Science.gov

Sample records for affect disease resistance

  1. Dietary supplementation of probiotics affects growth, immune response and disease resistance of Cyprinus carpio fry.

    PubMed

    Gupta, Akhil; Gupta, Paromita; Dhawan, Asha

    2014-12-01

    The effects of dietary Bacillus coagulans (MTCC 9872), Bacillus licheniformis (MTCC 6824) and Paenibacillus polymyxa (MTCC 122) supplementation on growth performance, non-specific immunity and protection against Aeromonas hydrophila infection were evaluated in common carp, Cyprinus carpio fry. Laboratory maintained B. coagulans, B. licheniformis and P. polymyxa were used to study antagonistic activity against fish pathogenic bacteria by agar well diffusion assay. Healthy fish fry were challenged by this bacterium for determination of its safety. Fish were fed for 80 days with control basal diet (B0) and experimental diets containing B. coagulans (B1), B. licheniformis (B2) and P. polymyxa (B3) at 10(9) CFU/g diet. Fish fry (mean weight 0.329 ± 0.01 g) were fed these diets and growth performance, various non-specific immune parameters and disease resistance study were conducted at 80 days post-feeding. The antagonism study showed inhibition zone against A. hydrophila and Vibrio harveyi. All the probiotic bacterial strains were harmless to fish fry as neither mortality nor morbidities were observed of the challenge. The growth-promoting influences of probiotic supplemented dietary treatments were observed with fish fry and the optimum survival, growth and feed utilization were obtained with P. polymyxa (B3) supplemented diet. Study of different non-specific innate immunological parameters viz. lysozyme activity, respiratory burst assay and myeloperoxidase content showed significant (p < 0.05) higher values in fish fry fed B3 diet at 10(9) CFU/g. The challenge test showed dietary supplementation of B. coagulans, B. licheniformis and P. polymyxa significantly (p < 0.05) enhanced the resistance of fish fry against bacterial challenge. These results collectively suggests that P. polymyxa is a potential probiotic species and can be used in aquaculture to improve growth, feed utilization, non-specific immune responses and disease resistance of fry common carp, C. carpio.

  2. Disease Resistance in the Drywood Termite, Incisitermes schwarzi: Does Nesting Ecology Affect Immunocompetence?

    PubMed Central

    Calleri, Daniel V.; Rosengaus, Rebeca B.; Traniello, James F.A.

    2010-01-01

    Termites live in nests that can differ in microbial load and thus vary in degree of disease risk. It was hypothesized that termite investment in immune response would differ in species living in nest environments that vary in the richness and abundance of microbes. Using the drywood termite, Incisitermes schwarzi Banks (Isoptera: Kalotermitidae), as a model for species having low nest and cuticular microbial loads, the susceptibility of individuals and groups to conidia of the entomopathogenic fungus, Metarhizium anisopliae Sorokin (Hypocreales: Clavicipitaceae), was examined. The survivorship of I. schwarzi was compared to that of the dampwood termite, Zootermopsis angusticollis Hagen (Termopsidae), a species with comparatively high microbial loads. The results indicated that I. schwarzi derives similar benefits from group living as Z. angusticollis: isolated termites had 5.5 times the hazard ratio of death relative to termites nesting in groups of 25 while termites in groups of 10 did not differ significantly from the groups of 25. The results also indicated, after controlling for the influence of group size and conidia exposure on survivorship, that Z. angusticollis was significantly more susceptible to fungal infection than I. schwarzi, the former having 1.6 times the hazard ratio of death relative to drywood termites. Thus, disease susceptibility and individual investment in immunocompetence may not be dependent on interspecific variation in microbial pressures. The data validate prior studies indicating that sociality has benefits in infection control and suggest that social mechanisms of disease resistance, rather than individual physiological and immunological adaptations, may have been the principle target of selection related to variation in infection risk from microbes in the nest environment of different termite species. PMID:20572790

  3. A genome-screen experiment to detect quantitative trait loci affecting resistance to facial eczema disease in sheep.

    PubMed

    Phua, S H; Dodds, K G; Morris, C A; Henry, H M; Beattie, A E; Garmonsway, H G; Towers, N R; Crawford, A M

    2009-02-01

    Facial eczema (FE) is a secondary photosensitization disease arising from liver cirrhosis caused by the mycotoxin sporidesmin. The disease affects sheep, cattle, deer and goats, and costs the New Zealand sheep industry alone an estimated NZ$63M annually. A long-term sustainable solution to this century-old FE problem is to breed for disease-resistant animals by marker-assisted selection. As a step towards finding a diagnostic DNA test for FE sensitivity, we have conducted a genome-scan experiment to screen for quantitative trait loci (QTL) affecting this trait in Romney sheep. Four F(1) sires, obtained from reciprocal matings of FE resistant and susceptible selection-line animals, were used to generate four outcross families. The resulting half-sib progeny were artificially challenged with sporidesmin to phenotype their FE traits measured in terms of their serum levels of liver-specific enzymes, namely gamma-glutamyl transferase and glutamate dehydrogenase. In a primary screen using selective genotyping on extreme progeny of each family, a total of 244 DNA markers uniformly distributed over all 26 ovine autosomes (with an autosomal genome coverage of 79-91%) were tested for linkage to the FE traits. Data were analysed using Haley-Knott regression. The primary screen detected one significant and one suggestive QTL on chromosomes 3 and 8 respectively. Both the significant and suggestive QTL were followed up in a secondary screen where all progeny were genotyped and analysed; the QTL on chromosome 3 was significant in this analysis.

  4. Phenotypic instability of Arabidopsis alleles affecting a disease Resistance gene cluster

    PubMed Central

    Yi, Hankuil; Richards, Eric J

    2008-01-01

    Background Three mutations in Arabidopsis thaliana strain Columbia – cpr1, snc1, and bal – map to the RPP5 locus, which contains a cluster of disease Resistance genes. The similar phenotypes, gene expression patterns, and genetic interactions observed in these mutants are related to constitutive activation of pathogen defense signaling. However, these mutant alleles respond differently to various conditions. Exposure to mutagens, such as ethyl methanesulfonate (EMS) and γ-irradiation, induce high frequency phenotypic instability of the bal allele. In addition, a fraction of the bal and cpr1 alleles segregated from bal × cpr1 F1 hybrids also show signs of phenotypic instability. To gain more insight into the mechanism of phenotypic instability of the bal and cpr1 mutations, we systematically compared the behavior of these unusual alleles with that of the missense gain-of-function snc1 allele in response to DNA damage or passage through F1 hybrids. Results We found that the cpr1 allele is similar to the bal allele in its unstable behavior after EMS mutagenesis. For both the bal and cpr1 mutants, destabilization of phenotypes was observed in more than 10% of EMS-treated plants in the M1 generation. In addition, exceptions to simple Mendelian inheritance were identified in the M2 generation. Like cpr1 × bal F1 hybrids, cpr1 × snc1 F1 hybrids and bal × snc1 F1 hybrids exhibited dwarf morphology. While only dwarf F2 plants were produced from bal × snc1 F1 hybrids, about 10% wild-type F2 progeny were produced from cpr1 × snc1 F1 hybrids, as well as from cpr1 × bal hybrids. Segregation analysis suggested that the cpr1 allele in cpr1 × snc1 crosses was destabilized during the late F1 generation to early F2 generation. Conclusion With exposure to EMS or different F1 hybrid contexts, phenotypic instability is induced for the bal and cpr1 alleles, but not for the snc1 allele. Our results suggest that the RPP5 locus can adopt different metastable genetic or

  5. Disease severity of organic rice as affected by host resistance, fertility and tillage

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several studies were conducted to determine the effect of fertilizer inputs and tillage methods on disease incidence in an organic rice production system. The results of these studies suggest that organically produced rice is more vulnerable to infection of narrow brown leaf spot and brown spot. Thi...

  6. Does Wheat Genetically Modified for Disease Resistance Affect Root-Colonizing Pseudomonads and Arbuscular Mycorrhizal Fungi?

    PubMed Central

    Foetzki, Andrea; Luginbühl, Carolin; Winzeler, Michael; Kneubühler, Yvan; Matasci, Caterina; Mascher-Frutschi, Fabio; Kalinina, Olena; Boller, Thomas; Keel, Christoph; Maurhofer, Monika

    2013-01-01

    This study aimed to evaluate the impact of genetically modified (GM) wheat with introduced pm3b mildew resistance transgene, on two types of root-colonizing microorganisms, namely pseudomonads and arbuscular mycorrhizal fungi (AMF). Our investigations were carried out in field trials over three field seasons and at two locations. Serial dilution in selective King's B medium and microscopy were used to assess the abundance of cultivable pseudomonads and AMF, respectively. We developed a denaturing gradient gel electrophoresis (DGGE) method to characterize the diversity of the pqqC gene, which is involved in Pseudomonas phosphate solubilization. A major result was that in the first field season Pseudomonas abundances and diversity on roots of GM pm3b lines, but also on non-GM sister lines were different from those of the parental lines and conventional wheat cultivars. This indicates a strong effect of the procedures by which these plants were created, as GM and sister lines were generated via tissue cultures and propagated in the greenhouse. Moreover, Pseudomonas population sizes and DGGE profiles varied considerably between individual GM lines with different genomic locations of the pm3b transgene. At individual time points, differences in Pseudomonas and AMF accumulation between GM and control lines were detected, but they were not consistent and much less pronounced than differences detected between young and old plants, different conventional wheat cultivars or at different locations and field seasons. Thus, we conclude that impacts of GM wheat on plant-beneficial root-colonizing microorganisms are minor and not of ecological importance. The cultivation-independent pqqC-DGGE approach proved to be a useful tool for monitoring the dynamics of Pseudomonas populations in a wheat field and even sensitive enough for detecting population responses to altered plant physiology. PMID:23372672

  7. Mapping and validation of a major QTL affecting resistance to pancreas disease (salmonid alphavirus) in Atlantic salmon (Salmo salar).

    PubMed

    Gonen, S; Baranski, M; Thorland, I; Norris, A; Grove, H; Arnesen, P; Bakke, H; Lien, S; Bishop, S C; Houston, R D

    2015-11-01

    Pancreas disease (PD), caused by a salmonid alphavirus (SAV), has a large negative economic and animal welfare impact on Atlantic salmon aquaculture. Evidence for genetic variation in host resistance to this disease has been reported, suggesting that selective breeding may potentially form an important component of disease control. The aim of this study was to explore the genetic architecture of resistance to PD, using survival data collected from two unrelated populations of Atlantic salmon; one challenged with SAV as fry in freshwater (POP 1) and one challenged with SAV as post-smolts in sea water (POP 2). Analyses of the binary survival data revealed a moderate-to-high heritability for host resistance to PD in both populations (fry POP 1 h(2)~0.5; post-smolt POP 2 h(2)~0.4). Subsets of both populations were genotyped for single nucleotide polymorphism markers, and six putative resistance quantitative trait loci (QTL) were identified. One of these QTL was mapped to the same location on chromosome 3 in both populations, reaching chromosome-wide significance in both the sire- and dam-based analyses in POP 1, and genome-wide significance in a combined analysis in POP 2. This independently verified QTL explains a significant proportion of host genetic variation in resistance to PD in both populations, suggesting a common underlying mechanism for genetic resistance across lifecycle stages. Markers associated with this QTL are being incorporated into selective breeding programs to improve PD resistance.

  8. Mapping and validation of a major QTL affecting resistance to pancreas disease (salmonid alphavirus) in Atlantic salmon (Salmo salar)

    PubMed Central

    Gonen, S; Baranski, M; Thorland, I; Norris, A; Grove, H; Arnesen, P; Bakke, H; Lien, S; Bishop, S C; Houston, R D

    2015-01-01

    Pancreas disease (PD), caused by a salmonid alphavirus (SAV), has a large negative economic and animal welfare impact on Atlantic salmon aquaculture. Evidence for genetic variation in host resistance to this disease has been reported, suggesting that selective breeding may potentially form an important component of disease control. The aim of this study was to explore the genetic architecture of resistance to PD, using survival data collected from two unrelated populations of Atlantic salmon; one challenged with SAV as fry in freshwater (POP 1) and one challenged with SAV as post-smolts in sea water (POP 2). Analyses of the binary survival data revealed a moderate-to-high heritability for host resistance to PD in both populations (fry POP 1 h2~0.5; post-smolt POP 2 h2~0.4). Subsets of both populations were genotyped for single nucleotide polymorphism markers, and six putative resistance quantitative trait loci (QTL) were identified. One of these QTL was mapped to the same location on chromosome 3 in both populations, reaching chromosome-wide significance in both the sire- and dam-based analyses in POP 1, and genome-wide significance in a combined analysis in POP 2. This independently verified QTL explains a significant proportion of host genetic variation in resistance to PD in both populations, suggesting a common underlying mechanism for genetic resistance across lifecycle stages. Markers associated with this QTL are being incorporated into selective breeding programs to improve PD resistance. PMID:25990876

  9. Extreme Air Pollution Conditions Adversely Affect Blood Pressure and Insulin Resistance: The Air Pollution and Cardiometabolic Disease Study.

    PubMed

    Brook, Robert D; Sun, Zhichao; Brook, Jeffrey R; Zhao, Xiaoyi; Ruan, Yanping; Yan, Jianhua; Mukherjee, Bhramar; Rao, Xiaoquan; Duan, Fengkui; Sun, Lixian; Liang, Ruijuan; Lian, Hui; Zhang, Shuyang; Fang, Quan; Gu, Dongfeng; Sun, Qinghua; Fan, Zhongjie; Rajagopalan, Sanjay

    2016-01-01

    Mounting evidence supports that fine particulate matter adversely affects cardiometabolic diseases particularly in susceptible individuals; however, health effects induced by the extreme concentrations within megacities in Asia are not well described. We enrolled 65 nonsmoking adults with metabolic syndrome and insulin resistance in the Beijing metropolitan area into a panel study of 4 repeated visits across 4 seasons since 2012. Daily ambient fine particulate matter and personal black carbon levels ranged from 9.0 to 552.5 µg/m(3) and 0.2 to 24.5 µg/m(3), respectively, with extreme levels observed during January 2013. Cumulative fine particulate matter exposure windows across the prior 1 to 7 days were significantly associated with systolic blood pressure elevations ranging from 2.0 (95% confidence interval, 0.3-3.7) to 2.7 (0.6-4.8) mm Hg per SD increase (67.2 µg/m(3)), whereas cumulative black carbon exposure during the previous 2 to 5 days were significantly associated with ranges in elevations in diastolic blood pressure from 1.3 (0.0-2.5) to 1.7 (0.3-3.2) mm Hg per SD increase (3.6 µg/m(3)). Both black carbon and fine particulate matter were significantly associated with worsening insulin resistance (0.18 [0.01-0.36] and 0.22 [0.04-0.39] unit increase per SD increase of personal-level black carbon and 0.18 [0.02-0.34] and 0.22 [0.08-0.36] unit increase per SD increase of ambient fine particulate matter on lag days 4 and 5). These results provide important global public health warnings that air pollution may pose a risk to cardiometabolic health even at the extremely high concentrations faced by billions of people in the developing world today. PMID:26573709

  10. Extreme Air Pollution Conditions Adversely Affect Blood Pressure and Insulin Resistance: The Air Pollution and Cardiometabolic Disease Study.

    PubMed

    Brook, Robert D; Sun, Zhichao; Brook, Jeffrey R; Zhao, Xiaoyi; Ruan, Yanping; Yan, Jianhua; Mukherjee, Bhramar; Rao, Xiaoquan; Duan, Fengkui; Sun, Lixian; Liang, Ruijuan; Lian, Hui; Zhang, Shuyang; Fang, Quan; Gu, Dongfeng; Sun, Qinghua; Fan, Zhongjie; Rajagopalan, Sanjay

    2016-01-01

    Mounting evidence supports that fine particulate matter adversely affects cardiometabolic diseases particularly in susceptible individuals; however, health effects induced by the extreme concentrations within megacities in Asia are not well described. We enrolled 65 nonsmoking adults with metabolic syndrome and insulin resistance in the Beijing metropolitan area into a panel study of 4 repeated visits across 4 seasons since 2012. Daily ambient fine particulate matter and personal black carbon levels ranged from 9.0 to 552.5 µg/m(3) and 0.2 to 24.5 µg/m(3), respectively, with extreme levels observed during January 2013. Cumulative fine particulate matter exposure windows across the prior 1 to 7 days were significantly associated with systolic blood pressure elevations ranging from 2.0 (95% confidence interval, 0.3-3.7) to 2.7 (0.6-4.8) mm Hg per SD increase (67.2 µg/m(3)), whereas cumulative black carbon exposure during the previous 2 to 5 days were significantly associated with ranges in elevations in diastolic blood pressure from 1.3 (0.0-2.5) to 1.7 (0.3-3.2) mm Hg per SD increase (3.6 µg/m(3)). Both black carbon and fine particulate matter were significantly associated with worsening insulin resistance (0.18 [0.01-0.36] and 0.22 [0.04-0.39] unit increase per SD increase of personal-level black carbon and 0.18 [0.02-0.34] and 0.22 [0.08-0.36] unit increase per SD increase of ambient fine particulate matter on lag days 4 and 5). These results provide important global public health warnings that air pollution may pose a risk to cardiometabolic health even at the extremely high concentrations faced by billions of people in the developing world today.

  11. Grafting for disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary purpose of grafting vegetables worldwide has been to provide resistance to soil-borne diseases. The potential loss of methyl bromide as a soil fumigant combined with pathogen resistance to commonly used pesticides will make resistance to soil-borne pathogens even more important in the fu...

  12. Chemokine-like receptor 1 deficiency does not affect the development of insulin resistance and nonalcoholic fatty liver disease in mice.

    PubMed

    Gruben, Nanda; Aparicio Vergara, Marcela; Kloosterhuis, Niels J; van der Molen, Henk; Stoelwinder, Stefan; Youssef, Sameh; de Bruin, Alain; Delsing, Dianne J; Kuivenhoven, Jan Albert; van de Sluis, Bart; Hofker, Marten H; Koonen, Debby P Y

    2014-01-01

    The adipokine chemerin and its receptor, chemokine-like receptor 1 (Cmklr1), are associated with insulin resistance and nonalcoholic fatty liver disease (NAFLD), which covers a broad spectrum of liver diseases, ranging from simple steatosis to nonalcoholic steatohepatitis (NASH). It is possible that chemerin and/or Cmklr1 exert their effects on these disorders through inflammation, but so far the data have been controversial. To gain further insight into this matter, we studied the effect of whole-body Cmklr1 deficiency on insulin resistance and NAFLD. In view of the primary role of macrophages in hepatic inflammation, we also transplanted bone marrow from Cmklr1 knock-out (Cmklr1-/-) mice and wild type (WT) mice into low-density lipoprotein receptor knock-out (Ldlr-/-) mice, a mouse model for NASH. All mice were fed a high fat, high cholesterol diet containing 21% fat from milk butter and 0.2% cholesterol for 12 weeks. Insulin resistance was assessed by an oral glucose tolerance test, an insulin tolerance test, and by measurement of plasma glucose and insulin levels. Liver pathology was determined by measuring hepatic inflammation, fibrosis, lipid accumulation and the NAFLD activity score (NAS). Whole-body Cmklr1 deficiency did not affect body weight gain or food intake. In addition, we observed no differences between WT and Cmklr1-/- mice for hepatic inflammatory and fibrotic gene expression, immune cell infiltration, lipid accumulation or NAS. In line with this, we detected no differences in insulin resistance. In concordance with whole-body Cmklr1 deficiency, the absence of Cmklr1 in bone marrow-derived cells in Ldlr-/- mice did not affect their insulin resistance or liver pathology. Our results indicate that Cmklr1 is not involved in the pathogenesis of insulin resistance or NAFLD. Thus, we recommend that the associations reported between Cmklr1 and insulin resistance or NAFLD should be interpreted with caution.

  13. Methyl esterification of pectin plays a role during plant-pathogen interactions and affects plant resistance to diseases.

    PubMed

    Lionetti, Vincenzo; Cervone, Felice; Bellincampi, Daniela

    2012-11-01

    The cell wall is a complex structure mainly composed by a cellulose-hemicellulose network embedded in a cohesive pectin matrix. Pectin is synthesized in a highly methyl esterified form and is de-esterified in muro by pectin methyl esterases (PMEs). The degree and pattern of methyl esterification affect the cell wall structure and properties with consequences on both the physiological processes of the plants and their resistance to pathogens. PME activity displays a crucial role in the outcome of the plant-pathogen interactions by making pectin more susceptible to the action of the enzymes produced by the pathogens. This review focuses on the impact of pectin methyl esterification in plant-pathogen interactions and on the dynamic role of its alteration during pathogenesis.

  14. Engineering disease resistant cattle.

    PubMed

    Donovan, David M; Kerr, David E; Wall, Robert J

    2005-10-01

    Mastitis is a disease of the mammary gland caused by pathogens that find their way into the lumen of the gland through the teat canal. Mammary gland infections cost the US dairy industry approximately $2 billion dollars annually and have a similar impact in Europe. In the absence of effective treatments or breeding strategies to enhance mastitis resistance, we have created transgenic dairy cows that express lysostaphin in their mammary epithelium and secrete the antimicrobial peptide into milk. Staphylococcus aureus, a major mastitis pathogen, is exquisitely sensitive to lysostaphin. The transgenic cattle resist S. aureus mammary gland challenges, and their milk kills the bacteria, in a dose dependent manner. This first step in protecting cattle against mastitis will be followed by introduction of other genes to deal with potential resistance issues and other mastitis causing organisms. Care will be taken to avoid altering milk's nutritional and manufacturing properties. Multi-cistronic constructs may be required to achieve our goals as will other strategies possibly involving RNAi and gene targeting technology. This work demonstrates the possibility of using transgenic technology to address disease problems in agriculturally important species.

  15. Reconceptualizing resistance: sociology and the affective dimension of resistance.

    PubMed

    Hynes, Maria

    2013-12-01

    This paper re-examines the sociological study of resistance in light of growing interest in the concept of affect. Recent claims that we are witness to an 'affective turn' and calls for a 'new sociological empiricism' sensitive to affect indicate an emerging paradigm shift in sociology. Yet, mainstream sociological study of resistance tends to have been largely unaffected by this shift. To this end, this paper presents a case for the significance of affect as a lens by which to approach the study of resistance. My claim is not simply that the forms of actions we would normally recognize as resistance have an affective dimension. Rather, it is that the theory of affect broadens 'resistance' beyond the purview of the two dominant modes of analysis in sociology; namely, the study of macropolitical forms, on the one hand, and the micropolitics of everyday resistance on the other. This broadened perspective challenges the persistent assumption that ideological forms of power and resistance are the most pertinent to the contemporary world, suggesting that much power and resistance today is of a more affective nature. In making this argument, it is a Deleuzian reading of affect that is pursued, which opens up to a level of analysis beyond the common understanding of affect as emotion. I argue that an affective approach to resistance would pay attention to those barely perceptible transitions in power and mobilizations of bodily potential that operate below the conscious perceptions and subjective emotions of social actors. These affective transitions constitute a new site at which both power and resistance operate.

  16. Powdery Mildew Disease Resistance

    SciTech Connect

    Somerville, Shauna C.

    2010-08-31

    The overall goal of this project was to characterize the PMR5 protein, a member of the DUF231/TBR family, and to determine its role in plant cell wall biogenesis. Since the pmr5 mutants are also resistant to the fungal powdery mildew pathogen, we wished to determine what specific cell wall changes are associated with disease resistance and why. The graduate student working on this project made mutations in the putative active site of PMR5, assuming it is a member of the SGNH/GDSL esterase superfamily (Anantharaman and Aravind, 2010, Biology Direct 5, 1). These mutants were inactive in planta suggesting that PMR5 is a functional enzyme and not a binding protein or chaperone. In addition, she determined that cell wall preparations from the pmr5 mutant exhibited a modest reduction (13%) in total acetyl groups. To pursue characterization further, the graduate student expressed the PMR5 protein in a heterologous E. coli system. She could purify PMR5 using a two step protocol based on tags added to the N and C terminus of the protein. She was able to show the PMR5 protein bound to pectins, including homogalacturonan, but not to other cell wall components (e.g., xyloglucans, arabinans). Based on these observations, a postdoctoral fellow is currently developing an enzyme assay for PMR5 based on the idea that it may be acetylating the homogalacturonic acid pectin fraction. Our initial experiments to localize PMR5 subcellularly suggested that it occurred in the endoplasmic reticulum. However, since the various pectins are believed to be synthesized in the Golgi apparatus, we felt it necessary to repeat our results using a native promoter expression system. Within the past year, we have demonstrated conclusively that PMR5 is localized to the endoplasmic reticulum, a location that sets it apart from most cell wall biogenesis and modification enzymes. The graduate student contributed to the characterization of two suppressor mutants, which were selected as restoring powdery

  17. Rainbow Trout (Oncorhynchus mykiss) resistance to columnaris disease is heritable and favorably correlated with bacterial cold water disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Columnaris disease (CD) is an emerging disease affecting rainbow trout aquaculture. Objectives were to estimate heritability of CD resistance in a line (ARS-Fp-R) selected 4 generations for improved bacterial cold water disease (BCWD) resistance; estimate genetic correlations among CD resistance, BC...

  18. Ectopically expressed sweet pepper ferredoxin PFLP enhances disease resistance to Pectobacterium carotovorum subsp. carotovorum affected by harpin and protease-mediated hypersensitive response in Arabidopsis.

    PubMed

    Ger, Mang-Jye; Louh, Guan-Yu; Lin, Yi-Hsien; Feng, Teng-Yung; Huang, Hsiang-En

    2014-12-01

    Plant ferredoxin-like protein (PFLP) is a photosynthesis-type ferredoxin (Fd) found in sweet pepper. It contains an iron-sulphur cluster that receives and delivers electrons between enzymes involved in many fundamental metabolic processes. It has been demonstrated that transgenic plants overexpressing PFLP show a high resistance to many bacterial pathogens, although the mechanism remains unclear. In this investigation, the PFLP gene was transferred into Arabidopsis and its defective derivatives, such as npr1 (nonexpresser of pathogenesis-related gene 1) and eds1 (enhanced disease susceptibility 1) mutants and NAHG-transgenic plants. These transgenic plants were then infected with the soft-rot bacterial pathogen Pectobacterium carotovorum subsp. carotovorum (Erwinia carotovora ssp. carotovora, ECC) to investigate the mechanism behind PFLP-mediated resistance. The results revealed that, instead of showing soft-rot symptoms, ECC activated hypersensitive response (HR)-associated events, such as the accumulation of hydrogen peroxide (H2 O2 ), electrical conductivity leakage and expression of the HR marker genes (ATHSR2 and ATHSR3) in PFLP-transgenic Arabidopsis. This PFLP-mediated resistance could be abolished by inhibitors, such as diphenylene iodonium (DPI), 1-l-trans-epoxysuccinyl-leucylamido-(4-guanidino)-butane (E64) and benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (z-VAD-fmk), but not by myriocin and fumonisin. The PFLP-transgenic plants were resistant to ECC, but not to its harpin mutant strain ECCAC5082. In the npr1 mutant and NAHG-transgenic Arabidopsis, but not in the eds1 mutant, overexpression of the PFLP gene increased resistance to ECC. Based on these results, we suggest that transgenic Arabidopsis contains high levels of ectopic PFLP; this may lead to the recognition of the harpin and to the activation of the HR and other resistance mechanisms, and is dependent on the protease-mediated pathway.

  19. Insulin Resistance in Alzheimer's Disease

    PubMed Central

    Dineley, Kelly T; Jahrling, Jordan B; Denner, Larry

    2014-01-01

    Insulin is a key hormone regulating metabolism. Insulin binding to cell surface insulin receptors engages many signaling intermediates operating in parallel and in series to control glucose, energy, and lipids while also regulating mitogenesis and development. Perturbations in the function of any of these intermediates, which occur in a variety of diseases, cause reduced sensitivity to insulin and insulin resistance with consequent metabolic dysfunction. Chronic inflammation ensues which exacerbates compromised metabolic homeostasis. Since insulin has a key role in learning and memory as well as directly regulating ERK, a kinase required for the type of learning and memory compromised in early Alzheimer's disease (AD), insulin resistance has been identified as a major risk factor for the onset of AD. Animal models of AD or insulin resistance or both demonstrate that AD pathology and impaired insulin signaling form a reciprocal relationship. Of note are human and animal model studies geared toward improving insulin resistance that have led to the identification of the nuclear receptor and transcription factor, peroxisome proliferator-activated receptor gamma (PPARγ) as an intervention tool for early AD. Strategic targeting of alternate nodes within the insulin signaling network has revealed disease-stage therapeutic windows in animal models that coalesce with previous and ongoing clinical trial approaches. Thus, exploiting the connection between insulin resistance and AD provides powerful opportunities to delineate therapeutic interventions that slow or block the pathogenesis of AD. PMID:25237037

  20. Developing disease resistant stone fruits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stone fruit (Prunus spp.) (peach, nectarine, plum, apricot, cherry) and almonds are susceptible to a number of pathogens. These pathogens can cause extensive losses in the field, during transport and storage, and in the market. Breeding for disease resistance requires an extensive knowledge of the...

  1. Multiple Disease Resistance in Plants.

    PubMed

    Wiesner-Hanks, Tyr; Nelson, Rebecca

    2016-08-01

    Many plants, both in nature and in agriculture, are resistant to multiple diseases. Although much of the plant innate immunity system provides highly specific resistance, there is emerging evidence to support the hypothesis that some components of plant defense are relatively nonspecific, providing multiple disease resistance (MDR). Understanding MDR is of fundamental and practical interest to plant biologists, pathologists, and breeders. This review takes stock of the available evidence related to the MDR hypothesis. Questions about MDR are considered primarily through the lens of forward genetics, starting at the organismal level and proceeding to the locus level and, finally, to the gene level. At the organismal level, MDR may be controlled by clusters of R genes that evolve under diversifying selection, by dispersed, pathogen-specific genes, and/or by individual genes providing MDR. Based on the few MDR loci that are well-understood, MDR is conditioned by diverse mechanisms at the locus and gene levels. PMID:27296142

  2. Genomics and disease resistance studies in livestock☆

    PubMed Central

    Bishop, Stephen C; Woolliams, John A

    2014-01-01

    This paper considers the application of genetic and genomic techniques to disease resistance, the interpretation of data arising from such studies and the utilisation of the research outcomes to breed animals for enhanced resistance. Resistance and tolerance are defined and contrasted, factors affecting the analysis and interpretation of field data presented, and appropriate experimental designs discussed. These general principles are then applied to two detailed case studies, infectious pancreatic necrosis in Atlantic salmon and bovine tuberculosis in dairy cattle, and the lessons learnt are considered in detail. It is concluded that the rate limiting step in disease genetic studies will generally be provision of adequate phenotypic data, and its interpretation, rather than the genomic resources. Lastly, the importance of cross-disciplinary dialogue between the animal health and animal genetics communities is stressed. PMID:26339300

  3. Prolonged weightlessness affects promyelocytic multidrug resistance.

    PubMed

    Piepmeier, E H; Kalns, J E; McIntyre, K M; Lewis, M L

    1997-12-15

    An immortalized promyelocytic cell line was studied to detect how doxorubicin uptake is affected by microgravity. The purpose of this experiment was to identify the effect that microgravity may have on multidrug resistance in leukocytes. HL60 cells and HL60 cells resistant to anthracycline (HL60/AR) were grown in RPMI and 10% FBS. Upon reaching orbit in the Space Shuttle Endeavour, the cells were robotically mixed with doxorubicin. Three days after mixing, cells were fixed with paraformaldehyde/glutaraldehyde. Ground control experiments were conducted concurrently using a robot identical to the one used on the Shuttle. Fixed cells were analyzed within 2 weeks of launch. Confocal micrographs identified changes in cell structure (transmittance), drug distribution (fluorescence), and microtubule polymerization (fluorescence). Flight cells showed a lack of cytoskeletal polymerization resulting in an overall amorphic globular shape. Doxorubicin distribution in ground cells included a large numbers of vesicles relative to flight cells. There was a greater amount of doxorubicin present in flight cells (85% +/- 9.7) than in ground control cells (43% +/- 26) as determined by image analysis. Differences in microtubule formation between flight cells and ground cells could be partially responsible for the differences in drug distribution. Cytoskeletal interactions are critical to the function of P-glycoprotein as a drug efflux pump responsible for multidrug resistance.

  4. Immunoglobulin Resistance in Kawasaki Disease

    PubMed Central

    Hartas, Georgios A.; Hashmi, Syed Shahrukh; Pham-Peyton, Chi; Tsounias, Emmanouil; Bricker, John T.

    2015-01-01

    Background: The aim of this study was to identify risk factors for immunoglobulin resistance, including clinical symptoms such as arthritis and the pH of intravenous immunoglobulin. Methods: The data of children with Kawasaki disease who had received immunoglobulin were evaluated. Data regarding the brand of immunoglobulin administered were abstracted from the pharmacy records. Results: Eighty consecutive children with Kawasaki disease were evaluated (Mdnage=28 months, 66% male). The prevalence of immunoglobulin resistance was 30%. Arthritis was a presenting symptom in the acute phase of Kawasaki disease in 8% (6/80, all male) and was seen in significant association with immunoglobulin resistance in comparison to those without arthritis (16.7% vs. 0.2%, p=0.008). Next, the immunoglobulin brand types were divided into two groups: the relatively high pH group (n=16), including Carimune (pH 6.6±0.2), and the low pH group (n=63), including Gamunex (pH 4–4.5) or Privigen (pH 4.6–5). Overall, no significant difference in immunoglobulin responsiveness was found between the low pH and the high pH groups (73% vs. 56%, p=0.193), although the low pH group showed a trend toward a larger decrease in erythrocyte sedimentation rate (p=0.048), lower steroid use (p=0.054), and lower coronary involvement (p=0.08) than those in the high pH group. Conclusions: Children presenting with arthritis in the acute phase of Kawasaki disease may be at risk for immunoglobulin resistance. PMID:25852966

  5. Stress factors in affective diseases.

    PubMed

    Bidzińska, E J

    1984-02-01

    An investigation carried out on 97 patients with affective disorders and on 100 healthy control subjects, revealed that acute and chronic stress factors occurred more in the group of patients with affective disorders than among healthy control over a similar time period. The frequency of stressful life situations was the same before the first affective episode in patients with unipolar and bipolar illness. The possible participation of such factors in triggering the first phase of illness is discussed. Similar factors appeared in both types of affective disorders. Significantly more frequent among patients than in the control group were: marital and family conflicts, health problems, emotional and ambitional failures, lack of success and work overload.

  6. Affective cycling in thyroid disease

    SciTech Connect

    Tapp, A.

    1988-05-01

    Depression in an elderly man with primary recurrent unipolar depression responded to radioactive iodine treatment of a thyrotoxic nodule, without the addition of psychotropic medications. Two months later, manic symptoms developed concomitant with the termination of the hyperthyroid state secondary to the radioactive iodine treatment. Clinical implications of these findings in relation to the possible mechanism of action of thyroid hormones on affective cycling are discussed.

  7. Insulin Resistance and Skin Diseases

    PubMed Central

    Napolitano, Maddalena; Megna, Matteo; Monfrecola, Giuseppe

    2015-01-01

    In medical practice, almost every clinician may encounter patients with skin disease. However, it is not always easy for physicians of all specialties to face the daily task of determining the nature and clinical implication of dermatologic manifestations. Are they confined to the skin, representing a pure dermatologic event? Or are they also markers of internal conditions relating to the patient's overall health? In this review, we will discuss the principal cutaneous conditions which have been linked to metabolic alterations. Particularly, since insulin has an important role in homeostasis and physiology of the skin, we will focus on the relationships between insulin resistance (IR) and skin diseases, analyzing strongly IR-associated conditions such as acanthosis nigricans, acne, and psoriasis, without neglecting emerging and potential scenarios as the ones represented by hidradenitis suppurativa, androgenetic alopecia, and hirsutism. PMID:25977937

  8. Diabetes prevention: Reproductive age women affected by insulin resistance.

    PubMed

    Rezai, Shadi; LoBue, Stephen; Henderson, Cassandra E

    2016-07-01

    In the United States, 29.1 million people are affected by diabetes, of which 95% have type 2 diabetes. There has been a fivefold increase in type 2 diabetes in the latter half of the 20th century, an increase strongly linked to the obesity epidemic in the United States. In addition, insulin resistance affects 86 million Americans, or more than one-third of the adult population, as manifested by impaired fasting glucose tolerance with random glucose values ranging from ⩾100 to <126 mg/dL. In all, 90% of those affected by impaired fasting glucose tolerance or pre-diabetes are unaware of their metabolic derangement. Although impaired fasting glucose tolerance increases one's risk of developing type 2 diabetes, once identified, application of lifestyle changes by affected individuals may avoid or delay the onset of type 2 diabetes. For reproductive age women who are found to have impaired fasting glucose tolerance, lifestyle changes may be an effective tool to diminish the reproductive health consequences of insulin resistance related diseases. PMID:27638898

  9. Everolimus affects vasculogenic mimicry in renal carcinoma resistant to sunitinib.

    PubMed

    Serova, Maria; Tijeras-Raballand, Annemilaï; Dos Santos, Celia; Martinet, Matthieu; Neuzillet, Cindy; Lopez, Alfred; Mitchell, Dianne C; Bryan, Brad A; Gapihan, Guillaume; Janin, Anne; Bousquet, Guilhem; Riveiro, Maria Eugenia; Bieche, Ivan; Faivre, Sandrine; Raymond, Eric; de Gramont, Armand

    2016-06-21

    Angiogenesis is hallmark of clear cell renal cell carcinogenesis. Anti-angiogenic therapies have been successful in improving disease outcome; however, most patients treated with anti-angiogenic agents will eventually progress. In this study we report that clear cell renal cell carcinoma was associated with vasculogenic mimicry in both mice and human with tumor cells expressing endothelial markers in the vicinity of tumor vessels. We show that vasculogenic mimicry was efficiently targeted by sunitinib but eventually associated with tumor resistance and a more aggressive phenotype both in vitro and in vivo. Re-challenging these resistant tumors in mice, we showed that second-line treatment with everolimus particularly affected vasculogenic mimicry and tumor cell differentiation compared to sorafenib and axitinib. Finally, our results highlighted the phenotypic and genotypic changes at the tumor cell and microenvironment levels during sunitinib response and progression and the subsequent improvement second-line therapies bring to the current renal cell carcinoma treatment paradigm. PMID:27509260

  10. Detection and validation of QTL affecting bacterial cold water disease resistance in rainbow trout using restriction-site associated DNA sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial cold water disease (BCWD) causes significant economic loss in salmonid aquaculture. Using microsatellites genome scan we have previously detected significant and suggestive QTL with major effects on the phenotypic variation of survival following challenge with Flavobacterium psychrophilum...

  11. Spatial variation in disease resistance: from molecules to metapopulations

    PubMed Central

    Laine, Anna-Liisa; Burdon, Jeremy J.; Dodds, Peter N.; Thrall, Peter H.

    2010-01-01

    Summary Variation in disease resistance is a widespread phenomenon in wild plant-pathogen associations. Here, we review current literature on natural plant-pathogen associations to determine how diversity in disease resistance is distributed at different hierarchical levels – within host individuals, within host populations, among host populations at the metapopulation scale and at larger regional scales. We find diversity in resistance across all spatial scales examined. Furthermore, variability seems to be the best counter-defence of plants against their rapidly evolving pathogens. We find that higher diversity of resistance phenotypes also results in higher levels of resistance at the population level. Overall, we find that wild plant populations are more likely to be susceptible than resistant to their pathogens. However, the degree of resistance differs strikingly depending on the origin of the pathogen strains used in experimental inoculation studies. Plant populations are on average 16% more resistant to allopatric pathogen strains than they are to strains that occur within the same population (48 % vs. 32 % respectively). Pathogen dispersal mode affects levels of resistance in natural plant populations with lowest levels detected for hosts of airborne pathogens and highest for waterborne pathogens. Detailed analysis of two model systems, Linum marginale infected by Melampsora lini, and Plantago lanceolata infected by Podosphaera plantaginis, show that the amount of variation in disease resistance declines towards higher spatial scales as we move from individual hosts to metapopulations, but evaluation of multiple spatial scales is needed to fully capture the structure of disease resistance. Synthesis: Variation in disease resistance is ubiquitous in wild plant-pathogen associations. While the debate over whether the resistance structure of plant populations is determined by pathogen-imposed selection versus non-adaptive processes remains unresolved, we do

  12. Cotton GhMKK5 affects disease resistance, induces HR-like cell death, and reduces the tolerance to salt and drought stress in transgenic Nicotiana benthamiana.

    PubMed

    Zhang, Liang; Li, Yuzhen; Lu, Wenjing; Meng, Fei; Wu, Chang-ai; Guo, Xingqi

    2012-06-01

    Mitogen-activated protein kinase (MAPK) cascades are involved in various processes from plant growth and development to biotic and abiotic stress responses. MAPK kinases (MAPKKs), which link MAPKs and MAPKK kinases (MAPKKKs), play crucial roles in MAPK cascades to mediate a variety of stress responses in plants. However, few MAPKKs have been functionally characterized in cotton (Gossypium hirsutum). In this study, a novel gene, GhMKK5, from cotton belonging to the group C MAPKKs was isolated and characterized. The expression of GhMKK5 can be induced by pathogen infection, abiotic stresses, and multiple defence-related signal molecules. The overexpression of GhMKK5 in Nicotiana benthamiana enhanced the plants' resistance to the bacterial pathogen Ralstonia solanacearum by elevating the expression of pathogen resistance (PR) genes, including PR1a, PR2, PR4, PR5, and NPR1, but increased the plants' sensitivity to the oomycete pathogen Phytophthora parasitica var. nicotianae Tucker. Importantly, GhMKK5-overexpressing plants displayed markedly elevated expression of reactive oxygen species-related and cell death marker genes, such as NtRbohA and NtCDM, and resulted in hypersensitive response (HR)-like cell death characterized by the accumulation of H(2)O(2). Furthermore, it was demonstrated that GhMKK5 overexpression in plants reduced their tolerance to salt and drought stresses, as determined by statistical analysis of seed germination, root length, leaf water loss, and survival rate. Drought obviously accelerated the cell death phenomenon in GhMKK5-overexpressing plants. These results suggest that GhMKK5 may play an important role in pathogen infection and the regulation of the salt and drought stress responses in plants.

  13. Rainbow trout (Oncorhynchus mykiss) resistance to columnaris disease is heritable and favorably correlated with bacterial cold water disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Columnaris disease (CD), caused by Flabobacterium columnare, is an emerging disease affecting rainbow trout aquaculture. Objectives of this study were to 1) estimate heritability of innate CD resistance in a rainbow trout line (ARS-Fp-R) previously selected four generations for improved bacterial co...

  14. Disease resistance: Molecular mechanisms and biotechnological applications

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This special issue “Disease resistance: molecular mechanisms and biotechnological applications” contains 11 review articles and four original research papers. Research in the area of engineering for disease resistance continues to progress although only 10% of the transgenic plants registered for ...

  15. Natural Disease Resistance in Threatened Staghorn Corals

    PubMed Central

    Vollmer, Steven V.; Kline, David I.

    2008-01-01

    Disease epidemics have caused extensive damage to tropical coral reefs and to the reef-building corals themselves, yet nothing is known about the abilities of the coral host to resist disease infection. Understanding the potential for natural disease resistance in corals is critically important, especially in the Caribbean where the two ecologically dominant shallow-water corals, Acropora cervicornis and A. palmata, have suffered an unprecedented mass die-off due to White Band Disease (WBD), and are now listed as threatened under the US Threatened Species Act and as critically endangered under the IUCN Red List criteria. Here we examine the potential for natural resistance to WBD in the staghorn coral Acropora cervicornis by combining microsatellite genotype information with in situ transmission assays and field monitoring of WBD on tagged genotypes. We show that six percent of staghorn coral genotypes (3 out of 49) are resistant to WBD. This natural resistance to WBD in staghorn corals represents the first evidence of host disease resistance in scleractinian corals and demonstrates that staghorn corals have an innate ability to resist WBD infection. These resistant staghorn coral genotypes may explain why pockets of Acropora have been able to survive the WBD epidemic. Understanding disease resistance in these corals may be the critical link to restoring populations of these once dominant corals throughout their range. PMID:19005565

  16. Natural disease resistance in threatened staghorn corals.

    PubMed

    Vollmer, Steven V; Kline, David I

    2008-01-01

    Disease epidemics have caused extensive damage to tropical coral reefs and to the reef-building corals themselves, yet nothing is known about the abilities of the coral host to resist disease infection. Understanding the potential for natural disease resistance in corals is critically important, especially in the Caribbean where the two ecologically dominant shallow-water corals, Acropora cervicornis and A. palmata, have suffered an unprecedented mass die-off due to White Band Disease (WBD), and are now listed as threatened under the US Threatened Species Act and as critically endangered under the IUCN Red List criteria. Here we examine the potential for natural resistance to WBD in the staghorn coral Acropora cervicornis by combining microsatellite genotype information with in situ transmission assays and field monitoring of WBD on tagged genotypes. We show that six percent of staghorn coral genotypes (3 out of 49) are resistant to WBD. This natural resistance to WBD in staghorn corals represents the first evidence of host disease resistance in scleractinian corals and demonstrates that staghorn corals have an innate ability to resist WBD infection. These resistant staghorn coral genotypes may explain why pockets of Acropora have been able to survive the WBD epidemic. Understanding disease resistance in these corals may be the critical link to restoring populations of these once dominant corals throughout their range.

  17. Teaching the Factors Affecting Resistance Using Pencil Leads

    NASA Astrophysics Data System (ADS)

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A). Additionally, the resistance depends on the type of conductor. Resistance R can be thus be expressed as R = ρL/A, where ρ is the resistivity of the conductor.

  18. Resistance to Foliar Diseases in Rosa sp

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fifty cultivars of roses were evaluated for disease resistance to black spot and Cercospora leaf spot. Many rose cultivars were susceptibe to black spot, Cercospora leaf spot, or both. Six cultivars that were highly resistant to Cercospora leaf spot were susceptible to black spot (Belinda's Dream, M...

  19. Teaching the Factors Affecting Resistance Using Pencil Leads

    ERIC Educational Resources Information Center

    Küçüközer, Asuman

    2015-01-01

    The aim of this paper is to provide a way of teaching the factors that affect resistance using mechanical pencil leads and the brightness of the light given out by a light bulb connected to an electrical circuit. The resistance of a conductor is directly proportional to its length (L) and inversely proportional to its cross-sectional area (A).…

  20. Disease Resistance Gene Analogs (RGAs) in Plants

    PubMed Central

    Sekhwal, Manoj Kumar; Li, Pingchuan; Lam, Irene; Wang, Xiue; Cloutier, Sylvie; You, Frank M.

    2015-01-01

    Plants have developed effective mechanisms to recognize and respond to infections caused by pathogens. Plant resistance gene analogs (RGAs), as resistance (R) gene candidates, have conserved domains and motifs that play specific roles in pathogens’ resistance. Well-known RGAs are nucleotide binding site leucine rich repeats, receptor like kinases, and receptor like proteins. Others include pentatricopeptide repeats and apoplastic peroxidases. RGAs can be detected using bioinformatics tools based on their conserved structural features. Thousands of RGAs have been identified from sequenced plant genomes. High-density genome-wide RGA genetic maps are useful for designing diagnostic markers and identifying quantitative trait loci (QTL) or markers associated with plant disease resistance. This review focuses on recent advances in structures and mechanisms of RGAs, and their identification from sequenced genomes using bioinformatics tools. Applications in enhancing fine mapping and cloning of plant disease resistance genes are also discussed. PMID:26287177

  1. Disease Resistance Gene Analogs (RGAs) in Plants.

    PubMed

    Sekhwal, Manoj Kumar; Li, Pingchuan; Lam, Irene; Wang, Xiue; Cloutier, Sylvie; You, Frank M

    2015-01-01

    Plants have developed effective mechanisms to recognize and respond to infections caused by pathogens. Plant resistance gene analogs (RGAs), as resistance (R) gene candidates, have conserved domains and motifs that play specific roles in pathogens' resistance. Well-known RGAs are nucleotide binding site leucine rich repeats, receptor like kinases, and receptor like proteins. Others include pentatricopeptide repeats and apoplastic peroxidases. RGAs can be detected using bioinformatics tools based on their conserved structural features. Thousands of RGAs have been identified from sequenced plant genomes. High-density genome-wide RGA genetic maps are useful for designing diagnostic markers and identifying quantitative trait loci (QTL) or markers associated with plant disease resistance. This review focuses on recent advances in structures and mechanisms of RGAs, and their identification from sequenced genomes using bioinformatics tools. Applications in enhancing fine mapping and cloning of plant disease resistance genes are also discussed.

  2. Improved genetic disease resistance solutions for potato

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Halterman Lab research program is focused on understanding the genetic basis of disease resistance in potato. Several diseases, such as late blight, early blight, potato virus Y, and verticillium wilt, are particularly problematic in Wisconsin. With the exception of early blight, major genes hav...

  3. Does natural variation in diversity affect biotic resistance?

    USGS Publications Warehouse

    Harrison, Susan; Cornell, Howard; Grace, James B.

    2015-01-01

    Theories linking diversity to ecosystem function have been challenged by the widespread observation of more exotic species in more diverse native communities. Few studies have addressed the key underlying process by dissecting how community diversity is shaped by the same environmental gradients that determine biotic and abiotic resistance to new invaders. In grasslands on highly heterogeneous soils, we used addition of a recent invader, competitor removal and structural equation modelling (SEM) to analyse soil influences on community diversity, biotic and abiotic resistance and invader success. Biotic resistance, measured by reduction in invader success in the presence of the resident community, was negatively correlated with species richness and functional diversity. However, in the multivariate SEM framework, biotic resistance was independent of all forms of diversity and was positively affected by soil fertility via community biomass. Abiotic resistance, measured by invader success in the absence of the resident community, peaked on infertile soils with low biomass and high community diversity. Net invader success was determined by biotic resistance, consistent with this invader's better performance on infertile soils in unmanipulated conditions. Seed predation added slightly to biotic resistance without qualitatively changing the results. Soil-related genotypic variation in the invader also did not affect the results. Synthesis. In natural systems, diversity may be correlated with invasibility and yet have no effect on either biotic or abiotic resistance to invasion. More generally, the environmental causes of variation in diversity should not be overlooked when considering the potential functional consequences of diversity.

  4. Degenerative disease affecting the nervous system.

    PubMed

    Eadie, M J

    1974-03-01

    The term "degenerative disease" is one which is rather widely used in relation to the nervous system and yet one which is rarely formally and carefully defined. The term appears to be applied to disorders of the nervous system which often occur in later life and which are of uncertain cause. In the Shorter Oxford Dictionary the word degeneration is defined as "a change of structure by which an organism, or an organ, assumes the form of a lower type". However this is not quite the sense in which the word is applied in human neuropathology, where it is conventional to restrict the use of the word to those organic disorders which are of uncertain or poorly understood cause and in which there is a deterioration or regression in the level of functioning of the nervous system. The concept of degenerative disorder is applied to other organs as well as to the brain, and as disease elsewhere in the body may affect the nervous system, it seems reasonable to include within the topic of degenerative disorder affecting the nervous system those conditions in which the nervous system is involved as a result of primary degenerations in other parts of the body. PMID:25026144

  5. Degenerative disease affecting the nervous system.

    PubMed

    Eadie, M J

    1974-03-01

    The term "degenerative disease" is one which is rather widely used in relation to the nervous system and yet one which is rarely formally and carefully defined. The term appears to be applied to disorders of the nervous system which often occur in later life and which are of uncertain cause. In the Shorter Oxford Dictionary the word degeneration is defined as "a change of structure by which an organism, or an organ, assumes the form of a lower type". However this is not quite the sense in which the word is applied in human neuropathology, where it is conventional to restrict the use of the word to those organic disorders which are of uncertain or poorly understood cause and in which there is a deterioration or regression in the level of functioning of the nervous system. The concept of degenerative disorder is applied to other organs as well as to the brain, and as disease elsewhere in the body may affect the nervous system, it seems reasonable to include within the topic of degenerative disorder affecting the nervous system those conditions in which the nervous system is involved as a result of primary degenerations in other parts of the body.

  6. Elevating crop disease resistance with cloned genes.

    PubMed

    Jones, Jonathan D G; Witek, Kamil; Verweij, Walter; Jupe, Florian; Cooke, David; Dorling, Stephen; Tomlinson, Laurence; Smoker, Matthew; Perkins, Sara; Foster, Simon

    2014-04-01

    Essentially all plant species exhibit heritable genetic variation for resistance to a variety of plant diseases caused by fungi, bacteria, oomycetes or viruses. Disease losses in crop monocultures are already significant, and would be greater but for applications of disease-controlling agrichemicals. For sustainable intensification of crop production, we argue that disease control should as far as possible be achieved using genetics rather than using costly recurrent chemical sprays. The latter imply CO₂ emissions from diesel fuel and potential soil compaction from tractor journeys. Great progress has been made in the past 25 years in our understanding of the molecular basis of plant disease resistance mechanisms, and of how pathogens circumvent them. These insights can inform more sophisticated approaches to elevating disease resistance in crops that help us tip the evolutionary balance in favour of the crop and away from the pathogen. We illustrate this theme with an account of a genetically modified (GM) blight-resistant potato trial in Norwich, using the Rpi-vnt1.1 gene isolated from a wild relative of potato, Solanum venturii, and introduced by GM methods into the potato variety Desiree. PMID:24535396

  7. Elevating crop disease resistance with cloned genes

    PubMed Central

    Jones, Jonathan D. G.; Witek, Kamil; Verweij, Walter; Jupe, Florian; Cooke, David; Dorling, Stephen; Tomlinson, Laurence; Smoker, Matthew; Perkins, Sara; Foster, Simon

    2014-01-01

    Essentially all plant species exhibit heritable genetic variation for resistance to a variety of plant diseases caused by fungi, bacteria, oomycetes or viruses. Disease losses in crop monocultures are already significant, and would be greater but for applications of disease-controlling agrichemicals. For sustainable intensification of crop production, we argue that disease control should as far as possible be achieved using genetics rather than using costly recurrent chemical sprays. The latter imply CO2 emissions from diesel fuel and potential soil compaction from tractor journeys. Great progress has been made in the past 25 years in our understanding of the molecular basis of plant disease resistance mechanisms, and of how pathogens circumvent them. These insights can inform more sophisticated approaches to elevating disease resistance in crops that help us tip the evolutionary balance in favour of the crop and away from the pathogen. We illustrate this theme with an account of a genetically modified (GM) blight-resistant potato trial in Norwich, using the Rpi-vnt1.1 gene isolated from a wild relative of potato, Solanum venturii, and introduced by GM methods into the potato variety Desiree. PMID:24535396

  8. How could preventive therapy affect the prevalence of drug resistance? Causes and consequences

    PubMed Central

    Kunkel, Amber; Colijn, Caroline; Lipsitch, Marc; Cohen, Ted

    2015-01-01

    Various forms of preventive and prophylactic antimicrobial therapies have been proposed to combat HIV (e.g. pre-exposure prophylaxis), tuberculosis (e.g. isoniazid preventive therapy) and malaria (e.g. intermittent preventive treatment). However, the potential population-level effects of preventative therapy (PT) on the prevalence of drug resistance are not well understood. PT can directly affect the rate at which resistance is acquired among those receiving PT. It can also indirectly affect resistance by altering the rate at which resistance is acquired through treatment for active disease and by modifying the level of competition between transmission of drug-resistant and drug-sensitive pathogens. We propose a general mathematical model to explore the ways in which PT can affect the long-term prevalence of drug resistance. Depending on the relative contributions of these three mechanisms, we find that increasing the level of coverage of PT may result in increases, decreases or non-monotonic changes in the overall prevalence of drug resistance. These results demonstrate the complexity of the relationship between PT and drug resistance in the population. Care should be taken when predicting population-level changes in drug resistance from small pilot studies of PT or estimates based solely on its direct effects. PMID:25918446

  9. How could preventive therapy affect the prevalence of drug resistance? Causes and consequences.

    PubMed

    Kunkel, Amber; Colijn, Caroline; Lipsitch, Marc; Cohen, Ted

    2015-06-01

    Various forms of preventive and prophylactic antimicrobial therapies have been proposed to combat HIV (e.g. pre-exposure prophylaxis), tuberculosis (e.g. isoniazid preventive therapy) and malaria (e.g. intermittent preventive treatment). However, the potential population-level effects of preventative therapy (PT) on the prevalence of drug resistance are not well understood. PT can directly affect the rate at which resistance is acquired among those receiving PT. It can also indirectly affect resistance by altering the rate at which resistance is acquired through treatment for active disease and by modifying the level of competition between transmission of drug-resistant and drug-sensitive pathogens. We propose a general mathematical model to explore the ways in which PT can affect the long-term prevalence of drug resistance. Depending on the relative contributions of these three mechanisms, we find that increasing the level of coverage of PT may result in increases, decreases or non-monotonic changes in the overall prevalence of drug resistance. These results demonstrate the complexity of the relationship between PT and drug resistance in the population. Care should be taken when predicting population-level changes in drug resistance from small pilot studies of PT or estimates based solely on its direct effects.

  10. Enhancing Plant Disease Resistance without R Genes.

    PubMed

    Sarma, Birinchi Kumar; Singh, Harikesh Bahadur; Fernando, Dilantha; Silva, Roberto Nascimento; Gupta, Vijai Kumar

    2016-07-01

    Crop plants encounter constant biotic challenges, and these challenges have historically been best managed with resistance (R) genes. However, the rapid evolution of new pathogenic strains along with the nonavailability or nonidentification of R genes in cultivated crop species against a large number of plant pathogens have led researchers to think beyond R genes. Biotechnological tools have shown promise in dealing with such challenges. Technologies such as transgenerational plant immunity, interspecies transfer of pattern recognition receptors (PRRs), pathogen-derived resistance (PDR), gene regulation, and expression of antimicrobial peptides (AMPs) in host plants from other plant species have led to enhanced disease resistance and increased food security. PMID:27113633

  11. Nationwide Surveillance of Azole Resistance in Aspergillus Diseases.

    PubMed

    Vermeulen, Edith; Maertens, Johan; De Bel, Annelies; Nulens, Eric; Boelens, Jerina; Surmont, Ignace; Mertens, Anna; Boel, An; Lagrou, Katrien

    2015-08-01

    Aspergillus disease affects a broad patient population, from patients with asthma to immunocompromised patients. Azole resistance has been increasingly reported in both clinical and environmental Aspergillus strains. The prevalence and clinical impact of azole resistance in different patient populations are currently unclear. This 1-year prospective multicenter cohort study aimed to provide detailed epidemiological data on Aspergillus resistance among patients with Aspergillus disease in Belgium. Isolates were prospectively collected in 18 hospitals (April 2011 to April 2012) for susceptibility testing. Clinical and treatment data were collected with a questionnaire. The outcome was evaluated to 1 year after a patient's inclusion. A total of 220 Aspergillus isolates from 182 patients were included. The underlying conditions included invasive aspergillosis (n = 122 patients), allergic bronchopulmonary aspergillosis (APBA) (n = 39 patients), chronic pulmonary aspergillosis (n = 10 patients), Aspergillus bronchitis (n = 7 patients), and aspergilloma (n = 5 patients). The overall azole resistance prevalence was 5.5% (95% confidence interval [CI] 2.8 to 10.2%) and was 7.0% (4/57; 95% CI, 2.3 to 17.2%) in patients with APBA, bronchitis, aspergilloma, or chronic aspergillosis and 4.6% in patients with invasive aspergillosis (5/108; 95% CI, 1.7 to 10.7%). The 6-week survival in invasive aspergillosis was 52.5%, while susceptibility testing revealed azole resistance in only 2/58 of the deceased patients. The clinical impact of Aspergillus fumigatus resistance was limited in our patient population with Aspergillus diseases.

  12. Developing disease resistance in CP-Cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Disease resistance is an important selection criterion in the Canal Point (CP) Sugarcane Cultivar Development Program. Ratoon stunt (RSD, caused by Leifsonia xyli subsp. Xyli Evtsuhenko et al.), leaf scald (caused by Xanthomonas albilineans Ashby, Dowson), mosaic (caused by Sugarcane mosaic virus st...

  13. Epidemiology of columnaris disease affecting fishes within the same watershed.

    PubMed

    Mohammed, Haitham H; Arias, Covadonga R

    2014-07-01

    In the southeastern USA, columnaris disease (caused by Flavobacterium columnare) typically affects catfish raised in earthen ponds from early spring until late summer. Recently, unusually severe outbreaks of columnaris disease occurred at the E. W. Shell Fisheries Center located in Auburn, AL, USA. During these outbreaks, catfish and other aquaculture and sport fish species that were in ponds located within the same watershed were affected. Our objective was to investigate the genetic diversity among F. columnare isolates recovered from different sites, sources, and dates to clarify the origin of these outbreaks and, ultimately, to better understand the epidemiology of columnaris disease. A total of 102 F. columnare isolates were recovered from catfishes (channel catfish Ictalurus puntactus, blue catfish I. furcatus, and their hybrid), bluegill Lepomis microchirus, Nile tilapia Oreochromis niloticus, largemouth bass Micropterus salmoides, egg masses, and water during columnaris outbreaks (from spring 2010 to summer 2012). Putative F. columnare colonies were identified following standard protocols. All isolates were ascribed to Genomovar II following restriction fragment length polymorphism analysis of the 16S rRNA gene. Genetic variability among the isolates was revealed by amplified fragment length polymorphism. Date of isolation explained most of the variability among our isolates, while host was the least influential parameter, denoting a lack of host specificity within Genomovar II isolates. The susceptibility of each of the isolates against commonly used antibiotics was tested by antibiogram. Our data showed that 19.6 and 12.7% of the isolates were resistant to oxytetracycline and kanamycin, respectively. PMID:24991846

  14. Nutritional modulation of resistance to infectious diseases.

    PubMed

    Klasing, K C

    1998-08-01

    Dietary characteristics can modulate a bird's susceptibility to infectious challenges and subtle influences due to the level of nutrients or the types of ingredients may at times be of critical importance. This review considers seven mechanisms for nutritional modulation of resistance to infectious disease in poultry. 1) Nutrition may impact the development of the immune system, both in ovo and in the first weeks posthatch. Micronutrient deficiencies that affect developmental events, such as the seeding of lymphoid organs and clonal expansion of lymphocyte clones, can negatively impact the immune system later in life. 2) A substrate role of nutrients is necessary for the immune response so that responding cells can divide and synthesize effector molecules. The quantitative need for nutrients for supporting a normal immune system, as well as the proliferation of leukocytes and the production of antibodies during an infectious challenge, is very small relative to uses for growth or egg production. It is likely that the systemic acute phase response that accompanies most infectious challenges is a more significant consumer of nutrients than the immune system itself. 3) The low concentration of some nutrients (e.g., iron) in body fluids makes them the limiting substrates for the proliferation of invading pathogens and the supply of these nutrients is further limited during the immune response. 4) Some nutrients (e.g., fatty acids and vitamins A, D, and E) have direct regulatory actions on leukocytes by binding to intracellular receptors or by modifying the release of second messengers. 5) The diet may also have indirect regulatory effects that are mediated by the classical endocrine system. 6) Physical and chemical aspects of the diet can modify the populations of microorganisms in the gastrointestinal tract, the capacity of pathogens to attach to enterocytes, and the integrity of the intestinal epithelium.

  15. Treatment of affective disorders in cardiac disease.

    PubMed

    Mavrides, Nicole; Nemeroff, Charles B

    2015-06-01

    Patients with cardiovascular disease (CVD) commonly have syndromal major depression, and depression has been associated with an increased risk of morbidity and mortality. Prevalence of depression is between 17% and 47% in CVD patients. Pharmacologic and psychotherapeutic interventions have long been studied, and in general are safe and somewhat efficacious in decreasing depressive symptoms in patients with CVD. The impact on cardiac outcomes remains unclear. The evidence from randomized controlled clinical trials indicates that antidepressants, especially selective serotonin uptake inhibitors, are overwhelmingly safe, and likely to be effective in the treatment of depression in patients with CVD. This review describes the prevalence of depression in patients with CVD, the physiological links between depression and CVD, the treatment options for affective disorders, and the clinical trials that demonstrate efficacy and safety of antidepressant medications and psychotherapy in this patient population. Great progress has been made in understanding potential mediators between major depressive disorder and CVD--both health behaviors and shared biological risks such as inflammation.

  16. Development of disease-resistant rice using regulatory components of induced disease resistance

    PubMed Central

    Takatsuji, Hiroshi

    2014-01-01

    Infectious diseases cause huge crop losses annually. In response to pathogen attacks, plants activate defense systems that are mediated through various signaling pathways. The salicylic acid (SA) signaling pathway is the most powerful of these pathways. Several regulatory components of the SA signaling pathway have been identified, and are potential targets for genetic manipulation of plants’ disease resistance. However, the resistance associated with these regulatory components is often accompanied by fitness costs; that is, negative effects on plant growth and crop yield. Chemical defense inducers, such as benzothiadiazole and probenazole, act on the SA pathway and induce strong resistance to various pathogens without major fitness costs, owing to their ‘priming effect.’ Studies on how benzothiadiazole induces disease resistance in rice have identified WRKY45, a key transcription factor in the branched SA pathway, and OsNPR1/NH1. Rice plants overexpressing WRKY45 were extremely resistant to rice blast disease caused by the fungus Magnaporthe oryzae and bacterial leaf blight disease caused by Xanthomonas oryzae pv. oryzae (Xoo), the two major rice diseases. Disease resistance is often accompanied by fitness costs; however, WRKY45 overexpression imposed relatively small fitness costs on rice because of its priming effect. This priming effect was similar to that of chemical defense inducers, although the fitness costs were amplified by some environmental factors. WRKY45 is degraded by the ubiquitin–proteasome system, and the dual role of this degradation partly explains the priming effect. The synergistic interaction between SA and cytokinin signaling that activates WRKY45 also likely contributes to the priming effect. With a main focus on these studies, I review the current knowledge of SA-pathway-dependent defense in rice by comparing it with that in Arabidopsis, and discuss potential strategies to develop disease-resistant rice using signaling components

  17. Transgenic animals resistant to infectious diseases.

    PubMed

    Tiley, L

    2016-04-01

    The list of transgenic animals developed to test ways of producing livestock resistant to infectious disease continues to grow. Although the basic techniques for generating transgenic animals have not changed very much in the ten years since they were last reviewed for the World Organisation for Animal Health, one recent fundamental technological advance stands to revolutionise genome engineering. The advent of technically simple and efficient site-specific gene targeting has profound implications for genetically modifying livestock species.

  18. N-terminal motifs in some plant disease resistance proteins function in membrane attachment and contribute to disease resistance.

    PubMed

    Takemoto, Daigo; Rafiqi, Maryam; Hurley, Ursula; Lawrence, Greg J; Bernoux, Maud; Hardham, Adrienne R; Ellis, Jeffrey G; Dodds, Peter N; Jones, David A

    2012-03-01

    To investigate the role of N-terminal domains of plant disease resistance proteins in membrane targeting, the N termini of a number of Arabidopsis and flax disease resistance proteins were fused to green fluorescent protein (GFP) and the fusion proteins localized in planta using confocal microscopy. The N termini of the Arabidopsis RPP1-WsB and RPS5 resistance proteins and the PBS1 protein, which is required for RPS5 resistance, targeted GFP to the plasma membrane, and mutation of predicted myristoylation and potential palmitoylation sites resulted in a shift to nucleocytosolic localization. The N-terminal domain of the membrane-attached Arabidopsis RPS2 resistance protein was targeted incompletely to the plasma membrane. In contrast, the N-terminal domains of the Arabidopsis RPP1-WsA and flax L6 and M resistance proteins, which carry predicted signal anchors, were targeted to the endomembrane system, RPP1-WsA to the endoplasmic reticulum and the Golgi apparatus, L6 to the Golgi apparatus, and M to the tonoplast. Full-length L6 was also targeted to the Golgi apparatus. Site-directed mutagenesis of six nonconserved amino acid residues in the signal anchor domains of L6 and M was used to change the localization of the L6 N-terminal fusion protein to that of M and vice versa, showing that these residues control the targeting specificity of the signal anchor. Replacement of the signal anchor domain of L6 by that of M did not affect L6 protein accumulation or resistance against flax rust expressing AvrL567 but removal of the signal anchor domain reduced L6 protein accumulation and L6 resistance, suggesting that membrane attachment is required to stabilize the L6 protein.

  19. Exposure to Corticosterone Affects Host Resistance, but Not Tolerance, to an Emerging Fungal Pathogen

    PubMed Central

    Murone, Julie; DeMarchi, Joseph A.; Venesky, Matthew D.

    2016-01-01

    Host responses to pathogens include defenses that reduce infection burden (i.e., resistance) and traits that reduce the fitness consequences of an infection (i.e., tolerance). Resistance and tolerance are affected by an organism's physiological status. Corticosterone (“CORT”) is a hormone that is associated with the regulation of many physiological processes, including metabolism and reproduction. Because of its role in the stress response, CORT is also considered the primary vertebrate stress hormone. When secreted at high levels, CORT is generally thought to be immunosuppressive. Despite the known association between stress and disease resistance in domesticated organisms, it is unclear whether these associations are ecologically and evolutionary relevant in wildlife species. We conducted a 3x3 fully crossed experiment in which we exposed American toads (Anaxyrus [Bufo] americanus) to one of three levels of exogenous CORT (no CORT, low CORT, or high CORT) and then to either low or high doses of the pathogenic chytrid fungus Batrachochytrium dendrobatidis (“Bd”) or a sham exposure treatment. We assessed Bd infection levels and tested how CORT and Bd affected toad resistance, tolerance, and mortality. Exposure to the high CORT treatment significantly elevated CORT release in toads; however, there was no difference between toads given no CORT or low CORT. Exposure to CORT and Bd each increased toad mortality, but they did not interact to affect mortality. Toads that were exposed to CORT had higher Bd resistance than toads exposed to ethanol controls/low CORT, a pattern opposite that of most studies on domesticated animals. Exposure to CORT did not affect toad tolerance to Bd. Collectively, these results show that physiological stressors can alter a host’s response to a pathogen, but that the outcome might not be straightforward. Future studies that inhibit CORT secretion are needed to better our understanding of the relationship between stress physiology

  20. Partial aphid resistance in lettuce negatively affects parasitoids.

    PubMed

    Lanteigne, Marie-Eve; Brodeur, Jacques; Jenni, Sylvie; Boivin, Guy

    2014-10-01

    This study investigated the effects of partial plant resistance on the lettuce aphid Nasonovia ribisnigri (Mosley) (Hemiptera: Aphididae), a major pest of cultivated lettuce (Lactuca sativa L.), and one of its parasitoids, Aphidius ervi Haliday (Hymenoptera: Braconidae). Aphids were reared on susceptible (L. sativa variety Estival; S) or partially resistant (Lactuca serriola L. PI 491093; PR) lettuce, and next parasitized by A. ervi females. Fitness proxies were measured for both aphids and parasitoids. Developmental time to adult stage took longer for alate and apterous aphids (an average of 3.5 and 1.5 additional days, respectively) on PR than on S lettuce, and fecundity of alate aphids reared on PR lettuce was reduced by 37.8% relative to those reared on S lettuce. Size (tibia length) and weight of aphids reared on PR lettuce were lower than for aphids reared on S lettuce from the third and second instar onward, respectively. Parasitism of aphids reared on PR plants resulted in lower parasitoid offspring emergence (-49.9%), lower adult female (-30.3%) and male (-27.5%) weight, smaller adult female (-17.5%) and male (-11.9%) size, and lower female fecundity (37.8% fewer eggs) than when parasitoids developed from aphids reared on S plants. Our results demonstrate that partial aphid resistance in lettuce negatively affects both the second and third trophic levels. Host plant resistance in cultivated lettuce may therefore create an ecological sink for aphid parasitoids. PMID:25197882

  1. Partial aphid resistance in lettuce negatively affects parasitoids.

    PubMed

    Lanteigne, Marie-Eve; Brodeur, Jacques; Jenni, Sylvie; Boivin, Guy

    2014-10-01

    This study investigated the effects of partial plant resistance on the lettuce aphid Nasonovia ribisnigri (Mosley) (Hemiptera: Aphididae), a major pest of cultivated lettuce (Lactuca sativa L.), and one of its parasitoids, Aphidius ervi Haliday (Hymenoptera: Braconidae). Aphids were reared on susceptible (L. sativa variety Estival; S) or partially resistant (Lactuca serriola L. PI 491093; PR) lettuce, and next parasitized by A. ervi females. Fitness proxies were measured for both aphids and parasitoids. Developmental time to adult stage took longer for alate and apterous aphids (an average of 3.5 and 1.5 additional days, respectively) on PR than on S lettuce, and fecundity of alate aphids reared on PR lettuce was reduced by 37.8% relative to those reared on S lettuce. Size (tibia length) and weight of aphids reared on PR lettuce were lower than for aphids reared on S lettuce from the third and second instar onward, respectively. Parasitism of aphids reared on PR plants resulted in lower parasitoid offspring emergence (-49.9%), lower adult female (-30.3%) and male (-27.5%) weight, smaller adult female (-17.5%) and male (-11.9%) size, and lower female fecundity (37.8% fewer eggs) than when parasitoids developed from aphids reared on S plants. Our results demonstrate that partial aphid resistance in lettuce negatively affects both the second and third trophic levels. Host plant resistance in cultivated lettuce may therefore create an ecological sink for aphid parasitoids.

  2. Genetic improvement for disease resistance in oysters: A review.

    PubMed

    Dégremont, Lionel; Garcia, Céline; Allen, Standish K

    2015-10-01

    Oyster species suffer from numerous disease outbreaks, often causing high mortality. Because the environment cannot be controlled, genetic improvement for disease resistance to pathogens is an attractive option to reduce their impact on oyster production. We review the literature on selective breeding programs for disease resistance in oyster species, and the impact of triploidy on such resistance. Significant response to selection to improve disease resistance was observed in all studies after two to four generations of selection for Haplosporidium nelsoni and Roseovarius crassostrea in Crassostrea virginica, OsHV-1 in Crassostrea gigas, and Martelia sydneyi in Saccostrea glomerata. Clearly, resistance in these cases was heritable, but most of the studies failed to provide estimates for heritability or genetic correlations with other traits, e.g., between resistance to one disease and another. Generally, it seems breeding for higher resistance to one disease does not confer higher resistance or susceptibility to another disease. For disease resistance in triploid oysters, several studies showed that triploidy confers neither advantage nor disadvantage in survival, e.g., OsHV-1 resistance in C. gigas. Other studies showed higher disease resistance of triploids over diploid as observed in C. virginica and S. glomerata. One indirect mechanism for triploids to avoid disease was to grow faster, thus limiting the span of time when oysters might be exposed to disease. PMID:26037230

  3. Transposon tagging of disease resistance genes

    SciTech Connect

    Michelmore, R.W. . Dept. of Physics)

    1989-01-01

    We are developing a transposon mutagenesis system for lettuce to clone genes for resistance to the fungal pathogen, Bremia lactucae. Activity of heterologous transposons is being studied in transgenic plants. Southern analysis of T{sub 1} and T{sub 2} plants containing Tam3 from Antirrhinum provided ambiguous results. Multiple endonuclease digests indicated that transposition had occurred; however, in no plant were all endonuclease digests consistent with a simple excision event. Southern or PCR analysis of over 50 plans containing Ac from maize have also failed to reveal clear evidence of transposition; this is contrast to experiments by others with the same constructs who have observed high rates of Ac excision in other plant species. Nearly all of 65 T{sub 2} families containing Ac interrupting a chimeric streptomycin resistance gene (Courtesy J. Jones, Sainsbury Lab., UK) clearly segregated for streptomycin resistance. Southern analyses, however, showed no evidence of transposition, indicating restoration of a functional message by other mechanisms, possibly mRNA processing. Transgenic plants have also been generated containing CaMV 35S or hsp70 promoters fused to transposase coding sequences or a Ds element interrupting a chimeric GUS gene (Courtesy M. Lassner, UC Davis). F{sub 1} plants containing both constructs were analyzed for transposition. Only two plants containing both constructs were obtained from 48 progeny, far fewer than expected, and neither showed evidence of transposition in Southerns and GUS assays. We are currently constructing further chimeric transposase fusions. To test for the stability of the targeted disease resistance genes, 50,000 F{sub 1} plants heterozygous for three resistance genes were generated; no mutants have been identified in the 5000 so far screened.

  4. High Strength Stainless Steel Properties that Affect Resistance Welding

    SciTech Connect

    Kanne, W.R.

    2001-08-01

    This report discusses results of a study on selected high strength stainless steel alloy properties that affect resistance welding. The austenitic alloys A-286, JBK-75 (Modified A-286), 21-6-9, 22-13-5, 316 and 304L were investigated and compared. The former two are age hardenable, and the latter four obtain their strength through work hardening. Properties investigated include corrosion and its relationship to chemical cleaning, the effects of heat treatment on strength and surface condition, and the effect of mechanical properties on strength and weldability.

  5. Rainbow trout (Oncorhynchus mykiss) resistance to columnaris disease is heritable and favorably correlated with bacterial cold water disease resistance.

    PubMed

    Evenhuis, J P; Leeds, T D; Marancik, D P; LaPatra, S E; Wiens, G D

    2015-04-01

    Columnaris disease (CD), caused by Flavobacterium columnare, is an emerging disease affecting rainbow trout aquaculture. Objectives of this study were to 1) estimate heritability of CD resistance in a rainbow trout line (ARS-Fp-R) previously selected 4 generations for improved bacterial cold water disease (BCWD) resistance; 2) estimate genetic correlations among CD resistance, BCWD resistance, and growth to market BW; and 3) compare CD resistance among the ARS-Fp-R, ARS-Fp-S (selected 1 generation for increased BCWD susceptibility), and ARS-Fp-C (selection control) lines. Heritability of CD resistance was estimated using data from a waterborne challenge of 44 full-sib ARS-Fp-R families produced using a paternal half-sib mating design, and genetic correlations were estimated using these data and 5 generations of BCWD resistance, 9-mo BW (approximately 0.5 kg), and 12-mo BW (approximately 1.0 kg) data from 405 ARS-Fp-R full-sib families. The CD and BCWD challenges were initiated at approximately 52 and 84 d posthatch, or approximately 650 and 1,050 degree days (°C × d), respectively. Survival of ARS-Fp-R families ranged from 0 to 48% following CD challenge and heritability estimates were similar between CD (0.17 ± 0.09) and BCWD (0.18 ± 0.03) resistance, and the genetic correlation between these 2 traits was favorable (0.35 ± 0.25). Genetic correlations were small and antagonistic (-0.15 ± 0.08 to -0.19 ± 0.24) between the 2 resistance traits and 9- and 12-mo BW. Two challenges were conducted in consecutive years to compare CD resistance among ARS-Fp-R, ARS-Fp-C, and ARS-Fp-S families. In the first challenge, ARS-Fp-R families (83% survival) had greater CD resistance than ARS-Fp-C (73.5%; P = 0.02) and ARS-Fp-S (68%; P < 0.001) families, which did not differ (P = 0.16). In the second challenge, using an approximately 2.5-fold greater challenge dose, ARS-Fp-R families exhibited greater CD resistance (56% survival) than ARS-Fp-S (38% survival; P = 0.02) families

  6. Therapy-resistant symptoms in Parkinson's disease.

    PubMed

    Vorovenci, Ruxandra Julia; Biundo, Roberta; Antonini, Angelo

    2016-01-01

    In recent years, the management of Parkinson's disease (PD) has come a long way, leading to an increase in therapeutic options that now include oral and transdermal drug delivery, infusion as well as surgical treatments. Nonetheless, in the evolution of this complex neurodegenerative disorder, several symptoms remain refractory to dopaminergic therapy. It is our aim to review the literature to date and to bring them into focus, as well as emphasizing on pathophysiological mechanisms, profile of risk factors in their development, and therapeutic options. We will focus on freezing of gait, camptocormia, dysphagia and dysphonia, as well as cognitive impairment and dementia because they represent the far end of therapy-resistant symptoms, encompassing poor health-related quality of life and often a more reserved prognosis with either a rapid evolution of the disease, and/or merely a more severe clinical picture. Pathophysiological mechanisms and brain neurotransmitter abnormalities behind these symptoms seem to overlap to some extent, and a better understanding of these correlations is desirable. We believe that further research is paramount to expand our knowledge of the dopamine-resistant symptoms and, consequently, to develop specific therapeutic strategies. PMID:26410626

  7. How pregnancy can affect autoimmune diseases progression?

    PubMed

    Piccinni, Marie-Pierre; Lombardelli, Letizia; Logiodice, Federica; Kullolli, Ornela; Parronchi, Paola; Romagnani, Sergio

    2016-01-01

    Autoimmune disorders are characterized by tissue damage, caused by self-reactivity of different effectors mechanisms of the immune system, namely antibodies and T cells. Their occurrence may be associated with genetic and/or environmental predisposition and to some extent, have implications for fertility and obstetrics. The relationship between autoimmunity and reproduction is bidirectional. This review only addresses the impact of pregnancy on autoimmune diseases and not the influence of autoimmunity on pregnancy development. Th17/Th1-type cells are aggressive and pathogenic in many autoimmune disorders and inflammatory diseases. The immunology of pregnancy underlies the role of Th2-type cytokines to maintain the tolerance of the mother towards the fetal semi-allograft. Non-specific factors, including hormonal changes, favor a switch to Th2-type cytokine profile. In pregnancy Th2, Th17/Th2 and Treg cells accumulate in the decidua but may also be present in the mother's circulation and can regulate autoimmune responses influencing the progression of autoimmune diseases. PMID:27651750

  8. Inherited metabolic diseases affecting the carrier.

    PubMed

    Endres, W

    1997-03-01

    The objective of this review is to draw attention to those inherited metabolic traits which are potentially harmful also for the carrier, and to outline preventive measures, at least for obligate heterozygotes, i.e. parents of homozygous children. Concerning carriers of food-dependent abnormalities, early vascular disease in homocystinuria, hyperammonaemic episodes in ornithine transcarbamylase deficiency, presenile cataracts in galactosaemia as well as galactokinase deficiency, spastic paraparesis in X-linked adrenoleukodystrophy, and HELLP syndrome in mothers of babies with long-chain 3-hydroxyacyl-coenzyme A dehydrogenase deficiency have to be mentioned. In the group of food-independent disorders, clinical features in carriers may be paraesthesias and corneal dystrophy in Fabry disease, lens clouding in Lowe syndrome, lung and/or liver diseases in alpha 1-antitrypsin deficiency, and renal stones in cystinuria type II and III. Finally, two monogenic carrier states are known which in pregnant individuals could possibly afflict the developing fetus, i.e. heterozygosity for galactosaemia and for phenylketonuria. Elevated levels of galactose-1-phosphate have been found in red blood cells of infants heterozygous for galactosaemia born to heterozygous mothers. Aspartame in very high doses is reported to increase blood phenylalanine levels in heterozygotes for phenylketonuria, thus being a risk for the fetus of a heterozygous mother. For some of these carrier states preventive measures can be recommended, e.g. restriction of lactose in parents and heterozygous grandparents of children with galactosaemia and galactokinase deficiency as well as transiently in infants heterozygous for galactosaemia, dietary supplementation with monounsaturated fatty acids in symptomatic carriers for X-linked adrenoleukodystrophy, avoidance of smoking and alcohol in heterozygotes for alpha 1-antitrypsin deficiency, avoidance of episodes of dehydration in heterozygotes for cystinuria, and

  9. Resistant Hypertension in Nondialysis Chronic Kidney Disease

    PubMed Central

    Stanzione, Giovanna; Conte, Giuseppe

    2013-01-01

    Resistant hypertension (RH) is defined as blood pressure (BP) that remains above the target of less than 140/90 mmHg in the general population and 130/80 mmHg in people with diabetes mellitus or chronic kidney disease (CKD) in spite of the use of at least three full-dose antihypertensive drugs including a diuretic or as BP that reaches the target by means of four or more drugs. In CKD, RH is a common condition due to a combination of factors including sodium retention, increased activity of the renin-angiotensin system, and enhanced activity of the sympathetic nervous system. Before defining the hypertensive patient as resistant it is mandatory to exclude the so-called “pseudoresistance.” This condition, which refers to the apparent failure to reach BP target in spite of an appropriate antihypertensive treatment, is mainly caused by white coat hypertension that is prevalent (30%) in CKD patients. Recently we have demonstrated that “true” RH represents an independent risk factor for renal and cardiovascular outcomes in CKD patients. PMID:23710342

  10. Airway resistance and reactance are affected in systemic sclerosis

    PubMed Central

    Aronsson, David; Hesselstrand, Roger; Bozovic, Gracijela; Wuttge, Dirk M.; Tufvesson, Ellen

    2015-01-01

    Background Interstitial lung disease often occurs as an early complication of systemic sclerosis (SSc). The aim was to investigate whether impulse oscillometry (IOS) could be used to evaluate lung impairment in SSc. Methods Seventy-eight SSc patients, of which 65 had limited cutaneous SSc (lcSSc) and 13 had diffuse cutaneous SSc (dcSSc), were subjected to high-resolution computed tomography (HRCT) and pulmonary function tests (spirometry, IOS, and single breath CO diffusion capacity test). Twenty-six healthy individuals served as controls. Results Patients with lcSSc had higher levels of peripheral airway resistance, that is, R5–R20 (difference between resistance at 5 Hz and resistance at 20 Hz) showed a median (and interquartile range) of 0.05 (0.02–0.09) in lcSSc, 0.01 (0.00–0.04) in dcSSc and 0.04 (0.01–0.06) in healthy controls. They also had higher levels of reactance: reactance area was 0.26 (0.15–0.56) in lcSSc, 0.20 (0.11–0.29) in dcSSc and 0.18 (0.08–0.30) in healthy controls, and resonant frequency was 10.9 (8.8–14.8) in lcSSc, 9.0 (8.3–11.6) in dcSSc and 9.1 (8.0–13.1) in healthy controls. Airway reactance correlated to fibrotic findings on HRCT, such as ground glass opacities and reticulations. Discussion This implies that IOS parameters to some extent are related to fibrosis in patients with SSc. PMID:26672963

  11. Genetics and genomics of disease resistance in salmonid species

    PubMed Central

    Yáñez, José M.; Houston, Ross D.; Newman, Scott

    2014-01-01

    Infectious and parasitic diseases generate large economic losses in salmon farming. A feasible and sustainable alternative to prevent disease outbreaks may be represented by genetic improvement for disease resistance. To include disease resistance into the breeding goal, prior knowledge of the levels of genetic variation for these traits is required. Furthermore, the information from the genetic architecture and molecular factors involved in resistance against diseases may be used to accelerate the genetic progress for these traits. In this regard, marker assisted selection and genomic selection are approaches which incorporate molecular information to increase the accuracy when predicting the genetic merit of selection candidates. In this article we review and discuss key aspects related to disease resistance in salmonid species, from both a genetic and genomic perspective, with emphasis in the applicability of disease resistance traits into breeding programs in salmonids. PMID:25505486

  12. Genetics and genomics of disease resistance in salmonid species.

    PubMed

    Yáñez, José M; Houston, Ross D; Newman, Scott

    2014-01-01

    Infectious and parasitic diseases generate large economic losses in salmon farming. A feasible and sustainable alternative to prevent disease outbreaks may be represented by genetic improvement for disease resistance. To include disease resistance into the breeding goal, prior knowledge of the levels of genetic variation for these traits is required. Furthermore, the information from the genetic architecture and molecular factors involved in resistance against diseases may be used to accelerate the genetic progress for these traits. In this regard, marker assisted selection and genomic selection are approaches which incorporate molecular information to increase the accuracy when predicting the genetic merit of selection candidates. In this article we review and discuss key aspects related to disease resistance in salmonid species, from both a genetic and genomic perspective, with emphasis in the applicability of disease resistance traits into breeding programs in salmonids.

  13. Evaluation of soybean genotypes for resistance to three seed borne diseases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seed-borne diseases of soybeans caused by Phomopsis longicolla (Phomopsis seed decay), Cercospora kukuchii (purple seed stain), and M. phaseolina (charcoal rot) are economically important seed-borne diseases that affect seed quality. Commercial cultivars marketed as resistant to all the three disea...

  14. How should environmental stress affect the population dynamics of disease?

    USGS Publications Warehouse

    Lafferty, Kevin D.; Holt, Robert D.

    2003-01-01

    We modelled how stress affects the population dynamics of infectious disease. We were specifically concerned with stress that increased susceptibility of uninfected hosts when exposed to infection. If such stresses also reduced resources, fecundity and/or survivorship, there was a reduction in the host carrying capacity. This lowered the contact between infected and uninfected hosts, thereby decreasing transmission. In addition, stress that increased parasite mortality decreased disease. The opposing effects of stress on disease dynamics made it difficult to predict the response of disease to environmental stress. We found analytical solutions with negative, positive, convex and concave associations between disease and stress. Numerical simulations with randomly generated parameter values suggested that the impact of host-specific diseases generally declined with stress while the impact of non-specific (or open) diseases increased with stress. These results help clarify predictions about the interaction between environmental stress and disease in natural populations.

  15. Defense mechanisms involved in disease resistance of grafted vegetables

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vegetable grafting with resistant rootstocks is an effective strategy to control a variety of soil-borne diseases and root-knot nematodes in the Cucurbitaceae and Solanaceae. In addition, improved resistance to some foliar diseases and viruses has also been reported in grafted plants. Hence, graft...

  16. Genomic selection for genetic resistance to Marek's disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enhancing genetic resistance to Marek’s disease (MD) is another control strategy to augment MD vaccines. Ideally selection would use genetic markers linked to the underlying genes that confer MD genetic resistance, which would avoid having to expose elite lines to Marek’s disease virus (MDV). To ide...

  17. Transgenic approaches to microbial disease resistance in crop plants.

    PubMed

    Salmeron, J M; Vernooij, B

    1998-08-01

    Recent progress in the genetic dissection of plant disease resistance signaling pathways has opened a number of new avenues towards engineering pathogen resistance in crops. Genes controlling race-specific and broad-spectrum resistance responses have been cloned, and novel induced resistance pathways have been identified in model and crop systems. Advances continue to be made in identification of antifungal proteins with effects inhibitory to either pathogen development or accumulation of associated mycotoxins.

  18. Nanotechnology and pulmonary delivery to overcome resistance in infectious diseases.

    PubMed

    Andrade, Fernanda; Rafael, Diana; Videira, Mafalda; Ferreira, Domingos; Sosnik, Alejandro; Sarmento, Bruno

    2013-11-01

    Used since ancient times especially for the local treatment of pulmonary diseases, lungs and airways are a versatile target route for the administration of both local and systemic drugs. Despite the existence of different platforms and devices for the pulmonary administration of drugs, only a few formulations are marketed, partly due to physiological and technological limitations. Respiratory infections represent a significant burden to health systems worldwide mainly due to intrahospital infections that more easily affect immune-compromised patients. Moreover, tuberculosis (TB) is an endemic infectious disease in many developing nations and it has resurged in the developed world associated with the human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) epidemic. Currently, medicine faces the specter of antibiotic resistance. Besides the development of new anti-infectious drugs, the development of innovative and more efficient delivery systems for drugs that went off patent appears as a promising strategy pursued by the pharmaceutical industry to improve the therapeutic outcomes and to prolong the utilities of their intellectual property portfolio. In this context, nanotechnology-based drug delivery systems (nano-DDS) emerged as a promising approach to circumvent the limitations of conventional formulations and to treat drug resistance, opening the hypothesis for new developments in this area.

  19. Factors affecting the reversal of antimicrobial-drug resistance.

    PubMed

    Johnsen, Pål J; Townsend, Jeffrey P; Bøhn, Thomas; Simonsen, Gunnar S; Sundsfjord, Arnfinn; Nielsen, Kaare M

    2009-06-01

    The persistence or loss of acquired antimicrobial-drug resistance in bacterial populations previously exposed to drug-selective pressure depends on several biological processes. We review mechanisms promoting or preventing the loss of resistance, including rates of reacquisition, effects of resistance traits on bacterial fitness, linked selection, and segregational stability of resistance determinants. As a case study, we discuss the persistence of glycopeptide-resistant enterococci in Norwegian and Danish poultry farms 12 years after the ban of the animal growth promoter avoparcin. We conclude that complete eradication of antimicrobial resistance in bacterial populations following relaxed drug-selective pressures is not straightforward. Resistance determinants may persist at low, but detectable, levels for many years in the absence of the corresponding drugs. PMID:19467475

  20. Molecular communications between plant heat shock responses and disease resistance.

    PubMed

    Lee, Jae-Hoon; Yun, Hye Sup; Kwon, Chian

    2012-08-01

    As sessile, plants are continuously exposed to potential dangers including various abiotic stresses and pathogen attack. Although most studies focus on plant responses under an ideal condition to a specific stimulus, plants in nature must cope with a variety of stimuli at the same time. This indicates that it is critical for plants to fine-control distinct signaling pathways temporally and spatially for simultaneous and effective responses to various stresses. Global warming is currently a big issue threatening the future of humans. Reponses to high temperature affect many physiological processes in plants including growth and disease resistance, resulting in decrease of crop yield. Although plant heat stress and defense responses share important mediators such as calcium ions and heat shock proteins, it is thought that high temperature generally suppresses plant immunity. We therefore specifically discuss on interactions between plant heat and defense responses in this review hopefully for an integrated understanding of these responses in plants.

  1. Advances and Challenges in Genomic Selection for Disease Resistance.

    PubMed

    Poland, Jesse; Rutkoski, Jessica

    2016-08-01

    Breeding for disease resistance is a central focus of plant breeding programs, as any successful variety must have the complete package of high yield, disease resistance, agronomic performance, and end-use quality. With the need to accelerate the development of improved varieties, genomics-assisted breeding is becoming an important tool in breeding programs. With marker-assisted selection, there has been success in breeding for disease resistance; however, much of this work and research has focused on identifying, mapping, and selecting for major resistance genes that tend to be highly effective but vulnerable to breakdown with rapid changes in pathogen races. In contrast, breeding for minor-gene quantitative resistance tends to produce more durable varieties but is a more challenging breeding objective. As the genetic architecture of resistance shifts from single major R genes to a diffused architecture of many minor genes, the best approach for molecular breeding will shift from marker-assisted selection to genomic selection. Genomics-assisted breeding for quantitative resistance will therefore necessitate whole-genome prediction models and selection methodology as implemented for classical complex traits such as yield. Here, we examine multiple case studies testing whole-genome prediction models and genomic selection for disease resistance. In general, whole-genome models for disease resistance can produce prediction accuracy suitable for application in breeding. These models also largely outperform multiple linear regression as would be applied in marker-assisted selection. With the implementation of genomic selection for yield and other agronomic traits, whole-genome marker profiles will be available for the entire set of breeding lines, enabling genomic selection for disease at no additional direct cost. In this context, the scope of implementing genomics selection for disease resistance, and specifically for quantitative resistance and quarantined pathogens

  2. Advances and Challenges in Genomic Selection for Disease Resistance.

    PubMed

    Poland, Jesse; Rutkoski, Jessica

    2016-08-01

    Breeding for disease resistance is a central focus of plant breeding programs, as any successful variety must have the complete package of high yield, disease resistance, agronomic performance, and end-use quality. With the need to accelerate the development of improved varieties, genomics-assisted breeding is becoming an important tool in breeding programs. With marker-assisted selection, there has been success in breeding for disease resistance; however, much of this work and research has focused on identifying, mapping, and selecting for major resistance genes that tend to be highly effective but vulnerable to breakdown with rapid changes in pathogen races. In contrast, breeding for minor-gene quantitative resistance tends to produce more durable varieties but is a more challenging breeding objective. As the genetic architecture of resistance shifts from single major R genes to a diffused architecture of many minor genes, the best approach for molecular breeding will shift from marker-assisted selection to genomic selection. Genomics-assisted breeding for quantitative resistance will therefore necessitate whole-genome prediction models and selection methodology as implemented for classical complex traits such as yield. Here, we examine multiple case studies testing whole-genome prediction models and genomic selection for disease resistance. In general, whole-genome models for disease resistance can produce prediction accuracy suitable for application in breeding. These models also largely outperform multiple linear regression as would be applied in marker-assisted selection. With the implementation of genomic selection for yield and other agronomic traits, whole-genome marker profiles will be available for the entire set of breeding lines, enabling genomic selection for disease at no additional direct cost. In this context, the scope of implementing genomics selection for disease resistance, and specifically for quantitative resistance and quarantined pathogens

  3. Insecticide resistance in vector Chagas disease: evolution, mechanisms and management.

    PubMed

    Mougabure-Cueto, Gastón; Picollo, María Inés

    2015-09-01

    Chagas disease is a chronic parasitic infection restricted to America. The disease is caused by the protozoa Trypanosoma cruzi, which is transmitted to human through the feces of infected triatomine insects. Because no treatment is available for the chronic forms of the disease, vector chemical control represents the best way to reduce the incidence of the disease. Chemical control has been based principally on spraying dwellings with insecticide formulations and led to the reduction of triatomine distribution and consequent interruption of disease transmission in several areas from endemic region. However, in the last decade it has been repeatedly reported the presence triatomnes, mainly Triatoma infestans, after spraying with pyrethroid insecticides, which was associated to evolution to insecticide resistance. In this paper the evolution of insecticide resistance in triatomines is reviewed. The insecticide resistance was detected in 1970s in Rhodnius prolixus and 1990s in R. prolixus and T. infestans, but not until the 2000s resistance to pyrthroids in T. infestans associated to control failures was described in Argentina and Bolivia. The main resistance mechanisms (i.e. enhanced metabolism, altered site of action and reduced penetration) were described in the T. infestans resistant to pyrethrods. Different resistant profiles were demonstrated suggesting independent origin of the different resistant foci of Argentina and Bolivia. The deltamethrin resistance in T. infestans was showed to be controlled by semi-dominant, autosomally inherited factors. Reproductive and developmental costs were also demonstrated for the resistant T. infestans. A discussion about resistance and tolerance concepts and the persistence of T. infestans in Gran Chaco region are presented. In addition, theoretical concepts related to toxicological, evolutionary and ecological aspects of insecticide resistance are discussed in order to understand the particular scenario of pyrethroid

  4. Insecticide resistance in vector Chagas disease: evolution, mechanisms and management.

    PubMed

    Mougabure-Cueto, Gastón; Picollo, María Inés

    2015-09-01

    Chagas disease is a chronic parasitic infection restricted to America. The disease is caused by the protozoa Trypanosoma cruzi, which is transmitted to human through the feces of infected triatomine insects. Because no treatment is available for the chronic forms of the disease, vector chemical control represents the best way to reduce the incidence of the disease. Chemical control has been based principally on spraying dwellings with insecticide formulations and led to the reduction of triatomine distribution and consequent interruption of disease transmission in several areas from endemic region. However, in the last decade it has been repeatedly reported the presence triatomnes, mainly Triatoma infestans, after spraying with pyrethroid insecticides, which was associated to evolution to insecticide resistance. In this paper the evolution of insecticide resistance in triatomines is reviewed. The insecticide resistance was detected in 1970s in Rhodnius prolixus and 1990s in R. prolixus and T. infestans, but not until the 2000s resistance to pyrthroids in T. infestans associated to control failures was described in Argentina and Bolivia. The main resistance mechanisms (i.e. enhanced metabolism, altered site of action and reduced penetration) were described in the T. infestans resistant to pyrethrods. Different resistant profiles were demonstrated suggesting independent origin of the different resistant foci of Argentina and Bolivia. The deltamethrin resistance in T. infestans was showed to be controlled by semi-dominant, autosomally inherited factors. Reproductive and developmental costs were also demonstrated for the resistant T. infestans. A discussion about resistance and tolerance concepts and the persistence of T. infestans in Gran Chaco region are presented. In addition, theoretical concepts related to toxicological, evolutionary and ecological aspects of insecticide resistance are discussed in order to understand the particular scenario of pyrethroid

  5. Resistance to aphid vectors of virus disease.

    PubMed

    Westwood, Jack H; Stevens, Mark

    2010-01-01

    The majority of plant viruses rely on vectors for their transmission and completion of their life cycle. These vectors comprise a diverse range of life forms including insects, nematodes, and fungi with the most common of these being insects. The geographic range of many of these vectors is continually expanding due to climate change. The viruses that they carry are therefore also expanding their range to exploit novel and naïve plant hosts. There are many forms of naturally occurring vector resistance ranging from broad nonhost resistance to more specific types of inducible resistance. Understanding and exploiting the many and varied forms of natural resistance to virus vectors is therefore extremely important for current and future agricultural production systems. To demonstrate the range and extent of these resistance mechanisms, this chapter will primarily focus on aphids to highlight key developments appropriate to plant-insect-virus interactions. PMID:20965074

  6. Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat.

    PubMed Central

    Görlach, J; Volrath, S; Knauf-Beiter, G; Hengy, G; Beckhove, U; Kogel, K H; Oostendorp, M; Staub, T; Ward, E; Kessmann, H; Ryals, J

    1996-01-01

    Systemic acquired resistance is an important component of the disease resistance repertoire of plants. In this study, a novel synthetic chemical, benzo(1,2,3)thiadiazole-7-carbothioic acid S-methyl ester (BTH), was shown to induce acquired resistance in wheat. BTH protected wheat systemically against powdery mildew infection by affecting multiple steps in the life cycle of the pathogen. The onset of resistance was accompanied by the induction of a number of newly described wheat chemically induced (WCI) genes, including genes encoding a lipoxygenase and a sulfur-rich protein. With respect to both timing and effectiveness, a tight correlation existed between the onset of resistance and the induction of the WCI genes. Compared with other plant activators, such as 2,6-dichloroisonicotinic acid and salicylic acid, BTH was the most potent inducer of both resistance and gene induction. BTH is being developed commercially as a novel type of plant protection compound that works by inducing the plant's inherent disease resistance mechanisms. PMID:8624439

  7. Molecular genetics and evolution of disease resistance in cereals.

    PubMed

    Krattinger, Simon G; Keller, Beat

    2016-10-01

    Contents 320 I. 320 II. 321 III. 321 IV. 322 V. 324 VI. 328 VII. 329 330 References 330 SUMMARY: Cereal crops produce a large part of the globally consumed food and feed. Because of the constant presence of devastating pathogens, the molecular characterization of disease resistance is a major research area and highly relevant for breeding. There has been recent and accelerating progress in the understanding of three distinct resistance mechanisms in cereals: resistance conferred by plasma membrane-localized receptor proteins; race-specific resistance conferred by intracellular immune receptors; and quantitative disease resistance. Intracellular immune receptors provide a particularly rich source for evolutionary studies, and have, for example, resulted in the recent discovery of a novel detection mechanism based on integrated decoy domains. Evolutionary studies have also revealed the origins of active resistance genes in both wild progenitors of today's cereals as well as in cultivated forms. In addition, independent evolution of orthologous genes in related cereals has resulted in resistance to different pathogen species. Quantitative resistance genes have been best characterized in wheat. The quantitative resistance genes identified so far in wheat encode transporter proteins or unusual kinase proteins. The recent discoveries in these three different resistance mechanisms have contributed to the basic molecular understanding of cereal immunity against pathogens and have suggested novel applications for resistance breeding.

  8. Molecular genetics and evolution of disease resistance in cereals.

    PubMed

    Krattinger, Simon G; Keller, Beat

    2016-10-01

    Contents 320 I. 320 II. 321 III. 321 IV. 322 V. 324 VI. 328 VII. 329 330 References 330 SUMMARY: Cereal crops produce a large part of the globally consumed food and feed. Because of the constant presence of devastating pathogens, the molecular characterization of disease resistance is a major research area and highly relevant for breeding. There has been recent and accelerating progress in the understanding of three distinct resistance mechanisms in cereals: resistance conferred by plasma membrane-localized receptor proteins; race-specific resistance conferred by intracellular immune receptors; and quantitative disease resistance. Intracellular immune receptors provide a particularly rich source for evolutionary studies, and have, for example, resulted in the recent discovery of a novel detection mechanism based on integrated decoy domains. Evolutionary studies have also revealed the origins of active resistance genes in both wild progenitors of today's cereals as well as in cultivated forms. In addition, independent evolution of orthologous genes in related cereals has resulted in resistance to different pathogen species. Quantitative resistance genes have been best characterized in wheat. The quantitative resistance genes identified so far in wheat encode transporter proteins or unusual kinase proteins. The recent discoveries in these three different resistance mechanisms have contributed to the basic molecular understanding of cereal immunity against pathogens and have suggested novel applications for resistance breeding. PMID:27427289

  9. Engineering disease resistance with pectate lyase-like genes

    DOEpatents

    Vogel, John; Somerville, Shauna

    2005-03-08

    A mutant gene coding for pectate lyase and homologs thereof is provided, which when incorporated in transgenic plants effect an increased level disease resistance in such plants. Also is provided the polypeptide sequence for the pectate lyase of the present invention. Methods of obtaining the mutant gene, producing transgenic plants which include the nucleotide sequence for the mutant gene and producing improved disease resistance in a crop of such transgenic plants are also provided.

  10. Inoculation of Transgenic Resistant Potato by Phytophthora infestans Affects Host Plant Choice of a Generalist Moth.

    PubMed

    Abreha, Kibrom B; Alexandersson, Erik; Vossen, Jack H; Anderson, Peter; Andreasson, Erik

    2015-01-01

    Pathogen attack and the plant's response to this attack affect herbivore oviposition preference and larval performance. Introduction of major resistance genes against Phytophthora infestans (Rpi-genes), the cause of the devastating late blight disease, from wild Solanum species into potato changes the plant-pathogen interaction dynamics completely, but little is known about the effects on non-target organisms. Thus, we examined the effect of P. infestans itself and introduction of an Rpi-gene into the crop on host plant preference of the generalist insect herbivore, Spodoptera littoralis (Lepidoptera: Noctuidae). In two choice bioassays, S. littoralis preferred to oviposit on P. infestans-inoculated plants of both the susceptible potato (cv. Desiree) and an isogenic resistant clone (A01-22: cv. Desiree transformed with Rpi-blb1), when compared to uninoculated plants of the same genotype. Both cv. Desiree and clone A01-22 were equally preferred for oviposition by S. littoralis when uninoculated plants were used, while cv. Desiree received more eggs compared to the resistant clone when both were inoculated with the pathogen. No significant difference in larval and pupal weight was found between S. littoralis larvae reared on leaves of the susceptible potato plants inoculated or uninoculated with P. infestans. Thus, the herbivore's host plant preference in this system was not directly associated with larval performance. The results indicate that the Rpi-blb1 based resistance in itself does not influence insect behavior, but that herbivore oviposition preference is affected by a change in the plant-microbe interaction. PMID:26053171

  11. Inoculation of Transgenic Resistant Potato by Phytophthora infestans Affects Host Plant Choice of a Generalist Moth

    PubMed Central

    Abreha, Kibrom B.; Alexandersson, Erik; Vossen, Jack H.; Anderson, Peter; Andreasson, Erik

    2015-01-01

    Pathogen attack and the plant’s response to this attack affect herbivore oviposition preference and larval performance. Introduction of major resistance genes against Phytophthora infestans (Rpi-genes), the cause of the devastating late blight disease, from wild Solanum species into potato changes the plant-pathogen interaction dynamics completely, but little is known about the effects on non-target organisms. Thus, we examined the effect of P. infestans itself and introduction of an Rpi-gene into the crop on host plant preference of the generalist insect herbivore, Spodoptera littoralis (Lepidoptera: Noctuidae). In two choice bioassays, S. littoralis preferred to oviposit on P. infestans-inoculated plants of both the susceptible potato (cv. Desiree) and an isogenic resistant clone (A01-22: cv. Desiree transformed with Rpi-blb1), when compared to uninoculated plants of the same genotype. Both cv. Desiree and clone A01-22 were equally preferred for oviposition by S. littoralis when uninoculated plants were used, while cv. Desiree received more eggs compared to the resistant clone when both were inoculated with the pathogen. No significant difference in larval and pupal weight was found between S. littoralis larvae reared on leaves of the susceptible potato plants inoculated or uninoculated with P. infestans. Thus, the herbivore’s host plant preference in this system was not directly associated with larval performance. The results indicate that the Rpi-blb1 based resistance in itself does not influence insect behavior, but that herbivore oviposition preference is affected by a change in the plant-microbe interaction. PMID:26053171

  12. The impact of insecticide-resistance on control of vectors and vector-borne diseases

    PubMed Central

    Busvine, J. R.; Pal, R.

    1969-01-01

    A questionnaire inquiring into the nature of schemes for the insecticidal control of disease vectors, the development of resistance in these vectors, and the effect of any such resistance on their control and on the extent of disease was sent to more than 100 health authorities throughout the world. The replies to the questionnaire are summarized in this paper. Until recently, the use of insecticides in public health has been largely based on three organochlorine compounds—DDT, HCH and dieldrin. However, in some countries resistance to these has now severely affected control both of many insect species and of the diseases they transmit (e.g., malaria, yellow fever, filariasis, typhus, plague). Certain other public health problems (onchocerciasis, Chagas' disease, trypanosomiasis, leishmaniasis) have not so far been greatly affected by resistance, but it is difficult to be sure of the continued reliability of the organochlorines. Research in the past 5 years, much of it sponsored by WHO, has shown the value of various organophosphorus and carbamate insecticides as replacements for the organochlorines, although resistance to them, too, can occur. Attention must therefore be focused on all facets of the use of these newer compounds and particular scrutiny made of possible instances of resistance to them. PMID:5307234

  13. Breeding for disease resistance in cacao

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cacao production must increase in order to meet the projected rise in the demand for chocolate. Approximately one-third of global production is lost annually to diseases and insects. Four diseases account for the greatest losses worldwide: black pod, caused by four Phytophthora spp; witches’ broom...

  14. Glyphosate resistance does not affect Palmer amaranth seedbank longevity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A greater understanding of the factors that regulate weed seed return to and persistence in the soil seedbank is needed for the management of difficult to control herbicide resistant weeds. Studies were conducted in Tifton, GA to evaluate the longevity of buried Palmer amaranth seeds and estimate t...

  15. The double challenge of resistant hypertension and chronic kidney disease.

    PubMed

    Rossignol, Patrick; Massy, Ziad A; Azizi, Michel; Bakris, George; Ritz, Eberhard; Covic, Adrian; Goldsmith, David; Heine, Gunnar H; Jager, Kitty J; Kanbay, Mehmet; Mallamaci, Francesca; Ortiz, Alberto; Vanholder, Raymond; Wiecek, Andrzej; Zoccali, Carmine; London, Gérard Michel; Stengel, Bénédicte; Fouque, Denis

    2015-10-17

    Resistant hypertension is defined as blood pressure above goal despite adherence to a combination of at least three optimally dosed antihypertensive medications, one of which is a diuretic. Chronic kidney disease is the most frequent of several patient factors or comorbidities associated with resistant hypertension. The prevalence of resistant hypertension is increased in patients with chronic kidney disease, while chronic kidney disease is associated with an impaired prognosis in patients with resistant hypertension. Recommended low-salt diet and triple antihypertensive drug regimens that include a diuretic, should be complemented by the sequential addition of other antihypertensive drugs. New therapeutic innovations for resistant hypertension, such as renal denervation and carotid barostimulation, are under investigation especially in patients with advanced chronic kidney disease. We discuss resistant hypertension in chronic kidney disease stages 3-5 (ie, patients with an estimated glomerular filtration rate below 60 mL/min per 1·73 m(2) and not on dialysis), in terms of worldwide epidemiology, outcomes, causes and pathophysiology, evidence-based treatment, and a call for action.

  16. Markers associated with disease resistance in Eastern oysters, Crassostrea virginica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Eastern oyster, Crassostrea viginica, is an economically important aquaculture species in the USA, but production has been impacted by diseases such as dermo and MSX. Efforts have been put into the development of disease-resistant oyster lines using selective breeding techniques. However, these met...

  17. Marker-assisted selection for disease resistance in lettuce

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lettuce (Lactuca sativa L.) is the most popular leafy vegetable that is cultivated mainly in moderate climate. Consumers demand lettuce with good visual appearance and free of disease. Improved disease resistance of new cultivars is achieved by combining desirable genes (or alleles) from existing cu...

  18. Antimicrobial resistance in bacteria associated with porcine respiratory disease in Australia.

    PubMed

    Dayao, Denise Ann E; Gibson, Justine S; Blackall, Patrick J; Turni, Conny

    2014-06-25

    The porcine respiratory disease complex greatly affects the health and production of pigs. While antimicrobial agents are used to treat the respiratory infections caused by bacterial pathogens, there is no current information on antimicrobial resistance in Australian pig respiratory bacterial isolates. The aim of this study was to determine the antimicrobial resistance profiles, by determining the minimum inhibitory concentration of nine antimicrobial agents for 71 Actinobacillus pleuropneumoniae, 51 Pasteurella multocida and 18 Bordetella bronchiseptica cultured from Australian pigs. The majority of A. pleuropneumoniae isolates were resistant to erythromycin (89%) and tetracycline (75%). Resistance to ampicillin (8.5%), penicillin (8.5%) and tilmicosin (25%) was also identified. The P. multocida isolates exhibited resistance to co-trimoxazole (2%), florfenicol (2%), ampicillin (4%), penicillin (4%), erythromycin (14%) and tetracycline (28%). While all the B. bronchiseptica isolates showed resistance to beta-lactams (ampicillin, ceftiofur and penicillin), some were resistant to erythromycin (94%), florfenicol (6%), tilmicosin (22%) and tetracycline (39%). The incidence of multiple drug resistance (MDR) varied across the species - in B. bronchiseptica, 27.8% of resistant isolates showed MDR, while 9.1% of the resistant isolates in A. pleuropneumoniae, and 4.8% in P. multocida showed MDR. This study illustrated that Australian pig strains of bacterial respiratory pathogens exhibited low levels of resistance to antimicrobial agents commonly used in the pig industry.

  19. Antimicrobial resistance in bacteria associated with porcine respiratory disease in Australia.

    PubMed

    Dayao, Denise Ann E; Gibson, Justine S; Blackall, Patrick J; Turni, Conny

    2014-06-25

    The porcine respiratory disease complex greatly affects the health and production of pigs. While antimicrobial agents are used to treat the respiratory infections caused by bacterial pathogens, there is no current information on antimicrobial resistance in Australian pig respiratory bacterial isolates. The aim of this study was to determine the antimicrobial resistance profiles, by determining the minimum inhibitory concentration of nine antimicrobial agents for 71 Actinobacillus pleuropneumoniae, 51 Pasteurella multocida and 18 Bordetella bronchiseptica cultured from Australian pigs. The majority of A. pleuropneumoniae isolates were resistant to erythromycin (89%) and tetracycline (75%). Resistance to ampicillin (8.5%), penicillin (8.5%) and tilmicosin (25%) was also identified. The P. multocida isolates exhibited resistance to co-trimoxazole (2%), florfenicol (2%), ampicillin (4%), penicillin (4%), erythromycin (14%) and tetracycline (28%). While all the B. bronchiseptica isolates showed resistance to beta-lactams (ampicillin, ceftiofur and penicillin), some were resistant to erythromycin (94%), florfenicol (6%), tilmicosin (22%) and tetracycline (39%). The incidence of multiple drug resistance (MDR) varied across the species - in B. bronchiseptica, 27.8% of resistant isolates showed MDR, while 9.1% of the resistant isolates in A. pleuropneumoniae, and 4.8% in P. multocida showed MDR. This study illustrated that Australian pig strains of bacterial respiratory pathogens exhibited low levels of resistance to antimicrobial agents commonly used in the pig industry. PMID:24726505

  20. CNS-disease affecting the heart: brain-heart disorders.

    PubMed

    Finsterer, Josef; Wahbi, Karim

    2014-10-15

    There are a number of hereditary and non-hereditary central nervous system (CNS) disorders, which directly or indirectly affect the heart (brain-heart disorders). The most well-known of these CNS-disorders are epilepsy, stroke, subarachanoid bleeding, bacterial meningitis, and head injury. In addition, a number of hereditary and non-hereditary neurodegenerative disorders may impair cardiac functions. Affection of the heart may manifest as arrhythmias, cardiomyopathy, or autonomic dysfunction. Rarer cardiac complications of CNS disorders include heart failure, systolic or diastolic dysfunction, myocardial infarction, arterial hypertension, or pulmonary hypertension. Cardiomyopathy induced by hereditary CNS disease mainly include stress-induced myocardial dysfunction, known as Takotsubo syndrome (TTS). CNS disease triggering TTS includes epilepsy, ischemic stroke, subarachnoid bleeding, or PRES syndrome. Arrhythmias induced by hereditary CNS disease include supraventricular or ventricular arrhythmias leading to palpitations, dizziness, vertigo, fainting, syncope, (near) sudden cardiac death, or sudden unexplained death in epilepsy (SUDEP). Appropriate management of cardiac involvement in CNS-disorders is essential to improve outcome of affected patients. PMID:25034054

  1. Genomics of Fungal Disease Resistance in Tomato

    PubMed Central

    Panthee, Dilip R.; Chen, Feng

    2010-01-01

    Tomato (Solanum lycopersicum) is an important vegetable crop worldwide. Often times, its production is hindered by fungal diseases. Important fungal diseases limiting tomato production are late blight, caused by Phytophthora infestans, early blight, caused by Alternaria solanii, and septoria leaf spot, caused by Septoria lycopersici, fusarium wilt caused by Fusarium oxysporium fsp. oxysporium, and verticilium wilt caused by Verticilium dahlea. The Phytophthora infestans is the same fungus that caused the devastating loss of potato in Europe in 1845. A similar magnitude of crop loss in tomato has not occurred but Phytophthora infestans has caused the complete loss of tomato crops around the world on a small scale. Several attempts have been made through conventional breeding and the molecular biological approaches to understand the biology of host-pathogen interaction so that the disease can be managed and crop loss prevented. In this review, we present a comprehensive analysis of information produced by molecular genetic and genomic experiments on host-pathogen interactions of late blight, early blight, septoria leaf spot, verticilim wilt and fusarium wilt in tomato. Furthermore, approaches adopted to manage these diseases in tomato including genetic transformation are presented. Attempts made to link molecular markers with putative genes and their use in crop improvement are discussed. PMID:20808521

  2. Chapter 11: Disease resistance in chickpea

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chickpea is a grain legume with valuable nutritional characteristics; it is a basic aliment in Asian countries such as India and Pakistan as well as a traditional ingredient in Mediterranean diet. Biotic stresses such as ascochyta blight and fusarium wilt together with other diseases such as botryti...

  3. Relationship between Phylogeny and Immunity Suggests Older Caribbean Coral Lineages Are More Resistant to Disease

    PubMed Central

    Pinzón C., Jorge H.; Beach-Letendre, Joshuah; Weil, Ernesto; Mydlarz, Laura D.

    2014-01-01

    Diseases affect coral species fitness and contribute significantly to the deterioration of coral reefs. The increase in frequency and severity of disease outbreaks has made evaluating and determining coral resistance a priority. Phylogenetic patterns in immunity and disease can provide important insight to how corals may respond to current and future environmental and/or biologically induced diseases. The purpose of this study was to determine if immunity, number of diseases and disease prevalence show a phylogenetic signal among Caribbean corals. We characterized the constitutive levels of six distinct innate immune traits in 14 Caribbean coral species and tested for the presence of a phylogenetic signal on each trait. Results indicate that constitutive levels of some individual immune related processes (i.e. melanin concentration, peroxidase and inhibition of bacterial growth), as well as their combination show a phylogenetic signal. Additionally, both the number of diseases affecting each species and disease prevalence (as measures of disease burden) show a significant phylogenetic signal. The phylogenetic signal of immune related processes, combined with estimates of species divergence times, indicates that among the studied species, those belonging to older lineages tend to resist/fight infections better than more recently diverged coral lineages. This result, combined with the increasing stressful conditions on corals in the Caribbean, suggest that future reefs in the region will likely be dominated by older lineages while modern species may face local population declines and/or geographic extinction. PMID:25133685

  4. The reproduction in women affected by cooley disease

    PubMed Central

    Pafumi, Carlo; Leanza, Vito; Coco, Luana; Vizzini, Stefania; Ciotta, Lilliana; Messina, Alessandra; Leanza, Gianluca; Zarbo, Giuseppe; D'Agati, Alfio; Palumbo, Marco Antonio; Iemmola, Alessandra; Gulino, Ferdinando Antonio; Teodoro, Maria Cristina; Attard, Matthew; Plesca, Alina Cristina; Soares, Catarina; Kouloubis, Nina; Chammas, Mayada

    2011-01-01

    The health background management and outcomes of 5 pregnancies in 4 women affected by Cooley Disease, from Paediatric Institute of Catania University, are described, considering the preconceptual guidances and cares for such patients. These patients were selected among a group of 100 thalassemic women divided into three subgroups, according to their first and successive menstruation characteristics: i) patients with primitive amenorrhoea, ii) patients with secondary amenorrhoea and iii) patients with normal menstruation. Only one woman, affected by primitive amenorrhoea, needed the induction of ovulation. A precise and detailed pre-pregnancy assessment was effected before each conception. This was constituted by a series of essays, including checks for diabetes and hypothyroidism, for B and C hepatitis and for blood group antibodies. Moreover were evaluated: cardiac function, rubella immunity and transaminases. Other pregnancy monitoring, and cares during labour and delivery were effected according to usual obstetrics practice. All the women were in labour when she were 38 week pregnant, and the outcome were five healthy babies born at term, weighting between 2600 and 3200gs. The only complication was the Caesarean section. The improvements of current treatments, especially in the management of iron deposits, the prolongation of survival rate, will result in a continuous increase of pregnancies in thalassemic women. Pregnancy is now a real possibility for women affected by such disease. We are furthermore studying the possibility to collect the fetus' umbilical cord blood, after the delivery, to attempt eterologus transplantation to his mother trying to get a complete marrow reconstitution. PMID:22184526

  5. Genetically Engineered Broad-Spectrum Disease Resistance in Tomato

    NASA Astrophysics Data System (ADS)

    Oldroyd, Giles E. D.; Staskawicz, Brian J.

    1998-08-01

    Resistance in tomato to the bacterial pathogen Pseudomonas syringae pathovar tomato requires Pto and Prf. Mutations that eliminate Prf show a loss of both Pto resistance and sensitivity to the organophosphate insecticide fenthion, suggesting that Prf controls both phenotypes. Herein, we report that the overexpression of Prf leads to enhanced resistance to a number of normally virulent bacterial and viral pathogens and leads to increased sensitivity to fenthion. These plants express levels of salicylic acid comparable to plants induced for systemic acquired resistance (SAR) and constitutively express pathogenesis related genes. These results suggest that the overexpression of Prf activates the Pto and Fen pathways in a pathogen-independent manner and leads to the activation of SAR. Transgene-induced SAR has implications for the generation of broad spectrum disease resistance in agricultural crop plants.

  6. Multiple insecticide resistances in the disease vector Culex p. quinquefasciatus from Western Indian Ocean.

    PubMed

    Pocquet, Nicolas; Milesi, Pascal; Makoundou, Patrick; Unal, Sandra; Zumbo, Betty; Atyame, Célestine; Darriet, Frédéric; Dehecq, Jean-Sébastien; Thiria, Julien; Bheecarry, Ambicadutt; Iyaloo, Diana P; Weill, Mylène; Chandre, Fabrice; Labbé, Pierrick

    2013-01-01

    Several mosquito-borne diseases affect the Western Indian Ocean islands. Culex pipiens quinquefasciatus is one of these vectors and transmits filariasis, Rift Valley and West Nile viruses and the Japanese encephalitis. To limit the impact of these diseases on public health, considerable vector control efforts have been implemented since the 50s, mainly through the use of neurotoxic insecticides belonging to Organochlorines (OC), Organophosphates (OP) and pyrethroids (PYR) families. However, mosquito control failures have been reported on site, and they were probably due to the selection of resistant individuals in response to insecticide exposure. In this study, we used different approaches to establish a first regional assessment of the levels and mechanisms of resistance to various insecticides. Bioassays were used to evaluate resistance to various insecticides, enzyme activity was measured to assess the presence of metabolic resistances through elevated detoxification, and molecular identification of known resistance alleles was investigated to determine the frequency of target-site mutations. These complementary approaches showed that resistance to the most used insecticides families (OC, OP and PYR) is widespread at a regional scale. However, the distribution of the different resistance genes is quite heterogeneous among the islands, some being found at high frequencies everywhere, others being frequent in some islands and absent in others. Moreover, two resistance alleles displayed clinal distributions in Mayotte and La Réunion, probably as a result of a heterogeneous selection due to local treatment practices. These widespread and diverse resistance mechanisms reduce the capacity of resistance management through classical strategies (e.g. insecticide rotation). In case of a disease outbreak, it could undermine the efforts of the vector control services, as only few compounds could be used. It thus becomes urgent to find alternatives to control populations

  7. Multiple Insecticide Resistances in the Disease Vector Culex p. Quinquefasciatus from Western Indian Ocean

    PubMed Central

    Pocquet, Nicolas; Milesi, Pascal; Makoundou, Patrick; Unal, Sandra; Zumbo, Betty; Atyame, Célestine; Darriet, Frédéric; Dehecq, Jean-Sébastien; Thiria, Julien; Bheecarry, Ambicadutt; Iyaloo, Diana P.; Weill, Mylène; Chandre, Fabrice; Labbé, Pierrick

    2013-01-01

    Several mosquito-borne diseases affect the Western Indian Ocean islands. Culex pipiens quinquefasciatus is one of these vectors and transmits filariasis, Rift Valley and West Nile viruses and the Japanese encephalitis. To limit the impact of these diseases on public health, considerable vector control efforts have been implemented since the 50s, mainly through the use of neurotoxic insecticides belonging to Organochlorines (OC), Organophosphates (OP) and pyrethroids (PYR) families. However, mosquito control failures have been reported on site, and they were probably due to the selection of resistant individuals in response to insecticide exposure. In this study, we used different approaches to establish a first regional assessment of the levels and mechanisms of resistance to various insecticides. Bioassays were used to evaluate resistance to various insecticides, enzyme activity was measured to assess the presence of metabolic resistances through elevated detoxification, and molecular identification of known resistance alleles was investigated to determine the frequency of target-site mutations. These complementary approaches showed that resistance to the most used insecticides families (OC, OP and PYR) is widespread at a regional scale. However, the distribution of the different resistance genes is quite heterogeneous among the islands, some being found at high frequencies everywhere, others being frequent in some islands and absent in others. Moreover, two resistance alleles displayed clinal distributions in Mayotte and La Réunion, probably as a result of a heterogeneous selection due to local treatment practices. These widespread and diverse resistance mechanisms reduce the capacity of resistance management through classical strategies (e.g. insecticide rotation). In case of a disease outbreak, it could undermine the efforts of the vector control services, as only few compounds could be used. It thus becomes urgent to find alternatives to control populations

  8. Black leaf streak disease affects starch metabolism in banana fruit.

    PubMed

    Saraiva, Lorenzo de Amorim; Castelan, Florence Polegato; Shitakubo, Renata; Hassimotto, Neuza Mariko Aymoto; Purgatto, Eduardo; Chillet, Marc; Cordenunsi, Beatriz Rosana

    2013-06-12

    Black leaf streak disease (BLSD), also known as black sigatoka, represents the main foliar disease in Brazilian banana plantations. In addition to photosynthetic leaf area losses and yield losses, this disease causes an alteration in the pre- and postharvest behavior of the fruit. The aim of this work was to investigate the starch metabolism of fruits during fruit ripening from plants infected with BLSD by evaluating carbohydrate content (i.e., starch, soluble sugars, oligosaccharides, amylose), phenolic compound content, phytohormones, enzymatic activities (i.e., starch phosphorylases, α- and β-amylase), and starch granules. The results indicated that the starch metabolism in banana fruit ripening is affected by BLSD infection. Fruit from infested plots contained unusual amounts of soluble sugars in the green stage and smaller starch granules and showed a different pattern of superficial degradation. Enzymatic activities linked to starch degradation were also altered by the disease. Moreover, the levels of indole-acetic acid and phenolic compounds indicated an advanced fruit physiological age for fruits from infested plots. PMID:23692371

  9. Risks of population antimicrobial resistance associated with chronic macrolide use for inflammatory airway diseases.

    PubMed

    Serisier, David J

    2013-05-01

    Macrolide antibiotics have established efficacy in the management of cystic fibrosis and diffuse panbronchiolitis-uncommon lung diseases with substantial morbidity and the potential for rapid progression to death. Emerging evidence suggests benefits of maintenance macrolide treatment in more indolent respiratory diseases including chronic obstructive pulmonary disease and non-cystic fibrosis bronchiectasis. In view of the greater patient population affected by these disorders (and potential for macrolide use to spread to disorders such as chronic cough), widespread use of macrolides, particularly azithromycin, has the potential to substantially influence antimicrobial resistance rates of a range of respiratory microbes. In this Personal View, I explore theories around population (rather than patient) macrolide resistance, appraise evidence linking macrolide use with development of resistance, and highlight the risks posed by injudicious broadening of their use, particularly of azithromycin. These risks are weighed against the potential benefits of macrolides in less aggressive inflammatory airway disorders. A far-sighted approach to maintenance macrolide use in non-cystic fibrosis inflammatory airway diseases is needed, which minimises risks of adversely affecting community macrolide resistance: combining preferential use of erythromycin and restriction of macrolide use to those patients at greatest risk represents an appropriately cautious management approach. PMID:24429132

  10. Risks of population antimicrobial resistance associated with chronic macrolide use for inflammatory airway diseases.

    PubMed

    Serisier, David J

    2013-05-01

    Macrolide antibiotics have established efficacy in the management of cystic fibrosis and diffuse panbronchiolitis-uncommon lung diseases with substantial morbidity and the potential for rapid progression to death. Emerging evidence suggests benefits of maintenance macrolide treatment in more indolent respiratory diseases including chronic obstructive pulmonary disease and non-cystic fibrosis bronchiectasis. In view of the greater patient population affected by these disorders (and potential for macrolide use to spread to disorders such as chronic cough), widespread use of macrolides, particularly azithromycin, has the potential to substantially influence antimicrobial resistance rates of a range of respiratory microbes. In this Personal View, I explore theories around population (rather than patient) macrolide resistance, appraise evidence linking macrolide use with development of resistance, and highlight the risks posed by injudicious broadening of their use, particularly of azithromycin. These risks are weighed against the potential benefits of macrolides in less aggressive inflammatory airway disorders. A far-sighted approach to maintenance macrolide use in non-cystic fibrosis inflammatory airway diseases is needed, which minimises risks of adversely affecting community macrolide resistance: combining preferential use of erythromycin and restriction of macrolide use to those patients at greatest risk represents an appropriately cautious management approach.

  11. Glyphosate affects seed composition in glyphosate-resistant soybean.

    PubMed

    Zobiole, Luiz H S; Oliveira, Rubem S; Visentainer, Jesui V; Kremer, Robert J; Bellaloui, Nacer; Yamada, Tsuioshi

    2010-04-14

    The cultivation of glyphosate-resistant (GR) soybeans has continuously increased worldwide in recent years mainly due to the importance of glyphosate in current weed management systems. However, not much has been done to understand eventual effects of glyphosate application on GR soybean physiology, especially those related to seed composition with potential effects on human health. Two experiments were conducted to evaluate the effects of glyphosate application on GR soybeans compared with its near-isogenic non-GR parental lines. Results of the first experiment showed that glyphosate application resulted in significant decreases in shoot nutrient concentrations, photosynthetic parameters, and biomass production. Similar trends were observed for the second experiment, although glyphosate application significantly altered seed nutrient concentrations and polyunsaturated fatty acid percentages. Glyphosate resulted in significant decreases in polyunsaturated linoleic acid (18:2n-6) (2.3% decrease) and linolenic acid (18:3n-3) (9.6% decrease) and a significant increase in monounsaturated fatty acids 17:1n-7 (30.3% increase) and 18:1n-7 (25% increase). The combined observations of decreased photosynthetic parameters and low nutrient availability in glyphosate-treated plants may explain potential adverse effects of glyphosate in GR soybeans.

  12. Nutrient enrichment affects the mechanical resistance of aquatic plants

    PubMed Central

    Puijalon, Sara

    2012-01-01

    For many plant species, nutrient availability induces important anatomical responses, particularly the production of low-density tissues to the detriment of supporting tissues. Due to the contrasting biomechanical properties of plant tissues, these anatomical responses may induce important modifications in the biomechanical properties of plant organs. The aim of this study was to determine the effects of nutrient enrichment on the anatomical traits of two freshwater plant species and its consequences on plant biomechanical performance. Two plant species were grown under controlled conditions in low versus high nutrient levels. The anatomical and biomechanical traits of the plant stems were measured. Both species produced tissues with lower densities under nutrient-rich conditions, accompanied by modifications in the structure of the aerenchyma for one species. As expected, nutrient enrichment also led to important modifications in the biomechanical properties of the stem for both species. In particular, mechanical resistance (breaking force and strength) and stiffness of stems were significantly reduced under nutrient rich conditions. The production of weaker stem tissues as a result of nutrient enrichment may increase the risk of plants to mechanical failure, thus challenging plant maintenance in mechanically stressful or disturbed habitats. PMID:23028018

  13. Nutrient enrichment affects the mechanical resistance of aquatic plants.

    PubMed

    Lamberti-Raverot, Barbara; Puijalon, Sara

    2012-10-01

    For many plant species, nutrient availability induces important anatomical responses, particularly the production of low-density tissues to the detriment of supporting tissues. Due to the contrasting biomechanical properties of plant tissues, these anatomical responses may induce important modifications in the biomechanical properties of plant organs. The aim of this study was to determine the effects of nutrient enrichment on the anatomical traits of two freshwater plant species and its consequences on plant biomechanical performance. Two plant species were grown under controlled conditions in low versus high nutrient levels. The anatomical and biomechanical traits of the plant stems were measured. Both species produced tissues with lower densities under nutrient-rich conditions, accompanied by modifications in the structure of the aerenchyma for one species. As expected, nutrient enrichment also led to important modifications in the biomechanical properties of the stem for both species. In particular, mechanical resistance (breaking force and strength) and stiffness of stems were significantly reduced under nutrient rich conditions. The production of weaker stem tissues as a result of nutrient enrichment may increase the risk of plants to mechanical failure, thus challenging plant maintenance in mechanically stressful or disturbed habitats. PMID:23028018

  14. Prion protein polymorphisms affect chronic wasting disease progression.

    PubMed

    Johnson, Chad J; Herbst, Allen; Duque-Velasquez, Camilo; Vanderloo, Joshua P; Bochsler, Phil; Chappell, Rick; McKenzie, Debbie

    2011-01-01

    Analysis of the PRNP gene in cervids naturally infected with chronic wasting disease (CWD) suggested that PRNP polymorphisms affect the susceptibility of deer to infection. To test this effect, we orally inoculated 12 white-tailed deer with CWD agent. Three different PRNP alleles, wild-type (wt; glutamine at amino acid 95 and glycine at 96), Q95H (glutamine to histidine at amino acid position 95) and G96S (glycine to serine at position 96) were represented in the study cohort with 5 wt/wt, 3 wt/G96S, and 1 each wt/Q95H and Q95H/G96S. Two animals were lost to follow-up due to intercurrent disease. The inoculum was prepared from Wisconsin hunter-harvested homozygous wt/wt animals. All infected deer presented with clinical signs of CWD; the orally infected wt/wt had an average survival period of 693 days post inoculation (dpi) and G96S/wt deer had an average survival period of 956 dpi. The Q95H/wt and Q95H/G96S deer succumbed to CWD at 1,508 and 1,596 dpi respectively. These data show that polymorphisms in the PRNP gene affect CWD incubation period. Deer heterozygous for the PRNP alleles had extended incubation periods with the Q95H allele having the greatest effect.

  15. Evaluating paradox walnut rootstocks for resistance to Armillaria root disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The most common Juglans regia (English walnut) rootstock in California is Paradox, a hybrid between J. hindsii (Northern California black walnut) and J. regia. Unfortuntely, Paradox rootstock is highly susceptible to Armillaria root disease. The relative resistance of new clonal, Paradox rootstock...

  16. Identification of blast resistance genes for managing rice blast disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast, caused by the fungal pathogen Magnaporthe oryzae, is one of the most devastating diseases worldwide. In the present study, an international set of monogenic differentials carrying 24 major blast resistance (R) genes (Pia, Pib, Pii, Pik, Pik-h, Pik-m, Pik-p, Pik-s, Pish, Pit, Pita, Pita2,...

  17. Standardized Plant Disease Evaluations will Enhance Resistance Gene Discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene discovery and marker development using DNA based tools require plant populations with well-documented phenotypes. Related crops such as apples and pears may share a number of genes, for example resistance to common diseases, and data mining in one crop may reveal genes for the other. However, u...

  18. Loss of CMD2-mediated resistance to cassava mosaic disease in plants regenerated through somatic embryogenesis.

    PubMed

    Beyene, Getu; Chauhan, Raj Deepika; Wagaba, Henry; Moll, Theodore; Alicai, Titus; Miano, Douglas; Carrington, James C; Taylor, Nigel J

    2016-09-01

    Cassava mosaic disease (CMD) and cassava brown streak disease (CBSD) are the two most important viral diseases affecting cassava production in Africa. Three sources of resistance are employed to combat CMD: polygenic recessive resistance, termed CMD1, the dominant monogenic type, named CMD2, and the recently characterized CMD3. The farmer-preferred cultivar TME 204 carries inherent resistance to CMD mediated by CMD2, but is highly susceptible to CBSD. Selected plants of TME 204 produced for RNA interference (RNAi)-mediated resistance to CBSD were regenerated via somatic embryogenesis and tested in confined field trials in East Africa. Although micropropagated, wild-type TME 204 plants exhibited the expected levels of resistance, all plants regenerated via somatic embryogenesis were found to be highly susceptible to CMD. Glasshouse studies using infectious clones of East African cassava mosaic virus conclusively demonstrated that the process of somatic embryogenesis used to regenerate cassava caused the resulting plants to become susceptible to CMD. This phenomenon could be replicated in the two additional CMD2-type varieties TME 3 and TME 7, but the CMD1-type cultivar TMS 30572 and the CMD3-type cultivar TMS 98/0505 maintained resistance to CMD after passage through somatic embryogenesis. Data are presented to define the specific tissue culture step at which the loss of CMD resistance occurs and to show that the loss of CMD2-mediated resistance is maintained across vegetative generations. These findings reveal new aspects of the widely used technique of somatic embryogenesis, and the stability of field-level resistance in CMD2-type cultivars presently grown by farmers in East Africa, where CMD pressure is high.

  19. Animal genomics and infectious disease resistance in poultry.

    PubMed

    Smith, J; Gheyas, A; Burt, D W

    2016-04-01

    Avian pathogens are responsible for major costs to society, both in terms of huge economic losses to the poultry industry and their implications for human health. The health and welfare of millions of birds is under continued threat from many infectious diseases, some of which are increasing in virulence and thus becoming harder to control, such as Marek's disease virus and avian influenza viruses. The current era in animal genomics has seen huge developments in both technologies and resources, which means that researchers have never been in a better position to investigate the genetics of disease resistance and determine the underlying genes/mutations which make birds susceptible or resistant to infection. Avian genomics has reached a point where the biological mechanisms of infectious diseases can be investigated and understood in poultry and other avian species. Knowledge of genes conferring disease resistance can be used in selective breeding programmes or to develop vaccines which help to control the effects of these pathogens, which have such a major impact on birds and humans alike.

  20. Molecular mechanism of glucocorticoid resistance in inflammatory bowel disease

    PubMed Central

    De Iudicibus, Sara; Franca, Raffaella; Martelossi, Stefano; Ventura, Alessandro; Decorti, Giuliana

    2011-01-01

    Natural and synthetic glucocorticoids (GCs) are widely employed in a number of inflammatory, autoimmune and neoplastic diseases, and, despite the introduction of novel therapies, remain the first-line treatment for inducing remission in moderate to severe active Crohn’s disease and ulcerative colitis. Despite their extensive therapeutic use and the proven effectiveness, considerable clinical evidence of wide inter-individual differences in GC efficacy among patients has been reported, in particular when these agents are used in inflammatory diseases. In recent years, a detailed knowledge of the GC mechanism of action and of the genetic variants affecting GC activity at the molecular level has arisen from several studies. GCs interact with their cytoplasmic receptor, and are able to repress inflammatory gene expression through several distinct mechanisms. The glucocorticoid receptor (GR) is therefore crucial for the effects of these agents: mutations in the GR gene (NR3C1, nuclear receptor subfamily 3, group C, member 1) are the primary cause of a rare, inherited form of GC resistance; in addition, several polymorphisms of this gene have been described and associated with GC response and toxicity. However, the GR is not self-standing in the cell and the receptor-mediated functions are the result of a complex interplay of GR and many other cellular partners. The latter comprise several chaperonins of the large cooperative hetero-oligomeric complex that binds the hormone-free GR in the cytosol, and several factors involved in the transcriptional machinery and chromatin remodeling, that are critical for the hormonal control of target genes transcription in the nucleus. Furthermore, variants in the principal effectors of GCs (e.g. cytokines and their regulators) have also to be taken into account for a comprehensive evaluation of the variability in GC response. Polymorphisms in genes involved in the transport and/or metabolism of these hormones have also been

  1. Insecticide resistance in disease vectors from Mayotte: an opportunity for integrated vector management

    PubMed Central

    2014-01-01

    Background Mayotte, a small island in the Indian Ocean, has been affected for many years by vector-borne diseases. Malaria, Bancroftian filariasis, dengue, chikungunya and Rift Valley fever have circulated or still circulate on the island. They are all transmitted by Culicidae mosquitoes. To limit the impact of these diseases on human health, vector control has been implemented for more than 60 years on Mayotte. In this study, we assessed the resistance levels of four major vector species (Anopheles gambiae, Culex pipiens quinquefasciatus, Aedes aegypti and Aedes albopictus) to two types of insecticides: i) the locally currently-used insecticides (organophosphates, pyrethroids) and ii) alternative molecules that are promising for vector control and come from different insecticide families (bacterial toxins or insect growth regulators). When some resistance was found to one of these insecticides, we characterized the mechanisms involved. Methods Larval and adult bioassays were used to evaluate the level of resistance. When resistance was found, we tested for the presence of metabolic resistance through detoxifying enzyme activity assays, or for target-site mutations through molecular identification of known resistance alleles. Results Resistance to currently-used insecticides varied greatly between the four vector species. While no resistance to any insecticides was found in the two Aedes species, bioassays confirmed multiple resistance in Cx. p. quinquefasciatus (temephos: ~ 20 fold and deltamethrin: only 10% mortality after 24 hours). In An. gambiae, resistance was scarce: only a moderate resistance to temephos was found (~5 fold). This resistance appears to be due only to carboxyl-esterase overexpression and not to target modification. Finally, and comfortingly, none of the four species showed resistance to any of the new insecticides. Conclusions The low resistance observed in Mayotte’s main disease vectors is particularly interesting, because it leaves a

  2. Enhanced disease resistance caused by BRI1 mutation is conserved between Brachypodium distachyon and barley (Hordeum vulgare).

    PubMed

    Goddard, R; Peraldi, A; Ridout, C; Nicholson, P

    2014-10-01

    This study investigated the impact of brassinosteroid (BR)-insensitive 1 (BRI1) mutation, the main receptor of BR in both Brachypodium distachyon and barley, on disease resistance against a range of fungal pathogens of cereals exhibiting different trophic lifestyles. Results presented here show that i) disruption of BRI1 has pleiotropic effects on disease resistance in addition to affecting plant development. BR signaling functions antagonistically with mechanisms of disease resistance that are effective against a broad range of cereal pathogens. ii) Disruption of BRI1 results in increased disease resistance against necrotrophic and hemibiotrophic pathogens that exhibit only a marginal asymptomatic phase but has no effect on biotrophic pathogens or those with a prolonged asymptomatic phase, and iii) disruption of BRI1 has a similar effect on disease resistance in B. distachyon and barley, indicating that defense mechanisms are conserved between these species. This work presents the first evidence for conservation of disease resistance mechanisms between the model species B. distachyon and the cereal crop barley and validates B. distachyon for undertaking model-to-crop translation studies of disease resistance.

  3. Modulation of Phytoalexin Biosynthesis in Engineered Plants for Disease Resistance

    PubMed Central

    Jeandet, Philippe; Clément, Christophe; Courot, Eric; Cordelier, Sylvain

    2013-01-01

    Phytoalexins are antimicrobial substances of low molecular weight produced by plants in response to infection or stress, which form part of their active defense mechanisms. Starting in the 1950’s, research on phytoalexins has begun with biochemistry and bio-organic chemistry, resulting in the determination of their structure, their biological activity as well as mechanisms of their synthesis and their catabolism by microorganisms. Elucidation of the biosynthesis of numerous phytoalexins has permitted the use of molecular biology tools for the exploration of the genes encoding enzymes of their synthesis pathways and their regulators. Genetic manipulation of phytoalexins has been investigated to increase the disease resistance of plants. The first example of a disease resistance resulting from foreign phytoalexin expression in a novel plant has concerned a phytoalexin from grapevine which was transferred to tobacco. Transformations were then operated to investigate the potential of other phytoalexin biosynthetic genes to confer resistance to pathogens. Unexpectedly, engineering phytoalexins for disease resistance in plants seem to have been limited to exploiting only a few phytoalexin biosynthetic genes, especially those encoding stilbenes and some isoflavonoids. Research has rather focused on indirect approaches which allow modulation of the accumulation of phytoalexin employing transcriptional regulators or components of upstream regulatory pathways. Genetic approaches using gain- or less-of functions in phytoalexin engineering together with modulation of phytoalexin accumulation through molecular engineering of plant hormones and defense-related marker and elicitor genes have been reviewed. PMID:23880860

  4. Mutation in the C-Di-AMP Cyclase dacA Affects Fitness and Resistance of Methicillin Resistant Staphylococcus aureus

    PubMed Central

    Dengler, Vanina; McCallum, Nadine; Kiefer, Patrick; Christen, Philipp; Patrignani, Andrea; Vorholt, Julia A.; Berger-Bächi, Brigitte; Senn, Maria M.

    2013-01-01

    Faster growing and more virulent strains of methicillin resistant Staphylococcus aureus (MRSA) are increasingly displacing highly resistant MRSA. Elevated fitness in these MRSA is often accompanied by decreased and heterogeneous levels of methicillin resistance; however, the mechanisms for this phenomenon are not yet fully understood. Whole genome sequencing was used to investigate the genetic basis of this apparent correlation, in an isogenic MRSA strain pair that differed in methicillin resistance levels and fitness, with respect to growth rate. Sequencing revealed only one single nucleotide polymorphism (SNP) in the diadenylate cyclase gene dacA in the faster growing but less resistant strain. Diadenylate cyclases were recently discovered to synthesize the new second messenger cyclic diadenosine monophosphate (c-di-AMP). Introduction of this mutation into the highly resistant but slower growing strain reduced resistance and increased its growth rate, suggesting a direct connection between the dacA mutation and the phenotypic differences of these strains. Quantification of cellular c-di-AMP revealed that the dacA mutation decreased c-di-AMP levels resulting in reduced autolysis, increased salt tolerance and a reduction in the basal expression of the cell wall stress stimulon. These results indicate that c-di-AMP affects cell envelope-related signalling in S. aureus. The influence of c-di-AMP on growth rate and methicillin resistance in MRSA indicate that altering c-di-AMP levels could be a mechanism by which MRSA strains can increase their fitness levels by reducing their methicillin resistance levels. PMID:24013956

  5. Enhanced tomato disease resistance primed by arbuscular mycorrhizal fungus.

    PubMed

    Song, Yuanyuan; Chen, Dongmei; Lu, Kai; Sun, Zhongxiang; Zeng, Rensen

    2015-01-01

    Roots of most terrestrial plants form symbiotic associations (mycorrhiza) with soil- borne arbuscular mycorrhizal fungi (AMF). Many studies show that mycorrhizal colonization enhances plant resistance against pathogenic fungi. However, the mechanism of mycorrhiza-induced disease resistance remains equivocal. In this study, we found that mycorrhizal inoculation with AMF Funneliformis mosseae significantly alleviated tomato (Solanum lycopersicum Mill.) early blight disease caused by Alternaria solani Sorauer. AMF pre-inoculation led to significant increases in activities of β-1,3-glucanase, chitinase, phenylalanine ammonia-lyase (PAL) and lipoxygenase (LOX) in tomato leaves upon pathogen inoculation. Mycorrhizal inoculation alone did not influence the transcripts of most genes tested. However, pathogen attack on AMF-inoculated plants provoked strong defense responses of three genes encoding pathogenesis-related proteins, PR1, PR2, and PR3, as well as defense-related genes LOX, AOC, and PAL, in tomato leaves. The induction of defense responses in AMF pre-inoculated plants was much higher and more rapid than that in un-inoculated plants in present of pathogen infection. Three tomato genotypes: a Castlemart wild-type (WT) plant, a jasmonate (JA) biosynthesis mutant (spr2), and a prosystemin-overexpressing 35S::PS plant were used to examine the role of the JA signaling pathway in AMF-primed disease defense. Pathogen infection on mycorrhizal 35S::PS plants led to higher induction of defense-related genes and enzymes relative to WT plants. However, pathogen infection did not induce these genes and enzymes in mycorrhizal spr2 mutant plants. Bioassays showed that 35S::PS plants were more resistant and spr2 plants were more susceptible to early blight compared with WT plants. Our finding indicates that mycorrhizal colonization enhances tomato resistance to early blight by priming systemic defense response, and the JA signaling pathway is essential for mycorrhiza

  6. Enhanced tomato disease resistance primed by arbuscular mycorrhizal fungus

    PubMed Central

    Song, Yuanyuan; Chen, Dongmei; Lu, Kai; Sun, Zhongxiang; Zeng, Rensen

    2015-01-01

    Roots of most terrestrial plants form symbiotic associations (mycorrhiza) with soil- borne arbuscular mycorrhizal fungi (AMF). Many studies show that mycorrhizal colonization enhances plant resistance against pathogenic fungi. However, the mechanism of mycorrhiza-induced disease resistance remains equivocal. In this study, we found that mycorrhizal inoculation with AMF Funneliformis mosseae significantly alleviated tomato (Solanum lycopersicum Mill.) early blight disease caused by Alternaria solani Sorauer. AMF pre-inoculation led to significant increases in activities of β-1,3-glucanase, chitinase, phenylalanine ammonia-lyase (PAL) and lipoxygenase (LOX) in tomato leaves upon pathogen inoculation. Mycorrhizal inoculation alone did not influence the transcripts of most genes tested. However, pathogen attack on AMF-inoculated plants provoked strong defense responses of three genes encoding pathogenesis-related proteins, PR1, PR2, and PR3, as well as defense-related genes LOX, AOC, and PAL, in tomato leaves. The induction of defense responses in AMF pre-inoculated plants was much higher and more rapid than that in un-inoculated plants in present of pathogen infection. Three tomato genotypes: a Castlemart wild-type (WT) plant, a jasmonate (JA) biosynthesis mutant (spr2), and a prosystemin-overexpressing 35S::PS plant were used to examine the role of the JA signaling pathway in AMF-primed disease defense. Pathogen infection on mycorrhizal 35S::PS plants led to higher induction of defense-related genes and enzymes relative to WT plants. However, pathogen infection did not induce these genes and enzymes in mycorrhizal spr2 mutant plants. Bioassays showed that 35S::PS plants were more resistant and spr2 plants were more susceptible to early blight compared with WT plants. Our finding indicates that mycorrhizal colonization enhances tomato resistance to early blight by priming systemic defense response, and the JA signaling pathway is essential for mycorrhiza

  7. Resistance to Gastrointestinal nematodse of cattle: Identification of genomic regions affecting resistance and potential mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gastrointestinal nematode infections remain a major economic drain on the efficient raising of cattle throughout the world. The recent demonstrations of the appearance of drug resistance in these parasites underscores the problems associated with a complete reliance on anthelmintics to control econ...

  8. Prediction of disease-related mutations affecting protein localization

    PubMed Central

    Laurila, Kirsti; Vihinen, Mauno

    2009-01-01

    Background Eukaryotic cells contain numerous compartments, which have different protein constituents. Proteins are typically directed to compartments by short peptide sequences that act as targeting signals. Translocation to the proper compartment allows a protein to form the necessary interactions with its partners and take part in biological networks such as signalling and metabolic pathways. If a protein is not transported to the correct intracellular compartment either the reaction performed or information carried by the protein does not reach the proper site, causing either inactivation of central reactions or misregulation of signalling cascades, or the mislocalized active protein has harmful effects by acting in the wrong place. Results Numerous methods have been developed to predict protein subcellular localization with quite high accuracy. We applied bioinformatics methods to investigate the effects of known disease-related mutations on protein targeting and localization by analyzing over 22,000 missense mutations in more than 1,500 proteins with two complementary prediction approaches. Several hundred putative localization affecting mutations were identified and investigated statistically. Conclusion Although alterations to localization signals are rare, these effects should be taken into account when analyzing the consequences of disease-related mutations. PMID:19309509

  9. Inflammatory Bowel Disease and Mutations Affecting the Interleukin-10 Receptor

    PubMed Central

    Glocker, Erik-Oliver; Kotlarz, Daniel; Boztug, Kaan; Gertz, E. Michael; Schäffer, Alejandro A.; Noyan, Fatih; Perro, Mario; Diestelhorst, Jana; Allroth, Anna; Murugan, Dhaarini; Hätscher, Nadine; Pfeifer, Dietmar; Sykora, Karl-Walter; Sauer, Martin; Kreipe, Hans; Lacher, Martin; Nustede, Rainer; Woellner, Cristina; Baumann, Ulrich; Salzer, Ulrich; Koletzko, Sibylle; Shah, Neil; Segal, Anthony W.; Sauerbrey, Axel; Buderus, Stephan; Snapper, Scott B.; Grimbacher, Bodo; Klein, Christoph

    2009-01-01

    BACKGROUND The molecular cause of inflammatory bowel disease is largely unknown. METHODS We performed genetic-linkage analysis and candidate-gene sequencing on samples from two unrelated consanguineous families with children who were affected by early-onset inflammatory bowel disease. We screened six additional patients with early-onset colitis for mutations in two candidate genes and carried out functional assays in patients’ peripheral-blood mononuclear cells. We performed an allogeneic hematopoietic stem-cell transplantation in one patient. RESULTS In four of nine patients with early-onset colitis, we identified three distinct homozygous mutations in genes IL10RA and IL10RB, encoding the IL10R1 and IL10R2 proteins, respectively, which form a heterotetramer to make up the interleukin-10 receptor. The mutations abrogate interleukin-10–induced signaling, as shown by deficient STAT3 (signal transducer and activator of transcription 3) phosphorylation on stimulation with interleukin-10. Consistent with this observation was the increased secretion of tumor necrosis factor α and other proinflammatory cytokines from peripheral-blood mononuclear cells from patients who were deficient in IL10R subunit proteins, suggesting that interleukin-10–dependent “negative feedback” regulation is disrupted in these cells. The allogeneic stem-cell transplantation performed in one patient was successful. CONCLUSIONS Mutations in genes encoding the IL10R subunit proteins were found in patients with early-onset enterocolitis, involving hyperinflammatory immune responses in the intestine. Allogeneic stem-cell transplantation resulted in disease remission in one patient. PMID:19890111

  10. Engineering for disease resistance: persistent obstacles clouding tangible opportunities.

    PubMed

    Mullins, Ewen

    2015-05-01

    The accelerating pace of gene discovery, coupled with novel plant breeding technologies, provides tangible opportunities with which to engineer disease resistance into agricultural and horticultural crops. This is especially the case for potato, wheat, apple and banana, which are afflicted with fungal and bacterial diseases that impact significantly on each crop's economic viability. Yet public scepticism and burdensome regulatory systems remain the two primary obstacles preventing the translation of research discoveries into cultivars of agronomic value. In this perspective review, the potential to address these issues is explained, and specific opportunities arising from recent genomics-based initiatives are highlighted as clear examples of what can be achieved in respect of developing disease resistance in crop species. There is an urgent need to tackle the challenge of agrichemical dependency in current crop production systems, and, while engineering for disease resistance is possible, it is not the sole solution and should not be proclaimed as so. Instead, all systems must be given due consideration, with none dismissed in the absence of science-based support, thereby ensuring that future cropping systems have the necessary advantage over those pathogens that continue to inflict losses year after year.

  11. Engineering for disease resistance: persistent obstacles clouding tangible opportunities.

    PubMed

    Mullins, Ewen

    2015-05-01

    The accelerating pace of gene discovery, coupled with novel plant breeding technologies, provides tangible opportunities with which to engineer disease resistance into agricultural and horticultural crops. This is especially the case for potato, wheat, apple and banana, which are afflicted with fungal and bacterial diseases that impact significantly on each crop's economic viability. Yet public scepticism and burdensome regulatory systems remain the two primary obstacles preventing the translation of research discoveries into cultivars of agronomic value. In this perspective review, the potential to address these issues is explained, and specific opportunities arising from recent genomics-based initiatives are highlighted as clear examples of what can be achieved in respect of developing disease resistance in crop species. There is an urgent need to tackle the challenge of agrichemical dependency in current crop production systems, and, while engineering for disease resistance is possible, it is not the sole solution and should not be proclaimed as so. Instead, all systems must be given due consideration, with none dismissed in the absence of science-based support, thereby ensuring that future cropping systems have the necessary advantage over those pathogens that continue to inflict losses year after year. PMID:25353158

  12. Food plant derived disease tolerance and resistance in a natural butterfly-plant-parasite interactions.

    PubMed

    Sternberg, Eleanore D; Lefèvre, Thierry; Li, James; de Castillejo, Carlos Lopez Fernandez; Li, Hui; Hunter, Mark D; de Roode, Jacobus C

    2012-11-01

    Organisms can protect themselves against parasite-induced fitness costs through resistance or tolerance. Resistance includes mechanisms that prevent infection or limit parasite growth while tolerance alleviates the fitness costs from parasitism without limiting infection. Although tolerance and resistance affect host-parasite coevolution in fundamentally different ways, tolerance has often been ignored in animal-parasite systems. Where it has been studied, tolerance has been assumed to be a genetic mechanism, unaffected by the host environment. Here we studied the effects of host ecology on tolerance and resistance to infection by rearing monarch butterflies on 12 different species of milkweed food plants and infecting them with a naturally occurring protozoan parasite. Our results show that monarch butterflies experience different levels of tolerance to parasitism depending on the species of milkweed that they feed on, with some species providing over twofold greater tolerance than other milkweed species. Resistance was also affected by milkweed species, but there was no relationship between milkweed-conferred resistance and tolerance. Chemical analysis suggests that infected monarchs obtain highest fitness when reared on milkweeds with an intermediate concentration, diversity, and polarity of toxic secondary plant chemicals known as cardenolides. Our results demonstrate that environmental factors-such as interacting species in ecological food webs-are important drivers of disease tolerance. PMID:23106703

  13. The Use of Kosher Phenotyping for Mapping QTL Affecting Susceptibility to Bovine Respiratory Disease

    PubMed Central

    Eitam, Harel; Yishay, Moran; Schiavini, Fausta; Soller, Morris; Bagnato, Alessandro; Shabtay, Ariel

    2016-01-01

    Bovine respiratory disease (BRD) is the leading cause of morbidity and mortality in feedlot cattle, caused by multiple pathogens that become more virulent in response to stress. As clinical signs often go undetected and various preventive strategies failed, identification of genes affecting BRD is essential for selection for resistance. Selective DNA pooling (SDP) was applied in a genome wide association study (GWAS) to map BRD QTLs in Israeli Holstein male calves. Kosher scoring of lung adhesions was used to allocate 122 and 62 animals to High (Glatt Kosher) and Low (Non-Kosher) resistant groups, respectively. Genotyping was performed using the Illumina BovineHD BeadChip according to the Infinium protocol. Moving average of -logP was used to map QTLs and Log drop was used to define their boundaries (QTLRs). The combined procedure was efficient for high resolution mapping. Nineteen QTLRs distributed over 13 autosomes were found, some overlapping previous studies. The QTLRs contain polymorphic functional and expression candidate genes to affect kosher status, with putative immunological and wound healing activities. Kosher phenotyping was shown to be a reliable means to map QTLs affecting BRD morbidity. PMID:27077383

  14. Resistance to infectious diseases is a heritable trait in rabbits.

    PubMed

    Gunia, M; David, I; Hurtaud, J; Maupin, M; Gilbert, H; Garreau, H

    2015-12-01

    Selection for disease resistance is a powerful way to improve the health status of herds and to reduce the use of antibiotics. The objectives of this study were to estimate 1) the genetic parameters for simple visually assessed disease syndromes and for a composite trait of resistance to infectious disease including all syndromes and 2) their genetic correlations with production traits in a rabbit population. Disease symptoms were recorded in the selection herds of 2 commercial paternal rabbit lines during weighing at the end of the test (63 and 70 d of age, respectively). Causes of mortality occurring before these dates were also recorded. Seven disease traits were analyzed: 3 elementary traits visually assessed by technicians on farm (diarrhea, various digestive syndromes, and respiratory syndromes), 2 composite traits (all digestive syndromes and all infectious syndromes), and 2 mortality traits (digestive mortality and infectious mortality). Each animal was assigned only 1 disease trait, corresponding to the main syndrome ( = 153,400). Four production traits were also recorded: live weight the day before the end of test on most animals ( = 137,860) and cold carcass weight, carcass yield, and perirenal fat percentage of the carcass on a subset of slaughtered animals ( = 13,765). Records on both lines were analyzed simultaneously using bivariate linear animal models after validation of consistency with threshold models applied to logit-transformed traits. The heritabilities were low for disease traits, from 0.01 ± 0.002 for various digestive syndromes to 0.04 ± 0.004 for infectious mortality, and moderate to high for production traits. The genetic correlations between digestive syndromes were high and positive, whereas digestive and respiratory syndromes were slightly negatively correlated. The genetic correlations between the composite infectious disease trait and digestive or respiratory syndromes were moderate. Genetic correlations between disease and

  15. The drinking water treatment process as a potential source of affecting the bacterial antibiotic resistance.

    PubMed

    Bai, Xiaohui; Ma, Xiaolin; Xu, Fengming; Li, Jing; Zhang, Hang; Xiao, Xiang

    2015-11-15

    Two waterworks, with source water derived from the Huangpu or Yangtze River in Shanghai, were investigated, and the effluents were plate-screened for antibiotic-resistant bacteria (ARB) using five antibiotics: ampicillin (AMP), kanamycin (KAN), rifampicin (RFP), chloramphenicol (CM) and streptomycin (STR). The influence of water treatment procedures on the bacterial antibiotic resistance rate and the changes that bacteria underwent when exposed to the five antibiotics at concentration levels ranging from 1 to 100 μg/mL were studied. Multi-drug resistance was also analyzed using drug sensitivity tests. The results indicated that bacteria derived from water treatment plant effluent that used the Huangpu River rather than the Yangtze River as source water exhibited higher antibiotic resistance rates against AMP, STR, RFP and CM but lower antibiotic resistance rates against KAN. When the antibiotic concentration levels ranged from 1 to 10 μg/mL, the antibiotic resistance rates of the bacteria in the water increased as water treatment progressed. Biological activated carbon (BAC) filtration played a key role in increasing the antibiotic resistance rate of bacteria. Chloramine disinfection can enhance antibiotic resistance. Among the isolated ARB, 75% were resistant to multiple antibiotics. Ozone oxidation, BAC filtration and chloramine disinfection can greatly affect the relative abundance of bacteria in the community.

  16. Insulin resistance in clinical and experimental alcoholic liver disease

    PubMed Central

    Carr, Rotonya M.; Correnti, Jason

    2015-01-01

    Alcoholic liver disease (ALD) is the number one cause of liver failure worldwide; its management costs billions of health care dollars annually. Since the advent of the obesity epidemic, insulin resistance and diabetes have become common clinical findings in patients with ALD; and the development of insulin resistance predicts the progression from simple steatosis to cirrhosis in ALD patients. Both clinical and experimental data implicate the impairment of several mediators of insulin signaling in ALD, and experimental data suggest that insulin-sensitizing therapies improve liver histology. This review explores the contribution of impaired insulin signaling in ALD and summarizes the current understanding of the synergistic relationship between alcohol and nutrient excess in promoting hepatic inflammation and disease. PMID:25998863

  17. Fluconazole resistance in cryptococcal disease: emerging or intrinsic?

    PubMed

    Cheong, Jenny Wan Sai; McCormack, Joe

    2013-04-01

    With the widespread use of long-term fluconazole prophylaxis and suppressive treatment, the potential development of fluconazole resistance poses a threat to the management of cryptococcal disease. Interpretive breakpoints for the in vitro antifungal susceptibility testing of C. neoformans have not been established and it is unclear whether the fluconazole minimum inhibitory concentration (MIC) is clinically relevant. To gain insight into the management of patients with cryptococcosis who fail fluconazole therapy, we conducted a PubMed literature search for cases of fluconazole-resistant cryptococcosis reported from 1991 to 2011. A total of 20 such cases were identified in which most patients had AIDS and 30% had never had prior exposure to fluconazole. Fluconazole failure in patients with cryptococcal disease cannot be fully attributed to emerging resistance of the etiologic agent and heteroresistance is a potential alternative mechanism. There is a need to refine the definition of fluconazole-resistant cryptococcosis and additional studies of such patients will improve treatment strategies and outcomes.

  18. Interferon-Inducible GTPases in Host Resistance, Inflammation and Disease.

    PubMed

    Pilla-Moffett, Danielle; Barber, Matthew F; Taylor, Gregory A; Coers, Jörn

    2016-08-28

    Cell-autonomous immunity is essential for host organisms to defend themselves against invasive microbes. In vertebrates, both the adaptive and the innate branches of the immune system operate cell-autonomous defenses as key effector mechanisms that are induced by pro-inflammatory interferons (IFNs). IFNs can activate cell-intrinsic host defenses in virtually any cell type ranging from professional phagocytes to mucosal epithelial cells. Much of this IFN-induced host resistance program is dependent on four families of IFN-inducible GTPases: the myxovirus resistance proteins, the immunity-related GTPases, the guanylate-binding proteins (GBPs), and the very large IFN-inducible GTPases. These GTPase families provide host resistance to a variety of viral, bacterial, and protozoan pathogens through the sequestration of microbial proteins, manipulation of vesicle trafficking, regulation of antimicrobial autophagy (xenophagy), execution of intracellular membranolytic pathways, and the activation of inflammasomes. This review discusses our current knowledge of the molecular function of IFN-inducible GTPases in providing host resistance, as well as their role in the pathogenesis of autoinflammatory Crohn's disease. While substantial advances were made in the recent past, few of the known functions of IFN-inducible GTPases have been explored in any depth, and new functions await discovery. This review will therefore highlight key areas of future exploration that promise to advance our understanding of the role of IFN-inducible GTPases in human diseases. PMID:27181197

  19. Developmental acclimation to low or high humidity conditions affect starvation and heat resistance of Drosophila melanogaster.

    PubMed

    Parkash, Ravi; Ranga, Poonam; Aggarwal, Dau Dayal

    2014-09-01

    Several Drosophila species originating from tropical humid localities are more resistant to starvation and heat stress than populations from high latitudes but mechanistic bases of such physiological changes are largely unknown. In order to test whether humidity levels affect starvation and heat resistance, we investigated developmental acclimation effects of low to high humidity conditions on the storage and utilization of energy resources, body mass, starvation survival, heat knockdown and heat survival of D. melanogaster. Isofemale lines reared under higher humidity (85% RH) stored significantly higher level of lipids and showed greater starvation survival hours but smaller in body size. In contrast, lines reared at low humidity evidenced reduced levels of body lipids and starvation resistance. Starvation resistance and lipid storage level were higher in females than males. However, the rate of utilization of lipids under starvation stress was lower for lines reared under higher humidity. Adult flies of lines reared at 65% RH and acclimated under high or low humidity condition for 200 hours also showed changes in resistance to starvation and heat but such effects were significantly lower as compared with developmental acclimation. Isofemale lines reared under higher humidity showed greater heat knockdown time and heat-shock survival. These laboratory observations on developmental and adult acclimation effects of low versus high humidity conditions have helped in explaining seasonal changes in resistance to starvation and heat of the wild-caught flies of D. melanogaster. Thus, we may suggest that wet versus drier conditions significantly affect starvation and heat resistance of D. melanogaster.

  20. A Cmv2 QTL on chromosome X affects MCMV resistance in New Zealand male mice.

    PubMed

    Rodriguez, Marisela R; Lundgren, Alyssa; Sabastian, Pearl; Li, Qian; Churchill, Gary; Brown, Michael G

    2009-07-01

    NK cell-mediated resistance to viruses is subject to genetic control in humans and mice. Here we used classical and quantitative genetic strategies to examine NK-mediated murine cytomegalovirus (MCMV) control in genealogically related New Zealand white (NZW) and black (NZB) mice. NZW mice display NK cell-dependent MCMV resistance while NZB NK cells fail to limit viral replication after infection. Unlike Ly49H(+) NK resistance in C57BL/6 mice, NZW NK-mediated MCMV control was Ly49H-independent. Instead, MCMV resistance in NZW (Cmv2) involves multiple genetic factors. To establish the genetic basis of Cmv2 resistance, we further characterized a major chromosome X-linked resistance locus (DXMit216) responsible for innate MCMV control in NZW x NZB crosses. We found that the DXMit216 locus affects early MCMV control in New Zealand F(2) crosses and demonstrate that the NZB-derived DXMit216 allele enhances viral resistance in F(2) males. The evolutionary conservation of the DXMit216 region in mice and humans suggests that a Cmv2-related mechanism may affect human antiviral responses.

  1. A review of factors affecting vaccine preventable disease in Japan.

    PubMed

    Kuwabara, Norimitsu; Ching, Michael S L

    2014-12-01

    Japan is well known as a country with a strong health record. However its incidence rates of vaccine preventable diseases (VPD) such as hepatitis B, measles, mumps, rubella, and varicella remain higher than other developed countries. This article reviews the factors that contribute to the high rates of VPD in Japan. These include historical and political factors that delayed the introduction of several important vaccines until recently. Access has also been affected by vaccines being divided into government-funded "routine" (eg, polio, pertussis) and self-pay "voluntary" groups (eg, hepatitis A and B). Routine vaccines have higher rates of administration than voluntary vaccines. Administration factors include differences in well child care schedules, the approach to simultaneous vaccination, vaccination contraindication due to fever, and vaccination spacing. Parental factors include low intention to fully vaccinate their children and misperceptions about side effects and efficacy. There are also provider knowledge gaps regarding indications, adverse effects, interval, and simultaneous vaccination. These multifactorial issues combine to produce lower population immunization rates and a higher incidence of VPD than other developed countries. This article will provide insight into the current situation of Japanese vaccinations, the issues to be addressed and suggestions for public health promotion. PMID:25628969

  2. Subthalamic nucleus stimulation affects incentive salience attribution in Parkinson's disease.

    PubMed

    Serranová, Tereza; Jech, Robert; Dušek, Petr; Sieger, Tomáš; Růžička, Filip; Urgošík, Dušan; Růžička, Evžen

    2011-10-01

    Deep brain stimulation (DBS) of the subthalamic nucleus (STN) can induce nonmotor side effects such as behavioral and mood disturbances or body weight gain in Parkinson's disease (PD) patients. We hypothesized that some of these problems could be related to an altered attribution of incentive salience (ie, emotional relevance) to rewarding and aversive stimuli. Twenty PD patients (all men; mean age ± SD, 58.3 ± 6 years) in bilateral STN DBS switched ON and OFF conditions and 18 matched controls rated pictures selected from the International Affective Picture System according to emotional valence (unpleasantness/pleasantness) and arousal on 2 independent visual scales ranging from 1 to 9. Eighty-four pictures depicting primary rewarding (erotica and food) and aversive fearful (victims and threat) and neutral stimuli were selected for this study. In the STN DBS ON condition, the PD patients attributed lower valence scores to the aversive pictures compared with the OFF condition (P < .01) and compared with controls (P < .01). The difference between the OFF condition and controls was less pronounced (P < .05). Furthermore, postoperative weight gain correlated with arousal ratings from the food pictures in the STN DBS ON condition (P < .05 compensated for OFF condition). Our results suggest that STN DBS increases activation of the aversive motivational system so that more relevance is attributed to aversive fearful stimuli. In addition, STN DBS-related sensitivity to food reward stimuli cues might drive DBS-treated patients to higher food intake and subsequent weight gain. PMID:21780183

  3. A Review of Factors Affecting Vaccine Preventable Disease in Japan

    PubMed Central

    Ching, Michael SL

    2014-01-01

    Japan is well known as a country with a strong health record. However its incidence rates of vaccine preventable diseases (VPD) such as hepatitis B, measles, mumps, rubella, and varicella remain higher than other developed countries. This article reviews the factors that contribute to the high rates of VPD in Japan. These include historical and political factors that delayed the introduction of several important vaccines until recently. Access has also been affected by vaccines being divided into government-funded “routine” (eg, polio, pertussis) and self-pay “voluntary” groups (eg, hepatitis A and B). Routine vaccines have higher rates of administration than voluntary vaccines. Administration factors include differences in well child care schedules, the approach to simultaneous vaccination, vaccination contraindication due to fever, and vaccination spacing. Parental factors include low intention to fully vaccinate their children and misperceptions about side effects and efficacy. There are also provider knowledge gaps regarding indications, adverse effects, interval, and simultaneous vaccination. These multifactorial issues combine to produce lower population immunization rates and a higher incidence of VPD than other developed countries. This article will provide insight into the current situation of Japanese vaccinations, the issues to be addressed and suggestions for public health promotion. PMID:25628969

  4. [THE MANIC DEPRESSIVE DISEASE: PSYCHODYNAMICS ASPECTS AND AFFECTIVE SYNTONY].

    PubMed

    Widakowich, Christian

    2015-01-01

    In a time when manic-depressive disease became bipolar disorder, and it is conceptualized and treated almost as a fully medical illness, such as epilepsy, we found worth returning to some psychodynamic aspects underlying this condition. Conventionally, we depart from the concept of melancholy, to introduce in a second time, the mania, as a liberating solution of the depression. To Abraham (1912), mania is the liberation from suffering imposed by the reality principle For Freud (1915), mania becomes a leak from the ego face a tyrannical superego (the encounter of ego and the ego ideal). Klein (1934) explains that the mania serves to counter the depressive position and thus avoid the guilt inside of ego. For Racamier (1979), mania is clearly a frantic negation of the anguish and emotional suffering. Today, some authors as Chabot and Husain try to define the manic depression organization, with the help of projective tests. This personality structure would be between psychosis and borderline. An axial element of this structure is the research for an affective symbiosis with each other. These concept, strongly resemble the "syntony", from Bleuler. We trace the evolution of manic depression from a psychodynamic and structural point of view, with particular interesting in the concept of syntony. PMID:26323110

  5. The complex interplay of iron, biofilm formation, and mucoidy affecting antimicrobial resistance of Pseudomonas aeruginosa

    PubMed Central

    Oglesby-Sherrouse, Amanda G.; Djapgne, Louise; Nguyen, Angela T.; Vasil, Adriana I.; Vasil, Michael L.

    2014-01-01

    Pseudomonas aeruginosa is a Gram-negative opportunistic bacterial pathogen that is refractory to a variety of current antimicrobial therapeutic regimens. Complicating treatment of such infections is the ability of P. aeruginosa to form biofilms, as well as several innate and acquired resistance mechanisms. Previous studies suggest iron plays a role in resistance to antimicrobial therapy, including the efficacy of an FDA-approved iron chelator, deferasirox (DSX), or Gallium, an iron analog, in potentiating antibiotic-dependent killing of P. aeruginosa biofilms. Here we show that iron-replete conditions enhance resistance of P. aeruginosa nonbiofilm growth against tobramycin and tigecycline. Interestingly, the mechanism of iron-enhanced resistance to each of these antibiotics is distinct. Whereas pyoverdine-mediated iron uptake is important for optimal resistance to tigecycline, it does not enhance tobramycin resistance. In contrast, heme supplementation results in increased tobramycin resistance, while having no significant effect on tigecycline resistance. Thus, non-siderophore bound iron plays an important role in resistance to tobramycin, while pyoverdine increases the ability of P. aeruginosa to resist tigecycline treatment. Lastly, we show that iron increases the minimal concentration of tobramycin, but not tigecycline, required to eradicate P. aeruginosa biofilms. Moreover, iron depletion blocks the previous observed induction of biofilm formation by sub-inhibitory concentrations of tobramycin, suggesting iron and tobramycin signal through overlapping regulatory pathways to affect biofilm formation. These data further support the role of iron in P. aeruginosa antibiotic resistance, providing yet another compelling case for targeting iron acquisition for future antimicrobial drug development. PMID:24436170

  6. Factors affecting regional pulmonary blood flow in chronic ischemic heart disease

    SciTech Connect

    Pistolesi, M.; Miniati, M.; Bonsignore, M.; Andreotti, F.; Di Ricco, G.; Marini, C.; Rindi, M.; Biagini, A.; Milne, E.N.; Giuntini, C.

    1988-07-01

    To assess the effect of left heart disease on pulmonary blood flow distribution, we measured mean pulmonary arterial and wedge pressures, cardiac output, pulmonary vascular resistance, pulmonary blood volume, and arterial oxygen tension before and after treatment in 13 patients with longstanding ischemic heart failure and pulmonary edema. Pulmonary edema was evaluated by a radiographic score, and regional lung perfusion was quantified on a lung scan by the upper to lower third ratio (U:L ratio) of pulmonary blood flow per unit of lung volume. In all cases, redistribution of lung perfusion toward the apical regions was observed; this pattern was not affected by treatment. After treatment, pulmonary vascular pressures, resistance, and edema were reduced, while pulmonary blood volume did not change. At this time, pulmonary vascular resistance showed a positive correlation with the U:L ratio (r = 0.78; P less than 0.01), whereas no correlation was observed between U:L ratio and wedge pressure, pulmonary edema, or arterial oxygen tension. Hence, redistribution of pulmonary blood flow, in these patients, reflects chronic structural vascular changes prevailing in the dependent lung regions.

  7. Renal Lipotoxicity-Associated Inflammation and Insulin Resistance Affects Actin Cytoskeleton Organization in Podocytes

    PubMed Central

    Vivas, Yurena; Velasco, Ismael; Yeo, Tet-Kin; Chen, Sheldon; Medina-Gomez, Gema

    2015-01-01

    In the last few decades a change in lifestyle has led to an alarming increase in the prevalence of obesity and obesity-associated complications. Obese patients are at increased risk of developing hypertension, heart disease, insulin resistance (IR), dyslipidemia, type 2 diabetes and renal disease. The excess calories are stored as triglycerides in adipose tissue, but also may accumulate ectopically in other organs, including the kidney, which contributes to the damage through a toxic process named lipotoxicity. Recently, the evidence suggests that renal lipid accumulation leads to glomerular damage and, more specifically, produces dysfunction in podocytes, key cells that compose and maintain the glomerular filtration barrier. Our aim was to analyze the early mechanisms underlying the development of renal disease associated with the process of lipotoxicity in podocytes. Our results show that treatment of podocytes with palmitic acid produced intracellular accumulation of lipid droplets and abnormal glucose and lipid metabolism. This was accompanied by the development of inflammation, oxidative stress and endoplasmic reticulum stress and insulin resistance. We found specific rearrangements of the actin cytoskeleton and slit diaphragm proteins (Nephrin, P-Cadherin, Vimentin) associated with this insulin resistance in palmitic-treated podocytes. We conclude that lipotoxicity accelerates glomerular disease through lipid accumulation and inflammation. Moreover, saturated fatty acids specifically promote insulin resistance by disturbing the cytoarchitecture of podocytes. These data suggest that renal lipid metabolism and cytoskeleton rearrangements may serve as a target for specific therapies aimed at slowing the progression of podocyte failure during metabolic syndrome. PMID:26545114

  8. Renal Lipotoxicity-Associated Inflammation and Insulin Resistance Affects Actin Cytoskeleton Organization in Podocytes.

    PubMed

    Martínez-García, Cristina; Izquierdo-Lahuerta, Adriana; Vivas, Yurena; Velasco, Ismael; Yeo, Tet-Kin; Chen, Sheldon; Medina-Gomez, Gema

    2015-01-01

    In the last few decades a change in lifestyle has led to an alarming increase in the prevalence of obesity and obesity-associated complications. Obese patients are at increased risk of developing hypertension, heart disease, insulin resistance (IR), dyslipidemia, type 2 diabetes and renal disease. The excess calories are stored as triglycerides in adipose tissue, but also may accumulate ectopically in other organs, including the kidney, which contributes to the damage through a toxic process named lipotoxicity. Recently, the evidence suggests that renal lipid accumulation leads to glomerular damage and, more specifically, produces dysfunction in podocytes, key cells that compose and maintain the glomerular filtration barrier. Our aim was to analyze the early mechanisms underlying the development of renal disease associated with the process of lipotoxicity in podocytes. Our results show that treatment of podocytes with palmitic acid produced intracellular accumulation of lipid droplets and abnormal glucose and lipid metabolism. This was accompanied by the development of inflammation, oxidative stress and endoplasmic reticulum stress and insulin resistance. We found specific rearrangements of the actin cytoskeleton and slit diaphragm proteins (Nephrin, P-Cadherin, Vimentin) associated with this insulin resistance in palmitic-treated podocytes. We conclude that lipotoxicity accelerates glomerular disease through lipid accumulation and inflammation. Moreover, saturated fatty acids specifically promote insulin resistance by disturbing the cytoarchitecture of podocytes. These data suggest that renal lipid metabolism and cytoskeleton rearrangements may serve as a target for specific therapies aimed at slowing the progression of podocyte failure during metabolic syndrome. PMID:26545114

  9. Evidence for a reserpine-affected mechanism of resistance to tetracycline in Neisseria gonorrhoeae.

    PubMed

    Ruiz, Joaquim; Ribera, Anna; Jurado, Angels; Marco, Francesc; Vila, Jordi

    2005-10-01

    The presence of a reserpine-affected mechanism of tetracycline resistance was investigated in 17 Neisseria gonorrhoeae clinical isolates. To establish this fact the MIC of tetracycline in the presence and absence of reserpine was determined, and, in addition, mechanisms of tetracycline resistance were analyzed by PCR. The results showed that reserpine affects the MIC of tetracycline at least 4-fold in all isolates, including those containing the tetM gene. An inhibitory effect of reserpine against the MtrCDE efflux system was ruled out by using strains either with an inactive or with an unrepressed MtrCDE system. The results suggest the presence of a constitutive system of resistance to tetracycline, by a possible efflux pump, which may be inhibited by reserpine. Further studies are required to determine the exact nature of the action of reserpine on the MIC of tetracycline. PMID:16309425

  10. A signaling protease required for melanization in Drosophila affects resistance and tolerance of infections.

    PubMed

    Ayres, Janelle S; Schneider, David S

    2008-12-01

    Organisms evolve two routes to surviving infections-they can resist pathogen growth (resistance) and they can endure the pathogenesis of infection (tolerance). The sum of these two properties together defines the defensive capabilities of the host. Typically, studies of animal defenses focus on either understanding resistance or, to a lesser extent, tolerance mechanisms, thus providing little understanding of the relationship between these two mechanisms. We suggest there are nine possible pairwise permutations of these traits, assuming they can increase, decrease, or remain unchanged in an independent manner. Here we show that by making a single mutation in the gene encoding a protease, CG3066, active in the melanization cascade in Drosophila melanogaster, we observe the full spectrum of changes; these mutant flies show increases and decreases in their resistance and tolerance properties when challenged with a variety of pathogens. This result implicates melanization in fighting microbial infections and shows that an immune response can affect both resistance and tolerance to infections in microbe-dependent ways. The fly is often described as having an unsophisticated and stereotypical immune response where single mutations cause simple binary changes in immunity. We report a level of complexity in the fly's immune response that has strong ecological implications. We suggest that immune responses are highly tuned by evolution, since selection for defenses that alter resistance against one pathogen may change both resistance and tolerance to other pathogens.

  11. Cancer tolerance, resistance, pathogenicity and virulence: deconstructing the disease state.

    PubMed

    van Niekerk, Gustav; Loos, Benjamin; Nell, Theo; Engelbrecht, Anna-Mart

    2016-06-01

    Immunologists have recently taken note of the fact that a host not only resists infection, but also exhibits a capacity to manage the pathology associated with such infection - a concept referred to as tolerance. Here we explore how the tolerance/resistance (T/R) framework can be implemented within an oncological context and explore a number of implications. In particular, the T/R framework distinguishes between pathology manifesting from extensive tumor burden, versus cancers intrinsically expressing a more pathogenic phenotype. Consequently, the T/R framework provides novel methodology in studying the nature of cancer pathology and for marker identification. Additionally, this framework may aid in redefining the therapeutic end point under suitable circumstances: establishing cancer as a chronic, manageable disease. PMID:27029525

  12. Modeling mass drug treatment and resistant filaria disease transmission

    NASA Astrophysics Data System (ADS)

    Fuady, A. M.; Nuraini, N.; Soewono, E.; Tasman, H.; Supriatna, A. K.

    2014-03-01

    It has been indicated that a long term application of combined mass drug treatment may contribute to the development of drug resistance in lymphatic filariasis. This phenomenon is not well understood due to the complexity of filaria life cycle. In this paper we formulate a mathematical model for the spread of mass drug resistant in a filaria endemic region. The model is represented in a 13-dimensional Host-Vector system. The basic reproductive ratio of the system which is obtained from the next generation matrix, and analysis of stability of both the disease free equilibrium and the coexistence equilibria are shown. Numerical simulation for long term dynamics for possible field conditions is also shown.

  13. Antimicrobial resistance and management of invasive Salmonella disease

    PubMed Central

    Kariuki, Samuel; Gordon, Melita A.; Feasey, Nicholas; Parry, Christopher M

    2015-01-01

    Invasive Salmonella infections (typhoidal and non-typhoidal) cause a huge burden of illness estimated at nearly 3.4 million cases and over 600,000 deaths annually especially in resource-limited settings. Invasive non-typhoidal Salmonella (iNTS) infections are particularly important in immunosuppressed populations especially in sub-Saharan Africa, causing a mortality of 20–30% in vulnerable children below 5 years of age. In these settings, where routine surveillance for antimicrobial resistance is rare or non-existent, reports of 50–75% multidrug resistance (MDR) in NTS are common, including strains of NTS also resistant to flouroquinolones and 3rd generation cephalosporins. Typhoid (enteric) fever caused by Salmonella Typhi and Salmonella Paratyphi A remains a major public health problem in many parts of Asia and Africa. Currently over a third of isolates in many endemic areas are MDR, and diminished susceptibility or resistance to fluoroquinolones, the drugs of choice for MDR cases over the last decade is an increasing problem. The situation is particularly worrying in resource-limited settings where the few remaining effective antimicrobials are either unavailable or altogether too expensive to be afforded by either the general public or by public health services. Although the prudent use of effective antimicrobials, improved hygiene and sanitation and the discovery of new antimicrobial agents may offer hope for the management of invasive salmonella infections, it is essential to consider other interventions including the wider use of WHO recommended typhoid vaccines and the acceleration of trials for novel iNTS vaccines. The main objective of this review is to describe existing data on the prevalence and epidemiology of antimicrobial resistant invasive Salmonella infections and how this affects the management of these infections, especially in endemic developing countries. PMID:25912288

  14. Antimicrobial resistance and management of invasive Salmonella disease.

    PubMed

    Kariuki, Samuel; Gordon, Melita A; Feasey, Nicholas; Parry, Christopher M

    2015-06-19

    Invasive Salmonella infections (typhoidal and non-typhoidal) cause a huge burden of illness estimated at nearly 3.4 million cases and over 600,000 deaths annually especially in resource-limited settings. Invasive non-typhoidal Salmonella (iNTS) infections are particularly important in immunosuppressed populations especially in sub-Saharan Africa, causing a mortality of 20-30% in vulnerable children below 5 years of age. In these settings, where routine surveillance for antimicrobial resistance is rare or non-existent, reports of 50-75% multidrug resistance (MDR) in NTS are common, including strains of NTS also resistant to flouroquinolones and 3rd generation cephalosporins. Typhoid (enteric) fever caused by Salmonella Typhi and Salmonella Paratyphi A remains a major public health problem in many parts of Asia and Africa. Currently over a third of isolates in many endemic areas are MDR, and diminished susceptibility or resistance to fluoroquinolones, the drugs of choice for MDR cases over the last decade is an increasing problem. The situation is particularly worrying in resource-limited settings where the few remaining effective antimicrobials are either unavailable or altogether too expensive to be afforded by either the general public or by public health services. Although the prudent use of effective antimicrobials, improved hygiene and sanitation and the discovery of new antimicrobial agents may offer hope for the management of invasive salmonella infections, it is essential to consider other interventions including the wider use of WHO recommended typhoid vaccines and the acceleration of trials for novel iNTS vaccines. The main objective of this review is to describe existing data on the prevalence and epidemiology of antimicrobial resistant invasive Salmonella infections and how this affects the management of these infections, especially in endemic developing countries.

  15. Are stomatal responses the key to understanding the cost of fungal disease resistance in plants?

    PubMed

    Withers, Catherine M; Gay, Alan P; Mur, Luis A J

    2011-07-01

    Preventing disease in cereal crops is important for maintaining productivity and as the availability and efficacy of chemical control becomes reduced the emphasis on breeding for disease resistance increases. However, there is evidence that disease resistance may be physiologically costly to the plant and we ask if understanding stomatal responses to fungal attack is the key to minimising reductions in growth associated with disease resistance.

  16. Peanut rust (Puccinia arachidis Speg.) disease: its background and recent accomplishments towards disease resistance breeding.

    PubMed

    Mondal, Suvendu; Badigannavar, A M

    2015-11-01

    The peanut rust disease is an economically important biotic stress that significantly reduces the pod and fodder yield and oil quality. It is caused by the basidiomycete fungus Puccinia arachidis Speg. which belongs to class Pucciniomycetes like other rust fungus but has fewer occurrences in teliospore form. The P. arachidis predominantly spreads by the repeated cycle of uredospores in the field. The disease is prevalent in most of the countries where peanut is cultivated and favored by warm and humid climatic conditions. Despite its economic importance, very limited work has been carried out on host-fungus interaction, fungal genetic diversity, and physiological specialization. The present review describes different aspects of P. arachidis especially its symptomatology, cell biological aspects of pathogenesis, epidemiology, and physiology of resistance as well as developments on genetics and genomics of host resistance, and resistance breeding. The review will help to understand the behavior of this causal organism and the host resistance and subsequently design the breeding approaches to check the spread of the disease.

  17. Agrarian diet and diseases of affluence – Do evolutionary novel dietary lectins cause leptin resistance?

    PubMed Central

    Jönsson, Tommy; Olsson, Stefan; Ahrén, Bo; Bøg-Hansen, Thorkild C; Dole, Anita; Lindeberg, Staffan

    2005-01-01

    Background The global pattern of varying prevalence of diseases of affluence, such as obesity, cardiovascular disease and diabetes, suggests that some environmental factor specific to agrarian societies could initiate these diseases. Presentation of the hypothesis We propose that a cereal-based diet could be such an environmental factor. Through previous studies in archaeology and molecular evolution we conclude that humans and the human leptin system are not specifically adapted to a cereal-based diet, and that leptin resistance associated with diseases of affluence could be a sign of insufficient adaptation to such a diet. We further propose lectins as a cereal constituent with sufficient properties to cause leptin resistance, either through effects on metabolism central to the proper functions of the leptin system, and/or directly through binding to human leptin or human leptin receptor, thereby affecting the function. Testing the hypothesis Dietary interventions should compare effects of agrarian and non-agrarian diets on incidence of diseases of affluence, related risk factors and leptin resistance. A non-significant (p = 0.10) increase of cardiovascular mortality was noted in patients advised to eat more whole-grain cereals. Our lab conducted a study on 24 domestic pigs in which a cereal-free hunter-gatherer diet promoted significantly higher insulin sensitivity, lower diastolic blood pressure and lower C-reactive protein as compared to a cereal-based swine feed. Testing should also evaluate the effects of grass lectins on the leptin system in vivo by diet interventions, and in vitro in various leptin and leptin receptor models. Our group currently conducts such studies. Implications of the hypothesis If an agrarian diet initiates diseases of affluence it should be possible to identify the responsible constituents and modify or remove them so as to make an agrarian diet healthier. PMID:16336696

  18. Infectious diseases affect marine fisheries and aquaculture economics

    USGS Publications Warehouse

    Lafferty, Kevin D.; Harvell, C. Drew; Conrad, Jon M.; Friedman, Carolyn S.; Kent, Michael L.; Kuris, Armand M.; Powell, Eric N.; Rondeau, Daniel; Saksida, Sonja M.

    2015-01-01

    Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.

  19. Infectious diseases affect marine fisheries and aquaculture economics.

    PubMed

    Lafferty, Kevin D; Harvell, C Drew; Conrad, Jon M; Friedman, Carolyn S; Kent, Michael L; Kuris, Armand M; Powell, Eric N; Rondeau, Daniel; Saksida, Sonja M

    2015-01-01

    Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern. PMID:25251276

  20. Infectious diseases affect marine fisheries and aquaculture economics.

    PubMed

    Lafferty, Kevin D; Harvell, C Drew; Conrad, Jon M; Friedman, Carolyn S; Kent, Michael L; Kuris, Armand M; Powell, Eric N; Rondeau, Daniel; Saksida, Sonja M

    2015-01-01

    Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.

  1. Infectious Diseases Affect Marine Fisheries and Aquaculture Economics

    NASA Astrophysics Data System (ADS)

    Lafferty, Kevin D.; Harvell, C. Drew; Conrad, Jon M.; Friedman, Carolyn S.; Kent, Michael L.; Kuris, Armand M.; Powell, Eric N.; Rondeau, Daniel; Saksida, Sonja M.

    2015-01-01

    Seafood is a growing part of the economy, but its economic value is diminished by marine diseases. Infectious diseases are common in the ocean, and here we tabulate 67 examples that can reduce commercial species' growth and survivorship or decrease seafood quality. These impacts seem most problematic in the stressful and crowded conditions of aquaculture, which increasingly dominates seafood production as wild fishery production plateaus. For instance, marine diseases of farmed oysters, shrimp, abalone, and various fishes, particularly Atlantic salmon, cost billions of dollars each year. In comparison, it is often difficult to accurately estimate disease impacts on wild populations, especially those of pelagic and subtidal species. Farmed species often receive infectious diseases from wild species and can, in turn, export infectious agents to wild species. However, the impact of disease export on wild fisheries is controversial because there are few quantitative data demonstrating that wild species near farms suffer more from infectious diseases than those in other areas. The movement of exotic infectious agents to new areas continues to be the greatest concern.

  2. FACTORS AFFECTING SUSCEPTIBILITY OF THE CORAL MONTASTRAEA FAVEOLATE TO BLACK-BAND DISEASE

    EPA Science Inventory

    Black-band disease affects many species of tropical reef-building corals, but it is unclear what factors contribute to the disease-susceptibility of individual corals or how the disease is transmitted between colonies. Studies have suggested that the ability of black-band disease...

  3. TRANSPORTER POLYMORPHISMS AFFECT NORMAL PHYSIOLOGY, DISEASES, AND PHARMACOTHERAPY

    PubMed Central

    Sissung, Tristan M.; Troutman, Sarah M.; Campbell, Tessa J; Pressler, Heather M.; Sung, Hyeyoung; Bates, Susan E.; Figg, William D.

    2014-01-01

    Drug transporters mediate the movement of endobiotics and xenobiotics across biological membranes in multiple organs and in most tissues. As such, they are involved in physiology, development of disease, drug pharmacokinetics, and ultimately the clinical response to myriad medications. Genetic variants in transporters cause population-specific differences in drug transport and are responsible for considerable inter-individual variation in physiology and pharmacotherapy. The purpose of this review is to provide a broad overview of how inherited variants in transporters are associated with disease etiology, disease state, and the pharmacological treatment of diseases. Given that there are thousands of published papers related to the interplay between transporter genetics and medicine, this review will provide examples that exemplify the broader focus of the literature. PMID:22284781

  4. Transcriptional response of virus-infected cassava and identification of putative sources of resistance for cassava brown streak disease.

    PubMed

    Maruthi, M N; Bouvaine, Sophie; Tufan, Hale A; Mohammed, Ibrahim U; Hillocks, Rory J

    2014-01-01

    Cassava (Manihot esculenta) is a major food staple in sub-Saharan Africa, which is severely affected by cassava brown streak disease (CBSD). The aim of this study was to identify resistance for CBSD as well as to understand the mechanism of putative resistance for providing effective control for the disease. Three cassava varieties; Kaleso, Kiroba and Albert were inoculated with cassava brown streak viruses by grafting and also using the natural insect vector the whitefly, Bemisia tabaci. Kaleso expressed mild or no disease symptoms and supported low concentrations of viruses, which is a characteristic of resistant plants. In comparison, Kiroba expressed severe leaf but milder root symptoms, while Albert was susceptible with severe symptoms both on leaves and roots. Real-time PCR was used to estimate virus concentrations in cassava varieties. Virus quantities were higher in Kiroba and Albert compared to Kaleso. The Illumina RNA-sequencing was used to further understand the genetic basis of resistance. More than 700 genes were uniquely overexpressed in Kaleso in response to virus infection compared to Albert. Surprisingly, none of them were similar to known resistant gene orthologs. Some of the overexpressed genes, however, belonged to the hormone signalling pathways and secondary metabolites, both of which are linked to plant resistance. These genes should be further characterised before confirming their role in resistance to CBSD.

  5. How urbanization affects the epidemiology of emerging infectious diseases

    PubMed Central

    Neiderud, Carl-Johan

    2015-01-01

    The world is becoming more urban every day, and the process has been ongoing since the industrial revolution in the 18th century. The United Nations now estimates that 3.9 billion people live in urban centres. The rapid influx of residents is however not universal and the developed countries are already urban, but the big rise in urban population in the next 30 years is expected to be in Asia and Africa. Urbanization leads to many challenges for global health and the epidemiology of infectious diseases. New megacities can be incubators for new epidemics, and zoonotic diseases can spread in a more rapid manner and become worldwide threats. Adequate city planning and surveillance can be powerful tools to improve the global health and decrease the burden of communicable diseases. PMID:26112265

  6. Chestnut resistance to the blight disease: insights from transcriptome analysis

    PubMed Central

    2012-01-01

    Background A century ago, Chestnut Blight Disease (CBD) devastated the American chestnut. Backcross breeding has been underway to introgress resistance from Chinese chestnut into surviving American chestnut genotypes. Development of genomic resources for the family Fagaceae, has focused in this project on Castanea mollissima Blume (Chinese chestnut) and Castanea dentata (Marsh.) Borkh (American chestnut) to aid in the backcross breeding effort and in the eventual identification of blight resistance genes through genomic sequencing and map based cloning. A previous study reported partial characterization of the transcriptomes from these two species. Here, further analyses of a larger dataset and assemblies including both 454 and capillary sequences were performed and defense related genes with differential transcript abundance (GDTA) in canker versus healthy stem tissues were identified. Results Over one and a half million cDNA reads were assembled into 34,800 transcript contigs from American chestnut and 48,335 transcript contigs from Chinese chestnut. Chestnut cDNA showed higher coding sequence similarity to genes in other woody plants than in herbaceous species. The number of genes tagged, the length of coding sequences, and the numbers of tagged members within gene families showed that the cDNA dataset provides a good resource for studying the American and Chinese chestnut transcriptomes. In silico analysis of transcript abundance identified hundreds of GDTA in canker versus healthy stem tissues. A significant number of additional DTA genes involved in the defense-response not reported in a previous study were identified here. These DTA genes belong to various pathways involving cell wall biosynthesis, reactive oxygen species (ROS), salicylic acid (SA), ethylene, jasmonic acid (JA), abscissic acid (ABA), and hormone signalling. DTA genes were also identified in the hypersensitive response and programmed cell death (PCD) pathways. These DTA genes are candidates

  7. Early Huntington's Disease Affects Movements in Transformed Sensorimotor Mappings

    ERIC Educational Resources Information Center

    Boulet, C.; Lemay, M.; Bedard, M.A.; Chouinard, M.J.; Chouinard, S.; Richer, F.

    2005-01-01

    This study examined the effect of transformed visual feedback on movement control in Huntington's disease (HD). Patients in the early stages of HD and controls performed aiming movements towards peripheral targets on a digitizing tablet and emphasizing precision. In a baseline condition, HD patients were slower but showed few precision problems in…

  8. Concomitant gastroparesis negatively affects children with functional gallbladder disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The aim of the present study was to determine whether concomitant gastroparesis and biliary dyskinesia (BD) occur in children, and if so, to determine whether concomitant gastroparesis affects clinical outcome in children with BD. We conducted a retrospective chart review of children with BD (ejecti...

  9. PDT in periodontal disease of HAART resistance patients

    NASA Astrophysics Data System (ADS)

    Giovani, Elcio M.; Noro-Filho, Gilberto A.; Caputo, Bruno V.; Casarin, Renato; Costa, Claudio; Salgado, Daniela; Santos, Camila C.

    2016-03-01

    HIV/Aids patients present a change of microbiota associated with host immunodeficiency. Photodynamic therapy (PDT) showed as a promising and viable alternative in reducing microbiota. Present study evaluate effectiveness of photodynamic therapy in periodontal disease of AIDS patients with highly activity antiretroviral therapy (HAART) failure, measuring the clinical periodontal parameters and periodontal microbiota. Twelve patients with HARRT resistance (R group) divided into two groups (control and PDT) and 12 patients with no HAART resistance (NR group) divided into two groups (control and PDT). The results show the difference in baseline of CD4 cells count, NR group 640.0 +/- 176.2 cells/mm3 R group and 333.3 +/- 205.8 cells / mm3 (p<0.05), and in 8.3% detectable viral load in NR group and 75% detectable (p <0.001) in R group. As clinical periodontal parameters (PD and CAL), PDT was more effective than the control group only in the NR group (p <0.05%), moreover, there was no difference in the evaluation of clinical periodontal parameters between the both R groups (p>0.05%). Microbiological evaluation in R group presents a general reduction in the Aa at 3 and 6 months. Furthermore, demonstrated a reduction of Pg in all groups at 6 months and in R group at 3 months. The impact assessment of photodynamic therapy in patients with different levels of immunosuppression determined that the combination of mechanical periodontal treatment with photodynamic therapy in patients with HAART failure did not cause additional benefits. Therefore, PDT in this study could not been indicated in HAART resistance patients.

  10. Insulin resistance, small LDL particles, and risk for atherosclerotic disease.

    PubMed

    Toth, Peter P

    2014-01-01

    There is a global epidemic of obesity, metabolic syndrome, and diabetes mellitus. Insulin resistance (IR) is etiologic for both metabolic syndrome and diabetes mellitus. IR induces a broad range of toxic systemic effects, including dyslipidemia, hypertension, hyperglycemia, increased production of advanced glycosylation end products, increased inflammatory tone, as well as a prothrombotic and pro-oxidative state. Patients with IR are highly vulnerable to the development of accelerated atherosclerosis as well its clinical sequelae, including coronary artery disease and myocardial infarction, carotid artery disease and ischemic stroke, peripheral arterial disease and claudication/lower extremity amputation, and coronary mortality. Among the most important risk factors patients afflicted with IR develop is the so-called atherogenic lipid triad: large numbers of small, dense low-density lipoprotein (sdLDL) particles, hypertriglyceridemia, and low serum concentrations of high-density lipoprotein cholesterol. Though controversial, much recent evidence suggests that the formation of sdLDL particles in the setting of IR is an important metabolic transition. Some studies suggest that these smaller particles are more atherogenic than their larger, more buoyant counterparts. At least part of the explanation for the apparent augmented atherogenicity of small LDL particles is their reduced systemic clearance by the LDL receptor, increased vulnerability to oxidation rendering them more apt for scavenging by macrophages, and possible increased flux into the subendothelial space of arterial walls. Numerous small studies suggest that sdLDL is highly correlated with cardiovascular events. Cardiovascular medicine is in need of a large prospective, randomized study that would more definitively investigate the impact of small, dense LDL (sdLDL) on risk for cardiovascular disease and whether therapeutic interventions designed to specifically reduce the burden of sdLDL are associated

  11. Semantic Trouble Sources and Their Repair in Conversations Affected by Parkinson's Disease

    ERIC Educational Resources Information Center

    Saldert, Charlotta; Ferm, Ulrika; Bloch, Steven

    2014-01-01

    Background: It is known that dysarthria arising from Parkinson's disease may affect intelligibility in conversational interaction. Research has also shown that Parkinson's disease may affect cognition and cause word-retrieval difficulties and pragmatic problems in the use of language. However, it is not known whether or how these…

  12. Plant Chitinases and Their Roles in Resistance to Fungal Diseases

    PubMed Central

    Punja, Zamir K.; Zhang, Ye-Yan

    1993-01-01

    Chitinases are enzymes that hydrolyze the N-acetylglucosamine polymer chitin, and they occur in diverse plant tissues over a broad range of crop and noncrop species. The enzymes may be expressed constitutively at low levels but are dramatically enhanced by numerous abiotic agents (ethylene, salicylic acid, salt solutions, ozone, UV light) and by biotic factors (fungi, bacteria, viruses, viroids, fungal cell wall components, and oligosaccharides). Different classes of plant chitinases are distinguishable by molecular, biochemical, and physicochemical criteria. Thus, plant chitinases may differ in substrate-binding characteristics, localization within the cell, and specific activities. Because chitin is a structural component of the cell wall of many phytopathogenic fungi, extensive research has been conducted to determine whether plant chitinases have a role in defense against fungal diseases. Plant chitinases have different degrees of antifungal activity to several fungi in vitro. In vivo, although rapid accumulation and high levels of chitinases (together with numerous other pathogenesis-related proteins) occur in resistant tissues expressing a hypersensitive reaction, high levels also can occur in susceptible tissues. Expression of cloned chitinase genes in transgenic plants has provided further evidence for their role in plant defense. The level of protection observed in these plants is variable and may be influenced by the specific activity of the enzyme, its localization and concentration within the cell, the characteristics of the fungal pathogen, and the nature of the host-pathogen interaction. The expression of chitinase in combination with one or several different antifungal proteins should have a greater effect on reducing disease development, given the complexities of fungal-plant cell interactions and resistance responses in plants. The effects of plant chitinases on nematode development in vitro and in vivo are worthy of investigation. PMID:19279806

  13. Inflammation and Oxidative Stress: The Molecular Connectivity between Insulin Resistance, Obesity, and Alzheimer's Disease

    PubMed Central

    Verdile, Giuseppe; Keane, Kevin N.; Cruzat, Vinicius F.; Medic, Sandra; Sabale, Miheer; Rowles, Joanne; Wijesekara, Nadeeja; Martins, Ralph N.; Fraser, Paul E.; Newsholme, Philip

    2015-01-01

    Type 2 diabetes (T2DM), Alzheimer's disease (AD), and insulin resistance are age-related conditions and increased prevalence is of public concern. Recent research has provided evidence that insulin resistance and impaired insulin signalling may be a contributory factor to the progression of diabetes, dementia, and other neurological disorders. Alzheimer's disease (AD) is the most common subtype of dementia. Reduced release (for T2DM) and decreased action of insulin are central to the development and progression of both T2DM and AD. A literature search was conducted to identify molecular commonalities between obesity, diabetes, and AD. Insulin resistance affects many tissues and organs, either through impaired insulin signalling or through aberrant changes in both glucose and lipid (cholesterol and triacylglycerol) metabolism and concentrations in the blood. Although epidemiological and biological evidence has highlighted an increased incidence of cognitive decline and AD in patients with T2DM, the common molecular basis of cell and tissue dysfunction is rapidly gaining recognition. As a cause or consequence, the chronic inflammatory response and oxidative stress associated with T2DM, amyloid-β (Aβ) protein accumulation, and mitochondrial dysfunction link T2DM and AD. PMID:26693205

  14. Major viral diseases affecting fish aquaculture in Spain.

    PubMed

    Pérez, S I; Rodríguez, S

    1997-06-01

    The number of viruses isolated from fish has grown in the last few years as a reflection of the increasing interest in fish diseases, particularly those occurring in aquaculture facilities. Of all the described viruses, only a few are considered to be of serious concern and economic importance; they are described in this review, drawing special attention to the four families of viruses (Birnaviridae, Rhabdoviridae, Iridoviridae and Reoviridae) that have been reported in Spanish aquaculture. Infectious pancreatic necrosis virus, a member of the first family, is the most spread virus with a prevalence of 39%. Viral diseases are untreatable and because effective and safe vaccines for fish are not yet commercially available, a great care needs to be exercised when moving fish or eggs from one site or country to another. Some fish health control regulations have been legislated in Europe and USA.

  15. Issues affecting minority participation in research studies of Alzheimer disease.

    PubMed

    Welsh, Kathleen A; Ballard, Edna; Nash, Florence; Raiford, Kate; Harrell, Lindy

    1994-01-01

    Despite the need for minority subjects in research studies of Alzheimer disease (AD), the successful involvement of minority patients in such studies has been difficult. This report discusses the many societal, economic, logistical, and attitudinal barriers that have inhibited the participation of minority patients and their families in medical research programs of AD. Special consideration is given to the unique cultural issues that arise when conducting studies involving African-American elderly subjects. Methods are considered for overcoming the barriers to participation gleaned from the national study CERAD (Consortium to Establish a Registry of Alzheimer Disease) and other investigations of AD. Recommendations are made for future research programs targeted on the specific health care needs and concerns of the minority segments of our population.

  16. Mesenchymal Stromal Cells Affect Disease Outcomes via Macrophage Polarization

    PubMed Central

    Zheng, Guoping; Ge, Menghua; Qiu, Guanguan; Shu, Qiang; Xu, Jianguo

    2015-01-01

    Mesenchymal stromal cells (MSCs) are multipotent and self-renewable cells that reside in almost all postnatal tissues. In recent years, many studies have reported the effect of MSCs on the innate and adaptive immune systems. MSCs regulate the proliferation, activation, and effector function of T lymphocytes, professional antigen presenting cells (dendritic cells, macrophages, and B lymphocytes), and NK cells via direct cell-to-cell contact or production of soluble factors including indoleamine 2,3-dioxygenase, prostaglandin E2, tumor necrosis factor-α stimulated gene/protein 6, nitric oxide, and IL-10. MSCs are also able to reprogram macrophages from a proinflammatory M1 phenotype toward an anti-inflammatory M2 phenotype capable of regulating immune response. Because of their capacity for differentiation and immunomodulation, MSCs have been used in many preclinical and clinical studies as possible new therapeutic agents for the treatment of autoimmune, degenerative, and inflammatory diseases. In this review, we discuss the central role of MSCs in macrophage polarization and outcomes of diseases such as wound healing, brain/spinal cord injuries, and diseases of heart, lung, and kidney in animal models. PMID:26257791

  17. Identification of QTL affecting resistance/susceptibility to acute Actinobacillus pleuropneumoniae infection in swine.

    PubMed

    Reiner, Gerald; Bertsch, Natalie; Hoeltig, Doris; Selke, Martin; Willems, Hermann; Gerlach, Gerald Friedrich; Tuemmler, Burkhard; Probst, Inga; Herwig, Ralf; Drungowski, Mario; Waldmann, Karl Heinz

    2014-04-01

    Actinobacillus pleuropneumoniae is among the most important pathogens worldwide in pig production. The agent can cause severe economic losses due to decreased performance, acute or chronic pleuropneumonia and an increased incidence of death. Therapeutics cannot be used in a sustainable manner, and vaccination is not always available, but discovering more about host defence and disease mechanisms might lead to new methods of prophylaxis. The aim of the present study was to detect quantitative trait loci (QTL) associated with resistance/susceptibility to A. pleuropneumoniae. Under controlled conditions, 170 F2 animals of a Hampshire/Landrace family, with known differences in founder populations regarding A. pleuropneumoniae resistance, were challenged with an A. pleuropneumoniae serotype 7 aerosol followed by a detailed clinical, radiographic, ultrasonographic, pathological and bacteriological examination. F2 pigs were genotyped with 159 microsatellite markers. Significant QTL were identified on Sus scrofa chromosomes (SSC) 2, 6, 12, 13, 16, 17 and 18. They explained 6-22% of phenotypic variance. One QTL on SSC2 reached significance on a genome-wide level for five associated phenotypic traits. A multiple regression analysis revealed a combinatory effect of markers SWR345 (SSC2) and S0143 (SSC12) on Respiratory Health Score, Clinical Score and the occurrence of death. The results indicate the genetic background of A. pleuropneumoniae resistance in swine and provide new insights into the genetic architecture of resistance/susceptibility to porcine pleuropneumonia. The results will be helpful in identifying the underlying genes and mechanisms.

  18. Genetics and vaccine efficacy: host genetic variation affecting Marek's disease vaccine efficacy in White Leghorn chickens.

    PubMed

    Chang, S; Dunn, J R; Heidari, M; Lee, L F; Song, J; Ernst, C W; Ding, Z; Bacon, L D; Zhang, H

    2010-10-01

    Marek's disease (MD) is a T-cell lymphoma disease of domestic chickens induced by MD virus (MDV), a naturally oncogenic and highly contagious cell-associated α-herpesvirus. Earlier reports have shown that the MHC haplotype as well as non-MHC genes are responsible for genetic resistance to MD. The MHC was also shown to affect efficiency of vaccine response. Using specific-pathogen-free chickens from a series of 19 recombinant congenic strains and their 2 progenitor lines (lines 6(3) and 7(2)), vaccine challenge experiments were conducted to examine the effect of host genetic variation on vaccine efficacy. The 21 inbred lines of White Leghorns share the same B*2 MHC haplotype and the genome of each recombinant congenic strain differs by a random 1/8 sample of the susceptible donor line (7(2)) genome. Chickens from each of the lines were divided into 2 groups. One was vaccinated with turkey herpesvirus strain FC126 at the day of hatch and the other was treated as a nonvaccinated control. Chickens of both groups were inoculated with a very virulent plus strain of MDV on the fifth day posthatch. Analyses of the MD data showed that the genetic line significantly influenced MD incidence and days of survival post-MDV infection after vaccination of chickens (P<0.01). The protective indices against MD varied greatly among the lines with a range of 0 up to 84%. This is the first evidence that non-MHC host genetic variation significantly affects MD vaccine efficacy in chickens in a designed prospective study.

  19. Factors affecting treatment outcomes in drug-resistant tuberculosis cases in the Northern Cape, South Africa.

    PubMed

    Elliott, E; Draper, H R; Baitsiwe, P; Claassens, M M

    2014-09-21

    The Northern Cape Province has low cure rates (21%) for multidrug-resistant tuberculosis (TB). We audited the programme to identify factors affecting treatment outcomes. Cases admitted to two drug-resistant TB units from 2007 to 2009 had data extracted from clinical folders. Unfavourable treatment outcomes were found in 58% of the 272 cases. A multivariable regression analysis found that male sex was associated with unfavourable outcome (P = 0.009). Weight at diagnosis (P < 0.001) and oral drug adherence (P < 0.001) were also associated with an unfavourable outcome; however, injectable drug adherence was not (P = 0.395). Positive baseline smear and human immunodeficiency virus positive status were not associated with unfavourable outcome. Shorter, more patient-friendly regimens may go a long way to improving adherence and outcomes.

  20. European Sea Bass (Dicentrarchus labrax) Immune Status and Disease Resistance Are Impaired by Arginine Dietary Supplementation.

    PubMed

    Azeredo, Rita; Pérez-Sánchez, Jaume; Sitjà-Bobadilla, Ariadna; Fouz, Belén; Tort, Lluis; Aragão, Cláudia; Oliva-Teles, Aires; Costas, Benjamín

    2015-01-01

    Infectious diseases and fish feeds management are probably the major expenses in the aquaculture business. Hence, it is a priority to define sustainable strategies which simultaneously avoid therapeutic procedures and reinforce fish immunity. Currently, one preferred approach is the use of immunostimulants which can be supplemented to the fish diets. Arginine is a versatile amino acid with important mechanisms closely related to the immune response. Aiming at finding out how arginine affects the innate immune status or improve disease resistance of European seabass (Dicentrarchus labrax) against vibriosis, fish were fed two arginine-supplemented diets (1% and 2% arginine supplementation). A third diet meeting arginine requirement level for seabass served as control diet. Following 15 or 29 days of feeding, fish were sampled for blood, spleen and gut to assess cell-mediated immune parameters and immune-related gene expression. At the same time, fish from each dietary group were challenged against Vibrio anguillarum and survival was monitored. Cell-mediated immune parameters such as the extracellular superoxide and nitric oxide decreased in fish fed arginine-supplemented diets. Interleukins and immune-cell marker transcripts were down-regulated by the highest supplementation level. Disease resistance data were in accordance with a generally depressed immune status, with increased susceptibility to vibriosis in fish fed arginine supplemented diets. Altogether, these results suggest a general inhibitory effect of arginine on the immune defences and disease resistance of European seabass. Still, further research will certainly clarify arginine immunomodulation pathways thereby allowing the validation of its potential as a prophylactic strategy.

  1. European Sea Bass (Dicentrarchus labrax) Immune Status and Disease Resistance Are Impaired by Arginine Dietary Supplementation

    PubMed Central

    Azeredo, Rita; Pérez-Sánchez, Jaume; Sitjà-Bobadilla, Ariadna; Fouz, Belén; Tort, Lluis; Aragão, Cláudia; Oliva-Teles, Aires; Costas, Benjamín

    2015-01-01

    Infectious diseases and fish feeds management are probably the major expenses in the aquaculture business. Hence, it is a priority to define sustainable strategies which simultaneously avoid therapeutic procedures and reinforce fish immunity. Currently, one preferred approach is the use of immunostimulants which can be supplemented to the fish diets. Arginine is a versatile amino acid with important mechanisms closely related to the immune response. Aiming at finding out how arginine affects the innate immune status or improve disease resistance of European seabass (Dicentrarchus labrax) against vibriosis, fish were fed two arginine-supplemented diets (1% and 2% arginine supplementation). A third diet meeting arginine requirement level for seabass served as control diet. Following 15 or 29 days of feeding, fish were sampled for blood, spleen and gut to assess cell-mediated immune parameters and immune-related gene expression. At the same time, fish from each dietary group were challenged against Vibrio anguillarum and survival was monitored. Cell-mediated immune parameters such as the extracellular superoxide and nitric oxide decreased in fish fed arginine-supplemented diets. Interleukins and immune-cell marker transcripts were down-regulated by the highest supplementation level. Disease resistance data were in accordance with a generally depressed immune status, with increased susceptibility to vibriosis in fish fed arginine supplemented diets. Altogether, these results suggest a general inhibitory effect of arginine on the immune defences and disease resistance of European seabass. Still, further research will certainly clarify arginine immunomodulation pathways thereby allowing the validation of its potential as a prophylactic strategy. PMID:26447480

  2. Vector-borne pathogens: New and emerging arboviral diseases affecting public health

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dengue and Zika have quickly become two of the most important vector-borne diseases affecting Public health around the world. This presentation will introduce vector-borne diseases and all the vectors implicated. A focus will be made on the most important arboviral diseases (Zika and dengue) describ...

  3. Electrical Resistivity Monitoring for Leachate Distribution at Two Foot-and-Mouth- Disease (FMD) Burial Sites

    NASA Astrophysics Data System (ADS)

    Lee, S.; Kaown, D.; Lee, K.; Leem, K.; Ko, K.

    2011-12-01

    The main objective of this study was to provide the basic information on leachate distribution with time changes through the electrical resistivity monitoring for a certain period of time in the Foot-and-Mouth-Disease (FMD) burial facilities which is needed to prevent further soil and groundwater contamination and to build an effective plan for stabilization of the burial site. In this study, dipole-dipoles surveys were carried out around two FMD burial sites in Iceon-si, Gyeonggi-do. The FMD burial facility installed at Daewall-myeon is consists of one block but, at Yul-myeon, it is divided into 2 blocks named A and B blocks. Dipole-Dipole surveys with 8 lines at Yul-myeon and 3 lines at Daewall-myeon were carried out. The observed leachate distribution along survey lines was not clearly evident as time passes at Daewall-myeon site, but, at Yul-myeon site, the leachate distribution around the survey lines showed a decrease of resistivity around the burial facility. At and around A and B blocks of Yul-myeon site, interpretations of the survey data show low resistivity zones below 10 Ωm from a depth 3 m to 10 m and such low resistivity zones of the A block are thicker than the B block by about 5~10 m. From the geochemical data and resistivity survey at two FMD burial sites, it is inferred that the groundwater within a 50-meter radius around burial facilities of the Yul-myeon site are contaminated by leachate. The general resistivity distribution around the burial site is seemed affected by the leachate with high electrical conductivity. The detail distribution patterns can be explained by local distributions of soil and weathered rocks and associated leachate flow. This subject is supported by Brain Korea 21 and Korea Ministry of Environment as 'The GAIA Project (173-092-009)'.

  4. AFLP analysis and zebra disease resistance identification of 40 sisal genotypes in China.

    PubMed

    Gao, Jianming; Luoping; Guo, Chaoming; Li, Jinzhi; Liu, Qiaolian; Chen, Helong; Zhang, Shiqing; Zheng, Jinlong; Jiang, Chenji; Dai, Zhenzhen; Yi, Kexian

    2012-05-01

    Sisal is the most important fiber crop in tropical and subtropical areas in China and the world. Zebra disease is a serious threat to the main cultivar Agave hybrid No.11648 (H.11648) worldwide. To select germplasm materials with zebra disease resistance for breeding, the fluorescent amplified fragment length polymorphism (AFLP) technique was used to make a cluster analysis of the genetic relationships of 40 sisal genotypes grown in China, and Phytophthora nicotianae was used to inoculate the 40 genotypes to identify their resistance to zebra disease. As a result, the similarity coefficient among 40 sisal genotypes was found to be 0.44-0.83 and the 40 genotypes show different levels of disease resistance. According to the AFLP analysis, the disease resistance and chromosomal ploidy, it can be reasoned that, A. attenuata var. marginata, Dong 109, Nan ya 1 and A. attenuata are suitable for hybridization with H.11648 to breed a new disease-resistant variety. PMID:22327644

  5. AFLP analysis and zebra disease resistance identification of 40 sisal genotypes in China.

    PubMed

    Gao, Jianming; Luoping; Guo, Chaoming; Li, Jinzhi; Liu, Qiaolian; Chen, Helong; Zhang, Shiqing; Zheng, Jinlong; Jiang, Chenji; Dai, Zhenzhen; Yi, Kexian

    2012-05-01

    Sisal is the most important fiber crop in tropical and subtropical areas in China and the world. Zebra disease is a serious threat to the main cultivar Agave hybrid No.11648 (H.11648) worldwide. To select germplasm materials with zebra disease resistance for breeding, the fluorescent amplified fragment length polymorphism (AFLP) technique was used to make a cluster analysis of the genetic relationships of 40 sisal genotypes grown in China, and Phytophthora nicotianae was used to inoculate the 40 genotypes to identify their resistance to zebra disease. As a result, the similarity coefficient among 40 sisal genotypes was found to be 0.44-0.83 and the 40 genotypes show different levels of disease resistance. According to the AFLP analysis, the disease resistance and chromosomal ploidy, it can be reasoned that, A. attenuata var. marginata, Dong 109, Nan ya 1 and A. attenuata are suitable for hybridization with H.11648 to breed a new disease-resistant variety.

  6. Maternal age affects brain metabolism in adult children of mothers affected by Alzheimer’s disease

    PubMed Central

    Mosconi, Lisa; Tsui, Wai; Murray, John; McHugh, Pauline; Li, Yi; Williams, Schantel; Pirraglia, Elizabeth; Glodzik, Lidia; De Santi, Susan; Vallabhajosula, Shankar; de Leon, Mony J.

    2011-01-01

    Cognitively normal (NL) individuals with a maternal history of late-onset Alzheimer’s disease (MH) show reduced brain glucose metabolism on FDG-PET as compared to those with a paternal history (PH) and those with negative family history (NH) of Alzheimer’s disease (AD). This FDG-PET study investigates whether metabolic deficits in NL MH are associated with advancing maternal age at birth. Ninety-six NL individuals with FDG-PET were examined, including 36 MH, 24 PH, and 36 NH. Regional-to-whole brain gray matter standardized FDG uptake value ratios were examined for associations with parental age across groups using automated regions-of-interest and statistical parametric mapping. Groups were comparable for clinical and neuropsychological measures. Brain metabolism in AD-vulnerable regions was lower in MH compared to NH and PH, and negatively correlated with maternal age at birth only in MH. There were no associations between paternal age and metabolism in any group. Evidence for a maternally inherited, maternal age-related mechanism provides further insight on risk factors and genetic transmission in late-onset AD. PMID:21514691

  7. Maternal age affects brain metabolism in adult children of mothers affected by Alzheimer's disease.

    PubMed

    Mosconi, Lisa; Tsui, Wai; Murray, John; McHugh, Pauline; Li, Yi; Williams, Schantel; Pirraglia, Elizabeth; Glodzik, Lidia; De Santi, Susan; Vallabhajosula, Shankar; de Leon, Mony J

    2012-03-01

    Cognitively normal (NL) individuals with a maternal history of late-onset Alzheimer's disease (MH) show reduced brain glucose metabolism on FDG-PET as compared to those with a paternal history (PH) and those with negative family history (NH) of Alzheimer's disease (AD). This FDG-PET study investigates whether metabolic deficits in NL MH are associated with advancing maternal age at birth. Ninety-six NL individuals with FDG-PET were examined, including 36 MH, 24 PH, and 36 NH. Regional-to-whole brain gray matter standardized FDG uptake value ratios were examined for associations with parental age across groups using automated regions-of-interest and statistical parametric mapping. Groups were comparable for clinical and neuropsychological measures. Brain metabolism in AD-vulnerable regions was lower in MH compared to NH and PH, and negatively correlated with maternal age at birth only in MH. There were no associations between paternal age and metabolism in any group. Evidence for a maternally inherited, maternal age-related mechanism provides further insight on risk factors and genetic transmission in late-onset AD.

  8. Regulatory Circuitry Governing Fungal Development, Drug Resistance, and Disease

    PubMed Central

    Shapiro, Rebecca S.; Robbins, Nicole; Cowen, Leah E.

    2011-01-01

    Summary: Pathogenic fungi have become a leading cause of human mortality due to the increasing frequency of fungal infections in immunocompromised populations and the limited armamentarium of clinically useful antifungal drugs. Candida albicans, Cryptococcus neoformans, and Aspergillus fumigatus are the leading causes of opportunistic fungal infections. In these diverse pathogenic fungi, complex signal transduction cascades are critical for sensing environmental changes and mediating appropriate cellular responses. For C. albicans, several environmental cues regulate a morphogenetic switch from yeast to filamentous growth, a reversible transition important for virulence. Many of the signaling cascades regulating morphogenesis are also required for cells to adapt and survive the cellular stresses imposed by antifungal drugs. Many of these signaling networks are conserved in C. neoformans and A. fumigatus, which undergo distinct morphogenetic programs during specific phases of their life cycles. Furthermore, the key mechanisms of fungal drug resistance, including alterations of the drug target, overexpression of drug efflux transporters, and alteration of cellular stress responses, are conserved between these species. This review focuses on the circuitry regulating fungal morphogenesis and drug resistance and the impact of these pathways on virulence. Although the three human-pathogenic fungi highlighted in this review are those most frequently encountered in the clinic, they represent a minute fraction of fungal diversity. Exploration of the conservation and divergence of core signal transduction pathways across C. albicans, C. neoformans, and A. fumigatus provides a foundation for the study of a broader diversity of pathogenic fungi and a platform for the development of new therapeutic strategies for fungal disease. PMID:21646428

  9. Loss of CMD2‐mediated resistance to cassava mosaic disease in plants regenerated through somatic embryogenesis

    PubMed Central

    Chauhan, Raj Deepika; Wagaba, Henry; Moll, Theodore; Alicai, Titus; Miano, Douglas; Carrington, James C.; Taylor, Nigel J.

    2016-01-01

    Summary Cassava mosaic disease (CMD) and cassava brown streak disease (CBSD) are the two most important viral diseases affecting cassava production in Africa. Three sources of resistance are employed to combat CMD: polygenic recessive resistance, termed CMD1, the dominant monogenic type, named CMD2, and the recently characterized CMD3. The farmer‐preferred cultivar TME 204 carries inherent resistance to CMD mediated by CMD2, but is highly susceptible to CBSD. Selected plants of TME 204 produced for RNA interference (RNAi)‐mediated resistance to CBSD were regenerated via somatic embryogenesis and tested in confined field trials in East Africa. Although micropropagated, wild‐type TME 204 plants exhibited the expected levels of resistance, all plants regenerated via somatic embryogenesis were found to be highly susceptible to CMD. Glasshouse studies using infectious clones of East African cassava mosaic virus conclusively demonstrated that the process of somatic embryogenesis used to regenerate cassava caused the resulting plants to become susceptible to CMD. This phenomenon could be replicated in the two additional CMD2‐type varieties TME 3 and TME 7, but the CMD1‐type cultivar TMS 30572 and the CMD3‐type cultivar TMS 98/0505 maintained resistance to CMD after passage through somatic embryogenesis. Data are presented to define the specific tissue culture step at which the loss of CMD resistance occurs and to show that the loss of CMD2‐mediated resistance is maintained across vegetative generations. These findings reveal new aspects of the widely used technique of somatic embryogenesis, and the stability of field‐level resistance in CMD2‐type cultivars presently grown by farmers in East Africa, where CMD pressure is high. PMID:26662210

  10. Quantitative resistance affects the speed of frequency increase but not the diversity of the virulence alleles overcoming a major resistance gene to Leptosphaeria maculans in oilseed rape.

    PubMed

    Delourme, R; Bousset, L; Ermel, M; Duffé, P; Besnard, A L; Marquer, B; Fudal, I; Linglin, J; Chadœuf, J; Brun, H

    2014-10-01

    Quantitative resistance mediated by multiple genetic factors has been shown to increase the potential for durability of major resistance genes. This was demonstrated in the Leptosphaeria maculans/Brassica napus pathosystem in a 5year recurrent selection field experiment on lines harboring the qualitative resistance gene Rlm6 combined or not with quantitative resistance. The quantitative resistance limited the size of the virulent isolate population. In this study we continued this recurrent selection experiment in the same way to examine whether the pathogen population could adapt and render the major gene ineffective in the longer term. The cultivars Eurol, with a susceptible background, and Darmor, with quantitative resistance, were used. We confirmed that the combination of qualitative and quantitative resistance is an effective approach for controlling the pathogen epidemics over time. This combination did not prevent isolates virulent against the major gene from amplifying in the long term but the quantitative resistance significantly delayed for 5years the loss of effectiveness of the qualitative resistance and disease severity was maintained at a low level on the genotype with both types of resistance after the fungus population had adapted to the major gene. We also showed that diversity of AvrLm6 virulence alleles was comparable in isolates recovered after the recurrent selection on lines carrying either the major gene alone or in combination with quantitative resistance: a single repeat-induced point mutation and deletion events were observed in both situations. Breeding varieties which combine qualitative and quantitative resistance can effectively contribute to disease control by increasing the potential for durability of major resistance genes.

  11. External Resistances Applied to MFC Affect Core Microbiome and Swine Manure Treatment Efficiencies

    PubMed Central

    Vilajeliu-Pons, Anna; Bañeras, Lluis; Puig, Sebastià; Molognoni, Daniele; Vilà-Rovira, Albert; Hernández-del Amo, Elena; Balaguer, Maria D.; Colprim, Jesús

    2016-01-01

    Microbial fuel cells (MFCs) can be designed to combine water treatment with concomitant electricity production. Animal manure treatment has been poorly explored using MFCs, and its implementation at full-scale primarily relies on the bacterial distribution and activity within the treatment cell. This study reports the bacterial community changes at four positions within the anode of two almost identically operated MFCs fed swine manure. Changes in the microbiome structure are described according to the MFC fluid dynamics and the application of a maximum power point tracking system (MPPT) compared to a fixed resistance system (Ref-MFC). Both external resistance and cell hydrodynamics are thought to heavily influence MFC performance. The microbiome was characterised both quantitatively (qPCR) and qualitatively (454-pyrosequencing) by targeting bacterial 16S rRNA genes. The diversity of the microbial community in the MFC biofilm was reduced and differed from the influent swine manure. The adopted electric condition (MPPT vs fixed resistance) was more relevant than the fluid dynamics in shaping the MFC microbiome. MPPT control positively affected bacterial abundance and promoted the selection of putatively exoelectrogenic bacteria in the MFC core microbiome (Sedimentibacter sp. and gammaproteobacteria). These differences in the microbiome may be responsible for the two-fold increase in power production achieved by the MPPT-MFC compared to the Ref-MFC. PMID:27701451

  12. Factors Affecting the Hydrogen Environment Assisted Cracking Resistance of an AL-Zn-Mg-(Cu) Alloy

    SciTech Connect

    Young, G A; Scully, J R

    2002-04-09

    Precipitation hardenable Al-Zn-Mg alloys are susceptible to hydrogen environment assisted cracking (HEAC) when exposed to aqueous environments. In Al-Zn-Mg-Cu alloys, overaged tempers are used to increase HEAC resistance at the expense of strength but overaging has little benefit in low copper alloys. However, the mechanism or mechanisms by which overaging imparts HEAC resistance is poorly understood. The present research investigated hydrogen uptake, diffusion, and crack growth rate in 90% relative humidity (RH) air for both a commercial copper bearing Al-Zn-Mg-Cu alloy (AA 7050) and a low copper variant of this alloy in order to better understand the factors which affect HEAC resistance. Experimental methods used to evaluate hydrogen concentrations local to a surface and near a crack tip include nuclear reaction analysis (NRA), focused ion beam, secondary ion mass spectroscopy (FIB/SIMS) and thermal desorption spectroscopy (TDS). Results show that overaging the copper bearing alloys both inhibits hydrogen ingress from oxide covered surfaces and decreases the apparent hydrogen diffusion rates in the metal.

  13. Second generation peanut genotypes resistant to thrips-transmitted tomato spotted wilt virus exhibit tolerance rather than true resistance and differentially affect thrips fitness.

    PubMed

    Shrestha, Anita; Srinivasan, Rajagopalbabu; Sundaraj, Sivamani; Culbreath, Albert K; Riley, David G

    2013-04-01

    Spotted wilt disease caused by Tomato spotted wilt virus (TSWV) (family Bunyaviridae; genus Tospovirus) is a major constraint to peanut (Arachis hypogaea L.) production in the southeastern United States. Reducing yield losses to TSWV has heavily relied on planting genotypes that reduce the incidence of spotted wilt disease. However, mechanisms conferring resistance to TSWV have not been identified in these genotypes. Furthermore, no information is available on how these genotypes influence thrips fitness. In this study, we investigated the effects of newly released peanut genotypes (Georganic, GA-06G, Tifguard, and NC94022) with field resistance to TSWV and a susceptible genotype (Georgia Green) on tobacco thrips, Frankliniella fusca (Hinds), fitness, and TSWV incidence. Thrips-mediated transmission resulted in TSWV infection in both TSWV-resistant and susceptible genotypes and they exhibited typical TSWV symptoms. However, some resistant genotypes had reduced viral loads (fewer TSWV N-gene copies) than the susceptible genotype. F. fusca larvae acquired TSWV from resistant and susceptible genotypes indicating that resistant genotypes also can serve as inoculum sources. Unlike resistant genotypes in other crops that produce local lesions (hypersensitive reaction) upon TSWV infection, widespread symptom development was noticed in peanut genotypes. Results indicated that the observed field resistance in peanut genotypes could be because of tolerance. Further, fitness studies revealed some, but not substantial, differences in thrips adult emergence rates and developmental time between resistant and susceptible genotypes. Thrips head capsule length and width were not different when reared on different genotypes.

  14. Renal Resistive Index and Mortality in Chronic Kidney Disease

    PubMed Central

    Toledo, Clarisse; Thomas, George; Schold, Jesse D.; Arrigain, Susana; Gornik, Heather L.; Nally, Joseph V.; Navaneethan, Sankar D.

    2015-01-01

    Renal resistive index (RRI) measured by Doppler ultrasonography is associated with cardiovascular events and mortality in hypertensive, diabetic, and elderly patients. We studied the factors associated with high RRI (≥0.70) and its associations with mortality in CKD patients without renal artery stenosis. We included 1,962 patients with an eGFR 15-59 ml/min/1.73 m2 who also had RRI measured (January 1, 2005 - October 2011) from an existing CKD registry. Participants with renal artery stenosis (60-99% or renal artery occlusion) were excluded. Multivariable logistic regression model was used to study factors associated with high RRI (≥0.70) and its association with mortality was studied using Kaplan-Meier plots and Cox proportional hazards model. Hypertension was prevalent in >90% of the patients. In the multivariable logistic regression, older age, female gender, diabetes mellitus, coronary artery disease, peripheral vascular disease, higher systolic blood pressure and use of beta blockers were associated with higher odds of having RRI ≥0.70. During a median follow-up of 2.2 years, 428 patients died. After adjusting for covariates, RRI ≥0.70 was associated with increased mortality (adjusted HR 1.29, 95% CI, 1.02- 1.65, P< 0.05). This association was more pronounced among younger patients and those with stage 3 CKD. Non-cardiovascular/non-malignancy related deaths were higher in those with RRI ≥0.70. RRI ≥0.70 is associated with higher mortality in hypertensive CKD patients without clinically significant renal artery stenosis after accounting for other significant risk factors. Its evaluation may allow early identification of those who are at risk thereby potentially preventing or delaying adverse outcomes. PMID:26077569

  15. ENHANCED DISEASE SUSCEPTIBILITY 1 and SALICYLIC ACID act redundantly to regulate resistance gene-mediated signaling

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) protein–associated pathways are well known to participate in defense against a variety of microbial pathogens. Salicylic acid (SA) and its associated proteinaceous signaling components, including enhanced disease susceptibility 1 (EDS1), non–race-specific disease resistance 1 (NDR1), ...

  16. Isolation and genetic mapping of NBS-LRR disease resistance gene analogs in watermelon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sixty-six watermelon disease resistance gene analogs (WRGA) were isolated from genotypes possessing disease resistance to fusarium oxysporum f. sp. niveum races 0, 1, and 2, zucchini yellow mosaic virus, papaya ringspot virus watermelon strain, cucumber mosaic virus, and watermelon mosaic virus. Deg...

  17. Chloroquine resistance of Plasmodium falciparum is associated with severity of disease in Nigerian children.

    PubMed

    Olumese, P E; Amodu, O K; Björkman, A; Adeyemo, A A; Gbadegesin, R A; Walker, O

    2002-01-01

    Chloroquine resistance of Plasmodium falciparum in vitro was significantly higher in isolates from patients with severe malaria than those with uncomplicated disease. This association may be due to either progression of uncomplicated to severe disease following chloroquine failure or increased virulence of chloroquine-resistant parasites. The implication of this for antimalarial treatment policy is discussed. PMID:12497979

  18. Inheritance of Pigeonpea Sterility Mosaic Disease Resistance in Pigeonpea

    PubMed Central

    Daspute, Abhijit; Fakrudin, B.; Bhairappanavar, Shivarudrappa. B.; Kavil, S. P.; Narayana, Y. D.; Muniswamy; Kaumar, Anil; Krishnaraj, P. U.; Yerimani, Abid; Khadi, B. M.

    2014-01-01

    A comprehensive study was conducted using PPSMV resistant (BSMR 736) and susceptible (ICP 8863) genotypes to develop a segregating population and understand the inheritance of PPSMV resistance. The observed segregation was comparable to 13 (susceptible): 3 (resistant). Hence, the inheritance was controlled by two genes, SV1 and SV2, with inhibitory gene interaction. PMID:25289002

  19. Demographic, socioeconomic and environmental changes affecting circulation of neglected tropical diseases in Egypt.

    PubMed

    Abou-El-Naga, Iman F

    2015-11-01

    Egypt has been plagued by many neglected tropical diseases since Pharaonic time. These diseases are Schistosomiasis, soil-transmitted helminthiasis, lymphatic filariasis, leishmaniasis and fascioliasis beside the epidermal parasitic skin diseases. Indeed, theses diseases still persist as public health problem in the country by the influence of demographic, socioeconomic and environmental obstacles. This study seeks for understanding the contribution of each factor in each obstacle in neglected tropical diseases perpetuation which in turn could help the governorate in planning integrated control strategies. It was found that poverty, unregulated urbanization and inadequate sanitation are important socioeconomic factors that have great effect on the transmission dynamics of the diseases. The environmental factors which affect the epidemiology of these diseases in the country are scarcity of water, construction of dams, land reclamation for agriculture beside the climate factors. Unfortunately, the panic increase in the population growth rate minimizes the efforts done by the governorate to elevate the public health services. These conditions also affect the transmission of epidermal parasitic skin diseases including scabies, head lice and hookworm-related cutaneous larva migrans. The control programs and the recommendations to combat the diseases were discussed. The present study showed that the ecological factors affecting each neglected tropical disease in Egypt are somewhat similar which makes it worthy to develop an integrated control approaches aiming at improving the leading factors of neglected tropical diseases circulation in the country.

  20. Demographic, socioeconomic and environmental changes affecting circulation of neglected tropical diseases in Egypt.

    PubMed

    Abou-El-Naga, Iman F

    2015-11-01

    Egypt has been plagued by many neglected tropical diseases since Pharaonic time. These diseases are Schistosomiasis, soil-transmitted helminthiasis, lymphatic filariasis, leishmaniasis and fascioliasis beside the epidermal parasitic skin diseases. Indeed, theses diseases still persist as public health problem in the country by the influence of demographic, socioeconomic and environmental obstacles. This study seeks for understanding the contribution of each factor in each obstacle in neglected tropical diseases perpetuation which in turn could help the governorate in planning integrated control strategies. It was found that poverty, unregulated urbanization and inadequate sanitation are important socioeconomic factors that have great effect on the transmission dynamics of the diseases. The environmental factors which affect the epidemiology of these diseases in the country are scarcity of water, construction of dams, land reclamation for agriculture beside the climate factors. Unfortunately, the panic increase in the population growth rate minimizes the efforts done by the governorate to elevate the public health services. These conditions also affect the transmission of epidermal parasitic skin diseases including scabies, head lice and hookworm-related cutaneous larva migrans. The control programs and the recommendations to combat the diseases were discussed. The present study showed that the ecological factors affecting each neglected tropical disease in Egypt are somewhat similar which makes it worthy to develop an integrated control approaches aiming at improving the leading factors of neglected tropical diseases circulation in the country. PMID:26614986

  1. QTL Analysis for Resistance to Blast Disease in U.S. Weedy Rice.

    PubMed

    Liu, Yan; Qi, Xinshuai; Gealy, Dave R; Olsen, Kenneth M; Caicedo, Ana L; Jia, Yulin

    2015-07-01

    Understanding the genetic architecture of adaptation is of great importance in evolutionary biology. U.S. weedy rice is well adapted to the local conditions in U.S. rice fields. Rice blast disease is one of the most destructive diseases of cultivated rice worldwide. However, information about resistance to blast in weedy rice is limited. Here, we evaluated the disease reactions of 60 U.S. weedy rice accessions with 14 blast races, and investigated the quantitative trait loci (QTL) associated with blast resistance in two major ecotypes of U.S. weedy rice. Our results revealed that U.S. weedy rice exhibited a broad resistance spectrum. Using genotyping by sequencing, we identified 28 resistance QTL in two U.S. weedy rice ecotypes. The resistance QTL with relatively large and small effects suggest that U.S. weedy rice groups have adapted to blast disease using two methods, both major resistance (R) genes and QTL. Three genomic loci shared by some of the resistance QTL indicated that these loci may contribute to no-race-specific resistance in weedy rice. Comparing with known blast disease R genes, we found that the R genes at these resistance QTL are novel, suggesting that U.S. weedy rice is a potential source of novel blast R genes for resistant breeding.

  2. Insulin resistance and hypothyroidism: a complex relationship in non-alcoholic fatty liver disease.

    PubMed

    Misra, Sanjukta; Singh, Bratati

    2013-05-01

    An association of non-alcoholic fatty liver disease with insulin resistant metabolic syndrome and hypothyroidism has been suggested. Aim of the present study was to explore the above association and also to establish the correlation between hypothyroidism and insulin resistance in patients with nonalcoholic fatty liver disease. Study group comprised 40 cases of non-alcoholic fatty liver disease and 30 healthy controls. Serum samples were analysed for fasting glucose, insulin, lipid profile and thyroid hormones. Insulin resistance was assessed by homeostatic model of assessment calculation. Nonalcoholic fatty liver disease patients demonstrated significantly higher insulin resistance, TSH values and significantly lower FT4 values as compared to controls, which illustrates the prevalence of insulin resistance and hypothyroidism in patients. A significant positive correlation between TSH and Insulin resistance (r = 0.87, p < 0.001) and a significant negative correlation between FT4 and insulin resistance (r = -0.14, p < 0.001) were established in the cases. Moreover TSH was significantly related to low density lipoprotein cholesterol, independent of insulin resistance. There have been some doubts over the clinical correlation between insulin resistance and hypothyroidism to delineate increased risk of cardiovascular disease. So earlier detection and treatment of risk factors may have a significant impact on progression of non-alcoholic fatty liver disease. PMID:24765691

  3. Longer resistance of some DNA traits from BT176 maize to gastric juice from gastrointestinal affected patients.

    PubMed

    Ferrini, A M; Mannoni, V; Pontieri, E; Pourshaban, M

    2007-01-01

    The presence of antibiotic resistance marker genes in genetically engineered plants is one of the most controversial issues related to Genetically Modified Organism (GMO)-containing food, raising concern about the possibility that these markers could increase the pool of antibiotic resistance genes. This study investigates the in vitro survival of genes bla and cryIA(b) of maize Bt176 in human gastric juice samples. Five samples of gastric juice were collected from patients affected by gastro-esophageal reflux or celiac disease and three additional samples were obtained by pH modification with NaHCO3. DNA was extracted from maize Bt176 and incubated with samples of gastric juices at different times. The survival of the target traits (bla gene, whole 1914 bp gene cry1A(b), and its 211 bp fragment) was determined using PCR. The stability of the target genes was an inverse function of their lengths in all the samples. Survival in samples from untreated subjects was below the normal physiological time of gastric digestion. On the contrary, survival time in samples from patients under anti-acid drug treatment or in samples whose pH was modified, resulted strongly increased. Our data indicate the possibility that in particular cases the survival time could be so delayed that, as a consequence, some traits of DNA could reach the intestine. In general, this aspect must be considered for vulnerable consumers (people suffering from gastrointestinal diseases related to altered digestive functionality, physiological problems or drug side-effects) in the risk analysis usually referred to healthy subjects. PMID:17346434

  4. Longer resistance of some DNA traits from BT176 maize to gastric juice from gastrointestinal affected patients.

    PubMed

    Ferrini, A M; Mannoni, V; Pontieri, E; Pourshaban, M

    2007-01-01

    The presence of antibiotic resistance marker genes in genetically engineered plants is one of the most controversial issues related to Genetically Modified Organism (GMO)-containing food, raising concern about the possibility that these markers could increase the pool of antibiotic resistance genes. This study investigates the in vitro survival of genes bla and cryIA(b) of maize Bt176 in human gastric juice samples. Five samples of gastric juice were collected from patients affected by gastro-esophageal reflux or celiac disease and three additional samples were obtained by pH modification with NaHCO3. DNA was extracted from maize Bt176 and incubated with samples of gastric juices at different times. The survival of the target traits (bla gene, whole 1914 bp gene cry1A(b), and its 211 bp fragment) was determined using PCR. The stability of the target genes was an inverse function of their lengths in all the samples. Survival in samples from untreated subjects was below the normal physiological time of gastric digestion. On the contrary, survival time in samples from patients under anti-acid drug treatment or in samples whose pH was modified, resulted strongly increased. Our data indicate the possibility that in particular cases the survival time could be so delayed that, as a consequence, some traits of DNA could reach the intestine. In general, this aspect must be considered for vulnerable consumers (people suffering from gastrointestinal diseases related to altered digestive functionality, physiological problems or drug side-effects) in the risk analysis usually referred to healthy subjects.

  5. A Phytophthora sojae cytoplasmic effector mediates disease resistance and abiotic stress tolerance in Nicotiana benthamiana.

    PubMed

    Zhang, Meixiang; Ahmed Rajput, Nasir; Shen, Danyu; Sun, Peng; Zeng, Wentao; Liu, Tingli; Juma Mafurah, Joseph; Dou, Daolong

    2015-06-03

    Each oomycete pathogen encodes a large number of effectors. Some effectors can be used in crop disease resistance breeding, such as to accelerate R gene cloning and utilisation. Since cytoplasmic effectors may cause acute physiological changes in host cells at very low concentrations, we assume that some of these effectors can serve as functional genes for transgenic plants. Here, we generated transgenic Nicotiana benthamiana plants that express a Phytophthora sojae CRN (crinkling and necrosis) effector, PsCRN115. We showed that its expression did not significantly affect the growth and development of N. benthamiana, but significantly improved disease resistance and tolerance to salt and drought stresses. Furthermore, we found that expression of heat-shock-protein and cytochrome-P450 encoding genes were unregulated in PsCRN115-transgenic N. benthamiana based on digital gene expression profiling analyses, suggesting the increased plant defence may be achieved by upregulation of these stress-related genes in transgenic plants. Thus, PsCRN115 may be used to improve plant tolerance to biotic and abiotic stresses.

  6. Risk assessment for the harmful effects of UVB radiation on the immunological resistance to infectious diseases.

    PubMed

    Goettsch, W; Garssen, J; Slob, W; de Gruijl, F R; Van Loveren, H

    1998-02-01

    Risk assessment comprises four steps: hazard identification, dose-response assessment, exposure assessment, and risk characterization. In this study, the effects of increased ultraviolet B(UVB, 280-315 nm) radiation on immune functions and the immunological resistance to infectious diseases in rats were analyzed according to this strategy. In a parallelogram approach, nonthreshold mathematical methods were used to estimate the risk for the human population after increased exposure to UVB radiation. These data demonstrate, using a worst-case strategy (sensitive individuals, no adaptation), that exposure for approximately 90 min (local noon) at 40 degrees N in July might lead to 50% suppression of specific T-cell mediated responses to Listeria monocytogenes in humans who were not preexposed to UVB (i.e., not adapted). Additionally, a 5% decrease in the thickness of the ozone layer might shorten this exposure time by approximately 2.5%. These data demonstrate that UVB radiation, at doses relevant to outdoor exposure, may affect the specific cellular immune response to Listeria bacteria in humans. Whether this will also lead to a lowered resistance (i.e.,increased pathogenic load) in humans is not known, although it was demonstrated that UVB-induced immunosuppression in rats was sufficient to increase the pathogenic load. Epidemiology studies are needed to validate and improve estimates for the potential effects of increased UVB exposure on infectious diseases in humans.

  7. Wilson disease: changes in methionine metabolism and inflammation affect global DNA methylation in early liver disease

    PubMed Central

    Medici, Valentina; Shibata, Noreene M.; Kharbanda, Kusum K.; LaSalle, Janine M.; Woods, Rima; Liu, Sarah; Engelberg, Jesse A.; Devaraj, Sridevi; Török, Natalie J.; Jiang, Joy X.; Havel, Peter J.; Lönnerdal, Bo; Kim, Kyoungmi; Halsted, Charles H.

    2012-01-01

    Hepatic methionine metabolism may play an essential role in regulating methylation status and liver injury in Wilson disease (WD) through the inhibition of S-adenosylhomocysteine hydrolase (SAHH) by copper (Cu) and the consequent accumulation of S-adenosylhomocysteine (SAH). We studied the transcript levels of selected genes related to liver injury, levels of SAHH, SAH, DNA methyltransferases genes (Dnmt1, Dnmt3a, Dnmt3b) and global DNA methylation in the tx-j mouse (tx-j), an animal model of WD. Findings were compared to those in control C3H mice, and in response to Cu chelation by penicillamine (PCA) and dietary supplementation of the methyl donor betaine to modulate inflammatory and methylation status. Transcript levels of selected genes related to endoplasmic reticulum stress, lipid synthesis, and fatty acid oxidation were down-regulated at baseline in tx-j mice, further down-regulated in response to PCA, and showed little to no response to betaine. Hepatic Sahh transcript and protein levels were reduced in tx-j mice with consequent increase of SAH levels. Hepatic Cu accumulation was associated with inflammation, as indicated by histopathology and elevated serum ALT and liver tumor necrosis factor alpha (Tnf-α) levels. Dnmt3b was down-regulated in tx-j mice together with global DNA hypomethylation. PCA treatment of tx-j mice reduced Tnf-α and ALT levels, betaine treatment increased S-adenosylmethionine and up-regulated Dnmt3b levels, and both treatments restored global DNA methylation levels. Conclusion: reduced hepatic Sahh expression was associated with increased liver SAH levels in the tx-j model of WD, with consequent global DNA hypomethylation. Increased global DNA methylation was achieved by reducing inflammation by Cu chelation or by providing methyl groups. We propose that increased SAH levels and inflammation affect widespread epigenetic regulation of gene expression in WD. PMID:22945834

  8. Land use affects the resistance and resilience of carbon dynamics of mountain grassland to extreme drought

    NASA Astrophysics Data System (ADS)

    Ingrisch, Johannes; Karlowsky, Stefan; Hasibeder, Roland; Anadon-Rosell, Alba; Augusti, Angela; Scheld, Sarah; König, Alexander; Gleixner, Gerd; Bahn, Michael

    2015-04-01

    Climatic extremes like droughts are expected to occur more frequently and to be more severe in a future climate and have been shown to strongly affect the carbon (C) cycle. Few studies have so far explored how the management intensity of ecosystems and land-use changes alter C cycle responses to extreme climatic events. In many mountain areas land-use changes have been taking place at a rapid pace and have altered plant species composition and biogeochemical cycles. It is still unknown whether and how abandonment of mountain grasslands affects the resistance and the resilience of carbon dynamics to extreme drought. We carried out an in situ experiment to test the hypothesis that abandonment increases the resistance of grassland C dynamics to extreme drought, but decreases its resilience (i.e. post-drought recovery). In a common garden experiment at a mountain meadow in the Austrian Central Alps we exposed large intact monoliths from the meadow and a nearby abandoned grassland to extreme drought conditions during the main growth period in late spring. We measured above- and belowground productivity and net ecosystem exchange and its components over the course of the drought and during the recovery to assess and quantify their resistance and resilience. Furthermore, we analysed the coupling of the two major ecosystem CO2 fluxes, photosynthesis and soil respiration, as based on 13CO2 pulse labelling campaigns at peak drought and during post-drought recovery using isotope laser spectroscopy. Four weeks of early season drought induced a strong decrease of aboveground biomass at the mountain meadow, whereas no effect was observed for the abandoned grassland. At peak drought gross primary productivity was reduced at both grasslands compared to the respective controls, but with a stronger decrease at the meadow (80%) compared to the abandoned grassland (60%). The same pattern was observed for ecosystem respiration. However, the effect was less pronounced compared to carbon

  9. Development of EST-SSR markers related to disease resistance and their application in genetic diversity and evolution analysis in Gossypium.

    PubMed

    Wang, B H; Rong, P; Cai, X X; Wang, W; Zhu, X Y; Chen, C J; Xu, Y Y; Huang, X J; Zhuang, Z M; Wang, C B

    2015-01-01

    Cotton (Gossypium spp) is one of the most economically important crops that provide the world's most widely used natural fiber. Diseases such as Fusarium wilt and particularly Verticillium wilt seriously affect cotton production, and thus breeding for disease resistance is one of the most important goals of cotton breeding programs. Currently, potential exists to improve disease resistance in cultivated cotton. Increasing the understanding of the distribution, structure, and organization of genes or quantitative trait loci for disease resistance will help the breeders improve crop yield even in the event of disease. To facilitate the mapping of disease-resistance quantitative trait loci to achieve disease-resistant molecular breeding in cotton, it is necessary to develop polymorphic molecular markers. The objective of this study was to develop simple sequence repeat markers based on cotton expressed sequence tags for disease resistance. The efficacy of these simple sequence repeat markers, their polymorphisms, and cross-species transferability were evaluated. Their value was further investigated based on genetic diversity and evolution analysis. In this study, the unique sequences used to develop markers were compared with the G. arboretum and G. raimondii genome sequences to investigate their position, homology, and collinearity between G. arboretum and G. raimondii.

  10. Hybridization of an invasive shrub affects tolerance and resistance to defoliation by a biological control agent

    USGS Publications Warehouse

    Williams, Wyatt I.; Friedman, Jonathan M.; Gaskin, John F.; Norton, Andrew P.

    2014-01-01

    Evolution has contributed to the successful invasion of exotic plant species in their introduced ranges, but how evolution affects particular control strategies is still under evaluation. For instance, classical biological control, a common strategy involving the utilization of highly specific natural enemies to control exotic pests, may be negatively affected by host hybridization because of shifts in plant traits, such as root allocation or chemical constituents. We investigated introgression between two parent species of the invasive shrub tamarisk (Tamarix spp.) in the western United States, and how differences in plant traits affect interactions with a biological control agent. Introgression varied strongly with latitude of origin and was highly correlated with plant performance. Increased levels of T. ramosissima introgression resulted in both higher investment in roots and tolerance to defoliation and less resistance to insect attack. Because tamarisk hybridization occurs predictably on the western U.S. landscape, managers may be able to exploit this information to maximize control efforts. Genetic differentiation in plant traits in this system underpins the importance of plant hybridization and may explain why some biological control releases are more successful than others.

  11. Hybridization of an invasive shrub affects tolerance and resistance to defoliation by a biological control agent

    PubMed Central

    Williams, Wyatt I; Friedman, Jonathan M; Gaskin, John F; Norton, Andrew P

    2014-01-01

    Evolution has contributed to the successful invasion of exotic plant species in their introduced ranges, but how evolution affects particular control strategies is still under evaluation. For instance, classical biological control, a common strategy involving the utilization of highly specific natural enemies to control exotic pests, may be negatively affected by host hybridization because of shifts in plant traits, such as root allocation or chemical constituents. We investigated introgression between two parent species of the invasive shrub tamarisk (Tamarix spp.) in the western United States, and how differences in plant traits affect interactions with a biological control agent. Introgression varied strongly with latitude of origin and was highly correlated with plant performance. Increased levels of T. ramosissima introgression resulted in both higher investment in roots and tolerance to defoliation and less resistance to insect attack. Because tamarisk hybridization occurs predictably on the western U.S. landscape, managers may be able to exploit this information to maximize control efforts. Genetic differentiation in plant traits in this system underpins the importance of plant hybridization and may explain why some biological control releases are more successful than others. PMID:24665340

  12. Divergence of the yeast transcription factor FZF1 affects sulfite resistance.

    PubMed

    Engle, Elizabeth K; Fay, Justin C

    2012-01-01

    Changes in gene expression are commonly observed during evolution. However, the phenotypic consequences of expression divergence are frequently unknown and difficult to measure. Transcriptional regulators provide a mechanism by which phenotypic divergence can occur through multiple, coordinated changes in gene expression during development or in response to environmental changes. Yet, some changes in transcriptional regulators may be constrained by their pleiotropic effects on gene expression. Here, we use a genome-wide screen for promoters that are likely to have diverged in function and identify a yeast transcription factor, FZF1, that has evolved substantial differences in its ability to confer resistance to sulfites. Chimeric alleles from four Saccharomyces species show that divergence in FZF1 activity is due to changes in both its coding and upstream noncoding sequence. Between the two closest species, noncoding changes affect the expression of FZF1, whereas coding changes affect the expression of SSU1, a sulfite efflux pump activated by FZF1. Both coding and noncoding changes also affect the expression of many other genes. Our results show how divergence in the coding and promoter region of a transcription factor alters the response to an environmental stress.

  13. Decision Aids for Multiple-Decision Disease Management as Affected by Weather Input Errors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many disease management decision support systems (DSS) rely, exclusively or in part, on weather inputs to calculate an indicator for disease hazard. Error in the weather inputs, typically due to forecasting, interpolation or estimation from off-site sources, may affect model calculations and manage...

  14. Cosegregation of Christmas disease and major affective disorder in a pedigree.

    PubMed

    Gill, M; Castle, D; Duggan, C

    1992-01-01

    Three males with factor-IX deficiency (Christmas disease) in one pedigree all had severe affective disorder. This apparent cosegregation, if true, would support the hypothesis that in some pedigrees, a gene for major affective disorder is located on the X chromosome.

  15. Paleo-evolutionary plasticity of plant disease resistance genes

    PubMed Central

    2014-01-01

    Background The recent access to a large set of genome sequences, combined with a robust evolutionary scenario of modern monocot (i.e. grasses) and eudicot (i.e. rosids) species from their founder ancestors, offered the opportunity to gain insights into disease resistance genes (R-genes) evolutionary plasticity. Results We unravel in the current article (i) a R-genes repertoire consisting in 7883 for monocots and 15758 for eudicots, (ii) a contrasted R-genes conservation with 23.8% for monocots and 6.6% for dicots, (iii) a minimal ancestral founder pool of 384 R-genes for the monocots and 150 R-genes for the eudicots, (iv) a general pattern of organization in clusters accounting for more than 60% of mapped R-genes, (v) a biased deletion of ancestral duplicated R-genes between paralogous blocks possibly compensated by clusterization, (vi) a bias in R-genes clusterization where Leucine-Rich Repeats act as a ‘glue’ for domain association, (vii) a R-genes/miRNAs interome enriched toward duplicated R-genes. Conclusions Together, our data may suggest that R-genes family plasticity operated during plant evolution (i) at the structural level through massive duplicates loss counterbalanced by massive clusterization following polyploidization; as well as at (ii) the regulation level through microRNA/R-gene interactions acting as a possible source of functional diploidization of structurally retained R-genes duplicates. Such evolutionary shuffling events leaded to CNVs (i.e. Copy Number Variation) and PAVs (i.e. Presence Absence Variation) between related species operating in the decay of R-genes colinearity between plant species. PMID:24617999

  16. Application of RNA silencing to plant disease resistance

    PubMed Central

    2012-01-01

    To reduce the losses caused by plant pathogens, plant biologists have adopted numerous methods to engineer resistant plants. Among them, RNA silencing-based resistance has been a powerful tool that has been used to engineer resistant crops during the last two decades. Based on this mechanism, diverse approaches were developed. In this review, we focus on the application of RNA silencing to produce plants that are resistant to plant viruses such as RNA and DNA viruses, viroids, insects, and the recent expansion to fungal pathogens. PMID:22650989

  17. Identification of quantitative trait loci associated with resistance to viral haemorrhagic septicaemia (VHS) in turbot (Scophthalmus maximus ): a comparison between bacterium, parasite and virus diseases.

    PubMed

    Rodríguez-Ramilo, Silvia T; De La Herrán, Roberto; Ruiz-Rejón, Carmelo; Hermida, Miguel; Fernández, Carlos; Pereiro, Patricia; Figueras, Antonio; Bouza, Carmen; Toro, Miguel A; Martínez, Paulino; Fernández, Jesús

    2014-06-01

    One of the main objectives of genetic breeding programs in turbot industry is to reduce disease-related mortality. In the present study, a genome scan to detect quantitative trait loci (QTL) affecting resistance and survival to viral haemorrhagic septicaemia (VHS) was carried out. Three full-sib families with approximately 90 individuals each were genotyped and evaluated by linear regression and maximum likelihood approaches. In addition, a comparison between QTL detected for resistance and survival time to other important bacterial and parasite diseases affecting turbot (furunculosis and scuticociliatosis) was also carried out. Finally, the relationship between QTL affecting resistance/survival time to the virus and growth-related QTL was also evaluated. Several genomic regions controlling resistance and survival time to VHS were detected. Also significant associations between the evaluated traits and genotypes at particular markers were identified, explaining up to 14 % of the phenotypic variance. Several genomic regions controlling general and specific resistance to different diseases in turbot were detected. A preliminary gene mining approach identified candidate genes related to general or specific immunity. This information will be valuable to develop marker-assisted selection programs and to discover candidate genes related to disease resistance to improve turbot production.

  18. Host mating system and the spread of a disease-resistant allele in a population

    USGS Publications Warehouse

    DeAngelis, D.L.; Koslow, Jennifer M.; Jiang, J.; Ruan, S.

    2008-01-01

    The model presented here modifies a susceptible-infected (SI) host-pathogen model to determine the influence of mating system on the outcome of a host-pathogen interaction. Both deterministic and stochastic (individual-based) versions of the model were used. This model considers the potential consequences of varying mating systems on the rate of spread of both the pathogen and resistance alleles within the population. We assumed that a single allele for disease resistance was sufficient to confer complete resistance in an individual, and that both homozygote and heterozygote resistant individuals had the same mean birth and death rates. When disease invaded a population with only an initial small fraction of resistant genes, inbreeding (selfing) tended to increase the probability that the disease would soon be eliminated from a small population rather than become endemic, while outcrossing greatly increased the probability that the population would become extinct due to the disease.

  19. Toughing It Out--Disease-Resistant Potato Mutants Have Enhanced Tuber Skin Defenses.

    PubMed

    Thangavel, Tamilarasan; Tegg, Robert S; Wilson, Calum R

    2016-05-01

    Common scab, a globally important potato disease, is caused by infection of tubers with pathogenic Streptomyces spp. Previously, disease-resistant potato somaclones were obtained through cell selections against the pathogen's toxin, known to be essential for disease. Further testing revealed that these clones had broad-spectrum resistance to diverse tuber-invading pathogens, and that resistance was restricted to tuber tissues. The mechanism of enhanced disease resistance was not known. Tuber periderm tissues from disease-resistant clones and their susceptible parent were examined histologically following challenge with the pathogen and its purified toxin. Relative expression of genes associated with tuber suberin biosynthesis and innate defense pathways within these tissues were also examined. The disease-resistant somaclones reacted to both pathogen and toxin by producing more phellem cell layers in the tuber periderm, and accumulating greater suberin polyphenols in these tissues. Furthermore, they had greater expression of genes associated with suberin biosynthesis. In contrast, signaling genes associated with innate defense responses were not differentially expressed between resistant and susceptible clones. The resistance phenotype is due to induction of increased periderm cell layers and suberization of the tuber periderm preventing infection. The somaclones provide a valuable resource for further examination of suberization responses and its genetic control.

  20. Toughing It Out--Disease-Resistant Potato Mutants Have Enhanced Tuber Skin Defenses.

    PubMed

    Thangavel, Tamilarasan; Tegg, Robert S; Wilson, Calum R

    2016-05-01

    Common scab, a globally important potato disease, is caused by infection of tubers with pathogenic Streptomyces spp. Previously, disease-resistant potato somaclones were obtained through cell selections against the pathogen's toxin, known to be essential for disease. Further testing revealed that these clones had broad-spectrum resistance to diverse tuber-invading pathogens, and that resistance was restricted to tuber tissues. The mechanism of enhanced disease resistance was not known. Tuber periderm tissues from disease-resistant clones and their susceptible parent were examined histologically following challenge with the pathogen and its purified toxin. Relative expression of genes associated with tuber suberin biosynthesis and innate defense pathways within these tissues were also examined. The disease-resistant somaclones reacted to both pathogen and toxin by producing more phellem cell layers in the tuber periderm, and accumulating greater suberin polyphenols in these tissues. Furthermore, they had greater expression of genes associated with suberin biosynthesis. In contrast, signaling genes associated with innate defense responses were not differentially expressed between resistant and susceptible clones. The resistance phenotype is due to induction of increased periderm cell layers and suberization of the tuber periderm preventing infection. The somaclones provide a valuable resource for further examination of suberization responses and its genetic control. PMID:26780437

  1. A genome scan for quantitative trait loci affecting resistance to Trichostrongylus colubriformis in sheep.

    PubMed

    Beh, K J; Hulme, D J; Callaghan, M J; Leish, Z; Lenane, I; Windon, R G; Maddox, J F

    2002-04-01

    A genome linkage scan was carried out using a resource flock of 1029 sheep in six half-sib families. The families were offspring of sires derived by crossing divergent lines of sheep selected for response to challenge with the intestinal parasitic nematode Trichostrongylus colubriformis. All animals in the resource flock were phenotypically assessed for worm resistance soon after weaning using a vaccination/challenge regime. After correcting for fixed effects using a least squares linear model the faecal egg count data obtained following the first challenge and the faecal egg count data obtained after the second challenge were designated Trait 1 and Trait 2, respectively. A total of 472 lambs drawn from the phenotypic extremes of the Trait 2 faecal egg count distribution were genotyped with a panel of 133 microsatellite markers covering all 26 sheep autosomes. Detection of quantitative trait loci (QTL) for each of the faecal egg count traits was determined using interval analysis with the Animap program with recombination rates between markers derived from an existing marker map. No chromosomal regions attained genome-wide significance for QTL influencing either of the traits. However, one region attained chromosome-wide significance and five other regions attained point-wise significance for the presence of QTL affecting parasite resistance.

  2. Factors Affecting Comparative Resistance of Naturally Occurring and Subcultured Pseudomonas aeruginosa to Disinfectants

    PubMed Central

    Carson, L. A.; Favero, M. S.; Bond, W. W.; Petersen, N. J.

    1972-01-01

    A strain of Pseudomonas aeruginosa was isolated in pure culture from the reservoir of a hospital mist therapy unit by an extinction-dilution technique; its natural distilled water environment was used as a growth and maintenance medium. After a single subculture on Trypticase soy agar, the strain showed a marked decrease in resistance to inactivation by acetic acid, glutaraldehyde, chlorine dioxide, and a quaternary ammonium compound when compared with naturally occurring cells grown in mist therapy unit water. The following factors were observed to affect the relative resistances of naturally occurring and subcultured cells of the P. aeruginosa strain: (i) temperature at which the cultures were incubated prior to exposure to disinfectants, (ii) growth phase of the cultures at the time of exposure to disinfectants, (iii) nature of the suspending menstruum for disinfectants, and (iv) exposure to fluorescent light during incubation of inocula prior to testing. The applied significance of these findings may alter the present concepts of disinfectant testing as well as routine control procedures in the hospital environment. PMID:4624209

  3. Elevated Ambient Temperature Differentially Affects Virus Resistance in Two Tobacco Species.

    PubMed

    Ma, L; Huang, X; Yu, R; Jing, X L; Xu, J; Wu, C A; Zhu, C X; Liu, H M

    2016-01-01

    Antiviral defense of plants is usually enhanced by an elevated temperature under natural conditions. In order to better understand this phenomenon, we carried out temperature shift experiments with Nicotiana glutinosa plants that were infected with Potato virus X (PVX) or the necrotic strain of Potato virus Y (PVY(N)). The virus titer of the plants was found to be much lower when they were maintained at 30°C compared with 22°C, particularly in the upper leaves. PVX resistance at 30°C persisted for a short period even when temperature was shifted back to 22°C. In contrast, N. benthamiana lost the virus resistance immediately after the temperature dropped to 22°C. Expression analysis of two RNA-dependent RNA polymerases in N. glutinosa (NgRDR) showed that a 12-day treatment at 30°C increased the expression of NgRDR1, while NgRDR6 was not affected. In addition, the NgRDR6 mRNA level correlated with the PVX titer but was unaffected by PVY(N) infection. These observations indicate that PVX and PVY(N), although they are both RNA viruses, might trigger different defense responses at elevated temperatures. Our study provides valuable data for a better understanding of the temperature-regulated host virus interaction. PMID:26474332

  4. Radiation resistance of methanogenic archaea from Siberian permafrost-affected soils

    NASA Astrophysics Data System (ADS)

    Morozova, Daria; Moeller, Ralf; Rettberg, Petra; Wagner, Dirk

    2007-08-01

    Methanogenic archaea from the Siberian permafrost-affected soils and from nonpermafrost habitats were exposed to solar UV- and ionizing radiation in order to assess their limits of survival. Metabolic activity and viability of methanogenic archaea in environmental samples remained unaffected by exposure to monochromatic and polychromatic UV radiation caused by the shielding of the soil layers. Pure methanogenic cultures isolated from the permafrost's active layer exhibit an increase in radioresistance to UV (20-fold) and ionizing radiation (32-fold) compared to the non-permafrost isolates. The F37 (UV radiation) and D37 (X-rays) values of the permafrost strain Methanosarcina sp. SMA-21 were 700 J m-2 and 6-12 kGy, respectively. This resistance is comparable to values for Deinococcus radiodurans (F37 640 Jm-2, D37 6-7 kGy). Due to the increased radiation-resistance of permafrost isolates, their long-term survival, and their anaerobic lithoautotrophic metabolism, methanogenic archaea from permafrost can be considered as suitable candidates in the search for microbial life in the Martian subsurface. The ESA mission Mars Express confirmed the existence of water on Mars, which is a fundamental requirement for life, as well as CH4 in the Martian atmosphere, which could only originate from active volcanism or from biological sources; both these results suggest that microbial life could still exist on Mars, for example in the form of subsurface lithoautotrophic ecosystems, which also exist in permafrost regions on Earth.

  5. Butyrate upregulates endogenous host defense peptides to enhance disease resistance in piglets via histone deacetylase inhibition

    PubMed Central

    Xiong, Haitao; Guo, Bingxiu; Gan, Zhenshun; Song, Deguang; Lu, Zeqing; Yi, Hongbo; Wu, Yueming; Wang, Yizhen; Du, Huahua

    2016-01-01

    Butyrate has been used to treat different inflammatory disease with positive outcomes, the mechanisms by which butyrate exerts its anti-inflammatory effects remain largely undefined. Here we proposed a new mechanism that butyrate manipulate endogenous host defense peptides (HDPs) which contributes to the elimination of Escherichia coli O157:H7, and thus affects the alleviation of inflammation. An experiment in piglets treated with butyrate (0.2% of diets) 2 days before E. coli O157:H7 challenge was designed to investigate porcine HDP expression, inflammation and E. coli O157:H7 load in feces. The mechanisms underlying butyrate-induced HDP gene expression and the antibacterial activity and bacterial clearance of macrophage 3D4/2 cells in vitro were examined. Butyrate treatment (i) alleviated the clinical symptoms of E. coli O157:H7-induced hemolytic uremic syndrome (HUS) and the severity of intestinal inflammation; (ii) reduced the E. coli O157:H7 load in feces; (iii) significantly upregulated multiple, but not all, HDPs in vitro and in vivo via histone deacetylase (HDAC) inhibition; and (iv) enhanced the antibacterial activity and bacterial clearance of 3D4/2 cells. Our findings indicate that butyrate enhances disease resistance, promotes the clearance of E. coli O157:H7, and alleviates the clinical symptoms of HUS and inflammation, partially, by affecting HDP expression via HDAC inhibition. PMID:27230284

  6. Development of molecular markers for breeding for disease resistant crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice blast disease caused by the filamentous ascomycetes fungus Magnaporthe oryzae and sheath blight disease caused by the soil borne fungus Rhizocotonia solani are the two major rice diseases that threaten stable rice production in the USA and worldwide. These two diseases have been managed with a ...

  7. Enhancement of the citrus immune system provides effective resistance against Alternaria brown spot disease.

    PubMed

    Llorens, Eugenio; Fernández-Crespo, Emma; Vicedo, Begonya; Lapeña, Leonor; García-Agustín, Pilar

    2013-01-15

    In addition to basal defense mechanisms, plants are able to develop enhanced defense mechanisms such as induced resistance (IR) upon appropriate stimulation. We recently described the means by which several carboxylic acids protect Arabidopsis and tomato plants against fungi. In this work, we demonstrate the effectiveness of hexanoic acid (Hx) in the control of Alternaria brown spot (ABS) disease via enhancement of the immune system of Fortune mandarin. The application of 1mM Hx in irrigation water to 2-year-old Fortune plants clearly reduced the incidence of the disease and led to smaller lesions. We observed that several of the most important mechanisms involved in induced resistance were affected by Hx application. Our results demonstrate enhanced callose deposition in infected plants treated with Hx, which suggests an Hx priming mechanism. Plants treated with the callose inhibitor 2-DDG were more susceptible to the fungus. Moreover, polygalacturonase-inhibiting protein (PGIP) gene expression was rapidly and significantly upregulated in treated plants. However, treatment with Hx decreased the levels of reactive oxygen species (ROS) in infected plants. Hormonal and gene analyses revealed that the jasmonic acid (JA) pathway was activated due to a greater accumulation of 12-oxo-phytodienoic acid (OPDA) and JA along with a rapid accumulation of JA-isoleucine (JA-Ile). Furthermore, we observed a more rapid accumulation of abscisic acid (ABA), which could act as a positive regulator of callose deposition. Thus, our results support the hypothesis that both enhanced physical barriers and the JA signaling pathway are involved in hexanoic acid-induced resistance (Hx-IR) to Alternaria alternata.

  8. Overexpression of BSR1 confers broad-spectrum resistance against two bacterial diseases and two major fungal diseases in rice.

    PubMed

    Maeda, Satoru; Hayashi, Nagao; Sasaya, Takahide; Mori, Masaki

    2016-06-01

    Broad-spectrum disease resistance against two or more types of pathogen species is desirable for crop improvement. In rice, Xanthomonas oryzae pv. oryzae (Xoo), the causal bacteria of rice leaf blight, and Magnaporthe oryzae, the fungal pathogen causing rice blast, are two of the most devastating pathogens. We identified the rice BROAD-SPECTRUM RESISTANCE 1 (BSR1) gene for a BIK1-like receptor-like cytoplasmic kinase using the FOX hunting system, and demonstrated that BSR1-overexpressing (OX) rice showed strong resistance to the bacterial pathogen, Xoo and the fungal pathogen, M. oryzae. Here, we report that BSR1-OX rice showed extended resistance against two other different races of Xoo, and to at least one other race of M. oryzae. In addition, the rice showed resistance to another bacterial species, Burkholderia glumae, which causes bacterial seedling rot and bacterial grain rot, and to Cochliobolus miyabeanus, another fungal species causing brown spot. Furthermore, BSR1-OX rice showed slight resistance to rice stripe disease, a major viral disease caused by rice stripe virus. Thus, we demonstrated that BSR1-OX rice shows remarkable broad-spectrum resistance to at least two major bacterial species and two major fungal species, and slight resistance to one viral pathogen.

  9. Overexpression of BSR1 confers broad-spectrum resistance against two bacterial diseases and two major fungal diseases in rice

    PubMed Central

    Maeda, Satoru; Hayashi, Nagao; Sasaya, Takahide; Mori, Masaki

    2016-01-01

    Broad-spectrum disease resistance against two or more types of pathogen species is desirable for crop improvement. In rice, Xanthomonas oryzae pv. oryzae (Xoo), the causal bacteria of rice leaf blight, and Magnaporthe oryzae, the fungal pathogen causing rice blast, are two of the most devastating pathogens. We identified the rice BROAD-SPECTRUM RESISTANCE 1 (BSR1) gene for a BIK1-like receptor-like cytoplasmic kinase using the FOX hunting system, and demonstrated that BSR1-overexpressing (OX) rice showed strong resistance to the bacterial pathogen, Xoo and the fungal pathogen, M. oryzae. Here, we report that BSR1-OX rice showed extended resistance against two other different races of Xoo, and to at least one other race of M. oryzae. In addition, the rice showed resistance to another bacterial species, Burkholderia glumae, which causes bacterial seedling rot and bacterial grain rot, and to Cochliobolus miyabeanus, another fungal species causing brown spot. Furthermore, BSR1-OX rice showed slight resistance to rice stripe disease, a major viral disease caused by rice stripe virus. Thus, we demonstrated that BSR1-OX rice shows remarkable broad-spectrum resistance to at least two major bacterial species and two major fungal species, and slight resistance to one viral pathogen. PMID:27436950

  10. Overexpression of BSR1 confers broad-spectrum resistance against two bacterial diseases and two major fungal diseases in rice.

    PubMed

    Maeda, Satoru; Hayashi, Nagao; Sasaya, Takahide; Mori, Masaki

    2016-06-01

    Broad-spectrum disease resistance against two or more types of pathogen species is desirable for crop improvement. In rice, Xanthomonas oryzae pv. oryzae (Xoo), the causal bacteria of rice leaf blight, and Magnaporthe oryzae, the fungal pathogen causing rice blast, are two of the most devastating pathogens. We identified the rice BROAD-SPECTRUM RESISTANCE 1 (BSR1) gene for a BIK1-like receptor-like cytoplasmic kinase using the FOX hunting system, and demonstrated that BSR1-overexpressing (OX) rice showed strong resistance to the bacterial pathogen, Xoo and the fungal pathogen, M. oryzae. Here, we report that BSR1-OX rice showed extended resistance against two other different races of Xoo, and to at least one other race of M. oryzae. In addition, the rice showed resistance to another bacterial species, Burkholderia glumae, which causes bacterial seedling rot and bacterial grain rot, and to Cochliobolus miyabeanus, another fungal species causing brown spot. Furthermore, BSR1-OX rice showed slight resistance to rice stripe disease, a major viral disease caused by rice stripe virus. Thus, we demonstrated that BSR1-OX rice shows remarkable broad-spectrum resistance to at least two major bacterial species and two major fungal species, and slight resistance to one viral pathogen. PMID:27436950

  11. Factors Affecting the Hydrogen Environment Assisted Cracking Resistance of an Al-Zn-Mg-(Cu) Alloy

    SciTech Connect

    G.A. Young; J.R. Scully

    2001-09-12

    It is well established that Al-Zn-Mg-(Cu) aluminum alloys are susceptible to hydrogen environment assisted cracking (HEAC) when exposed to aqueous environments. In Al-Zn-Mg-Cu alloys, overaged tempers are commonly used to increase HEAC resistance at the expense of strength. Overaging has little benefit in low copper alloys. However, the mechanism or mechanisms by which overaging imparts HEAC resistance is poorly understood. The present research investigated hydrogen uptake, diffusion, and crack growth rate in 90% relative humidity (RH) air for both a commercial copper bearing Al-Zn-Mg-Cu alloy (AA 7050) and a low copper variant of this alloy in order to better understand the factors which affect HEAC resistance. Experimental methods used to evaluate hydrogen concentrations local to a surface and near a crack tip include nuclear reaction analysis (NRA), focused ion beam, secondary ion mass spectroscopy (FIB/SIMS) and thermal desorption spectroscopy (TDS). When freshly bared coupons of AA 7050 are exposed to 90 C, 90% RH air, hydrogen ingress follows inverse-logarithmic-type kinetics and is equivalent for underaged (HEAC susceptible) and overaged (HEAC resistant) tempers. However, when the native oxide is allowed to form (24 hrs in 25 C, 40% RH lab air) prior to exposure to 90 C, 90% RH air, underaged alloy shows significantly greater hydrogen ingress than the overaged alloy. Humid air is a very aggressive environment producing local ({approx}1{micro}m) hydrogen concentrations in excess of 10,000 wt. ppm at 90 C. In the copper bearing alloy, overaging also effects the apparent diffusivity of hydrogen. As AA 7050 is aged from underaged {yields} peak aged {yields} overaged, the activation energy for hydrogen diffusion increases and the apparent diffusivity for hydrogen decreases, In the low copper alloy, overaging has little effect on hydrogen diffusion. Comparison of the apparent activation energies for hydrogen diffusion and for K independent (stage II) crack growth

  12. [McArdle disease or glycogen storage disease type v: Should it affect anaesthetic management?].

    PubMed

    Ayerza-Casas, V; Ferreira-Laso, L; Alloza-Fortun, M C; Fraile-Jimenez, A E

    2015-02-01

    McArdle disease is a metabolic myopathy that can may lead to severe perioperative problems. A case is reported of a woman with a history of McArdle disease, who was scheduled for a mastectomy. An understanding of the physiology and pathology, and the application of appropriate preventive measures can avoid complications. A overview of the complications and the management are described.

  13. Characterization of disease resistance loci in the USDA soybean germplasm collection using genome-wide association studies

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic resistance is a key strategy for soybean disease management. In past decades, soybean germplasm has been phenotyped for resistance to many different pathogens and genes for resistance have been incorporated into elite breeding lines often resulting in commercial cultivars with disease resist...

  14. A Novel Statistical Model to Estimate Host Genetic Effects Affecting Disease Transmission

    PubMed Central

    Anacleto, Osvaldo; Garcia-Cortés, Luis Alberto; Lipschutz-Powell, Debby; Woolliams, John A.; Doeschl-Wilson, Andrea B.

    2015-01-01

    There is increasing recognition that genetic diversity can affect the spread of diseases, potentially affecting plant and livestock disease control as well as the emergence of human disease outbreaks. Nevertheless, even though computational tools can guide the control of infectious diseases, few epidemiological models can simultaneously accommodate the inherent individual heterogeneity in multiple infectious disease traits influencing disease transmission, such as the frequently modeled propensity to become infected and infectivity, which describes the host ability to transmit the infection to susceptible individuals. Furthermore, current quantitative genetic models fail to fully capture the heritable variation in host infectivity, mainly because they cannot accommodate the nonlinear infection dynamics underlying epidemiological data. We present in this article a novel statistical model and an inference method to estimate genetic parameters associated with both host susceptibility and infectivity. Our methodology combines quantitative genetic models of social interactions with stochastic processes to model the random, nonlinear, and dynamic nature of infections and uses adaptive Bayesian computational techniques to estimate the model parameters. Results using simulated epidemic data show that our model can accurately estimate heritabilities and genetic risks not only of susceptibility but also of infectivity, therefore exploring a trait whose heritable variation is currently ignored in disease genetics and can greatly influence the spread of infectious diseases. Our proposed methodology offers potential impacts in areas such as livestock disease control through selective breeding and also in predicting and controlling the emergence of disease outbreaks in human populations. PMID:26405030

  15. A genome scan for QTL affecting resistance to Haemonchus contortus in sheep.

    PubMed

    Sallé, G; Jacquiet, P; Gruner, L; Cortet, J; Sauvé, C; Prévot, F; Grisez, C; Bergeaud, J P; Schibler, L; Tircazes, A; François, D; Pery, C; Bouvier, F; Thouly, J C; Brunel, J C; Legarra, A; Elsen, J M; Bouix, J; Rupp, R; Moreno, C R

    2012-12-01

    Gastrointestinal nematodes are one of the main health issues in sheep breeding. To identify loci affecting the resistance to Haemonchus contortus, a genome scan was carried out using 1,275 Romane × Martinik Black Belly backcross lambs. The entire population was challenged with Haemonchus contortus in 2 consecutive experimental infections, and fecal egg counts (FEC) and packed cell volumes were measured. A subgroup of 332 lambs with extreme FEC was necropsied to determine the total worm burden, length of female worms, sex ratio in the worm population, abomasal pH, and serum and mucosal G immunoglobulins (IgG) responses. Pepsinogen concentration was measured in another subset of 229 lambs. For QTL detection, 160 microsatellite markers were used as well as the Illumina OvineSNP50 BeadChip that provided 42,469 SNP markers after quality control. Linkage, association, and joint linkage and association analyses were performed with the QTLMAP software. Linkage disequilibrium (LD) was estimated within each pure breed, and association analyses were carried out either considering or not the breed origin of the haplotypes. Four QTL regions on sheep chromosomes (OAR)5, 12, 13, and 21 were identified as key players among many other QTL with small to moderate effects. A QTL on OAR21 affecting pepsinogen concentration exactly matched the pepsinogen (PGA5) locus. A 10-Mbp region affecting FEC after the 1st and 2nd infections was found on OAR12. The SNP markers outperformed microsatellites in the linkage analysis. Taking advantage of the LD helped to refine the locations of the QTL mapped on OAR5 and 13.

  16. Insecticide Control of Vector-Borne Diseases: When Is Insecticide Resistance a Problem?

    PubMed Central

    Rivero, Ana; Vézilier, Julien; Weill, Mylène; Read, Andrew F.; Gandon, Sylvain

    2010-01-01

    Many of the most dangerous human diseases are transmitted by insect vectors. After decades of repeated insecticide use, all of these vector species have demonstrated the capacity to evolve resistance to insecticides. Insecticide resistance is generally considered to undermine control of vector-transmitted diseases because it increases the number of vectors that survive the insecticide treatment. Disease control failure, however, need not follow from vector control failure. Here, we review evidence that insecticide resistance may have an impact on the quality of vectors and, specifically, on three key determinants of parasite transmission: vector longevity, competence, and behaviour. We argue that, in some instances, insecticide resistance is likely to result in a decrease in vector longevity, a decrease in infectiousness, or in a change in behaviour, all of which will reduce the vectorial capacity of the insect. If this effect is sufficiently large, the impact of insecticide resistance on disease management may not be as detrimental as previously thought. In other instances, however, insecticide resistance may have the opposite effect, increasing the insect's vectorial capacity, which may lead to a dramatic increase in the transmission of the disease and even to a higher prevalence than in the absence of insecticides. Either way—and there may be no simple generality—the consequence of the evolution of insecticide resistance for disease ecology deserves additional attention. PMID:20700451

  17. Molecular Breeding Strategy and Challenges Towards Improvement of Blast Disease Resistance in Rice Crop.

    PubMed

    Ashkani, Sadegh; Rafii, Mohd Y; Shabanimofrad, Mahmoodreza; Miah, Gous; Sahebi, Mahbod; Azizi, Parisa; Tanweer, Fatah A; Akhtar, Mohd Sayeed; Nasehi, Abbas

    2015-01-01

    Rice is a staple and most important security food crop consumed by almost half of the world's population. More rice production is needed due to the rapid population growth in the world. Rice blast caused by the fungus, Magnaporthe oryzae is one of the most destructive diseases of this crop in different part of the world. Breakdown of blast resistance is the major cause of yield instability in several rice growing areas. There is a need to develop strategies providing long-lasting disease resistance against a broad spectrum of pathogens, giving protection for a long time over a broad geographic area, promising for sustainable rice production in the future. So far, molecular breeding approaches involving DNA markers, such as QTL mapping, marker-aided selection, gene pyramiding, allele mining and genetic transformation have been used to develop new resistant rice cultivars. Such techniques now are used as a low-cost, high-throughput alternative to conventional methods allowing rapid introgression of disease resistance genes into susceptible varieties as well as the incorporation of multiple genes into individual lines for more durable blast resistance. The paper briefly reviewed the progress of studies on this aspect to provide the interest information for rice disease resistance breeding. This review includes examples of how advanced molecular method have been used in breeding programs for improving blast resistance. New information and knowledge gained from previous research on the recent strategy and challenges towards improvement of blast disease such as pyramiding disease resistance gene for creating new rice varieties with high resistance against multiple diseases will undoubtedly provide new insights into the rice disease control.

  18. Molecular Breeding Strategy and Challenges Towards Improvement of Blast Disease Resistance in Rice Crop

    PubMed Central

    Ashkani, Sadegh; Rafii, Mohd Y.; Shabanimofrad, Mahmoodreza; Miah, Gous; Sahebi, Mahbod; Azizi, Parisa; Tanweer, Fatah A.; Akhtar, Mohd Sayeed; Nasehi, Abbas

    2015-01-01

    Rice is a staple and most important security food crop consumed by almost half of the world’s population. More rice production is needed due to the rapid population growth in the world. Rice blast caused by the fungus, Magnaporthe oryzae is one of the most destructive diseases of this crop in different part of the world. Breakdown of blast resistance is the major cause of yield instability in several rice growing areas. There is a need to develop strategies providing long-lasting disease resistance against a broad spectrum of pathogens, giving protection for a long time over a broad geographic area, promising for sustainable rice production in the future. So far, molecular breeding approaches involving DNA markers, such as QTL mapping, marker-aided selection, gene pyramiding, allele mining and genetic transformation have been used to develop new resistant rice cultivars. Such techniques now are used as a low-cost, high-throughput alternative to conventional methods allowing rapid introgression of disease resistance genes into susceptible varieties as well as the incorporation of multiple genes into individual lines for more durable blast resistance. The paper briefly reviewed the progress of studies on this aspect to provide the interest information for rice disease resistance breeding. This review includes examples of how advanced molecular method have been used in breeding programs for improving blast resistance. New information and knowledge gained from previous research on the recent strategy and challenges towards improvement of blast disease such as pyramiding disease resistance gene for creating new rice varieties with high resistance against multiple diseases will undoubtedly provide new insights into the rice disease control. PMID:26635817

  19. Increased Levels of Antinutritional and/or Defense Proteins Reduced the Protein Quality of a Disease-Resistant Soybean Cultivar.

    PubMed

    Sousa, Daniele O B; Carvalho, Ana F U; Oliveira, José Tadeu A; Farias, Davi F; Castelar, Ivan; Oliveira, Henrique P; Vasconcelos, Ilka M

    2015-07-01

    The biochemical and nutritional attributes of two soybean (Glycine max (L.) Merr.) cultivars, one susceptible (Seridó) and the other resistant (Seridó-RCH) to stem canker, were examined to assess whether the resistance to pathogens was related to levels of antinutritional and/or defense proteins in the plant and subsequently affected the nutritional quality. Lectin, urease, trypsin inhibitor, peroxidase and chitinase activities were higher in the resistant cultivar. Growing rats were fed with isocaloric and isoproteic diets prepared with defatted raw soybean meals. Those on the Seridó-RCH diet showed the worst performance in terms of protein quality indicators. Based on regression analysis, lectin, trypsin inhibitor, peroxidase and chitinase appear to be involved in the resistance trait but also in the poorer nutritional quality of Seridó-RCH. Thus, the development of cultivars for disease resistance may lead to higher concentrations of antinutritional compounds, affecting the quality of soybean seeds. Further research that includes the assessment of more cultivars/genotypes is needed. PMID:26205163

  20. Increased Levels of Antinutritional and/or Defense Proteins Reduced the Protein Quality of a Disease-Resistant Soybean Cultivar

    PubMed Central

    Sousa, Daniele O. B.; Carvalho, Ana F. U.; Oliveira, José Tadeu A.; Farias, Davi F.; Castelar, Ivan; Oliveira, Henrique P.; Vasconcelos, Ilka M.

    2015-01-01

    The biochemical and nutritional attributes of two soybean (Glycine max (L.) Merr.) cultivars, one susceptible (Seridó) and the other resistant (Seridó-RCH) to stem canker, were examined to assess whether the resistance to pathogens was related to levels of antinutritional and/or defense proteins in the plant and subsequently affected the nutritional quality. Lectin, urease, trypsin inhibitor, peroxidase and chitinase activities were higher in the resistant cultivar. Growing rats were fed with isocaloric and isoproteic diets prepared with defatted raw soybean meals. Those on the Seridó-RCH diet showed the worst performance in terms of protein quality indicators. Based on regression analysis, lectin, trypsin inhibitor, peroxidase and chitinase appear to be involved in the resistance trait but also in the poorer nutritional quality of Seridó-RCH. Thus, the development of cultivars for disease resistance may lead to higher concentrations of antinutritional compounds, affecting the quality of soybean seeds. Further research that includes the assessment of more cultivars/genotypes is needed. PMID:26205163

  1. The Genetic Architecture of Genetic Resistance to Marek's Disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marek’s disease (MD), a T cell lymphoma induced by the oncogenic Marek’s disease virus (MDV), is one of the most serious chronic disease problems for the poultry industry. While MD is controlled through vaccination and biosecurity, it still costs more than $2 billion worldwide annually due to meat c...

  2. Genetic Signature of Resistance to White Band Disease in the Caribbean Staghorn Coral Acropora cervicornis.

    PubMed

    Libro, Silvia; Vollmer, Steven V

    2016-01-01

    Coral reefs are declining worldwide due to multiple factors including rising sea surface temperature, ocean acidification, and disease outbreaks. Over the last 30 years, White Band Disease (WBD) alone has killed up to 95% of the Caribbean`s dominant shallow-water corals--the staghorn coral Acropora cervicornis and the elkhorn coral A. palmata. Both corals are now listed on the US Endangered Species Act, and while their recovery has been slow, recent transmission surveys indicate that more than 5% of staghorn corals are disease resistant. Here we compared transcriptome-wide gene expression between resistant and susceptible staghorn corals exposed to WBD using in situ transmission assays. We identified constitutive gene expression differences underlying disease resistance that are independent from the immune response associated with disease exposure. Genes involved in RNA interference-mediated gene silencing, including Argonaute were up-regulated in resistant corals, whereas heat shock proteins (HSPs) were down-regulated. Up-regulation of Argonaute proteins indicates that post-transcriptional gene silencing plays a key, but previously unsuspected role in coral immunity and disease resistance. Constitutive expression of HSPs has been linked to thermal resilience in other Acropora corals, suggesting that the down-regulation of HSPs in disease resistant staghorn corals may confer a dual benefit of thermal resilience. PMID:26784329

  3. Genetic Signature of Resistance to White Band Disease in the Caribbean Staghorn Coral Acropora cervicornis.

    PubMed

    Libro, Silvia; Vollmer, Steven V

    2016-01-01

    Coral reefs are declining worldwide due to multiple factors including rising sea surface temperature, ocean acidification, and disease outbreaks. Over the last 30 years, White Band Disease (WBD) alone has killed up to 95% of the Caribbean`s dominant shallow-water corals--the staghorn coral Acropora cervicornis and the elkhorn coral A. palmata. Both corals are now listed on the US Endangered Species Act, and while their recovery has been slow, recent transmission surveys indicate that more than 5% of staghorn corals are disease resistant. Here we compared transcriptome-wide gene expression between resistant and susceptible staghorn corals exposed to WBD using in situ transmission assays. We identified constitutive gene expression differences underlying disease resistance that are independent from the immune response associated with disease exposure. Genes involved in RNA interference-mediated gene silencing, including Argonaute were up-regulated in resistant corals, whereas heat shock proteins (HSPs) were down-regulated. Up-regulation of Argonaute proteins indicates that post-transcriptional gene silencing plays a key, but previously unsuspected role in coral immunity and disease resistance. Constitutive expression of HSPs has been linked to thermal resilience in other Acropora corals, suggesting that the down-regulation of HSPs in disease resistant staghorn corals may confer a dual benefit of thermal resilience.

  4. Genetic Signature of Resistance to White Band Disease in the Caribbean Staghorn Coral Acropora cervicornis

    PubMed Central

    Libro, Silvia; Vollmer, Steven V.

    2016-01-01

    Coral reefs are declining worldwide due to multiple factors including rising sea surface temperature, ocean acidification, and disease outbreaks. Over the last 30 years, White Band Disease (WBD) alone has killed up to 95% of the Caribbean`s dominant shallow-water corals—the staghorn coral Acropora cervicornis and the elkhorn coral A. palmata. Both corals are now listed on the US Endangered Species Act, and while their recovery has been slow, recent transmission surveys indicate that more than 5% of staghorn corals are disease resistant. Here we compared transcriptome-wide gene expression between resistant and susceptible staghorn corals exposed to WBD using in situ transmission assays. We identified constitutive gene expression differences underlying disease resistance that are independent from the immune response associated with disease exposure. Genes involved in RNA interference-mediated gene silencing, including Argonaute were up-regulated in resistant corals, whereas heat shock proteins (HSPs) were down-regulated. Up-regulation of Argonaute proteins indicates that post-transcriptional gene silencing plays a key, but previously unsuspected role in coral immunity and disease resistance. Constitutive expression of HSPs has been linked to thermal resilience in other Acropora corals, suggesting that the down-regulation of HSPs in disease resistant staghorn corals may confer a dual benefit of thermal resilience. PMID:26784329

  5. A Biochemical Phenotype for a Disease Resistance Gene of Maize.

    PubMed Central

    Meeley, RB; Johal, GS; Briggs, SP; Walton, JD

    1992-01-01

    In maize, major resistance to the pathogenic fungus Cochliobolus (Helminthosporium) carbonum race 1 is determined by the dominant allele of the nuclear locus hm. The interaction between C. carbonum race 1 and maize is mediated by a pathogen-produced, low molecular weight compound called HC-toxin. We recently described an enzyme from maize, called HC-toxin reductase, that inactivates HC-toxin by pyridine nucleotide-dependent reduction of an essential carbonyl group. We now report that this enzyme activity is detectable only in extracts of maize that are resistant to C. carbonum race 1 (genotype Hm/Hm or Hm/hm). In several genetic analyses, in vitro HC-toxin reductase activity was without exception associated with resistance to C. carbonum race 1. The results indicate that detoxification of HC-toxin is the biochemical basis of Hm-specific resistance of maize to infection by C. carbonum race 1. PMID:12297630

  6. PARKINSON'S DISEASE PATIENTS WITH DOMINANT HEMIBODY AFFECTED BY THE DISEASE RELY MORE ON VISION TO MAINTAIN UPRIGHT POSTURAL CONTROL.

    PubMed

    Lahr, Juliana; Pereira, Marcelo Pinto; Pelicioni, Paulo Henrique Silva; De Morais, Luana Carolina; Gobbi, Lilian Teresa Bucken

    2015-12-01

    This study assesses the association between disease onset side (dominant or non-dominant) and vision on postural control of Parkinson's disease patients. Patient volunteers composed two groups, according to the onset side affected: Dominant group (n=9; M age=66.1 yr., SD=7.2; 6 women, 3 men) and Non-dominant group (n=9; M age=67.4 yr., SD=6.4; 6 women, 3 men). The groups' postural control was assessed by posturography during quiet upright stance in two conditions, Eyes open and Eyes closed. Two-way analyses of variance (ANOVAs; group×condition) with repeated measures for the second factor assessed the differences associated with affected hemibody and vision on postural control. Analyses indicated that patients with the dominant side affected also presented significantly greater variation in center of pressure than those with the non-dominant side affected, mainly in the Eyes closed condition. The results demonstrate a higher reliance on vision in the dominant side, possibly to compensate somatosensory system impairments. These results also highlight the importance of analyzing the hemibody affected by the disease when postural control is assessed in this population.

  7. Bacteriophage can lyse antibiotic-resistant Pseudomonas aeruginosa isolated from canine diseases

    PubMed Central

    FURUSAWA, Takaaki; IWANO, Hidetomo; HIGUCHI, Hidetoshi; YOKOTA, Hiroshi; USUI, Masaru; IWASAKI, Tomohito; TAMURA, Yutaka

    2016-01-01

    Pseudomonas aeruginosa is a pathogen frequently identified as the cause of diverse infections or chronic disease. This microbe has natural resistance to several kinds of antibiotics, because of the species’ outer membrane, efflux pumps and growth as a biofilm. This bacterium can acquire increased resistance with specific point mutations. Bacteriophage (phage), however, can lyse these bacteria. Therefore, in the present study, we assessed the host range of phages isolates and their ability to lyse antibiotic-resistant P. aeruginosa. Present phages could lyse many strains of P. aeruginosa (28/39), including strains with high resistance to fluoroquinolones (4/6). In conclusion, application of phages for antibiotic-resistant bacteria is greatly effective. To avoid pervasive antibiotic-resistant bacteria, further development of phage usage for disease treatment is required. PMID:26876365

  8. Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens

    PubMed Central

    Ederli, Luisa; Dawe, Adam; Pasqualini, Stefania; Quaglia, Mara; Xiong, Liming; Gehring, Chris

    2015-01-01

    We investigated whether the Arabidopsis flower evolved protective measures to increase reproductive success. Firstly, analyses of available transcriptome data show that the most highly expressed transcripts in the closed sepal (stage 12) are enriched in genes with roles in responses to chemical stimuli and cellular metabolic processes. At stage 15, there is enrichment in transcripts with a role in responses to biotic stimuli. Comparative analyses between the sepal and petal in the open flower mark an over-representation of transcripts with a role in responses to stress and catalytic activity. Secondly, the content of the biotic defense-associated phytohormone salicylic acid (SA) in sepals and petals is significantly higher than in leaves. To understand whether the high levels of stress responsive transcripts and the higher SA content affect defense, wild-type plants (Col-0) and transgenic plants defective in SA accumulation (nahG) were challenged with the biotrophic fungus Golovinomyces cichoracearum, the causal agent of powdery mildew, and the necrotrophic fungus Botrytis cinerea. NahG leaves were more sensitive than those of Col-0, suggesting that in leaves SA has a role in the defense against biotrophs. In contrast, sepals and petals of both genotypes were resistant to G. cichoracearum, indicating that in the flower, resistance to the biotrophic pathogen is not critically dependent on SA, but likely dependent on the up-regulation of stress-responsive genes. Since sepals and petals of both genotypes are equally susceptible to B. cinerea, we conclude that neither stress-response genes nor increased SA accumulation offers protection against the necrotrophic pathogen. These results are interpreted in the light of the distinctive role of the flower and we propose that in the early stages, the sepal may act as a chemical defense barrier of the developing reproductive structures against biotrophic pathogens. PMID:25750645

  9. Carrageenans, Sulphated Polysaccharides of Red Seaweeds, Differentially Affect Arabidopsis thaliana Resistance to Trichoplusia ni (Cabbage Looper)

    PubMed Central

    Sangha, Jatinder S.; Khan, Wajahatullah; Ji, Xiuhong; Zhang, Junzeng; Mills, Aaron A. S.; Critchley, Alan T.; Prithiviraj, Balakrishnan

    2011-01-01

    Carrageenans are a collective family of linear, sulphated galactans found in a number of commercially important species of marine red alga. These polysaccharides are known to elicit defense responses in plant and animals and possess anti-viral properties. We investigated the effect of foliar application of ι-, κ- and λ-carrageenans (representing various levels of sulphation) on Arabidopsis thaliana in resistance to the generalist insect Trichoplusia ni (cabbage looper) which is known to cause serious economic losses in crop plants. Plants treated with ι- and κ-carrageenan showed reduced leaf damage, whereas those treated with λ- carrageenan were similar to that of the control. In a no-choice test, larval weight was reduced by more than 20% in ι- and κ- carrageenan treatments, but unaffected by λ-carrageenan. In multiple choice tests, carrageenan treated plants attracted fewer T. ni larvae by the fourth day following infestation as compared to the control. The application of carrageenans did not affect oviposition behaviour of T. ni. Growth of T. ni feeding on an artificial diet amended with carrageenans was not different from that fed with untreated control diet. ι-carrageenan induced the expression of defense genes; PR1, PDF1.2, and TI1, but κ- and λ-carrageenans did not. Besides PR1, PDF1.2, and TI1, the indole glucosinolate biosynthesis genes CYP79B2, CYP83B1 and glucosinolate hydrolysing QTL, ESM1 were up-regulated by ι-carrageenan treatment at 48 h post infestation. Gas chromatography-mass spectrometry analysis of carrageenan treated leaves showed increased concentrations of both isothiocyanates and nitriles. Taken together, these results show that carrageenans have differential effects on Arabidopsis resistance to T. ni and that the degree of sulphation of the polysaccharide chain may well mediate this effect. PMID:22046375

  10. Disease resistance breeding in rose: current status and potential of biotechnological tools.

    PubMed

    Debener, Thomas; Byrne, David H

    2014-11-01

    The cultivated rose is a multispecies complex for which a high level of disease protection is needed due to the low tolerance of blemishes in ornamental plants. The most important fungal diseases are black spot, powdery mildew, botrytis and downy mildew. Rose rosette, a lethal viral pathogen, is emerging as a devastating disease in North America. Currently rose breeders use a recurrent phenotypic selection approach and perform selection for disease resistance for most pathogen issues in a 2-3 year field trial. Marker assisted selection could accelerate this breeding process. Thus far markers have been identified for resistance to black spot (Rdrs) and powdery mildew and with the ability of genotyping by sequencing to generate 1000s of markers our ability to identify markers useful in plant improvement should increase exponentially. Transgenic rose lines with various fungal resistance genes inserted have shown limited success and RNAi technology has potential to provide virus resistance. Roses, as do other plants, have sequences homologous to characterized R-genes in their genomes, some which have been related to specific disease resistance. With improving next generation sequencing technology, our ability to do genomic and transcriptomic studies of the resistance related genes in both the rose and the pathogens to reveal novel gene targets to develop resistant roses will accelerate. Finally, the development of designer nucleases opens up a potentially non-GMO approach to directly modify a rose's DNA to create a disease resistant rose. Although there is much potential, at present rose breeders are not using marker assisted breeding primarily because a good suite of marker/trait associations (MTA) that would ensure a path to stable disease resistance is not available. As our genomic analytical tools improve, so will our ability to identify useful genes and linked markers. Once these MTAs are available, it will be the cost savings, both in time and money, that will

  11. Loss of dopaminergic nigrostriatal neurons accounts for the motivational and affective deficits in Parkinson's disease.

    PubMed

    Drui, G; Carnicella, S; Carcenac, C; Favier, M; Bertrand, A; Boulet, S; Savasta, M

    2014-03-01

    Parkinson's disease (PD) involves the degeneration of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNc) that is thought to cause the classical motor symptoms of this disease. However, motivational and affective impairments are also often observed in PD patients. These are usually attributed to a psychological reaction to the general motor impairment and to a loss of some of the neurons within the ventral tegmental area (VTA). We induced selective lesions of the VTA and SNc DA neurons that did not provoke motor deficits, and showed that bilateral dopamine loss within the SNc, but not within the VTA, induces motivational deficits and affective impairments that mimicked the symptoms of PD patients. Thus, motivational and affective deficits are a core impairment of PD, as they stem from the loss of the major group of neurons that degenerates in this disease (DA SNc neurons) and are independent of motor deficits.

  12. Identification of Resistance to Wet Bubble Disease and Genetic Diversity in Wild and Cultivated Strains of Agaricus bisporus.

    PubMed

    Fu, Yongping; Wang, Xinxin; Li, Dan; Liu, Yuan; Song, Bing; Zhang, Chunlan; Wang, Qi; Chen, Meiyuan; Zhang, Zhiwu; Li, Yu

    2016-01-01

    Outbreaks of wet bubble disease (WBD) caused by Mycogone perniciosa are increasing across the world and seriously affecting the yield of Agaricus bisporus. However, highly WBD-resistant strains are rare. Here, we tested 28 A. bisporus strains for WBD resistance by inoculating M. perniciosa spore suspension on casing soil, and assessed genetic diversity of these strains using 17 new simple sequence repeat (SSR) markers developed in this study. We found that 10 wild strains originating from the Tibetan Plateau in China were highly WBD-resistant strains, and 13 cultivated strains from six countries were highly susceptible strains. A total of 88 alleles were detected in these 28 strains, and the observed number of alleles per locus ranged from 2 to 8. Cluster and genetic structure analysis results revealed the wild resources from China have a relatively high level of genetic diversity and occur at low level of gene flow and introgression with cultivated strains. Moreover, the wild strains from China potentially have the consensus ancestral genotypes different from the cultivated strains and evolved independently. Therefore, the highly WBD-resistant wild strains from China and newly developed SSR markers could be used as novel sources for WBD-resistant breeding and quantitative trait locus (QTL) mapping of WBD-resistant gene of A. bisporus. PMID:27669211

  13. Identification of Resistance to Wet Bubble Disease and Genetic Diversity in Wild and Cultivated Strains of Agaricus bisporus

    PubMed Central

    Fu, Yongping; Wang, Xinxin; Li, Dan; Liu, Yuan; Song, Bing; Zhang, Chunlan; Wang, Qi; Chen, Meiyuan; Zhang, Zhiwu; Li, Yu

    2016-01-01

    Outbreaks of wet bubble disease (WBD) caused by Mycogone perniciosa are increasing across the world and seriously affecting the yield of Agaricus bisporus. However, highly WBD-resistant strains are rare. Here, we tested 28 A. bisporus strains for WBD resistance by inoculating M. perniciosa spore suspension on casing soil, and assessed genetic diversity of these strains using 17 new simple sequence repeat (SSR) markers developed in this study. We found that 10 wild strains originating from the Tibetan Plateau in China were highly WBD-resistant strains, and 13 cultivated strains from six countries were highly susceptible strains. A total of 88 alleles were detected in these 28 strains, and the observed number of alleles per locus ranged from 2 to 8. Cluster and genetic structure analysis results revealed the wild resources from China have a relatively high level of genetic diversity and occur at low level of gene flow and introgression with cultivated strains. Moreover, the wild strains from China potentially have the consensus ancestral genotypes different from the cultivated strains and evolved independently. Therefore, the highly WBD-resistant wild strains from China and newly developed SSR markers could be used as novel sources for WBD-resistant breeding and quantitative trait locus (QTL) mapping of WBD-resistant gene of A. bisporus. PMID:27669211

  14. Genome-wide association of rice blast disease resistance and yield-related components of rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Robust disease resistance may require an expenditure of energy that may limit crop yield potential. In the present study, a subset of a USDA rice core collection consisting of 151 accessions was selected using a major blast resistance (R) gene Pi-ta marker, and was genotyped with 156 simple sequence...

  15. Identification of disease resistance genes for enhancement of existing potato cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A plant’s ability to defend itself against host-specific microbes is specified by disease resistance (R) genes. Upon recognition of an invading pathogen, R proteins are responsible for the activation of a multitude of responses ultimately leading to resistance. The majority of R genes are dominant a...

  16. Translational neurophysiology in sheep: measuring sleep and neurological dysfunction in CLN5 Batten disease affected sheep

    PubMed Central

    Perentos, Nicholas; Martins, Amadeu Q.; Watson, Thomas C.; Bartsch, Ullrich; Mitchell, Nadia L.; Palmer, David N.; Jones, Matthew W.

    2015-01-01

    Creating valid mouse models of slowly progressing human neurological diseases is challenging, not least because the short lifespan of rodents confounds realistic modelling of disease time course. With their large brains and long lives, sheep offer significant advantages for translational studies of human disease. Here we used normal and CLN5 Batten disease affected sheep to demonstrate the use of the species for studying neurological function in a model of human disease. We show that electroencephalography can be used in sheep, and that longitudinal recordings spanning many months are possible. This is the first time such an electroencephalography study has been performed in sheep. We characterized sleep in sheep, quantifying characteristic vigilance states and neurophysiological hallmarks such as sleep spindles. Mild sleep abnormalities and abnormal epileptiform waveforms were found in the electroencephalographies of Batten disease affected sheep. These abnormalities resemble the epileptiform activity seen in children with Batten disease and demonstrate the translational relevance of both the technique and the model. Given that both spontaneous and engineered sheep models of human neurodegenerative diseases already exist, sheep constitute a powerful species in which longitudinal in vivo studies can be conducted. This will advance our understanding of normal brain function and improve our capacity for translational research into neurological disorders. PMID:25724202

  17. Acute arginine supplementation fails to improve muscle endurance or affect blood pressure responses to resistance training.

    PubMed

    Greer, Beau K; Jones, Brett T

    2011-07-01

    Dietary supplement companies claim that arginine supplements acutely enhance skeletal muscular endurance. The purpose of this study was to determine whether acute arginine α-ketoglutarate supplementation (AAKG) will affect local muscle endurance of the arm and shoulder girdle or the blood pressure (BP) response to anaerobic exercise. Twelve trained college-aged men (22.6 ± 3.8 years) performed 2 trials of exercise separated by at least 1 week. At 4 hours before, and 30 minutes before exercise, a serving of an AAKG supplement (3,700 mg arginine alpha-ketoglutarate per serving) or placebo was administered. Resting BP was assessed pre-exercise after 16 minutes of seated rest, and 5 and 10 minutes postexercise. Three sets each of chin-ups, reverse chin-ups, and push-ups were performed to exhaustion with 3 minutes of rest between each set. Data were analyzed using repeated-measures analysis of variance and paired t-tests. The AAKG supplementation did not improve muscle endurance or significantly affect the BP response to anaerobic work. Subjects performed fewer total chin-ups (23.75 ± 6.38 vs. 25.58 ± 7.18) and total trial repetitions (137.92 ± 28.18 vs. 141.08 ± 28.57) in the supplement trial (p ≤ 0.05). Subjects executed fewer reverse chin-ups (5.83 ± 1.85 vs. 6.75 ± 2.09) during set 2 after receiving the supplement as compared to the placebo (p < 0.05). Because AAKG supplementation may hinder muscular endurance, the use of these supplements before resistance training should be questioned.

  18. Elevated depressive affect is associated with adverse cardiovascular outcomes among African Americans with chronic kidney disease

    PubMed Central

    Fischer, Michael J.; Kimmel, Paul L.; Greene, Tom; Gassman, Jennifer J.; Wang, Xuelei; Brooks, Deborah H.; Charleston, Jeanne; Dowie, Donna; Thornley-Brown, Denyse; Cooper, Lisa A.; Bruce, Marino A.; Kusek, John W.; Norris, Keith C.; Lash, James P.

    2011-01-01

    This study was designed to examine the impact of elevated depressive affect on health outcomes among participants with hypertensive chronic kidney disease in the African-American Study of Kidney Disease and Hypertension (AASK) Cohort Study. Elevated depressive affect was defined by Beck Depression Inventory II (BDI-II) thresholds of 11 or more, above 14, and by 5-Unit increments in the score. Cox regression analyses were used to relate cardiovascular death/hospitalization, doubling of serum creatinine/end-stage renal disease, overall hospitalization, and all-cause death to depressive affect evaluated at baseline, the most recent annual visit (time-varying), or average from baseline to the most recent visit (cumulative). Among 628 participants at baseline, 42% had BDI-II scores of 11 or more and 26% had a score above 14. During a 5-year follow-up, the cumulative incidence of cardiovascular death/hospitalization was significantly greater for participants with baseline BDI-II scores of 11 or more compared with those with scores <11. The baseline, time-varying, and cumulative elevated depressive affect were each associated with a significant higher risk of cardiovascular death/hospitalization, especially with a time-varying BDI-II score over 14 (adjusted HR 1.63) but not with the other outcomes. Thus, elevated depressive affect is associated with unfavorable cardiovascular outcomes in African Americans with hypertensive chronic kidney disease. PMID:21633409

  19. Transcriptional profiling of Meq-dependent genes in Marek’s disease resistant and susceptible inbred chicken lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marek’s disease (MD) is an economically significant disease in chickens caused by the highly oncogenic Marek’s disease virus (MDV). Understanding the genes and biological pathways that confer MD genetic resistance should lead towards the development of more disease resistant commercial poultry flock...

  20. [Fosfomycin--its significance for treatment of diseases due to multidrug-resistant bacteria].

    PubMed

    Stock, Ingo

    2015-01-01

    Fosfomycin is a bactericidal phosphonic acid derivative, which engages by inhibiting pyruvyltransferase at an early stage in the peptidoglycan synthesis. It shows a broad spectrum of activity that includes many multidrug-resistant gram-negative and gram-positive bacteria. Fosfomycin is active against most strains of Pseudomonas aeruginosa and several multidrug-resistant Enterobacteriaceae, e.g., Escherichia coli strains expressing extended spectrum beta-lactamases (ESBL) and Klebsiella pneumoniae strains with decreased susceptibilities to carbapenems. Most methicillin-resistant Staphylococcus aureus (MRSA) strains as well as enterococci with and without vancomycin resistance are also sensitive to fosfomycin. During the last decade, a variety of studies showed that fosfomycin is not only suitable for treating uncomplicated urinary tract diseases, but also for the treatment of many other diseases caused by bacterial pathogens with and without multidrug resistance. However, large controlled studies demonstrating the efficacy of the drug to treat diseases caused by multidrug-resistant bacteria are still missing. Considering the low number of antibacterial agents with good activity against multidrug-resistant bacteria, fosfomycin should be evaluated as an important antibiotic for the treatment of several severe illnesses due to these pathogens. However, because some multidrug-resistant bacteria are also resistant to fosfomycin, this agent should only be applied if the pathogen is sensitive to this drug. In addition, because rapid development of resistance cannot be excluded if fosfomycin will be applied alone, this drug should only be given in combination with other effective drugs for the treatment of serious systemic diseases due to multidrug-resistant bacterial pathogens.

  1. Gingival fibroblasts resist apoptosis in response to oxidative stress in a model of periodontal diseases

    PubMed Central

    Cheng, R; Choudhury, D; Liu, C; Billet, S; Hu, T; Bhowmick, NA

    2015-01-01

    Periodontal diseases are classified as inflammation affecting the supporting tissue of teeth, which eventually leads to tooth loss. Mild reversible gingivitis and severe irreversible periodontitis are the most common periodontal diseases. Periodontal pathogens initiate the diseases. The bacterial toxin, lipopolysaccharide (LPS), triggers the inflammatory response and leads to oxidative stress. However, the progress of oxidative stress in periodontal diseases is unknown. The purpose of this study is to examine oxidative stress and cell damage in gingivitis and periodontitis. Our results showed that LPS increases reactive oxygen species (ROS) accumulation in gingival fibroblast (GF). However, oxidative stress resulting from excessive ROS did not influence DNA damage and cell apoptosis within 24 h. The mechanism may be related to the increased expression of DNA repair genes, Ogg1, Neil1 and Rad50. Detection of apoptosis-related proteins also showed anti-apoptotic effects and pro-apoptotic effects were balanced. The earliest damage appeared in DNA when increased γH2AX, an early biomarker for DNA damage, was detected in the LPS group after 48 h. Later, when recurrent inflammation persisted, 8-OHdG, a biomarker for oxidative stress was much higher in periodontitis model compared to the control in vivo. Staining of 8-OHdG in human periodontitis specimens confirmed the results. Furthermore, TUNEL staining of apoptotic cells indicated that the periodontitis model induced more cell apoptosis in gingival tissue. This suggested GF could resist early and acute inflammation (gingivitis), which was regarded as reversible, but recurrent and chronic inflammation (periodontitis) led to permanent cell damage and death. PMID:27551475

  2. The use of radio-collars for monitoring wildlife diseases: a case study from Iberian ibex affected by Sarcoptes scabiei in Sierra Nevada, Spain

    PubMed Central

    2013-01-01

    Background Wildlife radio tracking has gained popularity during the recent past. Ecologists and conservationists use radio-collars for different purposes: animal movement monitoring, home range, productivity, population estimation, behaviour, habitat use, survival, and predator-prey interaction, among others. The aim of our present study is to highlight the application of radio-collars for wildlife diseases monitoring. The spread of wildlife diseases and the efficacy of management actions for controlling them propose serious challenges for ecologists and conservationists, since it is difficult to re-capture (or simply observe) the same animal in pre-determined temporal interval, but such difficulty is overcome by the use of gps-gsm radio collars. Methods In the present study we report, for the first time to our knowledge, the use of radio-collars in the monitoring of Iberian ibex affected by Sarcoptes scabiei in Sierra Nevada mountain range, Spain. Twenty-five moderate or slightly mangy animals were radio-collared between 2006 and 2013. Results The radio-collars allowed us to confirm the presence of resistance to S. scabiei within Iberian ibex population. Twenty (80%) of the collared animals recovered totally from mange, while the disease progressed in the other five Iberian ibex (20% of the collared animals) and the animals died. The average estimated recovery time of the resistant animals was 245 ± 277 days, and the estimated average survival time of the non-resistant Iberian ibex was 121 ± 71 days. Non-resistant animals survived at least 100 days, while all of them died with less than 200 days. Sixty per cent of the resistant animals were recovered with less than 200 days. Conclusions We report, for the first time, the successful use of radio collars for wildlife diseases monitoring using Iberian ibex/S. scabiei as a model. By using radio collars we documented that most of the Sarcoptes-infected Iberian ibex are resistant to this disease, and we

  3. Identification of Genetic Loci Affecting the Severity of Symptoms of Hirschsprung Disease in Rats Carrying Ednrbsl Mutations by Quantitative Trait Locus Analysis

    PubMed Central

    Torigoe, Daisuke; Lei, Chuzhao; Lan, Xianyong; Chen, Hong; Sasaki, Nobuya; Wang, Jinxi; Agui, Takashi

    2015-01-01

    Hirschsprung’s disease (HSCR) is a congenital disease in neonates characterized by the absence of the enteric ganglia in a variable length of the distal colon. This disease results from multiple genetic interactions that modulate the ability of enteric neural crest cells to populate developing gut. We previously reported that three rat strains with different backgrounds (susceptible AGH-Ednrbsl/sl, resistant F344-Ednrbsl/sl, and LEH-Ednrbsl/sl) but the same null mutation of Ednrb show varying severity degrees of aganglionosis. This finding suggests that strain-specific genetic factors affect the severity of HSCR. Consistent with this finding, a quantitative trait locus (QTL) for the severity of HSCR on chromosome (Chr) 2 was identified using an F2 intercross between AGH and F344 strains. In the present study, we performed QTL analysis using an F2 intercross between the susceptible AGH and resistant LEH strains to identify the modifier/resistant loci for HSCR in Ednrb-deficient rats. A significant locus affecting the severity of HSCR was also detected within the Chr 2 region. These findings strongly suggest that a modifier gene of aganglionosis exists on Chr 2. In addition, two potentially causative SNPs (or mutations) were detected upstream of a known HSCR susceptibility gene, Gdnf. These SNPs were possibly responsible for the varied length of gut affected by aganglionosis. PMID:25790447

  4. A Nomadic Subtelomeric Disease Resistance Gene Cluster in Common Bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The B4 resistance (R)-gene cluster, located in subtelomeric region of chromosome 4, is one of the largest clusters known in common bean (Phaseolus vulgaris, Pv). We sequenced 650 kb spanning this locus and annotated 97 genes, 26 of which correspond to Coiled-coil-Nucleotide-Binding-Site-Leucine-Rich...

  5. Antimicrobial resistances do not affect colonization parameters of intestinal E. coli in a small piglet group

    PubMed Central

    Schierack, Peter; Kadlec, Kristina; Guenther, Sebastian; Filter, Matthias; Schwarz, Stefan; Ewers, Christa; Wieler, Lothar H

    2009-01-01

    Background Although antimicrobial resistance and persistence of resistant bacteria in humans and animals are major health concerns worldwide, the impact of antimicrobial resistance on bacterial intestinal colonization in healthy domestic animals has only been rarely studied. We carried out a retrospective analysis of the antimicrobial susceptibility status and the presence of resistance genes in intestinal commensal E. coli clones from clinically healthy pigs from one production unit with particular focus on effects of pheno- and/or genotypic resistance on different nominal and numerical intestinal colonization parameters. In addition, we compared the occurrence of antimicrobial resistance phenotypes and genotypes with the occurrence of virulence associated genes typical for extraintestinal pathogenic E. coli. Results In general, up to 72.1% of all E. coli clones were resistant to ampicillin, chloramphenicol, kanamycin, streptomycin, sulfamethoxazole or tetracycline with a variety of different resistance genes involved. There was no significant correlation between one of the nominal or numerical colonization parameters and the absence or presence of antimicrobial resistance properties or resistance genes. However, there were several statistically significant associations between the occurrence of single resistance genes and single virulence associated genes. Conclusion The demonstrated resistance to the tested antibiotics might not play a dominant role for an intestinal colonization success in pigs in the absence of antimicrobial drugs, or cross-selection of other colonization factors e.g. virulence associated genes might compensate "the cost of antibiotic resistance". Nevertheless, resistant strains are not outcompeted by susceptible bacteria in the porcine intestine. Trial Registration The study was approved by the local animal welfare committee of the "Landesamt für Arbeitsschutz, Gesundheitsschutz und technische Sicherheit" Berlin, Germany (No. G0037/02). PMID

  6. A new type of Alcaligenes eutrophus CH34 zinc resistance generated by mutations affecting regulation of the cnr cobalt-nickel resistance system.

    PubMed Central

    Collard, J M; Provoost, A; Taghavi, S; Mergeay, M

    1993-01-01

    Spontaneous mutants that were resistant to zinc were isolated from Alcaligenes eutrophus CH34 containing either the native plasmid pMOL28 or a derivative derepressed for its self-transfer, pMOL50. With the cured plasmid-free derivative of CH34, strain AE104, such mutants were not detected. The mutations, which were shown to be located in the plasmid, increased the level of the nickel and cobalt resistance determined by the cnr locus. The chromate resistance closely linked to the cnr locus was not affected by these mutations. In the Znr mutants, the resistance to zinc and nickel was constitutively expressed. Uptake studies showed that the zinc resistance in a Znr mutant resulted from reduced accumulation of zinc ions in comparison with that in the plasmid-free strain. Reduced accumulation of zinc was also observed to a lesser degree in the parental strain induced with nickel, suggesting that zinc interferes with the Ni2+ and Co2+ efflux system. A 12.2-kb EcoRI-XbaI restriction endonuclease fragment containing the cnr locus was cloned from plasmid pMOL28 harboring the mutation and shortened to an 8.5-kb EcoRI-PstI-PstI fragment conferring resistance to zinc, nickel, and cobalt. The 12.2-kb EcoRI-XbaI fragment was also reduced to a 9.7-kb BamHI fragment still encoding weak resistance to nickel and cobalt but not to zinc. Complementation studies demonstrated the recessivity of the cnr mutations with a Znr phenotype. Such mutations thus allow positive selection of mutants affected in the expression of the cnr operon. PMID:8423150

  7. Analysis of the characteristics of slot design affecting resistance to sliding during active archwire configurations

    PubMed Central

    2013-01-01

    Background During orthodontic treatment, a low resistance to slide (RS) is desirable when sliding mechanics are used. Many studies showed that several variables affect the RS at the bracket-wire interface; among these, the design of the bracket slot has not been deeply investigated yet. This study aimed to clarify the effect of different slot designs on the RS expressed by five types of low-friction brackets in vertical and horizontal active configurations of the wire. Methods Five low-friction brackets (Damon SL II, Ormco, Orange, CA, USA; In-Ovation, GAC International, Bohemia, NY, USA; Quick, Forestadent, Pforzheim, Germany; Time 2, AO, Sheboygan, WI, USA; Synergy, RMO, Denver, CO, USA) coupled with an 0.014-in NiTi thermal wire (Therma-Lite, AO) were tested in two three-bracket experimental models simulating vertical and horizontal bracket displacements. A custom-made machine was used to measure frictional resistance with tests repeated on ten occasions for each bracket-wire combination. Design characteristics such as the mesio-distal slot width, slot depth, and presence of chamfered edges at the extremities of the slot were evaluated on SEM images (SUPRA, Carl Zeiss, Oberkochen, Germany) and analyzed in relation to the data of RS recorded. Results Time 2 was found to show the higher frictional forces (1.50 and 1.35 N) in both experimental models (p < 0.05), while Quick and Synergy brackets showed the lower frictional values in the vertical (0.66 N) and in the horizontal (0.68 N) bracket displacements, respectively. With vertically displaced brackets, the increased mesio-distal slot width and the presence of clear angle at mesial and distal slot edges increase the values of RS. With brackets horizontally displaced, the RS expressed by the wire is influenced simultaneously by the depth of the slot, the mesio-distal slot width, and the presence of clear angle at the extremities of the slot base, the clip, or the slide. Conclusion In order to select the proper low

  8. The affect of infectious bursal disease virus on avian influenza virus vaccine efficacy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Immunosuppressive viruses are known to affect vaccinal immunity, however the impact of virally induced immunosuppression on avian influenza vaccine efficacy has not been quantified. In order to determine the effect of exposure to infectious bursal disease virus (IBDV) on vaccinal immunity to highly ...

  9. Toward The identification Of candidate genes involved in black pod disease resistance in Theobroma cacao L.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing yield, quality and disease resistance are important objectives for cacao breeding programs. Some of the diseases, such as black pod rot (Phytophtora spp), frosty pod (Moniliophthora roreri) and witches’ broom (M. perniciosa), produce significant losses in all or in some of the various pro...

  10. Production of transgenic citrus resistant to citrus canker and Huanglongbing diseases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Huanglongbing (HLB or citrus greening disease) caused by Candidatus Liberibacter asiaticus (Las) is a great threat to the U.S. citrus industry. There are no proven strategies to eliminate HLB disease and no cultivars identified with strong HLB resistance. Citrus canker is also an economically import...

  11. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

  12. Overexpression of a citrus NDR1 ortholog increases disease resistance in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging devastating diseases, such as Huanglongbing (HLB) and citrus canker, have caused tremendous losses to the citrus industry worldwide. Genetic engineering is a powerful approach that could allow us to increase citrus resistance against these diseases. The key to the success of this approach r...

  13. Induced resistance – does it have potential as a tool in pecan disease management?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pecan scab (Fusicladium effusum) causes losses of pecan nutmeat yield and quality in the southeastern US. New methods are needed to manage the disease. Plants possess resistance mechanisms that can be activated in response to infection with certain diseases (or damage from a pest). These mechanisms ...

  14. Confirming QTLs and finding additional loci responsible for resistance to rice sheath blight disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice sheath blight disease (Rhizoctonia solani AG1-1AKühn) is one of the most destructive rice diseases worldwide. Utilization of host resistance is the most economical and environmentally sound strategy in managing sheath blight (ShB). Ten ShB-QTLs were previously mapped in a LJRIL population using...

  15. QTLs analysis for resistance to blast disease in US weedy rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding the genetic architecture of adaptation is of great importance in evolutionary biology. US weedy rice is well-adapted to the local conditions in US rice fields. Rice blast disease is one of the most destructive diseases of cultivated rice worldwide. However, information about resistance...

  16. Reverse evolution: selection against costly resistance in disease-free microcosm populations of Paramecium caudatum.

    PubMed

    Duncan, Alison B; Fellous, Simon; Kaltz, Oliver

    2011-12-01

    Evolutionary costs of parasite resistance arise if genes conferring resistance reduce fitness in the absence of parasites. Thus, parasite-mediated selection may lead to increased resistance and a correlated decrease in fitness, whereas relaxed parasite-mediated selection may lead to reverse evolution of increased fitness and a correlated decrease in resistance. We tested this idea in experimental populations of the protozoan Paramecium caudatum and the parasitic bacterium Holospora undulata. After eight years, resistance to infection and asexual reproduction were compared among paramecia from (1) "infected" populations, (2) uninfected "naive" populations, and (3) previously infected, parasite-free "recovered" populations. Paramecia from "infected" populations were more resistant (+12%), but had lower reproduction (-15%) than "naive" paramecia, indicating an evolutionary trade-off between resistance and fitness. Recovered populations showed similar reproduction to naive populations; however, resistance of recently (<3 years) recovered populations was similar to paramecia from infected populations, whereas longer (>3 years) recovered populations were as susceptible as naive populations. This suggests a weak, convex trade-off between resistance and fitness, allowing recovery of fitness, without complete loss of resistance, favoring the maintenance of a generalist strategy of intermediate fitness and resistance. Our results indicate that (co)evolution with parasites can leave a genetic signature in disease-free populations. PMID:22133218

  17. [The White man's burden - a case study caught between bipolar affective disorder and Huntington's disease].

    PubMed

    Nowidi, K; Kunisch, R; Bouna-Pyrrou, P; Meißner, D; Hennig-Fast, K; Weindl, A; Förster, S; Neuhann, T M; Falkai, P; Berger, M; Musil, R

    2013-06-01

    We report upon a case of a 55 year old patient with a bipolar affective disorder, presenting herself with a depressive symptomatology in addition to a severe motor perturbation. The main emphasis upon admittance was perfecting and improving her latest medication. Four weeks prior to her stay at our clinic a thorough neurological examination had taken place in terms of an invalidity pension trial which did not result in any diagnostic findings. Therefore a neurological disease seemed at first highly unlikely. Even though the prior testing was negative, the ensuing neurological examination at our clinic resulted in movement disorders very much indicative of Huntington's Disease. A detailed investigation in regards to the particular family history of the patient was positive for Huntington's Disease. However, whether the patient's mother had also been a genetic carrier of Huntington's Disease was still unknown at the time the patient was admitted to our clinic. It was nevertheless discovered that her mother had also suffered from a bipolar affective disorder. A genetic testing that followed the neurological examination of the patient proved positive for Huntington's Disease. Neuro-imaging resulted in a bicaudate-index of 2.4 (the critical value is 1.8). In a clinical psychological test battery the ensuing results were highly uncommon for patients with solely a bipolar affective disorder people. Under the medical regimen of Quetiapine, Citalopram and Tiaprid the patient's mood could be stabilized and there was some improvement of her motor pertubation.

  18. The relationships of sleep apnea, hypertension, and resistant hypertension on chronic kidney disease

    PubMed Central

    Chang, Chih-Ping; Li, Tsai-Chung; Hang, Liang-Wen; Liang, Shinn-Jye; Lin, Jen-Jyn; Chou, Che-Yi; Tsai, Jeffrey J.P.; Ko, Po-Yen; Chang, Chiz-Tzung

    2016-01-01

    Abstract Hypertension, blood pressure variation, and resistant hypertension have close relations to sleep apnea, which lead to target organ damage, including the kidney. The complex relationships between sleep apnea and blood pressure cause their interactions with chronic kidney disease ambiguous. The aim of the study was to elucidate the separate and joint effects of sleep apnea, hypertension, and resistant hypertension on chronic kidney disease. A cross-sectional study was done to see the associations of sleep apnea, hypertension, and resistant hypertension with chronic kidney disease in 998 subjects underwent overnight polysomnography without device-therapy or surgery for their sleep-disordered breathing. Multivariate logistic regression was used to analyze the severity of SA, hypertension stage, resistant hypertension, and their joint effects on CKD. The multivariable relative odds (95% CI) of chronic kidney disease for the aged (age ≥65 years), severe sleep apnea, stage III hypertension, and resistant hypertension were 3.96 (2.57–6.09) (P < 0.001), 2.28 (1.13–4.58) (P < 0.05), 3.55 (1.70–7.42) (P < 0.001), and 9.42 (4.22–21.02) (P < 0.001), respectively. In subgroups analysis, the multivariable relative odds ratio of chronic kidney disease was highest in patients with both resistant hypertension and severe sleep apnea [13.42 (4.74–38.03)] (P < 0.001). Severe sleep apnea, stage III hypertension, and resistant hypertension are independent risk factors for chronic kidney disease. Patients with both severe sleep apnea and resistant hypertension have the highest risks. PMID:27281098

  19. Glyphosate Effects on Plant Mineral Nutrition, Crop Rhizosphere Microbiota, and Plant Disease in Glyphosate-Resistant Crops

    PubMed Central

    2012-01-01

    Claims have been made recently that glyphosate-resistant (GR) crops sometimes have mineral deficiencies and increased plant disease. This review evaluates the literature that is germane to these claims. Our conclusions are: (1) although there is conflicting literature on the effects of glyphosate on mineral nutrition on GR crops, most of the literature indicates that mineral nutrition in GR crops is not affected by either the GR trait or by application of glyphosate; (2) most of the available data support the view that neither the GR transgenes nor glyphosate use in GR crops increases crop disease; and (3) yield data on GR crops do not support the hypotheses that there are substantive mineral nutrition or disease problems that are specific to GR crops. PMID:23013354

  20. Comparative analysis of multiple disease resistance in ryegrass and cereal crops.

    PubMed

    Jo, Young-Ki; Barker, Reed; Pfender, William; Warnke, Scott; Sim, Sung-Chur; Jung, Geunhwa

    2008-08-01

    Ryegrass (Lolium spp.) is among the most important forage crops in Europe and Australia and is also a popular turfgrass in North America. Previous genetic analysis based on a three-generation interspecific (L. perennexL. multiflorum) ryegrass population identified four quantitative trait loci (QTLs) for resistance to gray leaf spot (Magneporthe grisea) and four QTLs for resistance to crown rust (Puccinia coronata). The current analysis based on the same mapping population detected seven QTLs for resistance to leaf spot (Bipolaris sorokiniana) and one QTL for resistance to stem rust (Puccinia graminis) in ryegrass for the first time. Three QTLs for leaf spot resistance on linkage groups (LGs) 2 and 4 were in regions of conserved synteny to the positions of resistance to net blotch (Drechslera teres) in barley (Hordeum vulgare). One ryegrass genomic region spanning 19 cM on LG 4, which contained three QTLs for resistance to leaf spot, gray leaf spot, and stem rust, had a syntenic relationship with a segment of rice chromosome 3, which contained QTLs for resistance to multiple diseases. However, at the genome-wide comparison based on 72 common RFLP markers between ryegrass and cereals, coincidence of QTLs for disease resistance to similar fungal pathogens was not statistically significant.

  1. Evaluation of Lettuce Germplasm Resistance to Gray Mold Disease for Organic Cultivations

    PubMed Central

    Shim, Chang Ki; Kim, Min Jeong; Kim, Yong Ki; Jee, Hyeong Jin

    2014-01-01

    This study was conducted to evaluate the resistance of 212 accessions of lettuce germplasm to gray mold disease caused by Botrytis cinerea. The lettuce germplasm were composed of five species: Lactuca sativa (193 accessions), L. sativa var. longifolia (2 accessions), L. sativa var. crispa (2 accessions), L. saligna (2 accessions), and L. serriola (1 accession); majority of these originated from Korea, Netherlands, USA, Russia, and Bulgaria. After 35 days of spray inoculation with conidial suspension (3×107 conidia/ml) of B. cinerea on the surface of lettuce leaves, tested lettuce germplasm showed severe symptoms of gray mold disease. There were 208 susceptible accessions to B. cinerea counted with 100% of disease incidence and four resistant accessions, IT908801, K000598, K000599, and K021055. Two moderately resistant accessions of L. sativa, K021055 and IT908801, showed 20% of disease incidence of gray mold disease at 45 days after inoculation; and two accessions of L. saligna, K000598 and K000599, which are wild relatives of lettuce germplasm with loose-leaf type, showed complete resistance to B. cinerea. These four accessions are candidates for breeding lettuce cultivars resistant to gray mold disease. PMID:25288990

  2. Factors affecting the thermal shock resistance of several hafnia based composites containing graphite or tungsten. M.S. Thesis

    NASA Technical Reports Server (NTRS)

    Lineback, L. D.

    1974-01-01

    The thermal shock resistance of hafnia based composites containing graphite powder or tungsten fibers was investigated in terms of material properties which include thermal expansion, thermal conductivity, compressive fracture stress, modulus of elasticity, and phase stability in terms of the processing parameters of hot pressing pressure and/or density, degree of stabilization of the hafnia, and composition. All other parameters were held constant or assumed constant. The thermal shock resistance was directly proportional to the compressive fracture stress to modulus of elasticity ratio and was not affected appreciably by the small thermal expansion or thermal conductivity changes. This ratio was found to vary strongly with the composition and density such that the composites containing graphite had relatively poor thermal shock resistance, while the composites containing tungsten had superior thermal shock resistance.

  3. Sociodemographic factors contribute to the depressive affect among African Americans with chronic kidney disease

    PubMed Central

    Fischer, Michael J.; Kimmel, Paul L.; Greene, Tom; Gassman, Jennifer J.; Wang, Xuelei; Brooks, Deborah H.; Charleston, Jeanne; Dowie, Donna; Thornley-Brown, Denyse; Cooper, Lisa A.; Bruce, Marino A.; Kusek, John W.; Norris, Keith C.; Lash, James P.

    2011-01-01

    Depression is common in end-stage renal disease and is associated with poor quality of life and higher mortality; however, little is known about depressive affect in earlier stages of chronic kidney disease. To measure this in a risk group burdened with hypertension and kidney disease, we conducted a cross-sectional analysis of individuals at enrollment in the African American Study of Kidney Disease and Hypertension Cohort Study. Depressive affect was assessed by the Beck Depression Inventory II and quality of life by the Medical Outcomes Study-Short Form and the Satisfaction with Life Scale. Beck Depression scores over 14 were deemed consistent with an increased depressive affect and linear regression analysis was used to identify factors associated with these scores. Among 628 subjects, 166 had scores over 14 but only 34 were prescribed antidepressants. The mean Beck Depression score of 11.0 varied with the estimated glomerular filtration rate (eGFR) from 10.7 (eGFR 50–60) to 16.0 (eGFR stage 5); however, there was no significant independent association between these. Unemployment, low income, and lower quality and satisfaction with life scale scores were independently and significantly associated with a higher Beck Depression score. Thus, our study shows that an increased depressive affect is highly prevalent in African Americans with chronic kidney disease, is infrequently treated with antidepressants, and is associated with poorer quality of life. Sociodemographic factors have especially strong associations with this increased depressive affect. Because this study was conducted in an African-American cohort, its findings may not be generalized to other ethnic groups. PMID:20200503

  4. Application of Infrared and Raman Spectroscopy for the Identification of Disease Resistant Trees

    PubMed Central

    Conrad, Anna O.; Bonello, Pierluigi

    2016-01-01

    New approaches for identifying disease resistant trees are needed as the incidence of diseases caused by non-native and invasive pathogens increases. These approaches must be rapid, reliable, cost-effective, and should have the potential to be adapted for high-throughput screening or phenotyping. Within the context of trees and tree diseases, we summarize vibrational spectroscopic and chemometric methods that have been used to distinguish between groups of trees which vary in disease susceptibility or other important characteristics based on chemical fingerprint data. We also provide specific examples from the literature of where these approaches have been used successfully. Finally, we discuss future application of these approaches for wide-scale screening and phenotyping efforts aimed at identifying disease resistant trees and managing forest diseases. PMID:26779211

  5. Theoretical model of the three-dimensional structure of a disease resistance gene homolog encoding resistance protein in Vigna mungo.

    PubMed

    Basak, Jolly; Bahadur, Ranjit P

    2006-10-01

    Plant disease resistance (R) genes, the key players of innate immunity system in plants encode 'R' proteins. 'R' protein recognizes product of avirulance gene from the pathogen and activate downstream signaling responses leading to disease resistance. No three dimensional (3D) structural information of any 'R' proteins is available as yet. We have reported a 'R' gene homolog, the 'VMYR1', encoding 'R' protein in Vigna mungo. Here, we describe the homology modeling of the 'VMYR1' protein. The model was created by using the 3D structure of an ATP-binding cassette transporter protein from Vibrio cholerae as a template. The strategy for homology modeling was based on the high structural conservation in the superfamily of P-loop containing nucleoside triphosphate hydrolase in which target and template proteins belong. This is the first report of theoretical model structure of any 'R' proteins.

  6. An Assessment of Antimicrobial Resistant Disease Threats in Canada

    PubMed Central

    Garner, Michael J.; Carson, Carolee; Lingohr, Erika J.; Fazil, Aamir; Edge, Victoria L.; Trumble Waddell, Jan

    2015-01-01

    Background Antimicrobial resistance (AMR) of infectious agents is a growing concern for public health organizations. Given the complexity of this issue and how widespread the problem has become, resources are often insufficient to address all concerns, thus prioritization of AMR pathogens is essential for the optimal allocation of risk management attention. Since the epidemiology of AMR pathogens differs between countries, country-specific assessments are important for the determination of national priorities. Objective To develop a systematic and transparent approach to AMR risk prioritization in Canada. Methods Relevant AMR pathogens in Canada were selected through a transparent multi-step consensus process (n=32). Each pathogen was assessed using ten criteria: incidence, mortality, case-fatality, communicability, treatability, clinical impact, public/political attention, ten-year projection of incidence, economic impact, and preventability. For each pathogen, each criterion was assigned a numerical score of 0, 1, or 2, and multiplied by criteria-specific weighting determined through researcher consensus of importance. The scores for each AMR pathogen were summed and ranked by total score, where a higher score indicated greater importance. A sensitivity analysis was conducted to determine the effects of changing the criteria-specific weights. Results The AMR pathogen with the highest total weighted score was extended spectrum B-lactamase-producing (ESBL) Enterobacteriaceae (score=77). When grouped by percentile, ESBL Enterobacteriaceae, Clostridium difficile, carbapenem-resistant Enterobacteriaceae, and methicillin-resistant Staphylococcus aureus were in the 80-100th percentile. Conclusion This assessment provides useful information for prioritising public health strategies regarding AMR resistance at the national level in Canada. As the AMR environment and challenges change over time and space, this systematic and transparent approach can be adapted for use by

  7. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit.

    PubMed

    Cao, Shifeng; Yang, Zhenfeng; Cai, Yuting; Zheng, Yonghua

    2014-11-15

    Two cultivars of loquat fruit were stored at 20°C for 10days to investigate the relationship between disease resistance, and fatty acid composition and activities of endogenous antioxidant enzymes. The results showed that decay incidence increased with storage time in both cultivars. A significantly lower disease incidence was observed in 'Qingzhong' fruit than in 'Fuyang', suggesting 'Qingzhong' had increased disease resistance. Meanwhile, 'Qingzhong' fruit also had lower levels of superoxide radical and hydrogen peroxide, and lower lipoxygenase activity, but higher levels of linolenic and linoleic acids and higher activities of catalase (CAT) and ascorbate peroxidase (APX) compared with 'Fuyang'. These results suggest that the higher levels of linolenic and linoleic acids and the higher activity of CAT and APX have a role in disease resistance of postharvest loquat fruit.

  8. Chloramphenicol Resistance Plasmids in Escherichia coli Isolated from Diseased Piglets

    PubMed Central

    Jørgensen, Sigrid Tue

    1978-01-01

    The plasmids in 19 chloramphenicol-resistant Escherichia coli strains of three pig pathogenic antigen types were studied in conjugation and transduction experiments. The plasmids had identical resistance patterns: streptomycin, spectinomycin, sulfonamides, and chloramphenicol (Sm, Sp, Su, Cm) and belonged to IncFII. One plasmid carried ampicillin resistance in addition. Restriction enzyme analysis of the deoxyribonucleic acid from five of the plasmids originating from the same herd showed that their digestion patterns with EcoRI were indistinguishable. EcoRI cleaved the deoxyribonucleic acid of a sixth plasmid from the same herd and displayed nine of the ten bands of the other five plasmids plus an additional six. It appears that the five plasmids with identical restriction patterns have a common origin and may be copies of the same plasmid from which the sixth may have developed. Four strains carried two plasmids each. In two of these strains, a plasmid with a tetracycline marker (Tc), or possibly the tetracycline marker alone, recombined frequently with the Sm Sp Su Cm plasmid without destroying any known function of the latter. The possibility that Tc is carried on a translocation sequence is discussed. Images PMID:352263

  9. Rifampin resistance of Legionella pneumophila is not increased during therapy for experimental Legionnaires disease: study of rifampin resistance using a guinea pig model of Legionnaires disease.

    PubMed Central

    Edelstein, P H

    1991-01-01

    Isolates of Legionella pneumophila serogroup 1, obtained from guinea pigs with experimentally induced Legionnaires disease, were tested for rifampin resistance. Thirteen isolates were from animals treated with rifampin alone, four isolates were from animals treated with saline, and three isolates each were from animals treated with erythromycin or erythromycin plus rifampin; all of these isolates were derived from the same parent strain, F889. Most of the isolates were obtained from rifampin-treated animals that survived infection but had persistence of bacteria in their lungs at necropsy. No differences in rifampin agar dilution MICs were detected for the 23 isolates and parent strain that were tested. None of the 13 isolates from animals treated with rifampin alone had a high number of resistant organisms detected by using a rifampin gradient plate assay. Thirteen isolates plus the parent strain were tested by using a quantitative method of determining resistance frequency. Considerable heterogeneity among isolates was observed, but there was no evidence of increased resistance for any treatment group. The range of rifampin resistance frequencies was 10(-7) to 10(-8). No evidence for rifampin-induced resistance of L. pneumophila was found in this study. PMID:2014980

  10. Review of insecticide resistance and behavioral avoidance of vectors of human diseases in Thailand

    PubMed Central

    2013-01-01

    Physiological resistance and behavioral responses of mosquito vectors to insecticides are critical aspects of the chemical-based disease control equation. The complex interaction between lethal, sub-lethal and excitation/repellent ('excito-repellent’) properties of chemicals is typically overlooked in vector management and control programs. The development of “physiological” resistance, metabolic and/or target site modifications, to insecticides has been well documented in many insect groups and disease vectors around the world. In Thailand, resistance in many mosquito populations has developed to all three classes of insecticidal active ingredients currently used for vector control with a majority being synthetic-derived pyrethroids. Evidence of low-grade insecticide resistance requires immediate countermeasures to mitigate further intensification and spread of the genetic mechanisms responsible for resistance. This can take the form of rotation of a different class of chemical, addition of a synergist, mixtures of chemicals or concurrent mosaic application of different classes of chemicals. From the gathered evidence, the distribution and degree of physiological resistance has been restricted in specific areas of Thailand in spite of long-term use of chemicals to control insect pests and disease vectors throughout the country. Most surprisingly, there have been no reported cases of pyrethroid resistance in anopheline populations in the country from 2000 to 2011. The precise reasons for this are unclear but we assume that behavioral avoidance to insecticides may play a significant role in reducing the selection pressure and thus occurrence and spread of insecticide resistance. The review herein provides information regarding the status of physiological resistance and behavioral avoidance of the primary mosquito vectors of human diseases to insecticides in Thailand from 2000 to 2011. PMID:24294938

  11. Inheritance of resistance to pyrethroids in Triatoma infestans, the main Chagas disease vector in South America.

    PubMed

    Cardozo, R M; Panzera, F; Gentile, A G; Segura, M A; Pérez, R; Díaz, R A; Basombrío, M A

    2010-12-01

    An outbreak of pyrethroid resistance was recently detected in Triatoma infestans from northern Argentina. To analyze the inheritance of the resistant phenotype, we carried out experimental crosses between resistant (R) and susceptible (S) strains captured in Argentina during 2005. The R strain was collected from sprayed houses in the north of the province of Salta while the S strain was collected in the province of Chaco. Both strains were bred in the laboratory for reciprocal crosses (F1), intercrosses (F2) and backcrosses (BC). The descendents were tested by a standard insecticide resistance bioassay. Resistance ratios were 1 for S strain, 103.36 for R strain and 18.34 for F1. The regression lines of F1 generations (R×S and S×R) showed no significant differences and were closer to that of the R parents, indicating that inheritance of deltamethrin resistance in T. infestans is autosomal and incompletely dominant (D=0.20). Chi-square analysis from responses of intercross and backcross progenies rejected the hypothesis of a single gene being responsible for resistance. The minimum number of independent segregation genes was three, as calculated with Lande's method. The genetic basis here described for the resistant phenotype indicate that, under pyrethroid selective pressure, the resistant genotypes could be easily spread to susceptible insects from resistant individuals, posing a major threat to vectorial control of Chagas disease.

  12. The pathology of sponge orange band disease affecting the Caribbean barrel sponge Xestospongia muta.

    PubMed

    Angermeier, Hilde; Kamke, Janine; Abdelmohsen, Usama R; Krohne, Georg; Pawlik, Joseph R; Lindquist, Niels L; Hentschel, Ute

    2011-02-01

    The aim of this study was to examine sponge orange band (SOB) disease affecting the prominent Caribbean sponge Xestospongia muta. Scanning and transmission electron microscopy revealed that SOB is accompanied by the massive destruction of the pinacoderm. Chlorophyll a content and the main secondary metabolites, tetrahydrofurans, characteristic of X. muta, were significantly lower in bleached than in healthy tissues. Denaturing gradient gel electrophoresis using cyanobacteria-specific 16S rRNA gene primers revealed a distinct shift from the Synechococcus/Prochlorococcus clade of sponge symbionts towards several clades of unspecific cyanobacteria, including lineages associated with coral disease (i.e. Leptolyngbya sp.). Underwater infection experiments were conducted by transplanting bleached cores into healthy individuals, but revealed no signs of SOB development. This study provided no evidence for the involvement of a specific microbial pathogen as an etiologic agent of disease; hence, the cause of SOB disease in X. muta remains unidentified.

  13. Mapping QTL for Resistance Against Viral Nervous Necrosis Disease in Asian Seabass.

    PubMed

    Liu, Peng; Wang, Le; Wan, Zi Yi; Ye, Bao Qing; Huang, Shuqing; Wong, Sek-Man; Yue, Gen Hua

    2016-02-01

    Viral nervous necrosis disease (VNN), caused by nervous necrosis virus (NNV), leads to mass mortality in mariculture. However, phenotypic selection for resistance against VNN is very difficult. To facilitate marker-assisted selection (MAS) for resistance against VNN and understanding of the genetic architecture underlying the resistance against this disease, we mapped quantitative trait loci (QTL) for resistance against VNN in Asian seabass. We challenged fingerlings at 37 days post-hatching (dph), from a single back-cross family, with NNV at a concentration of 9 × 10(6) TCID50/ml for 2 h. Daily mortalities were recorded and collected. A panel of 330 mortalities and 190 surviving fingerlings was genotyped using 149 microsatellites with 145 successfully mapped markers covering 24 linkage groups (LGs). Analysis of QTL for both resistance against VNN and survival time was conducted using interval mapping. Five significant QTL located in four LGs and eight suggestive QTL in seven LGs were identified for resistance. Another five significant QTL in three LGs and five suggestive QTL in three LGs were detected for survival time. One significant QTL, spanning 3 cM in LG20, was identified for both resistance and survival time. These QTL explained 2.2-4.1% of the phenotypic variance for resistance and 2.2-3.3% of the phenotypic variance for survival time, respectively. Our results suggest that VNN resistance in Asian seabass is controlled by many loci with small effects. Our data provide information for fine mapping of QTL and identification of candidate genes for a better understanding of the mechanism of disease resistance.

  14. HOPM1 mediated disease resistance to Pseudomonas syringae in Arabidopsis

    DOEpatents

    He, Sheng Yang; Nomura, Kinya

    2011-11-15

    The present invention relates to compositions and methods for enhancing plant defenses against pathogens. More particularly, the invention relates to enhancing plant immunity against bacterial pathogens, wherein HopM1.sub.1-300 mediated protection is enhanced, such as increased protection to Pseudomonas syringae pv. tomato DC3000 HopM1 and/or there is an increase in activity of an ATMIN associated plant protection protein, such as ATMIN7. Reagents of the present invention further provide a means of studying cellular trafficking while formulations of the present inventions provide increased pathogen resistance in plants.

  15. How do economic crises affect migrants’ risk of infectious disease? A systematic-narrative review

    PubMed Central

    Karanikolos, Marina; Williams, Gemma; Mladovsky, Philipa; King, Lawrence; Pharris, Anastasia; Suk, Jonathan E.; Hatzakis, Angelos; McKee, Martin; Noori, Teymur; Stuckler, David

    2015-01-01

    Background: It is not well understood how economic crises affect infectious disease incidence and prevalence, particularly among vulnerable groups. Using a susceptible-infected-recovered framework, we systematically reviewed literature on the impact of the economic crises on infectious disease risks in migrants in Europe, focusing principally on HIV, TB, hepatitis and other STIs. Methods: We conducted two searches in PubMed/Medline, Web of Science, Cochrane Library, Google Scholar, websites of key organizations and grey literature to identify how economic changes affect migrant populations and infectious disease. We perform a narrative synthesis in order to map critical pathways and identify hypotheses for subsequent research. Results: The systematic review on links between economic crises and migrant health identified 653 studies through database searching; only seven met the inclusion criteria. Fourteen items were identified through further searches. The systematic review on links between economic crises and infectious disease identified 480 studies through database searching; 19 met the inclusion criteria. Eight items were identified through further searches. The reviews show that migrant populations in Europe appear disproportionately at risk of specific infectious diseases, and that economic crises and subsequent responses have tended to exacerbate such risks. Recessions lead to unemployment, impoverishment and other risk factors that can be linked to the transmissibility of disease among migrants. Austerity measures that lead to cuts in prevention and treatment programmes further exacerbate infectious disease risks among migrants. Non-governmental health service providers occasionally stepped in to cater to specific populations that include migrants. Conclusions: There is evidence that migrants are especially vulnerable to infectious disease during economic crises. Ring-fenced funding of prevention programs, including screening and treatment, is important for

  16. How infectious disease outbreaks affect community-based primary care physicians

    PubMed Central

    Jaakkimainen, R. Liisa; Bondy, Susan J.; Parkovnick, Meredith; Barnsley, Jan

    2014-01-01

    Abstract Objective To compare how the infectious disease outbreaks H1N1 and severe acute respiratory syndrome (SARS) affected community-based GPs and FPs. Design A mailed survey sent after the H1N1 outbreak compared with the results of similar survey completed after the SARS outbreak. Setting Greater Toronto area in Ontario. Participants A total of 183 randomly selected GPs and FPs who provided office-based care. Main outcome measures The perceptions of GPs and FPs on how serious infectious disease outbreaks affected their clinical work and personal lives; their preparedness for a serious infectious disease outbreak; and the types of information they want to receive and the sources they wanted to receive information from during a serious infectious disease outbreak. The responses from this survey were compared with the responses of GPs and FPs in the greater Toronto area who completed a similar survey in 2003 after the SARS outbreak. Results After the H1N1 outbreak, GPs and FPs still had substantial concerns about the effects of serious infectious disease outbreaks on the health of their family members. Physicians made changes to various office practices in order to manage and deal with patients with serious infectious diseases. They expressed concerns about the effects of an infectious disease on the provision of health care services. Also, physicians wanted to quickly receive accurate information from the provincial government and their medical associations. Conclusion Serious community-based infectious diseases are a personal concern for GPs and FPs, and have considerable effects on their clinical practice. Further work examining the timely flow of relevant information through different health care sectors and government agencies still needs to be undertaken. PMID:25316747

  17. Semantic trouble sources and their repair in conversations affected by Parkinson's disease

    PubMed Central

    Saldert, Charlotta; Ferm, Ulrika; Bloch, Steven

    2014-01-01

    Background It is known that dysarthria arising from Parkinson's disease may affect intelligibility in conversational interaction. Research has also shown that Parkinson's disease may affect cognition and cause word-retrieval difficulties and pragmatic problems in the use of language. However, it is not known whether or how these problems become manifest in everyday conversations or how conversation partners handle such problems. Aims To describe the pragmatic problems related to the use of words that occur in everyday conversational interaction in dyads including an individual with Parkinson's disease, and to explore how interactants in conversation handle the problems to re-establish mutual understanding. Methods & Procedures Twelve video-recorded everyday conversations involving three couples where one of the individuals had Parkinson's disease were included in the study. All instances of other-initiated repair following a contribution from the people with Parkinson's disease were analysed. Those instances involving a trouble source relating to the use of words were analysed with a qualitative interaction analysis based on the principles of conversation analysis. Outcomes & Results In 70% of the instances of other-initiated repair the trouble source could be related to the semantic content produced by the individual with Parkinson's disease. The problematic contributions were typically characterized by more or less explicit symptoms of word search or use of atypical wording. The conversation partners completed the repair work collaboratively, but typically the non-impaired individual made a rephrasing or provided a suggestion for what the intended meaning had been. Conclusions & Implications In clinical work with people with Parkinson's disease and their conversation partners it is important to establish what type of trouble sources occur in conversations in a specific dyad. It may often be necessary to look beyond intelligibility and into aspects of pragmatics

  18. Plant eR Genes That Encode Photorespiratory Enzymes Confer Resistance against Disease

    PubMed Central

    Taler, Dvir; Galperin, Marjana; Benjamin, Ido; Cohen, Yigal; Kenigsbuch, David

    2004-01-01

    Downy mildew caused by the oomycete pathogen Pseudoperonospora cubensis is a devastating foliar disease of cucurbits worldwide. We previously demonstrated that the wild melon line PI 124111F (PI) is highly resistant to all pathotypes of P. cubensis. That resistance was controlled genetically by two partially dominant, complementary loci. Here, we show that unlike other plant disease resistance genes, which confer an ability to resist infection by pathogens expressing corresponding avirulence genes, the resistance of PI to P. cubensis is controlled by enhanced expression of the enzymatic resistance (eR) genes At1 and At2. These constitutively expressed genes encode the photorespiratory peroxisomal enzyme proteins glyoxylate aminotransferases. The low expression of At1 and At2 in susceptible melon lines is regulated mainly at the transcriptional level. This regulation is independent of infection with the pathogen. Transgenic melon plants overexpressing either of these eR genes displayed enhanced activity of glyoxylate aminotransferases and remarkable resistance against P. cubensis. The cloned eR genes provide a new resource for developing downy mildew–resistant melon varieties. PMID:14688292

  19. Definition, identification and treatment of resistant hypertension in chronic kidney disease patients.

    PubMed

    Drexler, Yelena R; Bomback, Andrew S

    2014-07-01

    Resistant hypertension, the inability to achieve goal blood pressure despite the use of three or more appropriately dosed antihypertensive drugs (including a diuretic), remains a common clinical problem, especially in patients with chronic kidney disease (CKD). While the exact prevalence and prognosis of resistant hypertension in CKD patients remain unknown, resistant hypertension likely contributes significantly to increased cardiovascular risk and progression of kidney disease in this population. We review the identification and evaluation of patients with resistant hypertension, including the importance of 24-h ambulatory blood pressure monitoring in the identification of 'white-coat', 'masked' and 'non-dipper' hypertension, the latter of which has particular clinical and therapeutic importance in patients with resistant hypertension and CKD. We then discuss treatment strategies for resistant hypertension that target the pathophysiologic mechanisms underlying resistance to treatment, including persistent volume excess, incomplete renin-angiotensin-aldosterone system blockade and inadequate nocturnal blood pressure control. Finally, we propose a treatment algorithm for evaluation and treatment of resistant hypertension in patients with CKD.

  20. High level resistance against rhizomania disease by simultaneously integrating two distinct defense mechanisms.

    PubMed

    Pavli, Ourania I; Tampakaki, Anastasia P; Skaracis, George N

    2012-01-01

    With the aim of achieving durable resistance against rhizomania disease of sugar beet, the employment of different sources of resistance to Beet necrotic yellow vein virus was pursued. To this purpose, Nicotiana benthamiana transgenic plants that simultaneously produce dsRNA originating from a conserved region of the BNYVV replicase gene and the HrpZ(Psph) protein in a secreted form (SP/HrpZ(Psph)) were produced. The integration and expression of both transgenes as well as proper production of the harpin protein were verified in all primary transformants and selfed progeny (T1, T2). Transgenic resistance was assessed by BNYVV-challenge inoculation on T2 progeny by scoring disease symptoms and DAS-ELISA at 20 and 30 dpi. Transgenic lines possessing single transformation events for both transgenes as well as wild type plants were included in inoculation experiments. Transgenic plants were highly resistant to virus infection, whereas in some cases immunity was achieved. In all cases, the resistant phenotype of transgenic plants carrying both transgenes was superior in comparison with the ones carrying a single transgene. Collectively, our findings demonstrate, for a first time, that the combination of two entirely different resistance mechanisms provide high level resistance or even immunity against the virus. Such a novel approach is anticipated to prevent a rapid virus adaptation that could potentially lead to the emergence of isolates with resistance breaking properties.

  1. High level resistance against rhizomania disease by simultaneously integrating two distinct defense mechanisms.

    PubMed

    Pavli, Ourania I; Tampakaki, Anastasia P; Skaracis, George N

    2012-01-01

    With the aim of achieving durable resistance against rhizomania disease of sugar beet, the employment of different sources of resistance to Beet necrotic yellow vein virus was pursued. To this purpose, Nicotiana benthamiana transgenic plants that simultaneously produce dsRNA originating from a conserved region of the BNYVV replicase gene and the HrpZ(Psph) protein in a secreted form (SP/HrpZ(Psph)) were produced. The integration and expression of both transgenes as well as proper production of the harpin protein were verified in all primary transformants and selfed progeny (T1, T2). Transgenic resistance was assessed by BNYVV-challenge inoculation on T2 progeny by scoring disease symptoms and DAS-ELISA at 20 and 30 dpi. Transgenic lines possessing single transformation events for both transgenes as well as wild type plants were included in inoculation experiments. Transgenic plants were highly resistant to virus infection, whereas in some cases immunity was achieved. In all cases, the resistant phenotype of transgenic plants carrying both transgenes was superior in comparison with the ones carrying a single transgene. Collectively, our findings demonstrate, for a first time, that the combination of two entirely different resistance mechanisms provide high level resistance or even immunity against the virus. Such a novel approach is anticipated to prevent a rapid virus adaptation that could potentially lead to the emergence of isolates with resistance breaking properties. PMID:23284692

  2. QTLs for Snow Mold Disease Resistance in Creeping Bentgrass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Snow molds caused by Typhula spp. are the most economically important winter diseases of turfgrass in the northern and alpine regions of the United States and Canada. During winter, the psychrophilic pathogens take advantage of the weakened host plants at low temperatures under persistent snow cover...

  3. Control of vectors and insecticide resistance: Implications for disease control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Effective management of insect and mite vectors of plant pathogens is of crucial importance to minimizing vector-borne diseases in crops. Insecticides play an important role in managing vector populations by reducing the number of individuals that can acquire and transmit a virus, thereby potentiall...

  4. Enhancing blast disease resistance by overexpression of the calcium-dependent protein kinase OsCPK4 in rice.

    PubMed

    Bundó, Mireia; Coca, María

    2016-06-01

    Rice is the most important staple food for more than half of the human population, and blast disease is the most serious disease affecting global rice production. In this work, the isoform OsCPK4 of the rice calcium-dependent protein kinase family is reported as a regulator of rice immunity to blast fungal infection. It shows that overexpression of OsCPK4 gene in rice plants enhances resistance to blast disease by preventing fungal penetration. The constitutive accumulation of OsCPK4 protein prepares rice plants for a rapid and potentiated defence response, including the production of reactive oxygen species, callose deposition and defence gene expression. OsCPK4 overexpression leads also to constitutive increased content of the glycosylated salicylic acid hormone in leaves without compromising rice yield. Given that OsCPK4 overexpression was known to confer also salt and drought tolerance in rice, the results reported in this article demonstrate that OsCPK4 acts as a convergence component that positively modulates both biotic and abiotic signalling pathways. Altogether, our findings indicate that OsCPK4 is a potential molecular target to improve not only abiotic stress tolerance, but also blast disease resistance of rice crops.

  5. Differential Muscle Involvement in Mice and Humans Affected by McArdle Disease.

    PubMed

    Krag, Thomas O; Pinós, Tomàs; Nielsen, Tue L; Brull, Astrid; Andreu, Antoni L; Vissing, John

    2016-05-01

    McArdle disease (muscle glycogenosis type V) is caused by myophosphorylase deficiency, which leads to impaired glycogen breakdown. We investigated how myophosphorylase deficiency affects muscle physiology, morphology, and glucose metabolism in 20-week-old McArdle mice and compared the findings to those in McArdle disease patients. Muscle contractions in the McArdle mice were affected by structural degeneration due to glycogen accumulation, and glycolytic muscles fatigued prematurely, as occurs in the muscles of McArdle disease patients. Homozygous McArdle mice showed muscle fiber disarray, variations in fiber size, vacuoles, and some internal nuclei associated with cytosolic glycogen accumulation and ongoing regeneration; structural damage was seen only in a minority of human patients. Neither liver nor brain isoforms of glycogen phosphorylase were upregulated in muscles, thus providing no substitution for the missing muscle isoform. In the mice, the tibialis anterior (TA) muscles were invariably more damaged than the quadriceps muscles. This may relate to a 7-fold higher level of myophosphorylase in TA compared to quadriceps in wild-type mice and suggests higher glucose turnover in the TA. Thus, despite differences, the mouse model of McArdle disease shares fundamental physiological and clinical features with the human disease and could be used for studies of pathogenesis and development of therapies. PMID:27030740

  6. Effects of a disease affecting a predator on the dynamics of a predator-prey system.

    PubMed

    Auger, Pierre; McHich, Rachid; Chowdhury, Tanmay; Sallet, Gauthier; Tchuente, Maurice; Chattopadhyay, Joydev

    2009-06-01

    We study the effects of a disease affecting a predator on the dynamics of a predator-prey system. We couple an SIRS model applied to the predator population, to a Lotka-Volterra model. The SIRS model describes the spread of the disease in a predator population subdivided into susceptible, infected and removed individuals. The Lotka-Volterra model describes the predator-prey interactions. We consider two time scales, a fast one for the disease and a comparatively slow one for predator-prey interactions and for predator mortality. We use the classical "aggregation method" in order to obtain a reduced equivalent model. We show that there are two possible asymptotic behaviors: either the predator population dies out and the prey tends to its carrying capacity, or the predator and prey coexist. In this latter case, the predator population tends either to a "disease-free" or to a "disease-endemic" state. Moreover, the total predator density in the disease-endemic state is greater than the predator density in the "disease-free" equilibrium (DFE).

  7. Immunomodulation and hormonal disruption without compromised disease resistance in perfluorooctanoic acid (PFOA) exposed Japanese quail.

    PubMed

    Smits, Judit E G; Nain, Sukhbir

    2013-08-01

    This study evaluated the impact of oral perfluorooctanoic acid (PFOA) on Japanese quail at concentrations found in American and Belgian workers at PFOA manufacturing facilities. Three arms of the immune system were tested; T cell, B cell, and innate immunity. After 6 weeks exposure, quail were challenged with E. coli infection to test the ultimate measure of immunotoxicity, disease resistance. The T cell response was lower in the high exposure groups. Antibody mediated, and innate immune responses were not different. Growth rate was higher, whereas thyroid hormone levels were lower in PFOA-exposed birds. Morbidity/mortality from disease challenge was not different among the control and PFOA-exposed groups, and no overt PFOA toxicity was observed pre-disease challenge. Although PFOA at 'worst case scenario' levels caused T cell immunosuppression, this did not translate into increased disease susceptibility, demonstrating that immunotoxicity testing must be interpreted with caution since disease resistance is the ultimate concern. PMID:23639742

  8. Estimation of genetic variability among peanut genotypes for resistance to leaf spot disease.

    PubMed

    Bano, Q; Hassan, M; Hussain, S B; Javed, M; Zulfiqar, M A; Younas, M; Baber, M; Zubair, M; Hussain, S M

    2016-01-01

    This study aimed to identify high-yielding peanut genotypes with resistance to leaf spot disease. The experiments included material from fourteen local and four exotic peanut genotypes that showed highly significant differences among morphological and disease severity parameters in all the genotypes which, in turn, suggested diversity genotypes. Disease severity analysis showed that the highest disease score and damaged leaf area were observed in the genotype Kelincer and the lowest scores and leaf damaged areas were observed in Majalaya super and BARI-2000, respectively. Based on these results, the genotypes BARI-2011, Chakori, Golden, BARI-89, Majalaya Super, BARD-699, BARI-2000, SP-1, and No. 334 can be used by breeders in peanut improvement programs for the development of new cultivars with higher disease resistance and increased yield. PMID:27525936

  9. Transcriptome Profiling Revealed Stress-Induced and Disease Resistance Genes Up-Regulated in PRSV Resistant Transgenic Papaya.

    PubMed

    Fang, Jingping; Lin, Aiting; Qiu, Weijing; Cai, Hanyang; Umar, Muhammad; Chen, Rukai; Ming, Ray

    2016-01-01

    Papaya is a productive and nutritious tropical fruit. Papaya Ringspot Virus (PRSV) is the most devastating pathogen threatening papaya production worldwide. Development of transgenic resistant varieties is the most effective strategy to control this disease. However, little is known about the genome-wide functional changes induced by particle bombardment transformation. We conducted transcriptome sequencing of PRSV resistant transgenic papaya SunUp and its PRSV susceptible progenitor Sunset to compare the transcriptional changes in young healthy leaves prior to infection with PRSV. In total, 20,700 transcripts were identified, and 842 differentially expressed genes (DEGs) randomly distributed among papaya chromosomes. Gene ontology (GO) category analysis revealed that microtubule-related categories were highly enriched among these DEGs. Numerous DEGs related to various transcription factors, transporters and hormone biosynthesis showed clear differences between the two cultivars, and most were up-regulated in transgenic papaya. Many known and novel stress-induced and disease-resistance genes were most highly expressed in SunUp, including MYB, WRKY, ERF, NAC, nitrate and zinc transporters, and genes involved in the abscisic acid, salicylic acid, and ethylene signaling pathways. We also identified 67,686 alternative splicing (AS) events in Sunset and 68,455 AS events in SunUp, mapping to 10,994 and 10,995 papaya annotated genes, respectively. GO enrichment for the genes displaying AS events exclusively in Sunset was significantly different from those in SunUp. Transcriptomes in Sunset and transgenic SunUp are very similar with noteworthy differences, which increased PRSV-resistance in transgenic papaya. No detrimental pathways and allergenic or toxic proteins were induced on a genome-wide scale in transgenic SunUp. Our results provide a foundation for unraveling the mechanism of PRSV resistance in transgenic papaya. PMID:27379138

  10. Transcriptome Profiling Revealed Stress-Induced and Disease Resistance Genes Up-Regulated in PRSV Resistant Transgenic Papaya

    PubMed Central

    Fang, Jingping; Lin, Aiting; Qiu, Weijing; Cai, Hanyang; Umar, Muhammad; Chen, Rukai; Ming, Ray

    2016-01-01

    Papaya is a productive and nutritious tropical fruit. Papaya Ringspot Virus (PRSV) is the most devastating pathogen threatening papaya production worldwide. Development of transgenic resistant varieties is the most effective strategy to control this disease. However, little is known about the genome-wide functional changes induced by particle bombardment transformation. We conducted transcriptome sequencing of PRSV resistant transgenic papaya SunUp and its PRSV susceptible progenitor Sunset to compare the transcriptional changes in young healthy leaves prior to infection with PRSV. In total, 20,700 transcripts were identified, and 842 differentially expressed genes (DEGs) randomly distributed among papaya chromosomes. Gene ontology (GO) category analysis revealed that microtubule-related categories were highly enriched among these DEGs. Numerous DEGs related to various transcription factors, transporters and hormone biosynthesis showed clear differences between the two cultivars, and most were up-regulated in transgenic papaya. Many known and novel stress-induced and disease-resistance genes were most highly expressed in SunUp, including MYB, WRKY, ERF, NAC, nitrate and zinc transporters, and genes involved in the abscisic acid, salicylic acid, and ethylene signaling pathways. We also identified 67,686 alternative splicing (AS) events in Sunset and 68,455 AS events in SunUp, mapping to 10,994 and 10,995 papaya annotated genes, respectively. GO enrichment for the genes displaying AS events exclusively in Sunset was significantly different from those in SunUp. Transcriptomes in Sunset and transgenic SunUp are very similar with noteworthy differences, which increased PRSV-resistance in transgenic papaya. No detrimental pathways and allergenic or toxic proteins were induced on a genome-wide scale in transgenic SunUp. Our results provide a foundation for unraveling the mechanism of PRSV resistance in transgenic papaya. PMID:27379138

  11. Drug Resistance Mechanisms in Bacteria Causing Sexually Transmitted Diseases and Associated with Vaginosis.

    PubMed

    Shaskolskiy, Boris; Dementieva, Ekaterina; Leinsoo, Arvo; Runina, Anastassia; Vorobyev, Denis; Plakhova, Xenia; Kubanov, Alexey; Deryabin, Dmitrii; Gryadunov, Dmitry

    2016-01-01

    Here, we review sexually transmitted diseases (STDs) caused by pathogenic bacteria and vaginal infections which result from an overgrowth of opportunistic bacterial microflora. First, we describe the STDs, the corresponding pathogens and the antimicrobials used for their treatment. In addition to the well-known diseases caused by single pathogens (i.e., syphilis, gonococcal infections, and chlamydiosis), we consider polymicrobial reproductive tract infections (especially those that are difficult to effectively clinically manage). Then, we summarize the biochemical mechanisms that lead to antimicrobial resistance and the most recent data on the emergence of drug resistance in STD pathogens and bacteria associated with vaginosis. A large amount of research performed in the last 10-15 years has shed light on the enormous diversity of mechanisms of resistance developed by bacteria. A detailed understanding of the mechanisms of antimicrobials action and the emergence of resistance is necessary to modify existing drugs and to develop new ones directed against new targets.

  12. Drug Resistance Mechanisms in Bacteria Causing Sexually Transmitted Diseases and Associated with Vaginosis

    PubMed Central

    Shaskolskiy, Boris; Dementieva, Ekaterina; Leinsoo, Arvo; Runina, Anastassia; Vorobyev, Denis; Plakhova, Xenia; Kubanov, Alexey; Deryabin, Dmitrii; Gryadunov, Dmitry

    2016-01-01

    Here, we review sexually transmitted diseases (STDs) caused by pathogenic bacteria and vaginal infections which result from an overgrowth of opportunistic bacterial microflora. First, we describe the STDs, the corresponding pathogens and the antimicrobials used for their treatment. In addition to the well-known diseases caused by single pathogens (i.e., syphilis, gonococcal infections, and chlamydiosis), we consider polymicrobial reproductive tract infections (especially those that are difficult to effectively clinically manage). Then, we summarize the biochemical mechanisms that lead to antimicrobial resistance and the most recent data on the emergence of drug resistance in STD pathogens and bacteria associated with vaginosis. A large amount of research performed in the last 10–15 years has shed light on the enormous diversity of mechanisms of resistance developed by bacteria. A detailed understanding of the mechanisms of antimicrobials action and the emergence of resistance is necessary to modify existing drugs and to develop new ones directed against new targets. PMID:27242760

  13. Wild Help for Enhancing Genetic Resistance in Lentil Against Fungal Diseases.

    PubMed

    Bhadauria, Vijai; Wong, Melissa M L; Bett, Kirstin E; Banniza, Sabine

    2016-01-01

    Lentil (Lens culinaris) is one of the cool season grain legume crops and an important source of dietary proteins and fibre. Fungal diseases are main constraints to lentil production and account for significant yield and quality losses. Lentil has a narrow genetic base presumably due to a bottleneck during domestication and as a result, any resistance to fungal diseases in the cultivated genepool is gradually eroded and overcome by pathogens. New sources of resistance have been identified in wild lentil (Lens ervoides). This article provides an overview of harnessing resistance potential of wild germplasm to enhance genetic resistance in lentil cultivars using next-generation sequencing-based genotyping, comparative genomics and marker-assisted selection breeding. PMID:26363611

  14. Drug Resistance Mechanisms in Bacteria Causing Sexually Transmitted Diseases and Associated with Vaginosis.

    PubMed

    Shaskolskiy, Boris; Dementieva, Ekaterina; Leinsoo, Arvo; Runina, Anastassia; Vorobyev, Denis; Plakhova, Xenia; Kubanov, Alexey; Deryabin, Dmitrii; Gryadunov, Dmitry

    2016-01-01

    Here, we review sexually transmitted diseases (STDs) caused by pathogenic bacteria and vaginal infections which result from an overgrowth of opportunistic bacterial microflora. First, we describe the STDs, the corresponding pathogens and the antimicrobials used for their treatment. In addition to the well-known diseases caused by single pathogens (i.e., syphilis, gonococcal infections, and chlamydiosis), we consider polymicrobial reproductive tract infections (especially those that are difficult to effectively clinically manage). Then, we summarize the biochemical mechanisms that lead to antimicrobial resistance and the most recent data on the emergence of drug resistance in STD pathogens and bacteria associated with vaginosis. A large amount of research performed in the last 10-15 years has shed light on the enormous diversity of mechanisms of resistance developed by bacteria. A detailed understanding of the mechanisms of antimicrobials action and the emergence of resistance is necessary to modify existing drugs and to develop new ones directed against new targets. PMID:27242760

  15. Behavioral Avoidance - Will Physiological Insecticide Resistance Level of Insect Strains Affect Their Oviposition and Movement Responses?

    PubMed Central

    Nansen, Christian; Baissac, Olivier; Nansen, Maria; Powis, Kevin; Baker, Greg

    2016-01-01

    Agricultural organisms, such as insect herbivores, provide unique opportunities for studies of adaptive evolutionary processes, including effects of insecticides on movement and oviposition behavior. In this study, Brassica leaves were treated with one of two non-systemic insecticides and exposed to two individual strains (referred to as single or double resistance) of diamondback moth (Plutella xylostella) (DBM) exhibiting physiological resistance. Behavioral responses by these two strains were compared as part of characterizing the relative effect of levels of physiological resistance on the likelihood of insects showing signs of behavioral avoidance. For each DBM strain, we used choice bioassays to quantify two possible types of behavioral avoidance: 1) females ovipositing predominantly on leaf surfaces without insecticides, and 2) larvae avoiding insecticide-treated leaf surfaces. In three-choice bioassays (leaves with no pesticide, 50% coverage with pesticide, or 100% coverage with pesticide), females from the single resistance DBM strain laid significantly more eggs on water treated leaves compared to leaves with 100% insecticide coverage (both gamma-cyhalothrin and spinetoram). Females from the double resistance DBM strain also laid significantly more eggs on water treated leaves compared to leaves with 100% gamma-cyhalothrin, while moths did not adjust their oviposition behavior in response to spinetoram. Larvae from the single resistance DBM strain showed a significant increase in mobility in response to both insecticides and avoided insecticide-treated portions of leaves when given a choice. On the other hand, DBM larvae from the double resistance strain showed a significant decrease in mobility in response to insecticides, and they did not avoid insecticide-treated portions of leaves when given a choice. Our results suggest that pest populations with physiological resistance may show behavioral avoidance, as resistant females avoided oviposition on

  16. Behavioral Avoidance - Will Physiological Insecticide Resistance Level of Insect Strains Affect Their Oviposition and Movement Responses?

    PubMed

    Nansen, Christian; Baissac, Olivier; Nansen, Maria; Powis, Kevin; Baker, Greg

    2016-01-01

    Agricultural organisms, such as insect herbivores, provide unique opportunities for studies of adaptive evolutionary processes, including effects of insecticides on movement and oviposition behavior. In this study, Brassica leaves were treated with one of two non-systemic insecticides and exposed to two individual strains (referred to as single or double resistance) of diamondback moth (Plutella xylostella) (DBM) exhibiting physiological resistance. Behavioral responses by these two strains were compared as part of characterizing the relative effect of levels of physiological resistance on the likelihood of insects showing signs of behavioral avoidance. For each DBM strain, we used choice bioassays to quantify two possible types of behavioral avoidance: 1) females ovipositing predominantly on leaf surfaces without insecticides, and 2) larvae avoiding insecticide-treated leaf surfaces. In three-choice bioassays (leaves with no pesticide, 50% coverage with pesticide, or 100% coverage with pesticide), females from the single resistance DBM strain laid significantly more eggs on water treated leaves compared to leaves with 100% insecticide coverage (both gamma-cyhalothrin and spinetoram). Females from the double resistance DBM strain also laid significantly more eggs on water treated leaves compared to leaves with 100% gamma-cyhalothrin, while moths did not adjust their oviposition behavior in response to spinetoram. Larvae from the single resistance DBM strain showed a significant increase in mobility in response to both insecticides and avoided insecticide-treated portions of leaves when given a choice. On the other hand, DBM larvae from the double resistance strain showed a significant decrease in mobility in response to insecticides, and they did not avoid insecticide-treated portions of leaves when given a choice. Our results suggest that pest populations with physiological resistance may show behavioral avoidance, as resistant females avoided oviposition on

  17. Companion cropping with potato onion enhances the disease resistance of tomato against Verticillium dahliae.

    PubMed

    Fu, Xuepeng; Wu, Xia; Zhou, Xingang; Liu, Shouwei; Shen, Yanhui; Wu, Fengzhi

    2015-01-01

    Intercropping could alleviate soil-borne diseases, however, few studies focused on the immunity of the host plant induced by the interspecific interactions. To test whether or not intercropping could enhance the disease resistance of host plant, we investigated the effect of companion cropping with potato onion on tomato Verticillium wilt caused by Verticillium dahliae (V. dahliae). To investigate the mechanisms, the root exudates were collected from tomato and potato onion which were grown together or separately, and were used to examine the antifungal activities against V. dahliae in vitro, respectively. Furthermore, RNA-seq was used to examine the expression pattern of genes related to disease resistance in tomato companied with potato onion compared to that in tomato grown alone, under the condition of infection with V. dahliae. The results showed that companion cropping with potato onion could alleviate the incidence and severity of tomato Verticillium wilt. The further studies revealed that the root exudates from tomato companied with potato onion significantly inhibited the mycelia growth and spore germination of V. dahliae. However, there were no significant effects on these two measurements for the root exudates from potato onion grown alone or from potato onion grown with tomato. RNA-seq data analysis showed the disease defense genes associated with pathogenesis-related proteins, biosynthesis of lignin, hormone metabolism and signal transduction were expressed much higher in the tomato companied with potato onion than those in the tomato grown alone, which indicated that these defense genes play important roles in tomato against V. dahliae infection, and meant that the disease resistance of tomato against V. dahliae was enhanced in the companion copping with potato onion. We proposed that companion cropping with potato onion could enhance the disease resistance of tomato against V. dahliae by regulating the expression of genes related to disease

  18. Companion cropping with potato onion enhances the disease resistance of tomato against Verticillium dahliae

    PubMed Central

    Fu, Xuepeng; Wu, Xia; Zhou, Xingang; Liu, Shouwei; Shen, Yanhui; Wu, Fengzhi

    2015-01-01

    Intercropping could alleviate soil-borne diseases, however, few studies focused on the immunity of the host plant induced by the interspecific interactions. To test whether or not intercropping could enhance the disease resistance of host plant, we investigated the effect of companion cropping with potato onion on tomato Verticillium wilt caused by Verticillium dahliae (V. dahliae). To investigate the mechanisms, the root exudates were collected from tomato and potato onion which were grown together or separately, and were used to examine the antifungal activities against V. dahliae in vitro, respectively. Furthermore, RNA-seq was used to examine the expression pattern of genes related to disease resistance in tomato companied with potato onion compared to that in tomato grown alone, under the condition of infection with V. dahliae. The results showed that companion cropping with potato onion could alleviate the incidence and severity of tomato Verticillium wilt. The further studies revealed that the root exudates from tomato companied with potato onion significantly inhibited the mycelia growth and spore germination of V. dahliae. However, there were no significant effects on these two measurements for the root exudates from potato onion grown alone or from potato onion grown with tomato. RNA-seq data analysis showed the disease defense genes associated with pathogenesis-related proteins, biosynthesis of lignin, hormone metabolism and signal transduction were expressed much higher in the tomato companied with potato onion than those in the tomato grown alone, which indicated that these defense genes play important roles in tomato against V. dahliae infection, and meant that the disease resistance of tomato against V. dahliae was enhanced in the companion copping with potato onion. We proposed that companion cropping with potato onion could enhance the disease resistance of tomato against V. dahliae by regulating the expression of genes related to disease

  19. The treatment of myositis. How to approach resistant disease.

    PubMed

    Adams, E M; Plotz, P H

    1995-02-01

    Idiopathic inflammatory myopathies, polymyositis, dermatomyositis, and inclusion body myositis, are increasingly recognized to cause long-term disability in certain subsets of patients. Because these diseases are infrequent, only retrospective analysis of most treatments are available. In this article, identification of subsets of patients with different prognoses and discussion of confounding factors for increasing weakness are emphasized. The advantages and disadvantages of different therapies for myositis and for extraskeletal muscle features are also discussed.

  20. REST and stress resistance in ageing and Alzheimer's disease.

    PubMed

    Lu, Tao; Aron, Liviu; Zullo, Joseph; Pan, Ying; Kim, Haeyoung; Chen, Yiwen; Yang, Tun-Hsiang; Kim, Hyun-Min; Drake, Derek; Liu, X Shirley; Bennett, David A; Colaiácovo, Monica P; Yankner, Bruce A

    2014-03-27

    Human neurons are functional over an entire lifetime, yet the mechanisms that preserve function and protect against neurodegeneration during ageing are unknown. Here we show that induction of the repressor element 1-silencing transcription factor (REST; also known as neuron-restrictive silencer factor, NRSF) is a universal feature of normal ageing in human cortical and hippocampal neurons. REST is lost, however, in mild cognitive impairment and Alzheimer's disease. Chromatin immunoprecipitation with deep sequencing and expression analysis show that REST represses genes that promote cell death and Alzheimer's disease pathology, and induces the expression of stress response genes. Moreover, REST potently protects neurons from oxidative stress and amyloid β-protein toxicity, and conditional deletion of REST in the mouse brain leads to age-related neurodegeneration. A functional orthologue of REST, Caenorhabditis elegans SPR-4, also protects against oxidative stress and amyloid β-protein toxicity. During normal ageing, REST is induced in part by cell non-autonomous Wnt signalling. However, in Alzheimer's disease, frontotemporal dementia and dementia with Lewy bodies, REST is lost from the nucleus and appears in autophagosomes together with pathological misfolded proteins. Finally, REST levels during ageing are closely correlated with cognitive preservation and longevity. Thus, the activation state of REST may distinguish neuroprotection from neurodegeneration in the ageing brain. PMID:24670762

  1. Repurposing diabetes drugs for brain insulin resistance in Alzheimer disease.

    PubMed

    Yarchoan, Mark; Arnold, Steven E

    2014-07-01

    A growing body of clinical and epidemiological research suggests that two of the most common diseases of aging, type 2 diabetes (T2DM) and Alzheimer disease (AD), are linked. The nature of the association is not known, but this observation has led to the notion that drugs developed for the treatment of T2DM may be beneficial in modifying the pathophysiology of AD and maintaining cognitive function. Recent advances in the understanding of the biology of T2DM have resulted in a growing number of therapies that are approved or in clinical development for this disease. This review summarizes the evidence that T2DM and AD are linked, with a focus on the cellular and molecular mechanisms in common, and then assesses the various clinical-stage diabetes drugs for their potential activity in AD. At a time when existing therapies for AD offer only limited symptomatic benefit for some patients, additional clinical trials of diabetes drugs are needed to at least advance the care of T2DM patients at risk for or with comorbid AD and also to determine their value for AD in general.

  2. REST and stress resistance in ageing and Alzheimer's disease

    NASA Astrophysics Data System (ADS)

    Lu, Tao; Aron, Liviu; Zullo, Joseph; Pan, Ying; Kim, Haeyoung; Chen, Yiwen; Yang, Tun-Hsiang; Kim, Hyun-Min; Drake, Derek; Liu, X. Shirley; Bennett, David A.; Colaiácovo, Monica P.; Yankner, Bruce A.

    2014-03-01

    Human neurons are functional over an entire lifetime, yet the mechanisms that preserve function and protect against neurodegeneration during ageing are unknown. Here we show that induction of the repressor element 1-silencing transcription factor (REST; also known as neuron-restrictive silencer factor, NRSF) is a universal feature of normal ageing in human cortical and hippocampal neurons. REST is lost, however, in mild cognitive impairment and Alzheimer's disease. Chromatin immunoprecipitation with deep sequencing and expression analysis show that REST represses genes that promote cell death and Alzheimer's disease pathology, and induces the expression of stress response genes. Moreover, REST potently protects neurons from oxidative stress and amyloid β-protein toxicity, and conditional deletion of REST in the mouse brain leads to age-related neurodegeneration. A functional orthologue of REST, Caenorhabditis elegans SPR-4, also protects against oxidative stress and amyloid β-protein toxicity. During normal ageing, REST is induced in part by cell non-autonomous Wnt signalling. However, in Alzheimer's disease, frontotemporal dementia and dementia with Lewy bodies, REST is lost from the nucleus and appears in autophagosomes together with pathological misfolded proteins. Finally, REST levels during ageing are closely correlated with cognitive preservation and longevity. Thus, the activation state of REST may distinguish neuroprotection from neurodegeneration in the ageing brain.

  3. Frequent Occurrence of Tomato Leaf Curl New Delhi Virus in Cotton Leaf Curl Disease Affected Cotton in Pakistan

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton leaf curl disease (CLCuD) in the Indian subcontinent is associated with several distinct monopartite begomoviruses and DNA satellites. However, only a single begomovirus was associated with breakdown of resistance against CLCuD in previously resistant cotton varieties. The monopartite begomov...

  4. Factors affecting poor nutritional status after small bowel resection in patients with Crohn disease.

    PubMed

    Jang, Ki Ung; Yu, Chang Sik; Lim, Seok-Byung; Park, In Ja; Yoon, Yong Sik; Kim, Chan Wook; Lee, Jong Lyul; Yang, Suk-Kyun; Ye, Byong Duk; Kim, Jin Cheon

    2016-07-01

    In Crohn disease, bowel-preserving surgery is necessary to prevent short bowel syndrome due to repeated operations. This study aimed to determine the remnant small bowel length cut-off and to evaluate the clinical factors related to nutritional status after small bowel resection in Crohn disease.We included 394 patients (69.3% male) who underwent small bowel resection for Crohn disease between 1991 and 2012. Patients who were classified as underweight (body mass index < 17.5) or at high risk of nutrition-related problems (modified nutritional risk index < 83.5) were regarded as having a poor nutritional status. Preliminary remnant small bowel length cut-offs were determined using receiver operating characteristic curves. Variables associated with poor nutritional status were assessed retrospectively using Student t tests, chi-squared tests, Fisher exact tests, and logistic regression analyses.The mean follow-up period was 52.9 months and the mean patient ages at the time of the last bowel surgery and last follow-up were 31.2 and 35.7 years, respectively. The mean remnant small bowel length was 331.8 cm. Forty-three patients (10.9%) underwent ileostomy, 309 (78.4%) underwent combined small bowel and colon resection, 111 (28.2%) had currently active disease, and 105 (26.6%) underwent at least 2 operations for recurrent disease. The mean body mass index and modified nutritional risk index were 20.6 and 100.8, respectively. The independent factors affecting underweight status were remnant small bowel length ≤240 cm (odds ratio: 4.84, P < 0.001), ileostomy (odds ratio: 4.70, P < 0.001), and currently active disease (odds ratio: 4.16, P < 0.001). The independent factors affecting high nutritional risk were remnant small bowel length ≤230 cm (odds ratio: 2.84, P = 0.012), presence of ileostomy (odds ratio: 3.36, P = 0.025), and currently active disease (odds ratio: 4.90, P < 0.001).Currently active disease, ileostomy, and remnant small

  5. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    PubMed

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  6. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes

    PubMed Central

    Serra, Heïdi; Ziolkowski, Piotr A.; Yelina, Nataliya E.; Jackson, Matthew; Mézard, Christine; McVean, Gil; Henderson, Ian R.

    2016-01-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity. PMID:27415776

  7. Prospects for exploitation of disease resistance from Hordeum chilense in cultivated cereals.

    PubMed

    Rubiales, D; Niks, R E; Carver, T L; Ballesteros, J; Martín, A

    2001-01-01

    Hordeum chilense is a South American wild barley with high potential for cereal breeding given its high crossability with other members of the Triticeae. In the present paper we consider the resistance of H. chilense to several fungal diseases and the prospects for its transference to cultivated cereals. All H. chilense accessions studied are resistant to the barley, wheat and rye brown rusts, the powdery mildews of wheat, barley, rye and oat, to Septoria leaf blotch, common bunt and to loose smuts, which suggests that H. chilense is a non-host of these diseases. There are also lines resistant to wheat and barley yellow rust, stem rust and to Agropyron leaf rust, as well as lines giving moderate levels of resistance to Septoria glume blotch, tan spot and Fusarium head blight. Some H. chilense lines display pre-appressorial avoidance to brown rust. Lines differ in the degree of haustorium formation by rust and mildew fungi they permit, and in the degree to which a hypersensitive response occurs after haustoria are formed. Unfortunately, resistance of H. chilense to rust fungi is not expressed in tritordeum hybrids, nor in chromosome addition lines in wheat. In tritordeum, H. chilense contributes quantitative resistance to wheat powdery mildew, tan spot and loose smut. The resistance to mildew, expressed as a reduced disease severity, is not associated with macroscopically visible necrosis. Hexaploid tritordeums are immune to Septoria leaf blotch and to common bunt although resistance to both is slightly diluted in octoploid tritordeums. Studies with addition lines in wheat indicate that the resistance of H. chilense to powdery mildew, Septoria leaf blotch and common bunt is of broad genetic basis, conferred by genes present on various chromosomes.

  8. Metatranscriptomic Analysis of Pycnopodia helianthoides (Asteroidea) Affected by Sea Star Wasting Disease.

    PubMed

    Gudenkauf, Brent M; Hewson, Ian

    2015-01-01

    Sea star wasting disease (SSWD) describes a suite of symptoms reported in asteroids of the North American Pacific Coast. We performed a metatranscriptomic survey of asymptomatic and symptomatic sunflower star (Pycnopodia helianthoides) body wall tissues to understand holobiont gene expression in tissues affected by SSWD. Metatranscriptomes were highly variable between replicate libraries, and most differentially expressed genes represented either transcripts of associated microorganisms (particularly Pseudomonas and Vibrio relatives) or low-level echinoderm transcripts of unknown function. However, the pattern of annotated host functional genes reflects enhanced apoptotic and tissue degradation processes and decreased energy metabolism, while signalling of death-related proteins was greater in asymptomatic and symptomatic tissues. Our results suggest that the body wall tissues of SSWD-affected asteroids may undergo structural changes during disease progression, and that they are stimulated to undergo autocatalytic cell death processes. PMID:26020776

  9. Metatranscriptomic Analysis of Pycnopodia helianthoides (Asteroidea) Affected by Sea Star Wasting Disease.

    PubMed

    Gudenkauf, Brent M; Hewson, Ian

    2015-01-01

    Sea star wasting disease (SSWD) describes a suite of symptoms reported in asteroids of the North American Pacific Coast. We performed a metatranscriptomic survey of asymptomatic and symptomatic sunflower star (Pycnopodia helianthoides) body wall tissues to understand holobiont gene expression in tissues affected by SSWD. Metatranscriptomes were highly variable between replicate libraries, and most differentially expressed genes represented either transcripts of associated microorganisms (particularly Pseudomonas and Vibrio relatives) or low-level echinoderm transcripts of unknown function. However, the pattern of annotated host functional genes reflects enhanced apoptotic and tissue degradation processes and decreased energy metabolism, while signalling of death-related proteins was greater in asymptomatic and symptomatic tissues. Our results suggest that the body wall tissues of SSWD-affected asteroids may undergo structural changes during disease progression, and that they are stimulated to undergo autocatalytic cell death processes.

  10. Metatranscriptomic Analysis of Pycnopodia helianthoides (Asteroidea) Affected by Sea Star Wasting Disease

    PubMed Central

    Gudenkauf, Brent M.; Hewson, Ian

    2015-01-01

    Sea star wasting disease (SSWD) describes a suite of symptoms reported in asteroids of the North American Pacific Coast. We performed a metatranscriptomic survey of asymptomatic and symptomatic sunflower star (Pycnopodia helianthoides) body wall tissues to understand holobiont gene expression in tissues affected by SSWD. Metatranscriptomes were highly variable between replicate libraries, and most differentially expressed genes represented either transcripts of associated microorganisms (particularly Pseudomonas and Vibrio relatives) or low-level echinoderm transcripts of unknown function. However, the pattern of annotated host functional genes reflects enhanced apoptotic and tissue degradation processes and decreased energy metabolism, while signalling of death-related proteins was greater in asymptomatic and symptomatic tissues. Our results suggest that the body wall tissues of SSWD-affected asteroids may undergo structural changes during disease progression, and that they are stimulated to undergo autocatalytic cell death processes. PMID:26020776

  11. Diabetes mellitus, a complex and heterogeneous disease, and the role of insulin resistance as a determinant of diabetic kidney disease.

    PubMed

    Karalliedde, Janaka; Gnudi, Luigi

    2016-02-01

    Diabetes mellitus (DM) is increasingly recognized as a heterogeneous condition. The individualization of care and treatment necessitates an understanding of the individual patient's pathophysiology of DM that underpins their DM classification and clinical presentation. Classical type-2 diabetes mellitus is due to a combination of insulin resistance and an insulin secretory defect. Type-1 diabetes is characterized by a near-absolute deficiency of insulin secretion. More recently, advances in genetics and a better appreciation of the atypical features of DM has resulted in more categories of diabetes. In the context of kidney disease, patients with DM and microalbuminuria are more insulin resistant, and insulin resistance may be a pathway that results in accelerated progression of diabetic kidney disease. This review summarizes the updated classification of DM, including more rarer categories and their associated renal manifestations that need to be considered in patients who present with atypical features. The benefits and limitations of the tests utilized to make a diagnosis of DM are discussed. We also review the putative pathways and mechanisms by which insulin resistance drives the progression of diabetic kidney disease.

  12. The β2 Adrenergic Receptor Gln27Glu Polymorphism Affects Insulin Resistance in Patients with Heart Failure

    PubMed Central

    Vardeny, Orly; Detry, Michelle A.; Moran, John J.M.; Johnson, Maryl R.; Sweitzer, Nancy K.

    2009-01-01

    Insulin resistance is prevalent in heart failure (HF) patients, and beta2 adrenergic receptors (β2-AR) are involved in glucose homeostasis. We hypothesized that β2-AR Gln27Glu and Arg16Gly polymorphisms affect insulin resistance in HF patients and explored if effects of β2-AR polymorphisms on glucose handling are modified by choice of beta blocker. We studied 30 non-diabetic adults with HF and a history of systolic dysfunction, 15 on metoprolol succinate and 15 on carvedilol. We measured fasting glucose, insulin, and insulin resistance, and determined β2-AR genotypes at codons 27 and 16. The cohort was insulin resistant with a mean HOMA-IR score of 3.4 (95%CI 2.3-4.5, normal value=1.0). Patients with the Glu27Glu genotype exhibited higher insulin and HOMA-IR compared to individuals carrying a Gln allele (p=0.019). Patients taking carvedilol demonstrated lower insulin resistance if also carrying a wild type allele at codon 27 (fasting insulin 9.8±10.5 versus 20.5±2.1 for variant, p=0.072, HOMA-IR 2.4±2.7 versus 5.1±0.6, p=0.074, respectively); those on metoprolol succinate had high insulin resistance irrespective of genotype. The β2-AR Glu27Glu genotype may be associated with higher insulin concentrations and insulin resistance in patients with HF. Future studies are needed to confirm whether treatment with carvedilol may be associated with decreased insulin and insulin resistance in β2-AR codon 27 Gln carriers. PMID:19034036

  13. Captures of MFO-resistant Cydia pomonella adults as affected by lure, crop management system and flight.

    PubMed

    Bosch, D; Rodríguez, M A; Avilla, J

    2016-02-01

    The main resistance mechanism of codling moth (Cydia pomonella) in the tree fruit area of Lleida (NE Spain) is multifunction oxidases (MFO). We studied the frequency of MFO-resistant adults captured by different lures, with and without pear ester, and flights in orchards under different crop management systems. The factor year affected codling moth MFO-resistance level, particularly in the untreated orchards, highlighting the great influence of codling moth migration on the spread of resistance in field populations. Chemical treatments and adult flight were also very important but mating disruption technique showed no influence. The second adult flight showed the highest frequency, followed by the first flight and the third flight. In untreated orchards, there were no significant differences in the frequency of MFO-resistant individuals attracted by Combo and BioLure. Red septa lures baited with pear ester (DA) captured sufficient insects only in the first generation of 2010, obtaining a significantly lower proportion of MFO-resistant adults than Combo and BioLure. In the chemically treated orchards, in 2009 BioLure caught a significantly lower proportion of MFO-resistant adults than Combo during the first and third flight, and also than DA during the first flight. No significant differences were found between the lures or flights in 2010. These results cannot support the idea of a higher attractiveness of the pear ester for MFO-resistant adults in the field but do suggest a high influence of the response to the attractant depending on the management of the orchard, particularly with regard to the use of chemical insecticides.

  14. Skeletal muscle fiber type: using insights from muscle developmental biology to dissect targets for susceptibility and resistance to muscle disease.

    PubMed

    Talbot, Jared; Maves, Lisa

    2016-07-01

    Skeletal muscle fibers are classified into fiber types, in particular, slow twitch versus fast twitch. Muscle fiber types are generally defined by the particular myosin heavy chain isoforms that they express, but many other components contribute to a fiber's physiological characteristics. Skeletal muscle fiber type can have a profound impact on muscle diseases, including certain muscular dystrophies and sarcopenia, the aging-induced loss of muscle mass and strength. These findings suggest that some muscle diseases may be treated by shifting fiber type characteristics either from slow to fast, or fast to slow phenotypes, depending on the disease. Recent studies have begun to address which components of muscle fiber types mediate their susceptibility or resistance to muscle disease. However, for many diseases it remains largely unclear why certain fiber types are affected. A substantial body of work has revealed molecular pathways that regulate muscle fiber type plasticity and early developmental muscle fiber identity. For instance, recent studies have revealed many factors that regulate muscle fiber type through modulating the activity of the muscle regulatory transcription factor MYOD1. Future studies of muscle fiber type development in animal models will continue to enhance our understanding of factors and pathways that may provide therapeutic targets to treat muscle diseases. WIREs Dev Biol 2016, 5:518-534. doi: 10.1002/wdev.230 For further resources related to this article, please visit the WIREs website. PMID:27199166

  15. Identification of nuclear genes affecting 2-Deoxyglucose resistance in Schizosaccharomyces pombe.

    PubMed

    Vishwanatha, Akshay; Rallis, Charalampos; Bevkal Subramanyaswamy, Shubha; D'Souza, Cletus Joseph Michael; Bähler, Jürg; Schweingruber, Martin Ernst

    2016-09-01

    2-Deoxyglucose (2-DG) is a toxic glucose analog. To identify genes involved in 2-DG toxicity in Schizosaccharomyces pombe, we screened a wild-type overexpression library for genes which render cells 2-DG resistant. A gene we termed odr1, encoding an uncharacterized hydrolase, led to strong resistance and altered invertase expression when overexpressed. We speculate that Odr1 neutralizes the toxic form of 2-DG, similar to the Saccharomyces cerevisiae Dog1 and Dog2 phosphatases which dephosphorylate 2-DG-6-phosphate synthesized by hexokinase. In a complementary approach, we screened a haploid deletion library to identify 2-DG-resistant mutants. This screen identified the genes snf5, ypa1, pas1 and pho7 In liquid medium, deletions of these genes conferred 2-DG resistance preferentially under glucose-repressed conditions. The deletion mutants expressed invertase activity more constitutively than the control strain, indicating defects in the control of glucose repression. No S. cerevisiae orthologs of the pho7 gene is known, and no 2-DG resistance has been reported for any of the deletion mutants of the other genes identified here. Moreover, 2-DG leads to derepressed invertase activity in S. pombe, while in S. cerevisiae it becomes repressed. Taken together, these findings suggest that mechanisms involved in 2-DG resistance differ between budding and fission yeasts.

  16. Development of ceftriaxone resistance affects the virulence properties of Salmonella enterica serotype Typhimurium strains.

    PubMed

    Li, Liang; Yang, Yu-Rong; Liao, Xiao-Ping; Lei, Chun-Yin; Sun, Jian; Li, Lu-Lu; Liu, Bao-Tao; Yang, Shou-Shen; Liu, Ya-Hong

    2013-01-01

    Development of antibiotic resistance may alter the virulence properties of bacterial organisms. In this study, nine clinical ceftriaxone-susceptible Salmonella enterica serotype Typhimurium strains were subjected to stepwise selection with increasing concentrations of ceftriaxone in culture media. Mutations in virulence-associated genes and antibiotic efflux genes were analyzed by polymerase chain reaction (PCR) and DNA sequencing. The expression levels of virulence genes invA and stn as well as efflux pump genes tolC, arcA, and arcB before and after the selection were measured by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR). The stepwise selection resulted in the development of Salmonella strains that were highly resistant to ceftriaxone. Sequence analysis did not reveal any mutations or deletions in the examined virulence genes and regulatory gene, but a silent mutation (T423C) in acrR (encoding a repressor for the efflux pump) was detected in most of the ceftriaxone-resistant strains. The qRT-PCR revealed increased expression of the AcrAB-TolC efflux pump and decreased expression of invA and stn in the ceftriaxone-resistant strains. Moreover, decreased invasion into cultured epithelial cells and reduced growth rates were observed with the resistant strains. These results suggest that acquisition of ceftriaxone resistance is associated with the overexpression of the AcrAB-TolC efflux pump and leads to reduced virulence in Salmonella Typhimurium.

  17. Identification of nuclear genes affecting 2-Deoxyglucose resistance in Schizosaccharomyces pombe.

    PubMed

    Vishwanatha, Akshay; Rallis, Charalampos; Bevkal Subramanyaswamy, Shubha; D'Souza, Cletus Joseph Michael; Bähler, Jürg; Schweingruber, Martin Ernst

    2016-09-01

    2-Deoxyglucose (2-DG) is a toxic glucose analog. To identify genes involved in 2-DG toxicity in Schizosaccharomyces pombe, we screened a wild-type overexpression library for genes which render cells 2-DG resistant. A gene we termed odr1, encoding an uncharacterized hydrolase, led to strong resistance and altered invertase expression when overexpressed. We speculate that Odr1 neutralizes the toxic form of 2-DG, similar to the Saccharomyces cerevisiae Dog1 and Dog2 phosphatases which dephosphorylate 2-DG-6-phosphate synthesized by hexokinase. In a complementary approach, we screened a haploid deletion library to identify 2-DG-resistant mutants. This screen identified the genes snf5, ypa1, pas1 and pho7 In liquid medium, deletions of these genes conferred 2-DG resistance preferentially under glucose-repressed conditions. The deletion mutants expressed invertase activity more constitutively than the control strain, indicating defects in the control of glucose repression. No S. cerevisiae orthologs of the pho7 gene is known, and no 2-DG resistance has been reported for any of the deletion mutants of the other genes identified here. Moreover, 2-DG leads to derepressed invertase activity in S. pombe, while in S. cerevisiae it becomes repressed. Taken together, these findings suggest that mechanisms involved in 2-DG resistance differ between budding and fission yeasts. PMID:27481777

  18. Transgenic banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease.

    PubMed

    Namukwaya, B; Tripathi, L; Tripathi, J N; Arinaitwe, G; Mukasa, S B; Tushemereirwe, W K

    2012-08-01

    Banana Xanthomonas wilt (BXW), caused by Xanthomonas campestris pv. musacearum, is one of the most important diseases of banana (Musa sp.) and currently considered as the biggest threat to banana production in Great Lakes region of East and Central Africa. The pathogen is highly contagious and its spread has endangered the livelihood of millions of farmers who rely on banana for food and income. The development of disease resistant banana cultivars remains a high priority since farmers are reluctant to employ labor-intensive disease control measures and there is no host plant resistance among banana cultivars. In this study, we demonstrate that BXW can be efficiently controlled using transgenic technology. Transgenic bananas expressing the plant ferredoxin-like protein (Pflp) gene under the regulation of the constitutive CaMV35S promoter were generated using embryogenic cell suspensions of banana. These transgenic lines were characterized by molecular analysis. After challenge with X. campestris pv. musacearum transgenic lines showed high resistance. About 67% of transgenic lines evaluated were completely resistant to BXW. These transgenic lines did not show any disease symptoms after artificial inoculation of in vitro plants under laboratory conditions as well as potted plants in the screen-house, whereas non-transgenic control plants showed severe symptoms resulting in complete wilting. This study confirms that expression of the Pflp gene in banana results in enhanced resistance to BXW. This transgenic technology can provide a timely solution to the BXW pandemic.

  19. Does Coral Disease Affect Symbiodinium? Investigating the Impacts of Growth Anomaly on Symbiont Photophysiology

    PubMed Central

    Burns, John Henrik Robert; Gregg, Toni Makani; Takabayashi, Misaki

    2013-01-01

    Growth anomaly (GA) is a commonly observed coral disease that impairs biological functions of the affected tissue. GA is prevalent at Wai ‘ōpae tide pools, southeast Hawai ‘i Island. Here two distinct forms of this disease, Type A and Type B, affect the coral, Montiporacapitata. While the effects of GA on biology and ecology of the coral host are beginning to be understood, the impact of this disease on the photophysiology of the dinoflagellate symbiont, Symbiodinium spp., has not been investigated. The GA clearly alters coral tissue structure and skeletal morphology and density. These tissue and skeletal changes are likely to modify not only the light micro-environment of the coral tissue, which has a direct impact on the photosynthetic potential of Symbiodinium spp., but also the physiological interactions within the symbiosis. This study utilized Pulse amplitude modulation fluorometry (PAM) to characterize the photophysiology of healthy and GA-affected M. capitata tissue. Overall, endosymbionts within GA-affected tissue exhibit reduced photochemical efficiency. Values of both Fv/Fm and ΔF/ Fm’ were significantly lower (p<0.01) in GA tissue compared to healthy and unaffected tissues. Tracking the photophysiology of symbionts over a diurnal time period enabled a comparison of symbiont responses to photosynthetically available radiation (PAR) among tissue conditions. Symbionts within GA tissue exhibited the lowest values of ΔF/Fm’ as well as the highest pressure over photosystem II (p<0.01). This study provides evidence that the symbionts within GA-affected tissue are photochemically compromised compared to those residing in healthy tissue. PMID:23967301

  20. Increased FOXP3 expression in tumour-associated tissues of horses affected with equine sarcoid disease.

    PubMed

    Mählmann, K; Hamza, E; Marti, E; Dolf, G; Klukowska, J; Gerber, V; Koch, C

    2014-12-01

    Recent studies suggest that regulatory T cells (Tregs) are associated with disease severity and progression in papilloma virus induced neoplasia. Bovine papilloma virus (BPV) is recognised as the most important aetiological factor in equine sarcoid (ES) disease. The aim of this study was to compare expression levels of Treg markers and associated cytokines in tissue samples of ES-affected equids with skin samples of healthy control horses. Eleven ES-affected, and 12 healthy horses were included in the study. Expression levels of forkhead box protein 3 (FOXP3), interleukin 10 (IL10), interleukin 4 (IL4) and interferon gamma (IFNG) mRNA in lesional and tumour-distant samples from ES-affected horses, as well as in dermal samples of healthy control horses were measured using quantitative reverse transcription polymerase chain reaction (PCR). Expression levels were compared between lesional and tumour-distant as well as between tumour-distant and control samples. Furthermore, BPV-1 E5 DNA in samples of ES-affected horses was quantified using quantitative PCR, and possible associations of viral load, disease severity and gene expression levels were evaluated. Expression levels of FOXP3, IL10 and IFNG mRNA and BPV-1 E5 copy numbers were significantly increased in lesional compared to tumour-distant samples. There was no difference in FOXP3 and cytokine expression in tumour-distant samples from ES- compared with control horses. In tumour-distant samples viral load was positively correlated with IL10 expression and severity score. The increased expression of Treg markers in tumour-associated tissues of ES-affected equids indicates a local, Treg-induced immune suppression.

  1. Resistance to Dutch Elm Disease Reduces Presence of Xylem Endophytic Fungi in Elms (Ulmus spp.)

    PubMed Central

    Martín, Juan A.; Witzell, Johanna; Blumenstein, Kathrin; Rozpedowska, Elzbieta; Helander, Marjo; Sieber, Thomas N.; Gil, Luis

    2013-01-01

    Efforts to introduce pathogen resistance into landscape tree species by breeding may have unintended consequences for fungal diversity. To address this issue, we compared the frequency and diversity of endophytic fungi and defensive phenolic metabolites in elm (Ulmus spp.) trees with genotypes known to differ in resistance to Dutch elm disease. Our results indicate that resistant U. minor and U. pumila genotypes exhibit a lower frequency and diversity of fungal endophytes in the xylem than susceptible U. minor genotypes. However, resistant and susceptible genotypes showed a similar frequency and diversity of endophytes in the leaves and bark. The resistant and susceptible genotypes could be discriminated on the basis of the phenolic profile of the xylem, but not on basis of phenolics in the leaves or bark. As the Dutch elm disease pathogen develops within xylem tissues, the defensive chemistry of resistant elm genotypes thus appears to be one of the factors that may limit colonization by both the pathogen and endophytes. We discuss a potential trade-off between the benefits of breeding resistance into tree species, versus concomitant losses of fungal endophytes and the ecosystem services they provide. PMID:23468900

  2. Resistance to Dutch elm disease reduces presence of xylem endophytic fungi in Elms (Ulmus spp.).

    PubMed

    Martín, Juan A; Witzell, Johanna; Blumenstein, Kathrin; Rozpedowska, Elzbieta; Helander, Marjo; Sieber, Thomas N; Gil, Luis

    2013-01-01

    Efforts to introduce pathogen resistance into landscape tree species by breeding may have unintended consequences for fungal diversity. To address this issue, we compared the frequency and diversity of endophytic fungi and defensive phenolic metabolites in elm (Ulmus spp.) trees with genotypes known to differ in resistance to Dutch elm disease. Our results indicate that resistant U. minor and U. pumila genotypes exhibit a lower frequency and diversity of fungal endophytes in the xylem than susceptible U. minor genotypes. However, resistant and susceptible genotypes showed a similar frequency and diversity of endophytes in the leaves and bark. The resistant and susceptible genotypes could be discriminated on the basis of the phenolic profile of the xylem, but not on basis of phenolics in the leaves or bark. As the Dutch elm disease pathogen develops within xylem tissues, the defensive chemistry of resistant elm genotypes thus appears to be one of the factors that may limit colonization by both the pathogen and endophytes. We discuss a potential trade-off between the benefits of breeding resistance into tree species, versus concomitant losses of fungal endophytes and the ecosystem services they provide.

  3. Characterization of Multiple-Antimicrobial-Resistant Escherichia coli Isolates from Diseased Chickens and Swine in China

    PubMed Central

    Yang, Hanchun; Chen, Sheng; White, David G.; Zhao, Shaohua; McDermott, Patrick; Walker, Robert; Meng, Jianghong

    2004-01-01

    Escherichia coli isolates from diseased piglets (n = 89) and chickens (n = 71) in China were characterized for O serogroups, virulence genes, antimicrobial susceptibility, class 1 integrons, and mechanisms of fluoroquinolone resistance. O78 was the most common serogroup identified (63%) among the chicken E. coli isolates. Most isolates were PCR positive for the increased serum survival gene (iss; 97%) and the temperature-sensitive hemagglutinin gene (tsh; 93%). The O serogroups of swine E. coli were not those typically associated with pathogenic strains, nor did they posses common characteristic virulence factors. Twenty-three serogroups were identified among the swine isolates; however, 38% were O nontypeable. Overall, isolates displayed resistance to nalidixic acid (100%), tetracycline (98%), sulfamethoxazole (84%), ampicillin (79%), streptomycin (77%), and trimethoprim-sulfamethoxazole (76%). Among the fluoroquinolones, resistance ranged between 64% to levofloxacin, 79% to ciprofloxacin, and 95% to difloxacin. DNA sequencing of gyrA, gyrB, parC, and parE quinolone resistance-determining regions of 39 nalidixic acid-resistant E. coli isolates revealed that a single gyrA mutation was found in all of the isolates; mutations in parC together with double gyrA mutations conferred high-level resistance to fluoroquinolones (ciprofloxacin MIC, ≥8 μg/ml). Class 1 integrons were identified in 17 (19%) isolates from swine and 42 (47%) from chickens. The majority of integrons possessed genes conferring resistance to streptomycin and trimethoprim. These findings suggest that multiple-antimicrobial-resistant E. coli isolates, including fluoroquinolone-resistant variants, are commonly present among diseased swine and chickens in China, and they also suggest the need for the introduction of surveillance programs in China to monitor antimicrobial resistance in pathogenic bacteria that can be potentially transmitted to humans from food animals. PMID:15297487

  4. The development of pathogen resistance in Daphnia magna: implications for disease spread in age-structured populations.

    PubMed

    Garbutt, Jennie S; O'Donoghue, Anna J P; McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

    2014-11-01

    Immunity in vertebrates is well established to develop with time, but the ontogeny of defence in invertebrates is markedly less studied. Yet, age-specific capacity for defence against pathogens, coupled with age structure in populations, has widespread implications for disease spread. Thus, we sought to determine the susceptibility of hosts of different ages in an experimental invertebrate host-pathogen system. In a series of experiments, we show that the ability of Daphnia magna to resist its natural bacterial pathogen Pasteuria ramosa changes with host age. Clonal differences make it difficult to draw general conclusions, but the majority of observations indicate that resistance increases early in the life of D. magna, consistent with the idea that the defence system develops with time. Immediately following this, at about the time when a daphnid would be most heavily investing in reproduction, resistance tends to decline. Because many ecological factors influence the age structure of Daphnia populations, our results highlight a broad mechanism by which ecological context can affect disease epidemiology. We also show that a previously observed protective effect of restricted maternal food persists throughout the entire juvenile period, and that the protective effect of prior treatment with a small dose of the pathogen ('priming') persists for 7 days, observations that reinforce the idea that immunity in D. magna can change over time. Together, our experiments lead us to conclude that invertebrate defence capabilities have an ontogeny that merits consideration with respect to both their immune systems and the epidemic spread of infection.

  5. Soybean (Glycine max L. Merr.) Sprouts Germinated under Red Light Irradiation Induce Disease Resistance against Bacterial Rotting Disease

    PubMed Central

    Dhakal, Radhika; Park, Euiho; Lee, Se-Weon; Baek, Kwang-Hyun

    2015-01-01

    Specific wavelengths of light can exert various physiological changes in plants, including effects on responses to disease incidence. To determine whether specific light wavelength had effects on rotting disease caused by Pseudomonas putida 229, soybean sprouts were germinated under a narrow range of wavelengths from light emitting diodes (LEDs), including red (650–660), far red (720–730) and blue (440–450 nm) or broad range of wavelength from daylight fluorescence bulbs. The controls were composed of soybean sprouts germinated in darkness. After germination under different conditions for 5 days, the soybean sprouts were inoculated with P. putida 229 and the disease incidence was observed for 5 days. The sprouts exposed to red light showed increased resistance against P. putida 229 relative to those grown under other conditions. Soybean sprouts germinated under red light accumulated high levels of salicylic acid (SA) accompanied with up-regulation of the biosynthetic gene ICS and the pathogenesis- related (PR) gene PR-1, indicating that the resistance was induced by the action of SA via de novo synthesis of SA in the soybean sprouts by red light irradiation. Taken together, these data suggest that only the narrow range of red light can induce disease resistance in soybean sprouts, regulated by the SA-dependent pathway via the de novo synthesis of SA and up-regulation of PR genes. PMID:25679808

  6. Food, nutrients and nutraceuticals affecting the course of inflammatory bowel disease.

    PubMed

    Uranga, José Antonio; López-Miranda, Visitación; Lombó, Felipe; Abalo, Raquel

    2016-08-01

    Inflammatory bowel diseases (ulcerative colitis; Crohn's disease) are debilitating relapsing inflammatory disorders affecting the gastrointestinal tract, with deleterious effect on quality of life, and increasing incidence and prevalence. Mucosal inflammation, due to altered microbiota, increased intestinal permeability and immune system dysfunction underlies the symptoms and may be caused in susceptible individuals by different factors (or a combination of them), including dietary habits and components. In this review we describe the influence of the Western diet, obesity, and different nutraceuticals/functional foods (bioactive peptides, phytochemicals, omega 3-polyunsaturated fatty acids, vitamin D, probiotics and prebiotics) on the course of IBD, and provide some hints that could be useful for nutritional guidance. Hopefully, research will soon offer enough reliable data to slow down the spread of the disease and to make diet a cornerstone in IBD therapy. PMID:27267792

  7. Food, nutrients and nutraceuticals affecting the course of inflammatory bowel disease.

    PubMed

    Uranga, José Antonio; López-Miranda, Visitación; Lombó, Felipe; Abalo, Raquel

    2016-08-01

    Inflammatory bowel diseases (ulcerative colitis; Crohn's disease) are debilitating relapsing inflammatory disorders affecting the gastrointestinal tract, with deleterious effect on quality of life, and increasing incidence and prevalence. Mucosal inflammation, due to altered microbiota, increased intestinal permeability and immune system dysfunction underlies the symptoms and may be caused in susceptible individuals by different factors (or a combination of them), including dietary habits and components. In this review we describe the influence of the Western diet, obesity, and different nutraceuticals/functional foods (bioactive peptides, phytochemicals, omega 3-polyunsaturated fatty acids, vitamin D, probiotics and prebiotics) on the course of IBD, and provide some hints that could be useful for nutritional guidance. Hopefully, research will soon offer enough reliable data to slow down the spread of the disease and to make diet a cornerstone in IBD therapy.

  8. Both epistatic and additive effects of QTLs are involved in polygenic induced resistance to disease: a case study, the interaction pepper - Phytophthora capsici Leonian.

    PubMed

    Lefebvre, V; Palloix, A

    1996-09-01

    To study the resistance of pepper to Phytophthora capsici, we analyzed 94 doubled-haploid (DH) lines derived from the intraspecific F1 hybrid obtained from a cross between Perennial, an Indian pungent resistant line, and Yolo Wonder, an American bell-pepper susceptible line, with 119 DNA markers. Four different criteria were used to evaluate the resistance, corresponding to different steps or mechanisms of the host-pathogen interaction: root-rot index, receptivity, inducibility and stability. Three distinct ANOVA models between DNA marker genotypes and the four disease criteria identified 13 genomic regions, distributed across several linkage groups or unlinked markers, affecting the resistance of pepper to P. capsici. Some QTLs were criterion specific, whereas others affect several criteria, so that the four resistance criteria were controlled by different combinations of QTLs. The QTLs were very different in their quantitative effect (R(2) values), including major QTLs which explained 41-55% of the phenotypic variance, intermediate QTLs with additive or/and epistatic action (17-28% of the variance explained) and minor QTLs. Favourable alleles of some minor QTLs were carried in the susceptible parent. The total phenotypic variation accounted for by QTLs reached up to 90% for receptivity, with an important part due to epistasis effects between QTLs (with or without additive effects). The relative impact of resistance QTLs in disease response is discussed. PMID:24162341

  9. Identification of Histological Patterns in Clinically Affected and Unaffected Palm Regions in Dupuytren's Disease

    PubMed Central

    Alfonso-Rodríguez, Camilo-Andrés; Garzón, Ingrid; Garrido-Gómez, Juan; Oliveira, Ana-Celeste-Ximenes; Martín-Piedra, Miguel-Ángel; Scionti, Giuseppe; Carriel, Víctor; Hernández-Cortés, Pedro; Campos, Antonio; Alaminos, Miguel

    2014-01-01

    Dupuytren's disease is a fibro-proliferative disease characterized by a disorder of the extracellular matrix (ECM) and high myofibroblast proliferation. However, studies failed to determine if the whole palm fascia is affected by the disease. The objective of this study was to analyze several components of the extracellular matrix of three types of tissues—Dupuytren's diseased contracture cords (DDC), palmar fascia clinically unaffected by Dupuytren's disease contracture (NPF), and normal forehand fascia (NFF). Histological analysis, quantification of cells recultured from each type of tissue, mRNA microarrays and immunohistochemistry for smooth muscle actin (SMA), fibrillar ECM components and non-fibrillar ECM components were carried out. The results showed that DDC samples had abundant fibrosis with reticular fibers and few elastic fibers, high cell proliferation and myofibroblasts, laminin and glycoproteins, whereas NFF did not show any of these findings. Interestingly, NPF tissues had more cells showing myofibroblasts differentiation and more collagen and reticular fibers, laminin and glycoproteins than NFF, although at lower level than DDC, with similar elastic fibers than DDC. Immunohistochemical expression of decorin was high in DDC, whereas versican was highly expressed NFF, with no differences for aggrecan. Cluster analysis revealed that the global expression profile of NPF was very similar to DDC, and reculturing methods showed that cells corresponding to DDC tissues proliferated more actively than NPF, and NPF more actively than NFF. All these results suggest that NPF tissues may be affected, and that a modification of the therapeutic approach used for the treatment of Dupuytren's disease should be considered. PMID:25379672

  10. Affective and cognitive Theory of Mind in patients with parkinson's disease.

    PubMed

    Bodden, Maren E; Mollenhauer, Brit; Trenkwalder, Claudia; Cabanel, Nicole; Eggert, Karla Maria; Unger, Marcus Michael; Oertel, Wolfgang Hermann; Kessler, Josef; Dodel, Richard; Kalbe, Elke

    2010-08-01

    Theory of Mind (ToM), which is the ability to infer other people's mental states such as beliefs or desires, is an important prerequisite for social interaction. Affective and cognitive subcomponents of ToM can be impaired selectively in neurological and psychiatric disorders. This study examines ToM in 21 Parkinson's disease (PD) patients and 21 healthy control (HC) subjects, using the computerized "Yoni task" that assesses affective and cognitive ToM abilities and an extensive battery of neuropsychological tests. Furthermore, questionnaires to assess health-related quality of life and depressive symptoms were applied and correlations to ToM were investigated. Compared to the control subjects, PD patients scored lower on both the affective (PD: 76% versus HC: 89%; p = 0.006) and cognitive (PD: 80% versus HC: 92%; p = 0.002) ToM subscales but not on control items (PD: 90% versus HC: 95%; p = 0.077). The ToM abilities were not associated with other cognitive functions, depressive symptoms or clinical data. However, affective ToM was correlated with health-related quality of life (p = 0.01). Parkinson patients are impaired in affective as well as cognitive ToM. These deficits are largely independent from other cognitive impairments, depressive symptoms and motor impairment. The relationship of affective ToM to the health-related quality of life of PD patients points to a clinical relevance of this issue and suggests that ToM dysfunctions must be regarded as an important non-motor feature of Parkinson's disease. PMID:20538499

  11. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.

    PubMed

    Chernoff, Y O; Vincent, A; Liebman, S W

    1994-02-15

    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  12. Comparisons of protein profiles of beech bark disease resistant and susceptible American beech (Fagus grandifolia)

    PubMed Central

    2013-01-01

    Background Beech bark disease is an insect-fungus complex that damages and often kills American beech trees and has major ecological and economic impacts on forests of the northeastern United States and southeastern Canadian forests. The disease begins when exotic beech scale insects feed on the bark of trees, and is followed by infection of damaged bark tissues by one of the Neonectria species of fungi. Proteomic analysis was conducted of beech bark proteins from diseased trees and healthy trees in areas heavily infested with beech bark disease. All of the diseased trees had signs of Neonectria infection such as cankers or fruiting bodies. In previous tests reported elsewhere, all of the diseased trees were demonstrated to be susceptible to the scale insect and all of the healthy trees were demonstrated to be resistant to the scale insect. Sixteen trees were sampled from eight geographically isolated stands, the sample consisting of 10 healthy (scale-resistant) and 6 diseased/infested (scale-susceptible) trees. Results Proteins were extracted from each tree and analysed in triplicate by isoelectric focusing followed by denaturing gel electrophoresis. Gels were stained and protein spots identified and intensity quantified, then a statistical model was fit to identify significant differences between trees. A subset of BBD differential proteins were analysed by mass spectrometry and matched to known protein sequences for identification. Identified proteins had homology to stress, insect, and pathogen related proteins in other plant systems. Protein spots significantly different in diseased and healthy trees having no stand or disease-by-stand interaction effects were identified. Conclusions Further study of these proteins should help to understand processes critical to resistance to beech bark disease and to develop biomarkers for use in tree breeding programs and for the selection of resistant trees prior to or in early stages of BBD development in stands. Early

  13. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes.

    PubMed

    He, Bin; Gu, Yinghong; Tao, Xiang; Cheng, Xiaojie; Wei, Changhe; Fu, Jian; Cheng, Zaiquan; Zhang, Yizheng

    2015-12-10

    Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant-pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future.

  14. Sex-specific effect of juvenile diet on adult disease resistance in a field cricket.

    PubMed

    Kelly, Clint D; Tawes, Brittany R

    2013-01-01

    Food limitation is expected to reduce an individual's body condition (body mass scaled to body size) and cause a trade-off between growth and other fitness-related traits, such as immunity. We tested the condition-dependence of growth and disease resistance in male and female Gryllus texensis field crickets by manipulating diet quality via nutrient content for their entire life and then subjecting individuals to a host resistance test using the live bacterium Serratia marcescens. As predicted, crickets on a high-quality diet eclosed more quickly, and at a larger body size and mass. Crickets on a high-quality diet were not in better condition at the time of eclosion, but they were in better condition 7-11 days after eclosion, with females also being in better condition than males. Despite being in better condition, however, females provided with a high-quality diet had significantly poorer disease resistance than females on a low-quality diet and in poor condition. Similarly, males on low- and high-quality diets did not differ in their disease resistance, despite differing in their body condition. A sex difference in disease resistance under diet-restriction suggests that females might allocate resources toward immunity during development if they expect harsh environmental conditions as an adult or it might suggest that females allocate resources toward other life history activities (i.e. reproduction) when food availability increases. We do not know what immune effectors were altered under diet-restriction to increase disease resistance, but our findings suggest that increased immune function might provide an explanation for the sexually-dimorphic increase in longevity generally observed in diet-restricted animals.

  15. De Novo Transcriptome Sequencing of Oryza officinalis Wall ex Watt to Identify Disease-Resistance Genes

    PubMed Central

    He, Bin; Gu, Yinghong; Tao, Xiang; Cheng, Xiaojie; Wei, Changhe; Fu, Jian; Cheng, Zaiquan; Zhang, Yizheng

    2015-01-01

    Oryza officinalis Wall ex Watt is one of the most important wild relatives of cultivated rice and exhibits high resistance to many diseases. It has been used as a source of genes for introgression into cultivated rice. However, there are limited genomic resources and little genetic information publicly reported for this species. To better understand the pathways and factors involved in disease resistance and accelerating the process of rice breeding, we carried out a de novo transcriptome sequencing of O. officinalis. In this research, 137,229 contigs were obtained ranging from 200 to 19,214 bp with an N50 of 2331 bp through de novo assembly of leaves, stems and roots in O. officinalis using an Illumina HiSeq 2000 platform. Based on sequence similarity searches against a non-redundant protein database, a total of 88,249 contigs were annotated with gene descriptions and 75,589 transcripts were further assigned to GO terms. Candidate genes for plant–pathogen interaction and plant hormones regulation pathways involved in disease-resistance were identified. Further analyses of gene expression profiles showed that the majority of genes related to disease resistance were all expressed in the three tissues. In addition, there are two kinds of rice bacterial blight-resistant genes in O. officinalis, including two Xa1 genes and three Xa26 genes. All 2 Xa1 genes showed the highest expression level in stem, whereas one of Xa26 was expressed dominantly in leaf and other 2 Xa26 genes displayed low expression level in all three tissues. This transcriptomic database provides an opportunity for identifying the genes involved in disease-resistance and will provide a basis for studying functional genomics of O. officinalis and genetic improvement of cultivated rice in the future. PMID:26690414

  16. Inheritance of black sigatoka disease resistance in plantain-banana (Musa spp.) hybrids.

    PubMed

    Ortiz, R; Vuylsteke, D

    1994-10-01

    Black sigatoka (Mycosphaerella fijiensis Morelet), an airborne fungal leaf-spot disease, is a major constraint to plantain and banana (Musa spp.) production world-wide. Gaining further knowledge of the genetics of host-plant resistance will enhance the development of resistant cultivars, which is considered to be the most appropriate means to achieve stable production. Genetic analysis was conducted on 101 euploid (2x, 3x and 4x) progenies, obtained from crossing two susceptible triploid plantain cultivars with the resistant wild diploid banana 'Calcutta 4'. Segregating progenies, and a susceptible reference plantain cultivar, were evaluated over 2 consecutive years. Three distinct levels of host response to black sigatoka were defined as follows: susceptible (< 8 leaves without spots), less susceptible (8-10) and partially resistant (> 10). Segregation ratios for resistance at the 2x level fitted a genetic model having one major recessive resistance allele (bs 1) and two independent alleles with additive effects (bsr 2 and bsr 3). A similar model explains the results at the 4x level assuming that the favourable resistance alleles have a dosage effect when four copies of them are present in their respective loci (bs i (4) ). The proposed model was further validated by segregation data of S 1 progenies. Mechanisms of black sigatoka resistance are discussed in relation to the genetic model.

  17. Metabolic profiling of chickpea-Fusarium interaction identifies differential modulation of disease resistance pathways.

    PubMed

    Kumar, Yashwant; Dholakia, Bhushan B; Panigrahi, Priyabrata; Kadoo, Narendra Y; Giri, Ashok P; Gupta, Vidya S

    2015-08-01

    Chickpea is the third most widely grown legume in the world and mainly used as a vegetarian source of human dietary protein. Fusarium wilt, caused by Fusarium oxysporum f. sp. ciceri (Foc), is one of the major threats to global chickpea production. Host resistance is the best way to protect crops from diseases; however, in spite of using various approaches, the mechanism of Foc resistance in chickpea remains largely obscure. In the present study, non-targeted metabolic profiling at several time points of resistant and susceptible chickpea cultivars using high-resolution liquid chromatography-mass spectrometry was applied to better understand the mechanistic basis of wilt resistance or susceptibility. Multivariate analysis of the data (OPLS-DA) revealed discriminating metabolites in chickpea root tissue after Foc inoculation such as flavonoids, isoflavonoids, alkaloids, amino acids and sugars. Foc inoculated resistant plants had more flavonoids and isoflavonoids along with their malonyl conjugates. Many antifungal metabolites that were induced after Foc infection viz., aurantion-obstine β-glucosides and querecitin were elevated in resistant cultivar. Overall, diverse genetic and biochemical mechanisms were operational in the resistant cultivar for Foc defense as compared to the susceptible plant. The resistant chickpea plants employed the above-mentioned metabolic pathways as potential defense strategy against Foc.

  18. Prevalence and characterization of apramycin-resistant Salmonella enterica serotype Typhimurium isolated from healthy and diseased pigs in Korea during 1998 through 2009.

    PubMed

    Lim, Suk-Kyung; Nam, Hyang-Mi; Lee, Hee-Soo; Kim, Ae-Ran; Jang, Gum-Chan; Jung, Suk-Chan; Kim, Tae-Sun

    2013-08-01

    Apramycin resistance was observed in 22.8% (81 of 355) of Salmonella Typhimurium isolates collected from pigs from 1998 through 2009 in Korea. All apramycin-resistant Salmonella Typhimurium isolates also were cross-resistant to gentamicin and tobramycin. Among the seven types of aminoglycoside resistance genes tested, only four types were detected in the apramycin-resistant Salmonella Typhimurium isolates: aac (3)-IV, aac (3)-II, aac (3)-III, and ant (2'')-I. Although the aac (3)-IV gene was found in all apramycin-resistant Salmonella Typhimurium isolates, aac (3)-II, aac (3)-III, and ant (2'')-I genes were detected in five (6.2%), two (2.5%), and three (3.7%) isolates, respectively. The apramycin-resistant isolates comprised six phage types, of which PT193 (16 of 81 isolates, 19.8%) was most commonly observed. To our knowledge, this is the first report describing characteristics of apramycin-resistant Salmonella Typhimurium isolates in Korea. Further study is warranted to determine whether apramycin use in animals results in cross-resistance to gentamicin, which may affect public health when gentamicin is required for disease treatment in humans.

  19. Identification and analysis of factors affecting thermal shock resistance of ceramic materials in solar receivers

    NASA Astrophysics Data System (ADS)

    Hasselman, D. P. H.; Singh, J. P.; Satyamurthy, K.

    1980-07-01

    An analysis was conducted of the possible modes of thermal stress failure of brittle ceramics for potential use in point-focussing solar receivers. The pertinent materials properties which control thermal stress resistance were identified for conditions of steady-state and transient heat flow, convective and radiative heat transfer, thermal buckling and thermal fatigue as well as catastrophic crack propagation. Selection rules for materials with optimum thermal stress resistance for a particular thermal environment were identified. Recommendations for materials for particular components were made. The general requirements for a thermal shock testing program quantitatively meaningful for point-focussing solar receivers were outlined. Recommendations for follow-on theoretical analyses were made.

  20. Psychosocial burden of sickle cell disease on parents with an affected child in Cameroon.

    PubMed

    Wonkam, Ambroise; Mba, Caryl Zameyo; Mbanya, Dora; Ngogang, Jeanne; Ramesar, Raj; Angwafo, Fru F

    2014-04-01

    The chronicity of Sickle Cell Disease (SCD) could impair the quality of life of caregivers. We performed a quantitative study to assess various indices of psychosocial burden on Cameroonian parents (N = 130) with at least one living SCD-affected child. Demographic and medical information were obtained from the participants and the review of the patients' medical records. The survey instrument included a 38-item stress factors scale using Likert-type statements, evaluating general perceptions of stress and five main specific stressors: disease factors (clinical severity), hospital factors, financial factors, family factors (life/dynamic) and SCD-child factors (perceived quality of life). The items pertaining to burden involved four response options with increasing severity: 0, 1, 2 or 3. Descriptive statistics and non-parametric tests were used for analysis. Participants were typically aged 38 years, urban dwellers (89%), female (80%), married (60.2%), employed (61.7%) and had secondary/tertiary education (82%). Median age of SCD-affected children was 9 years. The median age at diagnosis of SCD was 6 months; 47.8% had more than 3 painful crises per year. The majority of participants (88.3%) experienced moderate to severe difficulty coping with SCD. On a 0-3 scale, median score of SCD clinical severity was the major factor to undermine the coping ability of parents (2.2); vaso-occlusive painful events (>3 per year) was the disease-related stressor that most impacted their coping ability. The family life dynamic was the least stressful (0.7). Unemployment affected all the stressors' categories. Stressors scores also increased with female, single, low education level, age of SCD-affected children or more than 3 children in the family. In Cameroon, there is an urgent need to implement practices that ensure affordable access to health-care and activities that would reduce SCD morbidity.

  1. Role of matrix metalloproteinase-9 in chronic kidney disease: a new biomarker of resistant albuminuria.

    PubMed

    Pulido-Olmo, Helena; García-Prieto, Concha F; Álvarez-Llamas, Gloria; Barderas, María G; Vivanco, Fernando; Aranguez, Isabel; Somoza, Beatriz; Segura, Julián; Kreutz, Reinhold; Fernández-Alfonso, María S; Ruilope, Luis M; Ruiz-Hurtado, Gema

    2016-04-01

    Resistant albuminuria, developed under adequate chronic blockade of the renin-angiotensin system, is a clinical problem present in a small number of patients with chronic kidney disease (CKD). The mechanism underlying this resistant albuminuria remains unknown. Matrix metalloproteinases (MMPs) are involved in the pathophysiology of cardiovascular and renal diseases. In the present study we tested the role of MMPs in resistant albuminuria. First we evaluated gelatinase MMP-2 and MMP-9 activity by zymography in the Munich Wistar Frömter (MWF) rat, a model of progressive albuminuria, and subsequently in patients with resistant albuminuria. Markers of oxidative stress were observed in the kidneys of MWF rats, together with a significant increase in pro-MMP-2 and active MMP-9 forms. These changes were normalized together with reduced albuminuria in consomic MWF-8(SHR) rats, in which chromosome 8 of MWF was replaced with the respective chromosome from spontaneously hypertensive rats. The MMP-2 and MMP-9 protein levels were similar in patients with normal and resistant albuminuria; however, high circulating levels of collagen IV, a specific biomarker of tissue collagen IV degradation, were observed in patients with resistant albuminuria. These patients showed a significant increase in gelatinase MMP-2 and MMP-9 activity, but only a significant increase in the active MMP-9 form quantified by ELISA, which correlated significantly with the degree of albuminuria. Although the expression of the tissue inhibitor of MMP-9 (TIMP)-1 was similar, a novel AlphaLISA assay demonstrated that the MMP-9-TIMP-1 interaction was reduced in patients with resistant albuminuria. It is of interest that oxidized TIMP-1 expression was higher in patients with resistant albuminuria. Therefore, increased circulating MMP-9 activity is associated with resistant albuminuria and a deleterious oxidative stress environment appears to be the underlying mechanism. These changes might contribute to the

  2. Rice WRKY45 plays important roles in fungal and bacterial disease resistance.

    PubMed

    Shimono, Masaki; Koga, Hironori; Akagi, Aya; Hayashi, Nagao; Goto, Shingo; Sawada, Miyuki; Kurihara, Takayuki; Matsushita, Akane; Sugano, Shoji; Jiang, Chang-Jie; Kaku, Hisatoshi; Inoue, Haruhiko; Takatsuji, Hiroshi

    2012-01-01

    Plant 'activators', such as benzothiadiazole (BTH), protect plants from various diseases by priming the plant salicylic acid (SA) signalling pathway. We have reported previously that a transcription factor identified in rice, WRKY45 (OsWRKY45), plays a pivotal role in BTH-induced disease resistance by mediating SA signalling. Here, we report further functional characterization of WRKY45. Different plant activators vary in their action points, either downstream (BTH and tiadinil) or upstream (probenazole) of SA. Rice resistance to Magnaporthe grisea, induced by both types of plant activator, was markedly reduced in WRKY45-knockdown (WRKY45-kd) rice, indicating a universal role for WRKY45 in chemical-induced resistance. Fungal invasion into rice cells was blocked at most attempted invasion sites (pre-invasive defence) in WRKY45-overexpressing (WRKY45-ox) rice. Hydrogen peroxide accumulated within the cell wall underneath invading fungus appressoria or between the cell wall and the cytoplasm, implying a possible role for H(2)O(2) in pre-invasive defence. Moreover, a hypersensitive reaction-like reaction was observed in rice cells, in which fungal growth was inhibited after invasion (post-invasive defence). The two levels of defence mechanism appear to correspond to Type I and II nonhost resistances. The leaf blast resistance of WRKY45-ox rice plants was much higher than that of other known blast-resistant varieties. WRKY45-ox plants also showed strong panicle blast resistance. BTH-induced resistance to Xanthomonas oryzae pv. oryzae was compromised in WRKY45-kd rice, whereas WRKY45-ox plants were highly resistant to this pathogen. However, WRKY45-ox plants were susceptible to Rhizoctonia solani. These results indicate the versatility and limitations of the application of this gene.

  3. Rescuing valuable genomes by animal cloning: a case for natural disease resistance in cattle.

    PubMed

    Westhusin, M E; Shin, T; Templeton, J W; Burghardt, R C; Adams, L G

    2007-01-01

    Tissue banking and animal cloning represent a powerful tool for conserving and regenerating valuable animal genomes. Here we report an example involving cattle and the rescue of a genome affording natural disease resistance. During the course of a 2-decade study involving the phenotypic and genotypic analysis for the functional and genetic basis of natural disease resistance against bovine brucellosis, a foundation sire was identified and confirmed to be genetically resistant to Brucella abortus. This unique animal was utilized extensively in numerous animal breeding studies to further characterize the genetic basis for natural disease resistance. The bull died in 1996 of natural causes, and no semen was available for AI, resulting in the loss of this valuable genome. Fibroblast cell lines had been established in 1985, cryopreserved, and stored in liquid nitrogen for future genetic analysis. Therefore, we decided to utilize these cells for somatic cell nuclear transfer to attempt the production of a cloned bull and salvage this valuable genotype. Embryos were produced by somatic cell nuclear transfer and transferred to 20 recipient cows, 10 of which became pregnant as determined by ultrasound at d 40 of gestation. One calf survived to term. At present, the cloned bull is 4.5 yr old and appears completely normal as determined by physical examination and blood chemistry. Furthermore, in vitro assays performed to date indicate this bull is naturally resistant to B. abortus, Mycobacterium bovis, and Salmonella typhimurium, as was the original genetic donor.

  4. Simple Resistance Exercise helps Patients with Non-alcoholic Fatty Liver Disease.

    PubMed

    Takahashi, A; Abe, K; Usami, K; Imaizumi, H; Hayashi, M; Okai, K; Kanno, Y; Tanji, N; Watanabe, H; Ohira, H

    2015-10-01

    To date, only limited evidence has supported the notion that resistance exercise positively impacts non-alcoholic fatty liver disease. We evaluated the effects of resistance exercise on the metabolic parameters of non-alcoholic fatty liver disease (NAFLD) in 53 patients who were assigned to either a group that performed push-ups and squats 3 times weekly for 12 weeks (exercise group; n=31) or a group that did not (control; n=22). Patients in the control group proceeded with regular physical activities under a restricted diet throughout the study. The effects of the exercise were compared between the 2 groups after 12 weeks. Fat-free mass and muscle mass significantly increased, whereas hepatic steatosis grade, mean insulin and ferritin levels, and the homeostasis model assessment-estimated insulin resistance index were significantly decreased in the exercise group. Compliance with the resistance exercise program did not significantly correlate with patient background characteristics such as age, sex, BMI and metabolic complications. These findings show that resistance exercise comprising squats and push-ups helps to improve the characteristics of metabolic syndrome in patients with non-alcoholic fatty liver disease.

  5. Decision aids for multiple-decision disease management as affected by weather input errors.

    PubMed

    Pfender, W F; Gent, D H; Mahaffee, W F; Coop, L B; Fox, A D

    2011-06-01

    Many disease management decision support systems (DSSs) rely, exclusively or in part, on weather inputs to calculate an indicator for disease hazard. Error in the weather inputs, typically due to forecasting, interpolation, or estimation from off-site sources, may affect model calculations and management decision recommendations. The extent to which errors in weather inputs affect the quality of the final management outcome depends on a number of aspects of the disease management context, including whether management consists of a single dichotomous decision, or of a multi-decision process extending over the cropping season(s). Decision aids for multi-decision disease management typically are based on simple or complex algorithms of weather data which may be accumulated over several days or weeks. It is difficult to quantify accuracy of multi-decision DSSs due to temporally overlapping disease events, existence of more than one solution to optimizing the outcome, opportunities to take later recourse to modify earlier decisions, and the ongoing, complex decision process in which the DSS is only one component. One approach to assessing importance of weather input errors is to conduct an error analysis in which the DSS outcome from high-quality weather data is compared with that from weather data with various levels of bias and/or variance from the original data. We illustrate this analytical approach for two types of DSS, an infection risk index for hop powdery mildew and a simulation model for grass stem rust. Further exploration of analysis methods is needed to address problems associated with assessing uncertainty in multi-decision DSSs.

  6. Insulin resistance in Alzheimer disease: Is heme oxygenase-1 an Achille's heel?

    PubMed

    Barone, Eugenio; Butterfield, D Allan

    2015-12-01

    Insulin resistance, clinically defined as the inability of insulin to increase glucose uptake and utilization, has been found to be associated with the progression of Alzheimer disease (AD). Indeed, postmortem AD brain shows all the signs of insulin resistance including: (i) reduced brain insulin receptor (IR) sensitivity, (ii) hypophosphorylation of the insulin receptor and downstream second messengers such as IRS-1, and (iii) attenuated insulin and insulin growth factor (IGF)-1 receptor expression. However, the exact mechanisms driving insulin resistance have not been completely elucidated. Quite recently, the levels of the peripheral inducible isoform of heme oxygenase (HO-1), a well-known protein up-regulated during cell stress response, were proposed to be among the strongest positive predictors of metabolic disease, including insulin resistance. Because our group previously reported on levels, activation state and oxidative stress-induced post-translational modifications of HO-1 in AD brain and our ongoing studies to better elucidate the role of HO-1 in insulin resistance-associated AD pathology, the aim of this review is to provide reader with a critical analysis on new aspects of the interplay between HO-1 and insulin resistance and on how the available lines of evidence could be useful for further comprehension of processes in AD brain.

  7. Sugarcane borer resistance in sugarcane as affected by silicon applications in potting medium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The sugarcane borer, Diatraea saccharalis (F.)(Lepidoptera: Crambidae) is the most important insect pest of sugarcane (interspecific hybrids of Saccharum) in the Americas, and the key insect pest of sugarcane in Louisiana. Although the release of borer resistant varieties is sporadic in Louisiana, p...

  8. Rate of Conditioned Reinforcement Affects Observing Rate but Not Resistance to Change

    ERIC Educational Resources Information Center

    Shahan, Timothy A.; Podlesnik, Christopher A.

    2005-01-01

    The effects of rate of conditioned reinforcement on the resistance to change of operant behavior have not been examined. In addition, the effects of rate of conditioned reinforcement on the rate of observing have not been adequately examined. In two experiments, a multiple schedule of observing-response procedures was used to examine the effects…

  9. Resistance to essential oils affects survival of Salmonella enterica serovars in growing and harvested basil.

    PubMed

    Kisluk, Guy; Kalily, Emmanuel; Yaron, Sima

    2013-10-01

    The number of outbreaks of food-borne illness associated with consumption of fresh products has increased. A recent and noteworthy outbreak occurred in 2007. Basil contaminated with Salmonella enterica serovar Senftenberg was the source of this outbreak. Since basil produces high levels of antibacterial compounds the aim of this study was to investigate if the emerging outbreak reflects ecological changes that occurred as a result of development of resistance to ingredients of the basil oil. We irrigated basil plants with contaminated water containing two Salmonella serovars, Typhimurium and Senftenberg, and showed that Salmonella can survive on the basil plants for at least 100 days. S. Senftenberg counts in the phyllosphere were significantly higher than S. Typhimurium, moreover, S. Senftenberg was able to grow on stored harvested basil leaves. Susceptibility experiments demonstrated that S. Senftenberg is more resistant to basil oil and to its antimicrobial constituents: linalool, estragole and eugenol. This may indicate that S. Senftenberg had adapted to the basil environment by developing resistance to the basil oil. The emergence of resistant pathogens has a significant potential to change the ecology, and opens the way for pathogens to survive in new niches in the environment such as basil and other plants. PMID:23648052

  10. Volatiles produced by soil-borne endophytic bacteria increase plant pathogen resistance and affect tritrophic interactions

    PubMed Central

    Ton, Jurriaan; Brandenburg, Anna; Karlen, Danielle; Zopfi, Jakob; Turlings, Ted C. J.

    2014-01-01

    Volatile organic compounds (VOCs) released by soil microorganisms influence plant growth and pathogen resistance. Yet, very little is known about their influence on herbivores and higher trophic levels. We studied the origin and role of a major bacterial VOC, 2,3-butanediol (2,3-BD), on plant growth, pathogen and herbivore resistance, and the attraction of natural enemies in maize. One of the major contributors to 2,3-BD in the headspace of soil-grown maize seedlings was identified as Enterobacter aerogenes, an endophytic bacterium that colonizes the plants. The production of 2,3-BD by E. aerogenes rendered maize plants more resistant against the Northern corn leaf blight fungus Setosphaeria turcica. On the contrary, E. aerogenes-inoculated plants were less resistant against the caterpillar Spodoptera littoralis. The effect of 2,3-BD on the attraction of the parasitoid Cotesia marginiventris was more variable: 2,3-BD application to the headspace of the plants had no effect on the parasitoids, but application to the soil increased parasitoid attraction. Furthermore, inoculation of seeds with E. aerogenes decreased plant attractiveness, whereas inoculation of soil with a total extract of soil microbes increased parasitoid attraction, suggesting that the effect of 2,3-BD on the parasitoid is indirect and depends on the composition of the microbial community. PMID:24127750

  11. Glufosinate does not affect floral morphology and pollen viability in glufosinate-resistant cotton (Gossypium hirsutum)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Studies were conducted to determine whether glufosinate treatments to glufosinate-resistant cotton caused changes in floral morphology, pollen viability, and seed set. Four glufosinate treatments were included: (1) glufosinate applied postemergence over the top (POST) at the four-leaf stage, (2) glu...

  12. Resistant starch does not affect zinc homeostasis in rural Malawian children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study tested the hypothesis that Malawian children at risk for zinc deficiency will have reduced endogenous fecal zinc (EFZ) and increased net absorbed zinc (NAZ) following the addition of high amylose maize resistant starch (RS) to their diet. This was a small controlled clinical trial to dete...

  13. Methuselah-like genes affect development, stress resistance, lifespan and reproduction in Tribolium castaneum.

    PubMed

    Li, Chengjun; Zhang, Yi; Yun, Xiaopei; Wang, Yanyun; Sang, Ming; Liu, Xing; Hu, Xingxing; Li, Bin

    2014-10-01

    Methuselah (Mth) is associated with lifespan, stress resistance and reproduction in Drosophila melanogaster, but Mth is not present in nondrosophiline insects. A number of methuselah-likes (mthls) have been identified in nondrosophiline insects, but it is unknown whether the functions of mth are shared by mthls or are divergent from them. Five mthls have been identified in Tribolium castaneum. Although they have different developmental expression patterns, they all enhance resistance to starvation. Only mthl1 and mthl2 enhance resistance to high temperature, whereas mthl4 and mthl5 negatively regulate oxidative stress in T. castaneum. Unlike in the fly with mth mutation, knockdown of mthls, except mthl3, shortens the lifespan of T. castaneum. Moreover, mthl1 and mthl2 are critical for Tribolium development. mthl1 plays important roles in larval and pupal development and adult eclosion, while mthl2 is required for eclosion. Moreover, mthl1 and mthl2 silencing reduces the fertility of T. castaneum, and mthl1 and mthl4 are also essential for embryo development. In conclusion, mthls have a significant effect on insect development, lifespan, stress resistance and reproduction. These results provide experimental evidence for functional divergence among mthls/mth and clues for the signal transduction of Mthls.

  14. Cigarette smoking adversely affects disease activity and disease-specific quality of life in patients with Crohn’s disease at a tertiary referral center

    PubMed Central

    Quezada, Sandra M; Langenberg, Patricia; Cross, Raymond K

    2016-01-01

    Purpose Smoking has a negative impact on disease activity in Crohn’s disease (CD). Smoking may also affect the quality of life, but this has not been evaluated using validated measures over time. We assessed the relationship between smoking and disease-specific quality of life over time in a tertiary referral inflammatory bowel disease cohort. Patients and methods Retrospective cohort study from July 2004 to July 2009 in patients with CD identified from the University of Maryland, Baltimore, Institutional Review Board-approved University of Maryland School of Medicine Inflammatory Bowel Disease Program database. Smoking status was classified as current, former, and never. Age was categorized as <40 years, 40–59 years, and ≥60 years. Index visit disease activity and quality of life was measured with the Harvey–Bradshaw index, and the Short Inflammatory Bowel Disease Questionnaire (SIBDQ). Repeated measures linear regression was used to assess the association between smoking and quality of life over time after adjustment for confounding variables. Results A total of 608 patients were included, of whom 42% were male; 80% were Caucasian; 22% were current smokers; 24% were former smokers; and 54% were never smokers. Over time, adjusted Harvey–Bradshaw index scores declined in all patients, but current smokers had consistently higher scores. After adjustment for sex, age, and disease duration, never smokers had higher mean SIBDQ scores at index visit compared to former and current smokers (P<0.0001); all increased over time but SIBDQ scores for never smokers remained consistently highest. Conclusion Smoking has a negative impact on disease activity and quality of life in patients with CD. Prospects of improved disease activity and quality of life should be proposed as an additional incentive to encourage smoking cessation in patients with CD. PMID:27703391

  15. Transgenic Resistance Confers Effective Field Level Control of Bacterial Spot Disease in Tomato

    PubMed Central

    Horvath, Diana M.; Stall, Robert E.; Jones, Jeffrey B.; Pauly, Michael H.; Vallad, Gary E.; Dahlbeck, Doug; Staskawicz, Brian J.; Scott, John W.

    2012-01-01

    We investigated whether lines of transgenic tomato (Solanum lycopersicum) expressing the Bs2 resistance gene from pepper, a close relative of tomato, demonstrate improved resistance to bacterial spot disease caused by Xanthomonas species in replicated multi-year field trials under commercial type growing conditions. We report that the presence of the Bs2 gene in the highly susceptible VF 36 background reduced disease to extremely low levels, and VF 36-Bs2 plants displayed the lowest disease severity amongst all tomato varieties tested, including commercial and breeding lines with host resistance. Yields of marketable fruit from transgenic lines were typically 2.5 times that of the non-transformed parent line, but varied between 1.5 and 11.5 fold depending on weather conditions and disease pressure. Trials were conducted without application of any copper-based bactericides, presently in wide use despite negative impacts on the environment. This is the first demonstration of effective field resistance in a transgenic genotype based on a plant R gene and provides an opportunity for control of a devastating pathogen while eliminating ineffective copper pesticides. PMID:22870280

  16. Evaluation of seashore paspalum germplasm for resistance to dollar spot disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Development of seashore paspalum (Paspalum vaginatum Swartz) cultivars that exhibit resistance to dollar spot disease, caused by Sclerotinia homoeocarpa F.T. Bennett, are needed. Seashore paspalum is a warm-season turfgrass often utilized on golf courses and athletic fields in the southeastern Unite...

  17. Association mapping of fruit, seed and disease resistance traits in Theobroma cacao L

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An association mapping approach was employed to find markers for color, size, girth and mass of fruits; seed number and butterfat content; and resistance to black pod and witches’ broom diseases in cacao (Theobroma cacao L.). Ninety-five microsatellites (SSRs) and 775 single nucleotide polymorphisms...

  18. Evaluating Hawaii-Grown Papaya for Resistance to Internal Yellowing Disease Caused by Enterobacter cloacae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Papaya (Carica papaya L.) cultivars and breeding lines were evaluated for resistance to Enterobacter cloacae (Jordan) Hormaeche & Edwards, the bacterial causal agent of internal yellowing disease (IY), using a range of concentrations of the bacterium. Linear regression analysis was performed and IY ...

  19. Evaluation of fruit rot disease resistance in muscadine grapes (Vitis rotundifolia Michx)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Musacadine grapes (Vitis rotundifolia Michx.) are truly a sustainable fruit for the southeastern United States. Although far more resistant to many fungal and bacterial diseases and pests than most of the bunch grapes (V. vinifera, V. labrusca, or their derivatives), muscadine grape suffers consider...

  20. Genomic tools for developing markers for postharvest disease resistance in Rosaceae fruit crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A wealth of new plant genomic information and molecular tools have been developed over the past ten years and now the challenge is to learn how to apply this information to address critical production problems, such as disease resistance and abiotic stress tolerance. Malus sieversii, an apple speci...

  1. Screening for insect and disease resistance and aflatoxin accumulation in experimental maize hybrids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to develop new maize germplasm lines with resistance to multiple insect pests, disease, and aflatoxin accumulation in temperate region, a set of new experimental hybrids was made using exotic tropical and subtropical maize inbred lines. The evaluation of these breeding crosses for insect a...

  2. Identification of genes conferring genetic resistance to Marek’s disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic resistance to Marek’s disease (MD) is complex and controlled by many genes with the majority having small effect making them difficult to detect. Thus, to identify specific genes, we have been employing and integrating a variety of genomic and functional genomic approaches that capitalize on...

  3. Developing maize germplasm lines with multiple insect and disease resistance and low aflatoxin contamination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Yield and quality losses caused BY insects, diseases, and mycotoxin contaminations are the critical impediments for maize production under warm climate. In order to develop maize germplasm lines with resistance to multiple insect pests and aflatoxin accumulation, a set of 13 reciprocal breeding cro...

  4. Identification of tree-crop rootstocks with resistance to Armillaria root disease.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Armillaria root disease attacks a broad range of tree crops in California. Instead of re-tooling ineffective conventional controls, namely soil fumigation, we focused on identification of Armillaria-resistant Juglans rootstocks, as part of a collaborative project to identify rootstocks with resistan...

  5. The research agenda of the National Institute of Allergy and Infectious Diseases for antimicrobial resistance.

    PubMed

    Peters, N Kent; Dixon, Dennis M; Holland, Steven M; Fauci, Anthony S

    2008-04-15

    Antimicrobial resistance is an intrinsic and inevitable aspect of microbial survival that continually challenges human health. Research on antimicrobial resistance is central to the mission of the National Institute of Allergy and Infectious Diseases (NIAID). In fiscal year 2007, NIAID invested more than USD800 million to support basic and translational research on antimicrobials, more than USD200 million of which is devoted to understanding the causes, consequences, and treatments of antimicrobial drug resistance. The complex process that facilitates the transformation of ideas into therapies requires a pipeline that runs from bench to bedside, and NIAID has leveraged the entire spectrum of conventional and biodefense resources. NIAID works in partnership with other federal agencies, industry, foundation partners, and foreign governments. The basic and clinical research supported by NIAID will, ideally, continue to yield profound rewards in terms of the understanding, diagnosis, and treatment of infectious diseases.

  6. Affective disturbance in rheumatoid arthritis: psychological and disease-related pathways.

    PubMed

    Sturgeon, John A; Finan, Patrick H; Zautra, Alex J

    2016-09-01

    In addition to recurrent pain, fatigue, and increased rates of physical disability, individuals with rheumatoid arthritis (RA) have an increased prevalence of some mental health disorders, particularly those involving affective or mood disturbances. This narrative Review provides an overview of mental health comorbidities in RA, and discusses how these comorbidities interact with disease processes, including dysregulation of inflammatory responses, prolonged difficulties with pain and fatigue, and the development of cognitive and behavioural responses that could exacerbate the physical and psychological difficulties associated with RA. This article describes how the social context of individuals with RA affects both their coping strategies and their psychological responses to the disease, and can also impair responses to treatment through disruption of patient-physician relationships and treatment adherence. Evidence from the literature on chronic pain suggests that the resulting alterations in neural pathways of reward processing could yield new insights into the connections between disease processes in RA and psychological distress. Finally, the role of psychological interventions in the effective and comprehensive treatment of RA is discussed.

  7. Affective disturbance in rheumatoid arthritis: psychological and disease-related pathways.

    PubMed

    Sturgeon, John A; Finan, Patrick H; Zautra, Alex J

    2016-09-01

    In addition to recurrent pain, fatigue, and increased rates of physical disability, individuals with rheumatoid arthritis (RA) have an increased prevalence of some mental health disorders, particularly those involving affective or mood disturbances. This narrative Review provides an overview of mental health comorbidities in RA, and discusses how these comorbidities interact with disease processes, including dysregulation of inflammatory responses, prolonged difficulties with pain and fatigue, and the development of cognitive and behavioural responses that could exacerbate the physical and psychological difficulties associated with RA. This article describes how the social context of individuals with RA affects both their coping strategies and their psychological responses to the disease, and can also impair responses to treatment through disruption of patient-physician relationships and treatment adherence. Evidence from the literature on chronic pain suggests that the resulting alterations in neural pathways of reward processing could yield new insights into the connections between disease processes in RA and psychological distress. Finally, the role of psychological interventions in the effective and comprehensive treatment of RA is discussed. PMID:27411910

  8. Caloric restriction as a mechanism mediating resistance to environmental disease.

    PubMed Central

    Frame, L T; Hart, R W; Leakey, J E

    1998-01-01

    It has been observed that susceptibility to many degenerative diseases increases concurrently with industrialization and rising living standards. Although epidemiologic studies suggest that specific environmental and dietary factors may be important, caloric intake alone (as reflected in body size) may account for much of the differential risk observed among diverse human populations. It has been suggested from animal studies that caloric intake may be the primary effector for many hormonal, metabolic, physiologic, and behavioral responses that coordinate reproductive strategy to apparent availability of food. When caloric intake is excessive, particularly at critical developmental stages, physiologic priorities are set for body growth and fecundity rather than for endurance and longevity. The converse occurs during periods of famine, thus increasing the probability that sufficient individuals survive to restore the population when conditions improve. Calorically restricted rodents have significantly longer reproductive and total life spans than their ad libitum-fed controls and exhibit a spectrum of biochemical and physiologic alterations that characterize their adaptation to reduced intake. These include reduced stature, hypercorticism in the absence of elevated adrenocorticotropic hormone levels, increased metabolic efficiency, decreased mitogenic response coupled with increased rates of apoptosis, reduced inflammatory response, induction of stress proteins and DNA repair enzymes, altered drug-metabolizing enzyme expression, and modified cell-mediated immune function. The overall profile of these changes is one of improved defense against environmental stress. This has been suggested as the mechanistic basis for the protective effects of low body weight on radiation and chemically induced cancers in experimental animals. It may also explain the significantly higher thresholds of acute toxicity observed when calorically restricted rodents are exposed to certain

  9. 9 CFR 309.2 - Livestock suspected of being diseased or affected with certain conditions; identifying suspects...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... affected with any disease or condition that, under part 311 of this subchapter, may cause condemnation of... disease or condition that, under part 311 of this subchapter would cause condemnation of only part of the... disease, shall be identified as U.S. Suspects and disposed of as provided in § 311.10 of this...

  10. Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes.

    PubMed

    Sobolev, Victor S; Guo, Baozhu Z; Holbrook, C Corley; Lynch, Robert E

    2007-03-21

    In peanuts, a mechanism of resistance to fungal infection is reportedly due to the synthesis of stilbene phytoalexins, which are antibiotic, low molecular weight metabolites. The phytoalexin-associated response of different peanut genotypes to exogenous invasion in the field has not been investigated and may be useful for breeding resistant peanut cultivars. Five peanut genotypes, Georgia Green, Tifton 8, C-99R, GK-7 High Oleic, and MARC I, which differ in resistance to major peanut diseases, were investigated for their ability to produce phytoalexins under field conditions in South Georgia in 2001 and 2002. Five known peanut phytoalexins, trans-resveratrol, trans-arachidin-1, trans-arachidin-2, trans-arachidin-3, and trans-3'-isopentadienyl-3,5,4'-trihydroxystilbene, were quantitated. The phytoalexins were measured in peanuts of different pod maturity (yellow, orange, brown, and black) with or without insect pod damage (externally scarified or penetrated). Kernels from insect-damaged pods of C-99R and Tifton 8 genotypes had significantly higher concentrations of phytoalexins than other genotypes. The same genotypes were the most resistant to tomato spotted wilt virus and late leaf spot, while MARC I, which is highly susceptible to these diseases, produced very low concentrations of phytoalexins. However, there was no significant difference in phytoalexin production by undamaged peanut pods of all tested genotypes. trans-Arachidin-3 and trans-resveratrol were the major phytoalexins produced by insect-damaged peanuts. In damaged seeds, the concentrations of trans-3'-isopentadienyl-3,5,4'-trihydroxystilbene were significantly higher in Tifton 8 as compared to other genotypes. There was an association between total phytoalexin production and published genotype resistance to major peanut diseases. Stilbene phytoalexins may be considered potential chemical markers in breeding programs for disease-resistant peanuts.

  11. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.

    PubMed

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A

    2015-12-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 <9 with an average of 7.29, which exceeded the Egyptian bread wheat cultivar Giza-168 (5.58). Thirty three RILs were included among the acceptable range having RRI value >2 <6. However, only 7 RILs showed RRI value <2. Five RILs expressed hypersensitive type of resistance (R) against the pathogen and showed the lowest Average Coefficient of Infection (ACI). Bulked segregant analysis (BSA) with eight simple sequence repeat (SSR), eight sequence-related amplified polymorphism (SRAP) and sixteen random amplified polymorphic DNA (RAPD) markers revealed that three SSR, three SRAP and six RAPD markers were found to be associated with the resistance to yellow rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  12. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate

    PubMed Central

    Mahmoud, Amer F.; Hassan, Mohamed I.; Amein, Karam A.

    2015-01-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 <9 with an average of 7.29, which exceeded the Egyptian bread wheat cultivar Giza-168 (5.58). Thirty three RILs were included among the acceptable range having RRI value >2 <6. However, only 7 RILs showed RRI value <2. Five RILs expressed hypersensitive type of resistance (R) against the pathogen and showed the lowest Average Coefficient of Infection (ACI). Bulked segregant analysis (BSA) with eight simple sequence repeat (SSR), eight sequence-related amplified polymorphism (SRAP) and sixteen random amplified polymorphic DNA (RAPD) markers revealed that three SSR, three SRAP and six RAPD markers were found to be associated with the resistance to yellow rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat. PMID:26674020

  13. Cats are not small dogs: is there an immunological explanation for why cats are less affected by arthropod-borne disease than dogs?

    PubMed

    Day, Michael J

    2016-09-20

    It is widely recognized that cats appear to be less frequently affected by arthropod-borne infectious diseases than dogs and share fewer zoonotic pathogens with man. This impression is supported by the relative lack of scientific publications related to feline vector-borne infections. This review explores the possible reasons for the difference between the two most common small companion animal species, including the hypothesis that cats might have a genetically-determined immunological resistance to arthropod vectors or the microparasites they transmit. A number of simple possibilities might account for the lower prevalence of these diseases in cats, including factors related to the lifestyle and behaviour of the cat, lesser spend on preventative healthcare for cats and reduced opportunities for research funding for these animals. The dog and cat have substantially similar immune system components, but differences in immune function might in part account for the markedly distinct prevalence and clinicopathological appearance of autoimmune, allergic, idiopathic inflammatory, immunodeficiency, neoplastic and infectious diseases in the two species. Cats have greater genetic diversity than dogs with much lower linkage disequilibrium in feline compared with canine breed groups. Immune function is intrinsically related to the nature of the intestinal microbiome and subtle differences between the canine and feline microbial populations might also impact on immune function and disease resistance. The reasons for the apparent lesser susceptibility of cats to arthropod-borne infectious diseases are likely to be complex, but warrant further investigation.

  14. Cats are not small dogs: is there an immunological explanation for why cats are less affected by arthropod-borne disease than dogs?

    PubMed

    Day, Michael J

    2016-01-01

    It is widely recognized that cats appear to be less frequently affected by arthropod-borne infectious diseases than dogs and share fewer zoonotic pathogens with man. This impression is supported by the relative lack of scientific publications related to feline vector-borne infections. This review explores the possible reasons for the difference between the two most common small companion animal species, including the hypothesis that cats might have a genetically-determined immunological resistance to arthropod vectors or the microparasites they transmit. A number of simple possibilities might account for the lower prevalence of these diseases in cats, including factors related to the lifestyle and behaviour of the cat, lesser spend on preventative healthcare for cats and reduced opportunities for research funding for these animals. The dog and cat have substantially similar immune system components, but differences in immune function might in part account for the markedly distinct prevalence and clinicopathological appearance of autoimmune, allergic, idiopathic inflammatory, immunodeficiency, neoplastic and infectious diseases in the two species. Cats have greater genetic diversity than dogs with much lower linkage disequilibrium in feline compared with canine breed groups. Immune function is intrinsically related to the nature of the intestinal microbiome and subtle differences between the canine and feline microbial populations might also impact on immune function and disease resistance. The reasons for the apparent lesser susceptibility of cats to arthropod-borne infectious diseases are likely to be complex, but warrant further investigation. PMID:27646278

  15. Overexpression of a Modified Plant Thionin Enhances Disease Resistance to Citrus Canker and Huanglongbing (HLB)

    PubMed Central

    Hao, Guixia; Stover, Ed; Gupta, Goutam

    2016-01-01

    Huanglongbing (HLB or citrus greening disease) caused by Candidatus Liberibacter asiaticus (Las) is a great threat to the US citrus industry. There are no proven strategies to eliminate HLB disease and no cultivar has been identified with strong HLB resistance. Citrus canker is also an economically important disease associated with a bacterial pathogen (Xanthomonas citri). In this study, we characterized endogenous citrus thionins and investigated their expression in different citrus tissues. Since no HLB-resistant citrus cultivars have been identified, we attempted to develop citrus resistant to both HLB and citrus canker through overexpression of a modified plant thionin. To improve effectiveness for disease resistance, we modified and synthesized the sequence encoding a plant thionin and cloned into the binary vector pBinPlus/ARS. The construct was then introduced into Agrobacterium strain EHA105 for citrus transformation. Transgenic Carrizo plants expressing the modified plant thionin were generated by Agrobacterium-mediated transformation. Successful transformation and transgene gene expression was confirmed by molecular analysis. Transgenic Carrizo plants expressing the modified thionin gene were challenged with X. citri 3213 at a range of concentrations, and a significant reduction in canker symptoms and a decrease in bacterial growth were demonstrated compared to nontransgenic plants. Furthermore, the transgenic citrus plants were challenged with HLB via graft inoculation. Our results showed significant Las titer reduction in roots of transgenic Carrizo compared with control plants and reduced scion Las titer 12 months after graft inoculation. These data provide promise for engineering citrus disease resistance against HLB and canker. PMID:27499757

  16. Overexpression of a Modified Plant Thionin Enhances Disease Resistance to Citrus Canker and Huanglongbing (HLB).

    PubMed

    Hao, Guixia; Stover, Ed; Gupta, Goutam

    2016-01-01

    Huanglongbing (HLB or citrus greening disease) caused by Candidatus Liberibacter asiaticus (Las) is a great threat to the US citrus industry. There are no proven strategies to eliminate HLB disease and no cultivar has been identified with strong HLB resistance. Citrus canker is also an economically important disease associated with a bacterial pathogen (Xanthomonas citri). In this study, we characterized endogenous citrus thionins and investigated their expression in different citrus tissues. Since no HLB-resistant citrus cultivars have been identified, we attempted to develop citrus resistant to both HLB and citrus canker through overexpression of a modified plant thionin. To improve effectiveness for disease resistance, we modified and synthesized the sequence encoding a plant thionin and cloned into the binary vector pBinPlus/ARS. The construct was then introduced into Agrobacterium strain EHA105 for citrus transformation. Transgenic Carrizo plants expressing the modified plant thionin were generated by Agrobacterium-mediated transformation. Successful transformation and transgene gene expression was confirmed by molecular analysis. Transgenic Carrizo plants expressing the modified thionin gene were challenged with X. citri 3213 at a range of concentrations, and a significant reduction in canker symptoms and a decrease in bacterial growth were demonstrated compared to nontransgenic plants. Furthermore, the transgenic citrus plants were challenged with HLB via graft inoculation. Our results showed significant Las titer reduction in roots of transgenic Carrizo compared with control plants and reduced scion Las titer 12 months after graft inoculation. These data provide promise for engineering citrus disease resistance against HLB and canker. PMID:27499757

  17. The Arabidopsis NPR1 gene confers broad-spectrum disease resistance in strawberry.

    PubMed

    Silva, Katchen Julliany P; Brunings, Asha; Peres, Natalia A; Mou, Zhonglin; Folta, Kevin M

    2015-08-01

    Although strawberry is an economically important fruit crop worldwide, production of strawberry is limited by its susceptibility to a wide range of pathogens and the lack of major commercial cultivars with high levels of resistance to multiple pathogens. The objective of this study is to ectopically express the Arabidopsis thaliana NPR1 gene (AtNPR1) in the diploid strawberry Fragaria vesca L. and to test transgenic plants for disease resistance. AtNPR1 is a key positive regulator of the long-lasting broad-spectrum resistance known as systemic acquired resistance (SAR) and has been shown to confer resistance to a number of pathogens when overexpressed in Arabidopsis or ectopically expressed in several crop species. We show that ectopic expression of AtNPR1 in strawberry increases resistance to anthracnose, powdery mildew, and angular leaf spot, which are caused by different fungal or bacterial pathogens. The increased resistance is related to the relative expression levels of AtNPR1 in the transgenic plants. In contrast to Arabidopsis plants overexpressing AtNPR1, which grow normally and do not constitutively express defense genes, the strawberry transgenic plants are shorter than non-transformed controls, and most of them fail to produce runners and fruits. Consistently, most of the transgenic lines constitutively express the defense gene FvPR5, suggesting that the SAR activation mechanisms in strawberry and Arabidopsis are different. Nevertheless, our results indicate that overexpression of AtNPR1 holds the potential for generation of broad-spectrum disease resistance in strawberry.

  18. The Arabidopsis NPR1 gene confers broad-spectrum disease resistance in strawberry.

    PubMed

    Silva, Katchen Julliany P; Brunings, Asha; Peres, Natalia A; Mou, Zhonglin; Folta, Kevin M

    2015-08-01

    Although strawberry is an economically important fruit crop worldwide, production of strawberry is limited by its susceptibility to a wide range of pathogens and the lack of major commercial cultivars with high levels of resistance to multiple pathogens. The objective of this study is to ectopically express the Arabidopsis thaliana NPR1 gene (AtNPR1) in the diploid strawberry Fragaria vesca L. and to test transgenic plants for disease resistance. AtNPR1 is a key positive regulator of the long-lasting broad-spectrum resistance known as systemic acquired resistance (SAR) and has been shown to confer resistance to a number of pathogens when overexpressed in Arabidopsis or ectopically expressed in several crop species. We show that ectopic expression of AtNPR1 in strawberry increases resistance to anthracnose, powdery mildew, and angular leaf spot, which are caused by different fungal or bacterial pathogens. The increased resistance is related to the relative expression levels of AtNPR1 in the transgenic plants. In contrast to Arabidopsis plants overexpressing AtNPR1, which grow normally and do not constitutively express defense genes, the strawberry transgenic plants are shorter than non-transformed controls, and most of them fail to produce runners and fruits. Consistently, most of the transgenic lines constitutively express the defense gene FvPR5, suggesting that the SAR activation mechanisms in strawberry and Arabidopsis are different. Nevertheless, our results indicate that overexpression of AtNPR1 holds the potential for generation of broad-spectrum disease resistance in strawberry. PMID:25812515

  19. Unraveling Genomic Complexity at a Quantitative Disease Resistance Locus in Maize

    PubMed Central

    Jamann, Tiffany M.; Poland, Jesse A.; Kolkman, Judith M.; Smith, Laurie G.; Nelson, Rebecca J.

    2014-01-01

    Multiple disease resistance has important implications for plant fitness, given the selection pressure that many pathogens exert directly on natural plant populations and indirectly via crop improvement programs. Evidence of a locus conditioning resistance to multiple pathogens was found in bin 1.06 of the maize genome with the allele from inbred line “Tx303” conditioning quantitative resistance to northern leaf blight (NLB) and qualitative resistance to Stewart’s wilt. To dissect the genetic basis of resistance in this region and to refine candidate gene hypotheses, we mapped resistance to the two diseases. Both resistance phenotypes were localized to overlapping regions, with the Stewart’s wilt interval refined to a 95.9-kb segment containing three genes and the NLB interval to a 3.60-Mb segment containing 117 genes. Regions of the introgression showed little to no recombination, suggesting structural differences between the inbred lines Tx303 and “B73,” the parents of the fine-mapping population. We examined copy number variation across the region using next-generation sequencing data, and found large variation in read depth in Tx303 across the region relative to the reference genome of B73. In the fine-mapping region, association mapping for NLB implicated candidate genes, including a putative zinc finger and pan1. We tested mutant alleles and found that pan1 is a susceptibility gene for NLB and Stewart’s wilt. Our data strongly suggest that structural variation plays an important role in resistance conditioned by this region, and pan1, a gene conditioning susceptibility for NLB, may underlie the QTL. PMID:25009146

  20. Markers of Bone Metabolism Are Affected by Renal Function and Growth Hormone Therapy in Children with Chronic Kidney Disease

    PubMed Central

    Doyon, Anke; Fischer, Dagmar-Christiane; Bayazit, Aysun Karabay; Canpolat, Nur; Duzova, Ali; Sözeri, Betül; Bacchetta, Justine; Balat, Ayse; Büscher, Anja; Candan, Cengiz; Cakar, Nilgun; Donmez, Osman; Dusek, Jiri; Heckel, Martina; Klaus, Günter; Mir, Sevgi; Özcelik, Gül; Sever, Lale; Shroff, Rukshana; Vidal, Enrico; Wühl, Elke; Gondan, Matthias; Melk, Anette; Querfeld, Uwe; Haffner, Dieter; Schaefer, Franz

    2015-01-01

    Objectives The extent and relevance of altered bone metabolism for statural growth in children with chronic kidney disease is controversial. We analyzed the impact of renal dysfunction and recombinant growth hormone therapy on a panel of serum markers of bone metabolism in a large pediatric chronic kidney disease cohort. Methods Bone alkaline phosphatase (BAP), tartrate-resistant acid phosphatase 5b (TRAP5b), sclerostin and C-terminal FGF-23 (cFGF23) normalized for age and sex were analyzed in 556 children aged 6–18 years with an estimated glomerular filtration rate (eGFR) of 10–60 ml/min/1.73m2. 41 children receiving recombinant growth hormone therapy were compared to an untreated matched control group. Results Standardized levels of BAP, TRAP5b and cFGF-23 were increased whereas sclerostin was reduced. BAP was correlated positively and cFGF-23 inversely with eGFR. Intact serum parathormone was an independent positive predictor of BAP and TRAP5b and negatively associated with sclerostin. BAP and TRAP5B were negatively affected by increased C-reactive protein levels. In children receiving recombinant growth hormone, BAP was higher and TRAP5b lower than in untreated controls. Sclerostin levels were in the normal range and higher than in untreated controls. Serum sclerostin and cFGF-23 independently predicted height standard deviation score, and BAP and TRAP5b the prospective change in height standard deviation score. Conclusion Markers of bone metabolism indicate a high-bone turnover state in children with chronic kidney disease. Growth hormone induces an osteoanabolic pattern and normalizes osteocyte activity. The osteocyte markers cFGF23 and sclerostin are associated with standardized height, and the markers of bone turnover predict height velocity. PMID:25659076

  1. Why is living fast dangerous? Disentangling the roles of resistance and tolerance of disease.

    PubMed

    Cronin, James P; Rúa, Megan A; Mitchell, Charles E

    2014-08-01

    Primary axes of host developmental tempo (HDT; e.g., slow-quick return continuum) represent latent biological processes and are increasingly used to a priori identify hosts that contribute disproportionately more to pathogen transmission. The influence of HDT on host contributions to transmission depends on how HDT influences both resistance and tolerance of disease. Here, we use structural equation modeling to address known limitations of conventional measures of resistance and tolerance. We first provide a general resistance-tolerance metamodel from which system-specific models can be derived. We then develop a model specific to a group of vector-transmitted viruses that infect hundreds of grass species worldwide. We tested the model using experimental inoculations of six phylogenetically paired grass species. We found that (1) host traits covaried according to a prominent HDT axis, the slow-quick continuum; (2) infection caused a greater reduction in the performance of quick returns, with >80% of that greater impact explained by lesser resistance; (3) resistance-tolerance trade-off did not occur; and (4) phylogenetic control was necessary to measure the slow-quick continuum, resistance, and tolerance. These results support the conclusion that HDT's main influence on host contributions to transmission is via resistance. More broadly, this study provides a framework for quantifying HDT's influence on host contributions to transmission.

  2. Why is living fast dangerous? Disentangling the roles of resistance and tolerance of disease.

    PubMed

    Cronin, James P; Rúa, Megan A; Mitchell, Charles E

    2014-08-01

    Primary axes of host developmental tempo (HDT; e.g., slow-quick return continuum) represent latent biological processes and are increasingly used to a priori identify hosts that contribute disproportionately more to pathogen transmission. The influence of HDT on host contributions to transmission depends on how HDT influences both resistance and tolerance of disease. Here, we use structural equation modeling to address known limitations of conventional measures of resistance and tolerance. We first provide a general resistance-tolerance metamodel from which system-specific models can be derived. We then develop a model specific to a group of vector-transmitted viruses that infect hundreds of grass species worldwide. We tested the model using experimental inoculations of six phylogenetically paired grass species. We found that (1) host traits covaried according to a prominent HDT axis, the slow-quick continuum; (2) infection caused a greater reduction in the performance of quick returns, with >80% of that greater impact explained by lesser resistance; (3) resistance-tolerance trade-off did not occur; and (4) phylogenetic control was necessary to measure the slow-quick continuum, resistance, and tolerance. These results support the conclusion that HDT's main influence on host contributions to transmission is via resistance. More broadly, this study provides a framework for quantifying HDT's influence on host contributions to transmission. PMID:25058278

  3. High prevalence of aspirin resistance in elderly patients with cardiovascular disease and metabolic syndrome

    PubMed Central

    Liu, Lin; Gao, Ying-Hui; Cao, Jian; Zhang, Hua-Xin; Fan, Li; Hu, Guo-Liang; Hu, Yi-Xin; Li, Xiao-Li; Zou, Xiao; Li, Jian-Hua

    2016-01-01

    Background Metabolic syndrome is known to be a prothrombotic state. We undertook this study to examine a hypothesis that aspirin resistance may be associated with metabolic syndrome, and to assess other potential determinants of aspirin resistance in patients with cardiovascular disease (CVD). Methods A total of 469 elderly patients with CVD were recruited. One hundred and seventy-two patients with metabolic syndrome and 297 without metabolic syndrome (control group) received daily aspirin therapy (≥ 75 mg) over one month. Platelet aggregation was measured by light transmission aggregometry (LTA). Aspirin resistance was defined as ≥ 20% arachidonic acid (AA)- and ≥ 70% adenosine diphosphate (ADP)-induced aggregation according to LTA. Aspirin semi-responders were defined as meeting one (but not both) of these criteria. Results By LTA, 38 of 469 (8.1%) patients were aspirin resistant. The prevalence of aspirin resistance was higher in the metabolic syndrome group compared with the control group [11.6 % vs. 6.6%, odds ratio (OR) = 2.039; 95% confidence interval (CI): 1.047–3.973]. In the multivariate logistic regression analysis, metabolic syndrome (OR = 4.951, 95% CI: 1.440–17.019, P = 0.011) was a significant risk factor for aspirin resistance. Conclusions A significant number of patients with CVD and metabolic syndrome are resistant to aspirin therapy. This might further increase the risk of cardiovascular morbidity and mortality in these patients. PMID:27582771

  4. Communal farmers' perceptions of tick-borne diseases affecting cattle and investigation of tick control methods practiced in Zimbabwe.

    PubMed

    Sungirai, Marvelous; Moyo, Doreen Zandile; De Clercq, Patrick; Madder, Maxime

    2016-02-01

    success of government initiated tick control programs and these included inconsistent supply of acaricides, unaffordable dipping fees, lack of water, long distance to the dip tank, lack of information on dipping procedures and lack of knowledge on strategies for delaying acaricide resistance. This study demonstrates that while farmers can be a valuable source of information with regards to the epidemiology of tick borne diseases affecting their cattle, there is still need for further training in understanding the TBDs and strategies for their control. PMID:26234572

  5. Communal farmers' perceptions of tick-borne diseases affecting cattle and investigation of tick control methods practiced in Zimbabwe.

    PubMed

    Sungirai, Marvelous; Moyo, Doreen Zandile; De Clercq, Patrick; Madder, Maxime

    2016-02-01

    success of government initiated tick control programs and these included inconsistent supply of acaricides, unaffordable dipping fees, lack of water, long distance to the dip tank, lack of information on dipping procedures and lack of knowledge on strategies for delaying acaricide resistance. This study demonstrates that while farmers can be a valuable source of information with regards to the epidemiology of tick borne diseases affecting their cattle, there is still need for further training in understanding the TBDs and strategies for their control.

  6. Enhanced disease resistance in transgenic carrot (Daucus carota L.) plants over-expressing a rice cationic peroxidase.

    PubMed

    Wally, O; Punja, Z K

    2010-10-01

    Plant class III peroxidases are involved in numerous responses related to pathogen resistance including controlling hydrogen peroxide (H(2)O(2)) levels and lignin formation. Peroxidases catalyze the oxidation of organic compounds using H(2)O(2) as an oxidant. We examined the mechanisms of disease resistance in a transgenic carrot line (P23) which constitutively over-expresses the rice cationic peroxidase OsPrx114 (previously known as PO-C1) and which exhibits enhanced resistance to necrotrophic foliar pathogens. OsPrx114 over-expression led to a slight enhancement of constitutive transcript levels of pathogenesis-related (PR) genes. These transcript levels were dramatically increased in line P23 compared to controls [GUS construct under the control of 35S promoter (35S::GUS)] when tissues were treated with cell wall fragments of the fungal pathogen Sclerotinia sclerotiorum (SS-walls), and to a lesser extent with 2,6-dichloroisonicotinic acid. There was no basal increase in basal H(2)O(2) levels in tissues of the line P23. However, during an oxidative burst response elicited by SS-walls, H(2)O(2) accumulation was reduced in line P23 despite, typical media alkalinization associated with oxidative burst responses was observed, suggesting that OsPrx114 was involved in rapid H(2)O(2) consumption during the oxidative burst response. Tap roots of line P23 had increased lignin formation in the outer periderm tissues, which was further increased during challenge inoculation with Alternaria radicina. Plant susceptibility to a biotrophic pathogen, Erysiphe heraclei, was not affected. Disease resistance to necrotrophic pathogens in carrot as a result of OsPrx114 over-expression is manifested through increased PR transcript accumulation, rapid removal of H(2)O(2) during oxidative burst response and enhanced lignin formation.

  7. Trade-offs in group living: transmission and disease resistance in leaf-cutting ants.

    PubMed Central

    Hughes, William O H; Eilenberg, Jørgen; Boomsma, Jacobus J

    2002-01-01

    Sociality can be associated with significant costs due to the increased risk of disease transmission. However, in some organisms the costs may be offset by benefits due to improvements in defences against parasites. To examine this possible trade-off between infection risk and disease resistance, we used Acromyrmex leaf-cutting ants and the entomopathogenic fungus Metarhizium anisopliae as the model system. Ants exposed to the parasite were found to have substantially improved survival when they were kept with nest-mates, while the cost of being in a group in terms of increased disease transmission was very low. The efficiency of transmission is described by the transmission parameter, which decreased with increasing host density showing that transmission rates are inversely density dependent. Both grooming and antibiotic secretions appeared to be important in resistance against the parasite, with the defences of small workers being particularly effective. The results indicate that leaf-cutting ant colonies may have much greater resistance to disease than would be predicted from the high densities of host individuals within them. Unlike most organisms, group living in these ants may actually be associated with a net benefit in terms of disease dynamics. PMID:12350269

  8. Antibiotic resistance as collateral damage: the tragedy of the commons in a two-disease setting.

    PubMed

    Gao, Daozhou; Lietman, Thomas M; Porco, Travis C

    2015-05-01

    We propose a simple two-disease epidemic model where one disease exhibits only a drug-sensitive strain, while the other exhibits both drug-sensitive and drug-resistant strains. Treatment for the first disease may select for resistance in the other. We model antibiotic use as a mathematical game through the study of individual incentives and community welfare. The basic reproduction number is derived and the existence and local stability of the model equilibria are analyzed. When the force of infection of each disease is unaffected by the presence of the other, we find that there is a conflict of interest between individual and community, known as a tragedy of the commons, under targeted treatment toward persons infected by the single strain disease, but there is no conflict under mass treatment. However, we numerically show that individual and social incentive to use antibiotics may show disaccord under mass treatment if the restriction on the transmission ability of the dually infected people is removed, or drug resistant infection is worse than drug sensitive infection, or the uninfected state has a comparative disutility over the infected states. PMID:25726716

  9. Antibiotic resistance as collateral damage: the tragedy of the commons in a two-disease setting.

    PubMed

    Gao, Daozhou; Lietman, Thomas M; Porco, Travis C

    2015-05-01

    We propose a simple two-disease epidemic model where one disease exhibits only a drug-sensitive strain, while the other exhibits both drug-sensitive and drug-resistant strains. Treatment for the first disease may select for resistance in the other. We model antibiotic use as a mathematical game through the study of individual incentives and community welfare. The basic reproduction number is derived and the existence and local stability of the model equilibria are analyzed. When the force of infection of each disease is unaffected by the presence of the other, we find that there is a conflict of interest between individual and community, known as a tragedy of the commons, under targeted treatment toward persons infected by the single strain disease, but there is no conflict under mass treatment. However, we numerically show that individual and social incentive to use antibiotics may show disaccord under mass treatment if the restriction on the transmission ability of the dually infected people is removed, or drug resistant infection is worse than drug sensitive infection, or the uninfected state has a comparative disutility over the infected states.

  10. The translational machinery is an optimized molecular network that affects cellular homoeostasis and disease.

    PubMed

    Kazana, Eleanna; von der Haar, Tobias

    2014-02-01

    Translation involves interactions between mRNAs, ribosomes, tRNAs and a host of translation factors. Emerging evidence on the eukaryotic translational machinery indicates that these factors are organized in a highly optimized network, in which the levels of the different factors are finely matched to each other. This optimal factor network is essential for producing proteomes that result in optimal fitness, and perturbations to the optimal network that significantly affect translational activity therefore result in non-optimal proteomes, fitness losses and disease. On the other hand, experimental evidence indicates that translation and cell growth are relatively robust to perturbations, and viability can be maintained even upon significant damage to individual translation factors. How the eukaryotic translational machinery is optimized, and how it can maintain optimization in the face of changing internal parameters, are open questions relevant to the interaction between translation and cellular disease states.

  11. Skewed X-chromosome inactivation in women affected by Alzheimer's disease.

    PubMed

    Bajic, Vladan; Mandusic, Vesna; Stefanova, Elka; Bozovic, Ana; Davidovic, Radoslav; Zivkovic, Lada; Cabarkapa, Andrea; Spremo-Potparevic, Biljana

    2015-01-01

    X-chromosome instability has been a long established feature in Alzheimer's disease (AD). Premature centromere division and aneuploidy of the X-chromosome has been found in peripheral blood lymphocytes and neuronal tissue in female AD patients. Interestingly, only one chromosome of the X pair has been affected. These results raised a question, "Is the X-chromosome inactivation pattern altered in peripheral blood lymphocytes of women affected by AD?" To address this question, we analyzed the methylation status of androgen receptor promoter which may show us any deviation from the 50 : 50% X inactivation status in peripheral blood lymphocytes of women with AD. Our results showed skewed inactivation patterns (>90%). These findings suggest that an epigenetic alteration on the inactivation centers of the X-chromosome (or skewing) relates not only to aging, by might be a novel property that could account for the higher incidence of AD in women. PMID:25159673

  12. Functional investigation of a QTL affecting resistance to Haemonchus contortus in sheep

    PubMed Central

    2014-01-01

    This study reports a functional characterization of a limited segment (QTL) of sheep chromosome 12 associated with resistance to the abomasal nematode Haemonchus contortus. The first objective was to validate the identified QTL through the comparison of genetically susceptible (N) and resistant (R) sheep produced from Martinik × Romane back-cross sheep. The R and N genotype groups were then experimentally infected with 10 000 H. contortus larvae and measured for FEC (every three days from 18 to 30 days post-challenge), haematocrit, worm burden and fertility. Significant differences in FEC and haematocrit drop were found between R and N sheep. In addition, the female worms recovered from R sheep were less fecund. The second step of the characterization was to investigate functional mechanisms associated with the QTL, thanks to a gene expression analysis performed on the abomasal mucosa and the abomasal lymph node. The gene expression level of a candidate gene lying within the QTL region (PAPP-A2) was measured. In addition, putative interactions between the chromosome segment under study and the top ten differentially expressed genes between resistant MBB and susceptible RMN sheep highlighted in a previous microarray experiment were investigated. We found an induction of Th-2 related cytokine genes expression in the abomasal mucosa of R sheep. Down-regulation of the PAPP-A2 gene expression was observed between naïve and challenged sheep although no differential expression was recorded between challenged R and N sheep. The genotyping of this limited region should contribute to the ability to predict the intrinsic resistance level of sheep. PMID:24939584

  13. Dietary magnesium and copper affect survival time and neuroinflammation in chronic wasting disease.

    PubMed

    Nichols, Tracy A; Spraker, Terry R; Gidlewski, Thomas; Cummings, Bruce; Hill, Dana; Kong, Qingzhong; Balachandran, Aru; VerCauteren, Kurt C; Zabel, Mark D

    2016-05-01

    Chronic wasting disease (CWD), the only known wildlife prion disease, affects deer, elk and moose. The disease is an ongoing and expanding problem in both wild and captive North American cervid populations and is difficult to control in part due to the extreme environmental persistence of prions, which can transmit disease years after initial contamination. The role of exogenous factors in CWD transmission and progression is largely unexplored. In an effort to understand the influence of environmental and dietary constituents on CWD, we collected and analyzed water and soil samples from CWD-negative and positive captive cervid facilities, as well as from wild CWD-endozootic areas. Our analysis revealed that, when compared with CWD-positive sites, CWD-negative sites had a significantly higher concentration of magnesium, and a higher magnesium/copper (Mg/Cu) ratio in the water than that from CWD-positive sites. When cevidized transgenic mice were fed a custom diet devoid of Mg and Cu and drinking water with varied Mg/Cu ratios, we found that higher Mg/Cu ratio resulted in significantly longer survival times after intracerebral CWD inoculation. We also detected reduced levels of inflammatory cytokine gene expression in mice fed a modified diet with a higher Mg/Cu ratio compared to those on a standard rodent diet. These findings indicate a role for dietary Mg and Cu in CWD pathogenesis through modulating inflammation in the brain.

  14. Dietary magnesium and copper affect survival time and neuroinflammation in chronic wasting disease

    PubMed Central

    Nichols, Tracy A.; Spraker, Terry R.; Gidlewski, Thomas; Cummings, Bruce; Hill, Dana; Kong, Qingzhong; Balachandran, Aru; VerCauteren, Kurt C.; Zabel, Mark D.

    2016-01-01

    ABSTRACT Chronic wasting disease (CWD), the only known wildlife prion disease, affects deer, elk and moose. The disease is an ongoing and expanding problem in both wild and captive North American cervid populations and is difficult to control in part due to the extreme environmental persistence of prions, which can transmit disease years after initial contamination. The role of exogenous factors in CWD transmission and progression is largely unexplored. In an effort to understand the influence of environmental and dietary constituents on CWD, we collected and analyzed water and soil samples from CWD-negative and positive captive cervid facilities, as well as from wild CWD-endozootic areas. Our analysis revealed that, when compared with CWD-positive sites, CWD-negative sites had a significantly higher concentration of magnesium, and a higher magnesium/copper (Mg/Cu) ratio in the water than that from CWD-positive sites. When cevidized transgenic mice were fed a custom diet devoid of Mg and Cu and drinking water with varied Mg/Cu ratios, we found that higher Mg/Cu ratio resulted in significantly longer survival times after intracerebral CWD inoculation. We also detected reduced levels of inflammatory cytokine gene expression in mice fed a modified diet with a higher Mg/Cu ratio compared to those on a standard rodent diet. These findings indicate a role for dietary Mg and Cu in CWD pathogenesis through modulating inflammation in the brain. PMID:27216881

  15. Dietary magnesium and copper affect survival time and neuroinflammation in chronic wasting disease.

    PubMed

    Nichols, Tracy A; Spraker, Terry R; Gidlewski, Thomas; Cummings, Bruce; Hill, Dana; Kong, Qingzhong; Balachandran, Aru; VerCauteren, Kurt C; Zabel, Mark D

    2016-05-01

    Chronic wasting disease (CWD), the only known wildlife prion disease, affects deer, elk and moose. The disease is an ongoing and expanding problem in both wild and captive North American cervid populations and is difficult to control in part due to the extreme environmental persistence of prions, which can transmit disease years after initial contamination. The role of exogenous factors in CWD transmission and progression is largely unexplored. In an effort to understand the influence of environmental and dietary constituents on CWD, we collected and analyzed water and soil samples from CWD-negative and positive captive cervid facilities, as well as from wild CWD-endozootic areas. Our analysis revealed that, when compared with CWD-positive sites, CWD-negative sites had a significantly higher concentration of magnesium, and a higher magnesium/copper (Mg/Cu) ratio in the water than that from CWD-positive sites. When cevidized transgenic mice were fed a custom diet devoid of Mg and Cu and drinking water with varied Mg/Cu ratios, we found that higher Mg/Cu ratio resulted in significantly longer survival times after intracerebral CWD inoculation. We also detected reduced levels of inflammatory cytokine gene expression in mice fed a modified diet with a higher Mg/Cu ratio compared to those on a standard rodent diet. These findings indicate a role for dietary Mg and Cu in CWD pathogenesis through modulating inflammation in the brain. PMID:27216881

  16. Six-Digit CPK and Mildly Affected Renal Function in McArdle Disease

    PubMed Central

    Mcinnes, Andrew D.; DeGroote, Richard J.

    2014-01-01

    A previously healthy, white 12-year-old girl presented with diffuse body aches and poor perfusion. She developed severe respiratory failure and marked rhabdomyolysis and was mechanically ventilated. Although her CPK peaked at 500,000 IU/L, her renal function was mildly affected and her creatinine did not exceed the 0.8 mg/dL. The rhabdomyolysis was gradually resolved following aggressive fluid hydration. The patient did not require dialysis and made a complete recovery. Genetic studies revealed the diagnosis of McArdle disease. PMID:25371840

  17. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  18. Strengths amidst vulnerabilities: the paradox of resistance in a mining-affected community in Guatemala.

    PubMed

    Caxaj, C Susana; Berman, Helene; Ray, Susan L; Restoule, Jean-Paul; Varcoe, Coleen

    2014-11-01

    The influence of large-scale mining on the psychosocial wellbeing and mental health of diverse Indigenous communities has attracted increased attention. In previous reports, we have discussed the influence of a gold mining operation on the health of a community in the Western highlands of Guatemala. Here, we discuss the community strengths, and acts of resistance of this community, that is, community processes that promoted mental health amidst this context. Using an anti-colonial narrative methodology that incorporated participatory action research principles, we developed a research design in collaboration with community leaders and participants. Data collection involved focus groups, individual interviews and photo-sharing with 54 men and women between the ages of 18 and 67. Data analysis was guided by iterative and ongoing conversations with participants and McCormack's narrative lenses. Study findings revealed key mechanisms and sources of resistance, including a shared cultural identity, a spiritual knowing and being, 'defending our rights, defending our territory,' and, speaking truth to power. These overlapping strengths were identified by participants as key protective factors in facing challenges and adversity. Yet ultimately, these same strengths were often the most eroded or endangered due the influence of large-scale mining operations in the region. These community strengths and acts of resistance reveal important priorities for promoting mental health and wellbeing for populations impacted by large-scale mining operations. Mental health practitioners must attend to both the strengths and parallel vulnerabilities that may be occasioned by large-scale projects of this nature.

  19. Immunomodulation and disease resistance in postyearling rainbow trout infected with Myxobolus cerebralis, the causative agent of whirling disease

    USGS Publications Warehouse

    Densmore, Christine L.; Ottinger, C.A.; Blazer, V.S.; Iwanowicz, L.R.; Smith, D.R.

    2004-01-01

    Myxobolus cerebralis, the myxosporean parasite that causes whirling disease, has a number of deleterious effects on its salmonid host. Although it is well established that juvenile salmonids in the active stages of whirling disease mount an immune response to the pathogen, the occurrence and longevity of any related immunomodulatory effects are unknown. In this study, postyearling rainbow trout Oncorhynchus mykiss infected with M. cerebralis were examined for leukocyte functions and for resistance to Yersinia ruckeri, a bacterial pathogen of salmonids. Compared with uninfected controls, M. cerebralis-infected fish showed lower proliferative lymphocyte responses to four mitogens (concanavalin A, pokeweed mitogen, phytohemagglutinin, and lipopolysaccharide). Conversely, M. cerebralis-infected fish displayed greater bactericidal activity of anterior kidney macrophages than did uninfected fish. After bath challenges with K. ruckeri, M. cerebralis-infected fish had slightly lower survival and a more rapid onset of mortality than did the control fish. Renal tissue and fecal samples from M. cerebralis-infected and uninfected survivors were cultured for the presence of K. ruckeri, and no difference in prevalence was noted between the two groups. Because immunomodulatory changes in the M. cerebralis-infected fish involved functional enhancement and suppression of different leukocyte populations, disease resistance among M. cerebralis-infected fish in the later stages of whirling disease will probably vary with the secondary pathogen and the nature of immune response the pathogen evokes.

  20. CFH Variants Affect Structural and Functional Brain Changes and Genetic Risk of Alzheimer's Disease.

    PubMed

    Zhang, Deng-Feng; Li, Jin; Wu, Huan; Cui, Yue; Bi, Rui; Zhou, He-Jiang; Wang, Hui-Zhen; Zhang, Chen; Wang, Dong; Kong, Qing-Peng; Li, Tao; Fang, Yiru; Jiang, Tianzi; Yao, Yong-Gang

    2016-03-01

    The immune response is highly active in Alzheimer's disease (AD). Identification of genetic risk contributed by immune genes to AD may provide essential insight for the prognosis, diagnosis, and treatment of this neurodegenerative disease. In this study, we performed a genetic screening for AD-related top immune genes identified in Europeans in a Chinese cohort, followed by a multiple-stage study focusing on Complement Factor H (CFH) gene. Effects of the risk SNPs on AD-related neuroimaging endophenotypes were evaluated through magnetic resonance imaging scan, and the effects on AD cerebrospinal fluid biomarkers (CSF) and CFH expression changes were measured in aged and AD brain tissues and AD cellular models. Our results showed that the AD-associated top immune genes reported in Europeans (CR1, CD33, CLU, and TREML2) have weak effects in Chinese, whereas CFH showed strong effects. In particular, rs1061170 (P(meta)=5.0 × 10(-4)) and rs800292 (P(meta)=1.3 × 10(-5)) showed robust associations with AD, which were confirmed in multiple world-wide sample sets (4317 cases and 16 795 controls). Rs1061170 (P=2.5 × 10(-3)) and rs800292 (P=4.7 × 10(-4)) risk-allele carriers have an increased entorhinal thickness in their young age and a higher atrophy rate as the disease progresses. Rs800292 risk-allele carriers have higher CSF tau and Aβ levels and severe cognitive decline. CFH expression level, which was affected by the risk-alleles, was increased in AD brains and cellular models. These comprehensive analyses suggested that CFH is an important immune factor in AD and affects multiple pathological changes in early life and during disease progress.

  1. CFH Variants Affect Structural and Functional Brain Changes and Genetic Risk of Alzheimer's Disease.

    PubMed

    Zhang, Deng-Feng; Li, Jin; Wu, Huan; Cui, Yue; Bi, Rui; Zhou, He-Jiang; Wang, Hui-Zhen; Zhang, Chen; Wang, Dong; Kong, Qing-Peng; Li, Tao; Fang, Yiru; Jiang, Tianzi; Yao, Yong-Gang

    2016-03-01

    The immune response is highly active in Alzheimer's disease (AD). Identification of genetic risk contributed by immune genes to AD may provide essential insight for the prognosis, diagnosis, and treatment of this neurodegenerative disease. In this study, we performed a genetic screening for AD-related top immune genes identified in Europeans in a Chinese cohort, followed by a multiple-stage study focusing on Complement Factor H (CFH) gene. Effects of the risk SNPs on AD-related neuroimaging endophenotypes were evaluated through magnetic resonance imaging scan, and the effects on AD cerebrospinal fluid biomarkers (CSF) and CFH expression changes were measured in aged and AD brain tissues and AD cellular models. Our results showed that the AD-associated top immune genes reported in Europeans (CR1, CD33, CLU, and TREML2) have weak effects in Chinese, whereas CFH showed strong effects. In particular, rs1061170 (P(meta)=5.0 × 10(-4)) and rs800292 (P(meta)=1.3 × 10(-5)) showed robust associations with AD, which were confirmed in multiple world-wide sample sets (4317 cases and 16 795 controls). Rs1061170 (P=2.5 × 10(-3)) and rs800292 (P=4.7 × 10(-4)) risk-allele carriers have an increased entorhinal thickness in their young age and a higher atrophy rate as the disease progresses. Rs800292 risk-allele carriers have higher CSF tau and Aβ levels and severe cognitive decline. CFH expression level, which was affected by the risk-alleles, was increased in AD brains and cellular models. These comprehensive analyses suggested that CFH is an important immune factor in AD and affects multiple pathological changes in early life and during disease progress. PMID:26243271

  2. Proteomic Profiling in the Brain of CLN1 Disease Model Reveals Affected Functional Modules.

    PubMed

    Tikka, Saara; Monogioudi, Evanthia; Gotsopoulos, Athanasios; Soliymani, Rabah; Pezzini, Francesco; Scifo, Enzo; Uusi-Rauva, Kristiina; Tyynelä, Jaana; Baumann, Marc; Jalanko, Anu; Simonati, Alessandro; Lalowski, Maciej

    2016-03-01

    Neuronal ceroid lipofuscinoses (NCL) are the most commonly inherited progressive encephalopathies of childhood. Pathologically, they are characterized by endolysosomal storage with different ultrastructural features and biochemical compositions. The molecular mechanisms causing progressive neurodegeneration and common molecular pathways linking expression of different NCL genes are largely unknown. We analyzed proteome alterations in the brains of a mouse model of human infantile CLN1 disease-palmitoyl-protein thioesterase 1 (Ppt1) gene knockout and its wild-type age-matched counterpart at different stages: pre-symptomatic, symptomatic and advanced. For this purpose, we utilized a combination of laser capture microdissection-based quantitative liquid chromatography tandem mass spectrometry (MS) and matrix-assisted laser desorption/ionization time-of-flight MS imaging to quantify/visualize the changes in protein expression in disease-affected brain thalamus and cerebral cortex tissue slices, respectively. Proteomic profiling of the pre-symptomatic stage thalamus revealed alterations mostly in metabolic processes and inhibition of various neuronal functions, i.e., neuritogenesis. Down-regulation in dynamics associated with growth of plasma projections and cellular protrusions was further corroborated by findings from RNA sequencing of CLN1 patients' fibroblasts. Changes detected at the symptomatic stage included: mitochondrial functions, synaptic vesicle transport, myelin proteome and signaling cascades, such as RhoA signaling. Considerable dysregulation of processes related to mitochondrial cell death, RhoA/Huntington's disease signaling and myelin sheath breakdown were observed at the advanced stage of the disease. The identified changes in protein levels were further substantiated by bioinformatics and network approaches, immunohistochemistry on brain tissues and literature knowledge, thus identifying various functional modules affected in the CLN1 childhood

  3. Lifestyle-Related Diseases Affect Surgical Outcomes after Posterior Lumbar Interbody Fusion.

    PubMed

    Sakaura, Hironobu; Miwa, Toshitada; Yamashita, Tomoya; Kuroda, Yusuke; Ohwada, Tetsuo

    2016-02-01

    Study Design Retrospective study. Objective Hyperlipidemia (HL) and hypertension (HT) lead to systemic atherosclerosis. Not only atherosclerosis but also bone fragility and/or low bone mineral density result from diabetes mellitus (DM) and chronic kidney disease (CKD). The purpose of this study was to examine whether these lifestyle-related diseases affected surgical outcomes after posterior lumbar interbody fusion (PLIF). Methods The subjects comprised 122 consecutive patients who underwent single-level PLIF for degenerative lumbar spinal disorders. The clinical results were assessed using the Japanese Orthopaedic Association (JOA) score before surgery and at 2 years postoperatively. The fusion status was graded as union in situ, collapsed union, or nonunion at 2 years after surgery. The abdominal aorta calcification (AAC) score was assessed using preoperative lateral radiographs of the lumbar spine. Results HL did not significantly affect the JOA score recovery rate. On the other hand, HT and CKD (stage 3 to 4) had a significant adverse effect on the recovery rate. The recovery rate was also lower in the DM group than in the non-DM group, but the difference was not significant. The AAC score was negatively correlated with the JOA score recovery rate. The fusion status was not significantly affected by HL, HT, DM, or CKD; however, the AAC score was significantly higher in the collapsed union and nonunion group than in the union in situ group. Conclusions At 2 years after PLIF, the presence of HT, CKD, and AAC was associated with significantly worse clinical outcomes, and advanced AAC significantly affected fusion status. PMID:26835195

  4. Emotion Risk-Factor in Patients With Cardiac Diseases: The Role of Cognitive Emotion Regulation Strategies, Positive Affect and Negative Affect (A Case-Control Study)

    PubMed Central

    Bahremand, Mostafa; Alikhani, Mostafa; Zakiei, Ali; Janjani, Parisa; Aghaei, Abbas

    2016-01-01

    Application of psychological interventions is essential in classic treatments for patient with cardiac diseases. The present study compared cognitive emotion regulation strategies, positive affect, and negative affect for cardiac patients with healthy subjects. This study was a case-control study. Fifty subjects were selected using convenient sampling method from cardiac (coronary artery disease) patients presenting in Imam Ali medical center of Kermanshah, Iran in the spring 2013. Fifty subjects accompanied the patients to the medical center, selected as control group, did not have any history of cardiac diseases. For collecting data, the cognitive emotion regulation questionnaire and positive and negative affect scales were used. For data analysis, multivariate analysis of variance (MANOVA) was applied using the SPSS statistical software (ver. 19.0). In all cognitive emotion regulation strategies, there was a significant difference between the two groups. A significant difference was also detected regarding positive affect between the two groups, but no significant difference was found regarding negative affect. We found as a result that, having poor emotion regulation strategies is a risk factor for developing heart diseases. PMID:26234976

  5. Emotion Risk-Factor in Patients with Cardiac Diseases: The Role of Cognitive Emotion Regulation Strategies, Positive Affect and Negative Affect (A Case-Control Study).

    PubMed

    Bahremand, Mostafa; Alikhani, Mostafa; Zakiei, Ali; Janjani, Parisa; Aghei, Abbas

    2015-05-17

    Application of psychological interventions is essential in classic treatments for patient with cardiac diseases. The present study compared cognitive emotion regulation strategies, positive affect, and negative affect for cardiac patients with healthy subjects. This study was a case-control study. Fifty subjects were selected using convenient sampling method from cardiac (coronary artery disease) patients presenting in Imam Ali medical center of Kermanshah, Iran in the spring 2013. Fifty subjects accompanied the patients to the medical center, selected as control group, did not have any history of cardiac diseases. For collecting data, the cognitive emotion regulation questionnaire and positive and negative affect scales were used. For data analysis, multivariate analysis of variance (MANOVA) Was applied using the SPSS statistical software (ver. 19.0). In all cognitive emotion regulation strategies, there was a significant difference between the two groups. A significant difference was also detected regarding positive affect between the two groups, but no significant difference was found regarding negative affect. We found as a result that, having poor emotion regulation strategies is a risk factor for developing heart diseases.

  6. Accuracy of genome-wide evaluation for disease resistance in aquaculture breeding programs.

    PubMed

    Villanueva, B; Fernández, J; García-Cortés, L A; Varona, L; Daetwyler, H D; Toro, M A

    2011-11-01

    Current aquaculture breeding programs aimed at improving resistance to diseases are based on challenge tests, where performance is recorded on sibs of candidates to selection, and on selection between families. Genome-wide evaluation (GWE) of breeding values offers new opportunities for using variation within families when dealing with such traits. However, up-to-date studies on GWE in aquaculture programs have only considered continuous traits. The objectives of this study were to extend GWE methodology, in particular the Bayes B method, to analyze dichotomous traits such as resistance to disease, and to quantify, through computer simulation, the accuracy of GWE for disease resistance in aquaculture sib-based programs, using the methodology developed. Two heritabilities (0.1 and 0.3) and 2 disease prevalences (0.1 and 0.5) were assumed in the simulations. We followed the threshold liability model, which assumes that there is an underlying variable (liability) with a continuous distribution and assumed a BayesB model for the liabilities. It was shown that the threshold liability model used fits very well with the BayesB model of GWE. The advantage of using the threshold model was clear when dealing with disease resistance dichotomous phenotypes, particularly under the conditions where linear models are less appropriate (low heritability and disease prevalence). In the testing set (where individuals are genotyped but not measured), the increase in accuracy for the simulated schemes when using the threshold model ranged from 4 (for heritability equal to 0.3 and prevalence equal to 0.5) to 16% (for heritability and prevalence equal to 0.1) when compared with the linear model.

  7. Alterations in lignin content and phenylpropanoids pathway in date palm (Phoenix dactylifera L.) tissues affected by brittle leaf disease.

    PubMed

    Saidi, Mohammed Najib; Bouaziz, Donia; Hammami, Ines; Namsi, Ahmed; Drira, Noureddine; Gargouri-Bouzid, Radhia

    2013-10-01

    Brittle leaf disease or Maladie de la Feuille Cassante (MFC) is a lethal disorder of date palm that has assumed epidemic proportions in the oases of Tunisia and Algeria. No pathogen could ever be associated with the disease, while leaflets of affected palms have been previously shown to be deficient in manganese. The work reported here aims to understand the biochemical basis of the date palm response to this disorder. Since the typical disease symptom is the leaf fragility, we have investigated lignin content in leaves and roots. Strong decrease in total lignin content was observed in affected leaves, while lignin content increased in affected roots. Histochemical analyses showed hyperlignification thicker suberin layer in roots cortical cells. The phenylpropanoids pathway was also disrupted in leaves and roots, cinnamoyl-CoA reductase and cinnamyl-alcohol dehydrogenase gene expression was affected by the disease which severely affects the cell wall integrity. PMID:23987806

  8. Resistance to mycoplasmal lung disease in mice is a complex genetic trait.

    PubMed Central

    Cartner, S C; Simecka, J W; Briles, D E; Cassell, G H; Lindsey, J R

    1996-01-01

    Mouse strains differ markedly in resistance to Mycoplasma pulmonis infection, and investigation of these differences holds much promise for understanding the mechanisms of antimycoplasmal host defenses. To determine the potential genetic diversity of resistance to disease in murine respiratory mycoplasmosis (MRM) and to select disease-resistant and nonresistant mouse strains for further genetic analysis, we screened 17 inbred mouse strains of various Bcg and H-2 genotypes for resistance to M. pulmonis. Mice were inoculated intranasally with 10(4) CFU of M. pulmonis UAB CT and evaluated at 21 days postinfection for severities of the four histologic lung lesions characteristic of MRM: alveolar exudate, airway exudate, airway epithelial hyperplasia, and lymphoid infiltrate. On the basis of these assessments of MRM severity, one group of mouse strains was found to be extremely resistant to disease (C57BR/cdJ, C57BL/6NCr, C57BL/10ScNCr, and C57BL/6J). The remaining strains of mice (C57L/J, SJL/NCr, BALB/cAnNCr, A/JCr, C3H/HeJ, SWR/J, AKR/NCr, CBA/NCr, C58/J, DBA/2NCr, C3H/HeNCr, C3HeB/FeJ, and C3H/HeJCr) developed disease of widely varying severities. Furthermore, strains in the group with more disease varied in pattern of lesion severity. While the severities of all four lesions were correlated in most mouse strains, this was not always true. DBA/2NCr mice had one of the highest scores for alveolar exudate, only a moderate score for airway exudate, and significantly lower scores for both airway epithelial hyperplasia and lymphoid infiltrate than all other strains susceptible to lung disease. DBA/2NCr mice had one of the highest mortality rates. We concluded that resistance to MRM is a complex trait. The observed differences in lung disease severity could not be explained by known differences at the Bcg or H-2 locus in the strains of mice we studied. PMID:8945584

  9. Cyclic nucleotide gated channel gene family in tomato: genome-wide identification and functional analyses in disease resistance

    PubMed Central

    Saand, Mumtaz A.; Xu, You-Ping; Li, Wen; Wang, Ji-Peng; Cai, Xin-Zhong

    2015-01-01

    The cyclic nucleotide gated channel (CNGC) is suggested to be one of the important calcium conducting channels. Nevertheless, genome-wide identification and systemic functional analysis of CNGC gene family in crop plant species have not yet been conducted. In this study, we performed genome-wide identification of CNGC gene family in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of the group IVb SlCNGC genes in disease resistance. Eighteen CNGC genes were identified in tomato genome, and four CNGC loci that were misannotated at database were corrected by cloning and sequencing. Detailed bioinformatics analyses on gene structure, domain composition and phylogenetic relationship of the SlCNGC gene family were conducted and the group-specific feature was revealed. Comprehensive expression analyses demonstrated that SlCNGC genes were highly, widely but differently responsive to diverse stimuli. Pharmacological assays showed that the putative CNGC activators cGMP and cAMP enhanced resistance against Sclerotinia sclerotiorum. Silencing of group IVb SlCNGC genes significantly enhanced resistance to fungal pathogens Pythium aphanidermatum and S. sclerotiorum, strongly reduced resistance to viral pathogen Tobacco rattle virus, while attenuated PAMP- and DAMP-triggered immunity as shown by obvious decrease of the flg22- and AtPep1-elicited hydrogen peroxide accumulation in SlCNGC-silenced plants. Additionally, silencing of these SlCNGC genes significantly altered expression of a set of Ca2+ signaling genes including SlCaMs, SlCDPKs, and SlCAMTA3. Collectively, our results reveal that group IV SlCNGC genes regulate a wide range of resistance in tomato probably by affecting Ca2+ signaling. PMID:25999969

  10. Self-selected intensity, ratings of perceived exertion, and affective responses in sedentary male subjects during resistance training

    PubMed Central

    Elsangedy, Hassan Mohamed; Krinski, Kleverton; Machado, Daniel Gomes da Silva; Agrícola, Pedro Moraes Dutra; Okano, Alexandre Hideki; Gregório da Silva, Sergio

    2016-01-01

    [Purpose] This study examined the exercise intensity and psychophysiological responses to a self-selected resistance training session in sedentary male subjects. [Subjects and Methods] Twelve sedentary male subjects (35.8 ± 5.8 years; 25.5 ± 2.6 kg·m2) underwent four sessions at 48-h intervals: familiarization; two sessions of one repetition maximum test and a resistance training session in which they were told to self-select a load to complete 3 sets of 10 repetitions of chest press, leg press, seated rows, knee extension, overhead press, biceps curl, and triceps pushdown exercises. During the latter, the percentage of one repetition maximum, affective responses (feeling scale), and rating of perceived exertion (OMNI-RES scale) were measured. [Results] The percentage of one repetition maximum for all exercises was >51% (14–31% variability), the rating of perceived exertion was 5–6 (7–11% variability), and the affective responses was 0–1 point with large variability. [Conclusion] Sedentary male subjects self-selected approximately 55% of one maximum repetition, which was above the intensity suggested to increase strength in sedentary individuals, but below the recommended intensity to improve strength in novice to intermediate exercisers. The rating of perceived exertion was indicative of moderate intensity and slightly positive affective responses. PMID:27390418

  11. Self-selected intensity, ratings of perceived exertion, and affective responses in sedentary male subjects during resistance training.

    PubMed

    Elsangedy, Hassan Mohamed; Krinski, Kleverton; Machado, Daniel Gomes da Silva; Agrícola, Pedro Moraes Dutra; Okano, Alexandre Hideki; Gregório da Silva, Sergio

    2016-06-01

    [Purpose] This study examined the exercise intensity and psychophysiological responses to a self-selected resistance training session in sedentary male subjects. [Subjects and Methods] Twelve sedentary male subjects (35.8 ± 5.8 years; 25.5 ± 2.6 kg·m(2)) underwent four sessions at 48-h intervals: familiarization; two sessions of one repetition maximum test and a resistance training session in which they were told to self-select a load to complete 3 sets of 10 repetitions of chest press, leg press, seated rows, knee extension, overhead press, biceps curl, and triceps pushdown exercises. During the latter, the percentage of one repetition maximum, affective responses (feeling scale), and rating of perceived exertion (OMNI-RES scale) were measured. [Results] The percentage of one repetition maximum for all exercises was >51% (14-31% variability), the rating of perceived exertion was 5-6 (7-11% variability), and the affective responses was 0-1 point with large variability. [Conclusion] Sedentary male subjects self-selected approximately 55% of one maximum repetition, which was above the intensity suggested to increase strength in sedentary individuals, but below the recommended intensity to improve strength in novice to intermediate exercisers. The rating of perceived exertion was indicative of moderate intensity and slightly positive affective responses.

  12. Mapping of resistance to spot blotch disease caused by Bipolaris sorokiniana in spring wheat.

    PubMed

    Kumar, Uttam; Joshi, Arun K; Kumar, Sundeep; Chand, Ramesh; Röder, Marion S

    2009-02-01

    Spot blotch caused by Bipolaris sorokiniana is a destructive disease of wheat in warm and humid wheat growing regions of the world. The development of disease resistant cultivars is considered as the most effective control strategy for spot blotch. An intervarietal mapping population in the form of recombinant inbred lines (RILs) was developed from a cross 'Yangmai 6' (a Chinese source of resistance) x 'Sonalika' (a spot blotch susceptible cultivar). The 139 single seed descent (SSD) derived F(6), F(7), F(8) lines of 'Yangmai 6' x 'Sonalika' were evaluated for resistance to spot blotch in three blocks in each of the 3 years. Joint and/or single year analysis by composite interval mapping (CIM) and likelihood of odd ratio (LOD) >2.2, identified four quantitative trait loci (QTL) on the chromosomes 2AL, 2BS, 5BL and 6DL. These QTLs were designated as QSb.bhu-2A, QSb.bhu-2B, QSb.bhu-5B and QSb.bhu-6D, respectively. A total of 63.10% of phenotypic variation was explained by these QTLs based on the mean over years. Two QTLs on chromosomes 2B and 5B with major effects were consistent over 3 years. All QTL alleles for resistance were derived from the resistant parent 'Yangmai 6'.

  13. Compounds of the sphingomyelin-ceramide-glycosphingolipid pathways as secondary messenger molecules: new targets for novel therapies for fatty liver disease and insulin resistance.

    PubMed

    Ilan, Yaron

    2016-06-01

    The compounds of sphingomyelin-ceramide-glycosphingolipid pathways have been studied as potential secondary messenger molecules in various systems, along with liver function and insulin resistance. Secondary messenger molecules act directly or indirectly to affect cell organelles and intercellular interactions. Their potential role in the pathogenesis of steatohepatitis and diabetes has been suggested. Data samples collected from patients with Gaucher's disease, who had high levels of glucocerebroside, support a role for compounds from these pathways as a messenger molecules in the pathogenesis of fatty liver disease and diabetes. The present review summarizes some of the recent data on the role of glycosphingolipid molecules as messenger molecules in various physiological and pathological conditions, more specifically including insulin resistance and fatty liver disease. PMID:27173510

  14. Genome-Wide Association Study on Resistance to Stalk Rot Diseases in Grain Sorghum.

    PubMed

    Adeyanju, Adedayo; Little, Christopher; Yu, Jianming; Tesso, Tesfaye

    2015-06-01

    Stalk rots are important biotic constraints to sorghum production worldwide. Several pathogens may be associated with the disease, but Macrophomina phaseolina and Fusarium thapsinum are recognized as the major causal organisms. The diseases become more aggressive when drought and high-temperature stress occur during grain filling. Progress in genetic improvement efforts has been slow due to lack of effective phenotyping protocol and the strong environmental effect on disease incidence and severity. Deployment of modern molecular tools is expected to accelerate efforts to develop resistant hybrids. This study was aimed at identifying genomic regions associated with resistance to both causal organisms. A sorghum diversity panel consisting of 300 genotypes assembled from different parts of the world was evaluated for response to infection by both pathogens. Community resources of 79,132 single nucleotide polymorphic (SNP) markers developed on the panel were used in association studies using a multi-locus mixed model to map loci associated with stalk rot resistance. Adequate genetic variation was observed for resistance to both pathogens. Structure analysis grouped the genotypes into five subpopulations primarily based on the racial category of the genotypes. Fourteen loci and a set of candidate genes appear to be involved in connected functions controlling plant defense response. However, each associated SNP had relatively small effect on the traits, accounting for 19-30% of phenotypic variation. Linkage disequilibrium analyses suggest that significant SNPs are genetically independent. Estimation of frequencies of associated alleles revealed that durra and caudatum subpopulations were enriched for resistant alleles, but the results suggest complex molecular mechanisms underlying resistance to both pathogens. PMID:25882062

  15. Genome-Wide Association Study on Resistance to Stalk Rot Diseases in Grain Sorghum

    PubMed Central

    Adeyanju, Adedayo; Little, Christopher; Yu, Jianming; Tesso, Tesfaye

    2015-01-01

    Stalk rots are important biotic constraints to sorghum production worldwide. Several pathogens may be associated with the disease, but Macrophomina phaseolina and Fusarium thapsinum are recognized as the major causal organisms. The diseases become more aggressive when drought and high-temperature stress occur during grain filling. Progress in genetic improvement efforts has been slow due to lack of effective phenotyping protocol and the strong environmental effect on disease incidence and severity. Deployment of modern molecular tools is expected to accelerate efforts to develop resistant hybrids. This study was aimed at identifying genomic regions associated with resistance to both causal organisms. A sorghum diversity panel consisting of 300 genotypes assembled from different parts of the world was evaluated for response to infection by both pathogens. Community resources of 79,132 single nucleotide polymorphic (SNP) markers developed on the panel were used in association studies using a multi-locus mixed model to map loci associated with stalk rot resistance. Adequate genetic variation was observed for resistance to both pathogens. Structure analysis grouped the genotypes into five subpopulations primarily based on the racial category of the genotypes. Fourteen loci and a set of candidate genes appear to be involved in connected functions controlling plant defense response. However, each associated SNP had relatively small effect on the traits, accounting for 19–30% of phenotypic variation. Linkage disequilibrium analyses suggest that significant SNPs are genetically independent. Estimation of frequencies of associated alleles revealed that durra and caudatum subpopulations were enriched for resistant alleles, but the results suggest complex molecular mechanisms underlying resistance to both pathogens. PMID:25882062

  16. Genome-Wide Association Study on Resistance to Stalk Rot Diseases in Grain Sorghum.

    PubMed

    Adeyanju, Adedayo; Little, Christopher; Yu, Jianming; Tesso, Tesfaye

    2015-04-16

    Stalk rots are important biotic constraints to sorghum production worldwide. Several pathogens may be associated with the disease, but Macrophomina phaseolina and Fusarium thapsinum are recognized as the major causal organisms. The diseases become more aggressive when drought and high-temperature stress occur during grain filling. Progress in genetic improvement efforts has been slow due to lack of effective phenotyping protocol and the strong environmental effect on disease incidence and severity. Deployment of modern molecular tools is expected to accelerate efforts to develop resistant hybrids. This study was aimed at identifying genomic regions associated with resistance to both causal organisms. A sorghum diversity panel consisting of 300 genotypes assembled from different parts of the world was evaluated for response to infection by both pathogens. Community resources of 79,132 single nucleotide polymorphic (SNP) markers developed on the panel were used in association studies using a multi-locus mixed model to map loci associated with stalk rot resistance. Adequate genetic variation was observed for resistance to both pathogens. Structure analysis grouped the genotypes into five subpopulations primarily based on the racial category of the genotypes. Fourteen loci and a set of candidate genes appear to be involved in connected functions controlling plant defense response. However, each associated SNP had relatively small effect on the traits, accounting for 19-30% of phenotypic variation. Linkage disequilibrium analyses suggest that significant SNPs are genetically independent. Estimation of frequencies of associated alleles revealed that durra and caudatum subpopulations were enriched for resistant alleles, but the results suggest complex molecular mechanisms underlying resistance to both pathogens.

  17. Prevalence and resistance patterns of canine uropathogens in regard to concurrent diseases.

    PubMed

    Brložnik, Maja; Šterk, Karmen; Zdovc, Irena

    2016-01-01

    Predisposing factors for different types of urinary tract infections (UTI) were evaluated and prevalence of causative agents and their resistance were identified. A prospective epidemiologic study (2007 to 2012) included 191 dogs with signs of urinary tract disease. Anamnestic data were collected and clinical examination, abdominal ultrasonography, urinalysis and aerobic bacteriologic urine culture were performed in all dogs. Other diagnostic procedures were conducted when indicated. UTI was more common in neutered female dogs, older dogs and dogs with concurrent diseases. Using culture as the gold standard, sensitivity of urine sediment examination to detect bacteriuria increased from 89.9% to 98.1% with staining and specificity increased from 69.8% to 96.4%. A single species of microorganism was isolated in 90.7%. Most common causative agents of UTI were E. coli (39.0% of isolates), staphylococci (27.3% of isolates), Proteus sp. (13.5% of isolates), and enterococci (8.5% of isolates). Prevalence of the causative agents varied in regard to sex and concurrent diseases. The causative agents were in 29.4% susceptible to all tested antimicrobials and were multi-drug resistant in 27.7%. All methicillin resistant Staphylococcus pseudintermedius (MRSP) strains were isolated in 2010-2012. Resistant bacteria were more common in dogs previously treated with antimicrobials. Due to increased specificity and sensitivity of urine sediment examination, staining the sediment in practice is mandatory. Data on uropathogens and their resistance in regard to concurrent diseases is of crucial importance for diagnosis, treatment and prevention of complications in dogs with UT. Wide intercountry variability in bacterial susceptibility has been confirmed. Also, the onset of MRSP urinary strains in the country has been identified. PMID:27529997

  18. Strengths amidst vulnerabilities: the paradox of resistance in a mining-affected community in Guatemala.

    PubMed

    Caxaj, C Susana; Berman, Helene; Ray, Susan L; Restoule, Jean-Paul; Varcoe, Coleen

    2014-11-01

    The influence of large-scale mining on the psychosocial wellbeing and mental health of diverse Indigenous communities has attracted increased attention. In previous reports, we have discussed the influence of a gold mining operation on the health of a community in the Western highlands of Guatemala. Here, we discuss the community strengths, and acts of resistance of this community, that is, community processes that promoted mental health amidst this context. Using an anti-colonial narrative methodology that incorporated participatory action research principles, we developed a research design in collaboration with community leaders and participants. Data collection involved focus groups, individual interviews and photo-sharing with 54 men and women between the ages of 18 and 67. Data analysis was guided by iterative and ongoing conversations with participants and McCormack's narrative lenses. Study findings revealed key mechanisms and sources of resistance, including a shared cultural identity, a spiritual knowing and being, 'defending our rights, defending our territory,' and, speaking truth to power. These overlapping strengths were identified by participants as key protective factors in facing challenges and adversity. Yet ultimately, these same strengths were often the most eroded or endangered due the influence of large-scale mining operations in the region. These community strengths and acts of resistance reveal important priorities for promoting mental health and wellbeing for populations impacted by large-scale mining operations. Mental health practitioners must attend to both the strengths and parallel vulnerabilities that may be occasioned by large-scale projects of this nature. PMID:25353295

  19. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. PMID:26768363

  20. Sarcolemmal dependence of cardiac protection and stress-resistance: roles in aged or diseased hearts.

    PubMed

    See Hoe, Louise E; May, Lauren T; Headrick, John P; Peart, Jason N

    2016-10-01

    Disruption of the sarcolemmal membrane is a defining feature of oncotic death in cardiac ischaemia-reperfusion (I-R), and its molecular makeup not only fundamentally governs this process but also affects multiple determinants of both myocardial I-R injury and responsiveness to cardioprotective stimuli. Beyond the influences of membrane lipids on the cytoprotective (and death) receptors intimately embedded within this bilayer, myocardial ionic homeostasis, substrate metabolism, intercellular communication and electrical conduction are all sensitive to sarcolemmal makeup, and critical to outcomes from I-R. As will be outlined in this review, these crucial sarcolemmal dependencies may underlie not only the negative effects of age and common co-morbidities on myocardial ischaemic tolerance but also the on-going challenge of implementing efficacious cardioprotection in patients suffering accidental or surgically induced I-R. We review evidence for the involvement of sarcolemmal makeup changes in the impairment of stress-resistance and cardioprotection observed with ageing and highly prevalent co-morbid conditions including diabetes and hypercholesterolaemia. A greater understanding of membrane changes with age/disease, and the inter-dependences of ischaemic tolerance and cardioprotection on sarcolemmal makeup, can facilitate the development of strategies to preserve membrane integrity and cell viability, and advance the challenging goal of implementing efficacious 'cardioprotection' in clinically relevant patient cohorts. Linked Articles This article is part of a themed section on Molecular Pharmacology of G Protein-Coupled Receptors. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v173.20/issuetoc.

  1. Challenge infection as a means of determining the rate of disease resistant Trichomonas gallinae-free birds in a population

    USGS Publications Warehouse

    Kocan, R.M.; Knisley, J.O.

    1970-01-01

    Trichomonas gallinae-free pigeons and mourning doves were infected with the Jones' Barn strain of T. gallinae to determine the rate of disease resistant T. gallinae-free birds in each population. Although all birds became infected 88% of the pigeons were resistant to trichomoniasis while 82% of the mourning doves were resistant. It was concluded that these birds had been previously infected and spontaneously lost their trichomonad fauna while retaining their resistance to fatal infection.

  2. Parkinson's disease differentially affects adaptation to gradual as compared to sudden visuomotor distortions.

    PubMed

    Venkatakrishnan, Anusha; Banquet, Jean P; Burnod, Yves; Contreras-vidal, José L

    2011-08-01

    Patients with Parkinson's disease (PD) have difficulties in movement adaptation to optimize performance in novel environmental contexts such as altered screen cursor-hand relationships. Prior studies have shown that the time course of the distortion differentially affects visuomotor adaptation to screen cursor rotations, suggesting separate mechanisms for gradual and sudden adaptation. Moreover, studies in human and non-human primates suggest that adaptation to sudden kinematic distortions may engage the basal ganglia, whereas adaptation to gradual kinematic distortions involves cerebellar structures. In the present studies, participants were patients with PD, who performed center-out pointing movements, using either a digitizer tablet and pen or a computer trackball, under normal or rotated screen cursor feedback conditions. The initial study tested patients with PD using a cross-over experimental design for adaptation to gradual as compared with sudden rotated hand-screen cursor relationships and revealed significant after-effects for the gradual adaptation task only. Consistent with these results, findings from a follow-up experiment using a trackball that required only small finger movements showed that patients with PD adapt better to gradual as against sudden perturbations, when compared to age-matched healthy controls. We conclude that Parkinson's disease affects adaptation to sudden visuomotor distortions but spares adaptation to gradual distortions. PMID:21414678

  3. Genomic architecture of inflammatory bowel disease in five families with multiple affected individuals

    PubMed Central

    Stittrich, Anna B; Ashworth, Justin; Shi, Mude; Robinson, Max; Mauldin, Denise; Brunkow, Mary E; Biswas, Shameek; Kim, Jin-Man; Kwon, Ki-Sun; Jung, Jae U; Galas, David; Serikawa, Kyle; Duerr, Richard H; Guthery, Stephen L; Peschon, Jacques; Hood, Leroy; Roach, Jared C; Glusman, Gustavo

    2016-01-01

    Currently, the best clinical predictor for inflammatory bowel disease (IBD) is family history. Over 163 sequence variants have been associated with IBD in genome-wide association studies, but they have weak effects and explain only a fraction of the observed heritability. It is expected that additional variants contribute to the genomic architecture of IBD, possibly including rare variants with effect sizes larger than the identified common variants. Here we applied a family study design and sequenced 38 individuals from five families, under the hypothesis that families with multiple IBD-affected individuals harbor one or more risk variants that (i) are shared among affected family members, (ii) are rare and (iii) have substantial effect on disease development. Our analysis revealed not only novel candidate risk variants but also high polygenic risk scores for common known risk variants in four out of the five families. Functional analysis of our top novel variant in the remaining family, a rare missense mutation in the ubiquitin ligase TRIM11, suggests that it leads to increased nuclear factor of kappa light chain enhancer in B-cells (NF-κB) signaling. We conclude that an accumulation of common weak-effect variants accounts for the high incidence of IBD in most, but not all families we analyzed and that a family study design can identify novel rare variants conferring risk for IBD with potentially large effect size, such as the TRIM11 p.H414Y mutation. PMID:27081563

  4. Affective disorders as complex dynamic diseases--a perspective from systems biology.

    PubMed

    Tretter, F; Gebicke-Haerter, P J; an der Heiden, U; Rujescu, D; Mewes, H W; Turck, C W

    2011-05-01

    Understanding mental disorders and their neurobiological basis encompasses the conceptual management of "complexity" and "dynamics". For example, affective disorders exhibit several fluctuating state variables on psychological and biological levels and data collected of these systems levels suggest quasi-chaotic periodicity leading to use concepts and tools of the mathematics of nonlinear dynamic systems. Regarding this, we demonstrate that the concept of "Dynamic Diseases" could be a fruitful way for theory and empirical research in neuropsychiatry. In a first step, as an example, we focus on the analysis of dynamic cortisol regulation that is important for understanding depressive disorders. In this case, our message is that extremely complex phenomena of a disease may be explained as resulting from perplexingly simple nonlinear interactions of a very small number of variables. Additionally, we propose that and how widely used complex circuit diagrams representing the macroanatomic structures and connectivities of the brain involved in major depression or other mental disorders may be "animated" by quantification, even by using expert-based estimations (dummy variables). This method of modeling allows to develop exploratory computer-based numerical models that encompass the option to explore the system by computer simulations (in-silico experiments). Also inter- and intracellular molecular networks involved in affective disorders could be modeled by this procedure. We want to stimulate future research in this theoretical context. PMID:21544742

  5. Parkinson’s Disease Differentially Affects Adaptation to Gradual as Compared to Sudden Visuomotor Distortions

    PubMed Central

    Venkatakrishnan, Anusha; Banquet, Jean P.; Burnod, Yves; Contreras-Vidal, José L.

    2011-01-01

    Patients with Parkinson’s disease (PD) have difficulties in movement adaptation to optimize performance in novel environmental contexts such as altered screen cursor-hand relationships. Prior studies have shown that the time course of the distortion differentially affects visuomotor adaptation to screen cursor rotations, suggesting separate mechanisms for gradual and sudden adaptation. Moreover, studies in human and non-human primates suggest that adaptation to sudden kinematic distortions may engage the basal ganglia, whereas adaptation to gradual kinematic distortions involves cerebellar structures. In the present studies, participants were patients with PD, who performed center-out pointing movements, using either a digitizer tablet and pen or a computer trackball, under normal or rotated screen cursor feedback conditions. The initial study tested patients with PD using a cross-over experimental design for adaptation to gradual as compared with sudden rotated hand-screen cursor relationships and revealed significant after-effects for the gradual adaptation task only. Consistent with these results, findings from a follow-up experiment using a trackball that required only small finger movements showed that patients with PD adapt better to gradual as against sudden perturbations, when compared to age-matched healthy controls. We conclude that Parkinson’s disease affects adaptation to sudden visuomotor distortions but spares adaptation to gradual distortions. PMID:21414678

  6. Parkinson's disease differentially affects adaptation to gradual as compared to sudden visuomotor distortions.

    PubMed

    Venkatakrishnan, Anusha; Banquet, Jean P; Burnod, Yves; Contreras-vidal, José L

    2011-08-01

    Patients with Parkinson's disease (PD) have difficulties in movement adaptation to optimize performance in novel environmental contexts such as altered screen cursor-hand relationships. Prior studies have shown that the time course of the distortion differentially affects visuomotor adaptation to screen cursor rotations, suggesting separate mechanisms for gradual and sudden adaptation. Moreover, studies in human and non-human primates suggest that adaptation to sudden kinematic distortions may engage the basal ganglia, whereas adaptation to gradual kinematic distortions involves cerebellar structures. In the present studies, participants were patients with PD, who performed center-out pointing movements, using either a digitizer tablet and pen or a computer trackball, under normal or rotated screen cursor feedback conditions. The initial study tested patients with PD using a cross-over experimental design for adaptation to gradual as compared with sudden rotated hand-screen cursor relationships and revealed significant after-effects for the gradual adaptation task only. Consistent with these results, findings from a follow-up experiment using a trackball that required only small finger movements showed that patients with PD adapt better to gradual as against sudden perturbations, when compared to age-matched healthy controls. We conclude that Parkinson's disease affects adaptation to sudden visuomotor distortions but spares adaptation to gradual distortions.

  7. Exposure of the grass shrimp, Palaemonetes pugio, to antimicrobial compounds affects associated Vibrio bacterial density and development of antibiotic resistance.

    PubMed

    DeLorenzo, M E; Brooker, J; Chung, K W; Kelly, M; Martinez, J; Moore, J G; Thomas, M

    2016-04-01

    Antimicrobial compounds are widespread, emerging contaminants in the aquatic environment and may threaten ecosystem and human health. This study characterized effects of antimicrobial compounds common to human and veterinary medicine, aquaculture, and consumer personal care products [erythromycin (ERY), sulfamethoxazole (SMX), oxytetracycline (OTC), and triclosan (TCS)] in the grass shrimp Palaemonetes pugio. The effects of antimicrobial treatments on grass shrimp mortality and lipid peroxidation activity were measured. The effects of antimicrobial treatments on the bacterial community of the shrimp were then assessed by measuring Vibrio density and testing bacterial isolates for antibiotic resistance. TCS (0.33 mg/L) increased shrimp mortality by 37% and increased lipid peroxidation activity by 63%. A mixture of 0.33 mg/L TCS and 60 mg/L SMX caused a 47% increase in shrimp mortality and an 88% increase in lipid peroxidation activity. Exposure to SMX (30 mg/L or 60 mg/L) alone and to a mixture of SMX/ERY/OTC did not significantly affect shrimp survival or lipid peroxidation activity. Shrimp exposure to 0.33 mg/L TCS increased Vibrio density 350% as compared to the control whereas SMX, the SMX/TCS mixture, and the mixture of SMX/ERY/OTC decreased Vibrio density 78-94%. Increased Vibrio antibiotic resistance was observed for all shrimp antimicrobial treatments except for the mixture of SMX/ERY/OTC. Approximately 87% of grass shrimp Vibrio isolates displayed resistance to TCS in the control treatment suggesting a high level of TCS resistance in environmental Vibrio populations. The presence of TCS in coastal waters may preferentially increase the resistance and abundance of pathogenic bacteria. These results indicate the need for further study into the potential interactions between antimicrobials, aquatic organisms, and associated bacterial communities.

  8. ADS1 encodes a MATE-transporter that negatively regulates plant disease resistance.

    PubMed

    Sun, Xinli; Gilroy, Eleanor M; Chini, Andrea; Nurmberg, Pedro L; Hein, Ingo; Lacomme, Christophe; Birch, Paul R J; Hussain, Adil; Yun, Byung-Wook; Loake, Gary J

    2011-10-01

    Multidrug and toxic compound extrusion (MATE) proteins comprise the most recently identified family of multidrug transporters. In plants, the numbers of MATE proteins has undergone a remarkable expansion, underscoring the importance of these transporters within this kingdom. Here, we describe the identification and characterization of Activated Disease Susceptibility 1 (ADS1) which encodes a putative MATE transport protein. An activation tagging screen uncovered the ads1-Dominant (ads1-D) mutant, which was subsequently characterized by molecular, genetic and biochemical approaches. The ads1-D mutant was compromised in both basal and nonhost resistance against microbial pathogens. Further, plant defence responses conferred by RPS4 were also disabled in ads1-D plants. By contrast, depletion of ADS1 transcripts by RNA-interference (RNAi) promoted basal disease resistance. Unexpectedly, ads1-D plants were found to constitutively accumulate reactive oxygen intermediates (ROIs). However, analysis of ads1-D Arabidopsis thaliana respiratory burst oxidase (atrboh) double and triple mutants indicated that an increase in ROIs did not impact ads1-D-mediated disease susceptibility. Our findings imply that ADS1 negatively regulates the accumulation of the plant immune activator salicylic acid (SA) and cognate Pathogenesis-Related 1 (PR1) gene expression. Collectively, these data highlight an important role for MATE proteins in the establishment of plant disease resistance. PMID:21762165

  9. In silico identification of coffee genome expressed sequences potentially associated with resistance to diseases

    PubMed Central

    2010-01-01

    Sequences potentially associated with coffee resistance to diseases were identified by in silico analyses using the database of the Brazilian Coffee Genome Project (BCGP). Keywords corresponding to plant resistance mechanisms to pathogens identified in the literature were used as baits for data mining. Expressed sequence tags (ESTs) related to each of these keywords were identified with tools available in the BCGP bioinformatics platform. A total of 11,300 ESTs were mined. These ESTs were clustered and formed 979 EST-contigs with similarities to chitinases, kinases, cytochrome P450 and nucleotide binding site-leucine rich repeat (NBS-LRR) proteins, as well as with proteins related to disease resistance, pathogenesis, hypersensitivity response (HR) and plant defense responses to diseases. The 140 EST-contigs identified through the keyword NBS-LRR were classified according to function. This classification allowed association of the predicted products of EST-contigs with biological processes, including host defense and apoptosis, and with molecular functions such as nucleotide binding and signal transducer activity. Fisher's exact test was used to examine the significance of differences in contig expression between libraries representing the responses to biotic stress challenges and other libraries from the BCGP. This analysis revealed seven contigs highly similar to catalase, chitinase, protein with a BURP domain and unknown proteins. The involvement of these coffee proteins in plant responses to disease is discussed. PMID:21637594

  10. Are heat and cold resistance of arctic species affected by successive extreme temperature events?

    PubMed

    Marchand, F L; Kockelbergh, Fred; van de Vijver, Bart; Beyens, Louis; Nijs, I

    2006-01-01

    Extreme temperature events are projected to increase in frequency in a future climate. As successive extremes could occur more frequently, patches of vulnerable tundra vegetation were exposed to two consecutive heat waves (HWs) of 10 d each, with a 5-d recovery period in between. Surface temperatures during the HWs were increased approximately 6 degrees C using infrared irradiation sources. In three of the four target species (Pyrola grandiflora, Polygonum viviparum and Carex bigelowii), plant conditions improved upon the first exposure. Depending on species, leaf relative growth, leaf chlorophyll content or maximal photochemical efficiency was increased. In P. grandiflora the positive effects of the heat on the photosynthetic apparatus led to augmented net photosynthesis. By contrast, Salix arctica responded mainly negatively, indicating species-specific responses. During the second HW, leaf mortality suddenly increased, indicating that the heat stress induced by the extreme events lasted too long and negatively influenced the species resistance to high temperature. After the HWs, when plants were exposed to (low) ambient temperatures again, plant performance deteriorated further, indicating possible loss of cold resistance.

  11. Increasing fluid milk favorably affects bone mineral density responses to resistance training in adolescent boys.

    PubMed

    Volek, Jeff S; Gómez, Ana L; Scheett, Timothy P; Sharman, Matthew J; French, Duncan N; Rubin, Martyn R; Ratamess, Nicholas A; McGuigan, Michael M; Kraemer, William J

    2003-10-01

    This study examined the effects of increasing milk on bone and body composition responses to resistance training in adolescents. Twenty-eight boys (13 to 17 years of age) were randomly assigned to consume, in addition to their habitual diet, 3 servings/day of 1% fluid milk (n=14) or juice not fortified with calcium (n=14) while engaged in a 12-week resistance-training program. For all subjects combined, there were significant (P

  12. Jammed granular cones affect frictional resistive forces at the onset of intrusion

    NASA Astrophysics Data System (ADS)

    Aguilar, Jeffrey; Goldman, Daniel

    Characterizing the functional form of granular resistive forces has allowed for analysis of the locomotion of animals and robots on and within dry granular media. Resistive force theory (RFT) has been an effective tool in predicting these forces for various locomotive gaits within the ``frictional fluid'' regime, where intrusions are sufficiently slow such that granular inertial effects are negligible. These forces have been typically described by a linear dependence to submersion depth. However, recent experiments on robotic jumping [Aguilar & Goldman, Nature Physics, 2015] have revealed the importance of considering the nonlinear effects at the onset of intrusion to accurately predict robot kinematics. Particle image velocimetry (PIV) analysis of sidewall grain flow during foot intrusion reveals a jammed granular cone that develops beneath the foot at the onset of intrusion. A geometric model of cone development combined with empirical RFT forces on angled conical surfaces was able to predict the non-linear force trajectory vs. depth for experimental intrusions of various foot sizes, suggesting that intruders experience non-linear frictional forces according to the shape of the granular jamming fronts that form at the onset of movement. This work was supported by NSF Physics of Living Systems, Burroughs Wellcome Fund, and the Army Research Office.

  13. Insulin Resistance and Obesity Affect Lipid Profile in the Salivary Glands

    PubMed Central

    Matczuk, Jan; Zalewska, Anna; Łukaszuk, Bartłomiej; Knaś, Małgorzata; Maciejczyk, Mateusz; Garbowska, Marta; Ziembicka, Dominika M.; Waszkiel, Danuta; Chabowski, Adrian; Żendzian-Piotrowska, Małgorzata

    2016-01-01

    In today's world wrong nutritional habits together with a low level of physical activity have given rise to the development of obesity and its comorbidity, insulin resistance. More specifically, many researches indicate that lipids are vitally involved in the onset of a peripheral tissue (e.g., skeletal muscle, heart, and liver) insulin resistance. Moreover, it seems that diabetes can also induce changes in respect of lipid composition of both the salivary glands and saliva. However, judging by the number of research articles, the salivary glands lipid profile still has not been sufficiently explored. In the current study we aim to assess the changes in the main lipid fractions, namely, triacylglycerols, phospholipids, free fatty acids, and diacylglycerols, in the parotid and the submandibular salivary glands of rats exposed to a 5-week high fat diet regimen. We observed that the high caloric fat diet caused a significant change in the salivary glands lipid composition, especially with respect to PH and TG, but not DAG or FFAs, classes. The observed reduction in PH concentration is an interesting phenomenon frequently signifying the atrophy and malfunctions in the saliva secreting organs. On the other hand, the increased accumulation of TG in the glands may be an important clinical manifestation of metabolic syndrome and type 2 diabetes mellitus. PMID:27471733

  14. Insulin Resistance and Obesity Affect Lipid Profile in the Salivary Glands.

    PubMed

    Matczuk, Jan; Zalewska, Anna; Łukaszuk, Bartłomiej; Knaś, Małgorzata; Maciejczyk, Mateusz; Garbowska, Marta; Ziembicka, Dominika M; Waszkiel, Danuta; Chabowski, Adrian; Żendzian-Piotrowska, Małgorzata; Kurek, Krzysztof

    2016-01-01

    In today's world wrong nutritional habits together with a low level of physical activity have given rise to the development of obesity and its comorbidity, insulin resistance. More specifically, many researches indicate that lipids are vitally involved in the onset of a peripheral tissue (e.g., skeletal muscle, heart, and liver) insulin resistance. Moreover, it seems that diabetes can also induce changes in respect of lipid composition of both the salivary glands and saliva. However, judging by the number of research articles, the salivary glands lipid profile still has not been sufficiently explored. In the current study we aim to assess the changes in the main lipid fractions, namely, triacylglycerols, phospholipids, free fatty acids, and diacylglycerols, in the parotid and the submandibular salivary glands of rats exposed to a 5-week high fat diet regimen. We observed that the high caloric fat diet caused a significant change in the salivary glands lipid composition, especially with respect to PH and TG, but not DAG or FFAs, classes. The observed reduction in PH concentration is an interesting phenomenon frequently signifying the atrophy and malfunctions in the saliva secreting organs. On the other hand, the increased accumulation of TG in the glands may be an important clinical manifestation of metabolic syndrome and type 2 diabetes mellitus. PMID:27471733

  15. Activation tagging of ATHB13 in Arabidopsis thaliana confers broad-spectrum disease resistance.

    PubMed

    Gao, Dongli; Appiano, Michela; Huibers, Robin P; Chen, Xi; Loonen, Annelies E H M; Visser, Richard G F; Wolters, Anne-Marie A; Bai, Yuling

    2014-12-01

    Powdery mildew species Oidium neolycopersici (On) can cause serious yield losses in tomato production worldwide. Besides on tomato, On is able to grow and reproduce on Arabidopsis. In this study we screened a collection of activation-tagged Arabidopsis mutants and identified one mutant, 3221, which displayed resistance to On, and in addition showed a reduced stature and serrated leaves. Additional disease tests demonstrated that the 3221 mutant exhibited resistance to downy mildew (Hyaloperonospora arabidopsidis) and green peach aphid (Myzus persicae), but retained susceptibility to bacterial pathogen Pseudomonas syringae pv tomato DC3000. The resistance trait and morphological alteration were mutually linked in 3221. Identification of the activation tag insertion site and microarray analysis revealed that ATHB13, a homeodomain-leucine zipper (HD-Zip) transcription factor, was constitutively overexpressed in 3221. Silencing of ATHB13 in 3221 resulted in the loss of both the morphological alteration and resistance, whereas overexpression of the cloned ATHB13 in Col-0 and Col-eds1-2 backgrounds resulted in morphological alteration and resistance. Microarray analysis further revealed that overexpression of ATHB13 influenced the expression of a large number of genes. Previously, it was reported that ATHB13-overexpressing lines conferred tolerance to abiotic stress. Together with our results, it appears that ATHB13 is involved in the crosstalk between abiotic and biotic stress resistance pathways.

  16. Spatiotemporal and species-specific patterns of diseases affecting crustose coralline algae in Curaçao

    NASA Astrophysics Data System (ADS)

    Quéré, G.; Steneck, R. S.; Nugues, M. M.

    2015-03-01

    Distribution and abundance of coral diseases have been well documented, but only a few studies considered diseases affecting crustose coralline algae (CCA), particularly at the species level. We investigated the spatiotemporal dynamics of diseases affecting CCA along the south coast of Curaçao, southern Caribbean. Two syndromes were detected: the Coralline White Band Syndrome (CWBS) previously described and the Coralline White Patch Disease (CWPD) reported here for the first time. Diseases were present at all six study sites, and our results did not reveal a relationship between disease occurrence and human influence. Both diseases were more prevalent on the shallower reef flat than on the deeper reef slope, and during the warm/rainy season than during the cold/dry season. The patterns observed were consistent with a positive link between temperature and disease occurrence. Reef flat communities were dominated by Neogoniolithon mamillare and Paragoniolithon solubile, whereas deeper habitats were dominated by Hydrolithon boergesenii. Diseases affected all the species encountered, and no preferable host was detected. There was a significant relationship between both disease occurrences and CCA cover. Monitoring of affected patches revealed that 90 % of lesions in CWBS increased in size, whereas 88 % of CWPD lesions regenerated over time. CWBS linear progression rate did not vary between seasons or species and ranged from 0.15 to 0.36 cm month-1, which is in the same order of magnitude as rates previously documented. We conclude that diseases have the potential to cause major loss in CCA cover, particularly in shallow waters. As CCA play a key role in reef ecosystems, our study suggests that the emergence of diseases affecting these algae may pose a real threat to coral reef ecosystems. The levels of disease reported here will provide a much-needed local baseline allowing future comparisons.

  17. Concentration of carp edema virus (CEV) DNA in koi tissues affected by koi sleepy disease (KSD).

    PubMed

    Adamek, Mikolaj; Jung-Schroers, Verena; Hellmann, John; Teitge, Felix; Bergmann, Sven Michael; Runge, Martin; Kleingeld, Dirk Willem; Way, Keith; Stone, David Michael; Steinhagen, Dieter

    2016-05-26

    Carp edema virus (CEV), the causative agent of 'koi sleepy disease' (KSD), appears to be spreading worldwide and to be responsible for losses in koi, ornamental varieties of the common carp Cyprinus carpio. Clinical signs of KSD include lethargic behaviour, swollen gills, sunken eyes and skin alterations and can easily be mistaken for other diseases, such as infection with cyprinid herpesvirus 3 (CyHV-3). To improve the future diagnosis of CEV infection and to provide a tool to better explore the relationship between viral load and clinical disease, we developed a specific quantitative PCR (qPCR) for strains of the virus known to infect koi carp. In samples from several clinically affected koi, CEV-specific DNA was present in a range from 1 to 2,046,000 copies, with a mean of 129,982 copies and a median of 45 copies per 250 ng of isolated DNA, but virus DNA could not be detected in all clinically affected koi. A comparison of the newly developed qPCR, which is based on a dual-labelled probe, to an existing end-point PCR procedure revealed higher specificity and sensitivity of the qPCR and demonstrated that the new protocol could improve CEV detection in koi. In addition to improved diagnosis, the newly developed qPCR test would be a useful research tool. For example, studies on the pathobiology of CEV could employ controlled infection experiments in which the development of clinical signs could be examined in parallel with a quantitative determination of virus load. PMID:27225208

  18. Social-adaptive and psychological functioning of patients affected by Fabry disease.

    PubMed

    Laney, Dawn Alyssia; Gruskin, Daniel J; Fernhoff, Paul M; Cubells, Joseph F; Ousley, Opal Y; Hipp, Heather; Mehta, Ami J

    2010-12-01

    Fabry disease (FD) is an X-linked lysosomal storage disorder caused by the deficiency of alpha-galactosidase A. In addition to the debilitating physical symptoms of FD, there are also under-recognized and poorly characterized psychiatric features. As a first step toward characterizing psychiatric features of FD, we administered the Achenbach adult self report questionnaire to 30 FD patients and the Achenbach adult behavior checklist questionnaire to 28 partners/parents/friends of FD patients. Data from at least one of the questionnaires were available on 33 subjects. Analysis focused on social-adaptive functioning in various aspects of daily life and on criteria related to the Diagnostic and statistical manual of mental disorders IV (DSM-IV). Adaptive functioning scale values, which primarily measure social and relationship functioning and occupational success, showed that eight FD patients (six female and two male) had mean adaptive functioning deficits as compared to population norms. Greater rates of depression (P < 0.01), anxiety (P = 0.05), depression and anxiety (P = 0.03), antisocial personality (P < 0.001), attention-deficit/hyperactivity (AD/H; P < 0.01), hyperactivity-impulsivity (P < 0.01), and aggressive behavior (P = 0.03) were associated with poorer adaptive functioning. Decreased social-adaptive functioning in this study was not statistically significantly associated to disease severity, pain, or level of vitality. This study shows for the first time that FD patients, particularly women, are affected by decreased social-adaptive functioning. Comprehensive treatment plans for FD should consider assessments and interventions to evaluate and improve social, occupational, and psychological functioning. Attention to the behavioral aspects of FD could lead to improved treatment outcome and improved quality of life. Individuals affected by Fabry disease exhibited social-adaptive functioning deficits that were significantly correlated with anxiety

  19. Clinical Factors affecting Minor Amputation in Diabetic Foot Disease at Tengku Ampuan Afzan Hospital, Kuantan

    PubMed Central

    ZAKARIA, Zamzuri; AFIFI, Mustaqim; SHARIFUDIN, Mohd Ariff

    2015-01-01

    Background: Diabetic foot disease poses a substantial problem in Malaysian diabetic population. We evaluate the clinical factors affecting minor amputation in diabetic foot disease. Methods: A cross-sectional study enrolling patients admitted to orthopaedic wards of a single tertiary hospital for diabetic foot disease was conducted. Patients who had undergone major amputation or with medical condition above the ankle joint were not included. Clinical data were collected by measurement of ankle brachial systolic index and Semmes-Weinstein 5.07 gauge monofilament test with foot clinical evaluation using King’s classification respectively. Results: The total number of patients included was 138, with mean age of 59.7 years (range 29 to 94 years old). Fifty patients (36.2%) had minor amputations. Poor compliance to diabetic treatment, King’s classification stage 5, low measures of ankle brachial systolic index, sensory neuropathy, high serum C-Reactive protein and high serum creatinine are significant predictive factors for minor amputation (P < 0.05). Conclusion: Identifying these risk factors may help in prevention of minor amputation and subsequently reduce limb loss in diabetic foot. PMID:26023294

  20. ERα Variants Affect Age at Onset of Alzheimer's Disease in a Multiethnic Female Cohort

    PubMed Central

    Janicki, S.C.; Park, N.; Cheng, R.; Clark, L.N.; Lee, J. H.; Schupf, N.

    2014-01-01

    Background/Aims Few studies of gene variants that affect estrogen activity investigate their association with age at onset of Alzheimer's disease (AD) in women of different ethnicities. We investigated the influence of ESR1 polymorphisms on age at onset of AD in a multiethnic cohort of women. Methods Among 1,436 women participating in the Washington Heights Inwood Columbia Aging Project (WHICAP), association with age at AD onset was assessed for 41 single-nucleotide polymorphisms (SNPs) on the ESR1 gene using Cox proportional hazard models, adjusting for presence of an APOE ε4 allele, years of education, and body mass index (BMI). Results Six SNPs in self-identified White women were protectively associated with delayed age of AD onset in this self-identified group, including the two restriction fragment length polymorphisms (RFLPs) PvuII (rs2234693) and XbaI (rs9340799) (HR range 0.420 – 0.483). Two separate SNPs were found to affect age of AD onset in self-identified Black women. Conclusions ESR1 polymorphisms affect age of onset for AD in women, and risk alleles vary by ethnicity. These effects are possibly due to different linkage disequilibrium patterns or differences in comorbid environmental or cultural risk factors mediating SNP effect on risk for AD. PMID:24732579

  1. Clinical heterogeneity of dominant chronic mucocutaneous candidiasis disease: presenting as treatment-resistant candidiasis and chronic lung disease.

    PubMed

    Dotta, Laura; Scomodon, Omar; Padoan, Rita; Timpano, Silviana; Plebani, Alessandro; Soresina, Annarosa; Lougaris, Vassilios; Concolino, Daniela; Nicoletti, Angela; Giardino, Giuliana; Licari, Amelia; Marseglia, Gianluigi; Pignata, Claudio; Tamassia, Nicola; Facchetti, Fabio; Vairo, Donatella; Badolato, Raffaele

    2016-03-01

    In gain-of-function STAT1 mutations, chronic mucocutaneous candidiasis disease (CMCD) represents the phenotypic manifestation of a complex immunodeficiency characterized by clinical and immunological heterogeneity. We aimed to study clinical manifestations, long-term complications, molecular basis, and immune profile of patients with dominant CMCD. We identified nine patients with heterozygous mutations in STAT1, including novel amino acid substitutions (L283M, L351F, L400V). High risk of azole-resistance was observed, particularly when intermittent regimens of antifungal treatment or use of suboptimal dosage occurs. We report a case of Cryptococcosis and various bacterial and viral infections. Risk of developing bronchiectasis in early childhood or gradually evolving to chronic lung disease in adolescent or adult ages emerges. Lymphopenia is variable, likely progressing by adulthood. We conclude that continuous antifungal prophylaxis associated to drug monitoring might prevent resistance to treatment; prompt diagnosis and therapy of lung disease might control long-term progression; careful monitoring of lymphopenia-related infections might improve prognosis.

  2. Activation of Proteinase 3 Contributes to Nonalcoholic Fatty Liver Disease and Insulin Resistance

    PubMed Central

    Toonen, Erik JM; Mirea, Andreea-Manuela; Tack, Cees J; Stienstra, Rinke; Ballak, Dov B; van Diepen, Janna A; Hijmans, Anneke; Chavakis, Triantafyllos; Dokter, Wim H; Pham, Christine TN; Netea, Mihai G; Dinarello, Charles A; Joosten, Leo AB

    2016-01-01

    Activation of inflammatory pathways is known to accompany development of obesity-induced nonalcoholic fatty liver disease (NAFLD), insulin resistance and type 2 diabetes. In addition to caspase-1, the neutrophil serine proteases proteinase 3, neutrophil elastase and cathepsin G are able to process the inactive proinflammatory mediators interleukin (IL)-1β and IL-18 to their bioactive forms, thereby regulating inflammatory responses. In this study, we investigated whether proteinase 3 is involved in obesity-induced development of insulin resistance and NAFLD. We investigated the development of NAFLD and insulin resistance in mice deficient for neutrophil elastase/proteinase 3 and neutrophil elastase/cathepsin G and in wild-type mice treated with the neutrophil serine proteinase inhibitor human α-1 antitrypsin. Expression profiling of metabolically relevant tissues obtained from insulin-resistant mice showed that expression of proteinase 3 was specifically upregulated in the liver, whereas neutrophil elastase, cathepsin G and caspase-1 were not. Neutrophil elastase/proteinase 3-deficient mice showed strongly reduced levels of lipids in the liver after being fed a high-fat diet. Moreover, these mice were resistant to high–fat–diet-induced weight gain, inflammation and insulin resistance. Injection of proteinase 3 exacerbated insulin resistance in caspase-1–/– mice, indicating that proteinase 3 acts independently of caspase-1. Treatment with α-1 antitrypsin during the last 10 d of a 16-wk high-fat diet reduced hepatic lipid content and decreased fasting glucose levels. We conclude that proteinase 3 is involved in NAFLD and insulin resistance and that inhibition of proteinase 3 may have therapeutic potential. PMID:27261776

  3. Biochemical resistance of pyrogenic organic matter in fire-affected mineral soils of Southern Europe

    NASA Astrophysics Data System (ADS)

    Knicker, H.; González Vila, F. J.; Clemente Salas, L.

    2012-04-01

    Incorporated into the soil, naturally formed pyrogenic organic matter (PyOM) is considered as highly recalcitrant, but direct estimation of PyOM decomposition rates are scarce. With this aim in mind, we subjected organic matter (OM) of fire-affected and unaffected soils to biochemical degradation under laboratory conditions and monitored CO2 production over a period of seven months. The soils derived from fire affected and unaffected areas of the Sierra de Aznalcóllar and the Doñana National Park, Southern Spain. Virtual fractionation of the solid-state 13C nuclear magnetic resonance (NMR) spectra of the fire affected soils into fire-unaffected soil organic matter (SOM) and PyOM yielded charcoal C contributions of 30 to 50% to the total organic C (Corg) of the sample derived from the Aznalcóllar region. Fitting the respiration data with a double exponential decay model revealed a fast carbon flush during the first three weeks of the experiment. Solid-state 13C NMR spectroscopy evidenced the contribution of aromatic moieties of the PyOM to this initial carbon release and to the biosynthesis of new microbial biomass. The input of PyOM resulted in an increase of the mean residence time (MRT) of the slow OM pool of the soil by a factor of 3 to 4 to approximately 40 years which rises doubts rises doubts about the presumed big influence of PyOM as an additional C-sink in soils. On the other hand, although being small the difference in turnover rates is evident and has some major implication with respect to long-term alteration of the chemical composition of OM in fire-affected soils. Based on the obtained results and the analysis of PyOM in other soil systems, a conceptual model is presented which can explain the different behavior of PyOM under different soil conditions.

  4. Circulating leptin and osteoprotegerin levels affect insulin resistance in healthy premenopausal obese women.

    PubMed

    Ugur-Altun, Betul; Altun, Armagan

    2007-11-01

    We investigated the relationship between circulating leptin and osteoprotegerin (OPG) levels and insulin resistance assessed by HOMA-IR in premenopausal obese and normal weight women. Thirty four obese women (age 31 +/- 8 years) (BMI 35 +/- 4 kg/m(2)) with 19 healthy controls (age 31 +/- 7 years) (BMI <25 kg/m(2)) (BMI 21 +/- 2 kg/m(2)) were included in the study. Women were healthy and had no osteoporosis. Circulating leptin levels were significantly higher in obese women (17.11 +/- 2.05 ng/mL vs. 8.38 +/- 4.71 ng/mL, p <0.0001) and decreased OPG levels were found (14.7 +/- 7.15 pg/mL vs. 19.17 +/- 6.37 pg/mL, p = 0.03). Leptin showed a positive correlation with BMI (r = 0.851, p <0.0001), waist-to-hip ratio (r = 0.692, p <0.0001), fasting insulin (r = 0.441, p <0.001), HOMA-IR (r = 0.412, p = 0.002), fibrinogen (r = 0.387, p = 0.004), uric acid (r = 0.293, p = 0.033), hematocrit (r = 0.394, p = 0.003), systolic (r = 0.504, p <0.0001), and diastolic blood pressure (r = 0.363, p = 0.008). OPG showed a negative correlation with insulin (r = -0.341, p = 0.013) and HOMA-IR (r = -0.324, p = 0.018). In obese women group, the regression equation of HOMA-IR was (HOMA-IR = [0.095 x leptin]-[0.051 x OPG] + 1.71). However, there was no relation between leptin and OPG levels. In conclusion, circulating leptin and OPG levels were related to insulin resistance in premenopausal obese women. However, leptin had no interference in OPG in premenopausal women. PMID:17923273

  5. Overexpression of Arabidopsis Ceramide Synthases Differentially Affects Growth, Sphingolipid Metabolism, Programmed Cell Death, and Mycotoxin Resistance.

    PubMed

    Luttgeharm, Kyle D; Chen, Ming; Mehra, Amit; Cahoon, Rebecca E; Markham, Jonathan E; Cahoon, Edgar B

    2015-10-01

    Ceramide synthases catalyze an N-acyltransferase reaction using fatty acyl-coenzyme A (CoA) and long-chain base (LCB) substrates to form the sphingolipid ceramide backbone and are targets for inhibition by the mycotoxin fumonisin B1 (FB1). Arabidopsis (Arabidopsis thaliana) contains three genes encoding ceramide synthases with distinct substrate specificities: LONGEVITY ASSURANCE GENE ONE HOMOLOG1 (LOH1; At3g25540)- and LOH3 (At1g19260)-encoded ceramide synthases use very-long-chain fatty acyl-CoA and trihydroxy LCB substrates, and LOH2 (At3g19260)-encoded ceramide synthase uses palmitoyl-CoA and dihydroxy LCB substrates. In this study, complementary DNAs for each gene were overexpressed to determine the role of individual isoforms in physiology and sphingolipid metabolism. Differences were observed in growth resulting from LOH1 and LOH3 overexpression compared with LOH2 overexpression. LOH1- and LOH3-overexpressing plants had enhanced biomass relative to wild-type plants, due in part to increased cell division, suggesting that enhanced synthesis of very-long-chain fatty acid/trihydroxy LCB ceramides promotes cell division and growth. Conversely, LOH2 overexpression resulted in dwarfing. LOH2 overexpression also resulted in the accumulation of sphingolipids with C16 fatty acid/dihydroxy LCB ceramides, constitutive induction of programmed cell death, and accumulation of salicylic acid, closely mimicking phenotypes observed previously in LCB C-4 hydroxylase mutants defective in trihydroxy LCB synthesis. In addition, LOH2- and LOH3-overexpressing plants acquired increased resistance to FB1, whereas LOH1-overexpressing plants showed no increase in FB1 resistance, compared with wild-type plants, indicating that LOH1 ceramide synthase is most strongly inhibited by FB1. Overall, the findings described here demonstrate that overexpression of Arabidopsis ceramide synthases results in strongly divergent physiological and metabolic phenotypes, some of which have significance

  6. Lower temperature during the dark cycle affects disease development on Lygodium microphyllum (Old World climbing fern) by Bipolaris sacchari

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Growth chamber studies were conducted to examine environmental parameters affecting disease development by the indigenous pathogen Bipolaris sacchari isolate LJB-1L on the invasive weed Lygodium microphyllum (Old World climbing fern). Initial studies examined three different temperature regimes (20...

  7. Immunosuppression abrogates resistance of young rabbits to Rabbit Haemorrhagic Disease (RHD)

    PubMed Central

    2014-01-01

    Rabbit Haemorrhagic Disease (RHD) is caused by a calicivirus (RHDV) that kills 90% of infected adult European rabbits within 3 days. Remarkably, young rabbits are resistant to RHD. We induced immunosuppression in young rabbits by treatment with methylprednisolone acetate (MPA) and challenged the animals with RHDV by intramuscular injection. All of these young rabbits died within 3 days of infection due to fulminant hepatitis, presenting a large number of RHDV-positive dead or apoptotic hepatocytes, and a significant seric increase in cytokines, features that are similar to those of naïve adult rabbits infected by RHDV. We conclude that MPA-induced immunosuppression abrogates the resistance of young rabbits to RHD, indicating that there are differences in the innate immune system between young and adult rabbits that contribute to their distinct resistance/susceptibility to RHDV infection. PMID:24490832

  8. Disentangling genetic variation for resistance and tolerance to infectious diseases in animals.

    PubMed

    Råberg, Lars; Sim, Derek; Read, Andrew F

    2007-11-01

    Hosts can in principle employ two different strategies to defend themselves against parasites: resistance and tolerance. Animals typically exhibit considerable genetic variation for resistance (the ability to limit parasite burden). However, little is known about whether animals can evolve tolerance (the ability to limit the damage caused by a given parasite burden). Using rodent malaria in laboratory mice as a model system and the statistical framework developed by plant-pathogen biologists, we demonstrated genetic variation for tolerance, as measured by the extent to which anemia and weight loss increased with increasing parasite burden. Moreover, resistance and tolerance were negatively genetically correlated. These results mean that animals, like plants, can evolve two conceptually different types of defense, a finding that has important implications for the understanding of the epidemiology and evolution of infectious diseases.

  9. Nucleoporins Nup160 and Seh1 are required for disease resistance in Arabidopsis.

    PubMed

    Roth, Charlotte; Wiermer, Marcel

    2012-10-01

    Arabidopsis Nup160 and Seh1, encoding two predicted nucleoporins of the Nup107-160 nuclear pore sub-complex, were identified in a reverse genetics screen based on their requirement for basal disease resistance. Both genes also contribute to immunity conferred by Toll interleukin 1 receptor/nucleotide-binding/leucine-rich repeat (TNL)-type R proteins and constitutive resistance activated in the deregulated TNL mutant, snc1. Protein amounts of EDS1, a central regulator of TNL-triggered resistance, are reduced in seh1 and severely depleted in nup160 single mutants. Here, we investigate the impact of mutations in Nup160, Seh1 and a third complex member, MOS3/Nup96, on EDS1 protein accumulation in the snc1 auto-immune mutant background. In addition, we examine the subcellular localization of Seh1 in root tissues.

  10. Transposon tagging of disease resistance genes. Final report, May 1, 1988--April 30, 1993

    SciTech Connect

    Michelmore, R.

    1994-09-01

    The goal of this project was to develop a transposon mutagenesis system for lettuce and to clone and characterize disease resistance genes by transposon tagging. The majority of studies were conducted with the Ac/Ds System. Researchers made and tested several constructs as well as utilized constructions shown to be functional in other plant species. Researchers demonstrated movement of Ac and DS in lettuce; however, they transposed at much lower frequencies in lettuce than in other plant species. Therefore, further manipulation of the system, particularly for flower specific expression of transposase, is required before a routine transposon system is available for lettuce. Populations of lettuce were generated and screened to test for the stability of resistance genes and several spontaneous mutations were isolated. Researchers also identified a resistance gene mutant in plants transformed with a Ds element and chimeric transposase gene. This is currently being characterized in detail.

  11. Immunosuppression abrogates resistance of young rabbits to Rabbit Haemorrhagic Disease (RHD).

    PubMed

    Marques, Raquel M; Teixeira, Luzia; Aguas, Artur P; Ribeiro, Joana C; Costa-e-Silva, António; Ferreira, Paula G

    2014-02-04

    Rabbit Haemorrhagic Disease (RHD) is caused by a calicivirus (RHDV) that kills 90% of infected adult European rabbits within 3 days. Remarkably, young rabbits are resistant to RHD. We induced immunosuppression in young rabbits by treatment with methylprednisolone acetate (MPA) and challenged the animals with RHDV by intramuscular injection. All of these young rabbits died within 3 days of infection due to fulminant hepatitis, presenting a large number of RHDV-positive dead or apoptotic hepatocytes, and a significant seric increase in cytokines, features that are similar to those of naïve adult rabbits infected by RHDV. We conclude that MPA-induced immunosuppression abrogates the resistance of young rabbits to RHD, indicating that there are differences in the innate immune system between young and adult rabbits that contribute to their distinct resistance/susceptibility to RHDV infection.

  12. Frequent Occurrence of Tomato Leaf Curl New Delhi Virus in Cotton Leaf Curl Disease Affected Cotton in Pakistan

    PubMed Central

    Zaidi, Syed Shan-e-Ali; Shafiq, Muhammad; Amin, Imran; Scheffler, Brian E.; Scheffler, Jodi A.; Briddon, Rob W.; Mansoor, Shahid

    2016-01-01

    Cotton leaf curl disease (CLCuD) is the major biotic constraint to cotton production on the Indian subcontinent, and is caused by monopartite begomoviruses accompanied by a specific DNA satellite, Cotton leaf curl Multan betasatellite (CLCuMB). Since the breakdown of resistance against CLCuD in 2001/2002, only one virus, the “Burewala” strain of Cotton leaf curl Kokhran virus (CLCuKoV-Bur), and a recombinant form of CLCuMB have consistently been identified in cotton across the major cotton growing areas of Pakistan. Unusually a bipartite isolate of the begomovirus Tomato leaf curl virus was identified in CLCuD-affected cotton recently. In the study described here we isolated the bipartite begomovirus Tomato leaf curl New Delhi virus (ToLCNDV) from CLCuD-affected cotton. To assess the frequency and geographic occurrence of ToLCNDV in cotton, CLCuD-symptomatic cotton plants were collected from across the Punjab and Sindh provinces between 2013 and 2015. Analysis of the plants by diagnostic PCR showed the presence of CLCuKoV-Bur in all 31 plants examined and ToLCNDV in 20 of the samples. Additionally, a quantitative real-time PCR analysis of the levels of the two viruses in co-infected plants suggests that coinfection of ToLCNDV with the CLCuKoV-Bur/CLCuMB complex leads to an increase in the levels of CLCuMB, which encodes the major pathogenicity (symptom) determinant of the complex. The significance of these results are discussed. PMID:27213535

  13. Frequent Occurrence of Tomato Leaf Curl New Delhi Virus in Cotton Leaf Curl Disease Affected Cotton in Pakistan.

    PubMed

    Zaidi, Syed Shan-E-Ali; Shafiq, Muhammad; Amin, Imran; Scheffler, Brian E; Scheffler, Jodi A; Briddon, Rob W; Mansoor, Shahid

    2016-01-01

    Cotton leaf curl disease (CLCuD) is the major biotic constraint to cotton production on the Indian subcontinent, and is caused by monopartite begomoviruses accompanied by a specific DNA satellite, Cotton leaf curl Multan betasatellite (CLCuMB). Since the breakdown of resistance against CLCuD in 2001/2002, only one virus, the "Burewala" strain of Cotton leaf curl Kokhran virus (CLCuKoV-Bur), and a recombinant form of CLCuMB have consistently been identified in cotton across the major cotton growing areas of Pakistan. Unusually a bipartite isolate of the begomovirus Tomato leaf curl virus was identified in CLCuD-affected cotton recently. In the study described here we isolated the bipartite begomovirus Tomato leaf curl New Delhi virus (ToLCNDV) from CLCuD-affected cotton. To assess the frequency and geographic occurrence of ToLCNDV in cotton, CLCuD-symptomatic cotton plants were collected from across the Punjab and Sindh provinces between 2013 and 2015. Analysis of the plants by diagnostic PCR showed the presence of CLCuKoV-Bur in all 31 plants examined and ToLCNDV in 20 of the samples. Additionally, a quantitative real-time PCR analysis of the levels of the two viruses in co-infected plants suggests that coinfection of ToLCNDV with the CLCuKoV-Bur/CLCuMB complex leads to an increase in the levels of CLCuMB, which encodes the major pathogenicity (symptom) determinant of the complex. The significance of these results are discussed. PMID:27213535

  14. Biomarkers of evasive resistance predict disease progression in cancer patients treated with antiangiogenic therapies.

    PubMed

    Pircher, Andreas; Jöhrer, Karin; Kocher, Florian; Steiner, Normann; Graziadei, Ivo; Heidegger, Isabel; Pichler, Renate; Leonhartsberger, Nicolai; Kremser, Christian; Kern, Johann; Untergasser, Gerold; Gunsilius, Eberhard; Hilbe, Wolfgang

    2016-04-12

    Numerous antiangiogenic agents are approved for the treatment of oncological diseases. However, almost all patients develop evasive resistance mechanisms against antiangiogenic therapies. Currently no predictive biomarker for therapy resistance or response has been established. Therefore, the aim of our study was to identify biomarkers predicting the development of therapy resistance in patients with hepatocellular cancer (n = 11), renal cell cancer (n = 7) and non-small cell lung cancer (n = 2). Thereby we measured levels of angiogenic growth factors, tumor perfusion, circulating endothelial cells (CEC), circulating endothelial progenitor cells (CEP) and tumor endothelial markers (TEM) in patients during the course of therapy with antiangiogenic agents, and correlated them with the time to antiangiogenic progression (aTTP). Importantly, at disease progression, we observed an increase of proangiogenic factors, upregulation of CEC/CEP levels and downregulation of TEMs, such as Robo4 and endothelial cell-specific chemotaxis regulator (ECSCR), reflecting the formation of torturous tumor vessels. Increased TEM expression levels tended to correlate with prolonged aTTP (ECSCR high = 275 days vs. ECSCR low = 92.5 days; p = 0.07 and for Robo4 high = 387 days vs. Robo4 low = 90.0 days; p = 0.08). This indicates that loss of vascular stabilization factors aggravates the development of antiangiogenic resistance. Thus, our observations confirm that CEP/CEC populations, proangiogenic cytokines and TEMs contribute to evasive resistance in antiangiogenic treated patients. Higher TEM expression during disease progression may have clinical and pathophysiological implications, however, validation of our results is warranted for further biomarker development.

  15. Biomarkers of evasive resistance predict disease progression in cancer patients treated with antiangiogenic therapies

    PubMed Central

    Pircher, Andreas; Jöhrer, Karin; Kocher, Florian; Steiner, Normann; Graziadei, Ivo; Heidegger, Isabel; Pichler, Renate; Leonhartsberger, Nicolai; Kremser, Christian; Kern, Johann; Untergasser, Gerold; Gunsilius, Eberhard; Hilbe, Wolfgang

    2016-01-01

    Numerous antiangiogenic agents are approved for the treatment of oncological diseases. However, almost all patients develop evasive resistance mechanisms against antiangiogenic therapies. Currently no predictive biomarker for therapy resistance or response has been established. Therefore, the aim of our study was to identify biomarkers predicting the development of therapy resistance in patients with hepatocellular cancer (n = 11), renal cell cancer (n = 7) and non-small cell lung cancer (n = 2). Thereby we measured levels of angiogenic growth factors, tumor perfusion, circulating endothelial cells (CEC), circulating endothelial progenitor cells (CEP) and tumor endothelial markers (TEM) in patients during the course of therapy with antiangiogenic agents, and correlated them with the time to antiangiogenic progression (aTTP). Importantly, at disease progression, we observed an increase of proangiogenic factors, upregulation of CEC/CEP levels and downregulation of TEMs, such as Robo4 and endothelial cell-specific chemotaxis regulator (ECSCR), reflecting the formation of torturous tumor vessels. Increased TEM expression levels tended to correlate with prolonged aTTP (ECSCR high = 275 days vs. ECSCR low = 92.5 days; p = 0.07 and for Robo4 high = 387 days vs. Robo4 low = 90.0 days; p = 0.08). This indicates that loss of vascular stabilization factors aggravates the development of antiangiogenic resistance. Thus, our observations confirm that CEP/CEC populations, proangiogenic cytokines and TEMs contribute to evasive resistance in antiangiogenic treated patients. Higher TEM expression during disease progression may have clinical and pathophysiological implications, however, validation of our results is warranted for further biomarker development. PMID:26956051

  16. Environmental Conditions Influence Induction of Key ABC-Transporter Genes Affecting Glyphosate Resistance Mechanism in Conyza canadensis

    PubMed Central

    Tani, Eleni; Chachalis, Demosthenis; Travlos, Ilias S.; Bilalis, Dimitrios

    2016-01-01

    Conyza canadensis has been reported to be the most frequent weed species that evolved resistance to glyphosate