTL for the different traits related to disease resistance (body weight growth, plasma coloration, hematocrit, rectal temperature and lesion) on 6 chromosomes. Out of these, a genome-wide very significant QTL for body weight growth was found on GGA1, five genome-wide significant QTL for body weight growth, plasma coloration and hematocrit and one for plasma coloration were found on GGA1 and GGA6, respectively. Two genome-wide suggestive QTL for plasma coloration and rectal temperature were found on GGA1 and GGA2, respectively. Other chromosme-wide significant QTL were identified on GGA2, GGA3, GGA6, GGA15 and GGA23. Parent-of-origin effects were found for QTL for body weight growth and plasma coloration on GGA1 and GGA3. Several QTL for different resistance phenotypes were identified as co-localized on the same location. Conclusion Using an F2 cross from resistant and susceptible chicken lines proved to be a successful strategy to identify QTL for different resistance traits to Eimeria tenella, opening the way for further gene identification and underlying mechanisms and hopefully possibilities for new breeding strategies for resistance to coccidiosis in the chicken. From the QTL regions identified, several candidate genes and relevant

  14. Gene pyramiding enhances durable blast disease resistance in rice.

    PubMed

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-14

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resistance has been lacking. Here, we developed near-isogenic experimental lines representing all possible combinations of four QTL alleles from a durably resistant cultivar. These lines enabled us to evaluate the QTLs singly and in combination in a homogeneous genetic background. We present evidence that pyramiding QTL alleles, each controlling a different response to M. oryzae, confers strong, non-race-specific, environmentally stable resistance to blast disease. Our results suggest that this robust defence system provides durable resistance, thus avoiding an evolutionary "arms race" between a crop and its pathogen.

  15. Host resistance selects for traits unrelated to resistance-breaking that affect fitness in a plant virus.

    PubMed

    Fraile, Aurora; Hily, Jean-Michel; Pagán, Israel; Pacios, Luis F; García-Arenal, Fernando

    2014-04-01

    The acquisition by parasites of the capacity to infect resistant host genotypes, that is, resistance-breaking, is predicted to be hindered by across-host fitness trade-offs. All analyses of costs of resistance-breaking in plant viruses have focused on within-host multiplication without considering other fitness components, which may limit understanding of virus evolution. We have reported that host range expansion of tobamoviruses on L-gene resistant pepper genotypes was associated with severe within-host multiplication penalties. Here, we analyze whether resistance-breaking costs might affect virus survival in the environment by comparing tobamovirus pathotypes differing in infectivity on L-gene resistance alleles. We predicted particle stability from structural models, analyzed particle stability in vitro, and quantified virus accumulation in different plant organs and virus survival in the soil. Survival in the soil differed among tobamovirus pathotypes and depended on differential stability of virus particles. Structure model analyses showed that amino acid changes in the virus coat protein (CP) responsible for resistance-breaking affected the strength of the axial interactions among CP subunits in the rod-shaped particle, thus determining its stability and survival. Pathotypes ranked differently for particle stability/survival and for within-host accumulation. Resistance-breaking costs in survival add to, or subtract from, costs in multiplication according to pathotype. Hence, differential pathotype survival should be considered along with differential multiplication to understand the evolution of the virus populations. Results also show that plant resistance, in addition to selecting for resistance-breaking and for decreased multiplication, also selects for changes in survival, a trait unrelated to the host-pathogen interaction that may condition host range expansion.

  16. Patients with resistant hypertension have more peripheral arterial disease than other uncontrolled hypertensives.

    PubMed

    Korhonen, P E; Kautiainen, H; Kantola, I

    2015-01-01

    The aim of this study was to investigate whether resistant hypertension differs from uncontrolled and controlled hypertension in terms of target organ damage. Hypertensive subjects with antihypertensive medication (n=385) were identified in a population survey conducted in southwestern Finland. None of the study subjects had previously diagnosed cardiovascular or renal disease or diabetes. Ankle-brachial index, estimated glomerular filtration rate, electrocardiogram-determined left ventricular hypertrophy and cardiometabolic risk factors were assessed. The prevalence of peripheral arterial disease among subjects with resistant, uncontrolled and controlled hypertension was 6/37 (16%), 22/275 (8%) and 0/73 (0%), respectively (P=0.006). There were no differences in the prevalence of renal insufficiency, left ventricular hypertrophy or metabolic parameters between the groups. Resistant hypertension affects vasculature more than uncontrolled hypertension, and thus it can be regarded as a marker of more severe disease.

  17. Nutrient enrichment affects the mechanical resistance of aquatic plants

    PubMed Central

    Puijalon, Sara

    2012-01-01

    For many plant species, nutrient availability induces important anatomical responses, particularly the production of low-density tissues to the detriment of supporting tissues. Due to the contrasting biomechanical properties of plant tissues, these anatomical responses may induce important modifications in the biomechanical properties of plant organs. The aim of this study was to determine the effects of nutrient enrichment on the anatomical traits of two freshwater plant species and its consequences on plant biomechanical performance. Two plant species were grown under controlled conditions in low versus high nutrient levels. The anatomical and biomechanical traits of the plant stems were measured. Both species produced tissues with lower densities under nutrient-rich conditions, accompanied by modifications in the structure of the aerenchyma for one species. As expected, nutrient enrichment also led to important modifications in the biomechanical properties of the stem for both species. In particular, mechanical resistance (breaking force and strength) and stiffness of stems were significantly reduced under nutrient rich conditions. The production of weaker stem tissues as a result of nutrient enrichment may increase the risk of plants to mechanical failure, thus challenging plant maintenance in mechanically stressful or disturbed habitats. PMID:23028018

  18. Glyphosate affects seed composition in glyphosate-resistant soybean.

    PubMed

    Zobiole, Luiz H S; Oliveira, Rubem S; Visentainer, Jesui V; Kremer, Robert J; Bellaloui, Nacer; Yamada, Tsuioshi

    2010-04-14

    The cultivation of glyphosate-resistant (GR) soybeans has continuously increased worldwide in recent years mainly due to the importance of glyphosate in current weed management systems. However, not much has been done to understand eventual effects of glyphosate application on GR soybean physiology, especially those related to seed composition with potential effects on human health. Two experiments were conducted to evaluate the effects of glyphosate application on GR soybeans compared with its near-isogenic non-GR parental lines. Results of the first experiment showed that glyphosate application resulted in significant decreases in shoot nutrient concentrations, photosynthetic parameters, and biomass production. Similar trends were observed for the second experiment, although glyphosate application significantly altered seed nutrient concentrations and polyunsaturated fatty acid percentages. Glyphosate resulted in significant decreases in polyunsaturated linoleic acid (18:2n-6) (2.3% decrease) and linolenic acid (18:3n-3) (9.6% decrease) and a significant increase in monounsaturated fatty acids 17:1n-7 (30.3% increase) and 18:1n-7 (25% increase). The combined observations of decreased photosynthetic parameters and low nutrient availability in glyphosate-treated plants may explain potential adverse effects of glyphosate in GR soybeans.

  19. Relationship between Phylogeny and Immunity Suggests Older Caribbean Coral Lineages Are More Resistant to Disease

    PubMed Central

    Pinzón C., Jorge H.; Beach-Letendre, Joshuah; Weil, Ernesto; Mydlarz, Laura D.

    2014-01-01

    Diseases affect coral species fitness and contribute significantly to the deterioration of coral reefs. The increase in frequency and severity of disease outbreaks has made evaluating and determining coral resistance a priority. Phylogenetic patterns in immunity and disease can provide important insight to how corals may respond to current and future environmental and/or biologically induced diseases. The purpose of this study was to determine if immunity, number of diseases and disease prevalence show a phylogenetic signal among Caribbean corals. We characterized the constitutive levels of six distinct innate immune traits in 14 Caribbean coral species and tested for the presence of a phylogenetic signal on each trait. Results indicate that constitutive levels of some individual immune related processes (i.e. melanin concentration, peroxidase and inhibition of bacterial growth), as well as their combination show a phylogenetic signal. Additionally, both the number of diseases affecting each species and disease prevalence (as measures of disease burden) show a significant phylogenetic signal. The phylogenetic signal of immune related processes, combined with estimates of species divergence times, indicates that among the studied species, those belonging to older lineages tend to resist/fight infections better than more recently diverged coral lineages. This result, combined with the increasing stressful conditions on corals in the Caribbean, suggest that future reefs in the region will likely be dominated by older lineages while modern species may face local population declines and/or geographic extinction. PMID:25133685

  20. Chapter 11: Disease resistance in chickpea

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chickpea is a grain legume with valuable nutritional characteristics; it is a basic aliment in Asian countries such as India and Pakistan as well as a traditional ingredient in Mediterranean diet. Biotic stresses such as ascochyta blight and fusarium wilt together with other diseases such as botryti...

  1. Genomics of fungal disease resistance in tomato.

    PubMed

    Panthee, Dilip R; Chen, Feng

    2010-03-01

    Tomato (Solanum lycopersicum) is an important vegetable crop worldwide. Often times, its production is hindered by fungal diseases. Important fungal diseases limiting tomato production are late blight, caused by Phytophthora infestans, early blight, caused by Alternaria solanii, and septoria leaf spot, caused by Septoria lycopersici, fusarium wilt caused by Fusarium oxysporium fsp. oxysporium, and verticilium wilt caused by Verticilium dahlea. The Phytophthora infestans is the same fungus that caused the devastating loss of potato in Europe in 1845. A similar magnitude of crop loss in tomato has not occurred but Phytophthora infestans has caused the complete loss of tomato crops around the world on a small scale. Several attempts have been made through conventional breeding and the molecular biological approaches to understand the biology of host-pathogen interaction so that the disease can be managed and crop loss prevented. In this review, we present a comprehensive analysis of information produced by molecular genetic and genomic experiments on host-pathogen interactions of late blight, early blight, septoria leaf spot, verticilim wilt and fusarium wilt in tomato. Furthermore, approaches adopted to manage these diseases in tomato including genetic transformation are presented. Attempts made to link molecular markers with putative genes and their use in crop improvement are discussed.

  2. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    SciTech Connect

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R. )

    1990-03-01

    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells.

  3. Factors that influence the prevalence of acaricide resistance and tick-borne diseases.

    PubMed

    Foil, L D; Coleman, P; Eisler, M; Fragoso-Sanchez, H; Garcia-Vazquez, Z; Guerrero, F D; Jonsson, N N; Langstaff, I G; Li, A Y; Machila, N; Miller, R J; Morton, J; Pruett, J H; Torr, S

    2004-10-28

    obtain a comprehensive profile of their susceptibility to various pesticides. More outbreaks of clinical bovine babesisois and anaplasmosis have been associated with the presence of synthetic pyrethroid (SP) resistance when compared to OP and amidine resistance. This may be the result of differences in the temporal and geographic patterns of resistance development to the different acaricides. If acaricide resistance develops slowly, herd immunity may not be affected. The use of pesticides for the control of pests of cattle other than ticks can affect the incidence of tick resistance and tick-borne diseases. Simple analytical models of tick- and tsetse-borne diseases suggest that reducing the abundance of ticks, by treating cattle with pyrethroids for example, can have a variety of effects on tick-borne diseases. In the worst-case scenario, the models suggest that treating cattle might not only have no impact on trypanosomosis but could increase the incidence of tick-borne disease. In the best-case, treatment could reduce the incidence of both trypanosomosis and tick-borne diseases Surveys of beef and dairy properties in Queensland for which tick resistance to amitraz was known were intended to provide a clear understanding of the economic and management consequences resistance had on their properties. Farmers continued to use amitraz as the major acaricide for tick control after the diagnosis of resistance, although it was supplemented with moxidectin (dairy farms) or fluazuron, macrocyclic lactones or cypermethrin/chlorfenvinphos.

  4. Insulin resistance: The linchpin between prediabetes and cardiovascular disease.

    PubMed

    Salazar, Martin R; Carbajal, Horacio A; Espeche, Walter G; Aizpurúa, Marcelo; Leiva Sisnieguez, Carlos E; Leiva Sisnieguez, Betty C; Stavile, Rodolfo N; March, Carlos E; Reaven, Gerald M

    2016-03-01

    The aim of this study was to test the hypothesis that cardiovascular disease occurs to the greatest extent in persons with prediabetes mellitus who are also insulin resistant. In 2003, 664 non-diabetic women (n = 457) and men (n = 207), aged 52 ± 16 and 53 ± 15 years, were surveyed during a programme for cardiovascular disease prevention. Fasting plasma glucose concentrations defined participants as having normal fasting plasma glucose (fasting plasma glucose <5.6 mmol/L) or prediabetes mellitus (fasting plasma glucose ⩾ 5.6 and <7.0 mmol/L). The tertile of prediabetes mellitus subjects with the highest fasting plasma insulin concentration was classified as insulin resistant. Baseline cardiovascular disease risk factors were accentuated in prediabetes mellitus versus normal fasting glucose, particularly in prediabetes mellitus/insulin resistant. In 2012, 86% of the sample were surveyed again, and the crude incidence for cardiovascular disease was higher in subjects with prediabetes mellitus versus normal fasting glucose (13.7 vs 6.0/100 persons/10 years; age- and sex-adjusted hazard ratio = 1.88, p = 0.052). In prediabetes mellitus, the crude incidences were 22.9 versus 9.6/100 persons/10 years in insulin resistant versus non-insulin resistant persons (age- and sex-adjusted hazard ratio = 2.36, p = 0.040). In conclusion, cardiovascular disease risk was accentuated in prediabetes mellitus/insulin resistant individuals, with a relative risk approximately twice as high compared to prediabetes mellitus/non-insulin resistant subjects.

  5. Genetically Engineered Broad-Spectrum Disease Resistance in Tomato

    NASA Astrophysics Data System (ADS)

    Oldroyd, Giles E. D.; Staskawicz, Brian J.

    1998-08-01

    Resistance in tomato to the bacterial pathogen Pseudomonas syringae pathovar tomato requires Pto and Prf. Mutations that eliminate Prf show a loss of both Pto resistance and sensitivity to the organophosphate insecticide fenthion, suggesting that Prf controls both phenotypes. Herein, we report that the overexpression of Prf leads to enhanced resistance to a number of normally virulent bacterial and viral pathogens and leads to increased sensitivity to fenthion. These plants express levels of salicylic acid comparable to plants induced for systemic acquired resistance (SAR) and constitutively express pathogenesis related genes. These results suggest that the overexpression of Prf activates the Pto and Fen pathways in a pathogen-independent manner and leads to the activation of SAR. Transgene-induced SAR has implications for the generation of broad spectrum disease resistance in agricultural crop plants.

  6. The complex interplay of iron, biofilm formation, and mucoidy affecting antimicrobial resistance of Pseudomonas aeruginosa.

    PubMed

    Oglesby-Sherrouse, Amanda G; Djapgne, Louise; Nguyen, Angela T; Vasil, Adriana I; Vasil, Michael L

    2014-04-01

    Pseudomonas aeruginosa is a Gram-negative opportunistic bacterial pathogen that is refractory to a variety of current antimicrobial therapeutic regimens. Complicating treatment for such infections is the ability of P. aeruginosa to form biofilms, as well as several innate and acquired resistance mechanisms. Previous studies suggest iron plays a role in resistance to antimicrobial therapy, including the efficacy of an FDA-approved iron chelator, deferasirox (DSX), or Gallium, an iron analog, in potentiating antibiotic-dependent killing of P. aeruginosa biofilms. Here, we show that iron-replete conditions enhance resistance of P. aeruginosa nonbiofilm growth against tobramycin and tigecycline. Interestingly, the mechanism of iron-enhanced resistance to each of these antibiotics is distinct. Whereas pyoverdine-mediated iron uptake is important for optimal resistance to tigecycline, it does not enhance tobramycin resistance. In contrast, heme supplementation results in increased tobramycin resistance, while having no significant effect on tigecycline resistance. Thus, nonsiderophore bound iron plays an important role in resistance to tobramycin, while pyoverdine increases the ability of P. aeruginosa to resist tigecycline treatment. Lastly, we show that iron increases the minimal concentration of tobramycin, but not tigecycline, required to eradicate P. aeruginosa biofilms. Moreover, iron depletion blocks the previous observed induction of biofilm formation by subinhibitory concentrations of tobramycin, suggesting iron and tobramycin signal through overlapping regulatory pathways to affect biofilm formation. These data further support the role of iron in P. aeruginosa antibiotic resistance, providing yet another compelling case for targeting iron acquisition for future antimicrobial drug development.

  7. Nutritional Management of Insulin Resistance in Nonalcoholic Fatty Liver Disease (NAFLD)

    PubMed Central

    Conlon, Beth A.; Beasley, Jeannette M.; Aebersold, Karin; Jhangiani, Sunil S.; Wylie-Rosett, Judith

    2013-01-01

    Nonalcoholic fatty liver disease (NAFLD) is an emerging global health concern. It is the most common form of chronic liver disease in Western countries, affecting both adults and children. NAFLD encompasses a broad spectrum of fatty liver disease, ranging from simple steatosis (NAFL) to nonalcoholic steatohepatitis (NASH), and is strongly associated with obesity, insulin resistance, and dyslipidemia. First-line therapy for NAFLD includes weight loss achieved through diet and physical activity. However, there is a lack of evidenced-based dietary recommendations. The American Diabetes Association’s (ADA) recommendations that aim to reduce the risk of diabetes and cardiovascular disease may also be applicable to the NAFLD population. The objectives of this review are to: (1) provide an overview of NAFLD in the context of insulin resistance, and (2) provide a rationale for applying relevant aspects of the ADA recommendations to the nutritional management of NAFLD. PMID:24152749

  8. Nutritional management of insulin resistance in nonalcoholic fatty liver disease (NAFLD).

    PubMed

    Conlon, Beth A; Beasley, Jeannette M; Aebersold, Karin; Jhangiani, Sunil S; Wylie-Rosett, Judith

    2013-10-11

    Nonalcoholic fatty liver disease (NAFLD) is an emerging global health concern. It is the most common form of chronic liver disease in Western countries, affecting both adults and children. NAFLD encompasses a broad spectrum of fatty liver disease, ranging from simple steatosis (NAFL) to nonalcoholic steatohepatitis (NASH), and is strongly associated with obesity, insulin resistance, and dyslipidemia. First-line therapy for NAFLD includes weight loss achieved through diet and physical activity. However, there is a lack of evidenced-based dietary recommendations. The American Diabetes Association's (ADA) recommendations that aim to reduce the risk of diabetes and cardiovascular disease may also be applicable to the NAFLD population. The objectives of this review are to: (1) provide an overview of NAFLD in the context of insulin resistance, and (2) provide a rationale for applying relevant aspects of the ADA recommendations to the nutritional management of NAFLD.

  9. Oral necrotizing microvasculitis in a patient affected by Kawasaki disease.

    PubMed

    Scardina, Giuseppe Alessandro; Fucà, Gerlandina; Carini, Francesco; Valenza, Vincenzo; Spicola, Michele; Procaccianti, Paolo; Messina, Pietro; Maresi, Emiliano

    2007-12-01

    Kawasaki disease (KD) was first described in 1967 by Kawasaki, who defined it as "mucocutaneous lymph node syndrome". KD is an acute systemic vasculitis, which mainly involves medium calibre arteries; its origin is unknown, and it is observed in children under the age of 5, especially in their third year. The principal presentations of KD include fever, bilateral nonexudative conjunctivitis, erythema of the lips and oral mucosa, changes in the extremities, rash, and cervical lymphadenopathy. Within KD, oral mucositis - represented by diffuse mucous membrane erythema, lip and tongue reddening and lingual papillae hypertrophy with subsequent development of strawberry tongue - can occur both in the acute stage of the disease (0-9 days), and in the convalescence stage (>25 days) as a consequence of the pharmacological treatment. KD vascular lesions are defined as systemic vasculitis instead of systemic arteritis. This study analyzed the anatomical-pathological substrata of oral mucositis in a baby affected by Kawasaki disease and suddenly deceased for cardiac tamponade caused by coronary aneurysm rupture (sudden cardiac death of a mechanical type).

  10. Resistance of vectors of disease to pesticides. Fifth report of the WHO Expert Committee in Vector Biology and Control.

    PubMed

    1980-01-01

    The resistance of vectors (the term includes primary and intermediate vertebrate and invertebrate hosts and animal reservoirs of human and animal diseases) of disease to pesticides is a major problem faced by WHO member states in the control of vectorborne diseases. Since the meeting of the WHO Expert Committee on Insecticides in 1975, resistance has continued to increase and to affect disease control programs in many countries. The appearance of multiresistance in several important vectors has been the most significant development since the 1975 meeting. The sandfly Phlebotomus papatasi in Bihar, India has been found to be resistant to DDT, leaving the tsetse fly the only important vector species in which resistance has not been reported. This book discusses 1) pesticide resistance in arthropod vectors, malaria vectors, vectors of other diseases and disease reservoirs (rodents); 2) present status of research on resistance of vectors to pesticides, including the biochemistry and genetics of resistance; 3) measures to counteract resistance; 4) detection and monitoring of vector resistance to pesticides; 5) disseminatin of information and training; and 6) recommendations for future research and courses of action.

  11. Meal size and frequency affect neuronal plasticity and vulnerability to disease: cellular and molecular mechanisms.

    PubMed

    Mattson, Mark P; Duan, Wenzhen; Guo, Zhihong

    2003-02-01

    Although all cells in the body require energy to survive and function properly, excessive calorie intake over long time periods can compromise cell function and promote disorders such as cardiovascular disease, type-2 diabetes and cancers. Accordingly, dietary restriction (DR; either caloric restriction or intermittent fasting, with maintained vitamin and mineral intake) can extend lifespan and can increase disease resistance. Recent studies have shown that DR can have profound effects on brain function and vulnerability to injury and disease. DR can protect neurons against degeneration in animal models of Alzheimer's, Parkinson's and Huntington's diseases and stroke. Moreover, DR can stimulate the production of new neurons from stem cells (neurogenesis) and can enhance synaptic plasticity, which may increase the ability of the brain to resist aging and restore function following injury. Interestingly, increasing the time interval between meals can have beneficial effects on the brain and overall health of mice that are independent of cumulative calorie intake. The beneficial effects of DR, particularly those of intermittent fasting, appear to be the result of a cellular stress response that stimulates the production of proteins that enhance neuronal plasticity and resistance to oxidative and metabolic insults; they include neurotrophic factors such as brain-derived neurotrophic factor (BDNF), protein chaperones such as heat-shock proteins, and mitochondrial uncoupling proteins. Some beneficial effects of DR can be achieved by administering hormones that suppress appetite (leptin and ciliary neurotrophic factor) or by supplementing the diet with 2-deoxy-d-glucose, which may act as a calorie restriction mimetic. The profound influences of the quantity and timing of food intake on neuronal function and vulnerability to disease have revealed novel molecular and cellular mechanisms whereby diet affects the nervous system, and are leading to novel preventative and

  12. Are obesity-related insulin resistance and type 2 diabetes autoimmune diseases?

    PubMed

    Tsai, Sue; Clemente-Casares, Xavier; Revelo, Xavier S; Winer, Shawn; Winer, Daniel A

    2015-06-01

    Obesity and associated insulin resistance predispose individuals to develop chronic metabolic diseases, such as type 2 diabetes and cardiovascular disease. Although these disorders affect a significant proportion of the global population, the underlying mechanisms of disease remain poorly understood. The discovery of elevated tumor necrosis factor-α in adipose tissue as an inducer of obesity-associated insulin resistance marked a new era of understanding that a subclinical inflammatory process underlies the insulin resistance and metabolic dysfunction that precedes type 2 diabetes. Advances in the field identified components of both the innate and adaptive immune response as key players in regulating such inflammatory processes. As antigen specificity is a hallmark of an adaptive immune response, its role in modulating the chronic inflammation that accompanies obesity and type 2 diabetes begs the question of whether insulin resistance and type 2 diabetes can have autoimmune components. In this Perspective, we summarize current data that pertain to the activation and perpetuation of adaptive immune responses during obesity and discuss key missing links and potential mechanisms for obesity-related insulin resistance and type 2 diabetes to be considered as potential autoimmune diseases.

  13. Insulin resistance and gray matter volume in neurodegenerative disease.

    PubMed

    Morris, J K; Vidoni, E D; Perea, R D; Rada, R; Johnson, D K; Lyons, K; Pahwa, R; Burns, J M; Honea, R A

    2014-06-13

    The goal of this study was to compare insulin resistance in aging and aging-related neurodegenerative diseases, and to determine the relationship between insulin resistance and gray matter volume (GMV) in each cohort using an unbiased, voxel-based approach. Insulin resistance was estimated in apparently healthy elderly control (HC, n=21) and neurodegenerative disease (Alzheimer's disease (AD), n=20; Parkinson's disease (PD), n=22) groups using Homeostasis Model Assessment of Insulin Resistance 2 (HOMA2) and intravenous glucose tolerance test (IVGTT). HOMA2 and GMV were assessed within groups through General Linear Model multiple regression. We found that HOMA2 was increased in both AD and PD compared to the HC group (HC vs. AD, p=0.002, HC vs. PD, p=0.003), although only AD subjects exhibited increased fasting glucose (p=0.005). Furthermore, our voxel-based morphometry analysis revealed that HOMA2 was related to GMV in all cohorts in a region-specific manner (p<0.001, uncorrected). Significant relationships were observed in the medial prefrontal cortex (HC), medial temporal regions (AD), and parietal regions (PD). Finally, the directionality of the relationship between HOMA2 and GMV was disease-specific. Both HC and AD subjects exhibited negative relationships between HOMA2 and brain volume (increased HOMA2 associated with decreased brain volume), while a positive relationship was observed in PD. This cross-sectional study suggests that insulin resistance is increased in neurodegenerative disease, and that individuals with AD appear to have more severe metabolic dysfunction than individuals with PD or PD dementia.

  14. Lipoprotein metabolism differs between Marek's disease susceptible and resistant chickens.

    PubMed

    Yuan, P; Yu, Y; Luo, J; Tian, F; Zhang, H; Chang, S; Ramachandran, R; Zhang, L; Song, J

    2012-10-01

    Marek's disease (MD) is a lymphoproliferative disease of chickens caused by MD virus and has an important impact on the poultry industry worldwide. There have been reports showing different physiological characteristics between MD susceptible and resistant chickens. However, little is known about whether there are differences in lipid metabolism between MD susceptible and resistant lines of chickens. In this study, we examined the BW and the weight of tissues (abdominal fat, breast muscle with bone, leg muscle with bone, liver, and heart), the lipoprotein-cholesterol concentrations and distributions, and the plasma and tissue levels of adiponectin and its receptors in the highly resistant and susceptible lines during chicken growth. Our data showed that the increase in total cholesterol during growth was mainly due to the elevation of cholesterol in the low-density/very low-density lipoprotein fraction in MD susceptible chickens, whereas the increase of total cholesterol was mainly attributable to the increase in high-density lipoprotein-cholesterol in MD resistant chickens. Meanwhile, the MD resistant line appeared to have increased plasma adiponectin levels compared with MD susceptible chickens during growth. Taken together, our data suggested that lipoprotein-cholesterol and adiponectin metabolism are different between MD susceptible and resistant chickens.

  15. Identification of blast resistance genes for managing rice blast disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is one of the most devastating diseases worldwide. In the present study, an international set of monogenic differentials carrying 24 major blast resistance (R) genes (Pia, Pib, Pii, Pik, Pik-h, Pik-m, Pik-p, Pik-s, Pish, Pit, Pita, Pita2,...

  16. Genetic enhancement of peanut oil quality and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objectives of this project were to develop recombinant inbred lines (RILs, derived from SunOleic 97R x NC94022 ) for genetic and genomic studies and enhancement of peanut oil quality and disease resistance. The major fatty acids (oleic acid, linoleic acid, and palmitic acid) were 83.5%, 1.8%, an...

  17. Standardized Plant Disease Evaluations will Enhance Resistance Gene Discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene discovery and marker development using DNA based tools require plant populations with well-documented phenotypes. Related crops such as apples and pears may share a number of genes, for example resistance to common diseases, and data mining in one crop may reveal genes for the other. However, u...

  18. Evaluating paradox walnut rootstocks for resistance to Armillaria root disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The most common Juglans regia (English walnut) rootstock in California is Paradox, a hybrid between J. hindsii (Northern California black walnut) and J. regia. Unfortuntely, Paradox rootstock is highly susceptible to Armillaria root disease. The relative resistance of new clonal, Paradox rootstock...

  19. The Genetic Basis of Disease Resistance in Maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The advent of high throughput genomics has accelerated progress in understanding the genetic basis of disease resistance in maize, much as it enhanced discovery in other fields. Here we summarize progress made in recent years using resources such as association mapping and nested association mapping...

  20. Regeneration systems for pyramiding disease resistance into walnut rootstocks

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study was conducted to regenerate selected walnut rootstocks adventitiously. This is an essential step to be able to produce transgenic walnut rootstocks with superior traits, such as disease resistance. A series of plant tissue culture experiments were conducted on RX1 and VX211 rootstocks wit...

  1. Insulin resistance: an emerging link in Alzheimer's disease.

    PubMed

    Medhi, Bikash; Chakrabarty, Mrinmoy

    2013-10-01

    Relentless progression of Alzheimer's disease (AD) poses a grave situation for the biomedical community to tackle. Agents starting as hot favorites in clinical trials have failed in later stages and it is time we reconsidered our approaches to intervene the disease. Quite some interesting work in the last decade has introduced a new school of thought which factors in neuronal glycemic imbalance as a major component for the development of AD. Insulin resistance in the brain has brought forward subsequent sequelae which might work towards amyloid accretion and/or tau hyperphosphorylation. It is also pointed out that insulin works by distributing iron to neuronal tissue and an insulin resistant state throws it off gear leading to iron overloading of neurons which is ultimately detrimental. A relatively recent investigation finds the role of c-Jun-N-terminal kinase (JNK3) in AD which also seems to bear a link with insulin resistance.

  2. Genome-Wide Architecture of Disease Resistance Genes in Lettuce.

    PubMed

    Christopoulou, Marilena; Wo, Sebastian Reyes-Chin; Kozik, Alex; McHale, Leah K; Truco, Maria-Jose; Wroblewski, Tadeusz; Michelmore, Richard W

    2015-10-08

    Genome-wide motif searches identified 1134 genes in the lettuce reference genome of cv. Salinas that are potentially involved in pathogen recognition, of which 385 were predicted to encode nucleotide binding-leucine rich repeat receptor (NLR) proteins. Using a maximum-likelihood approach, we grouped the NLRs into 25 multigene families and 17 singletons. Forty-one percent of these NLR-encoding genes belong to three families, the largest being RGC16 with 62 genes in cv. Salinas. The majority of NLR-encoding genes are located in five major resistance clusters (MRCs) on chromosomes 1, 2, 3, 4, and 8 and cosegregate with multiple disease resistance phenotypes. Most MRCs contain primarily members of a single NLR gene family but a few are more complex. MRC2 spans 73 Mb and contains 61 NLRs of six different gene families that cosegregate with nine disease resistance phenotypes. MRC3, which is 25 Mb, contains 22 RGC21 genes and colocates with Dm13. A library of 33 transgenic RNA interference tester stocks was generated for functional analysis of NLR-encoding genes that cosegregated with disease resistance phenotypes in each of the MRCs. Members of four NLR-encoding families, RGC1, RGC2, RGC21, and RGC12 were shown to be required for 16 disease resistance phenotypes in lettuce. The general composition of MRCs is conserved across different genotypes; however, the specific repertoire of NLR-encoding genes varied particularly of the rapidly evolving Type I genes. These tester stocks are valuable resources for future analyses of additional resistance phenotypes.

  3. Resistant Hypertension and Chronic Kidney Disease: a Dangerous Liaison.

    PubMed

    Wolley, Martin J; Stowasser, Michael

    2016-04-01

    Treatment-resistant hypertension is an increasingly recognised problem and is markedly over-represented in patients with chronic kidney disease (CKD). Recent evidence has clarified the heightened risk for both adverse renal and cardiovascular outcomes associated with resistant hypertension, even when blood pressure control is attained. The diagnosis of resistant hypertension in CKD is reliant on accurate blood pressure measurement, and out of office measurements are important due to the high prevalence of masked hypertension in these patients. Treatment strategies include careful dietary measures to restrict sodium intake, and a focus on improving adherence to antihypertensive medications. Medication choices should focus on a sensible foundation and then diuretic titration to combat the salt and volume retention inherent in CKD. In this review, we discuss the epidemiology, pathogenesis and consequences of resistant hypertension in CKD, and then review the optimal diagnostic and management strategies.

  4. Insecticide resistance in disease vectors from Mayotte: an opportunity for integrated vector management

    PubMed Central

    2014-01-01

    Background Mayotte, a small island in the Indian Ocean, has been affected for many years by vector-borne diseases. Malaria, Bancroftian filariasis, dengue, chikungunya and Rift Valley fever have circulated or still circulate on the island. They are all transmitted by Culicidae mosquitoes. To limit the impact of these diseases on human health, vector control has been implemented for more than 60 years on Mayotte. In this study, we assessed the resistance levels of four major vector species (Anopheles gambiae, Culex pipiens quinquefasciatus, Aedes aegypti and Aedes albopictus) to two types of insecticides: i) the locally currently-used insecticides (organophosphates, pyrethroids) and ii) alternative molecules that are promising for vector control and come from different insecticide families (bacterial toxins or insect growth regulators). When some resistance was found to one of these insecticides, we characterized the mechanisms involved. Methods Larval and adult bioassays were used to evaluate the level of resistance. When resistance was found, we tested for the presence of metabolic resistance through detoxifying enzyme activity assays, or for target-site mutations through molecular identification of known resistance alleles. Results Resistance to currently-used insecticides varied greatly between the four vector species. While no resistance to any insecticides was found in the two Aedes species, bioassays confirmed multiple resistance in Cx. p. quinquefasciatus (temephos: ~ 20 fold and deltamethrin: only 10% mortality after 24 hours). In An. gambiae, resistance was scarce: only a moderate resistance to temephos was found (~5 fold). This resistance appears to be due only to carboxyl-esterase overexpression and not to target modification. Finally, and comfortingly, none of the four species showed resistance to any of the new insecticides. Conclusions The low resistance observed in Mayotte’s main disease vectors is particularly interesting, because it leaves a

  5. Molecular mechanism of glucocorticoid resistance in inflammatory bowel disease

    PubMed Central

    De Iudicibus, Sara; Franca, Raffaella; Martelossi, Stefano; Ventura, Alessandro; Decorti, Giuliana

    2011-01-01

    Natural and synthetic glucocorticoids (GCs) are widely employed in a number of inflammatory, autoimmune and neoplastic diseases, and, despite the introduction of novel therapies, remain the first-line treatment for inducing remission in moderate to severe active Crohn’s disease and ulcerative colitis. Despite their extensive therapeutic use and the proven effectiveness, considerable clinical evidence of wide inter-individual differences in GC efficacy among patients has been reported, in particular when these agents are used in inflammatory diseases. In recent years, a detailed knowledge of the GC mechanism of action and of the genetic variants affecting GC activity at the molecular level has arisen from several studies. GCs interact with their cytoplasmic receptor, and are able to repress inflammatory gene expression through several distinct mechanisms. The glucocorticoid receptor (GR) is therefore crucial for the effects of these agents: mutations in the GR gene (NR3C1, nuclear receptor subfamily 3, group C, member 1) are the primary cause of a rare, inherited form of GC resistance; in addition, several polymorphisms of this gene have been described and associated with GC response and toxicity. However, the GR is not self-standing in the cell and the receptor-mediated functions are the result of a complex interplay of GR and many other cellular partners. The latter comprise several chaperonins of the large cooperative hetero-oligomeric complex that binds the hormone-free GR in the cytosol, and several factors involved in the transcriptional machinery and chromatin remodeling, that are critical for the hormonal control of target genes transcription in the nucleus. Furthermore, variants in the principal effectors of GCs (e.g. cytokines and their regulators) have also to be taken into account for a comprehensive evaluation of the variability in GC response. Polymorphisms in genes involved in the transport and/or metabolism of these hormones have also been

  6. The drinking water treatment process as a potential source of affecting the bacterial antibiotic resistance.

    PubMed

    Bai, Xiaohui; Ma, Xiaolin; Xu, Fengming; Li, Jing; Zhang, Hang; Xiao, Xiang

    2015-11-15

    Two waterworks, with source water derived from the Huangpu or Yangtze River in Shanghai, were investigated, and the effluents were plate-screened for antibiotic-resistant bacteria (ARB) using five antibiotics: ampicillin (AMP), kanamycin (KAN), rifampicin (RFP), chloramphenicol (CM) and streptomycin (STR). The influence of water treatment procedures on the bacterial antibiotic resistance rate and the changes that bacteria underwent when exposed to the five antibiotics at concentration levels ranging from 1 to 100 μg/mL were studied. Multi-drug resistance was also analyzed using drug sensitivity tests. The results indicated that bacteria derived from water treatment plant effluent that used the Huangpu River rather than the Yangtze River as source water exhibited higher antibiotic resistance rates against AMP, STR, RFP and CM but lower antibiotic resistance rates against KAN. When the antibiotic concentration levels ranged from 1 to 10 μg/mL, the antibiotic resistance rates of the bacteria in the water increased as water treatment progressed. Biological activated carbon (BAC) filtration played a key role in increasing the antibiotic resistance rate of bacteria. Chloramine disinfection can enhance antibiotic resistance. Among the isolated ARB, 75% were resistant to multiple antibiotics. Ozone oxidation, BAC filtration and chloramine disinfection can greatly affect the relative abundance of bacteria in the community.

  7. Animal genomics and infectious disease resistance in poultry.

    PubMed

    Smith, J; Gheyas, A; Burt, D W

    2016-04-01

    Avian pathogens are responsible for major costs to society, both in terms of huge economic losses to the poultry industry and their implications for human health. The health and welfare of millions of birds is under continued threat from many infectious diseases, some of which are increasing in virulence and thus becoming harder to control, such as Marek's disease virus and avian influenza viruses. The current era in animal genomics has seen huge developments in both technologies and resources, which means that researchers have never been in a better position to investigate the genetics of disease resistance and determine the underlying genes/mutations which make birds susceptible or resistant to infection. Avian genomics has reached a point where the biological mechanisms of infectious diseases can be investigated and understood in poultry and other avian species. Knowledge of genes conferring disease resistance can be used in selective breeding programmes or to develop vaccines which help to control the effects of these pathogens, which have such a major impact on birds and humans alike.

  8. The Use of Kosher Phenotyping for Mapping QTL Affecting Susceptibility to Bovine Respiratory Disease

    PubMed Central

    Eitam, Harel; Yishay, Moran; Schiavini, Fausta; Soller, Morris; Bagnato, Alessandro; Shabtay, Ariel

    2016-01-01

    Bovine respiratory disease (BRD) is the leading cause of morbidity and mortality in feedlot cattle, caused by multiple pathogens that become more virulent in response to stress. As clinical signs often go undetected and various preventive strategies failed, identification of genes affecting BRD is essential for selection for resistance. Selective DNA pooling (SDP) was applied in a genome wide association study (GWAS) to map BRD QTLs in Israeli Holstein male calves. Kosher scoring of lung adhesions was used to allocate 122 and 62 animals to High (Glatt Kosher) and Low (Non-Kosher) resistant groups, respectively. Genotyping was performed using the Illumina BovineHD BeadChip according to the Infinium protocol. Moving average of -logP was used to map QTLs and Log drop was used to define their boundaries (QTLRs). The combined procedure was efficient for high resolution mapping. Nineteen QTLRs distributed over 13 autosomes were found, some overlapping previous studies. The QTLRs contain polymorphic functional and expression candidate genes to affect kosher status, with putative immunological and wound healing activities. Kosher phenotyping was shown to be a reliable means to map QTLs affecting BRD morbidity. PMID:27077383

  9. The Use of Kosher Phenotyping for Mapping QTL Affecting Susceptibility to Bovine Respiratory Disease.

    PubMed

    Lipkin, Ehud; Strillacci, Maria Giuseppina; Eitam, Harel; Yishay, Moran; Schiavini, Fausta; Soller, Morris; Bagnato, Alessandro; Shabtay, Ariel

    2016-01-01

    Bovine respiratory disease (BRD) is the leading cause of morbidity and mortality in feedlot cattle, caused by multiple pathogens that become more virulent in response to stress. As clinical signs often go undetected and various preventive strategies failed, identification of genes affecting BRD is essential for selection for resistance. Selective DNA pooling (SDP) was applied in a genome wide association study (GWAS) to map BRD QTLs in Israeli Holstein male calves. Kosher scoring of lung adhesions was used to allocate 122 and 62 animals to High (Glatt Kosher) and Low (Non-Kosher) resistant groups, respectively. Genotyping was performed using the Illumina BovineHD BeadChip according to the Infinium protocol. Moving average of -logP was used to map QTLs and Log drop was used to define their boundaries (QTLRs). The combined procedure was efficient for high resolution mapping. Nineteen QTLRs distributed over 13 autosomes were found, some overlapping previous studies. The QTLRs contain polymorphic functional and expression candidate genes to affect kosher status, with putative immunological and wound healing activities. Kosher phenotyping was shown to be a reliable means to map QTLs affecting BRD morbidity.

  10. Enhanced disease resistance caused by BRI1 mutation is conserved between Brachypodium distachyon and barley (Hordeum vulgare).

    PubMed

    Goddard, R; Peraldi, A; Ridout, C; Nicholson, P

    2014-10-01

    This study investigated the impact of brassinosteroid (BR)-insensitive 1 (BRI1) mutation, the main receptor of BR in both Brachypodium distachyon and barley, on disease resistance against a range of fungal pathogens of cereals exhibiting different trophic lifestyles. Results presented here show that i) disruption of BRI1 has pleiotropic effects on disease resistance in addition to affecting plant development. BR signaling functions antagonistically with mechanisms of disease resistance that are effective against a broad range of cereal pathogens. ii) Disruption of BRI1 results in increased disease resistance against necrotrophic and hemibiotrophic pathogens that exhibit only a marginal asymptomatic phase but has no effect on biotrophic pathogens or those with a prolonged asymptomatic phase, and iii) disruption of BRI1 has a similar effect on disease resistance in B. distachyon and barley, indicating that defense mechanisms are conserved between these species. This work presents the first evidence for conservation of disease resistance mechanisms between the model species B. distachyon and the cereal crop barley and validates B. distachyon for undertaking model-to-crop translation studies of disease resistance.

  11. Developmental acclimation to low or high humidity conditions affect starvation and heat resistance of Drosophila melanogaster.

    PubMed

    Parkash, Ravi; Ranga, Poonam; Aggarwal, Dau Dayal

    2014-09-01

    Several Drosophila species originating from tropical humid localities are more resistant to starvation and heat stress than populations from high latitudes but mechanistic bases of such physiological changes are largely unknown. In order to test whether humidity levels affect starvation and heat resistance, we investigated developmental acclimation effects of low to high humidity conditions on the storage and utilization of energy resources, body mass, starvation survival, heat knockdown and heat survival of D. melanogaster. Isofemale lines reared under higher humidity (85% RH) stored significantly higher level of lipids and showed greater starvation survival hours but smaller in body size. In contrast, lines reared at low humidity evidenced reduced levels of body lipids and starvation resistance. Starvation resistance and lipid storage level were higher in females than males. However, the rate of utilization of lipids under starvation stress was lower for lines reared under higher humidity. Adult flies of lines reared at 65% RH and acclimated under high or low humidity condition for 200 hours also showed changes in resistance to starvation and heat but such effects were significantly lower as compared with developmental acclimation. Isofemale lines reared under higher humidity showed greater heat knockdown time and heat-shock survival. These laboratory observations on developmental and adult acclimation effects of low versus high humidity conditions have helped in explaining seasonal changes in resistance to starvation and heat of the wild-caught flies of D. melanogaster. Thus, we may suggest that wet versus drier conditions significantly affect starvation and heat resistance of D. melanogaster.

  12. [Resistant hypertension and chronic kidney disease: epidemiology and prognosis].

    PubMed

    Seidowsky, Alexandre; Massy, Ziad A; Metzger, Marie; Stengel, Bénédicte

    2014-06-01

    The emergence of new effective therapeutic strategies for the treatment of resistant hypertension such as renal sympathetic denervation technique has lead to a renewed interest in the screening and assessment of prognosis of this specific entity which constitutes a subset of uncontrolled hypertension. Its prevalence is unknown, but estimated between 12 and 15% among hypertensive subjects from the general population. Several factors have been associated with the development of resistant hypertension, four of which are essential: age, diabetes, chronic kidney disease and vascular structural alteration. Excessive salt intake is also a risk factor for poorly controlled hypertension in patients with salt-dependent hypertension, and may participate to the genesis of resistant hypertension. Because of population ageing and increasing prevalence of diabetes, obesity and chronic kidney disease, the prevalence of resistant hypertension is expected to rise. A better understanding of its determinants and associated risks (such as chronic kidney disease) would identify high-risk groups that may benefit from extensive diagnosis work up and more specific treatments.

  13. Modulation of Phytoalexin Biosynthesis in Engineered Plants for Disease Resistance

    PubMed Central

    Jeandet, Philippe; Clément, Christophe; Courot, Eric; Cordelier, Sylvain

    2013-01-01

    Phytoalexins are antimicrobial substances of low molecular weight produced by plants in response to infection or stress, which form part of their active defense mechanisms. Starting in the 1950’s, research on phytoalexins has begun with biochemistry and bio-organic chemistry, resulting in the determination of their structure, their biological activity as well as mechanisms of their synthesis and their catabolism by microorganisms. Elucidation of the biosynthesis of numerous phytoalexins has permitted the use of molecular biology tools for the exploration of the genes encoding enzymes of their synthesis pathways and their regulators. Genetic manipulation of phytoalexins has been investigated to increase the disease resistance of plants. The first example of a disease resistance resulting from foreign phytoalexin expression in a novel plant has concerned a phytoalexin from grapevine which was transferred to tobacco. Transformations were then operated to investigate the potential of other phytoalexin biosynthetic genes to confer resistance to pathogens. Unexpectedly, engineering phytoalexins for disease resistance in plants seem to have been limited to exploiting only a few phytoalexin biosynthetic genes, especially those encoding stilbenes and some isoflavonoids. Research has rather focused on indirect approaches which allow modulation of the accumulation of phytoalexin employing transcriptional regulators or components of upstream regulatory pathways. Genetic approaches using gain- or less-of functions in phytoalexin engineering together with modulation of phytoalexin accumulation through molecular engineering of plant hormones and defense-related marker and elicitor genes have been reviewed. PMID:23880860

  14. Food plant derived disease tolerance and resistance in a natural butterfly-plant-parasite interactions.

    PubMed

    Sternberg, Eleanore D; Lefèvre, Thierry; Li, James; de Castillejo, Carlos Lopez Fernandez; Li, Hui; Hunter, Mark D; de Roode, Jacobus C

    2012-11-01

    Organisms can protect themselves against parasite-induced fitness costs through resistance or tolerance. Resistance includes mechanisms that prevent infection or limit parasite growth while tolerance alleviates the fitness costs from parasitism without limiting infection. Although tolerance and resistance affect host-parasite coevolution in fundamentally different ways, tolerance has often been ignored in animal-parasite systems. Where it has been studied, tolerance has been assumed to be a genetic mechanism, unaffected by the host environment. Here we studied the effects of host ecology on tolerance and resistance to infection by rearing monarch butterflies on 12 different species of milkweed food plants and infecting them with a naturally occurring protozoan parasite. Our results show that monarch butterflies experience different levels of tolerance to parasitism depending on the species of milkweed that they feed on, with some species providing over twofold greater tolerance than other milkweed species. Resistance was also affected by milkweed species, but there was no relationship between milkweed-conferred resistance and tolerance. Chemical analysis suggests that infected monarchs obtain highest fitness when reared on milkweeds with an intermediate concentration, diversity, and polarity of toxic secondary plant chemicals known as cardenolides. Our results demonstrate that environmental factors-such as interacting species in ecological food webs-are important drivers of disease tolerance.

  15. Genome-Wide Association Implicates Candidate Genes Conferring Resistance to Maize Rough Dwarf Disease in Maize.

    PubMed

    Chen, Gengshen; Wang, Xiaoming; Hao, Junjie; Yan, Jianbing; Ding, Junqiang

    2015-01-01

    Maize rough dwarf disease (MRDD) is a destructive viral disease in China, which results in 20-30% of the maize yield losses in affected areas and even as high as 100% in severely infected fields. Understanding the genetic basis of resistance will provide important insights for maize breeding program. In this study, a diverse maize population comprising of 527 inbred lines was evaluated in four environments and a genome-wide association study (GWAS) was undertaken with over 556000 SNP markers. Fifteen candidate genes associated with MRDD resistance were identified, including ten genes with annotated protein encoding functions. The homologous of nine candidate genes were predicted to relate to plant defense in different species based on published results. Significant correlation (R2 = 0.79) between the MRDD severity and the number of resistance alleles was observed. Consequently, we have broadened the resistant germplasm to MRDD and identified a number of resistance alleles by GWAS. The results in present study also imply the candidate genes in defense pathway play an important role in resistance to MRDD in maize.

  16. Enhanced tomato disease resistance primed by arbuscular mycorrhizal fungus

    PubMed Central

    Song, Yuanyuan; Chen, Dongmei; Lu, Kai; Sun, Zhongxiang; Zeng, Rensen

    2015-01-01

    Roots of most terrestrial plants form symbiotic associations (mycorrhiza) with soil- borne arbuscular mycorrhizal fungi (AMF). Many studies show that mycorrhizal colonization enhances plant resistance against pathogenic fungi. However, the mechanism of mycorrhiza-induced disease resistance remains equivocal. In this study, we found that mycorrhizal inoculation with AMF Funneliformis mosseae significantly alleviated tomato (Solanum lycopersicum Mill.) early blight disease caused by Alternaria solani Sorauer. AMF pre-inoculation led to significant increases in activities of β-1,3-glucanase, chitinase, phenylalanine ammonia-lyase (PAL) and lipoxygenase (LOX) in tomato leaves upon pathogen inoculation. Mycorrhizal inoculation alone did not influence the transcripts of most genes tested. However, pathogen attack on AMF-inoculated plants provoked strong defense responses of three genes encoding pathogenesis-related proteins, PR1, PR2, and PR3, as well as defense-related genes LOX, AOC, and PAL, in tomato leaves. The induction of defense responses in AMF pre-inoculated plants was much higher and more rapid than that in un-inoculated plants in present of pathogen infection. Three tomato genotypes: a Castlemart wild-type (WT) plant, a jasmonate (JA) biosynthesis mutant (spr2), and a prosystemin-overexpressing 35S::PS plant were used to examine the role of the JA signaling pathway in AMF-primed disease defense. Pathogen infection on mycorrhizal 35S::PS plants led to higher induction of defense-related genes and enzymes relative to WT plants. However, pathogen infection did not induce these genes and enzymes in mycorrhizal spr2 mutant plants. Bioassays showed that 35S::PS plants were more resistant and spr2 plants were more susceptible to early blight compared with WT plants. Our finding indicates that mycorrhizal colonization enhances tomato resistance to early blight by priming systemic defense response, and the JA signaling pathway is essential for mycorrhiza

  17. Development of high-level streptomycin resistance affected by a plasmid in lactic streptococci.

    PubMed

    Sinha, R P

    1986-08-01

    Some lactose-negative (Lac-) mutants of Streptococcus lactis C2 and ML3 exhibited development of very high level streptomycin resistance after incubation with subinhibitory concentrations of the drug for 18 to 22 h. These drug-resistant mutants showed no loss of resistance even after 6 months of subculturing in broth without any drug. The parental Lac+ strains did not show mutation to high-level streptomycin resistance. The Lac+ characteristic of the parental strain was conjugally transferred to Lac- derivatives of C2 and ML3, showing the ability to mutate to high-level resistance. When transconjugants were analyzed for this characteristic, they showed both mutable and nonmutable Lac+ types. The results suggested that genetic information for mutation to high-level streptomycin resistance in lactic streptococci resides on the chromosome, and its expression is affected by a plasmid. The plasmid profiles of strains C2, ML3, C2 Lac-, ML3 Lac-, and two kinds of transconjugants confirmed the presence of a plasmid of approximately 5.5 megadaltons in strains showing no mutation to high-level streptomycin resistance, while strains missing such a plasmid exhibited high-level streptomycin resistance after incubation with subinhibitory concentrations of the drug.

  18. Factors affecting seasonal variation of membrane filtration resistance caused by Chlorella algae.

    PubMed

    Babel, Sandhya; Takizawa, Satoshi; Ozaki, Hiroaki

    2002-03-01

    A seasonal fluctuation pattern was observed in membrane filtration resistance by Chlorella algae cultured in open ponds in the tropical environment. In order to investigate the causes of this phenomenon, Chlorella was cultivated under controlled conditions and the cake resistance was measured by batch filtration in dead-end mode. The filtration resistance was found to be a function of environmental conditions. Algae could grow favourably and offered low specific cake resistance (R,s) on the order of 10(11) m/g for the culture temperature from 28 degrees C to 35 degrees C. The algal growth was inhibited and the specific cake resistance increased to the order of 10(12) m/g below or above this optimum temperature range. Strong solar radiation, coupled with high temperatures, also inhibited the growth of algae and resulted in higher specific cake resistance. The specific cake resistance of algae cultured at different temperatures increased with the amount of the extracellular organic matter (EOM) extracted by 0.1 N NaOH. Hence EOM, rather than bacteria present in the mono-algal culture, was considered to be the primary factor affecting the cake resistance. The specific cake resistance increased drastically after actively growing cells were stored in nutrient-free water under dark conditions. However, the resistance was slightly decreased when the algal cells were stored in NSIII nutrient media in a dark room, indicating the effect of nutrient availability on the change of the specific cake resistance under the light-limiting conditions. EOM extracted from the cells kept in the nutrient-free water contained less sugar than the fresh culture, whereas the EOM extracted from the cells stored in the NSIII media contained more sugar. The molecular distribution of the EOM shifted from below 1,000 kDa before storage to more than 2,000 kDa after storage in both the nutrient-free and NSIII media.

  19. How does smoking affect olfaction in Parkinson's disease?

    PubMed

    Moccia, Marcello; Picillo, Marina; Erro, Roberto; Vitale, Carmine; Amboni, Marianna; Palladino, Raffaele; Cioffi, Dante Luigi; Barone, Paolo; Pellecchia, Maria Teresa

    2014-05-15

    Smoke-induced upper airway damage and Parkinson's disease (PD) can be considered independent risk factors for smell impairment. Interestingly, cigarette smoking has been strongly associated with reduced risk of PD and, therefore, has been suggested to have neuroprotective effects. Our pilot study aimed to evaluate the relationship between smoking and olfaction in PD patients and matched controls. Sixty-eight PD patients and 61 healthy controls were categorized in relation to PD diagnosis and current smoking status, and evaluated by means of the Italian version of the University of Pennsylvania 40-item Smell Identification Test (UPSIT-40). ANOVA analysis with post-hoc Bonferroni correction showed that non-smoker controls presented a higher UPSIT-40 total score than smoker controls (p<0.001), non-smoker PD patients (p<0.001) and smoker PD patients (p<0.001). In this view, smoking seems to affect olfaction in controls but not in PD patients, and no significant differences were found when comparing smoker controls, smoker PD patients and non-smoker PD patients. Several epidemiological studies showed a negative effect of smoking on olfaction in the general population. Otherwise the sense of smell is similar in smoker and non-smoker PD patients. These results suggest that PD and smoking are not independent risk factors for impairment of sense of smell, but they might variably interact.

  20. Subthalamic nucleus stimulation affects incentive salience attribution in Parkinson's disease.

    PubMed

    Serranová, Tereza; Jech, Robert; Dušek, Petr; Sieger, Tomáš; Růžička, Filip; Urgošík, Dušan; Růžička, Evžen

    2011-10-01

    Deep brain stimulation (DBS) of the subthalamic nucleus (STN) can induce nonmotor side effects such as behavioral and mood disturbances or body weight gain in Parkinson's disease (PD) patients. We hypothesized that some of these problems could be related to an altered attribution of incentive salience (ie, emotional relevance) to rewarding and aversive stimuli. Twenty PD patients (all men; mean age ± SD, 58.3 ± 6 years) in bilateral STN DBS switched ON and OFF conditions and 18 matched controls rated pictures selected from the International Affective Picture System according to emotional valence (unpleasantness/pleasantness) and arousal on 2 independent visual scales ranging from 1 to 9. Eighty-four pictures depicting primary rewarding (erotica and food) and aversive fearful (victims and threat) and neutral stimuli were selected for this study. In the STN DBS ON condition, the PD patients attributed lower valence scores to the aversive pictures compared with the OFF condition (P < .01) and compared with controls (P < .01). The difference between the OFF condition and controls was less pronounced (P < .05). Furthermore, postoperative weight gain correlated with arousal ratings from the food pictures in the STN DBS ON condition (P < .05 compensated for OFF condition). Our results suggest that STN DBS increases activation of the aversive motivational system so that more relevance is attributed to aversive fearful stimuli. In addition, STN DBS-related sensitivity to food reward stimuli cues might drive DBS-treated patients to higher food intake and subsequent weight gain.

  1. A Review of Factors Affecting Vaccine Preventable Disease in Japan

    PubMed Central

    Ching, Michael SL

    2014-01-01

    Japan is well known as a country with a strong health record. However its incidence rates of vaccine preventable diseases (VPD) such as hepatitis B, measles, mumps, rubella, and varicella remain higher than other developed countries. This article reviews the factors that contribute to the high rates of VPD in Japan. These include historical and political factors that delayed the introduction of several important vaccines until recently. Access has also been affected by vaccines being divided into government-funded “routine” (eg, polio, pertussis) and self-pay “voluntary” groups (eg, hepatitis A and B). Routine vaccines have higher rates of administration than voluntary vaccines. Administration factors include differences in well child care schedules, the approach to simultaneous vaccination, vaccination contraindication due to fever, and vaccination spacing. Parental factors include low intention to fully vaccinate their children and misperceptions about side effects and efficacy. There are also provider knowledge gaps regarding indications, adverse effects, interval, and simultaneous vaccination. These multifactorial issues combine to produce lower population immunization rates and a higher incidence of VPD than other developed countries. This article will provide insight into the current situation of Japanese vaccinations, the issues to be addressed and suggestions for public health promotion. PMID:25628969

  2. Resistance to infectious diseases is a heritable trait in rabbits.

    PubMed

    Gunia, M; David, I; Hurtaud, J; Maupin, M; Gilbert, H; Garreau, H

    2015-12-01

    Selection for disease resistance is a powerful way to improve the health status of herds and to reduce the use of antibiotics. The objectives of this study were to estimate 1) the genetic parameters for simple visually assessed disease syndromes and for a composite trait of resistance to infectious disease including all syndromes and 2) their genetic correlations with production traits in a rabbit population. Disease symptoms were recorded in the selection herds of 2 commercial paternal rabbit lines during weighing at the end of the test (63 and 70 d of age, respectively). Causes of mortality occurring before these dates were also recorded. Seven disease traits were analyzed: 3 elementary traits visually assessed by technicians on farm (diarrhea, various digestive syndromes, and respiratory syndromes), 2 composite traits (all digestive syndromes and all infectious syndromes), and 2 mortality traits (digestive mortality and infectious mortality). Each animal was assigned only 1 disease trait, corresponding to the main syndrome ( = 153,400). Four production traits were also recorded: live weight the day before the end of test on most animals ( = 137,860) and cold carcass weight, carcass yield, and perirenal fat percentage of the carcass on a subset of slaughtered animals ( = 13,765). Records on both lines were analyzed simultaneously using bivariate linear animal models after validation of consistency with threshold models applied to logit-transformed traits. The heritabilities were low for disease traits, from 0.01 ± 0.002 for various digestive syndromes to 0.04 ± 0.004 for infectious mortality, and moderate to high for production traits. The genetic correlations between digestive syndromes were high and positive, whereas digestive and respiratory syndromes were slightly negatively correlated. The genetic correlations between the composite infectious disease trait and digestive or respiratory syndromes were moderate. Genetic correlations between disease and

  3. Biofilm formation and antibiotic resistance in Salmonella Typhimurium are affected by different ribonucleases.

    PubMed

    Saramago, Margarida; Domingues, Susana; Viegas, Sandra Cristina; Arraiano, Cecília Maria

    2014-01-01

    Biofilm formation and antibiotic resistance are important determinants for bacterial pathogenicity. Ribonucleases control RNA degradation and there is increasing evidence that they have an important role in virulence mechanisms. In this report, we show that ribonucleases affect susceptibility against ribosome-targeting antibiotics and biofilm formation in Salmonella.

  4. Insulin resistance in clinical and experimental alcoholic liver disease

    PubMed Central

    Carr, Rotonya M.; Correnti, Jason

    2015-01-01

    Alcoholic liver disease (ALD) is the number one cause of liver failure worldwide; its management costs billions of health care dollars annually. Since the advent of the obesity epidemic, insulin resistance and diabetes have become common clinical findings in patients with ALD; and the development of insulin resistance predicts the progression from simple steatosis to cirrhosis in ALD patients. Both clinical and experimental data implicate the impairment of several mediators of insulin signaling in ALD, and experimental data suggest that insulin-sensitizing therapies improve liver histology. This review explores the contribution of impaired insulin signaling in ALD and summarizes the current understanding of the synergistic relationship between alcohol and nutrient excess in promoting hepatic inflammation and disease. PMID:25998863

  5. [Susceptible and resistant factors in neuro-immune disease].

    PubMed

    Sato, Shinya; Kira, Jun-ichi

    2013-05-01

    Neuro-immune diseases (NIDs) are caused by a complex interaction between multiple genetic and environmental factors, both of which can have some impacts on susceptibility or resistance to each disease. Remarkable advance in genome technology made possible the effective screening of thousands of single nucleotide polymorphisms in thousands of samples. Additionally, epidemiological science, supported by microbiology, immunology and biochemistry, has revealed many possible environmental factors. Integrating genetic and environmental research data will pave the way to inform and personalize therapeutic decision-making in NIDs. This review aims to discuss susceptible and resistant factors that have attracted the most attention in the recent years, especially focusing on multiple sclerosis, which is one of the most common NIDs.

  6. Genome-Editing Technologies for Enhancing Plant Disease Resistance

    PubMed Central

    Andolfo, Giuseppe; Iovieno, Paolo; Frusciante, Luigi; Ercolano, Maria R.

    2016-01-01

    One of the greatest challenges for agricultural science in the 21st century is to improve yield stability through the progressive development of superior cultivars. The increasing numbers of infectious plant diseases that are caused by plant-pathogens make it ever more necessary to develop new strategies for plant disease resistance breeding. Targeted genome engineering allows the introduction of precise modifications directly into a commercial variety, offering a viable alternative to traditional breeding methods. Genome editing is a powerful tool for modifying crucial players in the plant immunity system. In this work, we propose and discuss genome-editing strategies and targets for improving resistance to phytopathogens. First of all, we present the opportunities to rewrite the effector-target sequence for avoiding effector-target molecular interaction and also to modify effector-target promoters for increasing the expression of target genes involved in the resistance process. In addition, we describe potential approaches for obtaining synthetic R-genes through genome-editing technologies (GETs). Finally, we illustrate a genome editing flowchart to modify the pathogen recognition sites and engineer an R-gene that mounts resistance to some phylogenetically divergent pathogens. GETs potentially mark the beginning of a new era, in which synthetic biology affords a basis for obtaining a reinforced plant defense system. Nowadays it is conceivable that by modulating the function of the major plant immunity players, we will be able to improve crop performance for a sustainable agriculture. PMID:27990151

  7. Interferon-Inducible GTPases in Host Resistance, Inflammation and Disease.

    PubMed

    Pilla-Moffett, Danielle; Barber, Matthew F; Taylor, Gregory A; Coers, Jörn

    2016-08-28

    Cell-autonomous immunity is essential for host organisms to defend themselves against invasive microbes. In vertebrates, both the adaptive and the innate branches of the immune system operate cell-autonomous defenses as key effector mechanisms that are induced by pro-inflammatory interferons (IFNs). IFNs can activate cell-intrinsic host defenses in virtually any cell type ranging from professional phagocytes to mucosal epithelial cells. Much of this IFN-induced host resistance program is dependent on four families of IFN-inducible GTPases: the myxovirus resistance proteins, the immunity-related GTPases, the guanylate-binding proteins (GBPs), and the very large IFN-inducible GTPases. These GTPase families provide host resistance to a variety of viral, bacterial, and protozoan pathogens through the sequestration of microbial proteins, manipulation of vesicle trafficking, regulation of antimicrobial autophagy (xenophagy), execution of intracellular membranolytic pathways, and the activation of inflammasomes. This review discusses our current knowledge of the molecular function of IFN-inducible GTPases in providing host resistance, as well as their role in the pathogenesis of autoinflammatory Crohn's disease. While substantial advances were made in the recent past, few of the known functions of IFN-inducible GTPases have been explored in any depth, and new functions await discovery. This review will therefore highlight key areas of future exploration that promise to advance our understanding of the role of IFN-inducible GTPases in human diseases.

  8. Genome-Editing Technologies for Enhancing Plant Disease Resistance.

    PubMed

    Andolfo, Giuseppe; Iovieno, Paolo; Frusciante, Luigi; Ercolano, Maria R

    2016-01-01

    One of the greatest challenges for agricultural science in the 21st century is to improve yield stability through the progressive development of superior cultivars. The increasing numbers of infectious plant diseases that are caused by plant-pathogens make it ever more necessary to develop new strategies for plant disease resistance breeding. Targeted genome engineering allows the introduction of precise modifications directly into a commercial variety, offering a viable alternative to traditional breeding methods. Genome editing is a powerful tool for modifying crucial players in the plant immunity system. In this work, we propose and discuss genome-editing strategies and targets for improving resistance to phytopathogens. First of all, we present the opportunities to rewrite the effector-target sequence for avoiding effector-target molecular interaction and also to modify effector-target promoters for increasing the expression of target genes involved in the resistance process. In addition, we describe potential approaches for obtaining synthetic R-genes through genome-editing technologies (GETs). Finally, we illustrate a genome editing flowchart to modify the pathogen recognition sites and engineer an R-gene that mounts resistance to some phylogenetically divergent pathogens. GETs potentially mark the beginning of a new era, in which synthetic biology affords a basis for obtaining a reinforced plant defense system. Nowadays it is conceivable that by modulating the function of the major plant immunity players, we will be able to improve crop performance for a sustainable agriculture.

  9. Acquired resistance affects male sexual display and female choice in guppies

    PubMed Central

    pez, S. L

    1998-01-01

    Is resistance to parasites related to the expression of male secondary sex characters? Handicap models predict a positive relationship, proposing that males displaying extravagant sex characters may be honestly signalling their resistance to females. However, no current evidence addresses whether individual changes in immunity (acquired resistance) are reflected in sexual traits. In this experiment I use guppies to compare male orange colour, sigmoid display and female preferences for individual males, before and after a primary challenge infection of males. Challenge infections were terminated chemically and fish were given ten days' recovery time before proceeding with the second measurements. The degree of acquired resistance was quantified a posteriori, by exposing males to a secondary infection. Sigmoid display rates and female preference for males differed for males of different resistance groups after challenge infection only. This difference was due to resistant males displaying more than non-resistant ones. No differences were detected in male orange colour, but this may be because colour needs a longer time than ten days to be recovered and adjusted. The results show that the level of acquired resistance affects sexual display and attractiveness in guppies. They suggest that once an effective immunity is built up by a male, he can afford to incur higher costs for sexual characteristics, whereas a male that lacks the ability to build up effective resistance cannot. These costs probably consist of higher energy expenditure and/or higher circulating levels of testosterone, which may be needed to increase display. Priming and effective establishment of an individual's resistance to parasitic infection could eventually result in a higher availability of resources for sexual functions.

  10. Role of Dehydrodiferulates in Maize Resistance to Pests and Diseases

    PubMed Central

    Santiago, Rogelio; Malvar, Rosa A.

    2010-01-01

    Phenolic esters have attracted considerable interest due to the potential they offer for peroxidase catalysed cross-linking of cell wall polysaccharides. Particularly, feruloyl residues undergo radical coupling reactions that result in cross-linking (intra-/intermolecular) between polysaccharides, between polysaccharides and lignin and, between polysaccharides and proteins. This review addresses for the first time different studies in which it is established that cross-linking by dehydrodiferulates contributes to maize’s defences to pests and diseases. Dehydrodiferulate cross-links are involved in maize defence mechanisms against insects such as the European, Mediterranean, and tropical corn borers and, storage pest as the maize weevil. In addition, cross-links are also discussed to be involved in genetic resistance of maize to fungus diseases as Gibberella ear and stalk rot. Resistance against insects and fungus attending dehydrodiferulates could go hand in hand. Quantitative trait loci mapping for these cell wall components could be a useful tool for enhancing resistance to pest and diseases in future breeding programs. PMID:20386661

  11. Genetic variation in resistance to leaf fungus indirectly affects spider density.

    PubMed

    Slinn, Heather L; Barbour, Matthew A; Crawford, Kerri M; Rodriguez-Cabal, Mariano A; Crutsinger, Gregory M

    2017-03-01

    Many host-plants exhibit genetic variation in resistance to pathogens; however, little is known about the extent to which genetic variation in pathogen resistance influences other members of the host-plant community, especially arthropods at higher trophic levels. We addressed this knowledge gap by using a common garden experiment to examine whether genotypes of Populus trichocarpa varied in resistance to a leaf-blistering pathogen, Taphrina sp., and in the density of web-building spiders, the dominant group of predatory arthropods. In addition, we examined whether variation in spider density was explained by variation in the density and size of leaf blisters caused by Taphrina. We found that P. trichocarpa genotypes exhibited strong differences in their resistance to Taphrina and that P. trichocarpa genotypes that were more susceptible to Taphrina supported more web-building spiders, the dominant group of predatory arthropods. We suspect that this result is caused by blisters increasing the availability of suitable habitat for predators, and not due to variation in herbivores because including herbivore density as a covariate did not affect our models. Our study highlights a novel pathway by which genetic variation in pathogen resistance may affect higher trophic levels in arthropod communities.

  12. Resistance exercise training does not affect postexercise hypotension and wave reflection in women with fibromyalgia.

    PubMed

    Kingsley, J Derek; McMillan, Victor; Figueroa, Arturo

    2011-04-01

    The purpose of this study was to assess the effects of resistance exercise training (RET) on aortic wave reflection and hemodynamics during recovery from acute resistance exercise in women with fibromyalgia (FM) and healthy women (HW). Nine women with FM (aged 42 ± 5 years; mean ± SD) and 14 HW (aged 45 ± 5 years) completed testing at baseline and after 12 weeks of whole-body RET that consisted of 3 sets of 5 exercises. Heart rate (HR), digital blood pressure (BP, plethysmography), aortic BP, and wave reflection (radial tonometry) were assessed before and 20 min after acute leg resistance exercise. Aortic and digital diastolic blood pressure (DBP) were significantly decreased (p < 0.05) and aortic and digital pulse pressures (PP) were significantly increased (p < 0.05) after acute exercise before RET. Acute resistance exercise had no effect on HR, wave reflection (augmentation index and reflection time), digital, or aortic systolic BP. RET improved muscle strength without affecting acute DBP and PP responses. Acute resistance exercise produces postexercise diastolic hypotension without affecting systolic blood pressure, HR, and wave reflection responses in women with and without FM. RET does not alter resting and postexercise hemodynamics and aortic wave reflection in premenopausal women.

  13. The durable wheat disease resistance gene Lr34 confers common rust and northern corn leaf blight resistance in maize.

    PubMed

    Sucher, Justine; Boni, Rainer; Yang, Ping; Rogowsky, Peter; Büchner, Heike; Kastner, Christine; Kumlehn, Jochen; Krattinger, Simon G; Keller, Beat

    2017-04-01

    Maize (corn) is one of the most widely grown cereal crops globally. Fungal diseases of maize cause significant economic damage by reducing maize yields and by increasing input costs for disease management. The most sustainable control of maize diseases is through the release and planting of maize cultivars with durable disease resistance. The wheat gene Lr34 provides durable and partial field resistance against multiple fungal diseases of wheat, including three wheat rust pathogens and wheat powdery mildew. Because of its unique qualities, Lr34 became a cornerstone in many wheat disease resistance programmes. The Lr34 resistance is encoded by a rare variant of an ATP-binding cassette (ABC) transporter that evolved after wheat domestication. An Lr34-like disease resistance phenotype has not been reported in other cereal species, including maize. Here, we transformed the Lr34 resistance gene into the maize hybrid Hi-II. Lr34-expressing maize plants showed increased resistance against the biotrophic fungal disease common rust and the hemi-biotrophic disease northern corn leaf blight. Furthermore, the Lr34-expressing maize plants developed a late leaf tip necrosis phenotype, without negative impact on plant growth. With this and previous reports, it could be shown that Lr34 is effective against various biotrophic and hemi-biotrophic diseases that collectively parasitize all major cereal crop species.

  14. Histopathologic changes in disease-resistant-line and sdisease-susceptible-line juvenile rainbow trout experimentally infected with Flavobacterium psychrophilum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A challenge to genetically selecting fish for disease resistance is an incomplete understanding of how phenotypic selection affects innate immunity at the host-pathogen level. The objective of this study was to explore if tissue damage and cellular inflammatory response was associated with survival...

  15. Ketamine-induced affective switch in a patient with treatment-resistant depression

    PubMed Central

    Banwari, Girish; Desai, Prutha; Patidar, Prahlad

    2015-01-01

    There is growing evidence to support the rapid, albeit short-lived antidepressant effect of subanesthetic dose of ketamine, a noncompetitive glutamate N-methyl-D-aspartate receptor antagonist in treatment-resistant unipolar and bipolar depression. Ketamine is known to cause transient mood elevation or euphoria, psychotomimetic effects, and dissociative symptoms, but its use in unipolar or bipolar depression has not been reported to induce an affective switch amounting to persistent or prolonged hypomania/mania or manic-like syndrome. We report the case of a 52-year-old male with first episode, continuous, nonpsychotic, treatment-resistant, unipolar major depression of 10 years duration, who manifested a switch from depression to mania while being treated with subanesthetic dose of ketamine, given intramuscularly. This case suggests that polarity switch should be considered as a potential side effect while using ketamine for treatment-resistant depression. PMID:26288483

  16. Modeling mass drug treatment and resistant filaria disease transmission

    NASA Astrophysics Data System (ADS)

    Fuady, A. M.; Nuraini, N.; Soewono, E.; Tasman, H.; Supriatna, A. K.

    2014-03-01

    It has been indicated that a long term application of combined mass drug treatment may contribute to the development of drug resistance in lymphatic filariasis. This phenomenon is not well understood due to the complexity of filaria life cycle. In this paper we formulate a mathematical model for the spread of mass drug resistant in a filaria endemic region. The model is represented in a 13-dimensional Host-Vector system. The basic reproductive ratio of the system which is obtained from the next generation matrix, and analysis of stability of both the disease free equilibrium and the coexistence equilibria are shown. Numerical simulation for long term dynamics for possible field conditions is also shown.

  17. Antimicrobial drug resistance affects broad changes in metabolomic phenotype in addition to secondary metabolism

    PubMed Central

    Derewacz, Dagmara K.; Goodwin, Cody R.; McNees, C. Ruth; McLean, John A.; Bachmann, Brian O.

    2013-01-01

    Bacteria develop resistance to many classes of antibiotics vertically, by engendering mutations in genes encoding transcriptional and translational apparatus. These severe adaptations affect global transcription, translation, and the correspondingly affected metabolism. Here, we characterize metabolome scale changes in transcriptional and translational mutants in a genomically characterized Nocardiopsis, a soil-derived actinomycete, in stationary phase. Analysis of ultra-performance liquid chromatography–ion mobility–mass spectrometry metabolomic features from a cohort of streptomycin- and rifampicin-resistant mutants grown in the absence of antibiotics exhibits clear metabolomic speciation, and loadings analysis catalogs a marked change in metabolic phenotype. Consistent with derepression, up to 311 features are observed in antibiotic-resistant mutants that are not detected in their progenitors. Mutants demonstrate changes in primary metabolism, such as modulation of fatty acid composition and the increased production of the osmoprotectant ectoine, in addition to the presence of abundant emergent potential secondary metabolites. Isolation of three of these metabolites followed by structure elucidation demonstrates them to be an unusual polyketide family with a previously uncharacterized xanthene framework resulting from sequential oxidative carbon skeletal rearrangements. Designated as “mutaxanthenes,” this family can be correlated to a type II polyketide gene cluster in the producing organism. Taken together, these data suggest that biosynthetic pathway derepression is a general consequence of some antibiotic resistance mutations. PMID:23341601

  18. Antimicrobial resistance and management of invasive Salmonella disease.

    PubMed

    Kariuki, Samuel; Gordon, Melita A; Feasey, Nicholas; Parry, Christopher M

    2015-06-19

    Invasive Salmonella infections (typhoidal and non-typhoidal) cause a huge burden of illness estimated at nearly 3.4 million cases and over 600,000 deaths annually especially in resource-limited settings. Invasive non-typhoidal Salmonella (iNTS) infections are particularly important in immunosuppressed populations especially in sub-Saharan Africa, causing a mortality of 20-30% in vulnerable children below 5 years of age. In these settings, where routine surveillance for antimicrobial resistance is rare or non-existent, reports of 50-75% multidrug resistance (MDR) in NTS are common, including strains of NTS also resistant to flouroquinolones and 3rd generation cephalosporins. Typhoid (enteric) fever caused by Salmonella Typhi and Salmonella Paratyphi A remains a major public health problem in many parts of Asia and Africa. Currently over a third of isolates in many endemic areas are MDR, and diminished susceptibility or resistance to fluoroquinolones, the drugs of choice for MDR cases over the last decade is an increasing problem. The situation is particularly worrying in resource-limited settings where the few remaining effective antimicrobials are either unavailable or altogether too expensive to be afforded by either the general public or by public health services. Although the prudent use of effective antimicrobials, improved hygiene and sanitation and the discovery of new antimicrobial agents may offer hope for the management of invasive salmonella infections, it is essential to consider other interventions including the wider use of WHO recommended typhoid vaccines and the acceleration of trials for novel iNTS vaccines. The main objective of this review is to describe existing data on the prevalence and epidemiology of antimicrobial resistant invasive Salmonella infections and how this affects the management of these infections, especially in endemic developing countries.

  19. Infectious diseases affect marine fisheries and aquaculture economics

    USGS Publications Warehouse

    Lafferty, Kevin D.; Harvell, C. Drew; Conrad, Jon M.; Friedman, Carolyn S.; Kent, Michael L.; Kuris, Armand M.; Powell, Eric N.; Rondeau, Daniel; Saksida, Sonja M.

    2015-01-01

    Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.

  20. Infectious Diseases Affect Marine Fisheries and Aquaculture Economics

    NASA Astrophysics Data System (ADS)

    Lafferty, Kevin D.; Harvell, C. Drew; Conrad, Jon M.; Friedman, Carolyn S.; Kent, Michael L.; Kuris, Armand M.; Powell, Eric N.; Rondeau, Daniel; Saksida, Sonja M.

    2015-01-01

    Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.

  1. Infectious diseases affect marine fisheries and aquaculture economics.

    PubMed

    Lafferty, Kevin D; Harvell, C Drew; Conrad, Jon M; Friedman, Carolyn S; Kent, Michael L; Kuris, Armand M; Powell, Eric N; Rondeau, Daniel; Saksida, Sonja M

    2015-01-01

    Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.

  2. The factors affecting improvement sensitivity, CDU, and resolution in EUV resist

    NASA Astrophysics Data System (ADS)

    Han, Joonhee; Lim, Hyun Soon; Kim, Jin Ho; Choi, Sumi; Shin, Jin Bong; Bae, Chang Wan; Yoo, In Young; Shin, Bong Ha; Lee, Eun Kyo; Joo, Hyun Sang; Seo, Dong Chul; Chun, Jun Sung

    2014-04-01

    The minimum target specificatons of EUV resist material are the resolution < 30nm half pitch C/H, CDU < 3.0nm, and sensitivity < 20mJ. The major pending issue of EUV resist is how to simultaneously achieve high sensitivity, high resolution and low CD Uniformity (CDU). Thus, we have studied that which factors such as acid diffusion, solvents, polymer platform and film density etc are affecting to improve CDU, sensitivity and resolution. Especially, CDU and sensitivity are the main issues among above these performances. With the results of these experiments, we could determine polymer blend PAG as polymer platform for EUV resist material. We have also researched polymer to improve the sensitivity and CDU with variation of molecular weight, poly dispersity and monomer feed ratio. Additionally, we have studied the effects of resist solvents and film density. And we have measured the outgas of our EUV resist. In this paper, we will discuss the results of these studies obtained by EUV tools of SEMATECH.

  3. FACTORS AFFECTING SUSCEPTIBILITY OF THE CORAL MONTASTRAEA FAVEOLATE TO BLACK-BAND DISEASE

    EPA Science Inventory

    Black-band disease affects many species of tropical reef-building corals, but it is unclear what factors contribute to the disease-susceptibility of individual corals or how the disease is transmitted between colonies. Studies have suggested that the ability of black-band disease...

  4. Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor–Resistant Disease

    PubMed Central

    Ohashi, Kadoaki; Maruvka, Yosef E.; Michor, Franziska; Pao, William

    2013-01-01

    Purpose EGFR-mutant lung cancer was first described as a new clinical entity in 2004. Here, we present an update on new controversies and conclusions regarding the disease. Methods This article reviews the clinical implications of EGFR mutations in lung cancer with a focus on epidermal growth factor receptor tyrosine kinase inhibitor resistance. Results The discovery of EGFR mutations has altered the ways in which we consider and treat non–small-cell lung cancer (NSCLC). Patients whose metastatic tumors harbor EGFR mutations are expected to live longer than 2 years, more than double the previous survival rates for lung cancer. Conclusion The information presented in this review can guide practitioners and help them inform their patients about EGFR mutations and their impact on the treatment of NSCLC. Efforts should now concentrate on making EGFR-mutant lung cancer a chronic rather than fatal disease. PMID:23401451

  5. Insulin resistance in chronic kidney disease: a systematic review.

    PubMed

    Spoto, Belinda; Pisano, Anna; Zoccali, Carmine

    2016-12-01

    Insulin resistance (IR) is an early metabolic alteration in chronic kidney disease (CKD) patients, being apparent when the glomerular filtration rate is still within the normal range and becoming almost universal in those who reach the end stage of kidney failure. The skeletal muscle represents the primary site of IR in CKD, and alterations at sites beyond the insulin receptor are recognized as the main defect underlying IR in this condition. Estimates of IR based on fasting insulin concentration are easier and faster but may not be adequate in patients with CKD because renal insufficiency reduces insulin catabolism. The hyperinsulinemic euglycemic clamp is the gold standard for the assessment of insulin sensitivity because this technique allows a direct measure of skeletal muscle sensitivity to insulin. The etiology of IR in CKD is multifactorial in nature and may be secondary to disturbances that are prominent in renal diseases, including physical inactivity, chronic inflammation, oxidative stress, vitamin D deficiency, metabolic acidosis, anemia, adipokine derangement, and altered gut microbiome. IR contributes to the progression of renal disease by worsening renal hemodynamics by various mechanisms, including activation of the sympathetic nervous system, sodium retention, and downregulation of the natriuretic peptide system. IR has been solidly associated with intermediate mechanisms leading to cardiovascular (CV) disease in CKD including left ventricular hypertrophy, vascular dysfunction, and atherosclerosis. However, it remains unclear whether IR is an independent predictor of mortality and CV complications in CKD. Because IR is a modifiable risk factor and its reduction may lower CV morbidity and mortality, unveiling the molecular mechanisms responsible for the pathogenesis of CKD-related insulin resistance is of importance for the identification of novel therapeutic targets aimed at reducing the high CV risk of this condition.

  6. Impaired suppressor activity in children affected by coeliac disease.

    PubMed Central

    Pignata, C; Troncone, R; Monaco, G; Ciriaco, M; Farris, E; Carminati, G; Auricchio, S

    1985-01-01

    Immunoregulatory cells were enumerated in 19 coeliac disease children on a gluten free diet by means of monoclonal antibodies that define total T lymphocytes (T3), helper/inducer T cells (T4), suppressor/cytotoxic T cells (T8) and monocytes (M1), as well as by means of surface receptors for Fc fragments of IgM and IgG (T mu and T gamma, respectively). In addition, suppressor cell function was assessed in 17 coeliac disease patients by examining the ability of concanavalin-A (Con-A)-activated suppressor cells to inhibit autologous cell response to mitogenic stimulus as compared with age-matched controls. No statistically significant differences were found in the percentages of subsets defined by monoclonal antibodies between coeliac disease patients and age-matched controls, whereas coeliac disease patients had a significant decrease of the subpopulation bearing membrane receptor for Fc fragment of IgG. Mean value was 8.5% in coeliac patients versus 13.4% in age-matched controls. In the functional assay, mononuclear cells from 10 out of 17 coeliac disease patients either totally or partially failed to suppress responder cells after Con-A-activation. This defect is not related to HLA-DR status, because no difference was found between patients-HLA-matched and unmatched normal individuals. In this assay, mononuclear cells of three coeliac disease patients with low suppressor activity were able to inhibit responder cells to the same extent as controls, when indomethacin was used to block prostaglandin production in the induction phase of Con-A-activated suppressor cells. Our results suggest that an abnormality in immunoregulation may play a role in the pathogenesis of coeliac disease. PMID:3156076

  7. Agrarian diet and diseases of affluence – Do evolutionary novel dietary lectins cause leptin resistance?

    PubMed Central

    Jönsson, Tommy; Olsson, Stefan; Ahrén, Bo; Bøg-Hansen, Thorkild C; Dole, Anita; Lindeberg, Staffan

    2005-01-01

    Background The global pattern of varying prevalence of diseases of affluence, such as obesity, cardiovascular disease and diabetes, suggests that some environmental factor specific to agrarian societies could initiate these diseases. Presentation of the hypothesis We propose that a cereal-based diet could be such an environmental factor. Through previous studies in archaeology and molecular evolution we conclude that humans and the human leptin system are not specifically adapted to a cereal-based diet, and that leptin resistance associated with diseases of affluence could be a sign of insufficient adaptation to such a diet. We further propose lectins as a cereal constituent with sufficient properties to cause leptin resistance, either through effects on metabolism central to the proper functions of the leptin system, and/or directly through binding to human leptin or human leptin receptor, thereby affecting the function. Testing the hypothesis Dietary interventions should compare effects of agrarian and non-agrarian diets on incidence of diseases of affluence, related risk factors and leptin resistance. A non-significant (p = 0.10) increase of cardiovascular mortality was noted in patients advised to eat more whole-grain cereals. Our lab conducted a study on 24 domestic pigs in which a cereal-free hunter-gatherer diet promoted significantly higher insulin sensitivity, lower diastolic blood pressure and lower C-reactive protein as compared to a cereal-based swine feed. Testing should also evaluate the effects of grass lectins on the leptin system in vivo by diet interventions, and in vitro in various leptin and leptin receptor models. Our group currently conducts such studies. Implications of the hypothesis If an agrarian diet initiates diseases of affluence it should be possible to identify the responsible constituents and modify or remove them so as to make an agrarian diet healthier. PMID:16336696

  8. Environmental factors affecting inflammatory bowel disease: have we made progress?

    PubMed

    Lakatos, Peter Laszlo

    2009-01-01

    The pathogenesis of inflammatory bowel disease (IBD) is only partially understood; various environmental and host (e.g. genetic, epithelial, immune, and nonimmune) factors are involved. The critical role for environmental factors is strongly supported by recent worldwide trends in IBD epidemiology. One important environmental factor is smoking. A meta-analysis partially confirms previous findings that smoking was found to be protective against ulcerative colitis and, after the onset of the disease, might improve its course, decreasing the need for colectomy. In contrast, smoking increases the risk of developing Crohn's disease and aggravates its course. The history of IBD is dotted by cyclic reports on the isolation of specific infectious agents responsible for Crohn's disease or ulcerative colitis. The more recently published cold chain hypothesis is providing an even broader platform by linking dietary factors and microbial agents. An additional, recent theory has suggested a breakdown in the balance between putative species of 'protective' versus 'harmful' intestinal bacteria - this concept has been termed dysbiosis resulting in decreased bacterial diversity. Other factors such as oral contraceptive use, appendectomy, dietary factors (e.g. refined sugar, fat, and fast food), perinatal events, and childhood infections have also been associated with both diseases, but their role is more controversial. Nonetheless, there is no doubt that economic development, leading to improved hygiene and other changes in lifestyle ('westernized lifestyle') may play a role in the increase in IBD. This review article focuses on the role of environmental factors in the pathogenesis and progression of IBDs.

  9. How urbanization affects the epidemiology of emerging infectious diseases

    PubMed Central

    Neiderud, Carl-Johan

    2015-01-01

    The world is becoming more urban every day, and the process has been ongoing since the industrial revolution in the 18th century. The United Nations now estimates that 3.9 billion people live in urban centres. The rapid influx of residents is however not universal and the developed countries are already urban, but the big rise in urban population in the next 30 years is expected to be in Asia and Africa. Urbanization leads to many challenges for global health and the epidemiology of infectious diseases. New megacities can be incubators for new epidemics, and zoonotic diseases can spread in a more rapid manner and become worldwide threats. Adequate city planning and surveillance can be powerful tools to improve the global health and decrease the burden of communicable diseases. PMID:26112265

  10. Renal resistive index and mortality in chronic kidney disease.

    PubMed

    Toledo, Clarisse; Thomas, George; Schold, Jesse D; Arrigain, Susana; Gornik, Heather L; Nally, Joseph V; Navaneethan, Sankar D

    2015-08-01

    Renal resistive index (RRI) measured by Doppler ultrasonography is associated with cardiovascular events and mortality in hypertensive, diabetic, and elderly patients. We studied the factors associated with high RRI (≥0.70) and its associations with mortality in chronic kidney disease patients without renal artery stenosis. We included 1962 patients with an estimated glomerular filtration rate of 15 to 59 mL/min per 1.73 m(2) who also had RRI measured (January 1, 2005, to October 2011) from an existing chronic kidney disease registry. Participants with renal artery stenosis (60%-99% or renal artery occlusion) were excluded. Multivariable logistic regression model was used to study factors associated with high RRI (≥0.70), and its association with mortality was studied using Kaplan-Meier plots and Cox proportional hazards model. Hypertension was prevalent in >90% of the patients. In the multivariable logistic regression, older age, female sex, diabetes mellitus, coronary artery disease, peripheral vascular disease, higher systolic blood pressure, and the use of β blockers were associated with higher odds of having RRI≥0.70. During a median follow-up of 2.2 years, 428 patients died. After adjusting for covariates, RRI≥0.70 was associated with increased mortality (adjusted hazard ratio, 1.29; 95% confidence interval, 1.02-1.65; P<0.05). This association was more pronounced among younger patients and those with stage 3 chronic kidney disease. Noncardiovascular/non-malignancy-related deaths were higher in those with RRI≥0.70. RRI≥0.70 is associated with higher mortality in hypertensive chronic kidney disease patients without clinically significant renal artery stenosis after accounting for other significant risk factors. Its evaluation may allow early identification of those who are at risk thereby potentially preventing or delaying adverse outcomes.

  11. Concomitant gastroparesis negatively affects children with functional gallbladder disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The aim of the present study was to determine whether concomitant gastroparesis and biliary dyskinesia (BD) occur in children, and if so, to determine whether concomitant gastroparesis affects clinical outcome in children with BD. We conducted a retrospective chart review of children with BD (ejecti...

  12. Factors Affecting the Efficacy of Recombinant Marek's Disease Vaccine Protection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many factors have the potential to influence the efficacy of Marek's disease (MD) vaccination. Some of these factors include maternal antibody, vaccine dose, age of birds at vaccination or challenge, challenge virus strain and genetic background of chickens. The objective of this study was to evalua...

  13. Early Huntington's Disease Affects Movements in Transformed Sensorimotor Mappings

    ERIC Educational Resources Information Center

    Boulet, C.; Lemay, M.; Bedard, M.A.; Chouinard, M.J.; Chouinard, S.; Richer, F.

    2005-01-01

    This study examined the effect of transformed visual feedback on movement control in Huntington's disease (HD). Patients in the early stages of HD and controls performed aiming movements towards peripheral targets on a digitizing tablet and emphasizing precision. In a baseline condition, HD patients were slower but showed few precision problems in…

  14. Cj1199 Affect the Development of Erythromycin Resistance in Campylobacter jejuni through Regulation of Leucine Biosynthesis

    PubMed Central

    Hao, Haihong; Li, Fei; Han, Jing; Foley, Steven L.; Dai, Menghong; Wang, Xu; Wang, Yulian; Huang, Lingli; Sun, Yawei; Liu, Zhenli; Yuan, Zonghui

    2017-01-01

    The aim of this study was to reveal the biological function of Cj1199 which was overexpressed in the laboratory induced erythromycin resistant strains. The Cj1199 deletion mutant (ΦCj1199) was constructed via insertional inactivation from its parent strain Campylobacter jejuni NCTC11168. The ΦCj1199 and NCTC11168 were then subjected to microarray and real-time PCR to find gene pathway of Cj1199. The antimicrobial susceptibility, antimicrobial resistance development, growth characteristics and leucine metabolism were examined to confirm the biological function of Cj1199. Our result showed that a total of 20 genes were down-regulated in ΦCj1199. These genes were mainly involved in leucine biosynthesis, amino acid transport and periplasmic/membrane structure. Compared to NCTC11168, ΦCj1199 was difficult to acquire higher-level erythromycin resistance during the in vitro step-wise selection. The competition growth and leucine-dependent growth assays demonstrated that ΦCj1199 imposed a growth disadvantage under pressure of erythromycin and in the leucine-free medium. In conclusion, Cj1199 gene may directly regulate the leucine biosynthesis and transport and indirectly affect the development of erythromycin resistance in C. jejuni. PMID:28144238

  15. Cardiovascular Disease Susceptibility and Resistance in Circumpolar Inuit Populations.

    PubMed

    Tvermosegaard, Maria; Dahl-Petersen, Inger K; Nielsen, Nina Odgaard; Bjerregaard, Peter; Jørgensen, Marit Eika

    2015-09-01

    Cardiovascular disease (CVD) is a major public health issue in indigenous populations in the Arctic. These diseases have emerged concomitantly with profound social changes over the past 60 years. The aim of this study was to summarize the literature on CVD risk among Arctic Inuit. Literature on prevalence, incidence, and time trends for CVD and its risk factors in Arctic Inuit populations was reviewed. Most evidence supports a similar incidence of coronary heart disease and a higher incidence of cerebrovascular disease among Arctic Inuit than seen in western populations. Factors that may increase CVD risk include aging of the population, genetic susceptibility, and a rapid increase in obesity, diabetes, and hypertension in parallel with decreasing physical activity and deterioration of the lipid profile. In contrast, and of great importance, there has been a decrease in smoking and alcohol intake (at least documented in Greenland), and contaminant levels are declining. Although there have been marked socioeconomic and dietary changes, it remains unsolved and to some extent controversial how this may have influenced cardiovascular risk among Arctic Inuit. The increase in life expectancy, in combination with improved prognosis for patients with manifest CVD, will inevitably lead to a large increase in absolute numbers of individuals affected by CVD in Arctic Inuit populations, exacerbated by the rise in most CVD risk factors over the past decades. For preventive purposes and for health care planning, it is crucial to carefully monitor disease incidence and trends in risk factors in these vulnerable Arctic populations.

  16. Semantic Trouble Sources and Their Repair in Conversations Affected by Parkinson's Disease

    ERIC Educational Resources Information Center

    Saldert, Charlotta; Ferm, Ulrika; Bloch, Steven

    2014-01-01

    Background: It is known that dysarthria arising from Parkinson's disease may affect intelligibility in conversational interaction. Research has also shown that Parkinson's disease may affect cognition and cause word-retrieval difficulties and pragmatic problems in the use of language. However, it is not known whether or how these…

  17. Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew

    PubMed Central

    Chowdhury, Jamil; Lück, Stefanie; Rajaraman, Jeyaraman; Douchkov, Dimitar; Shirley, Neil J.; Schwerdt, Julian G.; Schweizer, Patrick; Fincher, Geoffrey B.; Burton, Rachel A.; Little, Alan

    2017-01-01

    Heteroxylan has recently been identified as an important component of papillae, which are formed during powdery mildew infection of barley leaves. Deposition of heteroxylan near the sites of attempted fungal penetration in the epidermal cell wall is believed to enhance the physical resistance to the fungal penetration peg and hence to improve pre-invasion resistance. Several glycosyltransferase (GT) families are implicated in the assembly of heteroxylan in the plant cell wall, and are likely to work together in a multi-enzyme complex. Members of key GT families reported to be involved in heteroxylan biosynthesis are up-regulated in the epidermal layer of barley leaves during powdery mildew infection. Modulation of their expression leads to altered susceptibility levels, suggesting that these genes are important for penetration resistance. The highest level of resistance was achieved when a GT43 gene was co-expressed with a GT47 candidate gene, both of which have been predicted to be involved in xylan backbone biosynthesis. Altering the expression level of several candidate heteroxylan synthesis genes can significantly alter disease susceptibility. This is predicted to occur through changes in the amount and structure of heteroxylan in barley papillae.

  18. Dietary modulation of the microbiome affects autoinflammatory disease

    PubMed Central

    Lukens, John R.; Gurung, Prajwal; Vogel, Peter; Johnson, Gordon R.; Carter, Robert A.; McGoldrick, Daniel J.; Bandi, Srinivasa R.A.O.; Calabrese, Christopher R.; Walle, Lieselotte Vande; Lamkanfi, Mohamed; Kanneganti, Thirumala-Devi

    2014-01-01

    The incidences of chronic inflammatory disorders have increased significantly over the past three decades1. Recent shifts in dietary consumption are believed to have contributed importantly to this surge, but how dietary consumption modulates inflammatory disease is poorly defined. Pstpip2cmo mice that express a homozygous L98P missense mutation in the Pombe Cdc15 homology (PCH) family proline-serine-threonine phosphatase interacting protein 2 (PSTPIP2) phosphatase spontaneously develop osteomyelitis that resembles chronic recurrent multifocal osteomyelitis (CRMO) in humans2-4. Recent reports demonstrated osteomyelitis to critically rely on IL-1β, but deletion of the inflammasome components caspase-1 and NLRP3 failed to rescue Pstpip2cmo mice from inflammatory bone disease5,6. Thus, the upstream mechanisms controlling IL-1β production in Pstpip2cmo mice remain to be identified. In addition, the environmental factors driving IL-1β-dependent inflammatory bone erosion are unknown. Here, we show that the intestinal microbiota of diseased Pstpip2cmo mice was characterized by an outgrowth of Prevotella. Notably, Pstpip2cmo mice that were fed a diet rich in fat and cholesterol maintained a normal body weight, but were markedly protected against inflammatory bone disease and bone erosion. Diet-induced protection against osteomyelitis was accompanied by marked reductions in intestinal Prevotella levels and significantly reduced proIL-1β expression in distant neutrophils. Furthermore, proIL-1β expression was also decreased in antibiotics-treated Pstpip2cmo mice, and in wildtype mice that were kept under germfree conditions. We further demonstrated that combined deletion of caspases 1 and 8 was required for protection against IL-1β-dependent inflammatory bone disease, whereas deletion of each caspase alone, elastase or neutrophil proteinase-3 failed to prevent inflammatory disease. Collectively, this work reveals diet-associated changes in the intestinal microbiome as a

  19. Innate immune markers that distinguish red deer (Cervus elaphus) selected for resistant or susceptible genotypes for Johne’s disease

    PubMed Central

    2013-01-01

    While many factors contribute to resistance and susceptibility to infectious disease, a major component is the genotype of the host and the way in which it is expressed. Johne’s disease is a chronic inflammatory bowel disease affecting ruminants and is caused by infection with Mycobacterium avium subspecies paratuberculosis (MAP). We have previously identified red deer breeds (Cervus elaphus) that are resistant; have a low rate of MAP infection and do not progress to develop Johne’s disease. In contrast, susceptible breeds have a high rate of MAP infection as seen by seroconversion and progress to develop clinical Johne’s disease. The aim of this study was to determine if immunological differences exist between animals of resistant or susceptible breeds. Macrophage cultures were derived from the monocytes of deer genotypically defined as resistant or susceptible to the development of Johne’s disease. Following in vitro infection of the cells with MAP, the expression of candidate genes was assessed by quantitative PCR as well as infection rate and cell death rate. The results indicate that macrophages from susceptible animals show a significantly higher upregulation of inflammatory genes (iNOS, IL-1α, TNF-α and IL-23p19) than the macrophages from resistant animals. Cells from resistant animals had a higher rate of apoptosis at 24 hours post infection (hpi) compared to macrophages from susceptible animals. The excessive expression of inflammatory mRNA transcripts in susceptible animals could cause inefficient clearing of the mycobacterial organism and the establishment of disease. Controlled upregulation of inflammatory pathways coupled with programmed cell death in the macrophages of resistant animals may predispose the host to a protective immune response against this mycobacterial pathogen. PMID:23347398

  20. Innate immune markers that distinguish red deer (Cervus elaphus) selected for resistant or susceptible genotypes for Johne's disease.

    PubMed

    Dobson, Brooke; Liggett, Simon; O'Brien, Rory; Griffin, J Frank T

    2013-01-24

    While many factors contribute to resistance and susceptibility to infectious disease, a major component is the genotype of the host and the way in which it is expressed. Johne's disease is a chronic inflammatory bowel disease affecting ruminants and is caused by infection with Mycobacterium avium subspecies paratuberculosis (MAP). We have previously identified red deer breeds (Cervus elaphus) that are resistant; have a low rate of MAP infection and do not progress to develop Johne's disease. In contrast, susceptible breeds have a high rate of MAP infection as seen by seroconversion and progress to develop clinical Johne's disease. The aim of this study was to determine if immunological differences exist between animals of resistant or susceptible breeds. Macrophage cultures were derived from the monocytes of deer genotypically defined as resistant or susceptible to the development of Johne's disease. Following in vitro infection of the cells with MAP, the expression of candidate genes was assessed by quantitative PCR as well as infection rate and cell death rate. The results indicate that macrophages from susceptible animals show a significantly higher upregulation of inflammatory genes (iNOS, IL-1α, TNF-α and IL-23p19) than the macrophages from resistant animals. Cells from resistant animals had a higher rate of apoptosis at 24 hours post infection (hpi) compared to macrophages from susceptible animals. The excessive expression of inflammatory mRNA transcripts in susceptible animals could cause inefficient clearing of the mycobacterial organism and the establishment of disease. Controlled upregulation of inflammatory pathways coupled with programmed cell death in the macrophages of resistant animals may predispose the host to a protective immune response against this mycobacterial pathogen.

  1. Factors affecting treatment outcomes in drug-resistant tuberculosis cases in the Northern Cape, South Africa.

    PubMed

    Elliott, E; Draper, H R; Baitsiwe, P; Claassens, M M

    2014-09-21

    The Northern Cape Province has low cure rates (21%) for multidrug-resistant tuberculosis (TB). We audited the programme to identify factors affecting treatment outcomes. Cases admitted to two drug-resistant TB units from 2007 to 2009 had data extracted from clinical folders. Unfavourable treatment outcomes were found in 58% of the 272 cases. A multivariable regression analysis found that male sex was associated with unfavourable outcome (P = 0.009). Weight at diagnosis (P < 0.001) and oral drug adherence (P < 0.001) were also associated with an unfavourable outcome; however, injectable drug adherence was not (P = 0.395). Positive baseline smear and human immunodeficiency virus positive status were not associated with unfavourable outcome. Shorter, more patient-friendly regimens may go a long way to improving adherence and outcomes.

  2. Evolutionary clade affects resistance of Clostridium difficile spores to Cold Atmospheric Plasma

    PubMed Central

    Connor, Mairéad; Flynn, Padrig B.; Fairley, Derek J.; Marks, Nikki; Manesiotis, Panagiotis; Graham, William G.; Gilmore, Brendan F.; McGrath, John W.

    2017-01-01

    Clostridium difficile is a spore forming bacterium and the leading cause of colitis and antibiotic associated diarrhoea in the developed world. Spores produced by C. difficile are robust and can remain viable for months, leading to prolonged healthcare-associated outbreaks with high mortality. Exposure of C. difficile spores to a novel, non-thermal atmospheric pressure gas plasma was assessed. Factors affecting sporicidal efficacy, including percentage of oxygen in the helium carrier gas admixture, and the effect on spores from different strains representing the five evolutionary C. difficile clades was investigated. Strains from different clades displayed varying resistance to cold plasma. Strain R20291, representing the globally epidemic ribotype 027 type, was the most resistant. However all tested strains displayed a ~3 log reduction in viable spore counts after plasma treatment for 5 minutes. Inactivation of a ribotype 078 strain, the most prevalent clinical type seen in Northern Ireland, was further assessed with respect to surface decontamination, pH, and hydrogen peroxide concentration. Environmental factors affected plasma activity, with dry spores without the presence of organic matter being most susceptible. This study demonstrates that cold atmospheric plasma can effectively inactivate C. difficile spores, and highlights factors that can affect sporicidal activity. PMID:28155914

  3. Evolutionary clade affects resistance of Clostridium difficile spores to Cold Atmospheric Plasma

    NASA Astrophysics Data System (ADS)

    Connor, Mairéad; Flynn, Padrig B.; Fairley, Derek J.; Marks, Nikki; Manesiotis, Panagiotis; Graham, William G.; Gilmore, Brendan F.; McGrath, John W.

    2017-02-01

    Clostridium difficile is a spore forming bacterium and the leading cause of colitis and antibiotic associated diarrhoea in the developed world. Spores produced by C. difficile are robust and can remain viable for months, leading to prolonged healthcare-associated outbreaks with high mortality. Exposure of C. difficile spores to a novel, non-thermal atmospheric pressure gas plasma was assessed. Factors affecting sporicidal efficacy, including percentage of oxygen in the helium carrier gas admixture, and the effect on spores from different strains representing the five evolutionary C. difficile clades was investigated. Strains from different clades displayed varying resistance to cold plasma. Strain R20291, representing the globally epidemic ribotype 027 type, was the most resistant. However all tested strains displayed a ~3 log reduction in viable spore counts after plasma treatment for 5 minutes. Inactivation of a ribotype 078 strain, the most prevalent clinical type seen in Northern Ireland, was further assessed with respect to surface decontamination, pH, and hydrogen peroxide concentration. Environmental factors affected plasma activity, with dry spores without the presence of organic matter being most susceptible. This study demonstrates that cold atmospheric plasma can effectively inactivate C. difficile spores, and highlights factors that can affect sporicidal activity.

  4. Issues affecting minority participation in research studies of Alzheimer disease.

    PubMed

    Welsh, Kathleen A; Ballard, Edna; Nash, Florence; Raiford, Kate; Harrell, Lindy

    1994-01-01

    Despite the need for minority subjects in research studies of Alzheimer disease (AD), the successful involvement of minority patients in such studies has been difficult. This report discusses the many societal, economic, logistical, and attitudinal barriers that have inhibited the participation of minority patients and their families in medical research programs of AD. Special consideration is given to the unique cultural issues that arise when conducting studies involving African-American elderly subjects. Methods are considered for overcoming the barriers to participation gleaned from the national study CERAD (Consortium to Establish a Registry of Alzheimer Disease) and other investigations of AD. Recommendations are made for future research programs targeted on the specific health care needs and concerns of the minority segments of our population.

  5. Major viral diseases affecting fish aquaculture in Spain.

    PubMed

    Pérez, S I; Rodríguez, S

    1997-06-01

    The number of viruses isolated from fish has grown in the last few years as a reflection of the increasing interest in fish diseases, particularly those occurring in aquaculture facilities. Of all the described viruses, only a few are considered to be of serious concern and economic importance; they are described in this review, drawing special attention to the four families of viruses (Birnaviridae, Rhabdoviridae, Iridoviridae and Reoviridae) that have been reported in Spanish aquaculture. Infectious pancreatic necrosis virus, a member of the first family, is the most spread virus with a prevalence of 39%. Viral diseases are untreatable and because effective and safe vaccines for fish are not yet commercially available, a great care needs to be exercised when moving fish or eggs from one site or country to another. Some fish health control regulations have been legislated in Europe and USA.

  6. Insulin resistance and Parkinson's disease: A new target for disease modification?

    PubMed

    Athauda, D; Foltynie, T

    There is growing evidence that patients with Type 2 diabetes have an increased risk of developing Parkinson's disease and share similar dysregulated pathways suggesting common underlying pathological mechanisms. Historically insulin was thought solely to be a peripherally acting hormone responsible for glucose homeostasis and energy metabolism. However accumulating evidence indicates insulin can cross the blood-brain-barrier and influence a multitude of processes in the brain including regulating neuronal survival and growth, dopaminergic transmission, maintenance of synapses and pathways involved in cognition. In conjunction, there is growing evidence that a process analogous to peripheral insulin resistance occurs in the brains of Parkinson's disease patients, even in those without diabetes. This raises the possibility that defective insulin signalling pathways may contribute to the development of the pathological features of Parkinson's disease, and thereby suggests that the insulin signalling pathway may potentially be a novel target for disease modification. Given these growing links between PD and Type 2 diabetes it is perhaps not unsurprising that drugs used the treatment of T2DM are amongst the most promising treatments currently being prioritised for repositioning as possible novel treatments for PD and several clinical trials are under way. In this review, we will examine the underlying cellular links between insulin resistance and the pathogenesis of PD and then we will assess current and future pharmacological strategies being developed to restore neuronal insulin signalling as a potential strategy for slowing neurodegeneration in Parkinson's disease.

  7. Postnatal Infections and Immunology Affecting Chronic Lung Disease of Prematurity

    PubMed Central

    Pryhuber, Gloria S.

    2015-01-01

    Synopsis Premature infants suffer significant respiratory morbidity during infancy with long-term negative consequences on health, quality of life, and health care costs. Enhanced susceptibility to a variety of infections and inflammation play a large role in early and prolonged lung disease following premature birth, though the mechanisms of susceptibility and immune dysregulation are active areas of research. This chapter will review aspects of host-pathogen interactions and immune responses that are altered by preterm birth and that impact chronic respiratory morbidity in these children. PMID:26593074

  8. Vector-borne pathogens: New and emerging arboviral diseases affecting public health

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dengue and Zika have quickly become two of the most important vector-borne diseases affecting Public health around the world. This presentation will introduce vector-borne diseases and all the vectors implicated. A focus will be made on the most important arboviral diseases (Zika and dengue) describ...

  9. Chronic Ischemic Heart Disease Affects Health Related Quality of Life

    PubMed Central

    Goreishi, Abolfazl; Shajari, Zahra; Mohammadi, Zeinab

    2012-01-01

    Background Chronic diseases endanger not only physical health but also psychological and social health of patient. Thus, evaluation of such patients for psychological treatment decisions is very important. Method This is a descriptive study that was performed with 50 chronic patients (ischemic heart disease) selected from Valiasr and Mousavi at cardiac wards in Zanjan Province. They were given three types of questionnaire: demographic, WHOQOL, and Zung depression and anxiety index. The information was statically analyzed by frequency chart, central indexes, dispersion, Chi-Square and t tests, Pearson’s correlation index (P < 0.05). Results The average of quality of life in all patients were calculated as was respectively 12.19, 11.98, 12.08, and 12.4 in physical, psychological, social and environmental domains respectively, 68 percent of total number of the patients had various degrees of anxiety and 78 percent of them had various degrees of depression. There was a significant relationship between the life quality average in all domains and anxiety intensity and depression intensity (P < 0.05) and there was a significant relationship between life quality average in all domains and income (P < 0.05). Conclusion As the level of depression and anxiety goes up, quality of life decreases pointing out that they have a reverse relationship. Depression and anxiety are one of the most significant factors of quality of life among other variables. Regarding specific conditions of the treatment, it is necessary to pay special attention to psychological aspects.

  10. PDT in periodontal disease of HAART resistance patients

    NASA Astrophysics Data System (ADS)

    Giovani, Elcio M.; Noro-Filho, Gilberto A.; Caputo, Bruno V.; Casarin, Renato; Costa, Claudio; Salgado, Daniela; Santos, Camila C.

    2016-03-01

    HIV/Aids patients present a change of microbiota associated with host immunodeficiency. Photodynamic therapy (PDT) showed as a promising and viable alternative in reducing microbiota. Present study evaluate effectiveness of photodynamic therapy in periodontal disease of AIDS patients with highly activity antiretroviral therapy (HAART) failure, measuring the clinical periodontal parameters and periodontal microbiota. Twelve patients with HARRT resistance (R group) divided into two groups (control and PDT) and 12 patients with no HAART resistance (NR group) divided into two groups (control and PDT). The results show the difference in baseline of CD4 cells count, NR group 640.0 +/- 176.2 cells/mm3 R group and 333.3 +/- 205.8 cells / mm3 (p<0.05), and in 8.3% detectable viral load in NR group and 75% detectable (p <0.001) in R group. As clinical periodontal parameters (PD and CAL), PDT was more effective than the control group only in the NR group (p <0.05%), moreover, there was no difference in the evaluation of clinical periodontal parameters between the both R groups (p>0.05%). Microbiological evaluation in R group presents a general reduction in the Aa at 3 and 6 months. Furthermore, demonstrated a reduction of Pg in all groups at 6 months and in R group at 3 months. The impact assessment of photodynamic therapy in patients with different levels of immunosuppression determined that the combination of mechanical periodontal treatment with photodynamic therapy in patients with HAART failure did not cause additional benefits. Therefore, PDT in this study could not been indicated in HAART resistance patients.

  11. Inflammation and Oxidative Stress: The Molecular Connectivity between Insulin Resistance, Obesity, and Alzheimer's Disease

    PubMed Central

    Verdile, Giuseppe; Keane, Kevin N.; Cruzat, Vinicius F.; Medic, Sandra; Sabale, Miheer; Rowles, Joanne; Wijesekara, Nadeeja; Martins, Ralph N.; Fraser, Paul E.; Newsholme, Philip

    2015-01-01

    Type 2 diabetes (T2DM), Alzheimer's disease (AD), and insulin resistance are age-related conditions and increased prevalence is of public concern. Recent research has provided evidence that insulin resistance and impaired insulin signalling may be a contributory factor to the progression of diabetes, dementia, and other neurological disorders. Alzheimer's disease (AD) is the most common subtype of dementia. Reduced release (for T2DM) and decreased action of insulin are central to the development and progression of both T2DM and AD. A literature search was conducted to identify molecular commonalities between obesity, diabetes, and AD. Insulin resistance affects many tissues and organs, either through impaired insulin signalling or through aberrant changes in both glucose and lipid (cholesterol and triacylglycerol) metabolism and concentrations in the blood. Although epidemiological and biological evidence has highlighted an increased incidence of cognitive decline and AD in patients with T2DM, the common molecular basis of cell and tissue dysfunction is rapidly gaining recognition. As a cause or consequence, the chronic inflammatory response and oxidative stress associated with T2DM, amyloid-β (Aβ) protein accumulation, and mitochondrial dysfunction link T2DM and AD. PMID:26693205

  12. Plant Chitinases and Their Roles in Resistance to Fungal Diseases

    PubMed Central

    Punja, Zamir K.; Zhang, Ye-Yan

    1993-01-01

    Chitinases are enzymes that hydrolyze the N-acetylglucosamine polymer chitin, and they occur in diverse plant tissues over a broad range of crop and noncrop species. The enzymes may be expressed constitutively at low levels but are dramatically enhanced by numerous abiotic agents (ethylene, salicylic acid, salt solutions, ozone, UV light) and by biotic factors (fungi, bacteria, viruses, viroids, fungal cell wall components, and oligosaccharides). Different classes of plant chitinases are distinguishable by molecular, biochemical, and physicochemical criteria. Thus, plant chitinases may differ in substrate-binding characteristics, localization within the cell, and specific activities. Because chitin is a structural component of the cell wall of many phytopathogenic fungi, extensive research has been conducted to determine whether plant chitinases have a role in defense against fungal diseases. Plant chitinases have different degrees of antifungal activity to several fungi in vitro. In vivo, although rapid accumulation and high levels of chitinases (together with numerous other pathogenesis-related proteins) occur in resistant tissues expressing a hypersensitive reaction, high levels also can occur in susceptible tissues. Expression of cloned chitinase genes in transgenic plants has provided further evidence for their role in plant defense. The level of protection observed in these plants is variable and may be influenced by the specific activity of the enzyme, its localization and concentration within the cell, the characteristics of the fungal pathogen, and the nature of the host-pathogen interaction. The expression of chitinase in combination with one or several different antifungal proteins should have a greater effect on reducing disease development, given the complexities of fungal-plant cell interactions and resistance responses in plants. The effects of plant chitinases on nematode development in vitro and in vivo are worthy of investigation. PMID:19279806

  13. Induction of Xa10-like genes in rice cultivar Nipponbare confers disease resistance to rice bacterial blight.

    PubMed

    Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

    2017-03-17

    Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice growing regions in the world. The rice disease resistance (R) genes Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effectors AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element (EBE) in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. Rice cultivar Nipponbare carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from rice cultivar CBB23. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALEs). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic

  14. Infectious, inflammatory, and metabolic diseases affecting the athlete's spine.

    PubMed

    Metz, Lionel N; Wustrack, Rosanna; Lovell, Alberto F; Sawyer, Aenor J

    2012-07-01

    Sports and weight-bearing activities can have a positive effect on bone health in the growing, mature, or aging athlete. However, certain athletic activities and training regimens may place the athlete at increased risk for stress fractures in the spine. In addition, some athletes have an underlying susceptibility to fracture due to either systemic or focal abnormalities. It is important to identify and treat these athletes in order to prevent stress fractures and reduce the risk of osteoporosis in late adulthood. Therefore, the pre-participation physical examination offers a unique opportunity to screen athletes for metabolic bone disease through the history and physical examination. Positive findings warrant a thorough workup including a metabolic bone laboratory panel, and possibly a DEXA scan, which includes a lateral spine view.

  15. Reversal of hypertriglyceridemia, fatty liver disease, and insulin resistance by a liver-targeted mitochondrial uncoupler.

    PubMed

    Perry, Rachel J; Kim, Taehan; Zhang, Xian-Man; Lee, Hui-Young; Pesta, Dominik; Popov, Violeta B; Zhang, Dongyan; Rahimi, Yasmeen; Jurczak, Michael J; Cline, Gary W; Spiegel, David A; Shulman, Gerald I

    2013-11-05

    Nonalcoholic fatty liver disease (NAFLD) affects one in three Americans and is a major predisposing condition for the metabolic syndrome and type 2 diabetes (T2D). We examined whether a functionally liver-targeted derivative of 2,4-dinitrophenol (DNP), DNP-methyl ether (DNPME), could safely decrease hypertriglyceridemia, NAFLD, and insulin resistance without systemic toxicities. Treatment with DNPME reversed hypertriglyceridemia, fatty liver, and whole-body insulin resistance in high-fat-fed rats and decreased hyperglycemia in a rat model of T2D with a wide therapeutic index. The reversal of liver and muscle insulin resistance was associated with reductions in tissue diacylglycerol content and reductions in protein kinase C epsilon (PKCε) and PKCθ activity in liver and muscle, respectively. These results demonstrate that the beneficial effects of DNP on hypertriglyceridemia, fatty liver, and insulin resistance can be dissociated from systemic toxicities and suggest the potential utility of liver-targeted mitochondrial uncoupling agents for the treatment of hypertriglyceridemia, NAFLD, metabolic syndrome, and T2D.

  16. Adaptive autophagy in Alexander disease-affected astrocytes.

    PubMed

    Tang, Guomei; Yue, Zhenyu; Tallóczy, Zsolt; Goldman, James E

    2008-07-01

    The ubiquitin-proteasome and autophagy-lysosomal pathways are the two main routes of protein and organelle clearance in eukaryotic cells. The proteasome system is responsible for unfolded, short-lived proteins, which precludes the clearance of oligomeric and aggregated proteins, whereas macroautophagy, a process generally referred to as autophagy, mediates mainly the bulk degradation of long-lived cytoplasmic proteins, large protein complexes or organelles.(1) Recently, the autophagy-lysosomal pathway has been implicated in neurodegenerative disorders as an important pathway for the clearance of abnormally accumulated intracellular proteins, such as huntingtin, tau, and mutant and modified α-synuclein.(1-6) Our recent study illustrated the induction of adaptive autophagy in response to mutant glial fibrillary acidic protein (GFAP) accumulation in astrocytes, in the brains of patients with Alexander disease (AxD), and in mutant GFAP knock-in mouse brains.(7) This autophagic response is negatively regulated by mammalian target of rapamycin (mTOR). The activation of p38 MAPK by GFAP accumulation is responsible for mTOR inactivation and the induction of autophagy. We also found that the accumulation of GFAP impairs proteasome activity.(8) In this commentary we discuss the potential compensatory relationship between an impaired proteasome and activated autophagy, and propose that the MLK-MAPK (mixed lineage kinase-mitogen-activated protein kinase) cascade is a regulator of this crosstalk. Addendum to: Tang G, Yue Z, Talloczy, Z, Hagemann T, Cho W, Sulzer D, Messing A, Goldman JE. Alexander disease-mutant GFAP accumulation stimulates autophagy through p38 MAPK and mTOR signaling pathways. Hum Mol Genetics 2008; In press.

  17. Iron deficiency affects plant defence responses and confers resistance to Dickeya dadantii and Botrytis cinerea.

    PubMed

    Kieu, Nam Phuong; Aznar, Aude; Segond, Diego; Rigault, Martine; Simond-Côte, Elizabeth; Kunz, Caroline; Soulie, Marie-Christine; Expert, Dominique; Dellagi, Alia

    2012-10-01

    Iron is an essential element for most living organisms, and pathogens are likely to compete with their hosts for the acquisition of this element. The bacterial plant pathogen Dickeya dadantii has been shown to require its siderophore-mediated iron uptake system for systemic disease progression on several host plants, including Arabidopsis thaliana. In this study, we investigated the effect of the iron status of Arabidopsis on the severity of disease caused by D. dadantii. We showed that symptom severity, bacterial fitness and the expression of bacterial pectate lyase-encoding genes were reduced in iron-deficient plants. Reduced symptoms correlated with enhanced expression of the salicylic acid defence plant marker gene PR1. However, levels of the ferritin coding transcript AtFER1, callose deposition and production of reactive oxygen species were reduced in iron-deficient infected plants, ruling out the involvement of these defences in the limitation of disease caused by D. dadantii. Disease reduction in iron-starved plants was also observed with the necrotrophic fungus Botrytis cinerea. Our data demonstrate that the plant nutritional iron status can control the outcome of an infection by acting on both the pathogen's virulence and the host's defence. In addition, iron nutrition strongly affects the disease caused by two soft rot-causing plant pathogens with a large host range. Thus, it may be of interest to take into account the plant iron status when there is a need to control disease without compromising crop quality and yield in economically important plant species.

  18. External Resistances Applied to MFC Affect Core Microbiome and Swine Manure Treatment Efficiencies

    PubMed Central

    Vilajeliu-Pons, Anna; Bañeras, Lluis; Puig, Sebastià; Molognoni, Daniele; Vilà-Rovira, Albert; Hernández-del Amo, Elena; Balaguer, Maria D.; Colprim, Jesús

    2016-01-01

    Microbial fuel cells (MFCs) can be designed to combine water treatment with concomitant electricity production. Animal manure treatment has been poorly explored using MFCs, and its implementation at full-scale primarily relies on the bacterial distribution and activity within the treatment cell. This study reports the bacterial community changes at four positions within the anode of two almost identically operated MFCs fed swine manure. Changes in the microbiome structure are described according to the MFC fluid dynamics and the application of a maximum power point tracking system (MPPT) compared to a fixed resistance system (Ref-MFC). Both external resistance and cell hydrodynamics are thought to heavily influence MFC performance. The microbiome was characterised both quantitatively (qPCR) and qualitatively (454-pyrosequencing) by targeting bacterial 16S rRNA genes. The diversity of the microbial community in the MFC biofilm was reduced and differed from the influent swine manure. The adopted electric condition (MPPT vs fixed resistance) was more relevant than the fluid dynamics in shaping the MFC microbiome. MPPT control positively affected bacterial abundance and promoted the selection of putatively exoelectrogenic bacteria in the MFC core microbiome (Sedimentibacter sp. and gammaproteobacteria). These differences in the microbiome may be responsible for the two-fold increase in power production achieved by the MPPT-MFC compared to the Ref-MFC. PMID:27701451

  19. Factors Affecting the Hydrogen Environment Assisted Cracking Resistance of an AL-Zn-Mg-(Cu) Alloy

    SciTech Connect

    Young, G A; Scully, J R

    2002-04-09

    Precipitation hardenable Al-Zn-Mg alloys are susceptible to hydrogen environment assisted cracking (HEAC) when exposed to aqueous environments. In Al-Zn-Mg-Cu alloys, overaged tempers are used to increase HEAC resistance at the expense of strength but overaging has little benefit in low copper alloys. However, the mechanism or mechanisms by which overaging imparts HEAC resistance is poorly understood. The present research investigated hydrogen uptake, diffusion, and crack growth rate in 90% relative humidity (RH) air for both a commercial copper bearing Al-Zn-Mg-Cu alloy (AA 7050) and a low copper variant of this alloy in order to better understand the factors which affect HEAC resistance. Experimental methods used to evaluate hydrogen concentrations local to a surface and near a crack tip include nuclear reaction analysis (NRA), focused ion beam, secondary ion mass spectroscopy (FIB/SIMS) and thermal desorption spectroscopy (TDS). Results show that overaging the copper bearing alloys both inhibits hydrogen ingress from oxide covered surfaces and decreases the apparent hydrogen diffusion rates in the metal.

  20. Electrical Resistivity Monitoring for Leachate Distribution at Two Foot-and-Mouth- Disease (FMD) Burial Sites

    NASA Astrophysics Data System (ADS)

    Lee, S.; Kaown, D.; Lee, K.; Leem, K.; Ko, K.

    2011-12-01

    The main objective of this study was to provide the basic information on leachate distribution with time changes through the electrical resistivity monitoring for a certain period of time in the Foot-and-Mouth-Disease (FMD) burial facilities which is needed to prevent further soil and groundwater contamination and to build an effective plan for stabilization of the burial site. In this study, dipole-dipoles surveys were carried out around two FMD burial sites in Iceon-si, Gyeonggi-do. The FMD burial facility installed at Daewall-myeon is consists of one block but, at Yul-myeon, it is divided into 2 blocks named A and B blocks. Dipole-Dipole surveys with 8 lines at Yul-myeon and 3 lines at Daewall-myeon were carried out. The observed leachate distribution along survey lines was not clearly evident as time passes at Daewall-myeon site, but, at Yul-myeon site, the leachate distribution around the survey lines showed a decrease of resistivity around the burial facility. At and around A and B blocks of Yul-myeon site, interpretations of the survey data show low resistivity zones below 10 Ωm from a depth 3 m to 10 m and such low resistivity zones of the A block are thicker than the B block by about 5~10 m. From the geochemical data and resistivity survey at two FMD burial sites, it is inferred that the groundwater within a 50-meter radius around burial facilities of the Yul-myeon site are contaminated by leachate. The general resistivity distribution around the burial site is seemed affected by the leachate with high electrical conductivity. The detail distribution patterns can be explained by local distributions of soil and weathered rocks and associated leachate flow. This subject is supported by Brain Korea 21 and Korea Ministry of Environment as 'The GAIA Project (173-092-009)'.

  1. European Sea Bass (Dicentrarchus labrax) Immune Status and Disease Resistance Are Impaired by Arginine Dietary Supplementation

    PubMed Central

    Azeredo, Rita; Pérez-Sánchez, Jaume; Sitjà-Bobadilla, Ariadna; Fouz, Belén; Tort, Lluis; Aragão, Cláudia; Oliva-Teles, Aires; Costas, Benjamín

    2015-01-01

    Infectious diseases and fish feeds management are probably the major expenses in the aquaculture business. Hence, it is a priority to define sustainable strategies which simultaneously avoid therapeutic procedures and reinforce fish immunity. Currently, one preferred approach is the use of immunostimulants which can be supplemented to the fish diets. Arginine is a versatile amino acid with important mechanisms closely related to the immune response. Aiming at finding out how arginine affects the innate immune status or improve disease resistance of European seabass (Dicentrarchus labrax) against vibriosis, fish were fed two arginine-supplemented diets (1% and 2% arginine supplementation). A third diet meeting arginine requirement level for seabass served as control diet. Following 15 or 29 days of feeding, fish were sampled for blood, spleen and gut to assess cell-mediated immune parameters and immune-related gene expression. At the same time, fish from each dietary group were challenged against Vibrio anguillarum and survival was monitored. Cell-mediated immune parameters such as the extracellular superoxide and nitric oxide decreased in fish fed arginine-supplemented diets. Interleukins and immune-cell marker transcripts were down-regulated by the highest supplementation level. Disease resistance data were in accordance with a generally depressed immune status, with increased susceptibility to vibriosis in fish fed arginine supplemented diets. Altogether, these results suggest a general inhibitory effect of arginine on the immune defences and disease resistance of European seabass. Still, further research will certainly clarify arginine immunomodulation pathways thereby allowing the validation of its potential as a prophylactic strategy. PMID:26447480

  2. Quantitative resistance affects the speed of frequency increase but not the diversity of the virulence alleles overcoming a major resistance gene to Leptosphaeria maculans in oilseed rape.

    PubMed

    Delourme, R; Bousset, L; Ermel, M; Duffé, P; Besnard, A L; Marquer, B; Fudal, I; Linglin, J; Chadœuf, J; Brun, H

    2014-10-01

    Quantitative resistance mediated by multiple genetic factors has been shown to increase the potential for durability of major resistance genes. This was demonstrated in the Leptosphaeria maculans/Brassica napus pathosystem in a 5year recurrent selection field experiment on lines harboring the qualitative resistance gene Rlm6 combined or not with quantitative resistance. The quantitative resistance limited the size of the virulent isolate population. In this study we continued this recurrent selection experiment in the same way to examine whether the pathogen population could adapt and render the major gene ineffective in the longer term. The cultivars Eurol, with a susceptible background, and Darmor, with quantitative resistance, were used. We confirmed that the combination of qualitative and quantitative resistance is an effective approach for controlling the pathogen epidemics over time. This combination did not prevent isolates virulent against the major gene from amplifying in the long term but the quantitative resistance significantly delayed for 5years the loss of effectiveness of the qualitative resistance and disease severity was maintained at a low level on the genotype with both types of resistance after the fungus population had adapted to the major gene. We also showed that diversity of AvrLm6 virulence alleles was comparable in isolates recovered after the recurrent selection on lines carrying either the major gene alone or in combination with quantitative resistance: a single repeat-induced point mutation and deletion events were observed in both situations. Breeding varieties which combine qualitative and quantitative resistance can effectively contribute to disease control by increasing the potential for durability of major resistance genes.

  3. The sustainability, feasibility and desirability of breeding livestock for disease resistance.

    PubMed

    Stear, M J; Bishop, S C; Mallard, B A; Raadsma, H

    2001-08-01

    Selective breeding for disease resistance utilises proven animal breeding methods to improve animal health, welfare and productivity. Unsurprisingly, it is receiving more and more attention from livestock breeders. However, there are a number of largely theoretical arguments that have been raised as potential problems in selection for disease resistance. These can be classified under sustainability, feasibility and desirability. This review considers each of these areas in turn. Several examples show that enhanced resistance to disease is stable under natural selection and therefore deliberate selection for disease resistance should also be stable and sustainable. The feasibility of selective breeding depends in part upon the heritability of the trait or traits used to measure disease resistance, as well as the amount of variation among animals. The heritability of traits associated with resistance to many important diseases is often high and considerable variation among animals exists. Consequently, selective breeding for enhanced disease resistance is certainly feasible. The desirability of breeding for disease resistance depends upon whether there are trade-offs with other economically important traits. By and large these remain to be defined. However, even if unfavourable associations exist, breeders can create selection indices that include traits with unfavourable associations and maximise the desired responses while attempting to minimise undesirable effects. In conclusion, so long as one or more diseases exert a significant influence on livestock production, selective breeding will be a useful tool to assist in disease control.

  4. Does Parkinson's disease affect judgement about another person's action?

    PubMed

    Poliakoff, E; Galpin, A J; Dick, J P R; Tipper, S P

    2010-07-01

    The observer's motor system has been shown to be involved in observing the actions of another person. Recent findings suggest that people with Parkinson's disease do not show the same motor facilitatory effects when observing the actions of another person. We studied whether Parkinson's patients were able to make unspeeded judgements about another person's action. Participants were asked to watch video clips of an actor lifting a box containing different weights (100, 200, 300 or 400 g) and to guess the weight that was being lifted on a 9-point scale. We compared the performance of 16 patients with PD with 16 healthy age-matched controls. Both groups were able to do the task, showing a significant relationship between the real weight and the guessed weight, albeit with a tendency to overestimate the lowest weight and underestimate the heaviest weight. The PD patients, however, showed a reduced slope value. These results show that despite their own motor deficits, PD patients are still able to judge the weight being lifted by another person, albeit with a slight reduction in accuracy. Further research will be required to determine whether PD patients use a motor simulation or a visual compensatory strategy to achieve this.

  5. Screening for anthracnose disease resistance in strawberry using a detached leaf assay

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Inoculation of detached strawberry leaves with Colletotrichum species may provide a rapid, non-destructive method of identifying anthracnose resistant germplasm. The reliability and validity of assessing disease severity is critical to disease management decisions. We inoculated detached strawberr...

  6. Loss of CMD2‐mediated resistance to cassava mosaic disease in plants regenerated through somatic embryogenesis

    PubMed Central

    Chauhan, Raj Deepika; Wagaba, Henry; Moll, Theodore; Alicai, Titus; Miano, Douglas; Carrington, James C.; Taylor, Nigel J.

    2016-01-01

    Summary Cassava mosaic disease (CMD) and cassava brown streak disease (CBSD) are the two most important viral diseases affecting cassava production in Africa. Three sources of resistance are employed to combat CMD: polygenic recessive resistance, termed CMD1, the dominant monogenic type, named CMD2, and the recently characterized CMD3. The farmer‐preferred cultivar TME 204 carries inherent resistance to CMD mediated by CMD2, but is highly susceptible to CBSD. Selected plants of TME 204 produced for RNA interference (RNAi)‐mediated resistance to CBSD were regenerated via somatic embryogenesis and tested in confined field trials in East Africa. Although micropropagated, wild‐type TME 204 plants exhibited the expected levels of resistance, all plants regenerated via somatic embryogenesis were found to be highly susceptible to CMD. Glasshouse studies using infectious clones of East African cassava mosaic virus conclusively demonstrated that the process of somatic embryogenesis used to regenerate cassava caused the resulting plants to become susceptible to CMD. This phenomenon could be replicated in the two additional CMD2‐type varieties TME 3 and TME 7, but the CMD1‐type cultivar TMS 30572 and the CMD3‐type cultivar TMS 98/0505 maintained resistance to CMD after passage through somatic embryogenesis. Data are presented to define the specific tissue culture step at which the loss of CMD resistance occurs and to show that the loss of CMD2‐mediated resistance is maintained across vegetative generations. These findings reveal new aspects of the widely used technique of somatic embryogenesis, and the stability of field‐level resistance in CMD2‐type cultivars presently grown by farmers in East Africa, where CMD pressure is high. PMID:26662210

  7. The role of renal nerve ablation for the management of resistant hypertension and other disease conditions: benefits and concerns.

    PubMed

    Faselis, C; Doumas, M; Kokkinos, P; Tsioufis, C; Papademetriou, V

    2014-01-01

    The sympathetic nervous system is overactivated in resistant hypertension and several other disease conditions. A reciprocal association between the brain and the kidney has been described, in that sympathetic overactivity affects renal function while renal injury stimulates central sympathetic drive. Renal nerve ablation has been recently introduced as a potential alternative for the management of resistant hypertension, mainly due to current limitations in pharmacologic antihypertensive therapy. Data accumulated thus far point towards an efficacious and safe interventional method for the management of treatment resistance, with additional benefits on glucose metabolism and cardiac structure and function. Furthermore, beneficial effects have been observed in patients with chronic kidney disease, obstructive sleep apnea, polycystic ovary syndrome, and sympathetically driven tachyarrhythmias. However, as with every novel technique, several questions need to be answered and concerns need to be addressed before the wide application of this interventional approach.

  8. Land use affects the resistance and resilience of carbon dynamics of mountain grassland to extreme drought

    NASA Astrophysics Data System (ADS)

    Ingrisch, Johannes; Karlowsky, Stefan; Hasibeder, Roland; Anadon-Rosell, Alba; Augusti, Angela; Scheld, Sarah; König, Alexander; Gleixner, Gerd; Bahn, Michael

    2015-04-01

    Climatic extremes like droughts are expected to occur more frequently and to be more severe in a future climate and have been shown to strongly affect the carbon (C) cycle. Few studies have so far explored how the management intensity of ecosystems and land-use changes alter C cycle responses to extreme climatic events. In many mountain areas land-use changes have been taking place at a rapid pace and have altered plant species composition and biogeochemical cycles. It is still unknown whether and how abandonment of mountain grasslands affects the resistance and the resilience of carbon dynamics to extreme drought. We carried out an in situ experiment to test the hypothesis that abandonment increases the resistance of grassland C dynamics to extreme drought, but decreases its resilience (i.e. post-drought recovery). In a common garden experiment at a mountain meadow in the Austrian Central Alps we exposed large intact monoliths from the meadow and a nearby abandoned grassland to extreme drought conditions during the main growth period in late spring. We measured above- and belowground productivity and net ecosystem exchange and its components over the course of the drought and during the recovery to assess and quantify their resistance and resilience. Furthermore, we analysed the coupling of the two major ecosystem CO2 fluxes, photosynthesis and soil respiration, as based on 13CO2 pulse labelling campaigns at peak drought and during post-drought recovery using isotope laser spectroscopy. Four weeks of early season drought induced a strong decrease of aboveground biomass at the mountain meadow, whereas no effect was observed for the abandoned grassland. At peak drought gross primary productivity was reduced at both grasslands compared to the respective controls, but with a stronger decrease at the meadow (80%) compared to the abandoned grassland (60%). The same pattern was observed for ecosystem respiration. However, the effect was less pronounced compared to carbon

  9. Longer resistance of some DNA traits from BT176 maize to gastric juice from gastrointestinal affected patients.

    PubMed

    Ferrini, A M; Mannoni, V; Pontieri, E; Pourshaban, M

    2007-01-01

    The presence of antibiotic resistance marker genes in genetically engineered plants is one of the most controversial issues related to Genetically Modified Organism (GMO)-containing food, raising concern about the possibility that these markers could increase the pool of antibiotic resistance genes. This study investigates the in vitro survival of genes bla and cryIA(b) of maize Bt176 in human gastric juice samples. Five samples of gastric juice were collected from patients affected by gastro-esophageal reflux or celiac disease and three additional samples were obtained by pH modification with NaHCO3. DNA was extracted from maize Bt176 and incubated with samples of gastric juices at different times. The survival of the target traits (bla gene, whole 1914 bp gene cry1A(b), and its 211 bp fragment) was determined using PCR. The stability of the target genes was an inverse function of their lengths in all the samples. Survival in samples from untreated subjects was below the normal physiological time of gastric digestion. On the contrary, survival time in samples from patients under anti-acid drug treatment or in samples whose pH was modified, resulted strongly increased. Our data indicate the possibility that in particular cases the survival time could be so delayed that, as a consequence, some traits of DNA could reach the intestine. In general, this aspect must be considered for vulnerable consumers (people suffering from gastrointestinal diseases related to altered digestive functionality, physiological problems or drug side-effects) in the risk analysis usually referred to healthy subjects.

  10. Hybridization of an invasive shrub affects tolerance and resistance to defoliation by a biological control agent

    USGS Publications Warehouse

    Williams, Wyatt I.; Friedman, Jonathan M.; Gaskin, John F.; Norton, Andrew P.

    2014-01-01

    Evolution has contributed to the successful invasion of exotic plant species in their introduced ranges, but how evolution affects particular control strategies is still under evaluation. For instance, classical biological control, a common strategy involving the utilization of highly specific natural enemies to control exotic pests, may be negatively affected by host hybridization because of shifts in plant traits, such as root allocation or chemical constituents. We investigated introgression between two parent species of the invasive shrub tamarisk (Tamarix spp.) in the western United States, and how differences in plant traits affect interactions with a biological control agent. Introgression varied strongly with latitude of origin and was highly correlated with plant performance. Increased levels of T. ramosissima introgression resulted in both higher investment in roots and tolerance to defoliation and less resistance to insect attack. Because tamarisk hybridization occurs predictably on the western U.S. landscape, managers may be able to exploit this information to maximize control efforts. Genetic differentiation in plant traits in this system underpins the importance of plant hybridization and may explain why some biological control releases are more successful than others.

  11. Divergence of the yeast transcription factor FZF1 affects sulfite resistance.

    PubMed

    Engle, Elizabeth K; Fay, Justin C

    2012-01-01

    Changes in gene expression are commonly observed during evolution. However, the phenotypic consequences of expression divergence are frequently unknown and difficult to measure. Transcriptional regulators provide a mechanism by which phenotypic divergence can occur through multiple, coordinated changes in gene expression during development or in response to environmental changes. Yet, some changes in transcriptional regulators may be constrained by their pleiotropic effects on gene expression. Here, we use a genome-wide screen for promoters that are likely to have diverged in function and identify a yeast transcription factor, FZF1, that has evolved substantial differences in its ability to confer resistance to sulfites. Chimeric alleles from four Saccharomyces species show that divergence in FZF1 activity is due to changes in both its coding and upstream noncoding sequence. Between the two closest species, noncoding changes affect the expression of FZF1, whereas coding changes affect the expression of SSU1, a sulfite efflux pump activated by FZF1. Both coding and noncoding changes also affect the expression of many other genes. Our results show how divergence in the coding and promoter region of a transcription factor alters the response to an environmental stress.

  12. Regulatory Circuitry Governing Fungal Development, Drug Resistance, and Disease

    PubMed Central

    Shapiro, Rebecca S.; Robbins, Nicole; Cowen, Leah E.

    2011-01-01

    Summary: Pathogenic fungi have become a leading cause of human mortality due to the increasing frequency of fungal infections in immunocompromised populations and the limited armamentarium of clinically useful antifungal drugs. Candida albicans, Cryptococcus neoformans, and Aspergillus fumigatus are the leading causes of opportunistic fungal infections. In these diverse pathogenic fungi, complex signal transduction cascades are critical for sensing environmental changes and mediating appropriate cellular responses. For C. albicans, several environmental cues regulate a morphogenetic switch from yeast to filamentous growth, a reversible transition important for virulence. Many of the signaling cascades regulating morphogenesis are also required for cells to adapt and survive the cellular stresses imposed by antifungal drugs. Many of these signaling networks are conserved in C. neoformans and A. fumigatus, which undergo distinct morphogenetic programs during specific phases of their life cycles. Furthermore, the key mechanisms of fungal drug resistance, including alterations of the drug target, overexpression of drug efflux transporters, and alteration of cellular stress responses, are conserved between these species. This review focuses on the circuitry regulating fungal morphogenesis and drug resistance and the impact of these pathways on virulence. Although the three human-pathogenic fungi highlighted in this review are those most frequently encountered in the clinic, they represent a minute fraction of fungal diversity. Exploration of the conservation and divergence of core signal transduction pathways across C. albicans, C. neoformans, and A. fumigatus provides a foundation for the study of a broader diversity of pathogenic fungi and a platform for the development of new therapeutic strategies for fungal disease. PMID:21646428

  13. Two Different Transcripts of a LAMMER Kinase Gene Play Opposite Roles in Disease Resistance1[OPEN

    PubMed Central

    Xiao, Wenfei; Xia, Fan; Liu, Hongbo; Xiao, Jinghua

    2016-01-01

    Alternative splicing of genes can increase protein diversity and affect mRNA stability. Genome-wide transcriptome sequencing has demonstrated that alternative splicing occurs in a large number of intron-containing genes of different species. However, despite the phenomenon having been known for decades, it is largely unknown how the alternatively spliced transcripts function differently. Here, we report that two alternatively spliced transcripts of the rice (Oryza sativa) LAMMER kinase gene OsDR11, long OsDR11L and short OsDR11S, play opposite roles in rice resistance against Xanthomonas oryzae pv oryzae (Xoo), which causes the most damaging bacterial disease in rice worldwide. Overexpressing OsDR11S or suppressing OsDR11L in rice enhanced resistance to Xoo, which was accompanied by an accumulation of jasmonic acid (JA) and induced expression of JA signaling genes. In contrast, suppressing OsDR11S was associated with increased susceptibility to Xoo, along with decreased levels of JA and expression of JA signaling genes. The OsDR11S and OsDR11L proteins colocalized in the nucleus. OsDR11L showed autophosphorylation activity in vitro, while OsDR11S did not. In the presence of OsDR11S, autophosphorylation of OsDR11L was inhibited, and overexpression of OsDR11S suppressed OsDR11L expression. OsDR11 appeared to contribute to a minor quantitative trait locus against Xoo. These results suggest that OsDR11L is a negative regulator in rice disease resistance, which may be associated with suppression of JA signaling. The results also suggest that OsDR11S may inhibit the function of OsDR11L at both the transcription and protein kinase activity levels, leading to resistance against Xoo. PMID:27621422

  14. A New SNP Haplotype associated with blue disease resistance gene in cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to cotton blue disease (CBD) was evaluated in 364 F2.3 families of 3 populations derived from resistant variety ‘Delta Opal’. The CBD resistance in ‘Delta Opal’ was controlled by one single dominant gene designated Cbd. Two simple sequence repeat (SSR) markers were identified as linked t...

  15. Parameter on systemic conditions affected by periodontal diseases. American Academy of Periodontology.

    PubMed

    2000-05-01

    The American Academy of Periodontology has developed the following parameter on systemic conditions affected by periodontal diseases. It is well known that systemic conditions may affect the onset, progression, and treatment of such diseases (see Parameter on Periodontitis Associated With Systemic Conditions, pages 876-879). The concept of periodontal diseases as localized entities affecting only the teeth and supporting apparatus is increasingly being questioned. Periodontal diseases may have widespread systemic effects. While these effects may be limited in some individuals, periodontal infections may significantly impact systemic health in others, and may serve as risk indicators for certain systemic diseases or conditions. As part of the approach to establishing and maintaining health, patients should be informed of the possible effects of periodontal infection on their overall well-being. Given this information, patients should then be able to make informed decisions regarding their periodontal therapy.

  16. ENHANCED DISEASE SUSCEPTIBILITY 1 and SALICYLIC ACID act redundantly to regulate resistance gene-mediated signaling

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) protein–associated pathways are well known to participate in defense against a variety of microbial pathogens. Salicylic acid (SA) and its associated proteinaceous signaling components, including enhanced disease susceptibility 1 (EDS1), non–race-specific disease resistance 1 (NDR1), ...

  17. Isolation and genetic mapping of NBS-LRR disease resistance gene analogs in watermelon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sixty-six watermelon disease resistance gene analogs (WRGA) were isolated from genotypes possessing disease resistance to fusarium oxysporum f. sp. niveum races 0, 1, and 2, zucchini yellow mosaic virus, papaya ringspot virus watermelon strain, cucumber mosaic virus, and watermelon mosaic virus. Deg...

  18. Evaluating Progeny of Glycine max by Glycine tomentella for Novel Disease Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hybridization with wild relatives of crops is an important tool for improving traits such as disease resistance and our objective is to expand the use of wild relatives for disease resistance in soybean. Glycine tomentella (2n=78) is a wild, perennial species in the tertiary gene pool of soybean (G....

  19. Characterization of partial resistance to black spot disease of Rosa spp.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Black spot disease (BSD) is one of the most serious diseases of garden roses. Both complete (vertical) resistance and partial (horizontal) resistance have been identified in 16 rose genotypes using two laboratory assays, the detached leaf assay (DLA) and the whole plant inoculation (WPI) approaches...

  20. Development of disease-resistant rice by optimized expression of WRKY45.

    PubMed

    Goto, Shingo; Sasakura-Shimoda, Fuyuko; Suetsugu, Mai; Selvaraj, Michael Gomez; Hayashi, Nagao; Yamazaki, Muneo; Ishitani, Manabu; Shimono, Masaki; Sugano, Shoji; Matsushita, Akane; Tanabata, Takanari; Takatsuji, Hiroshi

    2015-08-01

    The rice transcription factor WRKY45 plays a central role in the salicylic acid signalling pathway and mediates chemical-induced resistance to multiple pathogens, including Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae. Previously, we reported that rice transformants overexpressing WRKY45 driven by the maize ubiquitin promoter were strongly resistant to both pathogens; however, their growth and yield were negatively affected because of the trade-off between the two conflicting traits. Also, some unknown environmental factor(s) exacerbated this problem. Here, we report the development of transgenic rice lines resistant to both pathogens and with agronomic traits almost comparable to those of wild-type rice. This was achieved by optimizing the promoter driving WRKY45 expression. We isolated 16 constitutive promoters from rice genomic DNA and tested their ability to drive WRKY45 expression. Comparisons among different transformant lines showed that, overall, the strength of WRKY45 expression was positively correlated with disease resistance and negatively correlated with agronomic traits. We conducted field trials to evaluate the growth of transgenic and control lines. The agronomic traits of two lines expressing WRKY45 driven by the OsUbi7 promoter (PO sUbi7 lines) were nearly comparable to those of untransformed rice, and both lines were pathogen resistant. Interestingly, excessive WRKY45 expression rendered rice plants sensitive to low temperature and salinity, and stress sensitivity was correlated with the induction of defence genes by these stresses. These negative effects were barely observed in the PO sUbi7 lines. Moreover, their patterns of defence gene expression were similar to those in plants primed by chemical defence inducers.

  1. Factors Affecting Comparative Resistance of Naturally Occurring and Subcultured Pseudomonas aeruginosa to Disinfectants

    PubMed Central

    Carson, L. A.; Favero, M. S.; Bond, W. W.; Petersen, N. J.

    1972-01-01

    A strain of Pseudomonas aeruginosa was isolated in pure culture from the reservoir of a hospital mist therapy unit by an extinction-dilution technique; its natural distilled water environment was used as a growth and maintenance medium. After a single subculture on Trypticase soy agar, the strain showed a marked decrease in resistance to inactivation by acetic acid, glutaraldehyde, chlorine dioxide, and a quaternary ammonium compound when compared with naturally occurring cells grown in mist therapy unit water. The following factors were observed to affect the relative resistances of naturally occurring and subcultured cells of the P. aeruginosa strain: (i) temperature at which the cultures were incubated prior to exposure to disinfectants, (ii) growth phase of the cultures at the time of exposure to disinfectants, (iii) nature of the suspending menstruum for disinfectants, and (iv) exposure to fluorescent light during incubation of inocula prior to testing. The applied significance of these findings may alter the present concepts of disinfectant testing as well as routine control procedures in the hospital environment. PMID:4624209

  2. Diclofop-methyl affects microbial rhizosphere community and induces systemic acquired resistance in rice.

    PubMed

    Chen, Si; Li, Xingxing; Lavoie, Michel; Jin, Yujian; Xu, Jiahui; Fu, Zhengwei; Qian, Haifeng

    2017-01-01

    Diclofop-methyl (DM), a widely used herbicide in food crops, may partly contaminate the soil surface of natural ecosystems in agricultural area and exert toxic effects at low dose to nontarget plants. Even though rhizosphere microorganisms strongly interact with root cells, little is known regarding their potential modulating effect on herbicide toxicity in plants. Here we exposed rice seedlings (Xiushui 63) to 100μg/L DM for 2 to 8days and studied the effects of DM on rice rhizosphere microorganisms, rice systemic acquired resistance (SAR) and rice-microorganisms interactions. The results of metagenomic 16S rDNA Illumina tags show that DM increases bacterial biomass and affects their community structure in the rice rhizosphere. After DM treatment, the relative abundance of the bacterium genera Massilia and Anderseniella increased the most relative to the control. In parallel, malate and oxalate exudation by rice roots increased, potentially acting as a carbon source for several rhizosphere bacteria. Transcriptomic analyses suggest that DM induced SAR in rice seedlings through the salicylic acid (but not the jasmonic acid) signal pathway. This response to DM stress conferred resistance to infection by a pathogenic bacterium, but was not influenced by the presence of bacteria in the rhizosphere since SAR transcripts did not change significantly in xenic and axenic plant roots exposed to DM. The present study provides new insights on the response of rice and its associated microorganisms to DM stress.

  3. Inheritance of Pigeonpea Sterility Mosaic Disease Resistance in Pigeonpea

    PubMed Central

    Daspute, Abhijit; Fakrudin, B.; Bhairappanavar, Shivarudrappa. B.; Kavil, S. P.; Narayana, Y. D.; Muniswamy; Kaumar, Anil; Krishnaraj, P. U.; Yerimani, Abid; Khadi, B. M.

    2014-01-01

    A comprehensive study was conducted using PPSMV resistant (BSMR 736) and susceptible (ICP 8863) genotypes to develop a segregating population and understand the inheritance of PPSMV resistance. The observed segregation was comparable to 13 (susceptible): 3 (resistant). Hence, the inheritance was controlled by two genes, SV1 and SV2, with inhibitory gene interaction. PMID:25289002

  4. Decision Aids for Multiple-Decision Disease Management as Affected by Weather Input Errors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many disease management decision support systems (DSS) rely, exclusively or in part, on weather inputs to calculate an indicator for disease hazard. Error in the weather inputs, typically due to forecasting, interpolation or estimation from off-site sources, may affect model calculations and manage...

  5. Interfering TAL effectors of Xanthomonas oryzae neutralize R-gene-mediated plant disease resistance

    PubMed Central

    Ji, Zhiyuan; Ji, Chonghui; Liu, Bo; Zou, Lifang; Chen, Gongyou; Yang, Bing

    2016-01-01

    Plant pathogenic bacteria of the genus Xanthomonas possess transcription activator-like effectors (TALEs) that activate transcription of disease susceptibility genes in the host, inducing a state of disease. Here we report that some isolates of the rice pathogen Xanthomonas oryzae use truncated versions of TALEs (which we term interfering TALEs, or iTALEs) to overcome disease resistance. In comparison with typical TALEs, iTALEs lack a transcription activation domain but retain nuclear localization motifs and are expressed from genes that were previously considered pseudogenes. We show that the rice gene Xa1, encoding a nucleotide-binding leucine-rich repeat protein, confers resistance against X. oryzae isolates by recognizing multiple TALEs. However, the iTALEs present in many isolates interfere with the otherwise broad-spectrum resistance conferred by Xa1. Our findings illustrate how bacterial effectors that trigger disease resistance in the host can evolve to interfere with the resistance process and, thus, promote disease. PMID:27811915

  6. QTL Analysis for Resistance to Blast Disease in U.S. Weedy Rice.

    PubMed

    Liu, Yan; Qi, Xinshuai; Gealy, Dave R; Olsen, Kenneth M; Caicedo, Ana L; Jia, Yulin

    2015-07-01

    Understanding the genetic architecture of adaptation is of great importance in evolutionary biology. U.S. weedy rice is well adapted to the local conditions in U.S. rice fields. Rice blast disease is one of the most destructive diseases of cultivated rice worldwide. However, information about resistance to blast in weedy rice is limited. Here, we evaluated the disease reactions of 60 U.S. weedy rice accessions with 14 blast races, and investigated the quantitative trait loci (QTL) associated with blast resistance in two major ecotypes of U.S. weedy rice. Our results revealed that U.S. weedy rice exhibited a broad resistance spectrum. Using genotyping by sequencing, we identified 28 resistance QTL in two U.S. weedy rice ecotypes. The resistance QTL with relatively large and small effects suggest that U.S. weedy rice groups have adapted to blast disease using two methods, both major resistance (R) genes and QTL. Three genomic loci shared by some of the resistance QTL indicated that these loci may contribute to no-race-specific resistance in weedy rice. Comparing with known blast disease R genes, we found that the R genes at these resistance QTL are novel, suggesting that U.S. weedy rice is a potential source of novel blast R genes for resistant breeding.

  7. A Phytophthora sojae cytoplasmic effector mediates disease resistance and abiotic stress tolerance in Nicotiana benthamiana.

    PubMed

    Zhang, Meixiang; Ahmed Rajput, Nasir; Shen, Danyu; Sun, Peng; Zeng, Wentao; Liu, Tingli; Juma Mafurah, Joseph; Dou, Daolong

    2015-06-03

    Each oomycete pathogen encodes a large number of effectors. Some effectors can be used in crop disease resistance breeding, such as to accelerate R gene cloning and utilisation. Since cytoplasmic effectors may cause acute physiological changes in host cells at very low concentrations, we assume that some of these effectors can serve as functional genes for transgenic plants. Here, we generated transgenic Nicotiana benthamiana plants that express a Phytophthora sojae CRN (crinkling and necrosis) effector, PsCRN115. We showed that its expression did not significantly affect the growth and development of N. benthamiana, but significantly improved disease resistance and tolerance to salt and drought stresses. Furthermore, we found that expression of heat-shock-protein and cytochrome-P450 encoding genes were unregulated in PsCRN115-transgenic N. benthamiana based on digital gene expression profiling analyses, suggesting the increased plant defence may be achieved by upregulation of these stress-related genes in transgenic plants. Thus, PsCRN115 may be used to improve plant tolerance to biotic and abiotic stresses.

  8. Risk assessment for the harmful effects of UVB radiation on the immunological resistance to infectious diseases.

    PubMed Central

    Goettsch, W; Garssen, J; Slob, W; de Gruijl, F R; Van Loveren, H

    1998-01-01

    Risk assessment comprises four steps: hazard identification, dose-response assessment, exposure assessment, and risk characterization. In this study, the effects of increased ultraviolet B(UVB, 280-315 nm) radiation on immune functions and the immunological resistance to infectious diseases in rats were analyzed according to this strategy. In a parallelogram approach, nonthreshold mathematical methods were used to estimate the risk for the human population after increased exposure to UVB radiation. These data demonstrate, using a worst-case strategy (sensitive individuals, no adaptation), that exposure for approximately 90 min (local noon) at 40 degrees N in July might lead to 50% suppression of specific T-cell mediated responses to Listeria monocytogenes in humans who were not preexposed to UVB (i.e., not adapted). Additionally, a 5% decrease in the thickness of the ozone layer might shorten this exposure time by approximately 2.5%. These data demonstrate that UVB radiation, at doses relevant to outdoor exposure, may affect the specific cellular immune response to Listeria bacteria in humans. Whether this will also lead to a lowered resistance (i.e.,increased pathogenic load) in humans is not known, although it was demonstrated that UVB-induced immunosuppression in rats was sufficient to increase the pathogenic load. Epidemiology studies are needed to validate and improve estimates for the potential effects of increased UVB exposure on infectious diseases in humans. Images Figure 1 Figure 2 PMID:9435148

  9. Factors Affecting the Hydrogen Environment Assisted Cracking Resistance of an Al-Zn-Mg-(Cu) Alloy

    SciTech Connect

    G.A. Young; J.R. Scully

    2001-09-12

    It is well established that Al-Zn-Mg-(Cu) aluminum alloys are susceptible to hydrogen environment assisted cracking (HEAC) when exposed to aqueous environments. In Al-Zn-Mg-Cu alloys, overaged tempers are commonly used to increase HEAC resistance at the expense of strength. Overaging has little benefit in low copper alloys. However, the mechanism or mechanisms by which overaging imparts HEAC resistance is poorly understood. The present research investigated hydrogen uptake, diffusion, and crack growth rate in 90% relative humidity (RH) air for both a commercial copper bearing Al-Zn-Mg-Cu alloy (AA 7050) and a low copper variant of this alloy in order to better understand the factors which affect HEAC resistance. Experimental methods used to evaluate hydrogen concentrations local to a surface and near a crack tip include nuclear reaction analysis (NRA), focused ion beam, secondary ion mass spectroscopy (FIB/SIMS) and thermal desorption spectroscopy (TDS). When freshly bared coupons of AA 7050 are exposed to 90 C, 90% RH air, hydrogen ingress follows inverse-logarithmic-type kinetics and is equivalent for underaged (HEAC susceptible) and overaged (HEAC resistant) tempers. However, when the native oxide is allowed to form (24 hrs in 25 C, 40% RH lab air) prior to exposure to 90 C, 90% RH air, underaged alloy shows significantly greater hydrogen ingress than the overaged alloy. Humid air is a very aggressive environment producing local ({approx}1{micro}m) hydrogen concentrations in excess of 10,000 wt. ppm at 90 C. In the copper bearing alloy, overaging also effects the apparent diffusivity of hydrogen. As AA 7050 is aged from underaged {yields} peak aged {yields} overaged, the activation energy for hydrogen diffusion increases and the apparent diffusivity for hydrogen decreases, In the low copper alloy, overaging has little effect on hydrogen diffusion. Comparison of the apparent activation energies for hydrogen diffusion and for K independent (stage II) crack growth

  10. Development of EST-SSR markers related to disease resistance and their application in genetic diversity and evolution analysis in Gossypium.

    PubMed

    Wang, B H; Rong, P; Cai, X X; Wang, W; Zhu, X Y; Chen, C J; Xu, Y Y; Huang, X J; Zhuang, Z M; Wang, C B

    2015-09-09

    Cotton (Gossypium spp) is one of the most economically important crops that provide the world's most widely used natural fiber. Diseases such as Fusarium wilt and particularly Verticillium wilt seriously affect cotton production, and thus breeding for disease resistance is one of the most important goals of cotton breeding programs. Currently, potential exists to improve disease resistance in cultivated cotton. Increasing the understanding of the distribution, structure, and organization of genes or quantitative trait loci for disease resistance will help the breeders improve crop yield even in the event of disease. To facilitate the mapping of disease-resistance quantitative trait loci to achieve disease-resistant molecular breeding in cotton, it is necessary to develop polymorphic molecular markers. The objective of this study was to develop simple sequence repeat markers based on cotton expressed sequence tags for disease resistance. The efficacy of these simple sequence repeat markers, their polymorphisms, and cross-species transferability were evaluated. Their value was further investigated based on genetic diversity and evolution analysis. In this study, the unique sequences used to develop markers were compared with the G. arboretum and G. raimondii genome sequences to investigate their position, homology, and collinearity between G. arboretum and G. raimondii.

  11. Evolution of insulin resistance in coronary artery disease patients on four different pharmacological therapies

    PubMed Central

    Piedrola, G.; Novo, E.; Serrano-Gotarredo..., J.; de Teresa, M. L.; Garcia-Robles, R.

    1999-01-01

    The objective of the study was to examine the evolution of insulin sensitivity in a group of patients with stable coronary artery disease receiving one of four different pharmacological therapies. Insulin sensitivity was evaluated using an insulin suppression test in 40 newly diagnosed patients with coronary artery disease and no previous history of metabolic disorders, who were not taking any medication which might affect insulin sensitivity. The insulin suppression test consisted of a constant infusion of glucose, insulin and somatostatin for 150 min; insulin resistance was estimated by determining the steady-state plasma glucose concentrations during the last 60 minutes of the test. The insulin sensitivity index was calculated by the formula: insulin sensitivity index = (glucose infusion rate/steady state plasma glucose concentrations) × 103. A second insulin suppression test was performed after 6 months' therapy with either isosorbide mononitrate, atenolol, diltiazem or captopril in 30 of the 40 patients.
  There were no differences between any of the groups before therapy was initiated. After 6 months, patients treated with captopril and, to a lesser extent, those treated with diltiazem showed statistically significantly decreased steady state plasma glucose concentrations and increased insulin sensitivity index compared to basal values. No statistically significant differences were found in the other two groups. We conclude that captopril and, to a lesser extent, diltiazem improve insulin sensitivity in patients with stable coronary artery disease.


Keywords: insulin resistance; coronary artery disease; captopril; diltiazem PMID:10396583

  12. Exercise Type Affects Cardiac Vagal Autonomic Recovery After a Resistance Training Session.

    PubMed

    Mayo, Xián; Iglesias-Soler, Eliseo; Fariñas-Rodríguez, Juán; Fernández-Del-Olmo, Miguel; Kingsley, J Derek

    2016-09-01

    Mayo, X, Iglesias-Soler, E, Fariñas-Rodríguez, J, Fernández-del-Olmo, M, and Kingsley, JD. Exercise type affects cardiac vagal autonomic recovery after a resistance training session. J Strength Cond Res 30(9): 2565-2573, 2016-Resistance training sessions involving different exercises and set configurations may affect the acute cardiovascular recovery pattern. We explored the interaction between exercise type and set configuration on the postexercise cardiovagal withdrawal measured by heart rate variability and their hypotensive effect. Thirteen healthy participants (10 repetitions maximum [RM] bench press: 56 ± 10 kg; parallel squat: 91 ± 13 kg) performed 6 sessions corresponding to 2 exercises (Bench press vs. Parallel squat), 2 set configurations (Failure session vs. Interrepetition rest session), and a Control session of each exercise. Load (10RM), volume (5 sets), and rest (720 seconds) were equated between exercises and set configurations. Parallel squat produced higher reductions in cardiovagal recovery vs. Bench press (p = 0.001). These differences were dependent on the set configuration, with lower values in Parallel squat vs. Bench press for Interrepetition rest session (1.816 ± 0.711 vs. 2.399 ± 0.739 Ln HF/IRR × 10, p = 0.002), but not for Failure session (1.647 ± 0.904 vs. 1.808 ± 0.703 Ln HF/IRR × 10, p > 0.05). Set configuration affected the cardiovagal recovery, with lower values in Failure session in comparison with Interrepetition rest (p = 0.027) and Control session (p = 0.022). Postexercise hypotension was not dependent on the exercise type (p > 0.05) but was dependent on the set configuration, with lower values of systolic (p = 0.004) and diastolic (p = 0.011) blood pressure after the Failure session but not after an Interrepetition rest session in comparison with the Control session (p > 0.05). These results suggest that the exercise type and an Interrepetition rest design could blunt the decrease of cardiac vagal activity after

  13. Microgeodic Disease Affecting the Fingers and Toes in Childhood: A Case Report

    PubMed Central

    Tetsunaga, Tomonori; Endo, Hirosuke; Fujiwara, Kazuo; Tetsunaga, Tomoko; Ozaki, Toshifumi

    2016-01-01

    Microgeodic disease is a disease of unknown etiology that affects the fingers and toes of children, with ≥ 90% of cases involving the fingers alone. We present a rare case of microgeodic disease affecting an index finger and two toes simultaneously in a 7-year-old girl. X-ray and magnetic resonance imaging (MRI) showed multiple small areas of osteolysis in the middle phalanges of the left index finger, hallux, and second toe. Microgeodic disease was diagnosed from X-ray and MRI findings, and conservative therapy involving rest and avoidance of cold stimuli was provided. Although pathological fractures occurred in the course of conservative treatment, the affected finger healed under splinting without any deformity of the finger. PMID:27843512

  14. Life-history strategy defends against disease and may select against physiological resistance

    PubMed Central

    Gibson, Amanda K; Petit, Elsa; Mena-Ali, Jorge; Oxelman, Bengt; Hood, Michael E

    2013-01-01

    Host ecological traits may limit exposure to infectious disease, thereby generating the wide variation in disease incidence observed between host populations or species. The exclusion of disease by ecological traits may then allow selection to act against physiological defenses when they are costly to maintain in the absence of disease. This study investigates ecological resistance in the Silene-Microbotryum pathosystem. An estimated 80% of perennial Silene species host the anther-smut disease while no annuals harbor the disease in nature. Artificial inoculations of annual and perennial Silene plants, obtained from both natural and horticultural populations, demonstrate that the absence of disease in annuals is not explained by elevated physiological resistance. The annual habit is thus a powerful form of ecological defense against anther smut. Moreover, the higher susceptibility of annual species to anther smut relative to perennials supports the hypothesis of a loss of costly physiological resistance under ecological protection. The observation in annuals that physiological susceptibility is correlated with lower rates of flowering (i.e., lower fitness) suggests that variation in physiological resistance is costly in the absence of disease, even in a naїve Silene species. The absence of disease in natural populations of annuals combined with their high physiological susceptibility attest to the strength of host ecology in shaping the distribution of disease and to the dynamic nature of disease resistance. PMID:23789082

  15. Combining Selective Pressures to Enhance the Durability of Disease Resistance Genes

    PubMed Central

    Bourguet, Denis

    2016-01-01

    The efficacy of disease resistance genes in plants decreases over time because of the selection of virulent pathogen genotypes. A key goal of crop protection programs is to increase the durability of the resistance conferred by these genes. The spatial and temporal deployment of plant disease resistance genes is considered to be a major factor determining their durability. In the literature, four principal strategies combining resistance genes over time and space have been considered to delay the evolution of virulent pathogen genotypes. We reviewed this literature with the aim of determining which deployment strategy results in the greatest durability of resistance genes. Although theoretical and empirical studies comparing deployment strategies of more than one resistance gene are very scarce, they suggest that the overall durability of disease resistance genes can be increased by combining their presence in the same plant (pyramiding). Retrospective analyses of field monitoring data also suggest that the pyramiding of disease resistance genes within a plant is the most durable strategy. By extension, we suggest that the combination of disease resistance genes with other practices for pathogen control (pesticides, farming practices) may be a relevant management strategy to slow down the evolution of virulent pathogen genotypes. PMID:28066472

  16. [McArdle disease or glycogen storage disease type v: Should it affect anaesthetic management?].

    PubMed

    Ayerza-Casas, V; Ferreira-Laso, L; Alloza-Fortun, M C; Fraile-Jimenez, A E

    2015-02-01

    McArdle disease is a metabolic myopathy that can may lead to severe perioperative problems. A case is reported of a woman with a history of McArdle disease, who was scheduled for a mastectomy. An understanding of the physiology and pathology, and the application of appropriate preventive measures can avoid complications. A overview of the complications and the management are described.

  17. Evaluation of chronic kidney disease in chronic heart failure: From biomarkers to arterial renal resistances

    PubMed Central

    Iacoviello, Massimo; Leone, Marta; Antoncecchi, Valeria; Ciccone, Marco Matteo

    2015-01-01

    Chronic kidney disease and its worsening are recurring conditions in chronic heart failure (CHF) which are independently associated with poor patient outcome. The heart and kidney share many pathophysiological mechanisms which can determine dysfunction in each organ. Cardiorenal syndrome is the condition in which these two organs negatively affect each other, therefore an accurate evaluation of renal function in the clinical setting of CHF is essential. This review aims to revise the parameters currently used to evaluate renal dysfunction in CHF with particular reference to the usefulness and the limitations of biomarkers in evaluating glomerular dysfunction and tubular damage. Moreover, it is reported the possible utility of renal arterial resistance index (a parameter associated with abnormalities in renal vascular bed) for a better assesment of kidney disfunction. PMID:25610846

  18. Plant-pathogen interactions: toward development of next-generation disease-resistant plants.

    PubMed

    Nejat, Naghmeh; Rookes, James; Mantri, Nitin L; Cahill, David M

    2017-03-01

    Briskly evolving phytopathogens are dire threats to our food supplies and threaten global food security. From the recent advances made toward high-throughput sequencing technologies, understanding of pathogenesis and effector biology, and plant innate immunity, translation of these means into new control tools is being introduced to develop durable disease resistance. Effectoromics as a powerful genetic tool for uncovering effector-target genes, both susceptibility genes and executor resistance genes in effector-assisted breeding, open up new avenues to improve resistance. TALENs (Transcription Activator-Like Effector Nucleases), engineered nucleases and CRISPR (Clustered Regulatory Interspaced Short Palindromic Repeats)/Cas9 systems are breakthrough and powerful techniques for genome editing, providing efficient mechanisms for targeted crop protection strategies in disease resistance programs. In this review, major advances in plant disease management to confer durable disease resistance and novel strategies for boosting plant innate immunity are highlighted.

  19. Host mating system and the spread of a disease-resistant allele in a population

    USGS Publications Warehouse

    DeAngelis, D.L.; Koslow, Jennifer M.; Jiang, J.; Ruan, S.

    2008-01-01

    The model presented here modifies a susceptible-infected (SI) host-pathogen model to determine the influence of mating system on the outcome of a host-pathogen interaction. Both deterministic and stochastic (individual-based) versions of the model were used. This model considers the potential consequences of varying mating systems on the rate of spread of both the pathogen and resistance alleles within the population. We assumed that a single allele for disease resistance was sufficient to confer complete resistance in an individual, and that both homozygote and heterozygote resistant individuals had the same mean birth and death rates. When disease invaded a population with only an initial small fraction of resistant genes, inbreeding (selfing) tended to increase the probability that the disease would soon be eliminated from a small population rather than become endemic, while outcrossing greatly increased the probability that the population would become extinct due to the disease.

  20. Why is antibiotic resistance a deadly emerging disease?

    PubMed

    Courvalin, P

    2016-05-01

    Evolution of bacteria towards resistance to antimicrobial agents, including multidrug resistance, is unavoidable because it represents a particular aspect of the general evolution of bacteria that is unstoppable. Therefore, the only means of dealing with this situation is to delay the emergence and subsequent dissemination of resistant bacteria or resistance genes. In this review, we will consider the biochemical mechanisms and the genetics that bacteria use to offset antibiotic selective pressure. The data provided are mainly, if not exclusively, taken from the work carried out in the laboratory, although there are numerous other examples in the literature.

  1. Toughing It Out--Disease-Resistant Potato Mutants Have Enhanced Tuber Skin Defenses.

    PubMed

    Thangavel, Tamilarasan; Tegg, Robert S; Wilson, Calum R

    2016-05-01

    Common scab, a globally important potato disease, is caused by infection of tubers with pathogenic Streptomyces spp. Previously, disease-resistant potato somaclones were obtained through cell selections against the pathogen's toxin, known to be essential for disease. Further testing revealed that these clones had broad-spectrum resistance to diverse tuber-invading pathogens, and that resistance was restricted to tuber tissues. The mechanism of enhanced disease resistance was not known. Tuber periderm tissues from disease-resistant clones and their susceptible parent were examined histologically following challenge with the pathogen and its purified toxin. Relative expression of genes associated with tuber suberin biosynthesis and innate defense pathways within these tissues were also examined. The disease-resistant somaclones reacted to both pathogen and toxin by producing more phellem cell layers in the tuber periderm, and accumulating greater suberin polyphenols in these tissues. Furthermore, they had greater expression of genes associated with suberin biosynthesis. In contrast, signaling genes associated with innate defense responses were not differentially expressed between resistant and susceptible clones. The resistance phenotype is due to induction of increased periderm cell layers and suberization of the tuber periderm preventing infection. The somaclones provide a valuable resource for further examination of suberization responses and its genetic control.

  2. Paleo-evolutionary plasticity of plant disease resistance genes

    PubMed Central

    2014-01-01

    Background The recent access to a large set of genome sequences, combined with a robust evolutionary scenario of modern monocot (i.e. grasses) and eudicot (i.e. rosids) species from their founder ancestors, offered the opportunity to gain insights into disease resistance genes (R-genes) evolutionary plasticity. Results We unravel in the current article (i) a R-genes repertoire consisting in 7883 for monocots and 15758 for eudicots, (ii) a contrasted R-genes conservation with 23.8% for monocots and 6.6% for dicots, (iii) a minimal ancestral founder pool of 384 R-genes for the monocots and 150 R-genes for the eudicots, (iv) a general pattern of organization in clusters accounting for more than 60% of mapped R-genes, (v) a biased deletion of ancestral duplicated R-genes between paralogous blocks possibly compensated by clusterization, (vi) a bias in R-genes clusterization where Leucine-Rich Repeats act as a ‘glue’ for domain association, (vii) a R-genes/miRNAs interome enriched toward duplicated R-genes. Conclusions Together, our data may suggest that R-genes family plasticity operated during plant evolution (i) at the structural level through massive duplicates loss counterbalanced by massive clusterization following polyploidization; as well as at (ii) the regulation level through microRNA/R-gene interactions acting as a possible source of functional diploidization of structurally retained R-genes duplicates. Such evolutionary shuffling events leaded to CNVs (i.e. Copy Number Variation) and PAVs (i.e. Presence Absence Variation) between related species operating in the decay of R-genes colinearity between plant species. PMID:24617999

  3. Butyrate upregulates endogenous host defense peptides to enhance disease resistance in piglets via histone deacetylase inhibition

    PubMed Central

    Xiong, Haitao; Guo, Bingxiu; Gan, Zhenshun; Song, Deguang; Lu, Zeqing; Yi, Hongbo; Wu, Yueming; Wang, Yizhen; Du, Huahua

    2016-01-01

    Butyrate has been used to treat different inflammatory disease with positive outcomes, the mechanisms by which butyrate exerts its anti-inflammatory effects remain largely undefined. Here we proposed a new mechanism that butyrate manipulate endogenous host defense peptides (HDPs) which contributes to the elimination of Escherichia coli O157:H7, and thus affects the alleviation of inflammation. An experiment in piglets treated with butyrate (0.2% of diets) 2 days before E. coli O157:H7 challenge was designed to investigate porcine HDP expression, inflammation and E. coli O157:H7 load in feces. The mechanisms underlying butyrate-induced HDP gene expression and the antibacterial activity and bacterial clearance of macrophage 3D4/2 cells in vitro were examined. Butyrate treatment (i) alleviated the clinical symptoms of E. coli O157:H7-induced hemolytic uremic syndrome (HUS) and the severity of intestinal inflammation; (ii) reduced the E. coli O157:H7 load in feces; (iii) significantly upregulated multiple, but not all, HDPs in vitro and in vivo via histone deacetylase (HDAC) inhibition; and (iv) enhanced the antibacterial activity and bacterial clearance of 3D4/2 cells. Our findings indicate that butyrate enhances disease resistance, promotes the clearance of E. coli O157:H7, and alleviates the clinical symptoms of HUS and inflammation, partially, by affecting HDP expression via HDAC inhibition. PMID:27230284

  4. Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens

    PubMed Central

    Ederli, Luisa; Dawe, Adam; Pasqualini, Stefania; Quaglia, Mara; Xiong, Liming; Gehring, Chris

    2015-01-01

    We investigated whether the Arabidopsis flower evolved protective measures to increase reproductive success. Firstly, analyses of available transcriptome data show that the most highly expressed transcripts in the closed sepal (stage 12) are enriched in genes with roles in responses to chemical stimuli and cellular metabolic processes. At stage 15, there is enrichment in transcripts with a role in responses to biotic stimuli. Comparative analyses between the sepal and petal in the open flower mark an over-representation of transcripts with a role in responses to stress and catalytic activity. Secondly, the content of the biotic defense-associated phytohormone salicylic acid (SA) in sepals and petals is significantly higher than in leaves. To understand whether the high levels of stress responsive transcripts and the higher SA content affect defense, wild-type plants (Col-0) and transgenic plants defective in SA accumulation (nahG) were challenged with the biotrophic fungus Golovinomyces cichoracearum, the causal agent of powdery mildew, and the necrotrophic fungus Botrytis cinerea. NahG leaves were more sensitive than those of Col-0, suggesting that in leaves SA has a role in the defense against biotrophs. In contrast, sepals and petals of both genotypes were resistant to G. cichoracearum, indicating that in the flower, resistance to the biotrophic pathogen is not critically dependent on SA, but likely dependent on the up-regulation of stress-responsive genes. Since sepals and petals of both genotypes are equally susceptible to B. cinerea, we conclude that neither stress-response genes nor increased SA accumulation offers protection against the necrotrophic pathogen. These results are interpreted in the light of the distinctive role of the flower and we propose that in the early stages, the sepal may act as a chemical defense barrier of the developing reproductive structures against biotrophic pathogens. PMID:25750645

  5. Identification of positive and negative regulators of disease resistance to rice blast fungus using constitutive gene expression patterns.

    PubMed

    Grand, Xavier; Espinoza, Rocio; Michel, Corinne; Cros, Sandrine; Chalvon, Véronique; Jacobs, John; Morel, Jean-Benoit

    2012-09-01

    Elevated constitutive expression of components of the defence arsenal is associated with quantitative resistance to the rice blast fungus, a phenomenon called preformed defence. While the role of many disease regulators in inducible defence systems has been extensively studied, little attention has been paid so far to genes that regulate preformed defence. In this study, we show by microarray analysis across rice diversity that the preformed defence phenomenon impacts on a large number of defence-related genes without apparently affecting other biological processes. Using a guilt-by-association strategy, we identified two positive regulators that promote constitutive expression of known defence markers and partial resistance to rice blast. The HSF23 gene encodes for a putative member of the heat shock transcription factor family, while CaMBP encodes for a putative Calmodulin-binding protein. Both HSF23 and CaMBP strongly affect preformed defence and also plant growth. Additionally, we identified the OB-fold gene as a negative regulator of blast resistance, which could be involved in RNA stabilization. The OB-fold mutants do not suffer from obvious developmental defects. Taken together, our results prove that our strategy of combining analysis of gene expression diversity with guilt-by-association is a powerful way to identify disease resistance regulators in rice.

  6. Vitamin D status and resistance exercise training independently affect glucose tolerance in older adults.

    PubMed

    Kobza, Vanessa M; Fleet, James C; Zhou, Jing; Conley, Travis B; Peacock, Munro; IglayReger, Heidi B; DePalma, Glen; Campbell, Wayne W

    2013-05-01

    We assessed the influence of serum 25-hydroxyvitamin D (25[OH]D) and parathyroid hormone (PTH) concentrations on oral glucose tolerance, body composition, and muscle strength in older, nondiabetic adults who performed resistance exercise training (RT) while consuming diets with either 0.9 or 1.2 g protein kg(-1) d(-1). We hypothesized that individuals with insufficient 25(OH)D and/or high PTH would have less improvement in glucose tolerance after 12 weeks of RT compared with individuals with sufficient 25(OH)D and lower PTH. Sixteen men and 19 women (aged 61 ± 8 years; range, 50-80 years; body mass index, 26.3 ± 3.6 kg/m(2)) performed RT 3 times/wk for 12 weeks, with oral glucose tolerance tests done at baseline and postintervention. Protein intake did not influence the responses described below. Plasma glucose area under the curve (P = .02) and 2-hour plasma glucose concentration (P = .03) were higher for vitamin D-insufficient subjects (25[OH]D <50 nmol/L, n = 7) vs vitamin D-sufficient subjects (25[OH]D ≥50 nmol/L, n = 28). These differences remained significant after adjustment for age and body mass index. Resistance exercise training reduced fat mass (mean ± SD, -6% ± 7%; P < .001) and increased lean body mass (2% ± 3%, P < .001) and whole-body muscle strength (32% ± 17%, P < .001) in these weight-stable subjects but did not affect 25(OH)D or PTH concentrations. Oral glucose tolerance improved after RT (-10% ± 16% in glucose area under the curve and -21% ± 40% in 2-hour glucose, P = .001), but baseline 25(OH)D and PTH did not influence these RT-induced changes. These findings indicate that vitamin D status and RT independently affect glucose tolerance, and a training-induced improvement in glucose tolerance does not offset the negative effect of insufficient vitamin D status in older, nondiabetic adults.

  7. Overexpression of BSR1 confers broad-spectrum resistance against two bacterial diseases and two major fungal diseases in rice

    PubMed Central

    Maeda, Satoru; Hayashi, Nagao; Sasaya, Takahide; Mori, Masaki

    2016-01-01

    Broad-spectrum disease resistance against two or more types of pathogen species is desirable for crop improvement. In rice, Xanthomonas oryzae pv. oryzae (Xoo), the causal bacteria of rice leaf blight, and Magnaporthe oryzae, the fungal pathogen causing rice blast, are two of the most devastating pathogens. We identified the rice BROAD-SPECTRUM RESISTANCE 1 (BSR1) gene for a BIK1-like receptor-like cytoplasmic kinase using the FOX hunting system, and demonstrated that BSR1-overexpressing (OX) rice showed strong resistance to the bacterial pathogen, Xoo and the fungal pathogen, M. oryzae. Here, we report that BSR1-OX rice showed extended resistance against two other different races of Xoo, and to at least one other race of M. oryzae. In addition, the rice showed resistance to another bacterial species, Burkholderia glumae, which causes bacterial seedling rot and bacterial grain rot, and to Cochliobolus miyabeanus, another fungal species causing brown spot. Furthermore, BSR1-OX rice showed slight resistance to rice stripe disease, a major viral disease caused by rice stripe virus. Thus, we demonstrated that BSR1-OX rice shows remarkable broad-spectrum resistance to at least two major bacterial species and two major fungal species, and slight resistance to one viral pathogen. PMID:27436950

  8. Overexpression of BSR1 confers broad-spectrum resistance against two bacterial diseases and two major fungal diseases in rice.

    PubMed

    Maeda, Satoru; Hayashi, Nagao; Sasaya, Takahide; Mori, Masaki

    2016-06-01

    Broad-spectrum disease resistance against two or more types of pathogen species is desirable for crop improvement. In rice, Xanthomonas oryzae pv. oryzae (Xoo), the causal bacteria of rice leaf blight, and Magnaporthe oryzae, the fungal pathogen causing rice blast, are two of the most devastating pathogens. We identified the rice BROAD-SPECTRUM RESISTANCE 1 (BSR1) gene for a BIK1-like receptor-like cytoplasmic kinase using the FOX hunting system, and demonstrated that BSR1-overexpressing (OX) rice showed strong resistance to the bacterial pathogen, Xoo and the fungal pathogen, M. oryzae. Here, we report that BSR1-OX rice showed extended resistance against two other different races of Xoo, and to at least one other race of M. oryzae. In addition, the rice showed resistance to another bacterial species, Burkholderia glumae, which causes bacterial seedling rot and bacterial grain rot, and to Cochliobolus miyabeanus, another fungal species causing brown spot. Furthermore, BSR1-OX rice showed slight resistance to rice stripe disease, a major viral disease caused by rice stripe virus. Thus, we demonstrated that BSR1-OX rice shows remarkable broad-spectrum resistance to at least two major bacterial species and two major fungal species, and slight resistance to one viral pathogen.

  9. Development of molecular markers for breeding for disease resistant crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast disease caused by the filamentous ascomycetes fungus Magnaporthe oryzae and sheath blight disease caused by the soil borne fungus Rhizocotonia solani are the two major rice diseases that threaten stable rice production in the USA and worldwide. These two diseases have been managed with a ...

  10. Differential phenolic production in leaves of Vitis vinifera cv. Alvarinho affected with esca disease.

    PubMed

    Lima, Marta R M; Felgueiras, Mafalda L; Cunha, Ana; Chicau, Gisela; Ferreres, Federico; Dias, Alberto C P

    2017-03-01

    Esca is a destructive disease of complex etiology affecting grapevines worldwide. A major constraint to the study and control of esca is that the disease is not diagnosed until external leaf and/or fruit symptoms are visible; however external symptoms usually appear several years after infection onset. We studied the phenolic content of V. vinifera cv. Alvarinho leaves using high performance liquid chromatography-diode array detection-mass spectrometry (HPLC-DAD-MS)/LC-MS. Leaves from affected cordons with and without visible symptoms (diseased and apparently healthy leaves, respectively) and leaves from asymptomatic cordons (healthy leaves) were analyzed. Application of principal components analysis (PCA) to HPLC data showed a clear separation between diseased, apparently healthy, and healthy leaves, with the apparently healthy leaves clustered in a medial position. Several compounds were highly correlated with diseased leaves indicating a differential phenolic production due to esca disease in V. vinifera cv. Alvarinho leaves. Total phenolic production was shown to significantly increase in diseased leaves, compared to healthy leaves, with apparently healthy leaves containing a medial amount. Trans-caffeoyltartaric acid, trans-coumaroyl-tartaric acid, quercetin-3-O-glucoside, quercetin-3-O-galactoside, kaempferol-3-glucoside and myricetin were identified among the compounds associated with disease and their content shown to change similarly to total phenolic production. This study shows that it is possible to discriminate between diseased, healthy and apparently healthy leaves by applying PCA to HPLC data.

  11. Characterization of disease resistance loci in the USDA soybean germplasm collection using genome-wide association studies

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic resistance is a key strategy for soybean disease management. In past decades, soybean germplasm has been phenotyped for resistance to many different pathogens and genes for resistance have been incorporated into elite breeding lines often resulting in commercial cultivars with disease resist...

  12. Ganciclovir-resistant, cytomegalic interstitial lung disease in a patient with systemic lupus erythematosus.

    PubMed

    Finger, Eduardo; Romaldini, Helio; Lewi, David Salomão; Scheinberg, Morton Aaron

    2007-10-01

    A patient with systemic lupus erythematosus developed interstitial lung disease initially felt to be a manifestation of the disease but that, on further workup, proved to be a manifestation of cytomegalic disease resistant to ganciclovir. Treatment with foscarnet was associated with prompt improvement.

  13. A Benefit of High Temperature: Increased Effectiveness of a Rice Bacterial Blight Disease Resistance Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High temperatures promote development of many plant diseases and reduce effectiveness of disease resistance (R) genes. In many rice producing countries, two crops of rice are produced, with more disease occurring in the season with higher day/night temperatures. While studying the factors that influ...

  14. PARKINSON'S DISEASE PATIENTS WITH DOMINANT HEMIBODY AFFECTED BY THE DISEASE RELY MORE ON VISION TO MAINTAIN UPRIGHT POSTURAL CONTROL.

    PubMed

    Lahr, Juliana; Pereira, Marcelo Pinto; Pelicioni, Paulo Henrique Silva; De Morais, Luana Carolina; Gobbi, Lilian Teresa Bucken

    2015-12-01

    This study assesses the association between disease onset side (dominant or non-dominant) and vision on postural control of Parkinson's disease patients. Patient volunteers composed two groups, according to the onset side affected: Dominant group (n=9; M age=66.1 yr., SD=7.2; 6 women, 3 men) and Non-dominant group (n=9; M age=67.4 yr., SD=6.4; 6 women, 3 men). The groups' postural control was assessed by posturography during quiet upright stance in two conditions, Eyes open and Eyes closed. Two-way analyses of variance (ANOVAs; group×condition) with repeated measures for the second factor assessed the differences associated with affected hemibody and vision on postural control. Analyses indicated that patients with the dominant side affected also presented significantly greater variation in center of pressure than those with the non-dominant side affected, mainly in the Eyes closed condition. The results demonstrate a higher reliance on vision in the dominant side, possibly to compensate somatosensory system impairments. These results also highlight the importance of analyzing the hemibody affected by the disease when postural control is assessed in this population.

  15. Acute arginine supplementation fails to improve muscle endurance or affect blood pressure responses to resistance training.

    PubMed

    Greer, Beau K; Jones, Brett T

    2011-07-01

    Dietary supplement companies claim that arginine supplements acutely enhance skeletal muscular endurance. The purpose of this study was to determine whether acute arginine α-ketoglutarate supplementation (AAKG) will affect local muscle endurance of the arm and shoulder girdle or the blood pressure (BP) response to anaerobic exercise. Twelve trained college-aged men (22.6 ± 3.8 years) performed 2 trials of exercise separated by at least 1 week. At 4 hours before, and 30 minutes before exercise, a serving of an AAKG supplement (3,700 mg arginine alpha-ketoglutarate per serving) or placebo was administered. Resting BP was assessed pre-exercise after 16 minutes of seated rest, and 5 and 10 minutes postexercise. Three sets each of chin-ups, reverse chin-ups, and push-ups were performed to exhaustion with 3 minutes of rest between each set. Data were analyzed using repeated-measures analysis of variance and paired t-tests. The AAKG supplementation did not improve muscle endurance or significantly affect the BP response to anaerobic work. Subjects performed fewer total chin-ups (23.75 ± 6.38 vs. 25.58 ± 7.18) and total trial repetitions (137.92 ± 28.18 vs. 141.08 ± 28.57) in the supplement trial (p ≤ 0.05). Subjects executed fewer reverse chin-ups (5.83 ± 1.85 vs. 6.75 ± 2.09) during set 2 after receiving the supplement as compared to the placebo (p < 0.05). Because AAKG supplementation may hinder muscular endurance, the use of these supplements before resistance training should be questioned.

  16. Resistance to Multiple Tuber Diseases Expressed in Somaclonal Variants of the Potato Cultivar Russet Burbank

    PubMed Central

    Thangavel, Tamilarasan; Steven Tegg, Robert; Wilson, Calum Rae

    2014-01-01

    Multiple disease resistance is an aim of many plant breeding programs. Previously, novel somatic cell selection was used to generate potato variants of “Russet Burbank” with resistance to common scab caused by infection with an actinomycete pathogen. Coexpression of resistance to powdery scab caused by a protozoan pathogen was subsequently shown. This study sought to define whether this resistance was effective against additional potato tuber diseases, black scurf, and tuber soft rot induced by fungal and bacterial pathogens. Pot trials and in vitro assays with multiple pathogenic strains identified significant resistance to both tuber diseases across the potato variants examined; the best clone A380 showed 51% and 65% reductions in disease severity to tuber soft rot and black scurf, respectively, when compared with the parent line. The resistance appeared to be tuber specific as no enhanced resistance was recorded in stolons or stem material when challenged Rhizoctonia solani that induces stolon pruning and stem canker. The work presented here suggests that morphological characteristics associated with tuber resistance may be the predominant change that has resulted from the somaclonal cell selection process, potentially underpinning the demonstrated broad spectrum of resistance to tuber invading pathogens. PMID:24523639

  17. Population dynamics of epidemic and endemic states of drug-resistance emergence in infectious diseases

    PubMed Central

    Knipl, Diána; Röst, Gergely

    2017-01-01

    The emergence and spread of drug-resistance during treatment of many infectious diseases continue to degrade our ability to control and mitigate infection outcomes using therapeutic measures. While the coverage and efficacy of treatment remain key factors in the population dynamics of resistance, the timing for the start of the treatment in infectious individuals can significantly influence such dynamics. We developed a between-host disease transmission model to investigate the short-term (epidemic) and long-term (endemic) states of infections caused by two competing pathogen subtypes, namely the wild-type and resistant-type, when the probability of developing resistance is a function of delay in start of the treatment. We characterize the behaviour of disease equilibria and obtain a condition to minimize the fraction of population infectious at the endemic state in terms of probability of developing resistance and its transmission fitness. For the short-term epidemic dynamics, we illustrate that depending on the likelihood of resistance development at the time of treatment initiation, the same epidemic size may be achieved with different delays in start of the treatment, which may correspond to significantly different treatment coverages. Our results demonstrate that early initiation of treatment may not necessarily be the optimal strategy for curtailing the incidence of resistance or the overall disease burden. The risk of developing drug-resistance in-host remains an important factor in the management of resistance in the population. PMID:28097052

  18. PMT family of Candida albicans: five protein mannosyltransferase isoforms affect growth, morphogenesis and antifungal resistance.

    PubMed

    Prill, Stephan K-H; Klinkert, Birgit; Timpel, Claudia; Gale, Cheryl A; Schröppel, Klaus; Ernst, Joachim F

    2005-01-01

    Protein O-mannosyltransferases (Pmt proteins) initiate O-mannosylation of secretory proteins. The PMT gene family of the human fungal pathogen Candida albicans consists of PMT1 and PMT6, as well as three additional PMT genes encoding Pmt2, Pmt4 and Pmt5 isoforms described here. Both PMT2 alleles could not be deleted and growth of conditional strains, containing PMT2 controlled by the MET3- or tetOScHOP1-promoters, was blocked in non-permissive conditions, indicating that PMT2 is essential for growth. A homozygous pmt4 mutant was viable, but synthetic lethality of pmt4 was observed in combination with pmt1 mutations. Hyphal morphogenesis of a pmt4 mutant was defective under aerobic induction conditions, yet increased in embedded or hypoxic conditions, suggesting a role of Pmt4p-mediated O-glycosylation for environment-specific morphogenetic signalling. Although a PMT5 transcript was detected, a homozygous pmt5 mutant was phenotypically silent. All other pmt mutants showed variable degrees of supersensitivity to antifungals and to cell wall-destabilizing agents. Cell wall composition was markedly affected in pmt1 and pmt4 mutants, showing a significant decrease in wall mannoproteins. In a mouse model of haematogenously disseminated infection, PMT4 was required for full virulence of C. albicans. Functional analysis of the first complete PMT gene family in a fungal pathogen indicates that Pmt isoforms have variable and specific roles for in vitro and in vivo growth, morphogenesis and antifungal resistance.

  19. Molecular Breeding Strategy and Challenges Towards Improvement of Blast Disease Resistance in Rice Crop

    PubMed Central

    Ashkani, Sadegh; Rafii, Mohd Y.; Shabanimofrad, Mahmoodreza; Miah, Gous; Sahebi, Mahbod; Azizi, Parisa; Tanweer, Fatah A.; Akhtar, Mohd Sayeed; Nasehi, Abbas

    2015-01-01

    Rice is a staple and most important security food crop consumed by almost half of the world’s population. More rice production is needed due to the rapid population growth in the world. Rice blast caused by the fungus, Magnaporthe oryzae is one of the most destructive diseases of this crop in different part of the world. Breakdown of blast resistance is the major cause of yield instability in several rice growing areas. There is a need to develop strategies providing long-lasting disease resistance against a broad spectrum of pathogens, giving protection for a long time over a broad geographic area, promising for sustainable rice production in the future. So far, molecular breeding approaches involving DNA markers, such as QTL mapping, marker-aided selection, gene pyramiding, allele mining and genetic transformation have been used to develop new resistant rice cultivars. Such techniques now are used as a low-cost, high-throughput alternative to conventional methods allowing rapid introgression of disease resistance genes into susceptible varieties as well as the incorporation of multiple genes into individual lines for more durable blast resistance. The paper briefly reviewed the progress of studies on this aspect to provide the interest information for rice disease resistance breeding. This review includes examples of how advanced molecular method have been used in breeding programs for improving blast resistance. New information and knowledge gained from previous research on the recent strategy and challenges towards improvement of blast disease such as pyramiding disease resistance gene for creating new rice varieties with high resistance against multiple diseases will undoubtedly provide new insights into the rice disease control. PMID:26635817

  20. Molecular Breeding Strategy and Challenges Towards Improvement of Blast Disease Resistance in Rice Crop.

    PubMed

    Ashkani, Sadegh; Rafii, Mohd Y; Shabanimofrad, Mahmoodreza; Miah, Gous; Sahebi, Mahbod; Azizi, Parisa; Tanweer, Fatah A; Akhtar, Mohd Sayeed; Nasehi, Abbas

    2015-01-01

    Rice is a staple and most important security food crop consumed by almost half of the world's population. More rice production is needed due to the rapid population growth in the world. Rice blast caused by the fungus, Magnaporthe oryzae is one of the most destructive diseases of this crop in different part of the world. Breakdown of blast resistance is the major cause of yield instability in several rice growing areas. There is a need to develop strategies providing long-lasting disease resistance against a broad spectrum of pathogens, giving protection for a long time over a broad geographic area, promising for sustainable rice production in the future. So far, molecular breeding approaches involving DNA markers, such as QTL mapping, marker-aided selection, gene pyramiding, allele mining and genetic transformation have been used to develop new resistant rice cultivars. Such techniques now are used as a low-cost, high-throughput alternative to conventional methods allowing rapid introgression of disease resistance genes into susceptible varieties as well as the incorporation of multiple genes into individual lines for more durable blast resistance. The paper briefly reviewed the progress of studies on this aspect to provide the interest information for rice disease resistance breeding. This review includes examples of how advanced molecular method have been used in breeding programs for improving blast resistance. New information and knowledge gained from previous research on the recent strategy and challenges towards improvement of blast disease such as pyramiding disease resistance gene for creating new rice varieties with high resistance against multiple diseases will undoubtedly provide new insights into the rice disease control.

  1. Elevated depressive affect is associated with adverse cardiovascular outcomes among African Americans with chronic kidney disease.

    PubMed

    Fischer, Michael J; Kimmel, Paul L; Greene, Tom; Gassman, Jennifer J; Wang, Xuelei; Brooks, Deborah H; Charleston, Jeanne; Dowie, Donna; Thornley-Brown, Denyse; Cooper, Lisa A; Bruce, Marino A; Kusek, John W; Norris, Keith C; Lash, James P

    2011-09-01

    This study was designed to examine the impact of elevated depressive affect on health outcomes among participants with hypertensive chronic kidney disease in the African-American Study of Kidney Disease and Hypertension (AASK) Cohort Study. Elevated depressive affect was defined by Beck Depression Inventory II (BDI-II) thresholds of 11 or more, above 14, and by 5-Unit increments in the score. Cox regression analyses were used to relate cardiovascular death/hospitalization, doubling of serum creatinine/end-stage renal disease, overall hospitalization, and all-cause death to depressive affect evaluated at baseline, the most recent annual visit (time-varying), or average from baseline to the most recent visit (cumulative). Among 628 participants at baseline, 42% had BDI-II scores of 11 or more and 26% had a score above 14. During a 5-year follow-up, the cumulative incidence of cardiovascular death/hospitalization was significantly greater for participants with baseline BDI-II scores of 11 or more compared with those with scores <11. The baseline, time-varying, and cumulative elevated depressive affect were each associated with a significant higher risk of cardiovascular death/hospitalization, especially with a time-varying BDI-II score over 14 (adjusted HR 1.63) but not with the other outcomes. Thus, elevated depressive affect is associated with unfavorable cardiovascular outcomes in African Americans with hypertensive chronic kidney disease.

  2. Responses of horses affected with chronic obstructive pulmonary disease to inhalation challenges with mould antigens.

    PubMed

    McGorum, B C; Dixon, P M; Halliwell, R E

    1993-07-01

    Eight control and 8 asymptomatic COPD-affected horses were given, on separate occasions, inhalation challenges with extracts of Micropolyspora faeni, Aspergillus fumigatus and Thermoactinomyces vulgaris. All horses were also given nebulised phosphate-buffered saline (PBS) challenges and 'natural challenges' (NCs), i.e. exposure to hay and straw, as control challenges. Responses were assessed by clinical, pulmonary mechanics, arterial blood gas tensions, arterial blood pH and bronchoalveolar lavage fluid cytological examinations. PBS challenges had no effect on control or COPD-affected horses, while NC induced COPD only in the COPD-affected horses. Pulmonary disease, similar to naturally occurring COPD, was induced, only in the COPD-affected horses, by M. faeni and A. fumigatus challenges, thus implicating these organisms in the aetiology of equine COPD. The role of T. vulgaris in the aetiology of equine COPD could not, however, be determined because the T. vulgaris challenges, in addition to inducing pulmonary disease in 4 COPD-affected horses, induced pulmonary disease in 2 control horses which had been unaffected by NC. The absence of pulmonary disease in control horses after M. faeni, A. fumigatus and NC challenges suggests that equine COPD is a pulmonary hypersensitivity, rather than a non-specific toxic response.

  3. Does Vitamin D Affect Risk of Developing Autoimmune Disease?: A Systematic Review

    PubMed Central

    Kriegel, Martin A.; Manson, JoAnn E.; Costenbader, Karen H.

    2010-01-01

    Objectives We evaluated the epidemiologic evidence that vitamin D may be related to human autoimmune disease risk. Methods PubMed limited to English from inception through April 2010 was searched using keywords: “vitamin D”, “autoimmune” and autoimmune disease names. We summarized in vitro, animal, and genetic association studies of vitamin D in autoimmune disease pathogenesis. We sorted studies by design and disease and performed a systematic review of: a) cross-sectional data concerning vitamin D level and autoimmune disease; b) interventional data on vitamin D supplementation in autoimmune diseases and c) prospective data linking vitamin D level or intake to autoimmune disease risk. Results Vitamin D has effects on innate and acquired immune systems and vitamin D receptor polymorphisms have been associated with various autoimmune diseases. In experimental animal models, vitamin D supplementation can prevent or forestall autoimmune disease. We identified 76 studies in which vitamin D levels were studied in autoimmune disease patients, particularly with active disease, and compared to controls. Nineteen observational or interventional studies assessed the effect of vitamin D supplementation as therapy for various autoimmune diseases (excluding psoriasis and vitiligo) with a range of study approaches and results. The few prospective human studies performed conflict as to whether vitamin D level or intake is associated with autoimmune disease risk. No interventional trials have investigated whether vitamin D affects human autoimmune disease risk. Conclusions Cross-sectional data point to a potential role of vitamin D in autoimmune disease prevention, but prospective interventional evidence in humans is still lacking. PMID:21047669

  4. Translational neurophysiology in sheep: measuring sleep and neurological dysfunction in CLN5 Batten disease affected sheep

    PubMed Central

    Perentos, Nicholas; Martins, Amadeu Q.; Watson, Thomas C.; Bartsch, Ullrich; Mitchell, Nadia L.; Palmer, David N.; Jones, Matthew W.

    2015-01-01

    Creating valid mouse models of slowly progressing human neurological diseases is challenging, not least because the short lifespan of rodents confounds realistic modelling of disease time course. With their large brains and long lives, sheep offer significant advantages for translational studies of human disease. Here we used normal and CLN5 Batten disease affected sheep to demonstrate the use of the species for studying neurological function in a model of human disease. We show that electroencephalography can be used in sheep, and that longitudinal recordings spanning many months are possible. This is the first time such an electroencephalography study has been performed in sheep. We characterized sleep in sheep, quantifying characteristic vigilance states and neurophysiological hallmarks such as sleep spindles. Mild sleep abnormalities and abnormal epileptiform waveforms were found in the electroencephalographies of Batten disease affected sheep. These abnormalities resemble the epileptiform activity seen in children with Batten disease and demonstrate the translational relevance of both the technique and the model. Given that both spontaneous and engineered sheep models of human neurodegenerative diseases already exist, sheep constitute a powerful species in which longitudinal in vivo studies can be conducted. This will advance our understanding of normal brain function and improve our capacity for translational research into neurological disorders. PMID:25724202

  5. Is Insulin Resistance a Feature of or a Primary Risk Factor for Cardiovascular Disease?

    PubMed

    Laakso, Markku

    2015-12-01

    The two major pathophysiological abnormalities in type 2 diabetes are insulin resistance and impaired insulin secretion. Insulin resistance is a general term meaning that insulin does not exert its normal effects in insulin-sensitive target tissues, such as skeletal muscle, adipose tissue, and liver, the major target tissues for insulin action in glucose metabolism. Insulin resistance (IR) promotes cardiovascular disease via multiple mechanisms, including changes in classic cardiovascular risk factors and downregulation of the insulin signaling pathways in different tissues. This review presents evidence for the association of insulin resistance with cardiovascular disease from clinical and population-based studies. The causality of the association of insulin resistance with cardiovascular disease is discussed on the basis of recent findings from the Mendelian randomization studies.

  6. Genetic Signature of Resistance to White Band Disease in the Caribbean Staghorn Coral Acropora cervicornis

    PubMed Central

    Libro, Silvia; Vollmer, Steven V.

    2016-01-01

    Coral reefs are declining worldwide due to multiple factors including rising sea surface temperature, ocean acidification, and disease outbreaks. Over the last 30 years, White Band Disease (WBD) alone has killed up to 95% of the Caribbean`s dominant shallow-water corals—the staghorn coral Acropora cervicornis and the elkhorn coral A. palmata. Both corals are now listed on the US Endangered Species Act, and while their recovery has been slow, recent transmission surveys indicate that more than 5% of staghorn corals are disease resistant. Here we compared transcriptome-wide gene expression between resistant and susceptible staghorn corals exposed to WBD using in situ transmission assays. We identified constitutive gene expression differences underlying disease resistance that are independent from the immune response associated with disease exposure. Genes involved in RNA interference-mediated gene silencing, including Argonaute were up-regulated in resistant corals, whereas heat shock proteins (HSPs) were down-regulated. Up-regulation of Argonaute proteins indicates that post-transcriptional gene silencing plays a key, but previously unsuspected role in coral immunity and disease resistance. Constitutive expression of HSPs has been linked to thermal resilience in other Acropora corals, suggesting that the down-regulation of HSPs in disease resistant staghorn corals may confer a dual benefit of thermal resilience. PMID:26784329

  7. Genetic Signature of Resistance to White Band Disease in the Caribbean Staghorn Coral Acropora cervicornis.

    PubMed

    Libro, Silvia; Vollmer, Steven V

    2016-01-01

    Coral reefs are declining worldwide due to multiple factors including rising sea surface temperature, ocean acidification, and disease outbreaks. Over the last 30 years, White Band Disease (WBD) alone has killed up to 95% of the Caribbean`s dominant shallow-water corals--the staghorn coral Acropora cervicornis and the elkhorn coral A. palmata. Both corals are now listed on the US Endangered Species Act, and while their recovery has been slow, recent transmission surveys indicate that more than 5% of staghorn corals are disease resistant. Here we compared transcriptome-wide gene expression between resistant and susceptible staghorn corals exposed to WBD using in situ transmission assays. We identified constitutive gene expression differences underlying disease resistance that are independent from the immune response associated with disease exposure. Genes involved in RNA interference-mediated gene silencing, including Argonaute were up-regulated in resistant corals, whereas heat shock proteins (HSPs) were down-regulated. Up-regulation of Argonaute proteins indicates that post-transcriptional gene silencing plays a key, but previously unsuspected role in coral immunity and disease resistance. Constitutive expression of HSPs has been linked to thermal resilience in other Acropora corals, suggesting that the down-regulation of HSPs in disease resistant staghorn corals may confer a dual benefit of thermal resilience.

  8. A Biochemical Phenotype for a Disease Resistance Gene of Maize.

    PubMed Central

    Meeley, RB; Johal, GS; Briggs, SP; Walton, JD

    1992-01-01

    In maize, major resistance to the pathogenic fungus Cochliobolus (Helminthosporium) carbonum race 1 is determined by the dominant allele of the nuclear locus hm. The interaction between C. carbonum race 1 and maize is mediated by a pathogen-produced, low molecular weight compound called HC-toxin. We recently described an enzyme from maize, called HC-toxin reductase, that inactivates HC-toxin by pyridine nucleotide-dependent reduction of an essential carbonyl group. We now report that this enzyme activity is detectable only in extracts of maize that are resistant to C. carbonum race 1 (genotype Hm/Hm or Hm/hm). In several genetic analyses, in vitro HC-toxin reductase activity was without exception associated with resistance to C. carbonum race 1. The results indicate that detoxification of HC-toxin is the biochemical basis of Hm-specific resistance of maize to infection by C. carbonum race 1. PMID:12297630

  9. Production of homozygous transgenic rainbow trout with enhanced disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous studies conducted in our laboratory showed that transgenic medaka expressing cecropin B transgenes exhibited resistant characteristic to fish bacterial pathogens, Pseudomonas fluorescens and Vibrio anguillarum. To confirm whether antimicrobial peptide gene will also exhibit antibacterial an...

  10. Identification of Resistance to Wet Bubble Disease and Genetic Diversity in Wild and Cultivated Strains of Agaricus bisporus

    PubMed Central

    Fu, Yongping; Wang, Xinxin; Li, Dan; Liu, Yuan; Song, Bing; Zhang, Chunlan; Wang, Qi; Chen, Meiyuan; Zhang, Zhiwu; Li, Yu

    2016-01-01

    Outbreaks of wet bubble disease (WBD) caused by Mycogone perniciosa are increasing across the world and seriously affecting the yield of Agaricus bisporus. However, highly WBD-resistant strains are rare. Here, we tested 28 A. bisporus strains for WBD resistance by inoculating M. perniciosa spore suspension on casing soil, and assessed genetic diversity of these strains using 17 new simple sequence repeat (SSR) markers developed in this study. We found that 10 wild strains originating from the Tibetan Plateau in China were highly WBD-resistant strains, and 13 cultivated strains from six countries were highly susceptible strains. A total of 88 alleles were detected in these 28 strains, and the observed number of alleles per locus ranged from 2 to 8. Cluster and genetic structure analysis results revealed the wild resources from China have a relatively high level of genetic diversity and occur at low level of gene flow and introgression with cultivated strains. Moreover, the wild strains from China potentially have the consensus ancestral genotypes different from the cultivated strains and evolved independently. Therefore, the highly WBD-resistant wild strains from China and newly developed SSR markers could be used as novel sources for WBD-resistant breeding and quantitative trait locus (QTL) mapping of WBD-resistant gene of A. bisporus. PMID:27669211

  11. Analysis of the characteristics of slot design affecting resistance to sliding during active archwire configurations

    PubMed Central

    2013-01-01

    Background During orthodontic treatment, a low resistance to slide (RS) is desirable when sliding mechanics are used. Many studies showed that several variables affect the RS at the bracket-wire interface; among these, the design of the bracket slot has not been deeply investigated yet. This study aimed to clarify the effect of different slot designs on the RS expressed by five types of low-friction brackets in vertical and horizontal active configurations of the wire. Methods Five low-friction brackets (Damon SL II, Ormco, Orange, CA, USA; In-Ovation, GAC International, Bohemia, NY, USA; Quick, Forestadent, Pforzheim, Germany; Time 2, AO, Sheboygan, WI, USA; Synergy, RMO, Denver, CO, USA) coupled with an 0.014-in NiTi thermal wire (Therma-Lite, AO) were tested in two three-bracket experimental models simulating vertical and horizontal bracket displacements. A custom-made machine was used to measure frictional resistance with tests repeated on ten occasions for each bracket-wire combination. Design characteristics such as the mesio-distal slot width, slot depth, and presence of chamfered edges at the extremities of the slot were evaluated on SEM images (SUPRA, Carl Zeiss, Oberkochen, Germany) and analyzed in relation to the data of RS recorded. Results Time 2 was found to show the higher frictional forces (1.50 and 1.35 N) in both experimental models (p < 0.05), while Quick and Synergy brackets showed the lower frictional values in the vertical (0.66 N) and in the horizontal (0.68 N) bracket displacements, respectively. With vertically displaced brackets, the increased mesio-distal slot width and the presence of clear angle at mesial and distal slot edges increase the values of RS. With brackets horizontally displaced, the RS expressed by the wire is influenced simultaneously by the depth of the slot, the mesio-distal slot width, and the presence of clear angle at the extremities of the slot base, the clip, or the slide. Conclusion In order to select the proper low

  12. Disease resistance breeding in rose: current status and potential of biotechnological tools.

    PubMed

    Debener, Thomas; Byrne, David H

    2014-11-01

    The cultivated rose is a multispecies complex for which a high level of disease protection is needed due to the low tolerance of blemishes in ornamental plants. The most important fungal diseases are black spot, powdery mildew, botrytis and downy mildew. Rose rosette, a lethal viral pathogen, is emerging as a devastating disease in North America. Currently rose breeders use a recurrent phenotypic selection approach and perform selection for disease resistance for most pathogen issues in a 2-3 year field trial. Marker assisted selection could accelerate this breeding process. Thus far markers have been identified for resistance to black spot (Rdrs) and powdery mildew and with the ability of genotyping by sequencing to generate 1000s of markers our ability to identify markers useful in plant improvement should increase exponentially. Transgenic rose lines with various fungal resistance genes inserted have shown limited success and RNAi technology has potential to provide virus resistance. Roses, as do other plants, have sequences homologous to characterized R-genes in their genomes, some which have been related to specific disease resistance. With improving next generation sequencing technology, our ability to do genomic and transcriptomic studies of the resistance related genes in both the rose and the pathogens to reveal novel gene targets to develop resistant roses will accelerate. Finally, the development of designer nucleases opens up a potentially non-GMO approach to directly modify a rose's DNA to create a disease resistant rose. Although there is much potential, at present rose breeders are not using marker assisted breeding primarily because a good suite of marker/trait associations (MTA) that would ensure a path to stable disease resistance is not available. As our genomic analytical tools improve, so will our ability to identify useful genes and linked markers. Once these MTAs are available, it will be the cost savings, both in time and money, that will

  13. The use of radio-collars for monitoring wildlife diseases: a case study from Iberian ibex affected by Sarcoptes scabiei in Sierra Nevada, Spain

    PubMed Central

    2013-01-01

    Background Wildlife radio tracking has gained popularity during the recent past. Ecologists and conservationists use radio-collars for different purposes: animal movement monitoring, home range, productivity, population estimation, behaviour, habitat use, survival, and predator-prey interaction, among others. The aim of our present study is to highlight the application of radio-collars for wildlife diseases monitoring. The spread of wildlife diseases and the efficacy of management actions for controlling them propose serious challenges for ecologists and conservationists, since it is difficult to re-capture (or simply observe) the same animal in pre-determined temporal interval, but such difficulty is overcome by the use of gps-gsm radio collars. Methods In the present study we report, for the first time to our knowledge, the use of radio-collars in the monitoring of Iberian ibex affected by Sarcoptes scabiei in Sierra Nevada mountain range, Spain. Twenty-five moderate or slightly mangy animals were radio-collared between 2006 and 2013. Results The radio-collars allowed us to confirm the presence of resistance to S. scabiei within Iberian ibex population. Twenty (80%) of the collared animals recovered totally from mange, while the disease progressed in the other five Iberian ibex (20% of the collared animals) and the animals died. The average estimated recovery time of the resistant animals was 245 ± 277 days, and the estimated average survival time of the non-resistant Iberian ibex was 121 ± 71 days. Non-resistant animals survived at least 100 days, while all of them died with less than 200 days. Sixty per cent of the resistant animals were recovered with less than 200 days. Conclusions We report, for the first time, the successful use of radio collars for wildlife diseases monitoring using Iberian ibex/S. scabiei as a model. By using radio collars we documented that most of the Sarcoptes-infected Iberian ibex are resistant to this disease, and we

  14. Genetic selection for resistance or susceptibility to oral tolerance to ovalbumin affects general mechanisms of tolerance induction in mice.

    PubMed

    Kamphorst, Alice O; da Silva, Maria F S; da Silva, Antônio C; Carvalho, Claudia R; Faria, Ana Maria C

    2004-12-01

    To study the genes involved in oral tolerance susceptibility, two strains of mice were genetically selected for susceptibility (TS) and resistance (TR) to oral tolerance to ovalbumin by bidirectional breeding. Herein we show that the genetic selection process is restricted neither to ovalbumin nor to oral tolerance. It affected oral tolerance to other proteins, such as casein, and tolerance induced the intravenous route.

  15. Identification of Genetic Loci Affecting the Severity of Symptoms of Hirschsprung Disease in Rats Carrying Ednrbsl Mutations by Quantitative Trait Locus Analysis

    PubMed Central

    Torigoe, Daisuke; Lei, Chuzhao; Lan, Xianyong; Chen, Hong; Sasaki, Nobuya; Wang, Jinxi; Agui, Takashi

    2015-01-01

    Hirschsprung’s disease (HSCR) is a congenital disease in neonates characterized by the absence of the enteric ganglia in a variable length of the distal colon. This disease results from multiple genetic interactions that modulate the ability of enteric neural crest cells to populate developing gut. We previously reported that three rat strains with different backgrounds (susceptible AGH-Ednrbsl/sl, resistant F344-Ednrbsl/sl, and LEH-Ednrbsl/sl) but the same null mutation of Ednrb show varying severity degrees of aganglionosis. This finding suggests that strain-specific genetic factors affect the severity of HSCR. Consistent with this finding, a quantitative trait locus (QTL) for the severity of HSCR on chromosome (Chr) 2 was identified using an F2 intercross between AGH and F344 strains. In the present study, we performed QTL analysis using an F2 intercross between the susceptible AGH and resistant LEH strains to identify the modifier/resistant loci for HSCR in Ednrb-deficient rats. A significant locus affecting the severity of HSCR was also detected within the Chr 2 region. These findings strongly suggest that a modifier gene of aganglionosis exists on Chr 2. In addition, two potentially causative SNPs (or mutations) were detected upstream of a known HSCR susceptibility gene, Gdnf. These SNPs were possibly responsible for the varied length of gut affected by aganglionosis. PMID:25790447

  16. Race-nonspecific resistance to rust diseases in CIMMYT spring wheats (2010)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rust diseases continue to cause significant losses to wheat production worldwide. Although the life of effective race-specific resistance genes can be prolonged by using gene combinations, an alternative approach is to deploy varieties that posses adult plant resistance (APR) based on combinations o...

  17. Identification of a QTL for postharvest disease resistance to Penicillium expansum in Malus sieversii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Blue mold of apple caused by Penicillium expansum is one of the most important postharvest rots of apple fruit. Little attention has been devoted to postharvest disease resistance in apple breeding programs due both to a lack of sources of genetic resistance and to the time required for seedlings t...

  18. Response to selection for bacterial cold water disease resistance in rainbow trout

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous studies indicate that resistance to experimental bacterial cold water disease (BCWD) challenge is heritable and thus may be improved through selective breeding. Our objective was to estimate response after one generation of genetic selection for resistance to BCWD in a pedigreed population ...

  19. Genome-wide association of rice blast disease resistance and yield-related components of rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Robust disease resistance may require an expenditure of energy that may limit crop yield potential. In the present study, a subset of a USDA rice core collection consisting of 151 accessions was selected using a major blast resistance (R) gene Pi-ta marker, and was genotyped with 156 simple sequence...

  20. Identification of disease resistance genes for enhancement of existing potato cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A plant’s ability to defend itself against host-specific microbes is specified by disease resistance (R) genes. Upon recognition of an invading pathogen, R proteins are responsible for the activation of a multitude of responses ultimately leading to resistance. The majority of R genes are dominant a...

  1. Sweating treatment enhances citrus fruit disease resistance by inducing the accumulation of amino acids and salicylic acid-induced resistance pathway.

    PubMed

    Yun, Ze; Zhu, Feng; Liu, Ping; Zeng, Yunliu; Xu, Juan; Cheng, Yunjiang; Deng, Xiuxin

    2015-04-20

    To clarify the mechanism of fruit disease resistance activated by sweating treatment, 'Guoqing NO.1' Satsuma mandarin (Citrus unshiu Marc.) fruits were treated by sweating, which is a traditional prestorage treatment in China. Subsequently, we performed inoculation and physiological characterization, two-dimensional gel electrophoresis (2-DE) proteomics analysis and metabonomics analysis based on gas chromatography coupled to mass spectrometry (GC-MS) and high-performance liquid chromatography/electrospray ionization-time of flight-mass spectrometry (HPLC-qTOF-MS). The results showed that sweating treatment significantly inhibited pathogen infection without negatively affecting the fruit commercial quality. In addition, sweating treatment rapidly promoted the accumulation of amino acids (such as proline and serine). Meanwhile, hydrogen peroxide (H2 O2 ) and salicylic acid (SA) were significantly accumulated in the sweating-treated fruit. Thereafter, some stress-response proteins and metabolites [such as ascorbate peroxidase (APX), β-1,3-glucanase, vanillic acid and rutin] which can be induced by SA were also significantly increased in the sweating-treated fruit. Taken together, the disease resistance induced by sweating treatment might be attributed to: (1) the induction of the accumulation of amino acids; and (2) the accumulation of SA and subsequent activation of SA-induced resistance pathway, which can induce the stress-response proteins and metabolites that can directly inhibit pathogen development.

  2. Development of disease-resistant rice by pathogen-responsive expression of WRKY45.

    PubMed

    Goto, Shingo; Sasakura-Shimoda, Fuyuko; Yamazaki, Muneo; Hayashi, Nagao; Suetsugu, Mai; Ochiai, Hirokazu; Takatsuji, Hiroshi

    2016-04-01

    WRKY45 is an important transcription factor in the salicylic acid signalling pathway in rice that mediates chemical-induced resistance against multiple pathogens. Its constitutive overexpression confers extremely strong resistance against Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae to rice, but has adverse effects on agronomic traits. Here, a new strategy to confer rice with strong disease resistance without any negative effects on agronomic traits was established by expressing WRKY45 under the control of pathogen-responsive promoters in combination with a translational enhancer derived from a 5'-untranslated region (UTR) of rice alcohol dehydrogenase (ADH). Rice promoters that responded to M. oryzae and X. oryzae pv. oryzae infections within 24 h were identified, and 2-kb upstream sequences from nine of them were isolated, fused to WRKY45 cDNA with or without the ADH 5'-UTR, and introduced into rice. Although pathogen-responsive promoters alone failed to confer effective disease resistance, the use of the ADH 5'-UTR in combination with them, in particular the PR1b and GST promoters, enhanced disease resistance. Field trials showed that overall, PR1b promoter-driven (with ADH 5'-UTR) lines performed the best and one had agronomic traits comparable to control untransformed rice. Thus, expressing WRKY45 under the control of the PR1b promoter with the ADH 5'-UTR is an excellent strategy to develop disease-resistant rice, and the line established could serve as a mother line for breeding disease-resistant rice.

  3. Mutant Huntingtin Does Not Affect the Intrinsic Phenotype of Human Huntington's Disease T Lymphocytes.

    PubMed

    Miller, James R C; Träger, Ulrike; Andre, Ralph; Tabrizi, Sarah J

    2015-01-01

    Huntington's disease is a fatal neurodegenerative condition caused by a CAG repeat expansion in the huntingtin gene. The peripheral innate immune system is dysregulated in Huntington's disease and may contribute to its pathogenesis. However, it is not clear whether or to what extent the adaptive immune system is also involved. Here, we carry out the first comprehensive investigation of human ex vivo T lymphocytes in Huntington's disease, focusing on the frequency of a range of T lymphocyte subsets, as well as analysis of proliferation, cytokine production and gene transcription. In contrast to the innate immune system, the intrinsic phenotype of T lymphocytes does not appear to be affected by the presence of mutant huntingtin, with Huntington's disease T lymphocytes exhibiting no significant functional differences compared to control cells. The transcriptional profile of T lymphocytes also does not appear to be significantly affected, suggesting that peripheral immune dysfunction in Huntington's disease is likely to be mediated primarily by the innate rather than the adaptive immune system. This study increases our understanding of the effects of Huntington's disease on peripheral tissues, while further demonstrating the differential effects of the mutant protein on different but related cell types. Finally, this study suggests that the potential use of novel therapeutics aimed at modulating the Huntington's disease innate immune system should not be extended to include the adaptive immune system.

  4. Factors affecting the thermal shock resistance of several hafnia based composites containing graphite or tungsten. M.S. Thesis

    NASA Technical Reports Server (NTRS)

    Lineback, L. D.

    1974-01-01

    The thermal shock resistance of hafnia based composites containing graphite powder or tungsten fibers was investigated in terms of material properties which include thermal expansion, thermal conductivity, compressive fracture stress, modulus of elasticity, and phase stability in terms of the processing parameters of hot pressing pressure and/or density, degree of stabilization of the hafnia, and composition. All other parameters were held constant or assumed constant. The thermal shock resistance was directly proportional to the compressive fracture stress to modulus of elasticity ratio and was not affected appreciably by the small thermal expansion or thermal conductivity changes. This ratio was found to vary strongly with the composition and density such that the composites containing graphite had relatively poor thermal shock resistance, while the composites containing tungsten had superior thermal shock resistance.

  5. The affect of infectious bursal disease virus on avian influenza virus vaccine efficacy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Immunosuppressive viruses are known to affect vaccinal immunity, however the impact of virally induced immunosuppression on avian influenza vaccine efficacy has not been quantified. In order to determine the effect of exposure to infectious bursal disease virus (IBDV) on vaccinal immunity to highly ...

  6. Genetic engineering for increasing fungal and bacterial disease resistance in crop plants.

    PubMed

    Wally, Owen; Punja, Zamir K

    2010-01-01

    We review the current and future potential of genetic engineering strategies used to make fungal and bacterial pathogen-resistant GM crops, illustrating different examples of the technologies and the potential benefits and short-falls of the strategies. There are well- established procedures for the production of transgenic plants with resistance towards these pathogens and considerable progress has been made using a range of new methodologies. There are no current commercially available transgenic plant species with increased resistance towards fungal and bacterial pathogens; only plants with increased resistance towards viruses are available. With an improved understanding of plant signaling pathways in response to a range of other pathogens, such as fungi, additional candidate genes for achieving resistance are being investigated. The potential for engineering plants for resistance against individual devastating diseases or for plants with resistance towards multiple pathogens is discussed in detail.

  7. Clinical Characteristics, Treatment Outcomes, and Resistance Mutations Associated with Macrolide-Resistant Mycobacterium avium Complex Lung Disease.

    PubMed

    Moon, Seong Mi; Park, Hye Yun; Kim, Su-Young; Jhun, Byung Woo; Lee, Hyun; Jeon, Kyeongman; Kim, Dae Hun; Huh, Hee Jae; Ki, Chang-Seok; Lee, Nam Yong; Kim, Hong Kwan; Choi, Yong Soo; Kim, Jhingook; Lee, Seung-Heon; Kim, Chang Ki; Shin, Sung Jae; Daley, Charles L; Koh, Won-Jung

    2016-11-01

    Macrolide antibiotics are key components of the multidrug treatment regimen for treating lung disease (LD) due to Mycobacterium avium complex (MAC). Despite the emergence of macrolide resistance, limited data are available on macrolide-resistant MAC-LD. This study evaluated the clinical features and treatment outcomes of patients with macrolide-resistant MAC-LD and the molecular characteristics of the macrolide-resistant isolates. A retrospective review of the medical records of 34 patients with macrolide-resistant MAC-LD who were diagnosed between January 2002 and December 2014 was performed, along with genetic analysis of 28 clinical isolates. Nineteen (56%) patients had the fibrocavitary form of MAC-LD, and 15 (44%) had the nodular bronchiectatic form. M. intracellulare was the etiologic organism in 21 (62%) patients. Approximately two-thirds (22/34 [65%]) of the patients had been treated with currently recommended multidrug regimens that included macrolide, ethambutol, and rifamycin prior to the emergence of macrolide resistance, and none had been treated with macrolide monotherapy. The median duration of treatment after the detection of macrolide resistance was 23.0 months (interquartile range, 16.8 to 45.3 months). Treatment outcomes were poor after the development of macrolide resistance, with favorable treatment outcomes achieved in only five (15%) patients, including two patients who underwent surgical resection. One-, 3-, and 5-year mortality rates were 9, 24, and 47%, respectively. Molecular analysis of 28 clinical isolates revealed that 96% (27/28) had point mutations at position 2058 or 2059 of the 23S rRNA gene. Our analyses indicate that more effective therapy is needed to treat macrolide-resistant MAC-LD and prevent its development.

  8. Antimicrobial resistance in Salmonella that caused foodborne disease outbreaks: United States, 2003-2012.

    PubMed

    Brown, A C; Grass, J E; Richardson, L C; Nisler, A L; Bicknese, A S; Gould, L H

    2017-03-01

    Although most non-typhoidal Salmonella illnesses are self-limiting, antimicrobial treatment is critical for invasive infections. To describe resistance in Salmonella that caused foodborne outbreaks in the United States, we linked outbreaks submitted to the Foodborne Disease Outbreak Surveillance System to isolate susceptibility data in the National Antimicrobial Resistance Monitoring System. Resistant outbreaks were defined as those linked to one or more isolates with resistance to at least one antimicrobial drug. Multidrug resistant (MDR) outbreaks had at least one isolate resistant to three or more antimicrobial classes. Twenty-one per cent (37/176) of linked outbreaks were resistant. In outbreaks attributed to a single food group, 73% (16/22) of resistant outbreaks and 46% (31/68) of non-resistant outbreaks were attributed to foods from land animals (P < 0·05). MDR Salmonella with clinically important resistance caused 29% (14/48) of outbreaks from land animals and 8% (3/40) of outbreaks from plant products (P < 0·01). In our study, resistant Salmonella infections were more common in outbreaks attributed to foods from land animals than outbreaks from foods from plants or aquatic animals. Antimicrobial susceptibility data on isolates from foodborne Salmonella outbreaks can help determine which foods are associated with resistant infections.

  9. Reproductive and developmental costs of deltamethrin resistance in the Chagas disease vector Triatoma infestans.

    PubMed

    Germano, Mónica Daniela; Inés Picollo, María

    2015-06-01

    Effective chemical control relies on reducing vector population size. However, insecticide selection pressure is often associated with the development of resistant populations that reduce control success. In treated areas, these resistant individuals present an adaptive advantage due to enhanced survival. Resistance can also lead to negative effects when the insecticide pressure ceases. In this study, the biological effects of deltamethrin resistance were assessed in the Chagas disease vector Triatoma infestans. The length of each developmental stage and complete life cycle, mating rate, and fecundity were evaluated. Susceptible and resistant insects presented similar mating rates. A reproductive cost of resistance was expressed as a lower fecundity in the resistant colony. Developmental costs in the resistant colony were in the form of a shortening of the second and third nymph stage duration and an extension of the fifth stage. A maternal effect of deltamethrin resistance is suggested as these effects were identified in resistant females and their progeny independently of the mated male's deltamethrin response. Our results suggest the presence of pleiotropic effects of deltamethrin resistance. Possible associations of these characters to other traits such as developmental delays and behavioral resistance are discussed.

  10. [The White man's burden - a case study caught between bipolar affective disorder and Huntington's disease].

    PubMed

    Nowidi, K; Kunisch, R; Bouna-Pyrrou, P; Meißner, D; Hennig-Fast, K; Weindl, A; Förster, S; Neuhann, T M; Falkai, P; Berger, M; Musil, R

    2013-06-01

    We report upon a case of a 55 year old patient with a bipolar affective disorder, presenting herself with a depressive symptomatology in addition to a severe motor perturbation. The main emphasis upon admittance was perfecting and improving her latest medication. Four weeks prior to her stay at our clinic a thorough neurological examination had taken place in terms of an invalidity pension trial which did not result in any diagnostic findings. Therefore a neurological disease seemed at first highly unlikely. Even though the prior testing was negative, the ensuing neurological examination at our clinic resulted in movement disorders very much indicative of Huntington's Disease. A detailed investigation in regards to the particular family history of the patient was positive for Huntington's Disease. However, whether the patient's mother had also been a genetic carrier of Huntington's Disease was still unknown at the time the patient was admitted to our clinic. It was nevertheless discovered that her mother had also suffered from a bipolar affective disorder. A genetic testing that followed the neurological examination of the patient proved positive for Huntington's Disease. Neuro-imaging resulted in a bicaudate-index of 2.4 (the critical value is 1.8). In a clinical psychological test battery the ensuing results were highly uncommon for patients with solely a bipolar affective disorder people. Under the medical regimen of Quetiapine, Citalopram and Tiaprid the patient's mood could be stabilized and there was some improvement of her motor pertubation.

  11. Pyrethroid resistance in Aedes aegypti and Aedes albopictus: Important mosquito vectors of human diseases.

    PubMed

    Smith, Letícia B; Kasai, Shinji; Scott, Jeffrey G

    2016-10-01

    Aedes aegypti and A. albopictus mosquitoes are vectors of important human disease viruses, including dengue, yellow fever, chikungunya and Zika. Pyrethroid insecticides are widely used to control adult Aedes mosquitoes, especially during disease outbreaks. Herein, we review the status of pyrethroid resistance in A. aegypti and A. albopictus, mechanisms of resistance, fitness costs associated with resistance alleles and provide suggestions for future research. The widespread use of pyrethroids has given rise to many populations with varying levels of resistance worldwide, albeit with substantial geographical variation. In adult A. aegypti and A. albopictus, resistance levels are generally lower in Asia, Africa and the USA, and higher in Latin America, although there are exceptions. Susceptible populations still exist in several areas of the world, particularly in Asia and South America. Resistance to pyrethroids in larvae is also geographically widespread. The two major mechanisms of pyrethroid resistance are increased detoxification due to P450-monooxygenases, and mutations in the voltage sensitive sodium channel (Vssc) gene. Several P450s have been putatively associated with insecticide resistance, but the specific P450s involved are not fully elucidated. Pyrethroid resistance can be due to single mutations or combinations of mutations in Vssc. The presence of multiple Vssc mutations can lead to extremely high levels of resistance. Suggestions for future research needs are presented.

  12. Clinical Characteristics and Treatment Outcomes of Patients with Macrolide-Resistant Mycobacterium massiliense Lung Disease.

    PubMed

    Choi, Hayoung; Kim, Su-Young; Lee, Hyun; Jhun, Byung Woo; Park, Hye Yun; Jeon, Kyeongman; Kim, Dae Hun; Huh, Hee Jae; Ki, Chang-Seok; Lee, Nam Yong; Lee, Seung-Heon; Shin, Sung Jae; Daley, Charles L; Koh, Won-Jung

    2017-02-01

    Macrolide antibiotics are cornerstones in the treatment of Mycobacterium massiliense lung disease. Despite the emergence of resistance, limited data on macrolide-resistant M massiliense lung disease are available. This study evaluated the clinical features and treatment outcomes of patients and the molecular characteristics of macrolide-resistant M massiliense isolates. We performed a retrospective review of medical records and genetic analyses of clinical isolates from 15 patients who had macrolide-resistant M massiliense lung disease between September 2005 and February 2015. Nine patients (60%) had the nodular bronchiectatic form of the disease, and six (40%) had the fibrocavitary form. Before the detection of macrolide resistance, three patients (20%) were treated with macrolide monotherapy, four (27%) with therapy for presumed Mycobacterium avium complex infections, and eight (53%) with combination antibiotic therapy for M massiliense lung disease. The median treatment duration after the detection of resistance was 18.7 months (interquartile range, 11.2 to 39.8 months). Treatment outcomes were poor, with a favorable outcome being achieved for only one patient (7%), who underwent surgery in addition to antibiotic therapy. The 1-, 3-, and 5-year mortality rates were 7, 13, and 33%, respectively. Of the 15 clinical isolates, 14 (93%) had point mutations at position 2058 (n = 9) or 2059 (n = 5) of the 23S rRNA gene, resulting in macrolide resistance. Our study indicates that treatment outcomes are poor and mortality rates are high after the development of macrolide resistance in patients with M massiliense lung disease. Thus, preventing the development of macrolide resistance should be a key consideration during treatment.

  13. Gingival fibroblasts resist apoptosis in response to oxidative stress in a model of periodontal diseases

    PubMed Central

    Cheng, R; Choudhury, D; Liu, C; Billet, S; Hu, T; Bhowmick, NA

    2015-01-01

    Periodontal diseases are classified as inflammation affecting the supporting tissue of teeth, which eventually leads to tooth loss. Mild reversible gingivitis and severe irreversible periodontitis are the most common periodontal diseases. Periodontal pathogens initiate the diseases. The bacterial toxin, lipopolysaccharide (LPS), triggers the inflammatory response and leads to oxidative stress. However, the progress of oxidative stress in periodontal diseases is unknown. The purpose of this study is to examine oxidative stress and cell damage in gingivitis and periodontitis. Our results showed that LPS increases reactive oxygen species (ROS) accumulation in gingival fibroblast (GF). However, oxidative stress resulting from excessive ROS did not influence DNA damage and cell apoptosis within 24 h. The mechanism may be related to the increased expression of DNA repair genes, Ogg1, Neil1 and Rad50. Detection of apoptosis-related proteins also showed anti-apoptotic effects and pro-apoptotic effects were balanced. The earliest damage appeared in DNA when increased γH2AX, an early biomarker for DNA damage, was detected in the LPS group after 48 h. Later, when recurrent inflammation persisted, 8-OHdG, a biomarker for oxidative stress was much higher in periodontitis model compared to the control in vivo. Staining of 8-OHdG in human periodontitis specimens confirmed the results. Furthermore, TUNEL staining of apoptotic cells indicated that the periodontitis model induced more cell apoptosis in gingival tissue. This suggested GF could resist early and acute inflammation (gingivitis), which was regarded as reversible, but recurrent and chronic inflammation (periodontitis) led to permanent cell damage and death. PMID:27551475

  14. [Creation of Blast Disease-Resistant Rice Sorts with Modern DNA-Markers].

    PubMed

    Dubina, E V; Mukhina, Zh M; Kharitonov, E M; Shilovskiy, V N; Kharchenko, E S; Esaulova, L V; Korkina, N N; Maximenko, E P; Nikitina, I B

    2015-08-01

    Based on modern technologies of molecular DNA-markers, blast disease-resistance genes (Pi-ta, Pi-b, Pi-1, Pi-2, and Pi-33) were introgressed and pyramided into domestic rice varieties to give them long-term disease resistance. For that purpose, this case study uses SSR-markers closely linked to these genes, as well as intragenic markers of genes Pi-ta and Pi-b. Multiplex PCR systems were created for simultaneous identification of two resistance genes in the hybrid progeny for the following combinations: Pi-1 + Pi-2, Pi-ta + Pi-b, Pi-ta + Pi-33.

  15. Efficient dsRNA-mediated transgenic resistance to Beet necrotic yellow vein virus in sugar beets is not affected by other soilborne and aphid-transmitted viruses.

    PubMed

    Lennefors, Britt-Louise; van Roggen, Petra M; Yndgaard, Flemming; Savenkov, Eugene I; Valkonen, Jari P T

    2008-04-01

    Rhizomania caused by Beet necrotic yellow vein virus (BNYVV) is one of the most devastating sugar beet diseases. Sugar beet plants engineered to express a 0.4 kb inverted repeat construct based on the BNYVV replicase gene accumulated the transgene mRNA to similar levels in leaves and roots, whereas accumulation of the transgene-homologous siRNA was more pronounced in roots. The roots expressed high levels of resistance to BNYVV transmitted by the vector, Polymyxa betae. Resistance to BNYVV was not decreased following co-infection of the plants with Beet soil borne virus and Beet virus Q that share the same vector with BNYVV. Similarly, co-infection with the aphid-transmitted Beet mild yellowing virus, Beet yellows virus (BYV), or with all of the aforementioned viruses did not affect the resistance to BNYVV, while they accumulated in roots. These viruses are common in most of the sugar beet growing areas in Europe and world wide. However, there was a competitive interaction between BYV and BMYV in sugar beet leaves, as infection with BYV decreased the titres of BMYV. Other interactions between the viruses studied were not observed. The results suggest that the engineered resistance to BNYVV expressed in the sugar beets of this study is efficient in roots and not readily compromised following infection of the plants with heterologous viruses.

  16. Ecosystem screening approach for pathogen-associated microorganisms affecting host disease.

    PubMed

    Galiana, Eric; Marais, Antoine; Mura, Catherine; Industri, Benoît; Arbiol, Gilles; Ponchet, Michel

    2011-09-01

    The microbial community in which a pathogen evolves is fundamental to disease outcome. Species interacting with a pathogen on the host surface shape the distribution, density, and genetic diversity of the inoculum, but the role of these species is rarely determined. The screening method developed here can be used to characterize pathogen-associated species affecting disease. This strategy involves three steps: (i) constitution of the microbial community, using the pathogen as a trap; (ii) community selection, using extracts from the pathogen as the sole nutrient source; and (iii) molecular identification and the screening of isolates focusing on their effects on the growth of the pathogen in vitro and host disease. This approach was applied to a soilborne plant pathogen, Phytophthora parasitica, structured in a biofilm, for screening the microbial community from the rhizosphere of Nicotiana tabacum (the host). Two of the characterized eukaryotes interfered with the oomycete cycle and may affect the host disease. A Vorticella species acted through a mutualistic interaction with P. parasitica, disseminating pathogenic material by leaving the biofilm. A Phoma species established an amensal interaction with P. parasitica, strongly suppressing disease by inhibiting P. parasitica germination. This screening method is appropriate for all nonobligate pathogens. It allows the definition of microbial species as promoters or suppressors of a disease for a given biotope. It should also help to identify important microbial relationships for ecology and evolution of pathogens.

  17. A Nomadic Subtelomeric Disease Resistance Gene Cluster in Common Bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The B4 resistance (R)-gene cluster, located in subtelomeric region of chromosome 4, is one of the largest clusters known in common bean (Phaseolus vulgaris, Pv). We sequenced 650 kb spanning this locus and annotated 97 genes, 26 of which correspond to Coiled-coil-Nucleotide-Binding-Site-Leucine-Rich...

  18. Fosfomycin resistance plasmids do not affect fosfomycin transport into Escherichia coli.

    PubMed Central

    León, J; García-Lobo, J M; Ortiz, J M

    1982-01-01

    Escherichia coli cells carrying fosfomycin resistance plasmids were able to take up fosfomycin from the medium to the same extent as plasmid-free bacteria. The antibiotic entered the plasmid-harboring cells by means of the glpT and uhp transport systems, as is the case with susceptible bacteria. Active fosfomycin could be detected in soluble extracts of cells which had previously been incubated in the presence of the antibiotic. Furthermore, fosfomycin resistance plasmids did not confer on E. coli cells resistance to the novel antibiotic FR-31564, which is incorporated by the same transport systems as fosfomycin. We conclude that, in contrast to chromosomal resistance mutants, altered transport does not play a role in the plasmid-encoded fosfomycin resistance mechanism. PMID:7044304

  19. Glyphosate Effects on Plant Mineral Nutrition, Crop Rhizosphere Microbiota, and Plant Disease in Glyphosate-Resistant Crops

    PubMed Central

    2012-01-01

    Claims have been made recently that glyphosate-resistant (GR) crops sometimes have mineral deficiencies and increased plant disease. This review evaluates the literature that is germane to these claims. Our conclusions are: (1) although there is conflicting literature on the effects of glyphosate on mineral nutrition on GR crops, most of the literature indicates that mineral nutrition in GR crops is not affected by either the GR trait or by application of glyphosate; (2) most of the available data support the view that neither the GR transgenes nor glyphosate use in GR crops increases crop disease; and (3) yield data on GR crops do not support the hypotheses that there are substantive mineral nutrition or disease problems that are specific to GR crops. PMID:23013354

  20. ramR mutations affecting fluoroquinolone susceptibility in epidemic multidrug-resistant Salmonella enterica serovar Kentucky ST198.

    PubMed

    Baucheron, Sylvie; Le Hello, Simon; Doublet, Benoît; Giraud, Etienne; Weill, François-Xavier; Cloeckaert, Axel

    2013-01-01

    A screening for non-target mutations affecting fluoroquinolone susceptibility was conducted in epidemic multidrug-resistant Salmonella enterica serovar Kentucky ST198. Among a panel of representative isolates (n = 27), covering the epidemic, only three showed distinct mutations in ramR resulting in enhanced expression of genes encoding the AcrAB-TolC efflux system and low increase in ciprofloxacin MIC. No mutations were detected in other regulatory regions of this efflux system. Ciprofloxacin resistance in serovar Kentucky ST198 is thus currently mainly due to multiple target gene mutations.

  1. Induced resistance – does it have potential as a tool in pecan disease management?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pecan scab (Fusicladium effusum) causes losses of pecan nutmeat yield and quality in the southeastern US. New methods are needed to manage the disease. Plants possess resistance mechanisms that can be activated in response to infection with certain diseases (or damage from a pest). These mechanisms ...

  2. QTLs analysis for resistance to blast disease in US weedy rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding the genetic architecture of adaptation is of great importance in evolutionary biology. US weedy rice is well-adapted to the local conditions in US rice fields. Rice blast disease is one of the most destructive diseases of cultivated rice worldwide. However, information about resistance...

  3. Overexpression of a citrus NDR1 ortholog increases disease resistance in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging devastating diseases, such as Huanglongbing (HLB) and citrus canker, have caused tremendous losses to the citrus industry worldwide. Genetic engineering is a powerful approach that could allow us to increase citrus resistance against these diseases. The key to the success of this approach r...

  4. Toward The identification Of candidate genes involved in black pod disease resistance in Theobroma cacao L.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing yield, quality and disease resistance are important objectives for cacao breeding programs. Some of the diseases, such as black pod rot (Phytophtora spp), frosty pod (Moniliophthora roreri) and witches’ broom (M. perniciosa), produce significant losses in all or in some of the various pro...

  5. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

  6. Production of transgenic citrus resistant to citrus canker and Huanglongbing diseases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Huanglongbing (HLB or citrus greening disease) caused by Candidatus Liberibacter asiaticus (Las) is a great threat to the U.S. citrus industry. There are no proven strategies to eliminate HLB disease and no cultivars identified with strong HLB resistance. Citrus canker is also an economically import...

  7. Overexpression of a modified plant thionin enhances disease resistance to citrus canker and Huanglongbing (HLB)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Huanglongbing (HLB or citrus greening disease) caused by Candidatus Liberibacter asiaticus (Las) is a great threat to the United States citrus industry. There are no proven strategies to eliminate HLB disease and no cultivar has been identified with strong HLB resistance. Citrus canker is also an ec...

  8. The relationships of sleep apnea, hypertension, and resistant hypertension on chronic kidney disease.

    PubMed

    Chang, Chih-Ping; Li, Tsai-Chung; Hang, Liang-Wen; Liang, Shinn-Jye; Lin, Jen-Jyn; Chou, Che-Yi; Tsai, Jeffrey J P; Ko, Po-Yen; Chang, Chiz-Tzung

    2016-06-01

    Hypertension, blood pressure variation, and resistant hypertension have close relations to sleep apnea, which lead to target organ damage, including the kidney. The complex relationships between sleep apnea and blood pressure cause their interactions with chronic kidney disease ambiguous. The aim of the study was to elucidate the separate and joint effects of sleep apnea, hypertension, and resistant hypertension on chronic kidney disease. A cross-sectional study was done to see the associations of sleep apnea, hypertension, and resistant hypertension with chronic kidney disease in 998 subjects underwent overnight polysomnography without device-therapy or surgery for their sleep-disordered breathing. Multivariate logistic regression was used to analyze the severity of SA, hypertension stage, resistant hypertension, and their joint effects on CKD. The multivariable relative odds (95% CI) of chronic kidney disease for the aged (age ≥65 years), severe sleep apnea, stage III hypertension, and resistant hypertension were 3.96 (2.57-6.09) (P < 0.001), 2.28 (1.13-4.58) (P < 0.05), 3.55 (1.70-7.42) (P < 0.001), and 9.42 (4.22-21.02) (P < 0.001), respectively. In subgroups analysis, the multivariable relative odds ratio of chronic kidney disease was highest in patients with both resistant hypertension and severe sleep apnea [13.42 (4.74-38.03)] (P < 0.001). Severe sleep apnea, stage III hypertension, and resistant hypertension are independent risk factors for chronic kidney disease. Patients with both severe sleep apnea and resistant hypertension have the highest risks.

  9. Demography, disease and the devil: life-history changes in a disease-affected population of Tasmanian devils (Sarcophilus harrisii).

    PubMed

    Lachish, Shelly; McCallum, Hamish; Jones, Menna

    2009-03-01

    1. Examining the demographic responses of populations to disease epidemics and the nature of compensatory responses to perturbation from epidemics is critical to our understanding of the processes affecting population dynamics and our ability to conserve threatened species. Such knowledge is currently available for few systems. 2. We examined changes to the demography and life-history traits of a population of Tasmanian devils (Sarcophilus harrisii) following the arrival of a debilitating infectious disease, devil facial tumour disease (DFTD), and investigated the population's ability to compensate for the severe population perturbation caused by this epizootic. 3. There was a significant change to the age structure following the arrival of DFTD to the Freycinet Peninsula. This shift to a younger population was caused by the loss of older individuals from the population as a direct consequence of DFTD-driven declines in adult survival rates. 4. Offspring sex ratios of disease mothers were more female biased than those of healthy mothers, indicating that devils may facultatively adjust offspring sex ratios in response to disease-induced changes in maternal condition. 5. We detected evidence of reproductive compensation in response to disease impacts via a reduction in the age of sexual maturity of females (an increase in precocial breeding) over time. 6. The strength of this compensatory response appeared to be limited by factors that constrain the ability of individuals to reach a critical size for sexual maturity in their first year, because of the time limit dictated by the annual breeding season. 7. The ongoing devastating impacts of this disease for adult survival and the apparent reliance of precocial breeding on rapid early growth provide the opportunity for evolution to favour of this new life-history pattern, highlighting the potential for novel infectious diseases to be strong selective forces on life-history evolution.

  10. Antimicrobial resistance of Staphylococcus pseudintermedius isolates from healthy dogs and dogs affected with pyoderma in Japan.

    PubMed

    Onuma, Kenta; Tanabe, Taishi; Sato, Hisaaki

    2012-02-01

    Staphylococcus pseudintermedius strains were isolated from healthy dogs and dogs with pyoderma in 2000-2002 and 2009. All the isolates from dogs with pyoderma in 1999-2000 and from healthy dogs in 2000-2002 and 2009 were susceptible to cefalexin and/or other cephalosporins and oxacillin. However, 7.1-12.5 and 11.4% of S. pseudintermedius isolates from dogs with pyoderma in 2009 were resistant to cephalosporins and oxacillin, respectively. All S. pseudintermedius isolates from dogs with pyoderma in 1999-2000 and those from healthy dogs in 2000-2002 were susceptible to fluoroquinolones; however, 50% of the S. pseudintermedius strains isolated from dogs with pyoderma in 2009 and 30% of the S. pseudintermedius strains isolated from healthy dogs in 2009 were resistant to fluoroquinolones. Of the 21 oxacillin-resistant S. pseudintermedius (MRSP) isolates, 11 carried SCCmec type V and 10 carried hybrid SCCmec types II-III. Staphylococcus pseudintermedius strains that were resistant to only one of three fluoroquinolones had a mutation in the quinolone resistance determination region of grlA, whereas S. pseudintermedius strains that were resistant to two or more fluoroquinolones had mutations in the quinolone resistance determination regions of both grlA and gyrA.

  11. How do economic crises affect migrants’ risk of infectious disease? A systematic-narrative review

    PubMed Central

    Karanikolos, Marina; Williams, Gemma; Mladovsky, Philipa; King, Lawrence; Pharris, Anastasia; Suk, Jonathan E.; Hatzakis, Angelos; McKee, Martin; Noori, Teymur; Stuckler, David

    2015-01-01

    Background: It is not well understood how economic crises affect infectious disease incidence and prevalence, particularly among vulnerable groups. Using a susceptible-infected-recovered framework, we systematically reviewed literature on the impact of the economic crises on infectious disease risks in migrants in Europe, focusing principally on HIV, TB, hepatitis and other STIs. Methods: We conducted two searches in PubMed/Medline, Web of Science, Cochrane Library, Google Scholar, websites of key organizations and grey literature to identify how economic changes affect migrant populations and infectious disease. We perform a narrative synthesis in order to map critical pathways and identify hypotheses for subsequent research. Results: The systematic review on links between economic crises and migrant health identified 653 studies through database searching; only seven met the inclusion criteria. Fourteen items were identified through further searches. The systematic review on links between economic crises and infectious disease identified 480 studies through database searching; 19 met the inclusion criteria. Eight items were identified through further searches. The reviews show that migrant populations in Europe appear disproportionately at risk of specific infectious diseases, and that economic crises and subsequent responses have tended to exacerbate such risks. Recessions lead to unemployment, impoverishment and other risk factors that can be linked to the transmissibility of disease among migrants. Austerity measures that lead to cuts in prevention and treatment programmes further exacerbate infectious disease risks among migrants. Non-governmental health service providers occasionally stepped in to cater to specific populations that include migrants. Conclusions: There is evidence that migrants are especially vulnerable to infectious disease during economic crises. Ring-fenced funding of prevention programs, including screening and treatment, is important for

  12. Disease resistance is related to inherent swimming performance in Atlantic salmon

    PubMed Central

    2013-01-01

    Background Like humans, fish can be classified according to their athletic performance. Sustained exercise training of fish can improve growth and physical capacity, and recent results have documented improved disease resistance in exercised Atlantic salmon. In this study we investigated the effects of inherent swimming performance and exercise training on disease resistance in Atlantic salmon. Atlantic salmon were first classified as either poor or good according to their swimming performance in a screening test and then exercise trained for 10 weeks using one of two constant-velocity or two interval-velocity training regimes for comparison against control trained fish (low speed continuously). Disease resistance was assessed by a viral disease challenge test (infectious pancreatic necrosis) and gene expression analyses of the host response in selected organs. Results An inherently good swimming performance was associated with improved disease resistance, as good swimmers showed significantly better survival compared to poor swimmers in the viral challenge test. Differences in mortalities between poor and good swimmers were correlated with cardiac mRNA expression of virus responsive genes reflecting the infection status. Although not significant, fish trained at constant-velocity showed a trend towards higher survival than fish trained at either short or long intervals. Finally, only constant training at high intensity had a significant positive effect on fish growth compared to control trained fish. Conclusions This is the first evidence suggesting that inherent swimming performance is associated with disease resistance in fish. PMID:23336751

  13. Behavioral Avoidance - Will Physiological Insecticide Resistance Level of Insect Strains Affect Their Oviposition and Movement Responses?

    PubMed

    Nansen, Christian; Baissac, Olivier; Nansen, Maria; Powis, Kevin; Baker, Greg

    2016-01-01

    Agricultural organisms, such as insect herbivores, provide unique opportunities for studies of adaptive evolutionary processes, including effects of insecticides on movement and oviposition behavior. In this study, Brassica leaves were treated with one of two non-systemic insecticides and exposed to two individual strains (referred to as single or double resistance) of diamondback moth (Plutella xylostella) (DBM) exhibiting physiological resistance. Behavioral responses by these two strains were compared as part of characterizing the relative effect of levels of physiological resistance on the likelihood of insects showing signs of behavioral avoidance. For each DBM strain, we used choice bioassays to quantify two possible types of behavioral avoidance: 1) females ovipositing predominantly on leaf surfaces without insecticides, and 2) larvae avoiding insecticide-treated leaf surfaces. In three-choice bioassays (leaves with no pesticide, 50% coverage with pesticide, or 100% coverage with pesticide), females from the single resistance DBM strain laid significantly more eggs on water treated leaves compared to leaves with 100% insecticide coverage (both gamma-cyhalothrin and spinetoram). Females from the double resistance DBM strain also laid significantly more eggs on water treated leaves compared to leaves with 100% gamma-cyhalothrin, while moths did not adjust their oviposition behavior in response to spinetoram. Larvae from the single resistance DBM strain showed a significant increase in mobility in response to both insecticides and avoided insecticide-treated portions of leaves when given a choice. On the other hand, DBM larvae from the double resistance strain showed a significant decrease in mobility in response to insecticides, and they did not avoid insecticide-treated portions of leaves when given a choice. Our results suggest that pest populations with physiological resistance may show behavioral avoidance, as resistant females avoided oviposition on

  14. Behavioral Avoidance - Will Physiological Insecticide Resistance Level of Insect Strains Affect Their Oviposition and Movement Responses?

    PubMed Central

    Nansen, Christian; Baissac, Olivier; Nansen, Maria; Powis, Kevin; Baker, Greg

    2016-01-01

    Agricultural organisms, such as insect herbivores, provide unique opportunities for studies of adaptive evolutionary processes, including effects of insecticides on movement and oviposition behavior. In this study, Brassica leaves were treated with one of two non-systemic insecticides and exposed to two individual strains (referred to as single or double resistance) of diamondback moth (Plutella xylostella) (DBM) exhibiting physiological resistance. Behavioral responses by these two strains were compared as part of characterizing the relative effect of levels of physiological resistance on the likelihood of insects showing signs of behavioral avoidance. For each DBM strain, we used choice bioassays to quantify two possible types of behavioral avoidance: 1) females ovipositing predominantly on leaf surfaces without insecticides, and 2) larvae avoiding insecticide-treated leaf surfaces. In three-choice bioassays (leaves with no pesticide, 50% coverage with pesticide, or 100% coverage with pesticide), females from the single resistance DBM strain laid significantly more eggs on water treated leaves compared to leaves with 100% insecticide coverage (both gamma-cyhalothrin and spinetoram). Females from the double resistance DBM strain also laid significantly more eggs on water treated leaves compared to leaves with 100% gamma-cyhalothrin, while moths did not adjust their oviposition behavior in response to spinetoram. Larvae from the single resistance DBM strain showed a significant increase in mobility in response to both insecticides and avoided insecticide-treated portions of leaves when given a choice. On the other hand, DBM larvae from the double resistance strain showed a significant decrease in mobility in response to insecticides, and they did not avoid insecticide-treated portions of leaves when given a choice. Our results suggest that pest populations with physiological resistance may show behavioral avoidance, as resistant females avoided oviposition on

  15. Transient lactose malabsorption in patients affected by symptomatic uncomplicated diverticular disease of the colon.

    PubMed

    Tursi, Antonio; Brandimarte, Giovanni; Giorgetti, Gian Marco; Elisei, Walter

    2006-03-01

    Lactose malabsorption (LM) may be secondary to several small bowel diseases, and small intestinal overgrowth (SIBO) may be one of them. We looked for a correlation between symptomatic diverticular disease of the colon and LM and assessed whether this correlation may be related to SIBO. Ninety consecutive patients (pts; 39 males, 51 females; mean age, 67.2 years; range, 32-91 years) affected by symptomatic uncomplicated diverticular disease of the colon were evaluated to assess orocecal transit time (OCTT), SIBO, and LM by lactulose and lactose H2 breath test (H2-BT) at entry and after 8 weeks of treatment. OCTT was delayed in 67 of 90 pts (74.44%). Fifty-three of 90 pts (58.88%) showed SIBO, and OCTT was normal in 23 of 90 pts (25.56%). LM was diagnosed in 59 of 90 pts (65.55%): 49 of 59 (71.74%) were simultaneously affected by SIBO and delayed OCTT (and thus 49 of 53 pts [92.45%] with delayed OCTT and SIBO were affected by LM); 3 of 59 pts (5.09%) showed only delayed OCTT; 7 of 59 pts (11.86%) did not show either SIBO or delayed OCTT. The association of LM and SIBO was statistically significant (P < 0.001). Seventy-nine of 86 pts (91.86%) showed normal OCTT, while OCTT remained prolonged but shorter in the remaining 7 pts (8.14%). SIBO was eradicated in all pts completing the study, while a new lactulose H2-BT showed persistence of SIBO in one pt with recurrence of symptomatic diverticular disease. Forty-seven of 59 pts (79.66%) had a normal lactose H2-BT (P < 0.002), while 12 of 59 pts (20.34%) showed persistence of LM. LM disappeared in 46 of 49 pts (93.88%) concurrently with normalization of OCTT and eradication of SIBO (P < 0.002); it also disappeared in 1 of 3 pts (33.33%) previously affected by delayed OCTT (without SIBO) and LM concurrently with normalization of OCTT. On the contrary, it persisted in all pts with normal OCTT and absence of SIBO. Moreover, it persisted also in the pt with recurrence of symptomatic diverticular disease and persistence of SIBO

  16. Application of Infrared and Raman Spectroscopy for the Identification of Disease Resistant Trees.

    PubMed

    Conrad, Anna O; Bonello, Pierluigi

    2015-01-01

    New approaches for identifying disease resistant trees are needed as the incidence of diseases caused by non-native and invasive pathogens increases. These approaches must be rapid, reliable, cost-effective, and should have the potential to be adapted for high-throughput screening or phenotyping. Within the context of trees and tree diseases, we summarize vibrational spectroscopic and chemometric methods that have been used to distinguish between groups of trees which vary in disease susceptibility or other important characteristics based on chemical fingerprint data. We also provide specific examples from the literature of where these approaches have been used successfully. Finally, we discuss future application of these approaches for wide-scale screening and phenotyping efforts aimed at identifying disease resistant trees and managing forest diseases.

  17. Application of Infrared and Raman Spectroscopy for the Identification of Disease Resistant Trees

    PubMed Central

    Conrad, Anna O.; Bonello, Pierluigi

    2016-01-01

    New approaches for identifying disease resistant trees are needed as the incidence of diseases caused by non-native and invasive pathogens increases. These approaches must be rapid, reliable, cost-effective, and should have the potential to be adapted for high-throughput screening or phenotyping. Within the context of trees and tree diseases, we summarize vibrational spectroscopic and chemometric methods that have been used to distinguish between groups of trees which vary in disease susceptibility or other important characteristics based on chemical fingerprint data. We also provide specific examples from the literature of where these approaches have been used successfully. Finally, we discuss future application of these approaches for wide-scale screening and phenotyping efforts aimed at identifying disease resistant trees and managing forest diseases. PMID:26779211

  18. An Assessment of Antimicrobial Resistant Disease Threats in Canada

    PubMed Central

    Garner, Michael J.; Carson, Carolee; Lingohr, Erika J.; Fazil, Aamir; Edge, Victoria L.; Trumble Waddell, Jan

    2015-01-01

    Background Antimicrobial resistance (AMR) of infectious agents is a growing concern for public health organizations. Given the complexity of this issue and how widespread the problem has become, resources are often insufficient to address all concerns, thus prioritization of AMR pathogens is essential for the optimal allocation of risk management attention. Since the epidemiology of AMR pathogens differs between countries, country-specific assessments are important for the determination of national priorities. Objective To develop a systematic and transparent approach to AMR risk prioritization in Canada. Methods Relevant AMR pathogens in Canada were selected through a transparent multi-step consensus process (n=32). Each pathogen was assessed using ten criteria: incidence, mortality, case-fatality, communicability, treatability, clinical impact, public/political attention, ten-year projection of incidence, economic impact, and preventability. For each pathogen, each criterion was assigned a numerical score of 0, 1, or 2, and multiplied by criteria-specific weighting determined through researcher consensus of importance. The scores for each AMR pathogen were summed and ranked by total score, where a higher score indicated greater importance. A sensitivity analysis was conducted to determine the effects of changing the criteria-specific weights. Results The AMR pathogen with the highest total weighted score was extended spectrum B-lactamase-producing (ESBL) Enterobacteriaceae (score=77). When grouped by percentile, ESBL Enterobacteriaceae, Clostridium difficile, carbapenem-resistant Enterobacteriaceae, and methicillin-resistant Staphylococcus aureus were in the 80-100th percentile. Conclusion This assessment provides useful information for prioritising public health strategies regarding AMR resistance at the national level in Canada. As the AMR environment and challenges change over time and space, this systematic and transparent approach can be adapted for use by

  19. Effects of a disease affecting a predator on the dynamics of a predator-prey system.

    PubMed

    Auger, Pierre; McHich, Rachid; Chowdhury, Tanmay; Sallet, Gauthier; Tchuente, Maurice; Chattopadhyay, Joydev

    2009-06-07

    We study the effects of a disease affecting a predator on the dynamics of a predator-prey system. We couple an SIRS model applied to the predator population, to a Lotka-Volterra model. The SIRS model describes the spread of the disease in a predator population subdivided into susceptible, infected and removed individuals. The Lotka-Volterra model describes the predator-prey interactions. We consider two time scales, a fast one for the disease and a comparatively slow one for predator-prey interactions and for predator mortality. We use the classical "aggregation method" in order to obtain a reduced equivalent model. We show that there are two possible asymptotic behaviors: either the predator population dies out and the prey tends to its carrying capacity, or the predator and prey coexist. In this latter case, the predator population tends either to a "disease-free" or to a "disease-endemic" state. Moreover, the total predator density in the disease-endemic state is greater than the predator density in the "disease-free" equilibrium (DFE).

  20. Evidence of Multiple Disease Resistance (MDR) and implication of meta-analysis in marker assisted selection.

    PubMed

    Ali, Farhan; Pan, Qingchun; Chen, Genshen; Zahid, Kashif Rafiq; Yan, Jianbing

    2013-01-01

    Meta-analysis was performed for three major foliar diseases with the aim to find out the total number of QTL responsible for these diseases and depict some real QTL for molecular breeding and marker assisted selection (MAS) in maize. Furthermore, we confirmed our results with some major known disease resistance genes and most well-known gene family of nucleotide binding site (NBS) encoding genes. Our analysis revealed that disease resistance QTL were randomly distributed in maize genome, but were clustered at different regions of the chromosomes. Totally 389 QTL were observed for these three major diseases in diverse maize germplasm, out of which 63 QTL were controlling more than one disease revealing the presence of multiple disease resistance (MDR). 44 real-QTLs were observed based on 4 QTL as standard in a specific region of genome. We also confirmed the Ht1 and Ht2 genes within the region of real QTL and 14 NBS-encoding genes. On chromosome 8 two NBS genes in one QTL were observed and on chromosome 3, several cluster and maximum MDR QTL were observed indicating that the apparent clustering could be due to genes exhibiting pleiotropic effect. Significant relationship was observed between the number of disease QTL and total genes per chromosome based on the reference genome B73. Therefore, we concluded that disease resistance genes are abundant in maize genome and these results can unleash the phenomenon of MDR. Furthermore, these results could be very handy to focus on hot spot on different chromosome for fine mapping of disease resistance genes and MAS.

  1. Association of Osteoprotegerin with Obesity, Insulin Resistance and Non-Alcoholic Fatty Liver Disease in Children

    PubMed Central

    Erol, Meltem; Bostan Gayret, Ozlem; Tekin Nacaroglu, Hikmet; Yigit, Ozgul; Zengi, Oguzhan; Salih Akkurt, Mehmet; Tasdemir, Mehmet

    2016-01-01

    Background Osteoprotegerin (OPG) is a member of the tumor necrosis factor superfamily. Reduced OPG levels are related to obesity, insulin resistance, and non-alcoholic fatty liver disease (NAFLD). Objectives The aim of this study was to evaluate the relationship between OPG levels, obesity, insulin resistance, and NAFLD in pediatric patients. Methods This was a prospective, cross-sectional, controlled study that was conducted in the department of pediatrics at Bagcilar training and research hospital in Istanbul, Turkey, between April and August 2015. The study was performed on 107 children with obesity and 37 controls aged 5 - 17 years. In the obese subset, 62 patients had NAFLD. Homeostatic model assessment-insulin resistance (HOMA-IR) was used to calculate insulin resistance. Insulin resistance was defined as a HOMA-IR value greater than 2.5. Plasma OPG levels were measured using enzyme-linked immunosorbent assays. NAFLD was diagnosed by hepatic ultrasound. Results The mean age was 11.25 ± 3.38 years in the patient group and 10.41 ± 3.15 years in the control group. The OPG level in the obese group with the mean of 55.20 ± 24.55 pg/mL (median = 48.81 pg/mL) was significantly lower than that in the control group with the mean of 70.78 ± 33.41 pg/mL (median = 64.57 pg/mL) (P = 0.0001). The optimal cut-off point (sensitivity, specificity) of the OPG level for the diagnosis of obesity was ≤ 46, 19 pg/mL. According to logistic regression analysis, fasting insulin (P = 0.036) and OPG (P = 0.01) levels were most affected by obesity. In the obese patients, who had HOMA-IR < 2.5, the mean level of OPG was 58.91 ± 6.88729 pg/mL (median = 49.55). In the obese patients, who had HOMA-IR ≥ 2.5, the mean level of OPG was 54.19 ± 22.21 pg/mL (median = 48.47). No significant correlations were found between OPG and HOMA-IR (P = 0.791). No statistically significant difference was observed in the mean OPG between patients with hepatosteatosis (mean = 54.55 ± 25.01 pg

  2. Rifampin resistance of Legionella pneumophila is not increased during therapy for experimental Legionnaires disease: study of rifampin resistance using a guinea pig model of Legionnaires disease.

    PubMed Central

    Edelstein, P H

    1991-01-01

    Isolates of Legionella pneumophila serogroup 1, obtained from guinea pigs with experimentally induced Legionnaires disease, were tested for rifampin resistance. Thirteen isolates were from animals treated with rifampin alone, four isolates were from animals treated with saline, and three isolates each were from animals treated with erythromycin or erythromycin plus rifampin; all of these isolates were derived from the same parent strain, F889. Most of the isolates were obtained from rifampin-treated animals that survived infection but had persistence of bacteria in their lungs at necropsy. No differences in rifampin agar dilution MICs were detected for the 23 isolates and parent strain that were tested. None of the 13 isolates from animals treated with rifampin alone had a high number of resistant organisms detected by using a rifampin gradient plate assay. Thirteen isolates plus the parent strain were tested by using a quantitative method of determining resistance frequency. Considerable heterogeneity among isolates was observed, but there was no evidence of increased resistance for any treatment group. The range of rifampin resistance frequencies was 10(-7) to 10(-8). No evidence for rifampin-induced resistance of L. pneumophila was found in this study. PMID:2014980

  3. Drug Resistance Is Not Directly Affected by Mating Type Locus Zygosity in Candida albicans

    PubMed Central

    Pujol, Claude; Messer, Shawn A.; Pfaller, Michael; Soll, David R.

    2003-01-01

    Recently, evidence was presented that in a collection of fluconazole-resistant strains of Candida albicans there was a much higher proportion of homozygotes for the mating type locus (MTL) than in a collection of fluconazole-sensitive isolates, suggesting the possibility that when cells become MTL homozygous they acquire intrinsic drug resistance. To investigate this possibility, an opposite strategy was employed. First, drug susceptibility was measured in a collection of isolates selected for MTL homozygosity. The majority of these isolates had not been exposed to antifungal drugs. Second, the level of drug susceptibility was compared between spontaneously generated MTL-homozygous progeny and their MTL-heterozygous parent strains which had not been exposed to antifungal drugs. The results demonstrate that naturally occurring MTL-homozygous strains are not intrinsically more drug resistant, supporting the hypotheses that either the higher incidence of MTL homozygosity previously demonstrated among fluconazole-resistant isolates involved associated homozygosity of a drug resistance gene linked to the MTL locus, or that MTL-homozygous strains may be better at developing drug resistance upon exposure to the drug than MTL-heterozygous strains. Furthermore, the results demonstrate that a switch by an MTL-homozygous strain from the white to opaque phenotype, the latter functioning as the facilitator of mating, does not notably alter drug susceptibility. PMID:12654648

  4. Continuous treatment with FTS confers resistance to apoptosis and affects autophagy

    PubMed Central

    Schmukler, Eran; Wolfson, Eya; Elazar, Zvulun; Kloog, Yoel; Pinkas-Kramarski, Ronit

    2017-01-01

    High percentage of human cancers involves alteration or mutation in Ras proteins, including the most aggressive malignancies, such as lung, colon and pancreatic cancers. FTS (Salirasib) is a farnesylcysteine mimetic, which acts as a functional Ras inhibitor, and was shown to exert anti-tumorigenic effects in vitro and in vivo. Previously, we have demonstrated that short-term treatment with FTS also induces protective autophagy in several cancer cell lines. Drug resistance is frequently observed in cancer cells exposed to prolonged treatment, and is considered a major cause for therapy inefficiency. Therefore, in the present study, we examined the effect of a prolonged treatment with FTS on drug resistance of HCT-116 human colon cancer cells, and the involvement of autophagy in this process. We found that cells grown in the presence of FTS for 6 months have become resistant to FTS-induced cell growth inhibition and cell death. Furthermore, we discovered that the resistant cells exhibit altered autophagy, reduced apoptosis and changes in Ras-related signaling pathways following treatment with FTS. Moreover we found that while FTS induces an apoptosis-related cleavage of p62, the FTS-resistant cells were more resistant to apoptosis and p62 cleavage. PMID:28151959

  5. Dynamics of disease resistance polymorphism at the Rpm1 locus of Arabidopsis.

    PubMed

    Stahl, E A; Dwyer, G; Mauricio, R; Kreitman, M; Bergelson, J

    1999-08-12

    The co-evolutionary 'arms race' is a widely accepted model for the evolution of host-pathogen interactions. This model predicts that variation for disease resistance will be transient, and that host populations generally will be monomorphic at disease-resistance (R-gene) loci. However, plant populations show considerable polymorphism at R-gene loci involved in pathogen recognition. Here we have tested the arms-race model in Arabidopsis thaliana by analysing sequences flanking Rpm1, a gene conferring the ability to recognize Pseudomonas pathogens carrying AvrRpm1 or AvrB. We reject the arms-race hypothesis: resistance and susceptibility alleles at this locus have co-existed for millions of years. To account for the age of alleles and the relative levels of polymorphism within allelic classes, we use coalescence theory to model the long-term accumulation of nucleotide polymorphism in the context of the short-term ecological dynamics of disease resistance. This analysis supports a 'trench warfare' hypothesis, in which advances and retreats of resistance-allele frequency maintain variation for disease resistance as a dynamic polymorphism.

  6. Retention of acetylcarnitine in chronic kidney disease causes insulin resistance in skeletal muscle

    PubMed Central

    Miyamoto, Yasunori; Miyazaki, Teruo; Honda, Akira; Shimohata, Homare; Hirayama, Kouichi; Kobayashi, Masaki

    2016-01-01

    Insulin resistance occurs frequently in patients with chronic kidney disease. However, the mechanisms of insulin resistance associated with chronic kidney disease are unclear. It is known that an increase in the mitochondrial acetyl-CoA (AcCoA)/CoA ratio causes insulin resistance in skeletal muscle, and this ratio is regulated by carnitine acetyltransferase that exchanges acetyl moiety between CoA and carnitine. Because excess acetyl moiety of AcCoA is excreted in urine as acetylcarnitine, we hypothesized that retention of acetylcarnitine might be a cause of insulin resistance in chronic kidney disease patients. Serum acetylcarnitine concentrations were measured in chronic kidney disease patients, and were significantly increased with reduction of renal function. The effects of excess extracellular acetylcarnitine on insulin resistance were studied in cultured skeletal muscle cells (C2C12 and human myotubes), and insulin-dependent glucose uptake was significantly and dose-dependently inhibited by addition of acetylcarnitine. The added acetylcarnitine was converted to carnitine via reverse carnitine acetyltransferase reaction, and thus the AcCoA concentration and AcCoA/CoA ratio in mitochondria were significantly elevated. The results suggest that increased serum acetylcarnitine in CKD patients causes AcCoA accumulation in mitochondria by stimulating reverse carnitine acetyltransferase reaction, which leads to insulin resistance in skeletal muscle. PMID:27895387

  7. Review of insecticide resistance and behavioral avoidance of vectors of human diseases in Thailand

    PubMed Central

    2013-01-01

    Physiological resistance and behavioral responses of mosquito vectors to insecticides are critical aspects of the chemical-based disease control equation. The complex interaction between lethal, sub-lethal and excitation/repellent ('excito-repellent’) properties of chemicals is typically overlooked in vector management and control programs. The development of “physiological” resistance, metabolic and/or target site modifications, to insecticides has been well documented in many insect groups and disease vectors around the world. In Thailand, resistance in many mosquito populations has developed to all three classes of insecticidal active ingredients currently used for vector control with a majority being synthetic-derived pyrethroids. Evidence of low-grade insecticide resistance requires immediate countermeasures to mitigate further intensification and spread of the genetic mechanisms responsible for resistance. This can take the form of rotation of a different class of chemical, addition of a synergist, mixtures of chemicals or concurrent mosaic application of different classes of chemicals. From the gathered evidence, the distribution and degree of physiological resistance has been restricted in specific areas of Thailand in spite of long-term use of chemicals to control insect pests and disease vectors throughout the country. Most surprisingly, there have been no reported cases of pyrethroid resistance in anopheline populations in the country from 2000 to 2011. The precise reasons for this are unclear but we assume that behavioral avoidance to insecticides may play a significant role in reducing the selection pressure and thus occurrence and spread of insecticide resistance. The review herein provides information regarding the status of physiological resistance and behavioral avoidance of the primary mosquito vectors of human diseases to insecticides in Thailand from 2000 to 2011. PMID:24294938

  8. Acquired immunity and stochasticity in epidemic intervals impede the evolution of host disease resistance.

    PubMed

    Harding, Karin C; Hansen, B Johan L; Goodman, Simon J

    2005-12-01

    Disease can generate intense selection pressure on host populations, but here we show that acquired immunity in a population subject to repeated disease outbreaks can impede the evolution of genetic disease resistance by maintaining susceptible genotypes in the population. Interference between the life-history schedule of a species and periodicity of the disease has unintuitive effects on selection intensity, and stochasticity in outbreak period further reduces the rate of spread of disease-resistance alleles. A general age-structured population genetic model was developed and parameterized using empirical data for phocine distemper virus (PDV) epizootics in harbor seals. Scenarios with acquired immunity had lower levels of epizootic mortality compared with scenarios without acquired immunity for the first PDV outbreaks, but this pattern was reversed after about five disease cycles. Without acquired immunity, evolution of disease resistance was more rapid, and long-term population size variation is efficiently dampened. Acquired immunity has the potential to significantly influence rapid evolutionary dynamics of a host population in response to age-structured disease selection and to alter predicted selection intensities compared with epidemiological models that do not consider such feedback. This may have important implications for evolutionary population dynamics in a range of human, agricultural, and wildlife disease settings.

  9. A neurodegenerative disease affecting synaptic connections in Drosophila mutant for the tumor suppressor morphogen Patched

    PubMed Central

    Gazi, Michal; Shyamala, Baragur V.; Bhat, Krishna Moorthi

    2009-01-01

    The tumor-suppressor morphogen, Patched (Ptc), has extensive homology to the Niemann-Pick-C 1 (NPC1) protein. The NPC disease is a paediatric, progressive and fatal neurodegenerative disorder thought to be due to an abnormal accumulation of cholesterol in neurons. Here, we report that patched mutant adults develop a progressive neurodegenerative disease and their brain contains membranous and lamellar inclusions. There is also a significant reduction in the number of synaptic terminals in the brain of the mutant adults. Interestingly, feeding cholesterol to wild type flies generates inclusions in the brain, but does not cause the disease. However, feeding cholesterol to mutant flies increases synaptic connections and suppresses the disease. Our results suggest that sequestration of cholesterol in the mutant brain in the form of membranous material and inclusions affects available pool of cholesterol for cellular functions. This, in turn, negatively affects the synaptic number and contributes to the disease-state. Consistent with this, in ptc mutants there is a reduction in the pool of cholesterol esters, and cholesterol-mediated suppression of the disease accompanies an increase in cholesterol esters. We further show that Ptc does not function directly in this process since gain-of-function for Hedgehog also induces the same disease with a reduction in the level of cholesterol esters. We believe that loss of function for ptc causes neurodegeneration via two distinct ways: de-repression of genes that interfere with lipid trafficking, and de-repression of genes outside of the lipid trafficking; the functions of both classes of genes ultimately converge on synaptic connections. PMID:19635474

  10. Factors affecting poor nutritional status after small bowel resection in patients with Crohn disease.

    PubMed

    Jang, Ki Ung; Yu, Chang Sik; Lim, Seok-Byung; Park, In Ja; Yoon, Yong Sik; Kim, Chan Wook; Lee, Jong Lyul; Yang, Suk-Kyun; Ye, Byong Duk; Kim, Jin Cheon

    2016-07-01

    In Crohn disease, bowel-preserving surgery is necessary to prevent short bowel syndrome due to repeated operations. This study aimed to determine the remnant small bowel length cut-off and to evaluate the clinical factors related to nutritional status after small bowel resection in Crohn disease.We included 394 patients (69.3% male) who underwent small bowel resection for Crohn disease between 1991 and 2012. Patients who were classified as underweight (body mass index < 17.5) or at high risk of nutrition-related problems (modified nutritional risk index < 83.5) were regarded as having a poor nutritional status. Preliminary remnant small bowel length cut-offs were determined using receiver operating characteristic curves. Variables associated with poor nutritional status were assessed retrospectively using Student t tests, chi-squared tests, Fisher exact tests, and logistic regression analyses.The mean follow-up period was 52.9 months and the mean patient ages at the time of the last bowel surgery and last follow-up were 31.2 and 35.7 years, respectively. The mean remnant small bowel length was 331.8 cm. Forty-three patients (10.9%) underwent ileostomy, 309 (78.4%) underwent combined small bowel and colon resection, 111 (28.2%) had currently active disease, and 105 (26.6%) underwent at least 2 operations for recurrent disease. The mean body mass index and modified nutritional risk index were 20.6 and 100.8, respectively. The independent factors affecting underweight status were remnant small bowel length ≤240 cm (odds ratio: 4.84, P < 0.001), ileostomy (odds ratio: 4.70, P < 0.001), and currently active disease (odds ratio: 4.16, P < 0.001). The independent factors affecting high nutritional risk were remnant small bowel length ≤230 cm (odds ratio: 2.84, P = 0.012), presence of ileostomy (odds ratio: 3.36, P = 0.025), and currently active disease (odds ratio: 4.90, P < 0.001).Currently active disease, ileostomy, and remnant small

  11. Factors affecting poor nutritional status after small bowel resection in patients with Crohn disease

    PubMed Central

    Jang, Ki Ung; Yu, Chang Sik; Lim, Seok-Byung; Park, In Ja; Yoon, Yong Sik; Kim, Chan Wook; Lee, Jong Lyul; Yang, Suk-Kyun; Ye, Byong Duk; Kim, Jin Cheon

    2016-01-01

    Abstract In Crohn disease, bowel-preserving surgery is necessary to prevent short bowel syndrome due to repeated operations. This study aimed to determine the remnant small bowel length cut-off and to evaluate the clinical factors related to nutritional status after small bowel resection in Crohn disease. We included 394 patients (69.3% male) who underwent small bowel resection for Crohn disease between 1991 and 2012. Patients who were classified as underweight (body mass index < 17.5) or at high risk of nutrition-related problems (modified nutritional risk index < 83.5) were regarded as having a poor nutritional status. Preliminary remnant small bowel length cut-offs were determined using receiver operating characteristic curves. Variables associated with poor nutritional status were assessed retrospectively using Student t tests, chi-squared tests, Fisher exact tests, and logistic regression analyses. The mean follow-up period was 52.9 months and the mean patient ages at the time of the last bowel surgery and last follow-up were 31.2 and 35.7 years, respectively. The mean remnant small bowel length was 331.8 cm. Forty-three patients (10.9%) underwent ileostomy, 309 (78.4%) underwent combined small bowel and colon resection, 111 (28.2%) had currently active disease, and 105 (26.6%) underwent at least 2 operations for recurrent disease. The mean body mass index and modified nutritional risk index were 20.6 and 100.8, respectively. The independent factors affecting underweight status were remnant small bowel length ≤240 cm (odds ratio: 4.84, P < 0.001), ileostomy (odds ratio: 4.70, P < 0.001), and currently active disease (odds ratio: 4.16, P < 0.001). The independent factors affecting high nutritional risk were remnant small bowel length ≤230 cm (odds ratio: 2.84, P = 0.012), presence of ileostomy (odds ratio: 3.36, P = 0.025), and currently active disease (odds ratio: 4.90, P < 0.001). Currently active disease, ileostomy, and

  12. Frequent occurrence of tomato leaf curl New Delhi virus in cotton leaf curl disease affected cotton in Pakistan

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton leaf curl disease (CLCuD) in the Indian subcontinent is associated with several distinct monopartite begomoviruses and DNA satellites. However, only a single begomovirus was associated with breakdown of resistance against CLCuD in previously resistant cotton varieties. The monopartite begomov...

  13. Metatranscriptomic Analysis of Pycnopodia helianthoides (Asteroidea) Affected by Sea Star Wasting Disease.

    PubMed

    Gudenkauf, Brent M; Hewson, Ian

    2015-01-01

    Sea star wasting disease (SSWD) describes a suite of symptoms reported in asteroids of the North American Pacific Coast. We performed a metatranscriptomic survey of asymptomatic and symptomatic sunflower star (Pycnopodia helianthoides) body wall tissues to understand holobiont gene expression in tissues affected by SSWD. Metatranscriptomes were highly variable between replicate libraries, and most differentially expressed genes represented either transcripts of associated microorganisms (particularly Pseudomonas and Vibrio relatives) or low-level echinoderm transcripts of unknown function. However, the pattern of annotated host functional genes reflects enhanced apoptotic and tissue degradation processes and decreased energy metabolism, while signalling of death-related proteins was greater in asymptomatic and symptomatic tissues. Our results suggest that the body wall tissues of SSWD-affected asteroids may undergo structural changes during disease progression, and that they are stimulated to undergo autocatalytic cell death processes.

  14. Metatranscriptomic Analysis of Pycnopodia helianthoides (Asteroidea) Affected by Sea Star Wasting Disease

    PubMed Central

    Gudenkauf, Brent M.; Hewson, Ian

    2015-01-01

    Sea star wasting disease (SSWD) describes a suite of symptoms reported in asteroids of the North American Pacific Coast. We performed a metatranscriptomic survey of asymptomatic and symptomatic sunflower star (Pycnopodia helianthoides) body wall tissues to understand holobiont gene expression in tissues affected by SSWD. Metatranscriptomes were highly variable between replicate libraries, and most differentially expressed genes represented either transcripts of associated microorganisms (particularly Pseudomonas and Vibrio relatives) or low-level echinoderm transcripts of unknown function. However, the pattern of annotated host functional genes reflects enhanced apoptotic and tissue degradation processes and decreased energy metabolism, while signalling of death-related proteins was greater in asymptomatic and symptomatic tissues. Our results suggest that the body wall tissues of SSWD-affected asteroids may undergo structural changes during disease progression, and that they are stimulated to undergo autocatalytic cell death processes. PMID:26020776

  15. Definition, identification and treatment of resistant hypertension in chronic kidney disease patients.

    PubMed

    Drexler, Yelena R; Bomback, Andrew S

    2014-07-01

    Resistant hypertension, the inability to achieve goal blood pressure despite the use of three or more appropriately dosed antihypertensive drugs (including a diuretic), remains a common clinical problem, especially in patients with chronic kidney disease (CKD). While the exact prevalence and prognosis of resistant hypertension in CKD patients remain unknown, resistant hypertension likely contributes significantly to increased cardiovascular risk and progression of kidney disease in this population. We review the identification and evaluation of patients with resistant hypertension, including the importance of 24-h ambulatory blood pressure monitoring in the identification of 'white-coat', 'masked' and 'non-dipper' hypertension, the latter of which has particular clinical and therapeutic importance in patients with resistant hypertension and CKD. We then discuss treatment strategies for resistant hypertension that target the pathophysiologic mechanisms underlying resistance to treatment, including persistent volume excess, incomplete renin-angiotensin-aldosterone system blockade and inadequate nocturnal blood pressure control. Finally, we propose a treatment algorithm for evaluation and treatment of resistant hypertension in patients with CKD.

  16. High level resistance against rhizomania disease by simultaneously integrating two distinct defense mechanisms.

    PubMed

    Pavli, Ourania I; Tampakaki, Anastasia P; Skaracis, George N

    2012-01-01

    With the aim of achieving durable resistance against rhizomania disease of sugar beet, the employment of different sources of resistance to Beet necrotic yellow vein virus was pursued. To this purpose, Nicotiana benthamiana transgenic plants that simultaneously produce dsRNA originating from a conserved region of the BNYVV replicase gene and the HrpZ(Psph) protein in a secreted form (SP/HrpZ(Psph)) were produced. The integration and expression of both transgenes as well as proper production of the harpin protein were verified in all primary transformants and selfed progeny (T1, T2). Transgenic resistance was assessed by BNYVV-challenge inoculation on T2 progeny by scoring disease symptoms and DAS-ELISA at 20 and 30 dpi. Transgenic lines possessing single transformation events for both transgenes as well as wild type plants were included in inoculation experiments. Transgenic plants were highly resistant to virus infection, whereas in some cases immunity was achieved. In all cases, the resistant phenotype of transgenic plants carrying both transgenes was superior in comparison with the ones carrying a single transgene. Collectively, our findings demonstrate, for a first time, that the combination of two entirely different resistance mechanisms provide high level resistance or even immunity against the virus. Such a novel approach is anticipated to prevent a rapid virus adaptation that could potentially lead to the emergence of isolates with resistance breaking properties.

  17. Overexpression of a Modified Plant Thionin Enhances Disease Resistance to Citrus Canker and Huanglongbing (HLB).

    PubMed

    Hao, Guixia; Stover, Ed; Gupta, Goutam

    2016-01-01

    Huanglongbing (HLB or citrus greening disease) caused by Candidatus Liberibacter asiaticus (Las) is a great threat to the US citrus industry. There are no proven strategies to eliminate HLB disease and no cultivar has been identified with strong HLB resistance. Citrus canker is also an economically important disease associated with a bacterial pathogen (Xanthomonas citri). In this study, we characterized endogenous citrus thionins and investigated their expression in different citrus tissues. Since no HLB-resistant citrus cultivars have been identified, we attempted to develop citrus resistant to both HLB and citrus canker through overexpression of a modified plant thionin. To improve effectiveness for disease resistance, we modified and synthesized the sequence encoding a plant thionin and cloned into the binary vector pBinPlus/ARS. The construct was then introduced into Agrobacterium strain EHA105 for citrus transformation. Transgenic Carrizo plants expressing the modified plant thionin were generated by Agrobacterium-mediated transformation. Successful transformation and transgene gene expression was confirmed by molecular analysis. Transgenic Carrizo plants expressing the modified thionin gene were challenged with X. citri 3213 at a range of concentrations, and a significant reduction in canker symptoms and a decrease in bacterial growth were demonstrated compared to nontransgenic plants. Furthermore, the transgenic citrus plants were challenged with HLB via graft inoculation. Our results showed significant Las titer reduction in roots of transgenic Carrizo compared with control plants and reduced scion Las titer 12 months after graft inoculation. These data provide promise for engineering citrus disease resistance against HLB and canker.

  18. Cushing's syndrome presenting as treatment-resistant bipolar affective disorder: A step in understanding endocrine etiology of mood disorders

    PubMed Central

    Ummar, I. Syed; Rajaraman, Venkateswaran; Loganathan, N.

    2015-01-01

    Cushing's syndrome (CS) is the multisystem disorder which is due to cortisol excess. It is very difficult to diagnose in early stages, especially when psychiatric manifestations are the predominant complaints. It could result in significant morbidity and mortality. We report a case of resistant bipolar affective disorder secondary to CS. Early diagnosis and treatment will lead to better functional outcome and prevention of neurocognitive side-effects of excessive cortisol. PMID:26124528

  19. HOPM1 mediated disease resistance to Pseudomonas syringae in Arabidopsis

    DOEpatents

    He, Sheng Yang [Okemos, MI; Nomura, Kinya [East Lansing, MI

    2011-11-15

    The present invention relates to compositions and methods for enhancing plant defenses against pathogens. More particularly, the invention relates to enhancing plant immunity against bacterial pathogens, wherein HopM1.sub.1-300 mediated protection is enhanced, such as increased protection to Pseudomonas syringae pv. tomato DC3000 HopM1 and/or there is an increase in activity of an ATMIN associated plant protection protein, such as ATMIN7. Reagents of the present invention further provide a means of studying cellular trafficking while formulations of the present inventions provide increased pathogen resistance in plants.

  20. Does Coral Disease Affect Symbiodinium? Investigating the Impacts of Growth Anomaly on Symbiont Photophysiology

    PubMed Central

    Burns, John Henrik Robert; Gregg, Toni Makani; Takabayashi, Misaki

    2013-01-01

    Growth anomaly (GA) is a commonly observed coral disease that impairs biological functions of the affected tissue. GA is prevalent at Wai ‘ōpae tide pools, southeast Hawai ‘i Island. Here two distinct forms of this disease, Type A and Type B, affect the coral, Montiporacapitata. While the effects of GA on biology and ecology of the coral host are beginning to be understood, the impact of this disease on the photophysiology of the dinoflagellate symbiont, Symbiodinium spp., has not been investigated. The GA clearly alters coral tissue structure and skeletal morphology and density. These tissue and skeletal changes are likely to modify not only the light micro-environment of the coral tissue, which has a direct impact on the photosynthetic potential of Symbiodinium spp., but also the physiological interactions within the symbiosis. This study utilized Pulse amplitude modulation fluorometry (PAM) to characterize the photophysiology of healthy and GA-affected M. capitata tissue. Overall, endosymbionts within GA-affected tissue exhibit reduced photochemical efficiency. Values of both Fv/Fm and ΔF/ Fm’ were significantly lower (p<0.01) in GA tissue compared to healthy and unaffected tissues. Tracking the photophysiology of symbionts over a diurnal time period enabled a comparison of symbiont responses to photosynthetically available radiation (PAR) among tissue conditions. Symbionts within GA tissue exhibited the lowest values of ΔF/Fm’ as well as the highest pressure over photosystem II (p<0.01). This study provides evidence that the symbionts within GA-affected tissue are photochemically compromised compared to those residing in healthy tissue. PMID:23967301

  1. Mesenchymal stem cells derived from adipose tissue are not affected by renal disease.

    PubMed

    Roemeling-van Rhijn, Marieke; Reinders, Marlies E J; de Klein, Annelies; Douben, Hannie; Korevaar, Sander S; Mensah, Fane K F; Dor, Frank J M F; IJzermans, Jan N M; Betjes, Michiel G H; Baan, Carla C; Weimar, Willem; Hoogduijn, Martin J

    2012-10-01

    Mesenchymal stem cells are a potential therapeutic agent in renal disease and kidney transplantation. Autologous cell use in kidney transplantation is preferred to avoid anti-HLA reactivity; however, the influence of renal disease on mesenchymal stem cells is unknown. To investigate the feasibility of autologous cell therapy in patients with renal disease, we isolated these cells from subcutaneous adipose tissue of healthy controls and patients with renal disease and compared them phenotypically and functionally. The mesenchymal stem cells from both groups showed similar morphology and differentiation capacity, and were both over 90% positive for CD73, CD105, and CD166, and negative for CD31 and CD45. They demonstrated comparable population doubling times, rates of apoptosis, and were both capable of inhibiting allo-antigen- and anti-CD3/CD28-activated peripheral blood mononuclear cell proliferation. In response to immune activation they both increased the expression of pro-inflammatory and anti-inflammatory factors. These mesenchymal stem cells were genetically stable after extensive expansion and, importantly, were not affected by uremic serum. Thus, mesenchymal stem cells of patients with renal disease have similar characteristics and functionality as those from healthy controls. Hence, our results indicate the feasibility of their use in autologous cell therapy in patients with renal disease.

  2. Ehancing disease resistance in peach fruit with methyl jasmonate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effect of methyl jasmonate (MeJA) on postharvest diseases caused by P. expansum, B. cinerea and R. stolonifer in peach fruit (Prunus persica Batsch cv Dahebai) and the possible mechanisms involved were investigated. Peaches were harvested at the firm-mature stage and treated with 1 or 500 µmol/L...

  3. Transcriptome Profiling Revealed Stress-Induced and Disease Resistance Genes Up-Regulated in PRSV Resistant Transgenic Papaya.

    PubMed

    Fang, Jingping; Lin, Aiting; Qiu, Weijing; Cai, Hanyang; Umar, Muhammad; Chen, Rukai; Ming, Ray

    2016-01-01

    Papaya is a productive and nutritious tropical fruit. Papaya Ringspot Virus (PRSV) is the most devastating pathogen threatening papaya production worldwide. Development of transgenic resistant varieties is the most effective strategy to control this disease. However, little is known about the genome-wide functional changes induced by particle bombardment transformation. We conducted transcriptome sequencing of PRSV resistant transgenic papaya SunUp and its PRSV susceptible progenitor Sunset to compare the transcriptional changes in young healthy leaves prior to infection with PRSV. In total, 20,700 transcripts were identified, and 842 differentially expressed genes (DEGs) randomly distributed among papaya chromosomes. Gene ontology (GO) category analysis revealed that microtubule-related categories were highly enriched among these DEGs. Numerous DEGs related to various transcription factors, transporters and hormone biosynthesis showed clear differences between the two cultivars, and most were up-regulated in transgenic papaya. Many known and novel stress-induced and disease-resistance genes were most highly expressed in SunUp, including MYB, WRKY, ERF, NAC, nitrate and zinc transporters, and genes involved in the abscisic acid, salicylic acid, and ethylene signaling pathways. We also identified 67,686 alternative splicing (AS) events in Sunset and 68,455 AS events in SunUp, mapping to 10,994 and 10,995 papaya annotated genes, respectively. GO enrichment for the genes displaying AS events exclusively in Sunset was significantly different from those in SunUp. Transcriptomes in Sunset and transgenic SunUp are very similar with noteworthy differences, which increased PRSV-resistance in transgenic papaya. No detrimental pathways and allergenic or toxic proteins were induced on a genome-wide scale in transgenic SunUp. Our results provide a foundation for unraveling the mechanism of PRSV resistance in transgenic papaya.

  4. Transcriptome Profiling Revealed Stress-Induced and Disease Resistance Genes Up-Regulated in PRSV Resistant Transgenic Papaya

    PubMed Central

    Fang, Jingping; Lin, Aiting; Qiu, Weijing; Cai, Hanyang; Umar, Muhammad; Chen, Rukai; Ming, Ray

    2016-01-01

    Papaya is a productive and nutritious tropical fruit. Papaya Ringspot Virus (PRSV) is the most devastating pathogen threatening papaya production worldwide. Development of transgenic resistant varieties is the most effective strategy to control this disease. However, little is known about the genome-wide functional changes induced by particle bombardment transformation. We conducted transcriptome sequencing of PRSV resistant transgenic papaya SunUp and its PRSV susceptible progenitor Sunset to compare the transcriptional changes in young healthy leaves prior to infection with PRSV. In total, 20,700 transcripts were identified, and 842 differentially expressed genes (DEGs) randomly distributed among papaya chromosomes. Gene ontology (GO) category analysis revealed that microtubule-related categories were highly enriched among these DEGs. Numerous DEGs related to various transcription factors, transporters and hormone biosynthesis showed clear differences between the two cultivars, and most were up-regulated in transgenic papaya. Many known and novel stress-induced and disease-resistance genes were most highly expressed in SunUp, including MYB, WRKY, ERF, NAC, nitrate and zinc transporters, and genes involved in the abscisic acid, salicylic acid, and ethylene signaling pathways. We also identified 67,686 alternative splicing (AS) events in Sunset and 68,455 AS events in SunUp, mapping to 10,994 and 10,995 papaya annotated genes, respectively. GO enrichment for the genes displaying AS events exclusively in Sunset was significantly different from those in SunUp. Transcriptomes in Sunset and transgenic SunUp are very similar with noteworthy differences, which increased PRSV-resistance in transgenic papaya. No detrimental pathways and allergenic or toxic proteins were induced on a genome-wide scale in transgenic SunUp. Our results provide a foundation for unraveling the mechanism of PRSV resistance in transgenic papaya. PMID:27379138

  5. Exploring the role of microorganisms in the disease-like syndrome affecting the sponge Ianthella basta.

    PubMed

    Luter, Heidi M; Whalan, Steve; Webster, Nicole S

    2010-09-01

    A disease-like syndrome is currently affecting a large percentage of the Ianthella basta populations from the Great Barrier Reef and central Torres Strait. Symptoms of the syndrome include discolored, necrotic spots leading to tissue degradation, exposure of the skeletal fibers, and disruption of the choanocyte chambers. To ascertain the role of microbes in the disease process, a comprehensive comparison of bacteria, viruses, fungi, and other eukaryotes was performed in healthy and diseased sponges using multiple techniques. A low diversity of microbes was observed in both healthy and diseased sponge communities, with all sponges dominated by an Alphaproteobacteria, a Gammaproteobacteria, and a group I crenarchaeota. Bacterial cultivation, community analysis by denaturing gradient gel electrophoresis (Bacteria and Eukarya), sequencing of 16S rRNA clone libraries (Bacteria and Archaea), and direct visual assessment by electron microscopy failed to reveal any putative pathogens. In addition, infection assays could not establish the syndrome in healthy sponges even after direct physical contact with affected tissue. These results suggest that microbes are not responsible for the formation of brown spot lesions and necrosis in I. basta.

  6. Food, nutrients and nutraceuticals affecting the course of inflammatory bowel disease.

    PubMed

    Uranga, José Antonio; López-Miranda, Visitación; Lombó, Felipe; Abalo, Raquel

    2016-08-01

    Inflammatory bowel diseases (ulcerative colitis; Crohn's disease) are debilitating relapsing inflammatory disorders affecting the gastrointestinal tract, with deleterious effect on quality of life, and increasing incidence and prevalence. Mucosal inflammation, due to altered microbiota, increased intestinal permeability and immune system dysfunction underlies the symptoms and may be caused in susceptible individuals by different factors (or a combination of them), including dietary habits and components. In this review we describe the influence of the Western diet, obesity, and different nutraceuticals/functional foods (bioactive peptides, phytochemicals, omega 3-polyunsaturated fatty acids, vitamin D, probiotics and prebiotics) on the course of IBD, and provide some hints that could be useful for nutritional guidance. Hopefully, research will soon offer enough reliable data to slow down the spread of the disease and to make diet a cornerstone in IBD therapy.

  7. Drug Resistance Mechanisms in Bacteria Causing Sexually Transmitted Diseases and Associated with Vaginosis

    PubMed Central

    Shaskolskiy, Boris; Dementieva, Ekaterina; Leinsoo, Arvo; Runina, Anastassia; Vorobyev, Denis; Plakhova, Xenia; Kubanov, Alexey; Deryabin, Dmitrii; Gryadunov, Dmitry

    2016-01-01

    Here, we review sexually transmitted diseases (STDs) caused by pathogenic bacteria and vaginal infections which result from an overgrowth of opportunistic bacterial microflora. First, we describe the STDs, the corresponding pathogens and the antimicrobials used for their treatment. In addition to the well-known diseases caused by single pathogens (i.e., syphilis, gonococcal infections, and chlamydiosis), we consider polymicrobial reproductive tract infections (especially those that are difficult to effectively clinically manage). Then, we summarize the biochemical mechanisms that lead to antimicrobial resistance and the most recent data on the emergence of drug resistance in STD pathogens and bacteria associated with vaginosis. A large amount of research performed in the last 10–15 years has shed light on the enormous diversity of mechanisms of resistance developed by bacteria. A detailed understanding of the mechanisms of antimicrobials action and the emergence of resistance is necessary to modify existing drugs and to develop new ones directed against new targets. PMID:27242760

  8. Wild Help for Enhancing Genetic Resistance in Lentil Against Fungal Diseases.

    PubMed

    Bhadauria, Vijai; Wong, Melissa M L; Bett, Kirstin E; Banniza, Sabine

    2016-01-01

    Lentil (Lens culinaris) is one of the cool season grain legume crops and an important source of dietary proteins and fibre. Fungal diseases are main constraints to lentil production and account for significant yield and quality losses. Lentil has a narrow genetic base presumably due to a bottleneck during domestication and as a result, any resistance to fungal diseases in the cultivated genepool is gradually eroded and overcome by pathogens. New sources of resistance have been identified in wild lentil (Lens ervoides). This article provides an overview of harnessing resistance potential of wild germplasm to enhance genetic resistance in lentil cultivars using next-generation sequencing-based genotyping, comparative genomics and marker-assisted selection breeding.

  9. Curcumin affects components of the chromosomal passenger complex and induces mitotic catastrophe in apoptosis-resistant Bcr-Abl-expressing cells.

    PubMed

    Wolanin, Kamila; Magalska, Adriana; Mosieniak, Grazyna; Klinger, Rut; McKenna, Sharon; Vejda, Susanne; Sikora, Ewa; Piwocka, Katarzyna

    2006-07-01

    The Bcr-Abl oncoprotein plays a major role in the development and progression of chronic myeloid leukemia and is a determinant of chemotherapy resistance occurring during the blast crisis phase of the disease. The aim of this article was to investigate the possibility of combating the resistance to apoptosis caused by Bcr-Abl by inducing an alternative cell death process. As a model of chronic myeloid leukemia, we employed Bcr-Abl-transfected mouse progenitor 32D cells with low and high Bcr-Abl expression levels corresponding to drug-sensitive and drug-resistant cells, respectively. The drug curcumin (diferuloylmethane), a known potent inducer of cell death in many cancer cells, was investigated for efficacy with Bcr-Abl-expressing cells. Curcumin strongly inhibited cell proliferation and affected cell viability by inducing apoptotic symptoms in all tested cells; however, apoptosis was a relatively late event. G(2)-M cell cycle arrest, together with increased mitotic index and cellular and nuclear morphology resembling those described for mitotic catastrophe, was observed and preceded caspase-3 activation and DNA fragmentation. Mitosis-arrested cells displayed abnormal chromatin organization, multipolar chromosome segregation, aberrant cytokinesis, and multinucleated cells-morphologic changes typical of mitotic catastrophe. We found that the mitotic cell death symptoms correlated with attenuated expression of survivin, a member of the chromosomal passenger complex, and mislocalization of Aurora B, the partner of survivin in the chromosomal passenger complex. Inhibition of survivin expression with small interfering RNA exhibited similar mitotic disturbances, thus implicating survivin as a major, albeit not the only, target for curcumin action. This study shows that curcumin can overcome the broad resistance to cell death caused by expression of Bcr-Abl and suggests that curcumin may be a promising agent for new combination regimens for drug-resistant chronic myeloid

  10. Companion cropping with potato onion enhances the disease resistance of tomato against Verticillium dahliae

    PubMed Central

    Fu, Xuepeng; Wu, Xia; Zhou, Xingang; Liu, Shouwei; Shen, Yanhui; Wu, Fengzhi

    2015-01-01

    Intercropping could alleviate soil-borne diseases, however, few studies focused on the immunity of the host plant induced by the interspecific interactions. To test whether or not intercropping could enhance the disease resistance of host plant, we investigated the effect of companion cropping with potato onion on tomato Verticillium wilt caused by Verticillium dahliae (V. dahliae). To investigate the mechanisms, the root exudates were collected from tomato and potato onion which were grown together or separately, and were used to examine the antifungal activities against V. dahliae in vitro, respectively. Furthermore, RNA-seq was used to examine the expression pattern of genes related to disease resistance in tomato companied with potato onion compared to that in tomato grown alone, under the condition of infection with V. dahliae. The results showed that companion cropping with potato onion could alleviate the incidence and severity of tomato Verticillium wilt. The further studies revealed that the root exudates from tomato companied with potato onion significantly inhibited the mycelia growth and spore germination of V. dahliae. However, there were no significant effects on these two measurements for the root exudates from potato onion grown alone or from potato onion grown with tomato. RNA-seq data analysis showed the disease defense genes associated with pathogenesis-related proteins, biosynthesis of lignin, hormone metabolism and signal transduction were expressed much higher in the tomato companied with potato onion than those in the tomato grown alone, which indicated that these defense genes play important roles in tomato against V. dahliae infection, and meant that the disease resistance of tomato against V. dahliae was enhanced in the companion copping with potato onion. We proposed that companion cropping with potato onion could enhance the disease resistance of tomato against V. dahliae by regulating the expression of genes related to disease

  11. Isolation, cloning and sequencing of AFLP markers related to disease-resistance traits in Fenneropenaeus chinensis

    NASA Astrophysics Data System (ADS)

    Yue, Zhiqin; Wang, Weiji; Kong, Jie; Dai, Jixun

    2005-12-01

    Amplified fragment length polymorphism (AFLP) technique was used to analyze the fingerprinting of four successive generations of Fenneropenaeus chinensis to reveal their disease-resistance traits. Some loci showed quite different genetic frequencies due to artificial selection, which implied that these fragments were putative markers related to the disease-resistance trait. We developed a simple and effective method to further characterize these AFLP fragments. Specific AFLP bands were cut directly from polyacrylamide gels, re-amplified, cloned and sequenced. Eight putative genetic markers were sequenced and their sizes ranged from 63 to 209 bp. The sequences were submitted to dbGSS (database of Genome Sequence Survey); and the BLAST analysis showed low similarity to the function genes, indicating these markers were tightly linked to a disease-resistance trait but were not functional genes.

  12. The Expanding Pathogenic Role of Insulin Resistance in Human Disease.

    PubMed

    2014-01-07

    The December 2011 issue of Diabetic Medicine celebrated the outstanding personal contributions of the renowned clinical scientist Prof. Sir Harold Himsworth in characterizing impaired insulin action in relation to phenotypes of diabetes. The commissioned articles in the special issue of the journal were assembled in recognition of the publication in 1936 of a landmark paper in which Himsworth summarized his innovative research, to which much of our current understanding of insulin resistance can be readily traced. The collection of invited articles that marked the 75th anniversary of the Lancet publication provided a state-of-the-art summary from internationally renowned investigators of what has become an increasingly diverse field reaching into myriad aspects of clinical medicine. This article is protected by copyright. All rights reserved.

  13. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    PubMed

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  14. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes

    PubMed Central

    Serra, Heïdi; Ziolkowski, Piotr A.; Yelina, Nataliya E.; Jackson, Matthew; Mézard, Christine; McVean, Gil; Henderson, Ian R.

    2016-01-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity. PMID:27415776

  15. Repurposing diabetes drugs for brain insulin resistance in Alzheimer disease.

    PubMed

    Yarchoan, Mark; Arnold, Steven E

    2014-07-01

    A growing body of clinical and epidemiological research suggests that two of the most common diseases of aging, type 2 diabetes (T2DM) and Alzheimer disease (AD), are linked. The nature of the association is not known, but this observation has led to the notion that drugs developed for the treatment of T2DM may be beneficial in modifying the pathophysiology of AD and maintaining cognitive function. Recent advances in the understanding of the biology of T2DM have resulted in a growing number of therapies that are approved or in clinical development for this disease. This review summarizes the evidence that T2DM and AD are linked, with a focus on the cellular and molecular mechanisms in common, and then assesses the various clinical-stage diabetes drugs for their potential activity in AD. At a time when existing therapies for AD offer only limited symptomatic benefit for some patients, additional clinical trials of diabetes drugs are needed to at least advance the care of T2DM patients at risk for or with comorbid AD and also to determine their value for AD in general.

  16. REST and stress resistance in ageing and Alzheimer's disease

    NASA Astrophysics Data System (ADS)

    Lu, Tao; Aron, Liviu; Zullo, Joseph; Pan, Ying; Kim, Haeyoung; Chen, Yiwen; Yang, Tun-Hsiang; Kim, Hyun-Min; Drake, Derek; Liu, X. Shirley; Bennett, David A.; Colaiácovo, Monica P.; Yankner, Bruce A.

    2014-03-01

    Human neurons are functional over an entire lifetime, yet the mechanisms that preserve function and protect against neurodegeneration during ageing are unknown. Here we show that induction of the repressor element 1-silencing transcription factor (REST; also known as neuron-restrictive silencer factor, NRSF) is a universal feature of normal ageing in human cortical and hippocampal neurons. REST is lost, however, in mild cognitive impairment and Alzheimer's disease. Chromatin immunoprecipitation with deep sequencing and expression analysis show that REST represses genes that promote cell death and Alzheimer's disease pathology, and induces the expression of stress response genes. Moreover, REST potently protects neurons from oxidative stress and amyloid β-protein toxicity, and conditional deletion of REST in the mouse brain leads to age-related neurodegeneration. A functional orthologue of REST, Caenorhabditis elegans SPR-4, also protects against oxidative stress and amyloid β-protein toxicity. During normal ageing, REST is induced in part by cell non-autonomous Wnt signalling. However, in Alzheimer's disease, frontotemporal dementia and dementia with Lewy bodies, REST is lost from the nucleus and appears in autophagosomes together with pathological misfolded proteins. Finally, REST levels during ageing are closely correlated with cognitive preservation and longevity. Thus, the activation state of REST may distinguish neuroprotection from neurodegeneration in the ageing brain.

  17. Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

    PubMed

    He, Bin; Tao, Xiang; Gu, Yinghong; Wei, Changhe; Cheng, Xiaojie; Xiao, Suqin; Cheng, Zaiquan; Zhang, Yizheng

    2015-01-01

    Oryza meyeriana (O. meyeriana), with a GG genome type (2n = 24), accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11) genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26) differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease resistance in O

  18. Diabetes mellitus, a complex and heterogeneous disease, and the role of insulin resistance as a determinant of diabetic kidney disease.

    PubMed

    Karalliedde, Janaka; Gnudi, Luigi

    2016-02-01

    Diabetes mellitus (DM) is increasingly recognized as a heterogeneous condition. The individualization of care and treatment necessitates an understanding of the individual patient's pathophysiology of DM that underpins their DM classification and clinical presentation. Classical type-2 diabetes mellitus is due to a combination of insulin resistance and an insulin secretory defect. Type-1 diabetes is characterized by a near-absolute deficiency of insulin secretion. More recently, advances in genetics and a better appreciation of the atypical features of DM has resulted in more categories of diabetes. In the context of kidney disease, patients with DM and microalbuminuria are more insulin resistant, and insulin resistance may be a pathway that results in accelerated progression of diabetic kidney disease. This review summarizes the updated classification of DM, including more rarer categories and their associated renal manifestations that need to be considered in patients who present with atypical features. The benefits and limitations of the tests utilized to make a diagnosis of DM are discussed. We also review the putative pathways and mechanisms by which insulin resistance drives the progression of diabetic kidney disease.

  19. Sugarcane borer resistance in sugarcane as affected by silicon applications in potting medium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The sugarcane borer, Diatraea saccharalis (F.)(Lepidoptera: Crambidae) is the most important insect pest of sugarcane (interspecific hybrids of Saccharum) in the Americas, and the key insect pest of sugarcane in Louisiana. Although the release of borer resistant varieties is sporadic in Louisiana, p...

  20. Resistant starch does not affect zinc homeostasis in rural Malawian children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study tested the hypothesis that Malawian children at risk for zinc deficiency will have reduced endogenous fecal zinc (EFZ) and increased net absorbed zinc (NAZ) following the addition of high amylose maize resistant starch (RS) to their diet. This was a small controlled clinical trial to dete...

  1. Glufosinate does not affect floral morphology and pollen viability in glufosinate-resistant cotton (Gossypium hirsutum)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Studies were conducted to determine whether glufosinate treatments to glufosinate-resistant cotton caused changes in floral morphology, pollen viability, and seed set. Four glufosinate treatments were included: (1) glufosinate applied postemergence over the top (POST) at the four-leaf stage, (2) glu...

  2. Rate of Conditioned Reinforcement Affects Observing Rate but Not Resistance to Change

    ERIC Educational Resources Information Center

    Shahan, Timothy A.; Podlesnik, Christopher A.

    2005-01-01

    The effects of rate of conditioned reinforcement on the resistance to change of operant behavior have not been examined. In addition, the effects of rate of conditioned reinforcement on the rate of observing have not been adequately examined. In two experiments, a multiple schedule of observing-response procedures was used to examine the effects…

  3. Volatiles produced by soil-borne endophytic bacteria increase plant pathogen resistance and affect tritrophic interactions.

    PubMed

    D'Alessandro, Marco; Erb, Matthias; Ton, Jurriaan; Brandenburg, Anna; Karlen, Danielle; Zopfi, Jakob; Turlings, Ted C J

    2014-04-01

    Volatile organic compounds (VOCs) released by soil microorganisms influence plant growth and pathogen resistance. Yet, very little is known about their influence on herbivores and higher trophic levels. We studied the origin and role of a major bacterial VOC, 2,3-butanediol (2,3-BD), on plant growth, pathogen and herbivore resistance, and the attraction of natural enemies in maize. One of the major contributors to 2,3-BD in the headspace of soil-grown maize seedlings was identified as Enterobacter aerogenes, an endophytic bacterium that colonizes the plants. The production of 2,3-BD by E. aerogenes rendered maize plants more resistant against the Northern corn leaf blight fungus Setosphaeria turcica. On the contrary, E. aerogenes-inoculated plants were less resistant against the caterpillar Spodoptera littoralis. The effect of 2,3-BD on the attraction of the parasitoid Cotesia marginiventris was more variable: 2,3-BD application to the headspace of the plants had no effect on the parasitoids, but application to the soil increased parasitoid attraction. Furthermore, inoculation of seeds with E. aerogenes decreased plant attractiveness, whereas inoculation of soil with a total extract of soil microbes increased parasitoid attraction, suggesting that the effect of 2,3-BD on the parasitoid is indirect and depends on the composition of the microbial community.

  4. Methuselah-like genes affect development, stress resistance, lifespan and reproduction in Tribolium castaneum.

    PubMed

    Li, Chengjun; Zhang, Yi; Yun, Xiaopei; Wang, Yanyun; Sang, Ming; Liu, Xing; Hu, Xingxing; Li, Bin

    2014-10-01

    Methuselah (Mth) is associated with lifespan, stress resistance and reproduction in Drosophila melanogaster, but Mth is not present in nondrosophiline insects. A number of methuselah-likes (mthls) have been identified in nondrosophiline insects, but it is unknown whether the functions of mth are shared by mthls or are divergent from them. Five mthls have been identified in Tribolium castaneum. Although they have different developmental expression patterns, they all enhance resistance to starvation. Only mthl1 and mthl2 enhance resistance to high temperature, whereas mthl4 and mthl5 negatively regulate oxidative stress in T. castaneum. Unlike in the fly with mth mutation, knockdown of mthls, except mthl3, shortens the lifespan of T. castaneum. Moreover, mthl1 and mthl2 are critical for Tribolium development. mthl1 plays important roles in larval and pupal development and adult eclosion, while mthl2 is required for eclosion. Moreover, mthl1 and mthl2 silencing reduces the fertility of T. castaneum, and mthl1 and mthl4 are also essential for embryo development. In conclusion, mthls have a significant effect on insect development, lifespan, stress resistance and reproduction. These results provide experimental evidence for functional divergence among mthls/mth and clues for the signal transduction of Mthls.

  5. Resistance to essential oils affects survival of Salmonella enterica serovars in growing and harvested basil.

    PubMed

    Kisluk, Guy; Kalily, Emmanuel; Yaron, Sima

    2013-10-01

    The number of outbreaks of food-borne illness associated with consumption of fresh products has increased. A recent and noteworthy outbreak occurred in 2007. Basil contaminated with Salmonella enterica serovar Senftenberg was the source of this outbreak. Since basil produces high levels of antibacterial compounds the aim of this study was to investigate if the emerging outbreak reflects ecological changes that occurred as a result of development of resistance to ingredients of the basil oil. We irrigated basil plants with contaminated water containing two Salmonella serovars, Typhimurium and Senftenberg, and showed that Salmonella can survive on the basil plants for at least 100 days. S. Senftenberg counts in the phyllosphere were significantly higher than S. Typhimurium, moreover, S. Senftenberg was able to grow on stored harvested basil leaves. Susceptibility experiments demonstrated that S. Senftenberg is more resistant to basil oil and to its antimicrobial constituents: linalool, estragole and eugenol. This may indicate that S. Senftenberg had adapted to the basil environment by developing resistance to the basil oil. The emergence of resistant pathogens has a significant potential to change the ecology, and opens the way for pathogens to survive in new niches in the environment such as basil and other plants.

  6. The development of pathogen resistance in Daphnia magna: implications for disease spread in age-structured populations.

    PubMed

    Garbutt, Jennie S; O'Donoghue, Anna J P; McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

    2014-11-01

    Immunity in vertebrates is well established to develop with time, but the ontogeny of defence in invertebrates is markedly less studied. Yet, age-specific capacity for defence against pathogens, coupled with age structure in populations, has widespread implications for disease spread. Thus, we sought to determine the susceptibility of hosts of different ages in an experimental invertebrate host-pathogen system. In a series of experiments, we show that the ability of Daphnia magna to resist its natural bacterial pathogen Pasteuria ramosa changes with host age. Clonal differences make it difficult to draw general conclusions, but the majority of observations indicate that resistance increases early in the life of D. magna, consistent with the idea that the defence system develops with time. Immediately following this, at about the time when a daphnid would be most heavily investing in reproduction, resistance tends to decline. Because many ecological factors influence the age structure of Daphnia populations, our results highlight a broad mechanism by which ecological context can affect disease epidemiology. We also show that a previously observed protective effect of restricted maternal food persists throughout the entire juvenile period, and that the protective effect of prior treatment with a small dose of the pathogen ('priming') persists for 7 days, observations that reinforce the idea that immunity in D. magna can change over time. Together, our experiments lead us to conclude that invertebrate defence capabilities have an ontogeny that merits consideration with respect to both their immune systems and the epidemic spread of infection.

  7. Association mapping of disease resistance traits in rainbow trout using restriction site associated DNA sequencing.

    PubMed

    Campbell, Nathan R; LaPatra, Scott E; Overturf, Ken; Towner, Richard; Narum, Shawn R

    2014-10-28

    Recent advances in genotyping-by-sequencing have enabled genome-wide association studies in nonmodel species including those in aquaculture programs. As with other aquaculture species, rainbow trout and steelhead (Oncorhynchus mykiss) are susceptible to disease and outbreaks can lead to significant losses. Fish culturists have therefore been pursuing strategies to prevent losses to common pathogens such as Flavobacterium psychrophilum (the etiological agent for bacterial cold water disease [CWD]) and infectious hematopoietic necrosis virus (IHNV) by adjusting feed formulations, vaccine development, and selective breeding. However, discovery of genetic markers linked to disease resistance offers the potential to use marker-assisted selection to increase resistance and reduce outbreaks. For this study we sampled juvenile fish from 40 families from 2-yr classes that either survived or died after controlled exposure to either CWD or IHNV. Restriction site-associated DNA sequencing produced 4661 polymorphic single-nucleotide polymorphism loci after strict filtering. Genotypes from individual survivors and mortalities were then used to test for association between disease resistance and genotype at each locus using the program TASSEL. After we accounted for kinship and stratification of the samples, tests revealed 12 single-nucleotide polymorphism markers that were highly associated with resistance to CWD and 19 markers associated with resistance to IHNV. These markers are candidates for further investigation and are expected to be useful for marker assisted selection in future broodstock selection for various aquaculture programs.

  8. Single vessel air injection estimates of xylem resistance to cavitation are affected by vessel network characteristics and sample length.

    PubMed

    Venturas, Martin D; Rodriguez-Zaccaro, F Daniela; Percolla, Marta I; Crous, Casparus J; Jacobsen, Anna L; Pratt, R Brandon

    2016-10-01

    Xylem resistance to cavitation is an important trait that is related to the ecology and survival of plant species. Vessel network characteristics, such as vessel length and connectivity, could affect the spread of emboli from gas-filled vessels to functional ones, triggering their cavitation. We hypothesized that the cavitation resistance of xylem vessels is randomly distributed throughout the vessel network. We predicted that single vessel air injection (SVAI) vulnerability curves (VCs) would thus be affected by sample length. Longer stem samples were predicted to appear more resistant than shorter samples due to the sampled path including greater numbers of vessels. We evaluated the vessel network characteristics of grapevine (Vitis vinifera L.), English oak (Quercus robur L.) and black cottonwood (Populus trichocarpa Torr. & A. Gray), and constructed SVAI VCs for 5- and 20-cm-long segments. We also constructed VCs with a standard centrifuge method and used computer modelling to estimate the curve shift expected for pathways composed of different numbers of vessels. For all three species, the SVAI VCs for 5 cm segments rose exponentially and were more vulnerable than the 20 cm segments. The 5 cm curve shapes were exponential and were consistent with centrifuge VCs. Modelling data supported the observed SVAI VC shifts, which were related to path length and vessel network characteristics. These results suggest that exponential VCs represent the most realistic curve shape for individual vessel resistance distributions for these species. At the network level, the presence of some vessels with a higher resistance to cavitation may help avoid emboli spread during tissue dehydration.

  9. Resistance to Dutch Elm Disease Reduces Presence of Xylem Endophytic Fungi in Elms (Ulmus spp.)

    PubMed Central

    Martín, Juan A.; Witzell, Johanna; Blumenstein, Kathrin; Rozpedowska, Elzbieta; Helander, Marjo; Sieber, Thomas N.; Gil, Luis

    2013-01-01

    Efforts to introduce pathogen resistance into landscape tree species by breeding may have unintended consequences for fungal diversity. To address this issue, we compared the frequency and diversity of endophytic fungi and defensive phenolic metabolites in elm (Ulmus spp.) trees with genotypes known to differ in resistance to Dutch elm disease. Our results indicate that resistant U. minor and U. pumila genotypes exhibit a lower frequency and diversity of fungal endophytes in the xylem than susceptible U. minor genotypes. However, resistant and susceptible genotypes showed a similar frequency and diversity of endophytes in the leaves and bark. The resistant and susceptible genotypes could be discriminated on the basis of the phenolic profile of the xylem, but not on basis of phenolics in the leaves or bark. As the Dutch elm disease pathogen develops within xylem tissues, the defensive chemistry of resistant elm genotypes thus appears to be one of the factors that may limit colonization by both the pathogen and endophytes. We discuss a potential trade-off between the benefits of breeding resistance into tree species, versus concomitant losses of fungal endophytes and the ecosystem services they provide. PMID:23468900

  10. Bacterial Communities Differ among Drosophila melanogaster Populations and Affect Host Resistance against Parasitoids

    PubMed Central

    Dini-Andreote, Francisco; Falcao Salles, Joana

    2016-01-01

    In Drosophila, diet is considered a prominent factor shaping the associated bacterial community. However, the host population background (e.g. genotype, geographical origin and founder effects) is a factor that may also exert a significant influence and is often overlooked. To test for population background effects, we characterized the bacterial communities in larvae of six genetically differentiated and geographically distant D. melanogaster lines collected from natural populations across Europe. The diet for these six lines had been identical for ca. 50 generations, thus any differences in the composition of the microbiome originates from the host populations. We also investigated whether induced shifts in the microbiome—in this case by controlled antibiotic administration—alters the hosts’ resistance to parasitism. Our data revealed a clear signature of population background on the diversity and composition of D. melanogaster microbiome that differed across lines, even after hosts had been maintained at the same diet and laboratory conditions for over 4 years. In particular, the number of bacterial OTUs per line ranged from 8 to 39 OTUs. Each line harboured 2 to 28 unique OTUs, and OTUs that were highly abundant in some lines were entirely missing in others. Moreover, we found that the response to antibiotic treatment differed among the lines and significantly altered the host resistance to the parasitoid Asobara tabida in one of the six lines. Wolbachia, a widespread intracellular endosymbiont associated with parasitoid resistance, was lacking in this line, suggesting that other components of the Drosophila microbiome caused a change in host resistance. Collectively, our results revealed that lines that originate from different population backgrounds show significant differences in the established Drosophila microbiome, outpacing the long-term effect of diet. Perturbations on these naturally assembled microbiomes to some degree influenced the hosts

  11. Characterization of Multiple-Antimicrobial-Resistant Escherichia coli Isolates from Diseased Chickens and Swine in China

    PubMed Central

    Yang, Hanchun; Chen, Sheng; White, David G.; Zhao, Shaohua; McDermott, Patrick; Walker, Robert; Meng, Jianghong

    2004-01-01

    Escherichia coli isolates from diseased piglets (n = 89) and chickens (n = 71) in China were characterized for O serogroups, virulence genes, antimicrobial susceptibility, class 1 integrons, and mechanisms of fluoroquinolone resistance. O78 was the most common serogroup identified (63%) among the chicken E. coli isolates. Most isolates were PCR positive for the increased serum survival gene (iss; 97%) and the temperature-sensitive hemagglutinin gene (tsh; 93%). The O serogroups of swine E. coli were not those typically associated with pathogenic strains, nor did they posses common characteristic virulence factors. Twenty-three serogroups were identified among the swine isolates; however, 38% were O nontypeable. Overall, isolates displayed resistance to nalidixic acid (100%), tetracycline (98%), sulfamethoxazole (84%), ampicillin (79%), streptomycin (77%), and trimethoprim-sulfamethoxazole (76%). Among the fluoroquinolones, resistance ranged between 64% to levofloxacin, 79% to ciprofloxacin, and 95% to difloxacin. DNA sequencing of gyrA, gyrB, parC, and parE quinolone resistance-determining regions of 39 nalidixic acid-resistant E. coli isolates revealed that a single gyrA mutation was found in all of the isolates; mutations in parC together with double gyrA mutations conferred high-level resistance to fluoroquinolones (ciprofloxacin MIC, ≥8 μg/ml). Class 1 integrons were identified in 17 (19%) isolates from swine and 42 (47%) from chickens. The majority of integrons possessed genes conferring resistance to streptomycin and trimethoprim. These findings suggest that multiple-antimicrobial-resistant E. coli isolates, including fluoroquinolone-resistant variants, are commonly present among diseased swine and chickens in China, and they also suggest the need for the introduction of surveillance programs in China to monitor antimicrobial resistance in pathogenic bacteria that can be potentially transmitted to humans from food animals. PMID:15297487

  12. Hereditary retinal eye diseases in childhood and youth affecting the central retina.

    PubMed

    Nentwich, Martin M; Rudolph, Guenther

    2013-09-01

    Hereditary dystrophies affecting the central retina represent a heterogeneous group of diseases. Mutations in different genes may be responsible for changes of the choroid (choroideremia), of the retinal pigment epithelium [RPE] (Best's disease), of the photoreceptor outer segments (Stargardt's disease) and of the bipolar and Mueller cells (x-linked retinoschisis). The correct diagnosis of hereditary retinal dystrophies is important, even though therapeutic options are limited at the moment, as every patient should get a diagnosis and be informed about the expected prognosis. Furthermore, specific gene therapy of a number of diseases such as Leber congenital amaurosis, choroideremia, Stargardt's disease, Usher Syndrome and achromatopsia is being evaluated at present. Classic examinations for patients suffering from hereditary retinal dystrophies of the central retina are funduscopy - also using red-free light - visual-field tests, electrophysiologic tests as electro-retinogram [ERG] and multifocal ERG and tests evaluating color vision. Recently, new imaging modalities have been introduced into the clinical practice. The significance of these new methods such as high-resolution spectral-domain optic coherence tomography [SD-OCT] and fundus autofluorescence will be discussed as well as "next generation sequencing" as a new method for the analysis of genetic mutations in a larger number of patients.

  13. Decision aids for multiple-decision disease management as affected by weather input errors.

    PubMed

    Pfender, W F; Gent, D H; Mahaffee, W F; Coop, L B; Fox, A D

    2011-06-01

    Many disease management decision support systems (DSSs) rely, exclusively or in part, on weather inputs to calculate an indicator for disease hazard. Error in the weather inputs, typically due to forecasting, interpolation, or estimation from off-site sources, may affect model calculations and management decision recommendations. The extent to which errors in weather inputs affect the quality of the final management outcome depends on a number of aspects of the disease management context, including whether management consists of a single dichotomous decision, or of a multi-decision process extending over the cropping season(s). Decision aids for multi-decision disease management typically are based on simple or complex algorithms of weather data which may be accumulated over several days or weeks. It is difficult to quantify accuracy of multi-decision DSSs due to temporally overlapping disease events, existence of more than one solution to optimizing the outcome, opportunities to take later recourse to modify earlier decisions, and the ongoing, complex decision process in which the DSS is only one component. One approach to assessing importance of weather input errors is to conduct an error analysis in which the DSS outcome from high-quality weather data is compared with that from weather data with various levels of bias and/or variance from the original data. We illustrate this analytical approach for two types of DSS, an infection risk index for hop powdery mildew and a simulation model for grass stem rust. Further exploration of analysis methods is needed to address problems associated with assessing uncertainty in multi-decision DSSs.

  14. Soybean (Glycine max L. Merr.) sprouts germinated under red light irradiation induce disease resistance against bacterial rotting disease.

    PubMed

    Dhakal, Radhika; Park, Euiho; Lee, Se-Weon; Baek, Kwang-Hyun

    2015-01-01

    Specific wavelengths of light can exert various physiological changes in plants, including effects on responses to disease incidence. To determine whether specific light wavelength had effects on rotting disease caused by Pseudomonas putida 229, soybean sprouts were germinated under a narrow range of wavelengths from light emitting diodes (LEDs), including red (650-660), far red (720-730) and blue (440-450 nm) or broad range of wavelength from daylight fluorescence bulbs. The controls were composed of soybean sprouts germinated in darkness. After germination under different conditions for 5 days, the soybean sprouts were inoculated with P. putida 229 and the disease incidence was observed for 5 days. The sprouts exposed to red light showed increased resistance against P. putida 229 relative to those grown under other conditions. Soybean sprouts germinated under red light accumulated high levels of salicylic acid (SA) accompanied with up-regulation of the biosynthetic gene ICS and the pathogenesis- related (PR) gene PR-1, indicating that the resistance was induced by the action of SA via de novo synthesis of SA in the soybean sprouts by red light irradiation. Taken together, these data suggest that only the narrow range of red light can induce disease resistance in soybean sprouts, regulated by the SA-dependent pathway via the de novo synthesis of SA and up-regulation of PR genes.

  15. Soybean (Glycine max L. Merr.) Sprouts Germinated under Red Light Irradiation Induce Disease Resistance against Bacterial Rotting Disease

    PubMed Central

    Dhakal, Radhika; Park, Euiho; Lee, Se-Weon; Baek, Kwang-Hyun

    2015-01-01

    Specific wavelengths of light can exert various physiological changes in plants, including effects on responses to disease incidence. To determine whether specific light wavelength had effects on rotting disease caused by Pseudomonas putida 229, soybean sprouts were germinated under a narrow range of wavelengths from light emitting diodes (LEDs), including red (650–660), far red (720–730) and blue (440–450 nm) or broad range of wavelength from daylight fluorescence bulbs. The controls were composed of soybean sprouts germinated in darkness. After germination under different conditions for 5 days, the soybean sprouts were inoculated with P. putida 229 and the disease incidence was observed for 5 days. The sprouts exposed to red light showed increased resistance against P. putida 229 relative to those grown under other conditions. Soybean sprouts germinated under red light accumulated high levels of salicylic acid (SA) accompanied with up-regulation of the biosynthetic gene ICS and the pathogenesis- related (PR) gene PR-1, indicating that the resistance was induced by the action of SA via de novo synthesis of SA in the soybean sprouts by red light irradiation. Taken together, these data suggest that only the narrow range of red light can induce disease resistance in soybean sprouts, regulated by the SA-dependent pathway via the de novo synthesis of SA and up-regulation of PR genes. PMID:25679808

  16. "Nanoantibiotics": a new paradigm for treating infectious diseases using nanomaterials in the antibiotics resistant era.

    PubMed

    Huh, Ae Jung; Kwon, Young Jik

    2011-12-10

    Despite the fact that we live in an era of advanced and innovative technologies for elucidating underlying mechanisms of diseases and molecularly designing new drugs, infectious diseases continue to be one of the greatest health challenges worldwide. The main drawbacks for conventional antimicrobial agents are the development of multiple drug resistance and adverse side effects. Drug resistance enforces high dose administration of antibiotics, often generating intolerable toxicity, development of new antibiotics, and requests for significant economic, labor, and time investments. Recently, nontraditional antibiotic agents have been of tremendous interest in overcoming resistance that is developed by several pathogenic microorganisms against most of the commonly used antibiotics. Especially, several classes of antimicrobial nanoparticles (NPs) and nanosized carriers for antibiotics delivery have proven their effectiveness for treating infectious diseases, including antibiotics resistant ones, in vitro as well as in animal models. This review summarizes emerging efforts in combating against infectious diseases, particularly using antimicrobial NPs and antibiotics delivery systems as new tools to tackle the current challenges in treating infectious diseases.

  17. Life Experiences of People Affected by Crohn's Disease and Their Support Networks: Scoping Review.

    PubMed

    García-Sanjuán, Sofía; Lillo-Crespo, Manuel; Sanjuán-Quiles, Ángela; Gil-González, Diana; Richart-Martínez, Miguel

    2016-02-01

    This scoping review identifies and describes relevant studies related to the evidence published on life experiences and perceived social support of people affected by Crohn's disease. Twenty-three studies were definitely selected and analyzed for the topics explored. The overall findings show patients' needs and perceptions. There is a lack of evidence about patients' perceived needs as well as the understanding of social support that has contributed to improve their life experiences with that chronic illness. Lack of energy, loss of body control, body image damaged due to different treatments and surgeries, symptoms related to fear of disease, feeling burdened loss related to independence, and so on are some of the concerns with having to live with those affected by the Crohn. To underline those experiences through this scoping review provides valuable data for health care teams, especially for the nursing profession, considered by those affected as one of the main roles along the whole pathological process. This review provides the basis for developing broader research on the relatively underexplored topics and consequently improves specific programs that could address patients' needs.

  18. Functional investigation of a QTL affecting resistance to Haemonchus contortus in sheep.

    PubMed

    Sallé, Guillaume; Moreno, Carole; Boitard, Simon; Ruesche, Julien; Tircazes-Secula, Aurélie; Bouvier, Frédéric; Aletru, Mathias; Weisbecker, Jean-Louis; Prévot, Françoise; Bergeaud, Jean-Paul; Trumel, Cathy; Grisez, Christelle; Liénard, Emmanuel; Jacquiet, Philippe

    2014-06-17

    This study reports a functional characterization of a limited segment (QTL) of sheep chromosome 12 associated with resistance to the abomasal nematode Haemonchus contortus. The first objective was to validate the identified QTL through the comparison of genetically susceptible (N) and resistant (R) sheep produced from Martinik × Romane back-cross sheep. The R and N genotype groups were then experimentally infected with 10 000 H. contortus larvae and measured for FEC (every three days from 18 to 30 days post-challenge), haematocrit, worm burden and fertility. Significant differences in FEC and haematocrit drop were found between R and N sheep. In addition, the female worms recovered from R sheep were less fecund. The second step of the characterization was to investigate functional mechanisms associated with the QTL, thanks to a gene expression analysis performed on the abomasal mucosa and the abomasal lymph node. The gene expression level of a candidate gene lying within the QTL region (PAPP-A2) was measured. In addition, putative interactions between the chromosome segment under study and the top ten differentially expressed genes between resistant MBB and susceptible RMN sheep highlighted in a previous microarray experiment were investigated. We found an induction of Th-2 related cytokine genes expression in the abomasal mucosa of R sheep. Down-regulation of the PAPP-A2 gene expression was observed between naïve and challenged sheep although no differential expression was recorded between challenged R and N sheep. The genotyping of this limited region should contribute to the ability to predict the intrinsic resistance level of sheep.

  19. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  20. Strengths amidst vulnerabilities: the paradox of resistance in a mining-affected community in Guatemala.

    PubMed

    Caxaj, C Susana; Berman, Helene; Ray, Susan L; Restoule, Jean-Paul; Varcoe, Coleen

    2014-11-01

    The influence of large-scale mining on the psychosocial wellbeing and mental health of diverse Indigenous communities has attracted increased attention. In previous reports, we have discussed the influence of a gold mining operation on the health of a community in the Western highlands of Guatemala. Here, we discuss the community strengths, and acts of resistance of this community, that is, community processes that promoted mental health amidst this context. Using an anti-colonial narrative methodology that incorporated participatory action research principles, we developed a research design in collaboration with community leaders and participants. Data collection involved focus groups, individual interviews and photo-sharing with 54 men and women between the ages of 18 and 67. Data analysis was guided by iterative and ongoing conversations with participants and McCormack's narrative lenses. Study findings revealed key mechanisms and sources of resistance, including a shared cultural identity, a spiritual knowing and being, 'defending our rights, defending our territory,' and, speaking truth to power. These overlapping strengths were identified by participants as key protective factors in facing challenges and adversity. Yet ultimately, these same strengths were often the most eroded or endangered due the influence of large-scale mining operations in the region. These community strengths and acts of resistance reveal important priorities for promoting mental health and wellbeing for populations impacted by large-scale mining operations. Mental health practitioners must attend to both the strengths and parallel vulnerabilities that may be occasioned by large-scale projects of this nature.

  1. Development and Comparison of Symptom Indices for Quantifying Grapevine Resistance to Pierce's Disease.

    PubMed

    Krivanek, A F; Stevenson, J F; Walker, M A

    2005-01-01

    ABSTRACT Symptoms of Pierce's disease (PD) were assessed under greenhouse conditions on field-resistant and field-susceptible grapevines in order to characterize the PD resistance phenotype in the genus Vitis. A cane maturation index (CMI) was developed to quantify the green-islands symptom, which was measured at 12 weeks post-bacterial inoculation, along with leaf scorch and percentage of xylem vessels blocked by occlusions. Canes of resistant genotypes matured normally and had a significantly lower CMI score of 0.9 (on a 0-to-6 scale) compared with 5.1 for the susceptible genotypes. The CMI scoring method had a high correlation (R(2) = 0.91) with previously characterized field performance, whereas leaf scorch had only a moderate correlation (R(2) = 0.51) with field performance. Average scorched area on leaves of the susceptible and resistant genotypes was 80 and 48%, respectively, demonstrating that leaf scorch can be extensive in resistant genotypes under the presented screening conditions, and suggesting that systemic infection can occur in all evaluated genotypes. Occlusions within both stem and petiole vessels were composed principally of tyloses and were significantly higher in petioles than in stems of either resistant or susceptible backgrounds. Susceptible genotypes displayed a higher level of stem tylose occlusions relative to resistant genotypes, but correlation to field performance was low (R(2) = 0.13). Ease of use and high correlation to field performance makes CMI scoring a better choice for PD resistance evaluations relative to other phenotypic symptom assessments.

  2. Demographic effects of deltamethrin resistance in the Chagas disease vector Triatoma infestans.

    PubMed

    Germano, M D; Picollo, M I

    2016-12-01

    Triatoma infestans (Heteroptera: Reduviidae) Klug is the main vector of Chagas disease in Latin America. Resistance to deltamethrin was reported in Argentina and recently associated with reproductive and longevity trade-offs. The objectives of the present study were to describe the demographic consequences of deltamethrin resistance in T. infestans and to establish possible target stages for chemical control in susceptible and resistant colonies. A stage-classified matrix model was constructed based on the average stage length for susceptible, resistant and reciprocal matings' progeny. The differences between colonies were analysed by prospective and retrospective analysis. The life table parameters indicated reduced fecundity, fertility and population growth in resistant insects. The retrospective analysis suggested the latter was associated with lower reproductive output and increased fifth-instar nymph stage length. The prospective analysis suggested that the adult stage should be the main target for insecticide control. Although, fifth-instar nymphs should also be targeted when resistance has been detected. The presented results show demographic effects of deltamethrin resistance in T. infestans. While the older stages could be the main targets for chemical control, this approach is impeded by their higher tolerance to insecticides. It is concluded that the different mode of action insecticides would be more effective than a dose increase for the control of deltamethrin-resistant T. infestans.

  3. Inheritance of black sigatoka disease resistance in plantain-banana (Musa spp.) hybrids.

    PubMed

    Ortiz, R; Vuylsteke, D

    1994-10-01

    Black sigatoka (Mycosphaerella fijiensis Morelet), an airborne fungal leaf-spot disease, is a major constraint to plantain and banana (Musa spp.) production world-wide. Gaining further knowledge of the genetics of host-plant resistance will enhance the development of resistant cultivars, which is considered to be the most appropriate means to achieve stable production. Genetic analysis was conducted on 101 euploid (2x, 3x and 4x) progenies, obtained from crossing two susceptible triploid plantain cultivars with the resistant wild diploid banana 'Calcutta 4'. Segregating progenies, and a susceptible reference plantain cultivar, were evaluated over 2 consecutive years. Three distinct levels of host response to black sigatoka were defined as follows: susceptible (< 8 leaves without spots), less susceptible (8-10) and partially resistant (> 10). Segregation ratios for resistance at the 2x level fitted a genetic model having one major recessive resistance allele (bs 1) and two independent alleles with additive effects (bsr 2 and bsr 3). A similar model explains the results at the 4x level assuming that the favourable resistance alleles have a dosage effect when four copies of them are present in their respective loci (bs i (4) ). The proposed model was further validated by segregation data of S 1 progenies. Mechanisms of black sigatoka resistance are discussed in relation to the genetic model.

  4. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes.

    PubMed

    He, Bin; Gu, Yinghong; Tao, Xiang; Cheng, Xiaojie; Wei, Changhe; Fu, Jian; Cheng, Zaiquan; Zhang, Yizheng

    2015-12-10

    Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant-pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future.

  5. Overexpression of a citrus NDR1 ortholog increases disease resistance in Arabidopsis

    PubMed Central

    Lu, Hua; Zhang, Chong; Albrecht, Ute; Shimizu, Rena; Wang, Guanfeng; Bowman, Kim D.

    2013-01-01

    Emerging devastating diseases, such as Huanglongbing (HLB) and citrus canker, have caused tremendous losses to the citrus industry worldwide. Genetic engineering is a powerful approach that could allow us to increase citrus resistance against these diseases. The key to the success of this approach relies on a thorough understanding of defense mechanisms of citrus. Studies of Arabidopsis and other plants have provided a framework for us to better understand defense mechanisms of citrus. Salicylic acid (SA) is a key signaling molecule involved in basal defense and resistance (R) gene-mediated defense against broad-spectrum pathogens. The Arabidopsis gene NDR1 (NON-RACE-SPECIFIC DISEASE RESISTANCE 1) is a positive regulator of SA accumulation and is specifically required for signaling mediated by a subset of R genes upon recognition of their cognate pathogen effectors. Our bioinformatic analysis identified an ortholog of NDR1 from citrus, CsNDR1. Overexpression of CsNDR1 complemented susceptibility conferred by the Arabidopsis ndr1-1 mutant to Pseudomonas syringae strains and also led to enhanced resistance to an oomycete pathogen Hyaloperonospora arabidopsidis. Such heightened resistance is associated with increased SA production and expression of the defense marker gene PATHOGENESIS RELATED 1 (PR1). In addition, we found that expression of PR1 and accumulation of SA were induced to modest levels in citrus infected with Candidatus Liberibacter asiaticus, the bacterial pathogen associated with HLB disease. Thus, our data suggest that CsNDR1 is a functional ortholog of Arabidopsis NDR1. Since Ca. L. asiaticus infection only activates modest levels of defense responses in citrus, we propose that genetically increasing SA/NDR1-mediated pathways could potentially lead to enhanced resistance against HLB, citrus canker, and other destructive diseases challenging global citrus production. PMID:23761797

  6. Role of matrix metalloproteinase-9 in chronic kidney disease: a new biomarker of resistant albuminuria.

    PubMed

    Pulido-Olmo, Helena; García-Prieto, Concha F; Álvarez-Llamas, Gloria; Barderas, María G; Vivanco, Fernando; Aranguez, Isabel; Somoza, Beatriz; Segura, Julián; Kreutz, Reinhold; Fernández-Alfonso, María S; Ruilope, Luis M; Ruiz-Hurtado, Gema

    2016-04-01

    Resistant albuminuria, developed under adequate chronic blockade of the renin-angiotensin system, is a clinical problem present in a small number of patients with chronic kidney disease (CKD). The mechanism underlying this resistant albuminuria remains unknown. Matrix metalloproteinases (MMPs) are involved in the pathophysiology of cardiovascular and renal diseases. In the present study we tested the role of MMPs in resistant albuminuria. First we evaluated gelatinase MMP-2 and MMP-9 activity by zymography in the Munich Wistar Frömter (MWF) rat, a model of progressive albuminuria, and subsequently in patients with resistant albuminuria. Markers of oxidative stress were observed in the kidneys of MWF rats, together with a significant increase in pro-MMP-2 and active MMP-9 forms. These changes were normalized together with reduced albuminuria in consomic MWF-8(SHR) rats, in which chromosome 8 of MWF was replaced with the respective chromosome from spontaneously hypertensive rats. The MMP-2 and MMP-9 protein levels were similar in patients with normal and resistant albuminuria; however, high circulating levels of collagen IV, a specific biomarker of tissue collagen IV degradation, were observed in patients with resistant albuminuria. These patients showed a significant increase in gelatinase MMP-2 and MMP-9 activity, but only a significant increase in the active MMP-9 form quantified by ELISA, which correlated significantly with the degree of albuminuria. Although the expression of the tissue inhibitor of MMP-9 (TIMP)-1 was similar, a novel AlphaLISA assay demonstrated that the MMP-9-TIMP-1 interaction was reduced in patients with resistant albuminuria. It is of interest that oxidized TIMP-1 expression was higher in patients with resistant albuminuria. Therefore, increased circulating MMP-9 activity is associated with resistant albuminuria and a deleterious oxidative stress environment appears to be the underlying mechanism. These changes might contribute to the

  7. Rice WRKY45 plays important roles in fungal and bacterial disease resistance.

    PubMed

    Shimono, Masaki; Koga, Hironori; Akagi, Aya; Hayashi, Nagao; Goto, Shingo; Sawada, Miyuki; Kurihara, Takayuki; Matsushita, Akane; Sugano, Shoji; Jiang, Chang-Jie; Kaku, Hisatoshi; Inoue, Haruhiko; Takatsuji, Hiroshi

    2012-01-01

    Plant 'activators', such as benzothiadiazole (BTH), protect plants from various diseases by priming the plant salicylic acid (SA) signalling pathway. We have reported previously that a transcription factor identified in rice, WRKY45 (OsWRKY45), plays a pivotal role in BTH-induced disease resistance by mediating SA signalling. Here, we report further functional characterization of WRKY45. Different plant activators vary in their action points, either downstream (BTH and tiadinil) or upstream (probenazole) of SA. Rice resistance to Magnaporthe grisea, induced by both types of plant activator, was markedly reduced in WRKY45-knockdown (WRKY45-kd) rice, indicating a universal role for WRKY45 in chemical-induced resistance. Fungal invasion into rice cells was blocked at most attempted invasion sites (pre-invasive defence) in WRKY45-overexpressing (WRKY45-ox) rice. Hydrogen peroxide accumulated within the cell wall underneath invading fungus appressoria or between the cell wall and the cytoplasm, implying a possible role for H(2)O(2) in pre-invasive defence. Moreover, a hypersensitive reaction-like reaction was observed in rice cells, in which fungal growth was inhibited after invasion (post-invasive defence). The two levels of defence mechanism appear to correspond to Type I and II nonhost resistances. The leaf blast resistance of WRKY45-ox rice plants was much higher than that of other known blast-resistant varieties. WRKY45-ox plants also showed strong panicle blast resistance. BTH-induced resistance to Xanthomonas oryzae pv. oryzae was compromised in WRKY45-kd rice, whereas WRKY45-ox plants were highly resistant to this pathogen. However, WRKY45-ox plants were susceptible to Rhizoctonia solani. These results indicate the versatility and limitations of the application of this gene.

  8. Calf and disease factors affecting growth in female Holstein calves in Florida, USA.

    PubMed

    Donovan, G A; Dohoo, I R; Montgomery, D M; Bennett, F L

    1998-01-01

    A prospective cohort study was undertaken to determine calf-level factors that affect performance (growth) between birth and 14 months of age in a convenience sample of approximately 3300 female Holstein calves born in 1991 on two large Florida dairy farms. Data collected on each calf at birth included farm of origin, birth date, weight, height at the pelvis, and serum total protein (a measure of colostral immunoglobulin absorption). Birth season was dichotomized into summer and winter using meteorological data collected by University of Florida Agricultural Research Stations. Data collected at approximately 6 and 14 months of age included age, weight, height at the pelvis, and height at the withers. Growth in weight and stature (height) was calculated for each growth period; growth period 1 (GP1) = birth to 6 months, and growth period 2 (GP2) = 6 to 14 months. Health data collected included data of initial treatment and number of treatments for the diseases diarrhea, omphalitis, septicemia, pneumonia and keratoconjunctivitis. After adjusting for disease occurrence, passive transfer of colostral immunoglobulins had no significant effect on body weight gain or pelvic height growth. Season of birth and occurrence of diarrhea, septicemia and respiratory disease were significant variables decreasing heifer growth (height and weight) in GP1. These variables plus farm, birth weight and exact age when '6 month' data were collected explained 20% and 31% of the variation in body weight gain and pelvic height growth, respectively, in GP1. The number of days treated for pneumonia before 6 months of age significantly decreased average daily weight gain in GP2 (P < 0.025), but did not affect stature growth. Treatment for pneumonia after 6 months of age did not significantly affect weight or height gain after age 6 months. Neither omphalitis nor keratoconjunctivitis explained variability in growth in either of the growth periods.

  9. Emotion Risk-Factor in Patients With Cardiac Diseases: The Role of Cognitive Emotion Regulation Strategies, Positive Affect and Negative Affect (A Case-Control Study)

    PubMed Central

    Bahremand, Mostafa; Alikhani, Mostafa; Zakiei, Ali; Janjani, Parisa; Aghaei, Abbas

    2016-01-01

    Application of psychological interventions is essential in classic treatments for patient with cardiac diseases. The present study compared cognitive emotion regulation strategies, positive affect, and negative affect for cardiac patients with healthy subjects. This study was a case-control study. Fifty subjects were selected using convenient sampling method from cardiac (coronary artery disease) patients presenting in Imam Ali medical center of Kermanshah, Iran in the spring 2013. Fifty subjects accompanied the patients to the medical center, selected as control group, did not have any history of cardiac diseases. For collecting data, the cognitive emotion regulation questionnaire and positive and negative affect scales were used. For data analysis, multivariate analysis of variance (MANOVA) was applied using the SPSS statistical software (ver. 19.0). In all cognitive emotion regulation strategies, there was a significant difference between the two groups. A significant difference was also detected regarding positive affect between the two groups, but no significant difference was found regarding negative affect. We found as a result that, having poor emotion regulation strategies is a risk factor for developing heart diseases. PMID:26234976

  10. The translational machinery is an optimized molecular network that affects cellular homoeostasis and disease.

    PubMed

    Kazana, Eleanna; von der Haar, Tobias

    2014-02-01

    Translation involves interactions between mRNAs, ribosomes, tRNAs and a host of translation factors. Emerging evidence on the eukaryotic translational machinery indicates that these factors are organized in a highly optimized network, in which the levels of the different factors are finely matched to each other. This optimal factor network is essential for producing proteomes that result in optimal fitness, and perturbations to the optimal network that significantly affect translational activity therefore result in non-optimal proteomes, fitness losses and disease. On the other hand, experimental evidence indicates that translation and cell growth are relatively robust to perturbations, and viability can be maintained even upon significant damage to individual translation factors. How the eukaryotic translational machinery is optimized, and how it can maintain optimization in the face of changing internal parameters, are open questions relevant to the interaction between translation and cellular disease states.

  11. Aspirin Resistance Predicts Adverse Cardiovascular Events in Patients with Symptomatic Peripheral Artery Disease

    PubMed Central

    Pasala, Tilak; Hoo, Jennifer Soo; Lockhart, Mary Kate; Waheed, Rehan; Sengodan, Prasanna; Alexander, Jeffrey

    2016-01-01

    Antiplatelet therapy reduces the risk of myocardial infarction, stroke, and vascular death in patients who have symptomatic peripheral artery disease. However, a subset of patients who take aspirin continues to have recurrent cardiovascular events. There are few data on cardiovascular outcomes in patients with peripheral artery disease who manifest aspirin resistance. Patients with peripheral artery disease on long-term aspirin therapy (≥4 wk) were tested for aspirin responsiveness by means of the VerifyNow Aspirin Assay. The mean follow-up duration was 22.6 ± 8.3 months. The primary endpoint was a composite of death, myocardial infarction, or ischemic stroke. Secondary endpoints were the incidence of vascular interventions (surgical or percutaneous), or of amputation or gangrene caused by vascular disease. Of the 120 patients enrolled in the study, 31 (25.8%) were aspirin-resistant and 89 (74.2%) were aspirin-responsive. The primary endpoint occurred in 10 (32.3%) patients in the aspirin-resistant group and in 13 (14.6%) patients in the aspirin-responsive group (hazard ratio=2.48; 95% confidence interval, 1.08–5.66; P=0.03). There was no significant difference in the secondary outcome of revascularization or tissue loss. By multivariate analysis, aspirin resistance and history of chronic kidney disease were the only independent predictors of long-term adverse cardiovascular events. Aspirin resistance is highly prevalent in patients with symptomatic peripheral artery disease and is an independent predictor of adverse cardiovascular risk. Whether intervening in these patients with additional antiplatelet therapies would improve outcomes needs to be explored. PMID:28100965

  12. Evaluation of Neurodevelopment and Factors Affecting it in Children With Acyanotic Congenital Cardiac Disease

    PubMed Central

    Ozmen, Ayten; Terlemez, Semiha; Tunaoglu, Fatma Sedef; Soysal, Sebnem; Pektas, Ayhan; Cilsal, Erman; Koca, Ulker; Kula, Serdar; Deniz Oguz, Ayse

    2016-01-01

    Background: The rate of congenital heart disease is 0.8% in all live births. The majority of this, however, is acyanotic congenital heart disease. The survival rate of children with cardiac disease has increased with the developments provided in recent years and their lifetime is extended. Objectives: This study aims to evaluate neurodevelopment of children with uncomplicated acyanotic congenital heart disease in preschool period and determine the factors affecting their neurodevelopmental process. Patients and Methods: 132 children with acyanotic congenital heart disease aged 6 - 72 months were involved in the study. Mental development and intelligence levels of patients under 2 years old were assessed by using Bayley Development Scale-III, and Stanford Binet Intelligence test was employed for patients over 2 years old. Denver Developmental Screening Test II was applied to all patients for their personal-social, fine motor, gross motor and language development. Results: The average age of patients (67 girls, 65 boys) included in the study was 35.2 ± 19.6 months. It was determined that there were subnormal mental level in 13 (10%) patients and at least one specific developmental disorder in 33 (25%) patients. Bayley Mental Development Scale score of patients who had received incubator care in perinatal period was found significantly low (88 ± 4.2) compared to those with no incubator care (93.17 ± 8.5) (P = 0.028). Low educational level of father was established to be linked with low mental development scores at the age of 2 and following that age (P < 0.05). Iron deficiency anemia was discovered to be related to low psychometric test scores at every age (P < 0.05). Conclusions: Neurodevelopmental problems in children with acyanotic congenital heart disease were found higher compared to those in society. Mental development and intelligence levels of patients were determined to be closely associated with receiving incubator care, father’s educational level and

  13. Visualization of Microstructural Factor Resisting the Cleavage-Crack Propagation in the Simulated Heat-Affected Zone of Bainitic Steel

    NASA Astrophysics Data System (ADS)

    Terasaki, Hidenori; Miyahara, Yu; Ohata, Mitsuru; Moriguchi, Koji; Tomio, Yusaku; Hayashi, Kotaro

    2015-12-01

    Cleavage-crack propagation behavior was investigated in the simulated coarse-grained heat-affected zone (CGHAZ) of bainitic steel using electron backscattering diffraction (EBSD) pattern analysis when a low heat input welding was simulated. From viewpoint of crystallographic analysis, it was the condition in which the Bain zone was smaller than the close-packed plane (CP) group. It was clarified that the Bain zone and CP group boundaries provided crack-propagation resistance. The results revealed that when the Bain zone was smaller than the CP group, crack length was about one quarter the size of that measured when the CP group was smaller than the Bain zone because of the increasing Bain-zone boundaries. Furthermore, it was clarified that the plastic work associated with crack opening and resistance at the Bain and CP boundaries could be visualized by the kernel average misorientation maps.

  14. Treatment of multidrug-resistant tuberculosis in a remote, conflict-affected area of the Democratic Republic of Congo.

    PubMed

    Shanks, L; Masumbuko, E W; Ngoy, N M; Maneno, M; Bartlett, S; Thi, S S; Shah, T

    2012-08-01

    The Democratic Republic of Congo is a high-burden country for multidrug-resistant tuberculosis. Médecins Sans Frontières has supported the Ministry of Health in the conflict-affected region of Shabunda since 1997. In 2006, three patients were diagnosed with drug-resistant TB (DR-TB) and had no options for further treatment. An innovative model was developed to treat these patients despite the remote setting. Key innovations were the devolving of responsibility for treatment to non-TB clinicians remotely supported by a TB specialist, use of simplified monitoring protocols, and a strong focus on addressing stigma to support adherence. Treatment was successfully completed after a median of 24 months. This pilot programme demonstrates that successful treatment for DR-TB is possible on a small scale in remote settings.

  15. Predicting acute affective symptoms after deep brain stimulation surgery in Parkinson's disease.

    PubMed

    Schneider, Frank; Reske, Martina; Finkelmeyer, Andreas; Wojtecki, Lars; Timmermann, Lars; Brosig, Timo; Backes, Volker; Amir-Manavi, Atoosa; Sturm, Volker; Habel, Ute; Schnitzler, Alfons

    2010-01-01

    The current study aimed to investigate predictive markers for acute symptoms of depression and mania following deep brain stimulation (DBS) surgery of the subthalamic nucleus for the treatment of motor symptoms in Parkinson's disease (PD). Fourteen patients with PD (7 males) were included in a prospective longitudinal study. Neuropsychological tests, psychopathology scales and tests of motor functions were administered at several time points prior to and after neurosurgery. Pre-existing psychopathological and motor symptoms predicted postoperative affective side effects of DBS surgery. As these can easily be assessed, they should be considered along with other selection criteria for DBS surgery.

  16. A major effect quantitative trait locus for whirling disease resistance identified in rainbow trout (Oncorhynchus mykiss)

    PubMed Central

    Baerwald, M R; Petersen, J L; Hedrick, R P; Schisler, G J; May, B

    2011-01-01

    Whirling disease, caused by the pathogen Myxobolus cerebralis, leads to skeletal deformation, neurological impairment and under certain conditions, mortality of juvenile salmonid fishes. The disease has impacted the propagation and survival of many salmonid species over six continents, with particularly negative consequences for rainbow trout. To assess the genetic basis of whirling disease resistance in rainbow trout, genome-wide mapping was initiated using a large outbred F2 rainbow trout family (n=480) and results were confirmed in three additional outbred F2 families (n=96 per family). A single quantitative trait locus (QTL) region on chromosome Omy9 was identified in the large mapping family and confirmed in all additional families. This region explains 50–86% of the phenotypic variance across families. Therefore, these data establish that a single QTL region is capable of explaining a large percentage of the phenotypic variance contributing to whirling disease resistance. This is the first genetic region discovered that contributes directly to the whirling disease phenotype and the finding moves the field closer to a mechanistic understanding of resistance to this important disease of salmonid fish. PMID:21048672

  17. Dietary magnesium and copper affect survival time and neuroinflammation in chronic wasting disease

    PubMed Central

    Nichols, Tracy A.; Spraker, Terry R.; Gidlewski, Thomas; Cummings, Bruce; Hill, Dana; Kong, Qingzhong; Balachandran, Aru; VerCauteren, Kurt C.; Zabel, Mark D.

    2016-01-01

    ABSTRACT Chronic wasting disease (CWD), the only known wildlife prion disease, affects deer, elk and moose. The disease is an ongoing and expanding problem in both wild and captive North American cervid populations and is difficult to control in part due to the extreme environmental persistence of prions, which can transmit disease years after initial contamination. The role of exogenous factors in CWD transmission and progression is largely unexplored. In an effort to understand the influence of environmental and dietary constituents on CWD, we collected and analyzed water and soil samples from CWD-negative and positive captive cervid facilities, as well as from wild CWD-endozootic areas. Our analysis revealed that, when compared with CWD-positive sites, CWD-negative sites had a significantly higher concentration of magnesium, and a higher magnesium/copper (Mg/Cu) ratio in the water than that from CWD-positive sites. When cevidized transgenic mice were fed a custom diet devoid of Mg and Cu and drinking water with varied Mg/Cu ratios, we found that higher Mg/Cu ratio resulted in significantly longer survival times after intracerebral CWD inoculation. We also detected reduced levels of inflammatory cytokine gene expression in mice fed a modified diet with a higher Mg/Cu ratio compared to those on a standard rodent diet. These findings indicate a role for dietary Mg and Cu in CWD pathogenesis through modulating inflammation in the brain. PMID:27216881

  18. Analysis of Newcastle disease virus quasispecies and factors affecting the emergence of virulent virus.

    PubMed

    Kattenbelt, Jacqueline A; Stevens, Matthew P; Selleck, Paul W; Gould, Allan R

    2010-10-01

    Genome sequence analysis of a number of avirulent field isolates of Newcastle disease virus revealed the presence of viruses (within their quasispecies) that contained virulent F0 sequences. Detection of these virulent sequences below the ~1% level, using standard cloning and sequence analysis, proved difficult, and thus a more sensitive reverse-transcription real-time PCR procedure was developed to detect both virulent and avirulent NDV F0 sequences. Reverse-transcription real-time PCR analysis of the quasispecies of a number of Newcastle disease virus field isolates, revealed variable ratios (approximately 1:4-1:4,000) of virulent to avirulent viral F0 sequences. Since the ratios of these sequences generally remained constant in the quasispecies population during replication, factors that could affect the balance of virulent to avirulent sequences during viral infection of birds were investigated. It was shown both in vitro and in vivo that virulent virus present in the quasispecies did not emerge from the "avirulent background" unless a direct selection pressure was placed on the quasispecies, either by growth conditions or by transient immunosuppression. The effect of a prior infection of the host by infectious bronchitis virus or infectious bursal disease virus on the subsequent emergence of virulent Newcastle disease virus was examined.

  19. Simple Resistance Exercise helps Patients with Non-alcoholic Fatty Liver Disease.

    PubMed

    Takahashi, A; Abe, K; Usami, K; Imaizumi, H; Hayashi, M; Okai, K; Kanno, Y; Tanji, N; Watanabe, H; Ohira, H

    2015-10-01

    To date, only limited evidence has supported the notion that resistance exercise positively impacts non-alcoholic fatty liver disease. We evaluated the effects of resistance exercise on the metabolic parameters of non-alcoholic fatty liver disease (NAFLD) in 53 patients who were assigned to either a group that performed push-ups and squats 3 times weekly for 12 weeks (exercise group; n=31) or a group that did not (control; n=22). Patients in the control group proceeded with regular physical activities under a restricted diet throughout the study. The effects of the exercise were compared between the 2 groups after 12 weeks. Fat-free mass and muscle mass significantly increased, whereas hepatic steatosis grade, mean insulin and ferritin levels, and the homeostasis model assessment-estimated insulin resistance index were significantly decreased in the exercise group. Compliance with the resistance exercise program did not significantly correlate with patient background characteristics such as age, sex, BMI and metabolic complications. These findings show that resistance exercise comprising squats and push-ups helps to improve the characteristics of metabolic syndrome in patients with non-alcoholic fatty liver disease.

  20. CFH Variants Affect Structural and Functional Brain Changes and Genetic Risk of Alzheimer's Disease.

    PubMed

    Zhang, Deng-Feng; Li, Jin; Wu, Huan; Cui, Yue; Bi, Rui; Zhou, He-Jiang; Wang, Hui-Zhen; Zhang, Chen; Wang, Dong; Kong, Qing-Peng; Li, Tao; Fang, Yiru; Jiang, Tianzi; Yao, Yong-Gang

    2016-03-01

    The immune response is highly active in Alzheimer's disease (AD). Identification of genetic risk contributed by immune genes to AD may provide essential insight for the prognosis, diagnosis, and treatment of this neurodegenerative disease. In this study, we performed a genetic screening for AD-related top immune genes identified in Europeans in a Chinese cohort, followed by a multiple-stage study focusing on Complement Factor H (CFH) gene. Effects of the risk SNPs on AD-related neuroimaging endophenotypes were evaluated through magnetic resonance imaging scan, and the effects on AD cerebrospinal fluid biomarkers (CSF) and CFH expression changes were measured in aged and AD brain tissues and AD cellular models. Our results showed that the AD-associated top immune genes reported in Europeans (CR1, CD33, CLU, and TREML2) have weak effects in Chinese, whereas CFH showed strong effects. In particular, rs1061170 (P(meta)=5.0 × 10(-4)) and rs800292 (P(meta)=1.3 × 10(-5)) showed robust associations with AD, which were confirmed in multiple world-wide sample sets (4317 cases and 16 795 controls). Rs1061170 (P=2.5 × 10(-3)) and rs800292 (P=4.7 × 10(-4)) risk-allele carriers have an increased entorhinal thickness in their young age and a higher atrophy rate as the disease progresses. Rs800292 risk-allele carriers have higher CSF tau and Aβ levels and severe cognitive decline. CFH expression level, which was affected by the risk-alleles, was increased in AD brains and cellular models. These comprehensive analyses suggested that CFH is an important immune factor in AD and affects multiple pathological changes in early life and during disease progress.

  1. Overexpression of a novel peanut NBS-LRR gene AhRRS5 enhances disease resistance to Ralstonia solanacearum in tobacco.

    PubMed

    Zhang, Chong; Chen, Hua; Cai, Tiecheng; Deng, Ye; Zhuang, Ruirong; Zhang, Ning; Zeng, Yuanhuan; Zheng, Yixiong; Tang, Ronghua; Pan, Ronglong; Zhuang, Weijian

    2017-01-01

    Bacterial wilt caused by Ralstonia solanacearum is a ruinous soilborne disease affecting more than 450 plant species. Efficient control methods for this disease remain unavailable to date. This study characterized a novel nucleotide-binding site-leucine-rich repeat resistance gene AhRRS5 from peanut, which was up-regulated in both resistant and susceptible peanut cultivars in response to R. solanacearum. The product of AhRRS5 was localized in the nucleus. Furthermore, treatment with phytohormones such as salicylic acid (SA), abscisic acid (ABA), methyl jasmonate (MeJA) and ethephon (ET) increased the transcript level of AhRRS5 with diverse responses between resistant and susceptible peanuts. Abiotic stresses such as drought and cold conditions also changed AhRRS5 expression. Moreover, transient overexpression induced hypersensitive response in Nicotiana benthamiana. Overexpression of AhRRS5 significantly enhanced the resistance of heterogeneous tobacco to R. solanacearum, with diverse resistance levels in different transgenic lines. Several defence-responsive marker genes in hypersensitive response, including SA, JA and ET signals, were considerably up-regulated in the transgenic lines as compared with the wild type inoculated with R. solanacearum. Nonexpressor of pathogenesis-related gene 1 (NPR1) and non-race-specific disease resistance 1 were also up-regulated in response to the pathogen. These results indicate that AhRRS5 participates in the defence response to R. solanacearum through the crosstalk of multiple signalling pathways and the involvement of NPR1 and R gene signals for its resistance. This study may guide the resistance enhancement of peanut and other economic crops to bacterial wilt disease.

  2. Insulin resistance in Alzheimer disease: Is heme oxygenase-1 an Achille's heel?

    PubMed

    Barone, Eugenio; Butterfield, D Allan

    2015-12-01

    Insulin resistance, clinically defined as the inability of insulin to increase glucose uptake and utilization, has been found to be associated with the progression of Alzheimer disease (AD). Indeed, postmortem AD brain shows all the signs of insulin resistance including: (i) reduced brain insulin receptor (IR) sensitivity, (ii) hypophosphorylation of the insulin receptor and downstream second messengers such as IRS-1, and (iii) attenuated insulin and insulin growth factor (IGF)-1 receptor expression. However, the exact mechanisms driving insulin resistance have not been completely elucidated. Quite recently, the levels of the peripheral inducible isoform of heme oxygenase (HO-1), a well-known protein up-regulated during cell stress response, were proposed to be among the strongest positive predictors of metabolic disease, including insulin resistance. Because our group previously reported on levels, activation state and oxidative stress-induced post-translational modifications of HO-1 in AD brain and our ongoing studies to better elucidate the role of HO-1 in insulin resistance-associated AD pathology, the aim of this review is to provide reader with a critical analysis on new aspects of the interplay between HO-1 and insulin resistance and on how the available lines of evidence could be useful for further comprehension of processes in AD brain.

  3. Selection of Inhibitor-Resistant Viral Potassium Channels Identifies a Selectivity Filter Site that Affects Barium and Amantadine Block

    PubMed Central

    Fujiwara, Yuichiro; Arrigoni, Cristina; Domigan, Courtney; Ferrara, Giuseppina; Pantoja, Carlos; Thiel, Gerhard; Moroni, Anna; Minor, Daniel L.

    2009-01-01

    Background Understanding the interactions between ion channels and blockers remains an important goal that has implications for delineating the basic mechanisms of ion channel function and for the discovery and development of ion channel directed drugs. Methodology/Principal Findings We used genetic selection methods to probe the interaction of two ion channel blockers, barium and amantadine, with the miniature viral potassium channel Kcv. Selection for Kcv mutants that were resistant to either blocker identified a mutant bearing multiple changes that was resistant to both. Implementation of a PCR shuffling and backcrossing procedure uncovered that the blocker resistance could be attributed to a single change, T63S, at a position that is likely to form the binding site for the inner ion in the selectivity filter (site 4). A combination of electrophysiological and biochemical assays revealed a distinct difference in the ability of the mutant channel to interact with the blockers. Studies of the analogous mutation in the mammalian inward rectifier Kir2.1 show that the T→S mutation affects barium block as well as the stability of the conductive state. Comparison of the effects of similar barium resistant mutations in Kcv and Kir2.1 shows that neighboring amino acids in the Kcv selectivity filter affect blocker binding. Conclusions/Significance The data support the idea that permeant ions have an integral role in stabilizing potassium channel structure, suggest that both barium and amantadine act at a similar site, and demonstrate how genetic selections can be used to map blocker binding sites and reveal mechanistic features. PMID:19834614

  4. Association mapping of fruit, seed and disease resistance traits in Theobroma cacao L

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An association mapping approach was employed to find markers for color, size, girth and mass of fruits; seed number and butterfat content; and resistance to black pod and witches’ broom diseases in cacao (Theobroma cacao L.). Ninety-five microsatellites (SSRs) and 775 single nucleotide polymorphisms...

  5. Screening for insect and disease resistance and aflatoxin accumulation in experimental maize hybrids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to develop new maize germplasm lines with resistance to multiple insect pests, disease, and aflatoxin accumulation in temperate region, a set of new experimental hybrids was made using exotic tropical and subtropical maize inbred lines. The evaluation of these breeding crosses for insect a...

  6. The genetics of leaf flecking in maize and its relationship to plant defense and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Physiological/genetic leaf spotting, or flecking, is a mild lesion phenotype observed on the leaves of several commonly used maize inbred lines and has been anecdotally linked to enhanced broad-spectrum disease resistance. Flecking was assessed in the maize nested association mapping (NAM) populati...

  7. Genomic tools for developing markers for postharvest disease resistance in Rosaceae fruit crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A wealth of new plant genomic information and molecular tools have been developed over the past ten years and now the challenge is to learn how to apply this information to address critical production problems, such as disease resistance and abiotic stress tolerance. Malus sieversii, an apple speci...

  8. Response to selection for bacterial cold water disease resistance in rainbow trout

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A family-based selection program was initiated at the National Center for Cool and Cold Water Aquaculture in 2005 to improve resistance to bacterial cold water disease (BCWD) in rainbow trout. The objective of this study was to estimate response to 2 generations of selection. A total of 14,841 juven...

  9. Transgenic resistance confers effective field level control of bacterial spot disease in tomato.

    PubMed

    Horvath, Diana M; Stall, Robert E; Jones, Jeffrey B; Pauly, Michael H; Vallad, Gary E; Dahlbeck, Doug; Staskawicz, Brian J; Scott, John W

    2012-01-01

    We investigated whether lines of transgenic tomato (Solanum lycopersicum) expressing the Bs2 resistance gene from pepper, a close relative of tomato, demonstrate improved resistance to bacterial spot disease caused by Xanthomonas species in replicated multi-year field trials under commercial type growing conditions. We report that the presence of the Bs2 gene in the highly susceptible VF 36 background reduced disease to extremely low levels, and VF 36-Bs2 plants displayed the lowest disease severity amongst all tomato varieties tested, including commercial and breeding lines with host resistance. Yields of marketable fruit from transgenic lines were typically 2.5 times that of the non-transformed parent line, but varied between 1.5 and 11.5 fold depending on weather conditions and disease pressure. Trials were conducted without application of any copper-based bactericides, presently in wide use despite negative impacts on the environment. This is the first demonstration of effective field resistance in a transgenic genotype based on a plant R gene and provides an opportunity for control of a devastating pathogen while eliminating ineffective copper pesticides.

  10. Evaluating Hawaii-Grown Papaya for Resistance to Internal Yellowing Disease Caused by Enterobacter cloacae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Papaya (Carica papaya L.) cultivars and breeding lines were evaluated for resistance to Enterobacter cloacae (Jordan) Hormaeche & Edwards, the bacterial causal agent of internal yellowing disease (IY), using a range of concentrations of the bacterium. Linear regression analysis was performed and IY ...

  11. Prevalence and characteristics of patients with resistant hypertension and chronic kidney disease.

    PubMed

    Verdalles, Úrsula; Goicoechea, Marian; Garcia de Vinuesa, Soledad; Quiroga, Borja; Galan, Isabel; Verde, Eduardo; Perez de Jose, Ana; Luño, José

    Resistant hypertension (RH) is a common problem in patients with chronic kidney disease (CKD). A decline in the glomerular filtration rate (GFR) and increased albuminuria are associated with RH; however, there are few published studies about the prevalence of this entity in patients with CKD.

  12. Exosomal biomarkers of brain insulin resistance associated with regional atrophy in Alzheimer's disease.

    PubMed

    Mullins, Roger J; Mustapic, Maja; Goetzl, Edward J; Kapogiannis, Dimitrios

    2017-04-01

    Brain insulin resistance (IR), which depends on insulin-receptor-substrate-1 (IRS-1) phosphorylation, is characteristic of Alzheimer's disease (AD). Previously, we demonstrated higher pSer312-IRS-1 (ineffective insulin signaling) and lower p-panTyr-IRS-1 (effective insulin signaling) in neural origin-enriched plasma exosomes of AD patients vs.

  13. Development of a pathology toolbox for genetic and breeding for resistance to rice sheath blight disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Accurate evaluation of the host response of rice plants to sheath blight disease, Rhizoctonia solani, is important for genetic studies and breeding for improved resistance. In the present study, a method to evaluate the response of a recombinant inbred mapping population, consisting of 574 F10 indiv...

  14. Evaluation of seashore paspalum germplasm for resistance to dollar spot disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Development of seashore paspalum (Paspalum vaginatum Swartz) cultivars that exhibit resistance to dollar spot disease, caused by Sclerotinia homoeocarpa F.T. Bennett, are needed. Seashore paspalum is a warm-season turfgrass often utilized on golf courses and athletic fields in the southeastern Unite...

  15. Disease resistance from the USDA National Small Grains collection -- past, present, and future.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Disease resistance from the USDA National Small Grains Collection-- past, present, and future. J. M. BONMAN, H.E. Bockelman, and B.J. Goates. USDA-ARS, Small Grains and Potato Germplasm Research Unit, Aberdeen, ID The National Small Grains Collection (NSGC) had its beginnings more than 100 year...

  16. Probiotics cultures in animal feed: Effects on ruminal fermentation, immune responses, and resistance to infectious diseases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We evaluated the effects of probiotics included in dairy cattle and mice feed on ruminal fermentation, immune responses, and resistance to Johne’s disease. To unveil the underlying mechanisms, dairy cattle were either fed Bovamine (1.04 x 10**9 cfu of Lactobacillus acidophilus NP51 plus 2.04 x 10**...

  17. Evaluation of fruit rot disease resistance in muscadine grapes (Vitis rotundifolia Michx)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Musacadine grapes (Vitis rotundifolia Michx.) are truly a sustainable fruit for the southeastern United States. Although far more resistant to many fungal and bacterial diseases and pests than most of the bunch grapes (V. vinifera, V. labrusca, or their derivatives), muscadine grape suffers consider...

  18. Developing maize germplasm lines with multiple insect and disease resistance and low aflatoxin contamination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Yield and quality losses caused BY insects, diseases, and mycotoxin contaminations are the critical impediments for maize production under warm climate. In order to develop maize germplasm lines with resistance to multiple insect pests and aflatoxin accumulation, a set of 13 reciprocal breeding cro...

  19. Transgenic Resistance Confers Effective Field Level Control of Bacterial Spot Disease in Tomato

    PubMed Central

    Horvath, Diana M.; Stall, Robert E.; Jones, Jeffrey B.; Pauly, Michael H.; Vallad, Gary E.; Dahlbeck, Doug; Staskawicz, Brian J.; Scott, John W.

    2012-01-01

    We investigated whether lines of transgenic tomato (Solanum lycopersicum) expressing the Bs2 resistance gene from pepper, a close relative of tomato, demonstrate improved resistance to bacterial spot disease caused by Xanthomonas species in replicated multi-year field trials under commercial type growing conditions. We report that the presence of the Bs2 gene in the highly susceptible VF 36 background reduced disease to extremely low levels, and VF 36-Bs2 plants displayed the lowest disease severity amongst all tomato varieties tested, including commercial and breeding lines with host resistance. Yields of marketable fruit from transgenic lines were typically 2.5 times that of the non-transformed parent line, but varied between 1.5 and 11.5 fold depending on weather conditions and disease pressure. Trials were conducted without application of any copper-based bactericides, presently in wide use despite negative impacts on the environment. This is the first demonstration of effective field resistance in a transgenic genotype based on a plant R gene and provides an opportunity for control of a devastating pathogen while eliminating ineffective copper pesticides. PMID:22870280

  20. A Unique Wheat Disease Resistance-like Gene Governs Effector-Induced Susceptibility to Necrotrophic pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant disease resistance is often conferred by genes with nucleotide binding site and leucine-rich repeat NBS-LRR) or serine/threonine protein kinase (S/TPK) domains. Much less is known about mechanisms of susceptibility, particularly to necrotrophic fungal pathogens. The pathogens that cause the di...

  1. A central role for S-nitrosothiols in plant disease resistance.

    PubMed

    Feechan, Angela; Kwon, Eunjung; Yun, Byung-Wook; Wang, Yiqin; Pallas, Jacqueline A; Loake, Gary J

    2005-05-31

    Animal S-nitrosoglutathione reductase (GSNOR) governs the extent of cellular S-nitrosylation, a key redox-based posttranslational modification. Mutations in AtGSNOR1, an Arabidopsis thaliana GSNOR, modulate the extent of cellular S-nitrosothiol (SNO) formation in this model plant species. Loss of AtGSNOR1 function increased SNO levels, disabling plant defense responses conferred by distinct resistance (R) gene subclasses. Furthermore, in the absence of AtGSNOR1, both basal and nonhost disease resistance are also compromised. Conversely, increased AtGSNOR1 activity reduced SNO formation, enhancing protection against ordinarily virulent microbial pathogens. Here we demonstrate that AtGSNOR1 positively regulates the signaling network controlled by the plant immune system activator, salicylic acid. This contrasts with the function of this enzyme in mice during endotoxic shock, where GSNOR antagonizes inflammatory responses. Our data imply SNO formation and turnover regulate multiple modes of plant disease resistance.

  2. The research agenda of the National Institute of Allergy and Infectious Diseases for antimicrobial resistance.

    PubMed

    Peters, N Kent; Dixon, Dennis M; Holland, Steven M; Fauci, Anthony S

    2008-04-15

    Antimicrobial resistance is an intrinsic and inevitable aspect of microbial survival that continually challenges human health. Research on antimicrobial resistance is central to the mission of the National Institute of Allergy and Infectious Diseases (NIAID). In fiscal year 2007, NIAID invested more than USD800 million to support basic and translational research on antimicrobials, more than USD200 million of which is devoted to understanding the causes, consequences, and treatments of antimicrobial drug resistance. The complex process that facilitates the transformation of ideas into therapies requires a pipeline that runs from bench to bedside, and NIAID has leveraged the entire spectrum of conventional and biodefense resources. NIAID works in partnership with other federal agencies, industry, foundation partners, and foreign governments. The basic and clinical research supported by NIAID will, ideally, continue to yield profound rewards in terms of the understanding, diagnosis, and treatment of infectious diseases.

  3. Overexpression of a Chitinase Gene from Trichoderma asperellum Increases Disease Resistance in Transgenic Soybean.

    PubMed

    Zhang, Fuli; Ruan, Xianle; Wang, Xian; Liu, Zhihua; Hu, Lizong; Li, Chengwei

    2016-12-01

    In the present study, a chi gene from Trichoderma asperellum, designated Tachi, was cloned and functionally characterized in soybean. Firstly, the effects of sodium thiosulfate on soybean Agrobacterium-mediated genetic transformation with embryonic tip regeneration system were investigated. The transformation frequency was improved by adding sodium thiosulfate in co-culture medium for three soybean genotypes. Transgenic soybean plants with constitutive expression of Tachi showed increased resistance to Sclerotinia sclerotiorum compared to WT plants. Meanwhile, overexpression of Tachi in soybean exhibited increased reactive oxygen species (ROS) level as well as peroxidase (POD) and catalase (SOD) activities, decreased malondialdehyde (MDA) content, along with diminished electrolytic leakage rate after S. sclerotiorum inoculation. These results suggest that Tachi can improve disease resistance in plants by enhancing ROS accumulation and activities of ROS scavenging enzymes and then diminishing cell death. Therefore, Tachi represents a candidate gene with potential application for increasing disease resistance in plants.

  4. Resistance exercise volume affects myofibrillar protein synthesis and anabolic signalling molecule phosphorylation in young men

    PubMed Central

    Burd, Nicholas A; Holwerda, Andrew M; Selby, Keegan C; West, Daniel W D; Staples, Aaron W; Cain, Nathan E; Cashaback, Joshua G A; Potvin, James R; Baker, Steven K; Phillips, Stuart M

    2010-01-01

    We aimed to determine if any mechanistic differences exist between a single set (1SET) and multiple sets (i.e. 3 sets; 3SET) of resistance exercise by utilizing a primed constant infusion of [ring-13C6]phenylalanine to determine myofibrillar protein synthesis (MPS) and Western blot analysis to examine anabolic signalling molecule phosphorylation following an acute bout of resistance exercise. Eight resistance-trained men (24 ± 5 years, BMI = 25 ± 4 kg m−2) were randomly assigned to perform unilateral leg extension exercise at 70% concentric one repetition maximum (1RM) until volitional fatigue for 1SET or 3SET. Biopsies from the vastus lateralis were taken in the fasted state (Fast) and fed state (Fed; 20 g of whey protein isolate) at rest, 5 h Fed, 24 h Fast and 29 h Fed post-exercise. Fed-state MPS was transiently elevated above rest at 5 h for 1SET (2.3-fold) and returned to resting levels by 29 h post-exercise. However, the exercise induced increase in MPS following 3SET was superior in amplitude and duration as compared to 1SET at both 5 h (3.1-fold above rest) and 29 h post-exercise (2.3-fold above rest). Phosphorylation of 70 kDa S6 protein kinase (p70S6K) demonstrated a coordinated increase with MPS at 5 h and 29 h post-exercise such that the extent of p70S6K phosphorylation was related to the MPS response (r = 0.338, P = 0.033). Phosphorylation of 90 kDa ribosomal S6 protein kinase (p90RSK) and ribosomal protein S6 (rps6) was similar for 1SET and 3SET at 24 h Fast and 29 h Fed, respectively. However, 3SET induced a greater activation of eukaryotic translation initiation factor 2Bɛ (eIF2Bɛ) and rpS6 at 5 h Fed. These data suggest that 3SET of resistance exercise is more anabolic than 1SET and may lead to greater increases in myofibrillar protein accretion over time. PMID:20581041

  5. Expression levels of antimicrobial peptide tachyplesin I in transgenic Ornithogalum lines affect the resistance to Pectobacterium infection.

    PubMed

    Lipsky, Alexander; Joshi, Janak Raj; Carmi, Nir; Yedidia, Iris

    2016-11-20

    The genus Ornithogalum includes several ornamental species that suffer substantial losses from bacterial soft rot caused by Pectobacteria. The absence of effective control measures for use against soft rot bacteria led to the initiation of a project in which a small antimicrobial peptide from an Asian horseshoe crab, tachyplesin (tpnI), was introduced into two commercial cultivars: O. dubium and O. thyrsoides. Disease severity and bacterial colonization were examined in transgenic lines expressing this peptide. Disease resistance was evaluated in six lines of each species by measuring bacterial proliferation in the plant tissue. Three transgenic lines of each species were subjected to further analysis in which the expression level of the transgene was evaluated using RT-PCR and qRT-PCR. The development of disease symptoms and bacterial colonization of the plant tissue were also examined using GFP-expressing strain of P. carotovorum subsp. brasiliense Pcb3. Confocal-microscopy imaging revealed significantly reduced quantities of bacterial cells in the transgenic plant lines that had been challenged with the bacterium. The results clearly demonstrate that tpnI expression reduces bacterial proliferation, colonization and disease symptom (reduced by 95-100%) in the transgenic plant tissues. The quantity of tpnI transcripts, as measured by qRT-PCR, was negatively correlated with the protection afforded to the plants, as measured by the reduced severity of disease symptoms in the tissue.

  6. Exposure of the grass shrimp, Palaemonetes pugio, to antimicrobial compounds affects associated Vibrio bacterial density and development of antibiotic resistance.

    PubMed

    DeLorenzo, M E; Brooker, J; Chung, K W; Kelly, M; Martinez, J; Moore, J G; Thomas, M

    2016-04-01

    Antimicrobial compounds are widespread, emerging contaminants in the aquatic environment and may threaten ecosystem and human health. This study characterized effects of antimicrobial compounds common to human and veterinary medicine, aquaculture, and consumer personal care products [erythromycin (ERY), sulfamethoxazole (SMX), oxytetracycline (OTC), and triclosan (TCS)] in the grass shrimp Palaemonetes pugio. The effects of antimicrobial treatments on grass shrimp mortality and lipid peroxidation activity were measured. The effects of antimicrobial treatments on the bacterial community of the shrimp were then assessed by measuring Vibrio density and testing bacterial isolates for antibiotic resistance. TCS (0.33 mg/L) increased shrimp mortality by 37% and increased lipid peroxidation activity by 63%. A mixture of 0.33 mg/L TCS and 60 mg/L SMX caused a 47% increase in shrimp mortality and an 88% increase in lipid peroxidation activity. Exposure to SMX (30 mg/L or 60 mg/L) alone and to a mixture of SMX/ERY/OTC did not significantly affect shrimp survival or lipid peroxidation activity. Shrimp exposure to 0.33 mg/L TCS increased Vibrio density 350% as compared to the control whereas SMX, the SMX/TCS mixture, and the mixture of SMX/ERY/OTC decreased Vibrio density 78-94%. Increased Vibrio antibiotic resistance was observed for all shrimp antimicrobial treatments except for the mixture of SMX/ERY/OTC. Approximately 87% of grass shrimp Vibrio isolates displayed resistance to TCS in the control treatment suggesting a high level of TCS resistance in environmental Vibrio populations. The presence of TCS in coastal waters may preferentially increase the resistance and abundance of pathogenic bacteria. These results indicate the need for further study into the potential interactions between antimicrobials, aquatic organisms, and associated bacterial communities.

  7. Designer TAL effectors induce disease susceptibility and resistance to Xanthomonas oryzae pv. oryzae in rice.

    PubMed

    Li, Ting; Huang, Sheng; Zhou, Junhui; Yang, Bing

    2013-05-01

    TAL (transcription activator-like) effectors from Xanthomonas bacteria activate the cognate host genes, leading to disease susceptibility or resistance dependent on the genetic context of host target genes. The modular nature and DNA recognition code of TAL effectors enable custom-engineering of designer TAL effectors (dTALE) for gene activation. However, the feasibility of dTALEs as transcription activators for gene functional analysis has not been demonstrated. Here, we report the use of dTALEs, as expressed and delivered by the pathogenic Xanthomonas oryzae pv. oryzae (Xoo), in revealing the new function of two previously identified disease-related genes and the potential of one developmental gene for disease susceptibility in rice/Xoo interactions. The dTALE gene dTALE-xa27, designed to target the susceptible allele of the resistance gene Xa27, elicited a resistant reaction in the otherwise susceptible rice cultivar IR24. Four dTALE genes were made to induce the four annotated Xa27 homologous genes in rice cultivar Nipponbare, but none of the four induced Xa27-like genes conferred resistance to the dTALE-containing Xoo strains. A dTALE gene was also generated to activate the recessive resistance gene xa13, an allele of the disease-susceptibility gene Os8N3 (also named Xa13 or OsSWEET11, a member of sucrose efflux transporter SWEET gene family). The induction of xa13 by the dTALE rendered the resistant rice IRBB13 (xa13/xa13) susceptible to Xoo. Finally, OsSWEET12, an as-yet uncharacterized SWEET gene with no corresponding naturally occurring TAL effector identified, conferred susceptibility to the Xoo strains expressing the corresponding dTALE genes. Our results demonstrate that dTALEs can be delivered through the bacterial secretion system to activate genes of interest for functional analysis in plants.

  8. Caloric restriction as a mechanism mediating resistance to environmental disease.

    PubMed Central

    Frame, L T; Hart, R W; Leakey, J E

    1998-01-01

    It has been observed that susceptibility to many degenerative diseases increases concurrently with industrialization and rising living standards. Although epidemiologic studies suggest that specific environmental and dietary factors may be important, caloric intake alone (as reflected in body size) may account for much of the differential risk observed among diverse human populations. It has been suggested from animal studies that caloric intake may be the primary effector for many hormonal, metabolic, physiologic, and behavioral responses that coordinate reproductive strategy to apparent availability of food. When caloric intake is excessive, particularly at critical developmental stages, physiologic priorities are set for body growth and fecundity rather than for endurance and longevity. The converse occurs during periods of famine, thus increasing the probability that sufficient individuals survive to restore the population when conditions improve. Calorically restricted rodents have significantly longer reproductive and total life spans than their ad libitum-fed controls and exhibit a spectrum of biochemical and physiologic alterations that characterize their adaptation to reduced intake. These include reduced stature, hypercorticism in the absence of elevated adrenocorticotropic hormone levels, increased metabolic efficiency, decreased mitogenic response coupled with increased rates of apoptosis, reduced inflammatory response, induction of stress proteins and DNA repair enzymes, altered drug-metabolizing enzyme expression, and modified cell-mediated immune function. The overall profile of these changes is one of improved defense against environmental stress. This has been suggested as the mechanistic basis for the protective effects of low body weight on radiation and chemically induced cancers in experimental animals. It may also explain the significantly higher thresholds of acute toxicity observed when calorically restricted rodents are exposed to certain

  9. Insulin Resistance and Obesity Affect Lipid Profile in the Salivary Glands

    PubMed Central

    Matczuk, Jan; Zalewska, Anna; Łukaszuk, Bartłomiej; Knaś, Małgorzata; Maciejczyk, Mateusz; Garbowska, Marta; Ziembicka, Dominika M.; Waszkiel, Danuta; Chabowski, Adrian; Żendzian-Piotrowska, Małgorzata

    2016-01-01

    In today's world wrong nutritional habits together with a low level of physical activity have given rise to the development of obesity and its comorbidity, insulin resistance. More specifically, many researches indicate that lipids are vitally involved in the onset of a peripheral tissue (e.g., skeletal muscle, heart, and liver) insulin resistance. Moreover, it seems that diabetes can also induce changes in respect of lipid composition of both the salivary glands and saliva. However, judging by the number of research articles, the salivary glands lipid profile still has not been sufficiently explored. In the current study we aim to assess the changes in the main lipid fractions, namely, triacylglycerols, phospholipids, free fatty acids, and diacylglycerols, in the parotid and the submandibular salivary glands of rats exposed to a 5-week high fat diet regimen. We observed that the high caloric fat diet caused a significant change in the salivary glands lipid composition, especially with respect to PH and TG, but not DAG or FFAs, classes. The observed reduction in PH concentration is an interesting phenomenon frequently signifying the atrophy and malfunctions in the saliva secreting organs. On the other hand, the increased accumulation of TG in the glands may be an important clinical manifestation of metabolic syndrome and type 2 diabetes mellitus. PMID:27471733

  10. Jammed granular cones affect frictional resistive forces at the onset of intrusion

    NASA Astrophysics Data System (ADS)

    Aguilar, Jeffrey; Goldman, Daniel

    Characterizing the functional form of granular resistive forces has allowed for analysis of the locomotion of animals and robots on and within dry granular media. Resistive force theory (RFT) has been an effective tool in predicting these forces for various locomotive gaits within the ``frictional fluid'' regime, where intrusions are sufficiently slow such that granular inertial effects are negligible. These forces have been typically described by a linear dependence to submersion depth. However, recent experiments on robotic jumping [Aguilar & Goldman, Nature Physics, 2015] have revealed the importance of considering the nonlinear effects at the onset of intrusion to accurately predict robot kinematics. Particle image velocimetry (PIV) analysis of sidewall grain flow during foot intrusion reveals a jammed granular cone that develops beneath the foot at the onset of intrusion. A geometric model of cone development combined with empirical RFT forces on angled conical surfaces was able to predict the non-linear force trajectory vs. depth for experimental intrusions of various foot sizes, suggesting that intruders experience non-linear frictional forces according to the shape of the granular jamming fronts that form at the onset of movement. This work was supported by NSF Physics of Living Systems, Burroughs Wellcome Fund, and the Army Research Office.

  11. Enhanced disease resistance in transgenic carrot (Daucus carota L.) plants over-expressing a rice cationic peroxidase.

    PubMed

    Wally, O; Punja, Z K

    2010-10-01

    Plant class III peroxidases are involved in numerous responses related to pathogen resistance including controlling hydrogen peroxide (H(2)O(2)) levels and lignin formation. Peroxidases catalyze the oxidation of organic compounds using H(2)O(2) as an oxidant. We examined the mechanisms of disease resistance in a transgenic carrot line (P23) which constitutively over-expresses the rice cationic peroxidase OsPrx114 (previously known as PO-C1) and which exhibits enhanced resistance to necrotrophic foliar pathogens. OsPrx114 over-expression led to a slight enhancement of constitutive transcript levels of pathogenesis-related (PR) genes. These transcript levels were dramatically increased in line P23 compared to controls [GUS construct under the control of 35S promoter (35S::GUS)] when tissues were treated with cell wall fragments of the fungal pathogen Sclerotinia sclerotiorum (SS-walls), and to a lesser extent with 2,6-dichloroisonicotinic acid. There was no basal increase in basal H(2)O(2) levels in tissues of the line P23. However, during an oxidative burst response elicited by SS-walls, H(2)O(2) accumulation was reduced in line P23 despite, typical media alkalinization associated with oxidative burst responses was observed, suggesting that OsPrx114 was involved in rapid H(2)O(2) consumption during the oxidative burst response. Tap roots of line P23 had increased lignin formation in the outer periderm tissues, which was further increased during challenge inoculation with Alternaria radicina. Plant susceptibility to a biotrophic pathogen, Erysiphe heraclei, was not affected. Disease resistance to necrotrophic pathogens in carrot as a result of OsPrx114 over-expression is manifested through increased PR transcript accumulation, rapid removal of H(2)O(2) during oxidative burst response and enhanced lignin formation.

  12. Effects of testosterone and resistance training in men with chronic obstructive pulmonary disease.

    PubMed

    Casaburi, Richard; Bhasin, Shalender; Cosentino, Louis; Porszasz, Janos; Somfay, Attila; Lewis, Michael I; Fournier, Mario; Storer, Thomas W

    2004-10-15

    Dysfunction of the muscles of ambulation contributes to exercise intolerance in chronic obstructive pulmonary disease (COPD). Men with COPD have high prevalence of low testosterone levels, which may contribute to muscle weakness. We determined effects of testosterone supplementation (100 mg of testosterone enanthate injected weekly) with or without resistance training (45 minutes three times weekly) on body composition and muscle function in 47 men with COPD (mean FEV(1) = 40% predicted) and low testosterone levels (mean = 320 ng/dl). Subjects were randomized to 10 weeks of placebo injections + no training, testosterone injections + no training, placebo injections + resistance training, or testosterone injections + resistance training. Testosterone injections yielded a mean increase of 271 ng/dl in the nadir serum testosterone concentration (to the middle of the normal range for young men). The lean body mass (by dual-energy X-ray absorptiometry) increase averaged 2.3 kg with testosterone alone and 3.3 kg with combined testosterone and resistance training (p < 0.001). Increase in one-repetition maximum leg press strength averaged 17.2% with testosterone alone, 17.4% with resistance training alone, and 26.8% with testosterone + resistance training (p < 0.001). Interventions were well tolerated with no abnormalities in safety measures. Further studies are required to determine long-term benefits of adding testosterone supplementation and resistance training to rehabilitative programs for carefully screened men with COPD and low testosterone levels.

  13. Report: frequency of aspirin resistance in patients with coronory artery disease in Pakistan.

    PubMed

    Akhtar, Naveed; Junaid, Ayesha; Khalid, Ayesha; Ahmed, Waqas; Shah, Mumtaz Ali; Rahman, Habibur

    2009-04-01

    Aspirin resistance is an emerging clinical entity. However the data available on aspirin resistance in Asian population is scarce. This study was initiated to prospectively evaluate the frequency of aspirin resistance in patients with stable coronary artery disease (CAD) in Pakistan. A cross sectional prospective study was conducted in cardiology and hematology departments at Shifa International Hospital, Islamabad from January to December 2007. Two hundred and fifty patients were enrolled from cardiology out patient department having met the specific inclusion criteria. Details were entered on a pre-designed questionnaire and aspirin response assay was performed on IMPACT-R (Dia Med AG 1785 Cressier Morat, Switzerland). Data was analyzed using SPSS V12. Aspirin resistance was observed in 12% of patients. 73.2% of study population were male and 26.8% were female, with a mean age of 57.2 years. There was no significant correlation of aspirin resistance with traditional risk factors like diabetes mellitus (DM), hypertension or dyslipidemia. 84% of aspirin non responders were taking 75 mg per day and 16% were on 150 mg per day. A positive trend was noted between aspirin resistance and cigarette smoking. Aspirin resistance is a real phenomenon in Pakistani population with an estimated frequency of 12%. Large scale prospective randomized trials with long term follow up are needed to assess the impact of different doses and the clinical significance of this biochemical entity.

  14. Genetic analysis of multiple antimicrobial resistance in Salmonella isolated from diseased broilers in Egypt.

    PubMed

    Ahmed, Ashraf M; Shimamoto, Tadashi

    2012-04-01

    To date, no information has been available on the molecular bases of antimicrobial resistance in Salmonella spp. from poultry in Egypt or even in Africa. Therefore, the objective of this study was to analyze, at the molecular level, the mechanisms of multidrug-resistance in isolates of Salmonella recovered from diseased broilers in Egypt. Twenty-one Salmonella isolates were identified; 13 of these isolates were Salmonella enterica serovar Enteritidis and eight Salmonella enterica serovar Typhimurium. 17 (81%). Salmonella isolates displayed multidrug resistance phenotypes, particularly against ampicillin, streptomycin, spectinomycin, kanamycin, tetracycline, chloramphenicol, and trimethoprim/sulfamethoxazole. PCR and DNA sequencing identified class 1 integrons in nine (42.9%) isolates and class 2 integrons in three (14.3%) isolates. The identified resistance genes within class 1 integrons were aminoglycoside adenyltransferase type A, aadA1, aadA2 and aadA5 and dihydrofolate reductase type A, dfrA1, dfrA5, dfrA12, dfrA15 and dfrA17. The β-lactamase encoding genes bla(TEM-1) and bla(CMY-2) and florfenicol resistance gene floR were also identified. Furthermore, the tetracycline resistance gene tet(A) was identified in 14 (66.7%) Salmonella isolates. To the best of our knowledge, this is the first report of the molecular basis of antimicrobial resistance in Salmonella spp. isolated from poultry in Africa.

  15. Unraveling Genomic Complexity at a Quantitative Disease Resistance Locus in Maize

    PubMed Central

    Jamann, Tiffany M.; Poland, Jesse A.; Kolkman, Judith M.; Smith, Laurie G.; Nelson, Rebecca J.

    2014-01-01

    Multiple disease resistance has important implications for plant fitness, given the selection pressure that many pathogens exert directly on natural plant populations and indirectly via crop improvement programs. Evidence of a locus conditioning resistance to multiple pathogens was found in bin 1.06 of the maize genome with the allele from inbred line “Tx303” conditioning quantitative resistance to northern leaf blight (NLB) and qualitative resistance to Stewart’s wilt. To dissect the genetic basis of resistance in this region and to refine candidate gene hypotheses, we mapped resistance to the two diseases. Both resistance phenotypes were localized to overlapping regions, with the Stewart’s wilt interval refined to a 95.9-kb segment containing three genes and the NLB interval to a 3.60-Mb segment containing 117 genes. Regions of the introgression showed little to no recombination, suggesting structural differences between the inbred lines Tx303 and “B73,” the parents of the fine-mapping population. We examined copy number variation across the region using next-generation sequencing data, and found large variation in read depth in Tx303 across the region relative to the reference genome of B73. In the fine-mapping region, association mapping for NLB implicated candidate genes, including a putative zinc finger and pan1. We tested mutant alleles and found that pan1 is a susceptibility gene for NLB and Stewart’s wilt. Our data strongly suggest that structural variation plays an important role in resistance conditioned by this region, and pan1, a gene conditioning susceptibility for NLB, may underlie the QTL. PMID:25009146

  16. A synteny map and disease resistance gene comparison between barley and the model monocot Brachypodium distachyon.

    PubMed

    Drader, Tom; Kleinhofs, Andris

    2010-05-01

    Grass species have coevolved with current economically important crop pathogens over millions of years. During this time, speciation of current domestic crops has occurred, resulting in related yet divergent genomes. Here, we present a synteny map between the crop species Hordeum vulgare and the recently sequenced Brachypodium distachyon genome, focusing on regions known to harbor important barley disease resistance genes. The resistance genes have orthologous genes in Brachypodium that show conservation of the form and likely the function of the genes. The level of colinearity between the genomes is highly dependent on the region of interest and, at the DNA level or protein level, the gene of interest. The stem rust resistance gene Rpg1 has an ortholog with a high level of identity at the amino acid level, while the stem rust resistance gene Rpg5 has two orthologs with a high level of identity, one corresponding to the NBS-LRR domain and the other to the serine/threonine protein kinase domain, on different contigs. Interestingly, the predicted product of the Brachypodium Rpg1 ortholog contained a WD40 domain at the C-terminal end. The stem rust resistance gene rpg4 (actin depolymerizing factor 2) also has an ortholog with a high level of identity, in which one of the three residues indicated by allele sequencing in barley cultivars to be important in disease resistance is conserved. The syntenous region of the seedling spot blotch resistance locus, Rcs5, has a high level of colinearity that may prove useful in efforts to identify and clone this gene. A synteny map and orthologous resistance gene comparisons are presented.

  17. Identification of candidate genes in rice for resistance to sheath blight disease by whole genome sequencing.

    PubMed

    Silva, James; Scheffler, Brian; Sanabria, Yamid; De Guzman, Christian; Galam, Dominique; Farmer, Andrew; Woodward, Jimmy; May, Gregory; Oard, James

    2012-01-01

    Recent advances in whole genome sequencing (WGS) have allowed identification of genes for disease susceptibility in humans. The objective of our research was to exploit whole genome sequences of 13 rice (Oryza sativa L.) inbred lines to identify non-synonymous SNPs (nsSNPs) and candidate genes for resistance to sheath blight, a disease of worldwide significance. WGS by the Illumina GA IIx platform produced an average 5× coverage with ~700 K variants detected per line when compared to the Nipponbare reference genome. Two filtering strategies were developed to identify nsSNPs between two groups of known resistant and susceptible lines. A total of 333 nsSNPs detected in the resistant lines were absent in the susceptible group. Selected variants associated with resistance were found in 11 of 12 chromosomes. More than 200 genes with selected nsSNPs were assigned to 42 categories based on gene family/gene ontology. Several candidate genes belonged to families reported in previous studies, and three new regions with novel candidates were also identified. A subset of 24 nsSNPs detected in 23 genes was selected for further study. Individual alleles of the 24 nsSNPs were evaluated by PCR whose presence or absence corresponded to known resistant or susceptible phenotypes of nine additional lines. Sanger sequencing confirmed presence of 12 selected nsSNPs in two lines. "Resistant" nsSNP alleles were detected in two accessions of O. nivara that suggests sources for resistance occur in additional Oryza sp. Results from this study provide a foundation for future basic research and marker-assisted breeding of rice for sheath blight resistance.

  18. The Arabidopsis NPR1 gene confers broad-spectrum disease resistance in strawberry.

    PubMed

    Silva, Katchen Julliany P; Brunings, Asha; Peres, Natalia A; Mou, Zhonglin; Folta, Kevin M

    2015-08-01

    Although strawberry is an economically important fruit crop worldwide, production of strawberry is limited by its susceptibility to a wide range of pathogens and the lack of major commercial cultivars with high levels of resistance to multiple pathogens. The objective of this study is to ectopically express the Arabidopsis thaliana NPR1 gene (AtNPR1) in the diploid strawberry Fragaria vesca L. and to test transgenic plants for disease resistance. AtNPR1 is a key positive regulator of the long-lasting broad-spectrum resistance known as systemic acquired resistance (SAR) and has been shown to confer resistance to a number of pathogens when overexpressed in Arabidopsis or ectopically expressed in several crop species. We show that ectopic expression of AtNPR1 in strawberry increases resistance to anthracnose, powdery mildew, and angular leaf spot, which are caused by different fungal or bacterial pathogens. The increased resistance is related to the relative expression levels of AtNPR1 in the transgenic plants. In contrast to Arabidopsis plants overexpressing AtNPR1, which grow normally and do not constitutively express defense genes, the strawberry transgenic plants are shorter than non-transformed controls, and most of them fail to produce runners and fruits. Consistently, most of the transgenic lines constitutively express the defense gene FvPR5, suggesting that the SAR activation mechanisms in strawberry and Arabidopsis are different. Nevertheless, our results indicate that overexpression of AtNPR1 holds the potential for generation of broad-spectrum disease resistance in strawberry.

  19. Unraveling genomic complexity at a quantitative disease resistance locus in maize.

    PubMed

    Jamann, Tiffany M; Poland, Jesse A; Kolkman, Judith M; Smith, Laurie G; Nelson, Rebecca J

    2014-09-01

    Multiple disease resistance has important implications for plant fitness, given the selection pressure that many pathogens exert directly on natural plant populations and indirectly via crop improvement programs. Evidence of a locus conditioning resistance to multiple pathogens was found in bin 1.06 of the maize genome with the allele from inbred line "Tx303" conditioning quantitative resistance to northern leaf blight (NLB) and qualitative resistance to Stewart's wilt. To dissect the genetic basis of resistance in this region and to refine candidate gene hypotheses, we mapped resistance to the two diseases. Both resistance phenotypes were localized to overlapping regions, with the Stewart's wilt interval refined to a 95.9-kb segment containing three genes and the NLB interval to a 3.60-Mb segment containing 117 genes. Regions of the introgression showed little to no recombination, suggesting structural differences between the inbred lines Tx303 and "B73," the parents of the fine-mapping population. We examined copy number variation across the region using next-generation sequencing data, and found large variation in read depth in Tx303 across the region relative to the reference genome of B73. In the fine-mapping region, association mapping for NLB implicated candidate genes, including a putative zinc finger and pan1. We tested mutant alleles and found that pan1 is a susceptibility gene for NLB and Stewart's wilt. Our data strongly suggest that structural variation plays an important role in resistance conditioned by this region, and pan1, a gene conditioning susceptibility for NLB, may underlie the QTL.

  20. Oral impacts affecting daily performance in a low dental disease Thai population.

    PubMed

    Adulyanon, S; Vourapukjaru, J; Sheiham, A

    1996-12-01

    The aim of the study was to measure incidence of oral impacts on daily performances and their related features in a low dental disease population. 501 people aged 35-44 years in 16 rural villages in Ban Phang district, Khon Kaen, Thailand, were interviewed about oral impacts on nine physical, psychological and social aspects of performance during the past 6 months, and then had an oral examination. The clinical and behavioural data showed that the sample had low caries (DMFT = 2.7) and a low utilization of dental services. 73.6% of all subjects had at least one daily performance affected by an oral impact. The highest incidence of performances affected were Eating (49.7%), Emotional stability (46.5%) and Smiling (26.1%). Eating, Emotional stability and Cleaning teeth performances had a high frequency or long duration of impacts, but a low severity. The low frequency performances; Physical activities, Major role activity and Sleeping were rated as high severity. Pain and discomfort were mainly perceived as the causes of impacts (40.1%) for almost every performance except Smiling. Toothache was the major causal oral condition (32.7%) of almost all aspects of performance. It was concluded that this low caries people have as high an incidence of oral impacts as industrialized, high dental disease populations. Frequency and severity presented the paradoxical effect on different performances and should both be taken into account for overall estimation of impacts.

  1. Overexpression of a Modified Plant Thionin Enhances Disease Resistance to Citrus Canker and Huanglongbing (HLB)

    PubMed Central

    Hao, Guixia; Stover, Ed; Gupta, Goutam

    2016-01-01

    Huanglongbing (HLB or citrus greening disease) caused by Candidatus Liberibacter asiaticus (Las) is a great threat to the US citrus industry. There are no proven strategies to eliminate HLB disease and no cultivar has been identified with strong HLB resistance. Citrus canker is also an economically important disease associated with a bacterial pathogen (Xanthomonas citri). In this study, we characterized endogenous citrus thionins and investigated their expression in different citrus tissues. Since no HLB-resistant citrus cultivars have been identified, we attempted to develop citrus resistant to both HLB and citrus canker through overexpression of a modified plant thionin. To improve effectiveness for disease resistance, we modified and synthesized the sequence encoding a plant thionin and cloned into the binary vector pBinPlus/ARS. The construct was then introduced into Agrobacterium strain EHA105 for citrus transformation. Transgenic Carrizo plants expressing the modified plant thionin were generated by Agrobacterium-mediated transformation. Successful transformation and transgene gene expression was confirmed by molecular analysis. Transgenic Carrizo plants expressing the modified thionin gene were challenged with X. citri 3213 at a range of concentrations, and a significant reduction in canker symptoms and a decrease in bacterial growth were demonstrated compared to nontransgenic plants. Furthermore, the transgenic citrus plants were challenged with HLB via graft inoculation. Our results showed significant Las titer reduction in roots of transgenic Carrizo compared with control plants and reduced scion Las titer 12 months after graft inoculation. These data provide promise for engineering citrus disease resistance against HLB and canker. PMID:27499757

  2. Grapevine rootstock effects on scion sap phenolic levels, resistance to Xylella fastidiosa infection, and progression of Pierce’s disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The xylem-limited bacterium Xylella fastidiosa (Xf) causes Pierce’s disease (PD), an important disease of grapevine, Vitis vinifera L. Grapevine rootstocks were developed to provide increased resistance to root disease, but rootstock effects on cane and vine diseases remain unclear. Grapevines that ...

  3. Butyrylcholinesterase K and apolipoprotein ε4 affect cortical thickness and neuropsychiatric symptoms in Alzheimer's disease.

    PubMed

    Yoo, Hye B; Lee, Hae W; Shin, Sue; Park, Sun-Won; Choi, Jung S; Jung, Hee Y; Cha, Jungho; Lee, Jong-Min; Lee, Jun-Young

    2014-02-01

    Two major genotypes are known to affect the development and progression of Alzheimer's disease (AD) and its response to cholinesterase inhibitors: the apolipoprotein E (ApoE) and butyrylcholinesterase genes (BChE). This study analyzed the effects of the BChE and ApoE genotypes on the cortical thickness of patients with AD and examined how these genotypes affect the neuropsychiatric symptoms of AD. AD-drug-naïve patients who met the probable AD criteria proposed by the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association were recruited. Of 96 patients with AD, 65 were eligible for cortical thickness analysis. 3D T1-weighted images were acquired, and the cortical regions were segmented using the constrained Laplacian-based automated segmentation with proximities (CLASP) algorithm. Neuropsychiatric symptoms were measured by Neuropsychiatric Inventory (NPI) scores. BChE wild-type carriers (BChE-W) showed more thinning in the left dorsolateral prefrontal cortex, including the lateral premotor regions and anterior cingulate cortex, than did BChE-K variant carriers (BChE-K). ApoE-ε4 carriers had a thinner left medial prefrontal cortex, left superior frontal cortex, and left posterior cingulate cortex than did ApoE-ε4 non-carriers. Statistical analyses revealed that BChE-K carriers showed significantly less severe aberrant motor behavioral symptoms and that ε4 non-carriers showed less severe anxiety and indifference symptoms. The current findings show that, similar to ApoE-ε4 non-carriers, BChE-K carriers are protected from the pathological detriments of AD that affect frontal cortical thickness and neuropsychiatric symptoms. This study visually demonstrated the effects of the BChE-K and ApoE genotypes on the structural degeneration and complex aspects of the symptoms of AD.

  4. Social-adaptive and psychological functioning of patients affected by Fabry disease.

    PubMed

    Laney, Dawn Alyssia; Gruskin, Daniel J; Fernhoff, Paul M; Cubells, Joseph F; Ousley, Opal Y; Hipp, Heather; Mehta, Ami J

    2010-12-01

    Fabry disease (FD) is an X-linked lysosomal storage disorder caused by the deficiency of alpha-galactosidase A. In addition to the debilitating physical symptoms of FD, there are also under-recognized and poorly characterized psychiatric features. As a first step toward characterizing psychiatric features of FD, we administered the Achenbach adult self report questionnaire to 30 FD patients and the Achenbach adult behavior checklist questionnaire to 28 partners/parents/friends of FD patients. Data from at least one of the questionnaires were available on 33 subjects. Analysis focused on social-adaptive functioning in various aspects of daily life and on criteria related to the Diagnostic and statistical manual of mental disorders IV (DSM-IV). Adaptive functioning scale values, which primarily measure social and relationship functioning and occupational success, showed that eight FD patients (six female and two male) had mean adaptive functioning deficits as compared to population norms. Greater rates of depression (P < 0.01), anxiety (P = 0.05), depression and anxiety (P = 0.03), antisocial personality (P < 0.001), attention-deficit/hyperactivity (AD/H; P < 0.01), hyperactivity-impulsivity (P < 0.01), and aggressive behavior (P = 0.03) were associated with poorer adaptive functioning. Decreased social-adaptive functioning in this study was not statistically significantly associated to disease severity, pain, or level of vitality. This study shows for the first time that FD patients, particularly women, are affected by decreased social-adaptive functioning. Comprehensive treatment plans for FD should consider assessments and interventions to evaluate and improve social, occupational, and psychological functioning. Attention to the behavioral aspects of FD could lead to improved treatment outcome and improved quality of life. Individuals affected by Fabry disease exhibited social-adaptive functioning deficits that were significantly correlated with anxiety

  5. Resistant starch and arabinoxylan augment SCFA absorption, but affect postprandial glucose and insulin responses differently.

    PubMed

    Ingerslev, Anne Krog; Theil, Peter Kappel; Hedemann, Mette Skou; Lærke, Helle Nygaard; Bach Knudsen, Knud Erik

    2014-05-01

    The effects of increased colonic fermentation of dietary fibres (DF) on the net portal flux (NPF) of carbohydrate-derived metabolites (glucose, SCFA and, especially, butyrate), hormones (insulin, C-peptide, glucagon-like peptide 1 and glucose-dependent insulinotropic peptide) and NEFA were studied in a healthy catheterised pig model. A total of six pigs weighing 59 (SEM 1·6) kg were fitted with catheters in the mesenteric artery and in the portal and hepatic veins, and a flow probe around the portal vein, and included in a double 3 × 3 cross-over design with three daily feedings (at 09.00, 14.00 and 19.00 hours). Fasting and 5 h postprandial blood samples were collected after 7 d adaptation to each diet. The pigs were fed a low-DF Western-style control diet (WSD) and two high-DF diets (an arabinoxylan-enriched diet (AXD) and a resistant starch-enriched diet (RSD)). The NPF of insulin was lower (P= 0·04) in AXD-fed pigs (4·6 nmol/h) than in RSD-fed pigs (10·5 nmol/h), despite the lowest NPF of glucose being observed in RSD-fed pigs (203 mmol/h, P= 0·02). The NPF of total SCFA, acetate, propionate and butyrate were high, intermediate and low (P< 0·01) in AXD-, RSD- and WSD-fed pigs, respectively, with the largest relative increase being observed for butyrate in response to arabinoxylan supplementation. In conclusion, the RSD and AXD had different effects on the NPF of insulin and glucose, suggesting different impacts of arabinoxylan and resistant starch on human health.

  6. Spatiotemporal and species-specific patterns of diseases affecting crustose coralline algae in Curaçao

    NASA Astrophysics Data System (ADS)

    Quéré, G.; Steneck, R. S.; Nugues, M. M.

    2015-03-01

    Distribution and abundance of coral diseases have been well documented, but only a few studies considered diseases affecting crustose coralline algae (CCA), particularly at the species level. We investigated the spatiotemporal dynamics of diseases affecting CCA along the south coast of Curaçao, southern Caribbean. Two syndromes were detected: the Coralline White Band Syndrome (CWBS) previously described and the Coralline White Patch Disease (CWPD) reported here for the first time. Diseases were present at all six study sites, and our results did not reveal a relationship between disease occurrence and human influence. Both diseases were more prevalent on the shallower reef flat than on the deeper reef slope, and during the warm/rainy season than during the cold/dry season. The patterns observed were consistent with a positive link between temperature and disease occurrence. Reef flat communities were dominated by Neogoniolithon mamillare and Paragoniolithon solubile, whereas deeper habitats were dominated by Hydrolithon boergesenii. Diseases affected all the species encountered, and no preferable host was detected. There was a significant relationship between both disease occurrences and CCA cover. Monitoring of affected patches revealed that 90 % of lesions in CWBS increased in size, whereas 88 % of CWPD lesions regenerated over time. CWBS linear progression rate did not vary between seasons or species and ranged from 0.15 to 0.36 cm month-1, which is in the same order of magnitude as rates previously documented. We conclude that diseases have the potential to cause major loss in CCA cover, particularly in shallow waters. As CCA play a key role in reef ecosystems, our study suggests that the emergence of diseases affecting these algae may pose a real threat to coral reef ecosystems. The levels of disease reported here will provide a much-needed local baseline allowing future comparisons.

  7. Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance

    PubMed Central

    Saand, Mumtaz A.; Xu, You-Ping; Li, Wen; Wang, Ji-Peng; Cai, Xin-Zhong

    2015-01-01

    The cyclic nucleotide gated channel (CNGC) is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly, widely but differently responsive to diverse stimuli. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca2+ signaling genes including SlCaMs, SlCDPKs, and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca2+ signaling. PMID:25999969

  8. Immunomodulation and disease resistance in postyearling rainbow trout infected with Myxobolus cerebralis, the causative agent of whirling disease

    USGS Publications Warehouse

    Densmore, Christine L.; Ottinger, C.A.; Blazer, V.S.; Iwanowicz, L.R.; Smith, D.R.

    2004-01-01

    Myxobolus cerebralis, the myxosporean parasite that causes whirling disease, has a number of deleterious effects on its salmonid host. Although it is well established that juvenile salmonids in the active stages of whirling disease mount an immune response to the pathogen, the occurrence and longevity of any related immunomodulatory effects are unknown. In this study, postyearling rainbow trout Oncorhynchus mykiss infected with M. cerebralis were examined for leukocyte functions and for resistance to Yersinia ruckeri, a bacterial pathogen of salmonids. Compared with uninfected controls, M. cerebralis-infected fish showed lower proliferative lymphocyte responses to four mitogens (concanavalin A, pokeweed mitogen, phytohemagglutinin, and lipopolysaccharide). Conversely, M. cerebralis-infected fish displayed greater bactericidal activity of anterior kidney macrophages than did uninfected fish. After bath challenges with K. ruckeri, M. cerebralis-infected fish had slightly lower survival and a more rapid onset of mortality than did the control fish. Renal tissue and fecal samples from M. cerebralis-infected and uninfected survivors were cultured for the presence of K. ruckeri, and no difference in prevalence was noted between the two groups. Because immunomodulatory changes in the M. cerebralis-infected fish involved functional enhancement and suppression of different leukocyte populations, disease resistance among M. cerebralis-infected fish in the later stages of whirling disease will probably vary with the secondary pathogen and the nature of immune response the pathogen evokes.

  9. Rapid experimental evolution of pesticide resistance in C. elegans entails no costs and affects the mating system.

    PubMed

    Lopes, Patricia C; Sucena, Elio; Santos, M Emília; Magalhães, Sara

    2008-01-01

    Pesticide resistance is a major concern in natural populations and a model trait to study adaptation. Despite the importance of this trait, the dynamics of its evolution and of its ecological consequences remain largely unstudied. To fill this gap, we performed experimental evolution with replicated populations of Caenorhabditis elegans exposed to the pesticide Levamisole during 20 generations. Exposure to Levamisole resulted in decreased survival, fecundity and male frequency, which declined from 30% to zero. This was not due to differential susceptibility of males. Rather, the drug affected mobility, resulting in fewer encounters, probably leading to reduced outcrossing rates. Adaptation, i.e., increased survival and fecundity, occurred within 10 and 20 generations, respectively. Male frequency also increased by generation 20. Adaptation costs were undetected in the ancestral environment and in presence of Ivermectin, another widely-used pesticide with an opposite physiological effect. Our results demonstrate that pesticide resistance can evolve at an extremely rapid pace. Furthermore, we unravel the effects of behaviour on life-history traits and test the environmental dependence of adaptation costs. This study establishes experimental evolution as a powerful tool to tackle pesticide resistance, and paves the way to further investigations manipulating environmental and/or genetic factors underlying adaptation to pesticides.

  10. Environmental Conditions Influence Induction of Key ABC-Transporter Genes Affecting Glyphosate Resistance Mechanism in Conyza canadensis

    PubMed Central

    Tani, Eleni; Chachalis, Demosthenis; Travlos, Ilias S.; Bilalis, Dimitrios

    2016-01-01

    Conyza canadensis has been reported to be the most frequent weed species that evolved resistance to glyphosate in various parts of the world. The objective of the present study was to investigate the effect of environmental conditions (temperature and light) on the expression levels of the EPSPS gene and two major ABC-transporter genes (M10 and M11) on glyphosate susceptible (GS) and glyphosate resistant (GR) horseweed populations, collected from several regions across Greece. Real-time PCR was conducted to determine the expression level of the aforementioned genes when glyphosate was applied at normal (1×; 533 g·a.e.·ha−1) and high rates (4×, 8×), measured at an early one day after treatment (DAT) and a later stage (four DAT) of expression. Plants were exposed to light or dark conditions, at three temperature regimes (8, 25, 35 °C). GR plants were made sensitive when exposed to 8 °C with light; those sensitized plants behaved biochemically (shikimate accumulation) and molecularly (expression of EPSPS and ABC-genes) like the GS plants. Results from the current study show the direct link between the environmental conditions and the induction level of the above key genes that likely affect the efficiency of the proposed mechanism of glyphosate resistance. PMID:27104532

  11. A single bout of resistance exercise does not affect nonlinear dynamics of lower extremity kinematics during treadmill walking.

    PubMed

    Nessler, Jeff A; Huynh, Hal; McDougal, Mary

    2011-06-01

    Peripheral fatigue has been known to result in altered force output and muscle recruitment patterns by the CNS. These changes may affect lower extremity movement during gait, and such behavior may present implications for the interpretation of nonlinear analysis of gait in situations where a subject might become fatigued. The purpose of this study was to examine the effects of a single bout of resistance training on lower extremity movement during treadmill walking in healthy subjects. Fifteen recreationally active subjects performed two 10min trials of treadmill walking at their preferred speed while knee and ankle kinematics of their right limb were recorded via optical motion capture. Between walking trials, subjects performed a series of lower extremity resistance exercises designed to induce moderate muscular fatigue. Detrended fluctuation analysis of stride length and stride time revealed that statistical persistence was unaffected by moderate muscle fatigue. Estimates of finite-time maximal Lyapunov exponents for ankle angle, knee angle, and vertical ankle movement over the short (0-1 stride) and long (4-10 strides) term were also unaffected by a single bout of resistance training. These results suggest that control of locomotion in healthy individuals, as measured by the nonlinear dynamics of lower extremity movement used here, is relatively robust to moderate muscle fatigue. Additional work with greater levels of fatigue will be necessary to fully characterize the effects of muscular fatigue on gait.

  12. Rapid Experimental Evolution of Pesticide Resistance in C. elegans Entails No Costs and Affects the Mating System

    PubMed Central

    Lopes, Patricia C.; Sucena, Élio; Santos, M. Emília; Magalhães, Sara

    2008-01-01

    Pesticide resistance is a major concern in natural populations and a model trait to study adaptation. Despite the importance of this trait, the dynamics of its evolution and of its ecological consequences remain largely unstudied. To fill this gap, we performed experimental evolution with replicated populations of Caenorhabditis elegans exposed to the pesticide Levamisole during 20 generations. Exposure to Levamisole resulted in decreased survival, fecundity and male frequency, which declined from 30% to zero. This was not due to differential susceptibility of males. Rather, the drug affected mobility, resulting in fewer encounters, probably leading to reduced outcrossing rates. Adaptation, i.e., increased survival and fecundity, occurred within 10 and 20 generations, respectively. Male frequency also increased by generation 20. Adaptation costs were undetected in the ancestral environment and in presence of Ivermectin, another widely-used pesticide with an opposite physiological effect. Our results demonstrate that pesticide resistance can evolve at an extremely rapid pace. Furthermore, we unravel the effects of behaviour on life-history traits and test the environmental dependence of adaptation costs. This study establishes experimental evolution as a powerful tool to tackle pesticide resistance, and paves the way to further investigations manipulating environmental and/or genetic factors underlying adaptation to pesticides. PMID:19011681

  13. Environmental Conditions Influence Induction of Key ABC-Transporter Genes Affecting Glyphosate Resistance Mechanism in Conyza canadensis.

    PubMed

    Tani, Eleni; Chachalis, Demosthenis; Travlos, Ilias S; Bilalis, Dimitrios

    2016-04-20

    Conyza canadensis has been reported to be the most frequent weed species that evolved resistance to glyphosate in various parts of the world. The objective of the present study was to investigate the effect of environmental conditions (temperature and light) on the expression levels of the EPSPS gene and two major ABC-transporter genes (M10 and M11) on glyphosate susceptible (GS) and glyphosate resistant (GR) horseweed populations, collected from several regions across Greece. Real-time PCR was conducted to determine the expression level of the aforementioned genes when glyphosate was applied at normal (1×; 533 g·a.e.·ha(-1)) and high rates (4×, 8×), measured at an early one day after treatment (DAT) and a later stage (four DAT) of expression. Plants were exposed to light or dark conditions, at three temperature regimes (8, 25, 35 °C). GR plants were made sensitive when exposed to 8 °C with light; those sensitized plants behaved biochemically (shikimate accumulation) and molecularly (expression of EPSPS and ABC-genes) like the GS plants. Results from the current study show the direct link between the environmental conditions and the induction level of the above key genes that likely affect the efficiency of the proposed mechanism of glyphosate resistance.

  14. Compounds of the sphingomyelin-ceramide-glycosphingolipid pathways as secondary messenger molecules: new targets for novel therapies for fatty liver disease and insulin resistance.

    PubMed

    Ilan, Yaron

    2016-06-01

    The compounds of sphingomyelin-ceramide-glycosphingolipid pathways have been studied as potential secondary messenger molecules in various systems, along with liver function and insulin resistance. Secondary messenger molecules act directly or indirectly to affect cell organelles and intercellular interactions. Their potential role in the pathogenesis of steatohepatitis and diabetes has been suggested. Data samples collected from patients with Gaucher's disease, who had high levels of glucocerebroside, support a role for compounds from these pathways as a messenger molecules in the pathogenesis of fatty liver disease and diabetes. The present review summarizes some of the recent data on the role of glycosphingolipid molecules as messenger molecules in various physiological and pathological conditions, more specifically including insulin resistance and fatty liver disease.

  15. Quantitative proteome analysis of an antibiotic resistant Escherichia coli exposed to tetracycline reveals multiple affected metabolic and peptidoglycan processes.

    PubMed

    Jones-Dias, Daniela; Carvalho, Ana Sofia; Moura, Inês Barata; Manageiro, Vera; Igrejas, Gilberto; Caniça, Manuela; Matthiesen, Rune

    2017-03-06

    Tetracyclines are among the most commonly used antibiotics administrated to farm animals for disease treatment and prevention, contributing to the worldwide increase in antibiotic resistance in animal and human pathogens. Although tetracycline mechanisms of resistance are well known, the role of metabolism in bacterial reaction to antibiotic stress is still an important assignment and could contribute to the understanding of tetracycline related stress response. In this study, spectral counts-based label free quantitative proteomics has been applied to study the response to tetracycline of the environmental-borne Escherichia coli EcAmb278 isolate soluble proteome. A total of 1484 proteins were identified by high resolution mass spectrometry at a false discovery rate threshold of 1%, of which 108 were uniquely identified under absence of tetracycline whereas 126 were uniquely identified in presence of tetracycline. These proteins revealed interesting difference in e.g. proteins involved in peptidoglycan-based cell wall proteins and energy metabolism. Upon treatment, 12 proteins were differentially regulated showing more than 2-fold change and p<0.05 (p value corrected for multiple testing). This integrated study using high resolution mass spectrometry based label-free quantitative proteomics to study tetracycline antibiotic response in the soluble proteome of resistant E. coli provides novel insight into tetracycline related stress.

  16. An antibody that confers plant disease resistance targets a membrane-bound glyoxal oxidase in Fusarium.

    PubMed

    Song, Xiu-Shi; Xing, Shu; Li, He-Ping; Zhang, Jing-Bo; Qu, Bo; Jiang, Jin-He; Fan, Chao; Yang, Peng; Liu, Jin-Long; Hu, Zu-Quan; Xue, Sheng; Liao, Yu-Cai

    2016-05-01

    Plant germplasm resources with natural resistance against globally important toxigenic Fusarium are inadequate. CWP2, a Fusarium genus-specific antibody, confers durable resistance to different Fusarium pathogens that infect cereals and other crops, producing mycotoxins. However, the nature of the CWP2 target is not known. Thus, investigation of the gene coding for the CWP2 antibody target will likely provide critical insights into the mechanism underlying the resistance mediated by this disease-resistance antibody. Immunoblots and mass spectrometry analysis of two-dimensional electrophoresis gels containing cell wall proteins from Fusarium graminearum (Fg) revealed that a glyoxal oxidase (GLX) is the CWP2 antigen. Cellular localization studies showed that GLX is localized to the plasma membrane. This GLX efficiently catalyzes hydrogen peroxide production; this enzymatic activity was specifically inhibited by the CWP2 antibody. GLX-deletion strains of Fg, F. verticillioides (Fv) and F. oxysporum had significantly reduced virulence on plants. The GLX-deletion Fg and Fv strains had markedly reduced mycotoxin accumulation, and the expression of key genes in mycotoxin metabolism was downregulated. This study reveals a single gene-encoded and highly conserved cellular surface antigen that is specifically recognized by the disease-resistance antibody CWP2 and regulates both virulence and mycotoxin biosynthesis in Fusarium species.

  17. Organization, expression and evolution of a disease resistance gene cluster in soybean.

    PubMed Central

    Graham, Michelle A; Marek, Laura Fredrick; Shoemaker, Randy C

    2002-01-01

    PCR amplification was previously used to identify a cluster of resistance gene analogues (RGAs) on soybean linkage group J. Resistance to powdery mildew (Rmd-c), Phytophthora stem and root rot (Rps2), and an ineffective nodulation gene (Rj2) map within this cluster. BAC fingerprinting and RGA-specific primers were used to develop a contig of BAC clones spanning this region in cultivar "Williams 82" [rps2, Rmd (adult onset), rj2]. Two cDNAs with homology to the TIR/NBD/LRR family of R-genes have also been mapped to opposite ends of a BAC in the contig Gm_Isb001_091F11 (BAC 91F11). Sequence analyses of BAC 91F11 identified 16 different resistance-like gene (RLG) sequences with homology to the TIR/NBD/LRR family of disease resistance genes. Four of these RLGs represent two potentially novel classes of disease resistance genes: TIR/NBD domains fused inframe to a putative defense-related protein (NtPRp27-like) and TIR domains fused inframe to soybean calmodulin Ca(2+)-binding domains. RT-PCR analyses using gene-specific primers allowed us to monitor the expression of individual genes in different tissues and developmental stages. Three genes appeared to be constitutively expressed, while three were differentially expressed. Analyses of the R-genes within this BAC suggest that R-gene evolution in soybean is a complex and dynamic process. PMID:12524363

  18. Insulin resistance, dyslipidemia, and apolipoprotein E interactions as mechanisms in cognitive impairment and Alzheimer's disease

    PubMed Central

    Salameh, Therese S; Rhea, Elizabeth M; Hanson, Angela J

    2016-01-01

    An increased risk for Alzheimer's disease is associated with dyslipidemia and insulin resistance. A separate literature shows the genetic risk for developing Alzheimer's disease is strongly correlated to the presence of the E4 isoform of the apolipoprotein E carrier protein. Understanding how apolipoprotein E carrier protein, lipids, amyloid β peptides, glucose, central nervous system insulin, and peripheral insulin interact with one another in Alzheimer's disease is an area of increasing interest. Here, we will review the evidence relating apolipoprotein E carrier protein, lipids, and insulin action to Alzheimer's disease and Aβ peptides and then propose mechanisms as to how these factors might interact with one another to impair cognition and promote Alzheimer's disease. PMID:27470930

  19. Impact of Pulmonary Vascular Resistances in Heart Transplantation for Congenital Heart Disease

    PubMed Central

    Gazit, Avihu Z; Canter, Charles E

    2011-01-01

    Congenital heart disease is one of the major diagnoses in pediatric heart transplantation recipients of all age groups. Assessment of pulmonary vascular resistance in these patients prior to transplantation is crucial to determine their candidacy, however, it is frequently inaccurate because of their abnormal anatomy and physiology. This problem places them at significant risk for pulmonary hypertension and right ventricular failure post transplantation. The pathophysiology of pulmonary vascular disease in children with congenital heart disease depends on their pulmonary blood flow patterns, systemic ventricle function, as well as semilunar valves and atrioventricular valves structure and function. In our review we analyze the pathophysiology of pulmonary vascular disease in children with congenital heart disease and end-stage heart failure, and outline the state of the art pre-transplantation medical and surgical management to achieve reverse remodeling of the pulmonary vasculature by using pulmonary vasodilators and mechanical circulatory support. PMID:22548028

  20. Field performance of chitinase transgenic silver birches (Betula pendula): resistance to fungal diseases.

    PubMed

    Pasonen, H-L; Seppänen, S-K; Degefu, Y; Rytkönen, A; von Weissenberg, K; Pappinen, A

    2004-08-01

    A field trial of 15 transgenic birch lines expressing a sugar beet chitinase IV gene and the corresponding controls was established in southern Finland to study the effects of the level of sugar beet chitinase IV expression on birch resistance to fungal diseases. The symptoms caused by natural infections of two fungal pathogens, Pyrenopeziza betulicola (leaf spot disease) and Melampsoridium betulinum (birch rust), were analysed in the field during a period of 3 years. The lines that had shown a high level of sugar beet chitinase IV mRNA accumulation in the greenhouse also showed high sugar beet chitinase IV expression after 3 years in the field. The level of sugar beet chitinase IV expression did not significantly improve the resistance of transgenic birches to leaf spot disease. Instead, some transgenic lines were significantly more susceptible to leaf spot than the controls. The level of sugar beet chitinase IV expression did have an improving effect on most parameters of birch rust; the groups of lines showing high or intermediate transgene expression were more resistant to birch rust than those showing low expression. This result indicates that the tested transformation may provide a tool for increasing the resistance of silver birch to birch rust.

  1. Genome-Wide Association Study on Resistance to Stalk Rot Diseases in Grain Sorghum.

    PubMed

    Adeyanju, Adedayo; Little, Christopher; Yu, Jianming; Tesso, Tesfaye

    2015-04-16

    Stalk rots are important biotic constraints to sorghum production worldwide. Several pathogens may be associated with the disease, but Macrophomina phaseolina and Fusarium thapsinum are recognized as the major causal organisms. The diseases become more aggressive when drought and high-temperature stress occur during grain filling. Progress in genetic improvement efforts has been slow due to lack of effective phenotyping protocol and the strong environmental effect on disease incidence and severity. Deployment of modern molecular tools is expected to accelerate efforts to develop resistant hybrids. This study was aimed at identifying genomic regions associated with resistance to both causal organisms. A sorghum diversity panel consisting of 300 genotypes assembled from different parts of the world was evaluated for response to infection by both pathogens. Community resources of 79,132 single nucleotide polymorphic (SNP) markers developed on the panel were used in association studies using a multi-locus mixed model to map loci associated with stalk rot resistance. Adequate genetic variation was observed for resistance to both pathogens. Structure analysis grouped the genotypes into five subpopulations primarily based on the racial category of the genotypes. Fourteen loci and a set of candidate genes appear to be involved in connected functions controlling plant defense response. However, each associated SNP had relatively small effect on the traits, accounting for 19-30% of phenotypic variation. Linkage disequilibrium analyses suggest that significant SNPs are genetically independent. Estimation of frequencies of associated alleles revealed that durra and caudatum subpopulations were enriched for resistant alleles, but the results suggest complex molecular mechanisms underlying resistance to both pathogens.

  2. Quantitative trait locus analysis of fungal disease resistance factors on a molecular map of grapevine.

    PubMed

    Fischer, B M; Salakhutdinov, I; Akkurt, M; Eibach, R; Edwards, K J; Töpfer, R; Zyprian, E M

    2004-02-01

    A full-sibling F1 population comprising 153 individuals from the cross of 'Regent' x 'Lemberger' was employed to construct a genetic map based on 429 molecular markers. The newly-bred red grapevine variety 'Regent' has multiple field-resistance to fungal diseases inherited as polygenic traits, while 'Lemberger' is a traditional fungus-susceptible cultivar. The progeny segregate quantitatively for resistances to Plasmopara viticola and Uncinula necator, fungal pathogens that threaten viticulture in temperate areas. A double pseudo-testcross strategy was employed to construct the two parental maps under high statistical stringency for linkage to obtain a robust marker frame for subsequent quantitative trait locus (QTL) analysis. In total, 185 amplified fragment length polymorphism, 137 random amplified polymorphic DNA, 85 single sequence repeat and 22 sequence characterized amplified region or cleaved amplified polymorphic sequence markers were mapped. The maps were aligned by co-dominant or doubly heterozygous dominant anchor markers. Twelve pairs of homologous linkage groups could be integrated into consensus linkage groups. Resistance phenotypes and segregating characteristics were scored as quantitative traits in three or four growing seasons. Interval mapping reproducibly localized genetic factors that correlated with fungal disease resistances to specific regions on three linkage groups of the maternal 'Regent' map. A QTL for resistance to Uncinula necator was identified on linkage group 16, and QTLs for endurance to Plasmopara viticola on linkage groups 9 and 10 of 'Regent'. Additional QTLs for the onset of berry ripening ("veraison"), berry size and axillary shoot growth were identified. Berry color segregated as a simple trait in this cross of two red varieties and was mapped as a morphological marker. Six markers derived from functional genes could be localized. This dissection of polygenic fungus disease resistance in grapevine allows the development of

  3. Lower temperature during the dark cycle affects disease development on Lygodium microphyllum (Old World climbing fern) by Bipolaris sacchari

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Growth chamber studies were conducted to examine environmental parameters affecting disease development by the indigenous pathogen Bipolaris sacchari isolate LJB-1L on the invasive weed Lygodium microphyllum (Old World climbing fern). Initial studies examined three different temperature regimes (20...

  4. Grassland management affects belowground carbon allocation in mountain grasslands and its resistance and resilience to drought

    NASA Astrophysics Data System (ADS)

    Karlowsky, Stefan; Augusti, Angela; Ingrisch, Johannes; Hasibeder, Roland; Bahn, Michael; Gleixner, Gerd

    2015-04-01

    Future climate scenarios do not only forecast increased extreme events during summer, but also more frequent drought events in the early season. In mountain grasslands, different land uses may contribute to the response of the ecosystem to climate changes, like drought in May and June. In this study, we examined the drought response of two differently managed grasslands, 1) a more intensive used meadow and 2) a less intensive used abandoned area. Our aim was to highlight differences in both resistance and resilience of ecosystem functioning, based on carbon (C) belowground allocation as a key function in the plant-rhizosphere continuum. Therefore, we used an isotopic approach and in particular, we used 13C pulse labelling to track the fate of newly assimilated C from leaves, to roots and to soil, up to different microbial communities. We performed two 13C pulse labellings, the first during the acute phase of drought, when the water status of soil was drastically decreased compared to the control; and the second during the recovery phase, when the soil water status was restored to control level. We followed the kinetics of 13C incorporation in above- and below-ground bulk material as well as non-structural sugars, in general soil microbial biomass, in different soil microbial communities and in CO2 respired from roots, up to 5 days from each labelling. Preliminary results from the 13C analyses of bulk phytomass material and soil microbial biomass indicate, as expected, different kinetics of aboveground 13C incorporation and its belowground allocation. During the acute phase of drought, 13C incorporation shows a decrease compared to the control for both land uses, with generally higher reductions in meadow treatments. Root 13C tracer dynamics follow the leaf 13C enrichment with a delay. High label amounts are found in leaves directly after labelling, whereas in roots high 13C incorporation is found first after 24 hours, accompanied by a fast decrease of 13C label in

  5. Frequent Occurrence of Tomato Leaf Curl New Delhi Virus in Cotton Leaf Curl Disease Affected Cotton in Pakistan

    PubMed Central

    Zaidi, Syed Shan-e-Ali; Shafiq, Muhammad; Amin, Imran; Scheffler, Brian E.; Scheffler, Jodi A.; Briddon, Rob W.; Mansoor, Shahid

    2016-01-01

    Cotton leaf curl disease (CLCuD) is the major biotic constraint to cotton production on the Indian subcontinent, and is caused by monopartite begomoviruses accompanied by a specific DNA satellite, Cotton leaf curl Multan betasatellite (CLCuMB). Since the breakdown of resistance against CLCuD in 2001/2002, only one virus, the “Burewala” strain of Cotton leaf curl Kokhran virus (CLCuKoV-Bur), and a recombinant form of CLCuMB have consistently been identified in cotton across the major cotton growing areas of Pakistan. Unusually a bipartite isolate of the begomovirus Tomato leaf curl virus was identified in CLCuD-affected cotton recently. In the study described here we isolated the bipartite begomovirus Tomato leaf curl New Delhi virus (ToLCNDV) from CLCuD-affected cotton. To assess the frequency and geographic occurrence of ToLCNDV in cotton, CLCuD-symptomatic cotton plants were collected from across the Punjab and Sindh provinces between 2013 and 2015. Analysis of the plants by diagnostic PCR showed the presence of CLCuKoV-Bur in all 31 plants examined and ToLCNDV in 20 of the samples. Additionally, a quantitative real-time PCR analysis of the levels of the two viruses in co-infected plants suggests that coinfection of ToLCNDV with the CLCuKoV-Bur/CLCuMB complex leads to an increase in the levels of CLCuMB, which encodes the major pathogenicity (symptom) determinant of the complex. The significance of these results are discussed. PMID:27213535

  6. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

  7. Challenge infection as a means of determining the rate of disease resistant Trichomonas gallinae-free birds in a population

    USGS Publications Warehouse

    Kocan, R.M.; Knisley, J.O.

    1970-01-01

    Trichomonas gallinae-free pigeons and mourning doves were infected with the Jones' Barn strain of T. gallinae to determine the rate of disease resistant T. gallinae-free birds in each population. Although all birds became infected 88% of the pigeons were resistant to trichomoniasis while 82% of the mourning doves were resistant. It was concluded that these birds had been previously infected and spontaneously lost their trichomonad fauna while retaining their resistance to fatal infection.

  8. Early feeding affects resistance against cold exposure in young broiler chickens.

    PubMed

    van den Brand, H; Molenaar, R; van der Star, I; Meijerhof, R

    2010-04-01

    In field conditions, a fasting period of 24 to 72 h after hatch is common, which is associated with delayed gastrointestinal development and yolk utilization and retarded subsequent performance. Hardly any information is available about the influence of diet composition in the first days on later life and additionally, effects of early feeding on thermoregulatory development are also not known. The aim of this study was to investigate effects of diet composition in early fed broiler chickens on their (thermoregulatory) development. Shortly after hatch, 200 Hybro chickens (initial BW of 43.6 g) were assigned to 1 of 5 feed treatments: control, dextrose, albumen, prestarter, or prestarter plus fat. Water was available ad libitum. Measurements were done in 10 replicates of 4 chickens per treatment. At d 2 or 3, half of the chickens were exposed to 20 degrees C for 30 min to determine resistance against cold exposure and rectal temperature was determined just before, immediately after, and 30 min after the end of this cold exposure. Thereafter, all chickens were killed to investigate body development. Chickens in both prestarter groups developed faster than in the other 3 groups, expressed by a higher BW, yolk-free body mass, heart and liver weight, and higher chick and intestine length. Between d 2 and 3, differences in these variables among chickens from both prestarter groups and other groups increased. Rectal temperature before cold exposure was higher in chickens from both prestarter groups (40.6 and 40.7 degrees C, respectively) and decreased less (0.6 and 0.7 degrees C, respectively) during cold exposure than in chickens from the control (39.5 and 1.2 degrees C, respectively) and albumen group (39.8 and 2.1 degrees C, respectively), whereas chickens from the dextrose group were in between (40.4 and 1.2 degrees C, respectively). We conclude that early fed diet composition in broiler chickens is (besides general development) important for development of both body

  9. Previous hypertensive disease of pregnancy is associated with alterations of markers of insulin resistance.

    PubMed

    Girouard, Joël; Giguère, Yves; Moutquin, Jean-Marie; Forest, Jean-Claude

    2007-05-01

    Insulin resistance syndrome has been observed in women with hypertensive disease of pregnancy, but few studies evaluated the presence of the syndrome a few years after delivery. The objective of this study was to evaluate the presence of insulin resistance and its metabolic alterations in these women compared with those who had a normal pregnancy. We performed an observational study in 168 women with previous hypertensive disease of pregnancy and 168 control subjects with normal pregnancy contacted, on average, 7.8 years after their first delivery (mean age: 34.8 years). Complete blood lipid profile, insulin, glucose, homocysteine, adipokins, and markers of inflammation were measured. Also, an oral glucose tolerance test was performed in 146 case and 135 control subjects. Case subjects were more overweight compared with control subjects. We found significantly lower high-density lipoprotein cholesterol and adiponectin levels and higher apolipoprotein (apo) apoB/apoA1 ratio, homocysteine, leptin, and insulin levels among case subjects compared with control subjects (Presistant in the basal state estimated by homeostasis assessment model 2, as well as in the nonbasal state as estimated by insulin sensitivity indices calculated from the oral glucose tolerance test. Finally, in a multivariate regression model, leptin, apoB/apoA1 ratio, waist circumference, adiponectin, and free fatty acids explained 40% of homeostasis assessment model 2 variance. Young women with previous hypertensive disease of pregnancy show signs of insulin resistance within the first decade after delivery. These findings suggest that insulin resistance may be the link between hypertensive disease of pregnancy and increased cardiovascular risk later in life.

  10. Natural variation in the Pto disease resistance gene within species of wild tomato (Lycopersicon). II. Population genetics of Pto.

    PubMed

    Rose, Laura E; Michelmore, Richard W; Langley, Charles H

    2007-03-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the host species Lycopersicon esculentum, the cultivated tomato, and the closely related L. pimpinellifolium is triggered by the physical interaction between the protein products of the host resistance (R) gene Pto and the pathogen avirulence genes AvrPto and AvrPtoB. Sequence variation at the Pto locus was surveyed in natural populations of seven species of Lycopersicon to test hypotheses of host-parasite coevolution and functional adaptation of the Pto gene. Pto shows significantly higher nonsynonymous polymorphism than 14 other non-R-gene loci in the same samples of Lycopersicon species, while showing no difference in synonymous polymorphism, suggesting that the maintenance of amino acid polymorphism at this locus is mediated by pathogen selection. Also, a larger proportion of ancestral variation is maintained at Pto as compared to these non-R-gene loci. The frequency spectrum of amino acid polymorphisms known to negatively affect Pto function is skewed toward low frequency compared to amino acid polymorphisms that do not affect function or silent polymorphisms. Therefore, the evolution of Pto appears to be influenced by a mixture of both purifying and balancing selection.

  11. Natural Variation in the Pto Disease Resistance Gene Within Species of Wild Tomato (Lycopersicon). II. Population Genetics of Pto

    PubMed Central

    Rose, Laura E.; Michelmore, Richard W.; Langley, Charles H.

    2007-01-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the host species Lycopersicon esculentum, the cultivated tomato, and the closely related L. pimpinellifolium is triggered by the physical interaction between the protein products of the host resistance (R) gene Pto and the pathogen avirulence genes AvrPto and AvrPtoB. Sequence variation at the Pto locus was surveyed in natural populations of seven species of Lycopersicon to test hypotheses of host–parasite coevolution and functional adaptation of the Pto gene. Pto shows significantly higher nonsynonymous polymorphism than 14 other non-R-gene loci in the same samples of Lycopersicon species, while showing no difference in synonymous polymorphism, suggesting that the maintenance of amino acid polymorphism at this locus is mediated by pathogen selection. Also, a larger proportion of ancestral variation is maintained at Pto as compared to these non-R-gene loci. The frequency spectrum of amino acid polymorphisms known to negatively affect Pto function is skewed toward low frequency compared to amino acid polymorphisms that do not affect function or silent polymorphisms. Therefore, the evolution of Pto appears to be influenced by a mixture of both purifying and balancing selection. PMID:17179076

  12. Characterization and Antimicrobial Resistance of Salmonella Typhimurium Isolates from Clinically Diseased Pigs in Korea.

    PubMed

    Oh, Sang-Ik; Kim, Jong Wan; Chae, Myeongju; Jung, Ji-A; So, Byungjae; Kim, Bumseok; Kim, Ha-Young

    2016-11-01

    This study investigated the prevalence of Salmonella enterica serovar and antimicrobial resistance in Salmonella Typhimurium isolates from clinically diseased pigs collected from 2008 to 2014 in Korea. Isolates were also characterized according to the presence of antimicrobial resistance genes and pulsed-field gel electrophoresis patterns. Among 94 Salmonella isolates, 81 (86.2%) were identified as being of the Salmonella Typhimurium serotype, followed by Salmonella Derby (6 of 94, 6.4%), Salmonella 4,[5],12:i:- (4 of 94, 4.3%), Salmonella Enteritidis (2 of 94, 2.1%), and Salmonella Brandenburg (1 of 94, 1.1%). The majority of Salmonella Typhimurium isolates were resistant to tetracycline (92.6%), followed by streptomycin (88.9%) and ampicillin (80.2%). Overall, 96.3% of Salmonella Typhimurium isolates showed multidrug-resistant phenotypes and commonly harbored the resistance genes blaTEM (64.9%), flo (32.8%), aadA (55.3%), strA (58.5%), strB (58.5%), sulII (53.2%), and tetA (61.7%). The pulsed-field gel electrophoresis analysis of 45 Salmonella Typhimurium isolates from individual farms revealed 27 distinct patterns that formed one major and two minor clusters in the dendrogram analysis, suggesting that most of the isolates (91.1%) from diseased pigs were genetically related. These findings can assist veterinarians in the selection of appropriate antimicrobial agents to combat Salmonella Typhimurium infections in pigs. Furthermore, they highlight the importance of continuous surveillance of antimicrobial resistance and genetic status in Salmonella Typhimurium for the detection of emerging resistance trends.

  13. Does acquired resistance of rodent hosts affect metabolic rate of fleas?

    PubMed

    Khokhlova, Irina S; Ghazaryan, Lusine; Krasnov, Boris R; Degen, A Allan

    2009-07-01

    We studied whether (a) previous infestation of a rodent host with fleas and (b) the reproductive effort of fleas affect the rate of CO(2) emission in two flea species, host-specific Parapulex chephrenis and host-opportunistic Xenopsylla ramesis when feeding on their typical and atypical rodent hosts. We measured the rate of CO(2) emission in preovipositing and ovipositing female fleas fed on either pristine or previously infested Acomys cahirinus (typical host of P. chephrenis) and Dipodillus dasyurus (typical host of X. ramesis). When P. chephrenis fed on a typical host, its mass-specific rate of CO(2) emission was not affected by previous infestation of a host, whereas when this flea fed on the atypical host, its rate of CO(2) emission was higher when a host was previously infested. This was manifested, however, mainly during the oviposition period. The rate of CO(2) emission by X. ramesis feeding on pristine hosts was significantly lower than in conspecifics feeding on previously infested hosts, independent of host species. Both flea species feeding on their typical hosts emitted CO(2) at similar mass-specific rates during preoviposition and oviposition, except for P. chephrenis feeding on D. dasyurus, which increased its rate during oviposition. There was no effect of the number of eggs produced per female on the rate of CO(2) emission during oviposition.

  14. Aminoglycoside resistance 16S rRNA methyltransferases block endogenous methylation, affect translation efficiency and fitness of the host

    PubMed Central

    Lioy, Virginia S.; Goussard, Sylvie; Guerineau, Vincent; Yoon, Eun-Jeong; Courvalin, Patrice; Galimand, Marc; Grillot-Courvalin, Catherine

    2014-01-01

    In Gram-negative bacteria, acquired 16S rRNA methyltransferases ArmA and NpmA confer high-level resistance to all clinically useful aminoglycosides by modifying, respectively, G1405 and A1408 in the A-site. These enzymes must coexist with several endogenous methyltransferases that are essential for fine-tuning of the decoding center, such as RsmH and RsmI in Escherichia coli, which methylate C1402 and RsmF C1407. The resistance methyltransferases have a contrasting distribution—ArmA has spread worldwide, whereas a single clinical isolate producing NpmA has been reported. The rate of dissemination of resistance depends on the fitness cost associated with its expression. We have compared ArmA and NpmA in isogenic Escherichia coli harboring the corresponding structural genes and their inactive point mutants cloned under the control of their native constitutive promoter in the stable plasmid pGB2. Growth rate determination and competition experiments showed that ArmA had a fitness cost due to methylation of G1405, whereas NpmA conferred only a slight disadvantage to the host due to production of the enzyme. MALDI MS indicated that ArmA impeded one of the methylations at C1402 by RsmI, and not at C1407 as previously proposed, whereas NpmA blocked the activity of RsmF at C1407. A dual luciferase assay showed that methylation at G1405 and A1408 and lack of methylation at C1407 affect translation accuracy. These results indicate that resistance methyltransferases impair endogenous methylation with different consequences on cell fitness. PMID:24398977

  15. Nutrient utilisation and intestinal fermentation are differentially affected by the consumption of resistant starch varieties and conventional fibres in pigs.

    PubMed

    Rideout, Todd C; Liu, Qiang; Wood, Peter; Fan, Ming Z

    2008-05-01

    This study examined the influence of different resistant starch (RS) varieties and conventional fibres on the efficiency of nutrient utilisation and intestinal fermentation in pigs. Thirty-six pigs (30 kg) were fed poultry meal-based diets supplemented with 10 % granular resistant corn starch (GCS), granular resistant potato starch (GPS), retrograded resistant corn starch (RCS), guar gum (GG) or cellulose for 36 d according to a completely randomised block design. Distal ileal and total tract recoveries were similar (P>0.05) among the RS varieties. Distal ileal starch recovery was higher (P < 0.05) in pigs consuming the RS diets (27-42 %) as compared with the control group (0.64 %). Consumption of GCS reduced (P < 0.05) apparent total tract digestibility and whole-bo