Science.gov

Sample records for affect dna synthesis

  1. Translesion DNA synthesis

    PubMed Central

    Vaisman, Alexandra; McDonald, John P.; Woodgate, Roger

    2014-01-01

    All living organisms are continually exposed to agents that damage their DNA, which threatens the integrity of their genome. As a consequence, cells are equipped with a plethora of DNA repair enzymes to remove the damaged DNA. Unfortunately, situations nevertheless arise where lesions persist, and these lesions block the progression of the cell’s replicase. Under these situations, cells are forced to choose between recombination-mediated “damage avoidance” pathways, or use a specialized DNA polymerase (pol) to traverse the blocking lesion. The latter process is referred to as Translesion DNA Synthesis (TLS). As inferred by its name, TLS not only results in bases being (mis)incorporated opposite DNA lesions, but also downstream of the replicase-blocking lesion, so as to ensure continued genome duplication and cell survival. Escherichia coli and Salmonella typhimurium possess five DNA polymerases, and while all have been shown to facilitate TLS under certain experimental conditions, it is clear that the LexA-regulated and damage-inducible pols II, IV and V perform the vast majority of TLS under physiological conditions. Pol V can traverse a wide range of DNA lesions and performs the bulk of mutagenic TLS, whereas pol II and pol IV appear to be more specialized TLS polymerases. PMID:26442823

  2. Synthesis of DNA

    DOEpatents

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  3. Synthesis of chemically modified DNA.

    PubMed

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  4. Photoelectrochemical synthesis of DNA microarrays

    PubMed Central

    Chow, Brian Y.; Emig, Christopher J.; Jacobson, Joseph M.

    2009-01-01

    Optical addressing of semiconductor electrodes represents a powerful technology that enables the independent and parallel control of a very large number of electrical phenomena at the solid-electrolyte interface. To date, it has been used in a wide range of applications including electrophoretic manipulation, biomolecule sensing, and stimulating networks of neurons. Here, we have adapted this approach for the parallel addressing of redox reactions, and report the construction of a DNA microarray synthesis platform based on semiconductor photoelectrochemistry (PEC). An amorphous silicon photoconductor is activated by an optical projection system to create virtual electrodes capable of electrochemically generating protons; these PEC-generated protons then cleave the acid-labile dimethoxytrityl protecting groups of DNA phosphoramidite synthesis reagents with the requisite spatial selectivity to generate DNA microarrays. Furthermore, a thin-film porous glass dramatically increases the amount of DNA synthesized per chip by over an order of magnitude versus uncoated glass. This platform demonstrates that PEC can be used toward combinatorial bio-polymer and small molecule synthesis. PMID:19706433

  5. Sequence Affects the Cyclization of DNA Minicircles.

    PubMed

    Wang, Qian; Pettitt, B Montgomery

    2016-03-17

    Understanding how the sequence of a DNA molecule affects its dynamic properties is a central problem affecting biochemistry and biotechnology. The process of cyclizing short DNA, as a critical step in molecular cloning, lacks a comprehensive picture of the kinetic process containing sequence information. We have elucidated this process by using coarse-grained simulations, enhanced sampling methods, and recent theoretical advances. We are able to identify the types and positions of structural defects during the looping process at a base-pair level. Correlations along a DNA molecule dictate critical sequence positions that can affect the looping rate. Structural defects change the bending elasticity of the DNA molecule from a harmonic to subharmonic potential with respect to bending angles. We explore the subelastic chain as a possible model in loop formation kinetics. A sequence-dependent model is developed to qualitatively predict the relative loop formation time as a function of DNA sequence. PMID:26938490

  6. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  7. The structure and duplex context of DNA interstrand crosslinks affects the activity of DNA polymerase η

    PubMed Central

    Roy, Upasana; Mukherjee, Shivam; Sharma, Anjali; Frank, Ekaterina G.; Schärer, Orlando D.

    2016-01-01

    Several important anti-tumor agents form DNA interstrand crosslinks (ICLs), but their clinical efficiency is counteracted by multiple complex DNA repair pathways. All of these pathways require unhooking of the ICL from one strand of a DNA duplex by nucleases, followed by bypass of the unhooked ICL by translesion synthesis (TLS) polymerases. The structures of the unhooked ICLs remain unknown, yet the position of incisions and processing of the unhooked ICLs significantly influence the efficiency and fidelity of bypass by TLS polymerases. We have synthesized a panel of model unhooked nitrogen mustard ICLs to systematically investigate how the state of an unhooked ICL affects pol η activity. We find that duplex distortion induced by a crosslink plays a crucial role in translesion synthesis, and length of the duplex surrounding an unhooked ICL critically affects polymerase efficiency. We report the synthesis of a putative ICL repair intermediate that mimics the complete processing of an unhooked ICL to a single crosslinked nucleotide, and find that it provides only a minimal obstacle for DNA polymerases. Our results raise the possibility that, depending on the structure and extent of processing of an ICL, its bypass may not absolutely require TLS polymerases. PMID:27257072

  8. Inhibition of Cellular DNA Synthesis in Cells Infected with Infectious Pancreatic Necrosis Virus

    PubMed Central

    Lothrop, David; Nicholson, Bruce L.

    1974-01-01

    In asynchronous RTG-2 cell cultures infected with infectious pancreatic necrosis (IPN) virus, inhibition of cellular DNA synthesis, but not protein synthesis, was detected 5 to 6 h postinfection and was 80 to 90% complete by 7 to 8 h. Inhibition of DNA synthesis was largely abolished by UV irradiation of the virus. Sedimentation analyses of phenol-extracted DNA indicated that native cellular DNA was not degraded during infection. Sedimentation on alkaline sucrose gradients of DNA from cells pulsed with radioactive thymidine for varying periods indicated that elongation of nascent DNA chains proceeded normally in infected cells. These and previous results suggest that IPN virus infection results in a reduction of the number of chromosomal sites active in DNA synthesis but does not affect the rate of polymerization at active sites. Cells synchronized with excess thymidine and hydroxyurea and infected with virus at the time of release from the block demonstrated an inhibition of DNA synthesis 3 h postinfection. Cells infected 4 h prior to release continued to synthesize normal amounts of DNA for 1 to 2 h after release. These results indicated that DNA synthesis in early synthetic phase is relatively insensitive to inhibition by IPN virus. PMID:4852469

  9. Initiator RNA in Discontinuous Polyoma DNA Synthesis*

    PubMed Central

    Reichard, Peter; Eliasson, Rolf; Söderman, Gunilla

    1974-01-01

    During replication of polyoma DNA in isolated nuclei, RNA was found attached to the 5′ ends of growing progeny strands. This RNA starts with either ATP or GTP and can be labeled at its 5′ end with 32P from β-labeled nucleotides. Digestion of progeny strands with pancreatic DNase released 32P-labeled RNA that, on gel electrophoresis, gave a distinct peak in the position expected for a decanucleotide. We believe that this short RNA is involved in the initiation of the discontinuous synthesis of DNA and propose the name “initiator RNA” for it. The covalent linkage of initiator RNA to 5′ ends of growing DNA chains was substantiated by the finding that 32P was transferred to ribonucleotides by alkaline hydrolysis of purified initiator RNA obtained by DNase digestion of polyoma progeny strands synthesized from [α-32P]dTTP. While initiator RNA was quite homogeneous in size, it had no unique base sequence since digestion with pancreatic RNase of initiator RNA labeled at its 5′ end with 32P released a variety of different [32P]oligonucleotides. The switch from RNA to DNA synthesis during strand elongation may thus depend on the size of initiator RNA rather than on a specific base sequence. PMID:4373733

  10. Magnetic field affects enzymatic ATP synthesis.

    PubMed

    Buchachenko, Anatoly L; Kuznetsov, Dmitry A

    2008-10-01

    The rate of ATP synthesis by creatine kinase extracted from V. xanthia venom was shown to depend on the magnetic field. The yield of ATP produced by enzymes with 24Mg2+ and 26Mg2+ ions in catalytic sites increases by 7-8% at 55 mT and then decreases at 80 mT. For enzyme with 25Mg2+ ion in a catalytic site, the ATP yield increases by 50% and 70% in the fields 55 and 80 mT, respectively. In the Earth field the rate of ATP synthesis by enzyme, in which Mg2+ ion has magnetic nucleus 25Mg, is 2.5 times higher than that by enzymes, in which Mg2+ ion has nonmagnetic, spinless nuclei 24Mg or 26Mg. Both magnetic field effect and magnetic isotope effect demonstrate that the ATP synthesis is an ion-radical process, affected by Zeeman interaction and hyperfine coupling in the intermediate ion-radical pair. PMID:18774801

  11. Stability of mRNA/DNA and DNA/DNA Duplexes Affects mRNA Transcription

    PubMed Central

    Kraeva, Rayna I.; Krastev, Dragomir B.; Roguev, Assen; Ivanova, Anna; Nedelcheva-Veleva, Marina N.; Stoynov, Stoyno S.

    2007-01-01

    Nucleic acids, due to their structural and chemical properties, can form double-stranded secondary structures that assist the transfer of genetic information and can modulate gene expression. However, the nucleotide sequence alone is insufficient in explaining phenomena like intron-exon recognition during RNA processing. This raises the question whether nucleic acids are endowed with other attributes that can contribute to their biological functions. In this work, we present a calculation of thermodynamic stability of DNA/DNA and mRNA/DNA duplexes across the genomes of four species in the genus Saccharomyces by nearest-neighbor method. The results show that coding regions are more thermodynamically stable than introns, 3′-untranslated regions and intergenic sequences. Furthermore, open reading frames have more stable sense mRNA/DNA duplexes than the potential antisense duplexes, a property that can aid gene discovery. The lower stability of the DNA/DNA and mRNA/DNA duplexes of 3′-untranslated regions and the higher stability of genes correlates with increased mRNA level. These results suggest that the thermodynamic stability of DNA/DNA and mRNA/DNA duplexes affects mRNA transcription. PMID:17356699

  12. DNA Nanoparticles for Improved Protein Synthesis In Vitro

    PubMed Central

    Galinis, Robertas; Stonyte, Greta; Kiseliovas, Vaidotas; Zilionis, Rapolas; Studer, Sabine; Hilvert, Donald; Janulaitis, Arvydas

    2016-01-01

    Abstract The amplification and digital quantification of single DNA molecules are important in biomedicine and diagnostics. Beyond quantifying DNA molecules in a sample, the ability to express proteins from the amplified DNA would open even broader applications in synthetic biology, directed evolution, and proteomics. Herein, a microfluidic approach is reported for the production of condensed DNA nanoparticles that can serve as efficient templates for in vitro protein synthesis. Using phi29 DNA polymerase and a multiple displacement amplification reaction, single DNA molecules were converted into DNA nanoparticles containing up to about 104 clonal gene copies of the starting template. DNA nanoparticle formation was triggered by accumulation of inorganic pyrophosphate (produced during DNA synthesis) and magnesium ions from the buffer. Transcription–translation reactions performed in vitro showed that individual DNA nanoparticles can serve as efficient templates for protein synthesis in vitro. PMID:26821778

  13. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  14. Pentoxifylline affects idarubicin binding to DNA.

    PubMed

    Gołuński, Grzegorz; Borowik, Agnieszka; Lipińska, Andrea; Romanik, Monika; Derewońko, Natalia; Woziwodzka, Anna; Piosik, Jacek

    2016-04-01

    Anticancer drug idarubicin - derivative of doxorubicin - is commonly used in treatment of numerous cancer types. However, in contrast to doxorubicin, its biophysical properties are not well established yet. Additionally, potential direct interactions of idarubicin with other biologically active aromatic compounds, such as pentoxifylline - representative of methylxanthines - were not studied at all. Potential formation of such hetero-aggregates may result in sequestration of the anticancer drug and, in consequence, reduction of its biological activity. This work provide description of the idarubicin biophysical properties as well as assess influence of pentoxifylline on idarubicin interactions with DNA. To achieve these goals we employed spectrophotometric methods coupled with analysis with the appropriate mathematical models as well as flow cytometry and Ames test. Obtained results show influence of pentoxifylline on idarubicin binding to DNA and are well in agreement with the data previously published for other aromatic ligands. Additionally it may be hypothesized that direct interactions between idarubicin and pentoxifylline may influence the anticancer drug biological activity. PMID:26921593

  15. Requirement of E. coli DNA synthesis functions for the lytic replication of bacteriophage P1.

    PubMed

    Hay, N; Cohen, G

    1983-11-01

    P1 lytic growth was examined in a number of different temperature sensitive mutants of E. coli that affect chromosomal replication. Growth was analyzed by measurements of phage burst sizes and specific DNA synthesis. Efficient P1 growth required each of the bacterial elongation functions dnaE (polC), dnaZ (sub units of E. coli polymerase III holoenzyme), and dnaG (primase) but was not dependent on the elongation function dnaB (mobile promoter). Of two initiation functions tested the dnaA function was found to be dispensable for normal growth whereas the dnaC function was essential. Temperature shift experiments with different dnaC mutants showed that the initiation component of the dnaC function was needed continuously throughout at least the first half of the lytic cycle, while the dnaC elongation activity was probably required during the entire cycle for normal phage yields. In two respects the dependence of P1 lytic growth on E. coli DNA synthesis functions was significantly different from that reported for P1 plasmid replication (Scott and Vapnek, 1980). Thus, lytic replication was far more dependent on a functional polC gene product than was plasmid replication and did not require the bacterial dnaB product. PMID:6359668

  16. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  17. Cellular integrity is required for inhibition of initiation of cellular DNA synthesis by reovirus type 3.

    PubMed Central

    Roner, M R; Cox, D C

    1985-01-01

    Synchronized HeLa cells, primed for entry into the synthesis phase by amethopterin, were prevented from initiating DNA synthesis 9 h after infection with reovirus type 3. However, nuclei isolated from synchronized cells infected with reovirus for 9 or 16 h demonstrated a restored ability to synthesize DNA. The addition of enucleated cytoplasmic extracts from infected or uninfected cells did not affect this restored capacity for synthesis. The addition of ribonucleotide triphosphates to nuclei isolated from infected cells stimulated additional DNA synthesis, suggesting that these nuclei were competent to initiate new rounds of DNA replication. Permeabilization of infected cells did not restore the ability of these cells to synthesize DNA. Nucleoids isolated from intact or permeabilized cells, infected for 9 or 16 h displayed an increased rate of sedimentation when compared with nucleoids isolated from uninfected cells. Nucleoids isolated from the nuclei of infected cells demonstrated a rate of sedimentation similar to that of nucleoids isolated from the nuclei of uninfected cells. The inhibition of initiation of cellular DNA synthesis by reovirus type 3 appears not to have been due to a permanent alteration of the replication complex, but this inhibition could be reversed by the removal of that complex from factors unique to the structural or metabolic integrity of the infected cell. Images PMID:3968718

  18. Function of DNA polymerase I in RNA-primed synthesis of bacteriophage M-13 duplex DNA.

    PubMed Central

    Schneck, P K; Staudenbauer, W L; Hofschneider, P H

    1976-01-01

    Cell-free extracts from Escherichia coli contain a DNA polymerase activity resistant to SH-blocking agents, which is capable of synthesizing complementary strand DNA on a circular M-13 DNA template by extension of RNA primers. This activity is considered to be identical with DNA polymerase I (or some altered form of this enzyme) since it is missing in extracts from po1A- cells. DNA synthesis in the presence of SH-blocking agents occurs at a reduced rate as compared to untreated controls and leads to the formation of DNA chains of defined size (0.4-0.5 genome's length). It is concluded that efficient M-13 duplex DNA synthesis requires the cooperation of both DNA polymerase I and III. PMID:1272793

  19. Mutagenesis in Oocytes of DROSOPHILA MELANOGASTER. I. Scheduled Synthesis of Nuclear and Mitochondrial DNA and Unscheduled DNA Synthesis

    PubMed Central

    Kelley, Mark R.; Lee, William R.

    1983-01-01

    As a model system for studying mutagenesis, the oocyte of Drosophila melanogaster has exhibited considerable complexity. Very few experiments have been conducted on the effect of exposing oocytes to chemical mutagens, presumably due to their lower mutational response relative to sperm and spermatids. This lower response may be due either to a change in probability of mutation induction per adduct due to a change in the type of DNA repair or to a lower dose of the mutagen to the female germ line. To study molecular dosimetry and DNA repair in the oocyte, the large number of intracellular constituents (mtDNA, RNA, nucleic acid precursors and large quantities of proteins and lipids) must be separated from nuclear DNA. In this paper we present results showing reliable separation of such molecules enabling us to detect scheduled nuclear and mitochondrial DNA synthesis. We also, by understanding the precise timing of such events, can detect unscheduled DNA synthesis (UDS) as a measure of DNA repair. Furthermore, by comparing the UDS results in a repair competent (Ore-R) vs. a repair deficient (mei-9L1 ) strain, we have shown the oocyte capable of DNA repair after treatment with ethyl methanesulfonate (EMS). We conclude that the important determinant of mutation induction in oocytes after treatment with EMS is the time interval between DNA alkylation and DNA synthesis after fertilization, i.e., the interruption of continuous DNA repair. PMID:17246137

  20. Translesion DNA synthesis in the context of cancer research

    PubMed Central

    2011-01-01

    During cell division, replication of the genomic DNA is performed by high-fidelity DNA polymerases but these error-free enzymes can not synthesize across damaged DNA. Specialized DNA polymerases, so called DNA translesion synthesis polymerases (TLS polymerases), can replicate damaged DNA thereby avoiding replication fork breakdown and subsequent chromosomal instability. We focus on the involvement of mammalian TLS polymerases in DNA damage tolerance mechanisms. In detail, we review the discovery of TLS polymerases and describe the molecular features of all the mammalian TLS polymerases identified so far. We give a short overview of the mechanisms that regulate the selectivity and activity of TLS polymerases. In addition, we summarize the current knowledge how different types of DNA damage, relevant either for the induction or treatment of cancer, are bypassed by TLS polymerases. Finally, we elucidate the relevance of TLS polymerases in the context of cancer therapy. PMID:22047021

  1. Further Studies on Bacteriophage T4 DNA Synthesis in Sucrose-Plasmolyzed Cells

    PubMed Central

    Stafford, Mary E.; Reddy, G. Prem Veer; Mathews, Christopher K.

    1977-01-01

    This paper describes several technical improvements in the sucrose-plasmolyzed cell system used in earlier experiments on DNA synthesis in situ with Escherichia coli infected by DNA-defective mutants of bacteriophage T4 (W. L. Collinsworth and C. K. Mathews, J. Virol. 13:908-915, 1974). Using this system, which is based primarily on that of M. G. Wovcha et al. (Proc. Natl. Acad. Sci. U.S.A. 70:2196-2200, 1973), we reinvestigated the properties of mutants bearing lesions in genes 1, 41, and 62, and we resolved some disagreements with data reported from that laboratory. We also asked whether the DNA-delay phenotype of T4 mutants is related to possible early leakage of DNA precursors from infected cells. Such cells display defective DNA synthesis in situ, even when ample DNA precursors are made available. Thus, the lesions associated with these mutations seem to manifest themselves at the level of macromolecular metabolism. Similarly, we examined an E. coli mutant defective in its ability to support T4 production, apparently because of a lesion affecting DNA synthesis (L. Simon et al., Nature [London] 252:451-455). In the plasmolyzed cell system, reduced nucleotide incorporation is seen, indicating also that the genetic defect does not involve DNA precursor synthesis. The plasmolyzed cell system incorporates deoxynucleotide 5′-monophosphates into DNA severalfold more rapidly than the corresponding 5′-triphosphates. This is consistent with the idea that DNA precursor-synthesizing enzymes are functionally organized to shuttle substrates to their sites of utilization. PMID:328926

  2. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    PubMed

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases. PMID:22320201

  3. DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis

    PubMed Central

    2015-01-01

    The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the “structure elucidation problem”: the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS’s utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 104 molecules/bead and sequencing allowed for elucidation of each compound’s synthetic history. We applied DESPS to the combinatorial synthesis of a 75 645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and

  4. Decreased synthesis of DNA in regenerating rat liver after the administration of reserpine

    PubMed Central

    Ćihák, A.; Vaptzarova, K.

    1973-01-01

    1. Reserpine given to rats before the enhanced synthesis of DNA begins 14h after partial hepatectomy markedly depresses thymidine uptake into DNA at 24 hours. 2. At this time decreased activity of liver thymidine kinase but unchanged thymidine 5′-nucleotidase were observed. 3. Reserpine has no effect on DNA synthesis when administered simultaneously with the labelled thymidine 2 h before killing. 4. With depressed DNA synthesis after reserpine administration there is no significant decrease of liver RNA synthesis. PMID:4793440

  5. Polyaniline nanowire synthesis templated by DNA

    NASA Astrophysics Data System (ADS)

    Nickels, Patrick; Dittmer, Wendy U.; Beyer, Stefan; Kotthaus, Jörg P.; Simmel, Friedrich C.

    2004-11-01

    DNA-templated polyaniline nanowires and networks are synthesized using three different methods. The resulting DNA/polyaniline hybrids are fully characterized using atomic force microscopy, UV-vis spectroscopy and current-voltage measurements. Oxidative polymerization of polyaniline at moderate pH values is accomplished using ammonium persulfate as an oxidant, or alternatively in an enzymatic oxidation by hydrogen peroxide using horseradish peroxidase, or by photo-oxidation using a ruthenium complex as photo-oxidant. Atomic force microscopy shows that all three methods lead to the preferential growth of polyaniline along DNA templates. With ammonium persulfate, polyaniline can be grown on DNA templates already immobilized on a surface. Current-voltage measurements are successfully conducted on DNA/polyaniline networks synthesized by the enzymatic method and the photo-oxidation method. The conductance is found to be consistent with values measured for undoped polyaniline films.

  6. Magnetic isotope and magnetic field effects on the DNA synthesis

    PubMed Central

    Buchachenko, Anatoly L.; Orlov, Alexei P.; Kuznetsov, Dmitry A.; Breslavskaya, Natalia N.

    2013-01-01

    Magnetic isotope and magnetic field effects on the rate of DNA synthesis catalysed by polymerases β with isotopic ions 24Mg2+, 25Mg2+ and 26Mg2+ in the catalytic sites were detected. No difference in enzymatic activity was found between polymerases β carrying 24Mg2+ and 26Mg2+ ions with spinless, non-magnetic nuclei 24Mg and 26Mg. However, 25Mg2+ ions with magnetic nucleus 25Mg were shown to suppress enzymatic activity by two to three times with respect to the enzymatic activity of polymerases β with 24Mg2+ and 26Mg2+ ions. Such an isotopic dependence directly indicates that in the DNA synthesis magnetic mass-independent isotope effect functions. Similar effect is exhibited by polymerases β with Zn2+ ions carrying magnetic 67Zn and non-magnetic 64Zn nuclei, respectively. A new, ion–radical mechanism of the DNA synthesis is suggested to explain these effects. Magnetic field dependence of the magnesium-catalysed DNA synthesis is in a perfect agreement with the proposed ion–radical mechanism. It is pointed out that the magnetic isotope and magnetic field effects may be used for medicinal purposes (trans-cranial magnetic treatment of cognitive deceases, cell proliferation, control of the cancer cells, etc). PMID:23851636

  7. The coordinate induction of DNA synthesis after tuber wounding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tuber wounding induces a cascade of biological responses involved in processes required to heal and protect surviving plant issues. Little is known about the coordination of these processes, including essential wound-induced DNA synthesis, yet they play critical roles in maintaining marketability o...

  8. Seasonal variations of DNA synthesis in intestinal epithelial cells of hibernating animals--I. DNA synthesis in intestinal epithelial cells of ground squirrel (Citellus undulatus) during deep hibernation.

    PubMed

    Kruman, I I; Kolaeva, S G; Iljasova, E N; Zubrikhina, G N; Khachko, V N; Petrova, A S

    1986-01-01

    The conditions for obtaining crypt cells from ground squirrel small intestine were chosen which allow flow-through cytofluorometric analysis of the DNA synthesis of this tissue. DNA synthesis was found to be greatly reduced in the intestinal crypt cells of ground squirrel during deep hibernation in torpid animals, in animals during spontaneous arousals and in animals prevented from hibernation. The conclusion is made about endogenous control of the DNA synthesis in the cells of true hibernators. PMID:3943302

  9. Sickle erythrocytes inhibit human endothelial cell DNA synthesis

    SciTech Connect

    Weinstein, R.; Zhou, M.A.; Bartlett-Pandite, A.; Wenc, K. )

    1990-11-15

    Patients with sickle cell anemia experience severe vascular occlusive phenomena including acute pain crisis and cerebral infarction. Obstruction occurs at both the microvascular and the arterial level, and the clinical presentation of vascular events is heterogeneous, suggesting a complex etiology. Interaction between sickle erythrocytes and the endothelium may contribute to vascular occlusion due to alteration of endothelial function. To investigate this hypothesis, human vascular endothelial cells were overlaid with sickle or normal erythrocytes and stimulated to synthesize DNA. The erythrocytes were sedimented onto replicate monolayers by centrifugation for 10 minutes at 17 g to insure contact with the endothelial cells. Incorporation of 3H-thymidine into endothelial cell DNA was markedly inhibited during contact with sickle erythrocytes. This inhibitory effect was enhanced more than twofold when autologous sickle plasma was present during endothelial cell labeling. Normal erythrocytes, with or without autologous plasma, had a modest effect on endothelial cell DNA synthesis. When sickle erythrocytes in autologous sickle plasma were applied to endothelial monolayers for 1 minute, 10 minutes, or 1 hour and then removed, subsequent DNA synthesis by the endothelial cells was inhibited by 30% to 40%. Although adherence of sickle erythrocytes to the endothelial monolayers was observed under these experimental conditions, the effect of sickle erythrocytes on endothelial DNA synthesis occurred in the absence of significant adherence. Hence, human endothelial cell DNA synthesis is partially inhibited by contact with sickle erythrocytes. The inhibitory effect of sickle erythrocytes occurs during a brief (1 minute) contact with the endothelial monolayers, and persists for at least 6 hours of 3H-thymidine labeling.

  10. Synthesis and characterization of DNA nano-meso-microspheres as drug delivery carriers for intratumoral chemotherapy

    NASA Astrophysics Data System (ADS)

    Enriquez Schumacher, Iris Vanessa

    Conventional cancer chemotherapy results in systemic toxicity which severely limits effectiveness and often adversely affects patient quality of life. There is a need to find new drugs and delivery methods for less toxic therapy. Previous studies concerning DNA complexing with chemotherapy drugs suggest unique opportunities for DNA as a mesosphere drug carrier. The overall objective of this research was devoted to the synthesis and evaluation of novel DNA-drug nano-mesospheres designed for localized chemotherapy via intratumoral injection. My research presents DNA nano-meso-microspheres (DNA-MS) that were prepared using a modified steric stabilization method originally developed in this lab for the preparation of albumin MS. DNA-MS were prepared with glutaraldehyde covalent crosslinking (genipin crosslinking was attempted) through the DNA base pairs. In addition, novel crosslinking of DNA-MS was demonstrated using chromium, gadolinium, or iron cations through the DNA phosphate groups. Covalent and ionic crosslinked DNA-MS syntheses yielded smooth and spherical particle morphologies with multimodal size distributions. Optimized DNA-MS syntheses produced particles with narrow and normal size distributions in the 50nm to 5mum diameter size range. In aqueous dispersions approximately 200% swelling was observed with dispersion stability for more than 48 hours. Typical process conditions included a 1550rpm initial mixing speed and particle filtration through 20mum filters to facilitate preparation. DNA-MS were in situ loaded during synthesis for the first time with mitoxantrone, 5-fluorouracil, and methotrexate. DNA-MS drug incorporation was 12%(w/w) for mitoxantrone, 9%(w/w) for methotrexate, and 5%(w/w) for 5-fluorouracil. In vitro drug release into phosphate buffered saline was observed for over 35 days by minimum sink release testing. The effect of gadolinium crosslink concentration on mitoxantrone release was evaluated at molar equivalences in the range of 20% to

  11. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.

    PubMed

    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C

    2013-05-17

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates. PMID:23543747

  12. Nutri-epigenomic Studies Related to Neural Tube Defects: Does Folate Affect Neural Tube Closure Via Changes in DNA Methylation?

    PubMed

    Rochtus, Anne; Jansen, Katrien; Van Geet, Chris; Freson, Kathleen

    2015-01-01

    Neural tube defects (NTDs), affecting 1-2 per 1000 pregnancies, are severe congenital malformations that arise from the failure of neurulation during early embryonic development. The methylation hypothesis suggests that folate prevents NTDs by stimulating cellular methylation reactions. Folate is central to the one-carbon metabolism that produces pyrimidines and purines for DNA synthesis and for the generation of the methyldonor S-adenosyl-methionine. This review focuses on the relation between the folate-mediated one-carbon metabolism, DNA methylation and NTDs. Studies will be discussed that investigated global or locus-specific DNA methylation differences in patients with NTDs. Folate deficiency may increase NTD risk by decreasing DNA methylation, but to date, human studies vary widely in study design in terms of analyzing different clinical subtypes of NTDs, using different methylation quantification assays and using DNA isolated from diverse types of tissues. Some studies have focused mainly on global DNA methylation differences while others have quantified specific methylation differences for imprinted genes, transposable elements and DNA repair enzymes. Findings of global DNA hypomethylation and LINE-1 hypomethylation suggest that epigenetic alterations may disrupt neural tube closure. However, current research does not support a linear relation between red blood cell folate concentration and DNA methylation. Further studies are required to better understand the interaction between folate, DNA methylation changes and NTDs. PMID:26349489

  13. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  14. Anthocyanidins modulate the activity of human DNA topoisomerases I and II and affect cellular DNA integrity.

    PubMed

    Habermeyer, Michael; Fritz, Jessica; Barthelmes, Hans U; Christensen, Morten O; Larsen, Morten K; Boege, Fritz; Marko, Doris

    2005-09-01

    In the present study, we investigated the effect of anthocyanidins on human topoisomerases I and II and its relevance for DNA integrity within human cells. Anthocyanidins bearing vicinal hydroxy groups at the B-ring (delphinidin, DEL; cyanidin, CY) were found to potently inhibit the catalytic activity of human topoisomerases I and II, without discriminating between the IIalpha and the IIbeta isoforms. However, in contrast to topoisomerase poisons, DEL and CY did not stabilize the covalent DNA-topoisomerase intermediates (cleavable complex) of topoisomerase I or II. Using recombinant topoisomerase I, the presence of CY or DEL (> or = 1 microM) effectively prohibited the stabilization of the cleavable complex by the topoisomerase I poison camptothecin. We furthermore investigated whether the potential protective effect vs topoisomerase I poisons is reflected also on the cellular level, affecting the DNA damaging properties of camptothecin. Indeed, in HT29 cells, low micromolar concentrations of DEL (1-10 microM) significantly diminished the DNA strand breaking effect of camptothecin (100 microM). However, at concentrations > or = 50 microM, all anthocyanidins tested (delphinidin, cyanidin, malvidin, pelargonidin, and paeonidin), including those not interfering with topoisomerases, were found to induce DNA strand breaks in the comet assay. All of these analogues were able to compete with ethidium bromide for the intercalation into calf thymus DNA and to replace the minor groove binder Hoechst 33258. These data indicate substantial affinity to double-stranded DNA, which might contribute at least to the DNA strand breaking effect of anthocyanidins at higher concentrations (> or = 50 microM). PMID:16167831

  15. Low intensity infrared laser affects expression of oxidative DNA repair genes in mitochondria and nucleus

    NASA Astrophysics Data System (ADS)

    Fonseca, A. S.; Magalhães, L. A. G.; Mencalha, A. L.; Geller, M.; Paoli, F.

    2014-11-01

    Practical properties and physical characteristics of low intensity lasers have made possible their application to treat soft tissue diseases. Excitation of intracellular chromophores by red and infrared radiation at low energy fluences with increase of mitochondrial metabolism is the basis of the biostimulation effect but free radicals can be produced. DNA lesions induced by free radicals are repaired by the base excision repair pathway. In this work, we evaluate the expression of POLγ and APEX2 genes related to repair of mitochondrial and nuclear DNA, respectively. Skin and muscle tissue of Wistar rats were exposed to low intensity infrared laser at different fluences. One hour and 24 hours after laser exposure, tissue samples were withdrawn for total RNA extraction, cDNA synthesis, and evaluation of POLγ and APEX2 mRNA expression by real time quantitative polymerase chain reaction. Skin and muscle tissue of Wistar rats exposed to laser radiation show different expression of POLγ and APEX2 mRNA depending of the fluence and time after exposure. Our study suggests that a low intensity infrared laser affects expression of genes involved in repair of oxidative lesions in mitochondrial and nuclear DNA.

  16. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    PubMed

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (p<0.01) more mtDNA compared to cancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored. PMID:26403317

  17. Inaccurate DNA Synthesis in Cell Extracts of Yeast Producing Active Human DNA Polymerase Iota

    PubMed Central

    Makarova, Alena V.; Grabow, Corinn; Gening, Leonid V.; Tarantul, Vyacheslav Z.; Tahirov, Tahir H.; Bessho, Tadayoshi; Pavlov, Youri I.

    2011-01-01

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn2+ ions, can bypass some DNA lesions and misincorporates “G” opposite template “T” more frequently than incorporates the correct “A.” We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of “G” versus “A” method of Gening, abbreviated as “misGvA”). We provide unambiguous proof of the “misGvA” approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The “misGvA” activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts. PMID:21304950

  18. Pif1 helicase and Polδ promote recombination-coupled DNA synthesis via bubble migration

    PubMed Central

    Wilson, Marenda A.; Kwon, YoungHo; Xu, Yuanyuan; Chung, Woo-Hyun; Chi, Peter; Niu, Hengyao; Mayle, Ryan; Chen, Xuefeng; Malkova, Anna; Sung, Patrick; Ira, Grzegorz

    2013-01-01

    During DNA repair by homologous recombination (HR), DNA synthesis copies information from a template DNA molecule. Multiple DNA polymerases have been implicated in repair-specific DNA synthesis1–3, but it has remained unclear whether a DNA helicase is involved in this reaction. A good candidate is Pif1, an evolutionarily conserved helicase in S. cerevisiae important for break-induced replication (BIR)4 as well as HR-dependent telomere maintenance in the absence of telomerase5 found in 10–15% of all cancers6. Pif1 plays a role in DNA synthesis across hard-to-replicate sites7, 8 and in lagging strand synthesis with Polδ9–11. Here we provide evidence that Pif1 stimulates DNA synthesis during BIR and crossover recombination. The initial steps of BIR occur normally in Pif1-deficient cells, but Polδ recruitment and DNA synthesis are decreased, resulting in premature resolution of DNA intermediates into half crossovers. Purified Pif1 protein strongly stimulates Polδ-mediated DNA synthesis from a D-loop made by the Rad51 recombinase. Importantly, Pif1 liberates the newly synthesized strand to prevent the accumulation of topological constraint and to facilitate extensive DNA synthesis via the establishment of a migrating D-loop structure. Our results uncover a novel function of Pif1 and provide insights into the mechanism of HR. PMID:24025768

  19. Replication stress activates DNA repair synthesis in mitosis.

    PubMed

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach. PMID:26633632

  20. Synthesis of Mitochondrial DNA Precursors during Myogenesis, an Analysis in Purified C2C12 Myotubes*

    PubMed Central

    Frangini, Miriam; Franzolin, Elisa; Chemello, Francesco; Laveder, Paolo; Romualdi, Chiara; Bianchi, Vera; Rampazzo, Chiara

    2013-01-01

    During myogenesis, myoblasts fuse into multinucleated myotubes that acquire the contractile fibrils and accessory structures typical of striated skeletal muscle fibers. To support the high energy requirements of muscle contraction, myogenesis entails an increase in mitochondrial (mt) mass with stimulation of mtDNA synthesis and consumption of DNA precursors (dNTPs). Myotubes are quiescent cells and as such down-regulate dNTP production despite a high demand for dNTPs. Although myogenesis has been studied extensively, changes in dNTP metabolism have not been examined specifically. In differentiating cultures of C2C12 myoblasts and purified myotubes, we analyzed expression and activities of enzymes of dNTP biosynthesis, dNTP pools, and the expansion of mtDNA. Myotubes exibited pronounced post-mitotic modifications of dNTP synthesis with a particularly marked down-regulation of de novo thymidylate synthesis. Expression profiling revealed the same pattern of enzyme down-regulation in adult murine muscles. The mtDNA increased steadily after myoblast fusion, turning over rapidly, as revealed after treatment with ethidium bromide. We individually down-regulated p53R2 ribonucleotide reductase, thymidine kinase 2, and deoxyguanosine kinase by siRNA transfection to examine how a further reduction of these synthetic enzymes impacted myotube development. Silencing of p53R2 had little effect, but silencing of either mt kinase caused 50% mtDNA depletion and an unexpected decrease of all four dNTP pools independently of the kinase specificity. We suggest that during development of myotubes the shortage of even a single dNTP may affect all four pools through dysregulation of ribonucleotide reduction and/or dissipation of the non-limiting dNTPs during unproductive elongation of new DNA chains. PMID:23297407

  1. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  2. Synthesis and dissolution of hemicatenanes by type IA DNA topoisomerases

    PubMed Central

    Lee, Shun-Hsiao; Siaw, Grace Ee-Lu; Willcox, Smaranda; Griffith, Jack D.; Hsieh, Tao-Shih

    2013-01-01

    Type IA DNA topoisomerases work with a unique mechanism of strand passage through an enzyme-bridged, ssDNA gate, thus enabling them to carry out diverse reactions in processing structures important for replication, recombination, and repair. Here we report a unique reaction mediated by an archaeal type IA topoisomerase, the synthesis and dissolution of hemicatenanes. We cloned, purified, and characterized an unusual type IA enzyme from a hyperthermophilic archaeum, Nanoarchaeum equitans, which is split into two pieces. The recombinant heterodimeric enzyme has the expected activities in its preference of relaxing negatively supercoiled DNA. Its amino acid sequence and cleavage site sequence analysis suggest that it is topoisomerase III, and therefore we named it “NeqTop3.” At high enzyme concentrations, NeqTop3 can generate high-molecular-weight DNA networks. Biochemical and electron microscopic data indicate that the DNA networks are connected through hemicatenane linkages. The hemicatenane formation likely is mediated by the single-strand passage through denatured bubbles in the substrate DNA under high temperature. NeqTop3 at lower concentrations can reverse hemicatenanes. A complex of human topoisomerase 3α, Bloom helicase, and RecQ-mediated genome instability protein 1 and 2 can partially disentangle the hemicatenane network. Both the formation and dissolution of hemicatenanes by type IA topoisomerases demonstrate that these enzymes have an important role in regulating intermediates from replication, recombination, and repair. PMID:24003117

  3. Enhanced GSH synthesis by Bisphenol A exposure promoted DNA methylation process in the testes of adult rare minnow Gobiocypris rarus.

    PubMed

    Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao

    2016-09-01

    DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. PMID:27474941

  4. FOB1 affects DNA topoisomerase I in vivo cleavages in the enhancer region of the Saccharomyces cerevisiae ribosomal DNA locus

    PubMed Central

    Di Felice, Francesca; Cioci, Francesco; Camilloni, Giorgio

    2005-01-01

    In Saccharomyces cerevisiae the FOB1 gene affects replication fork blocking activity at the replication fork block (RFB) sequences and promotes recombination events within the rDNA cluster. Using in vivo footprinting assays we mapped two in vivo Fob1p-binding sites, RFB1 and RFB3, located in the rDNA enhancer region and coincident with those previously reported to be in vitro binding sites. We previously provided evidences that DNA topoisomerase I is able to cleave two sites within this region. The results reported in this paper, indicate that the DNA topoisomerase I cleavage specific activity at the enhancer region is affected by the presence of Fob1p and independent of replication and transcription activities. We thus hypothesize that the binding to DNA of Fob1p itself may be the cause of the DNA topoisomerase I activity in the rDNA enhancer. PMID:16269824

  5. Mutants affecting nucleotide recognition by T7 DNA polymerase.

    PubMed

    Donlin, M J; Johnson, K A

    1994-12-13

    Analysis of two mutations affecting nucleotide selection by the DNA polymerase from bacteriophage T7 is reported here. Two conserved residues (Glu480 and Tyr530) in the polymerase active site of an exonuclease deficient (exo-) T7 DNA polymerase were mutated using site-directed mutagenesis (Glu480-Asp and Tyr530-Phe). The kinetic and equilibrium constants governing DNA binding, nucleotide incorporation, and pyrophosphorolysis were measured with the mutants E480D(exo-) and Y530F(exo-) in single-turnover experiments using rapid chemical quench-flow methods. Both mutants have slightly lower Kd values for DNA binding compared to that of wild-type(exo-). With Y530F(exo-) the ground state nucleotide binding affinity was unchanged from wild-type for dGTP and dCTP, was 2-fold lower for dATP and 8-10-fold lower for dTTP binding. With E480D(exo-), the binding constants were 5-6-fold lower for dATP, dGTP, and dCTP and 40-fold lower for dTTP binding compared to those constants for wild-type(exo-). The significance of a specific destabilization of dTTP binding by these amino acids was examined using a dGTP analog, deoxyinosine triphosphate, which mimics the placement and number of hydrogen bonds of an A:T base pair. The Kd for dCTP opposite inosine was unchanged with wild-type(exo-) (197 microM) but higher with Y530F(exo-) (454 microM) and with E480D(exo-) (1 mM). The Kd for dITP was the same with wild-type(exo-) (180 microM) and Y530F(exo-) (229 microM), but significantly higher with E480D(exo-) (3.2 mM). These data support the suggestion that E480 selectively stabilizes dTTP in the wild-type enzyme, perhaps by hydrogen bonding to the unbonded carbonyl. Data on the incorporation of dideoxynucleotide analogs were consistent with the observation of a selective stabilization of dTTP by both residues. Pyrophosphorolysis experiments revealed that neither mutation had a significant effect on the chemistry of polymerization. The fidelity of the mutants were examined in

  6. [The biological effect of Y-family DNA polymerases on the translesion synthesis].

    PubMed

    Gong, Yi; Yang, Jin

    2013-02-01

    A common DNA polymerase can replicate DNA which functions normally. However, if DNA suffers damage, the genome can not be replicated by a common DNA polymerase because DNA lesions will block the replication apparatus. Another kind of DNA polymerases in organism, Y-family DNA polymerases which is also called translesion synthesis (TLS) polymerases, can deal with this problem. Their main functions are bypassing the lesions in DNA, replicating the genome and saving the dying cells. This thesis presents a historical review of the literature pertinent to the structure, functions and roles of Y-family DNA polymerases. PMID:23488167

  7. DNA replication and unscheduled DNA synthesis in lungs of mice exposed to cigarette smoke

    SciTech Connect

    Rasmussen, R.E.; Boyd, C.H.; Dansie, D.R.; Kouri, R.E.; Henry, C.J.

    1981-07-01

    Mice of the hybrid strain BC3F1/Cum (C57BL/Cum X C3H/AnfCum) were chronically exposed to measured amounts of machine-generated whole Kentucky reference 2A1 cigarette smoke. DNA replication and unscheduled DNA synthesis (UDS) were measured in lung tissue in vitro using a short-term organ culture method. Within one week of beginning smoke exposure, DNA replicative activity, as indicated by incorporation of (3H)-thymidine into total lung DNA, was increased more than two-fold over sham-exposed controls and remained elevated as long as smoke exposure was continued. Treatment of lung tissues in vitro with either the lung carcinogen 4-nitroquinoline-1-oxide or methylmethane sulfonate stimulated UDS, measured as incorporation of (3H)thymidine into lung DNA in the presence of hydroxyurea, presumably as the result of DNA repair activity. Until the 10th to 12th week of smoke exposure, at which time the accumulated deposition of total particulate material in the lung was approximately 40 mg, the level of UDS stimulated by the alkylating chemicals declined to approximately 50% of that seen in lung tissue from sham-exposed control mice. If the mice were removed from smoke exposure, DNA replicative activity returned to normal levels within one week, but the UDS response to DNA damage remained depressed up to five months after ending smoke exposure. The results show that both transient and apparently permanent changes are produced in mouse lung as the result of exposure to cigarette smoke. The role of these changes in lung neoplasia is under investigation.

  8. Synthesis of type 2 Adenovirus DNA in the Presence of Cycloheximide

    PubMed Central

    Horwitz, Marshall S.; Brayton, Carol; Baum, Stephen G.

    1973-01-01

    Adenovirus type 2 DNA synthesis, either in permissive human cells or nonpermissive monkey cells, becomes independent of protein synthesis after the appearance of progeny viral DNA. In the presence of cycloheximide, semiconservative replication and initiation of progeny molecules can occur. PMID:4349494

  9. DNA (DEOXYRIBONUCLEIC ACID) SYNTHESIS FOLLOWING MICROINJECTION OF HETEROLOGOUS SPERM AND SOMATIC CELL NUCLEI INTO HAMSTER OOCYTES

    EPA Science Inventory

    The authors have investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in 3H-thymidine after being parthenogenetically activated by sha...

  10. DNA precursor compartmentation in mammalian cells: metabolic and antimetabolic studies of nuclear and mitochondrial DNA synthesis

    SciTech Connect

    Bestwick, R.K.

    1983-01-01

    HeLa cells were used for the quantitation of cellular and mitochondrial deoxyribonucleoside triphosphate (dNTP) and ribonucleoside triphosphate (rNTP) pools and of changes in pools in response to treatment with the antimetabolites methotrexate (mtx) and 5-fluorodeoxyuridine (FUdR). Use of an enzymatic assay of dNTPs and of improved nucleotide extraction methods allowed quantitation of mitochondrial dNTP pools. All four mitochondrial dNTP pools expand following treatment with mtx or FUdR whereas cellular dTTP and dGTP pools are depleted. Mitochrondrial rNTP pools were also found to expand in response to these antimetabolites. Mouse L-cells were used to determine the relative contributions of an exogenously supplied precursor to nuclear and mitochrondrial DNA replication. Cells were labeled to near steady state specific activities with /sup 32/P-orthophosphate and subsequently labeled with (/sup 3/H)uridine, a general pyrimidine precursor, in the continuing presence of /sup 32/P. Deoxyribonucleoside monophosphates derived from these DNAs were separated by HPLC and the /sup 3/H//sup 32/P ratio in each pyrimidine determined. The dCMP residues in mitochondrial DNA (mtDNA) were found to be derived exclusively from the exogenous supplied uridine. The dTMP residues from nuclear and mtDNA and the dCMP residues from nuclear DNA were seen to be synthesized partly from exogenous sources and partly from other sources, presumably de novo pyrimidine synthesis.

  11. ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

    PubMed

    Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

    2016-07-15

    Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. PMID:27418514

  12. Divalent ions attenuate DNA synthesis by human DNA polymerase α by changing the structure of the template/primer or by perturbing the polymerase reaction.

    PubMed

    Zhang, Yinbo; Baranovskiy, Andrey G; Tahirov, Emin T; Tahirov, Tahir H; Pavlov, Youri I

    2016-07-01

    DNA polymerases (pols) are sophisticated protein machines operating in the replication, repair and recombination of genetic material in the complex environment of the cell. DNA pol reactions require at least two divalent metal ions for the phosphodiester bond formation. We explore two understudied roles of metals in pol transactions with emphasis on polα, a crucial enzyme in the initiation of DNA synthesis. We present evidence that the combination of many factors, including the structure of the template/primer, the identity of the metal, the metal turnover in the pol active site, and the influence of the concentration of nucleoside triphosphates, affect DNA pol synthesis. On the poly-dT70 template, the increase of Mg(2+) concentration within the range typically used for pol reactions led to the severe loss of the ability of pol to extend DNA primers and led to a decline in DNA product sizes when extending RNA primers, simulating the effect of "counting" of the number of nucleotides in nascent primers by polα. We suggest that a high Mg(2+) concentration promotes the dynamic formation of unconventional DNA structure(s), thus limiting the apparent processivity of the enzyme. Next, we found that Zn(2+) supported robust polα reactions when the concentration of nucleotides was above the concentration of ions; however, there was only one nucleotide incorporation by the Klenow fragment of DNA pol I. Zn(2+) drastically inhibited polα, but had no effect on Klenow, when Mg(2+) was also present. It is possible that Zn(2+) perturbs metal-mediated transactions in pol active site, for example affecting the step of pyrophosphate removal at the end of each pol cycle necessary for continuation of polymerization. PMID:27235627

  13. Misincorporation during DNA synthesis, analyzed by gel electrophoresis.

    PubMed Central

    Hillebrand, G G; McCluskey, A H; Abbott, K A; Revich, G G; Beattie, K L

    1984-01-01

    A method has been developed for simultaneous comparison of the propensity of a DNA polymerase to misincorporate at different points on a natural template-primer. In this method elongation of a [5'-32P] primer, annealed to a bacteriophage template strand, is carried out in the presence of only three dNTPs (highly purified by HPLC). Under these conditions the rate of primer elongation (monitored by gel electrophoresis/autoradiography) is limited by the rate of misincorporation at template positions complementary to the missing dNTP. Variations in the rate of elongation (revealed by autoradiographic banding patterns) reflect variations in the propensity for misincorporation at different positions along the template. The effect on primer elongation produced by addition of a chemically modified dNTP to 'minus' reactions reveals the mispairing potential of the modified nucleotide during DNA synthesis. By use of this electrophoretic assay of misincorporation we have demonstrated that the fidelity of E. coli DNA polymerase I varies greatly at different positions along a natural template, and that BrdUTP and IodUTP can be incorporated in place of dCTP during chain elongation catalyzed by this enzyme. Images PMID:6326053

  14. In vivo measurement of unscheduled DNA synthesis and S-phase synthesis as an indicator of hepatocarcinogenesis in rodents.

    PubMed

    Mirsalis, J C

    1987-06-01

    Measurement of chemically induced DNA repair as unscheduled DNA synthesis in rodent liver following in vivo treatment is a useful screen for potential hepatocarcinogens. In addition to measurement of unscheduled DNA synthesis, examination of S-phase synthesis provides an indicator of chemically induced cell proliferation in the liver, which may be a basis for hepatic tumor promotion. Several chemicals and classes of chemicals have been examined using these end points. The pyrrolizidine alkaloid riddelline is a potent genotoxic agent in vitro, and in vivo studies confirm this response as riddelline induces significant elevations in unscheduled DNA synthesis and S-phase synthesis in rat liver. Conversely, H.C. Blue dyes #1 and #2 are both potent genotoxic agents in vitro but fail to express this genotoxicity in vivo. H.C. Blue #1 induces significant increases in S-phase synthesis in B6C3F1 mouse liver, which correlates with the observed carcinogenicity of this compound. Halogenated hydrocarbons likewise fail to induce unscheduled DNA synthesis in vivo, but many of these compounds do increase hepatic cell proliferation in mice, which may be the principal mechanism of hepatocarcinogenesis in this species. PMID:3507253

  15. Structural basis of high-fidelity DNA synthesis by yeast DNA polymerase [delta

    SciTech Connect

    Swan, Michael K.; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2009-09-25

    DNA polymerase {delta} (Pol {delta}) is a high-fidelity polymerase that has a central role in replication from yeast to humans. We present the crystal structure of the catalytic subunit of yeast Pol {delta} in ternary complex with a template primer and an incoming nucleotide. The structure, determined at 2.0-{angstrom} resolution, catches the enzyme in the act of replication, revealing how the polymerase and exonuclease domains are juxtaposed relative to each other and how a correct nucleotide is selected and incorporated. The structure also reveals the 'sensing' interactions near the primer terminus, which signal a switch from the polymerizing to the editing mode. Taken together, the structure provides a chemical basis for the bulk of DNA synthesis in eukaryotic cells and a framework for understanding the effects of cancer-causing mutations in Pol {delta}.

  16. Relationship between DNA adduct formation and unscheduled DNA synthesis (UDS) in cultured mouse epidermal keratinocytes

    SciTech Connect

    Gill, R.D.; Nettikumara, A.N.; DiGiovanni, J. ); Butterworth, B.E. )

    1991-01-01

    Primary cultures of mouse epidermal keratinocytes from SENCAR mice were treated with 7,12-dimethylbenz(a)anthracene (DMBA), benzo(a)pyrene (B(a)P), ({plus minus}) 7{beta}-8{alpha}-dihydroxy-9{alpha},10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus}) anti-BPDE), and ({plus minus}) 7{beta},8{alpha}-dihydroxy-9{beta},10{beta}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (({plus minus})syn-BPDE) to examine the relationship between DNA adduct formation and the induction of unscheduled DNA synthesis (UDS). DNA adducts were measured as pmol hydrocarbon bound per mg of DNA, and UDS was quantitated autoradiographically as net grains per nucleus. A good correlation was observed between the levels of UDS detected and the amount of DNA adducts present int he cell population when comparing similar compounds within the linear dose-response range of 0.005 {mu}g/ml-0.25 {mu}g/ml. These results suggest that the present UDS assay with MEKs is a useful assay for the rapid screening of potential genotoxic agents. However, the limits of sensitivity are such that the current assay may be unable to detect a low level of DNA damage induced by some weakly genotoxic (carcinogenic) agents. In addition, while the limits of sensitivity determined in these experiments apply to the polycyclic aromatic hydrocarbon class, other classes of genotoxic compounds such as alkylating agents or crosslinking agents may exhibit different thresholds of detection.

  17. Synthesis and self-assembly of DNA-chromophore hybrid amphiphiles.

    PubMed

    Albert, Shine K; Golla, Murali; Thelu, Hari Veera Prasad; Krishnan, Nithiyanandan; Deepak, Perapaka; Varghese, Reji

    2016-08-01

    DNA based spherical nanostructures are one of the promising nanostructures for several biomedical and biotechnological applications due to their excellent biocompatibility and DNA-directed surface addressability. Herein, we report the synthesis and amphiphilicity-driven self-assembly of two classes of DNA (hydrophilic)-chromophore (hydrophobic) hybrid amphiphiles into spherical nanostructures. A solid-phase "click" chemistry based modular approach is demonstrated for the synthesis of DNA-chromophore amphiphiles. Various spectroscopic and microscopic analyses reveal the self-assembly of the amphiphiles into vesicular and micellar assemblies with the corona made of hydrophilic DNA and the hydrophobic chromophoric unit as the core of the spherical nanostructures. PMID:27241196

  18. Integrating S-phase Checkpoint Signaling with Trans-Lesion Synthesis of Bulky DNA Adducts

    PubMed Central

    Barkley, Laura R.; Ohmori, Haruo; Vaziri, Cyrus

    2011-01-01

    Bulky adducts are DNA lesions generated in response to environmental agents including benzo[a]pyrene (a combustion product) and solar ultraviolet radiation. Error-prone replication of adducted DNA can cause mutations, which may result in cancer. To minimize the detrimental effects of bulky adducts and other DNA lesions, S-phase checkpoint mechanisms sense DNA damage and integrate DNA repair with ongoing DNA replication. The essential protein kinase Chk1 mediates the S-phase checkpoint, inhibiting initiation of new DNA synthesis and promoting stabilization and recovery of stalled replication forks. Here we review the mechanisms by which Chk1 is activated in response to bulky adducts and potential mechanisms by which Chk1 signaling inhibits the initiation stage of DNA synthesis. Additionally, we discuss mechanisms by which Chk1 signaling facilitates bypass of bulky lesions by specialized Y-family DNA polymerases, thereby attenuating checkpoint signaling and allowing resumption of normal cell cycle progression. PMID:17652783

  19. Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

    SciTech Connect

    Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

    1982-12-01

    Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-dalton DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.

  20. The trypanocidal activity of the alkaloid oliverine involves inhibition of DNA synthesis.

    PubMed

    Garro, H A; Juri Ayub, M; Nieto, M; Lucero Estrada, C; Pungitore, C R; Tonn, C E

    2010-01-01

    The Trypanosoma cruzi parasite is an etiologic agent of the American trypanosomiasis called Chagas disease. This pathology affects more than 24 million persons and represents one of the most important public health problems in Latin America. Taking into account this, it is necessary the search of new antitrypanosomal agents that show a major level of efficacy and minor indexes of toxicity in affected patients. Vast source of them are the natural products from plants with enormous structural diversity. A particular type of these compounds is represented by aporphinoid alkaloids. In our experiments, anonaine (2), oliverine (3) and guatterine (5) displayed antitrypanosomal activity. The compound 3 showed the most important activity with an IC50 = 12.00 ± 0.36 μM. Its mechanism of action may include inhibition of DNA synthesis. PMID:20937218

  1. Unscheduled DNA Synthesis: The Clinical and Functional Assay for Global Genomic DNA Nucleotide Excision Repair

    PubMed Central

    Latimer, Jean J.; Kelly, Crystal M.

    2016-01-01

    The unscheduled DNA synthesis (UDS) assay measures the ability of a cell to perform global genomic nucleotide excision repair (NER). This chapter provides instructions for the application of this technique by creating 6-4 photoproducts and pyrimidine dimers using UV-C irradiation. This procedure is designed specifically for quantification of the 6-4 photoproducts. Repair is quantified by the amount of radioactive thymidine incorporated during repair synthesis after this insult, and radioactivity is evaluated by grain counting after autoradiography. The results are used to clinically diagnose human DNA repair deficiency disorders and provide a basis for investigation of repair deficiency in human tissues or tumors. No other functional assay is available that directly measures the capacity to perform NER on the entire genome without the use of specific antibodies. Since live cells are required for this assay, explant culture techniques must be previously established. Host cell reactivation (HCR), as discussed in Chapter 37, is not an equivalent technique, as it measures only transcription-coupled repair (TCR) at active genes, a small subset of total NER. PMID:24623250

  2. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  3. Synthesis and properties of mirror-image DNA.

    PubMed Central

    Urata, H; Ogura, E; Shinohara, K; Ueda, Y; Akagi, M

    1992-01-01

    We have investigated the conformations of the hexadeoxyribonucleotide, L-d(CGCGCG) composed of L-deoxyribose, the mirror image molecule of natural D-deoxyribose. In this paper, we report the synthesis of four L-deoxynucleosides and the L-oligonucleotide-ethidium bromide interactions. The L-deoxyribose synthon 9 was synthesized from L-arabinose with an over all yield of 28.5% via the Barton-McCombie reaction. The L-deoxynucleosides were obtained by a glycosylation of appropriate nucleobase derivatives with the 1-chloro sugar 9. After derivatization to nucleoside phosphoramidites, L-deoxycytidine and L-deoxyguanosine were incorporated into a hexadeoxynucleotide, L-d(CGCGCG) by a solid-phase beta-cyanoethylphosphoramidite method. This L-hexanucleotide was resistant to digestion with nuclease P1. The conformations of L-d(CGCGCG) were an exact mirror image of that of the corresponding natural one as described previously, and the conformations of the L-d(CGCGCG)-ethidium bromide complex were also the mirror images of those of the D-d(CGCGCG)-ethidium bromide complex under both low and high salt conditions. These results suggest that ethidium bromide prefers not a right-handed helical sense, but the base-base stacking geometry of the B-form rather than that of the Z-form. Thus, L-DNA would be a useful tool for studying DNA-drug interactions. PMID:1630904

  4. Method and apparatus for synthesis of arrays of DNA probes

    DOEpatents

    Cerrina, Francesco; Sussman, Michael R.; Blattner, Frederick R.; Singh-Gasson, Sangeet; Green, Roland

    2002-04-23

    The synthesis of arrays of DNA probes sequences, polypeptides, and the like is carried out using a patterning process on an active surface of a substrate. An image is projected onto the active surface of the substrate utilizing an image former that includes a light source that provides light to a micromirror device comprising an array of electronically addressable micromirrors, each of which can be selectively tilted between one of at least two positions. Projection optics receives the light reflected from the micromirrors along an optical axis and precisely images the micromirrors onto the active surface of the substrate, which may be used to activate the surface of the substrate. The first level of bases may then be applied to the substrate, followed by development steps, and subsequent exposure of the substrate utilizing a different pattern of micromirrors, with further repeats until the elements of a two dimensional array on the substrate surface have an appropriate base bound thereto. The micromirror array can be controlled in conjunction with a DNA synthesizer supplying appropriate reagents to a flow cell containing the active substrate to control the sequencing of images presented by the micromirror array in coordination of the reagents provided to the substrate.

  5. Sequence rearrangement and duplication of double stranded fibronectin cDNA probably occurring during cDNA synthesis by AMV reverse transcriptase and Escherichia coli DNA polymerase I.

    PubMed Central

    Fagan, J B; Pastan, I; de Crombrugghe, B

    1980-01-01

    Two cloned cDNAs derived from the mRNA for cell fibronectin have been sequenced, providing evidence that transcription with AMV reverse transcriptase or Escherichia coli DNA polymerase I may not always result in double stranded cDNA that is exactly homologous with its mRNA template. Instead, the sequences of these cloned cDNAs are consistent with the duplication and rearrangement of sequences during synthesis of double stranded cDNA. PMID:6159581

  6. Does varicocelectomy affect DNA fragmentation in infertile patients?

    PubMed Central

    Telli, Onur; Sarici, Hasmet; Kabar, Mucahit; Ozgur, Berat Cem; Resorlu, Berkan; Bozkurt, Selen

    2015-01-01

    Introduction: The aims of this study were to investigate the effect of varicocelectomy on DNA fragmentation index and semen parameters in infertile patients before and after surgical repair of varicocele. Materials and Methods: In this prospective study, 72 men with at least 1-year history of infertility, varicocele and oligospermia were examined. Varicocele sperm samples were classified as normal or pathological according to the 2010 World Health Organization guidelines. The acridine orange test was used to assess the DNA fragmentation index (DFI) preoperatively and postoperatively. Results: DFI decreased significantly after varicocelectomy from 34.5% to 28.2% (P = 0.024). In addition all sperm parameters such as mean sperm count, sperm concentration, progressive motility and sperm morphology significantly increased from 19.5 × 106 to 30.7 × 106, 5.4 × 106/ml to 14.3 × 106/ml, and 19.9% to 31.2% (P < 0.001) and 2.6% to 3.1% (P = 0.017). The study was limited by the loss to follow-up of some patients and unrecorded pregnancy outcome due to short follow-up. Conclusion: Varicocele causes DNA-damage in spermatozoa. We suggest that varicocelectomy improves sperm parameters and decreases DFI. PMID:25878412

  7. Nicotine inhibits collagen synthesis and alkaline phosphatase activity, but stimulates DNA synthesis in osteoblast-like cells

    SciTech Connect

    Ramp, W.K.; Lenz, L.G.; Galvin, R.J. )

    1991-05-01

    Use of smokeless tobacco is associated with various oral lesions including periodontal damage and alveolar bone loss. This study was performed to test the effects of nicotine on bone-forming cells at concentrations that occur in the saliva of smokeless tobacco users. Confluent cultures of osteoblast-like cells isolated from chick embryo calvariae were incubated for 2 days with nicotine added to the culture medium (25-600 micrograms/ml). Nicotine inhibited alkaline phosphatase in the cell layer and released to the medium, whereas glycolysis (as indexed by lactate production) was unaffected or slightly elevated. The effects on medium and cell layer alkaline phosphatase were concentration dependent with maximal inhibition occurring at 600 micrograms nicotine/ml. Nicotine essentially did not affect the noncollagenous protein content of the cell layer, but did inhibit collagen synthesis (hydroxylation of ({sup 3}H)proline and collagenase-digestible protein) at 100, 300, and 600 micrograms/ml. Release of ({sup 3}H)hydroxyproline to the medium was also decreased in a dose-dependent manner, as was the collagenase-digestible protein for both the medium and cell layer. In contrast, DNA synthesis (incorporation of ({sup 3}H)thymidine) was more than doubled by the alkaloid, whereas total DNA content was slightly inhibited at 600 micrograms/ml, suggesting stimulated cell turnover. Morphologic changes occurred in nicotine-treated cells including rounding up, detachment, and the occurrence of numerous large vacuoles. These results suggest that steps to reduce the salivary concentration of nicotine in smokeless tobacco users might diminish damaging effects of this product on alveolar bone.

  8. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    PubMed

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  9. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  10. Persistence of DNA in Carcasses, Slime and Avian Feces May Affect Interpretation of Environmental DNA Data

    PubMed Central

    Merkes, Christopher M.; McCalla, S. Grace; Jensen, Nathan R.; Gaikowski, Mark P.; Amberg, Jon J.

    2014-01-01

    The prevention of non-indigenous aquatic invasive species spreading into new areas is a goal of many resource managers. New techniques have been developed to survey for species that are difficult to capture with conventional gears that involve the detection of their DNA in water samples (eDNA). This technique is currently used to track the invasion of bigheaded carps (silver carp and bighead carp; Hypophthalmichthys molitrix and H. nobilis) in the Chicago Area Waterway System and Upper Mississippi River. In both systems DNA has been detected from silver carp without the capture of a live fish, which has led to some uncertainty about the source of the DNA. The potential contribution to eDNA by vectors and fomites has not been explored. Because barges move from areas with a high abundance of bigheaded carps to areas monitored for the potential presence of silver carp, we used juvenile silver carp to simulate the barge transport of dead bigheaded carp carcasses, slime residue, and predator feces to determine the potential of these sources to supply DNA to uninhabited waters where it could be detected and misinterpreted as indicative of the presence of live bigheaded carp. Our results indicate that all three vectors are feasible sources of detectable eDNA for at least one month after their deposition. This suggests that current monitoring programs must consider alternative vectors of DNA in the environment and consider alternative strategies to minimize the detection of DNA not directly released from live bigheaded carps. PMID:25402206

  11. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  12. Radiation effects on DNA synthesis in a defined chromosomal replicon

    SciTech Connect

    Larner, J.M.; Lee, H.; Hamlin, J.L. )

    1994-03-01

    It has recently been shown that the tumor suppressor p53 mediates a signal transduction pathway that responds to DNA damage by arresting cells in the late G[sub 1] period of the cell cycle. However, the operation of this pathway alone cannot explain the 50% reduction in the rate of DNA synthesis that occurs within 30 min of irradiation of an asynchronous cell population. The authors are using the amplified dihydrofolate reductase (DHFR) domain in the methotrexate-resistance CHO cell line, CHOC 400, as a model replicon in which to study this acute radiation effect. They first show that the CHOC-400 cell line retains the classical acute-phase response but does not display the late G[sub 1] arrest that characterizes the p53-mediated checkpoint. Using a two-dimensional gel replicon-mapping method, they then show that when asynchronous cultures are irradiated with 900 cGy, initiation in the DHFR locus is completely inhibited within 30 min and does not resume for 3 to 4 h. Since initiation in this locus occurs throughout the first 2 h of the S period, this result implies the existence of a p53-independent S-phase damage-sensing pathway that functions at the level of individual origins. Results obtained with the replication inhibitor mimosine define a position near the G[sub 1]/S boundary beyond which cells are unable to prevent initiation at early-firing origins in response to irradiation. This is the first direct demonstration at a defined chromosomal origin that radiation quantitatively down-regulates initiation. 42 refs., 9 figs.

  13. DNA synthesis in yeast cell-free extracts dependent on recombinant DNA plasmids purified from Escherichia coli.

    PubMed Central

    Jong, A Y; Scott, J F

    1985-01-01

    In our attempts to establish a cell-free DNA replication system for the yeast Saccharomyces cerevisiae, we have observed that recombinant DNA plasmids purified from Escherichia coli by a common procedure (lysozyme-detergent lysis and equilibrium banding in cesium chloride ethidium bromide gradients) often serve as templates for DNA synthesis by elongation enzymes. The templates could be elongated equally well by enzymes present in the yeast cell-free extracts, by the large proteolytic fragment of E. coli DNA polymerase I or by T4 DNA polymerase. The template activity of the purified plasmids was dependent on the presence of heterologous DNA segments in the bacterial vectors. The template activity could be diminished by treatment with alkali. We propose that the ability of recombinant plasmids isolated from bacterial hosts to serve as elongation templates may lead to erroneous conclusions when these plasmids are used as templates for in vitro replication or transcription reactions. Images PMID:3889851

  14. Short-step chemical synthesis of DNA by use of MMTrS group for protection of 5'-hydroxyl group.

    PubMed

    Shiraishi, Miyuki; Utagawa, Eri; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2007-01-01

    4-methoxytrithylthio (MMTrS) group was applied for the appropriately protected four canonical nucleosides. We prepared the phosphoroamidite units by use of these nucleosides and developed the synthesis of oligodeoxynucleotides without any acidic treatment. Moreover, the new DNA synthesis protocol was applied to an automated DNA synthesizer for the synthesis of longer oligodeoxynucleotides. PMID:18029620

  15. RecG Directs DNA Synthesis during Double-Strand Break Repair

    PubMed Central

    Azeroglu, Benura; Mawer, Julia S. P.; Cockram, Charlotte A.; White, Martin A.; Hasan, A. M. Mahedi; Filatenkova, Milana; Leach, David R. F.

    2016-01-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability. PMID:26872352

  16. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    SciTech Connect

    Lee, E.W.; Johnson, J.T.; Garner, C.D. )

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of ({sup 3}H)thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 {mu}M. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of ({sup 3}H)thymidine triphosphate into DNA up to 24 {mu}M but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase {alpha}, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase {alpha}, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause.

  17. Inhibition of mouse peritoneal macrophage DNA synthesis by infection with the arenavirus Pichinde.

    PubMed Central

    Friedlander, A M; Jahrling, P B; Merrill, P; Tobery, S

    1984-01-01

    Macrophage DNA synthesis and proliferation occur during the development of cell-mediated immunity and in the early nonspecific reaction to infection. Arenaviruses have a predilection for infection of cells of the reticuloendothelial system, and in this study we have examined the effect of the arenavirus Pichinde on macrophage DNA synthesis. We have found that infection of mouse peritoneal macrophages with Pichinde caused a profound dose-dependent inhibition of the DNA synthesis induced by macrophage growth factor-colony stimulating factor. At a multiplicity of inoculum of 5, there is a 75 to 95% inhibition of DNA synthesis. Viable virus is necessary for inhibition since Pichinde inactivated by heat or cobalt irradiation had no effect. Similarly, virus pretreated with an antiserum to Pichinde was without inhibitory effect. Inhibition was demonstrated by measuring DNA synthesis spectrofluorometrically as well as by [3H]thymidine incorporation. The inhibition of DNA synthesis was not associated with any cytopathology. There was no evidence that the inhibition was due to soluble factors, such as prostaglandins or interferon, released by infected cells. These studies demonstrate, for the first time in vitro, a significant alteration in macrophage function caused by infection with an arenavirus. It is possible that inhibition of macrophage proliferation represents a mechanism by which some microorganisms interfere with host resistance. PMID:6690404

  18. Estrogen-induced DNA synthesis in vascular endothelial cells is mediated by ROS signaling

    PubMed Central

    Felty, Quentin

    2006-01-01

    Background Since estrogen is known to increase vascular endothelial cell growth, elevated estrogen exposure from hormone replacement therapy or oral contraceptives has the potential to contribute in the development of abnormal proliferative vascular lesions and subsequent thickening of the vasculature. How estrogen may support or promote vascular lesions is not clear. We have examined in this study whether estrogen exposure to vascular endothelial cells increase the formation of reactive oxygen species (ROS), and estrogen-induced ROS is involved in the growth of endothelial cells. Methods The effect of estrogen on the production of intracellular oxidants and the role of estrogen-induced ROS on cell growth was studied in human umbilical vein endothelial cells. ROS were measured by monitoring the oxidation of 2'7'-dichlorofluorescin by spectrofluorometry. Endothelial cell growth was measured by a colorimetric immunoassay based on BrdU incorporation into DNA. Results Physiological concentrations of estrogen (367 fmol and 3.67 pmol) triggered a rapid 2-fold increase in intracellular oxidants in endothelial cells. E2-induced ROS formation was inhibited to basal levels by cotreatment with the mitochondrial inhibitor rotenone (2 μM) and xanthine oxidase inhibitor allopurinol (50 μM). Inhibitors of NAD(P)H oxidase, apocynin and DPI, did not block E2-induced ROS formation. Furthermore, the NOS inhibitor, L-NAME, did not prevent the increase in E2-induced ROS. These findings indicate both mitochondria and xanthine oxidase are the source of ROS in estrogen treated vascular endothelial cells. E2 treated cells showed a 2-fold induction of BrdU incorporation at 18 h which was not observed in cells exposed to vehicle alone. Cotreatment with ebselen (20 μM) and NAC (1 mM) inhibited E2-induced BrdU incorporation without affecting the basal levels of DNA synthesis. The observed inhibitory effect of NAC and ebselen on E2-induced DNA synthesis was also shown to be dose dependent

  19. Persistence of DNA in carcasses, slime and avian feces may affect interpretation of environmental DNA data

    USGS Publications Warehouse

    Merkes, Christopher M.; McCalla, S. Grace; Jensen, Nathan R.; Gaikowski, Mark P.; Amberg, Jon J.

    2014-01-01

    The prevention of non-indigenous aquatic invasive species spreading into new areas is a goal of many resource managers. New techniques have been developed to survey for species that are difficult to capture with conventional gears that involve the detection of their DNA in water samples (eDNA). This technique is currently used to track the invasion of bigheaded carps (silver carp and bighead carp; Hypophthalmichthys molitrix and H. nobilis) in the Chicago Area Waterway System and Upper Mississippi River. In both systems DNA has been detected from silver carp without the capture of a live fish, which has led to some uncertainty about the source of the DNA. The potential contribution to eDNA by vectors and fomites has not been explored. Because barges move from areas with a high abundance of bigheaded carps to areas monitored for the potential presence of silver carp, we used juvenile silver carp to simulate the barge transport of dead bigheaded carp carcasses, slime residue, and predator feces to determine the potential of these sources to supply DNA to uninhabited waters where it could be detected and misinterpreted as indicative of the presence of live bigheaded carp. Our results indicate that all three vectors are feasible sources of detectable eDNA for at least one month after their deposition. This suggests that current monitoring programs must consider alternative vectors of DNA in the environment and consider alternative strategies to minimize the detection of DNA not directly released from live bigheaded carps.

  20. Does organizational culture affect out-patient DNA (did not attend) rates?

    PubMed

    Jackson, S

    1997-01-01

    Government interest in health service "did not attend" (DNA) rates was seen to occur by accident, following which efforts to reduce DNAs have tended to concentrate on operational rather than strategic issues. Considers the effect hospital culture has had on DNA rates from an organizational and patient perspective. Identifies some of the key cultural issues that impacted on DNA rates by utilizing observation and telephone survey research methods. Concludes that, in the main, the lack of customer-oriented organizational culture was seen to affect DNA rates adversely within one NHS provider trust. PMID:10179096

  1. Synthesis, integration, and restriction and modification of mycoplasma virus L2 DNA

    SciTech Connect

    Dybvig, K.

    1981-01-01

    Mycoplasma virus L2 is an enveloped, nonlytic virus containing double-stranded, superhelical DNA. The L2 virion contains about 7 to 8 major proteins identified by SDS-polyacrylamide gel electrophoresis, but the virion has no discernible capsid structure. It has been suggested that the L2 virion is a DNA-protein condensation surrounded by a lipid-protein membrane. The host for mycoplasma virus L2 is Acholeplasma laidlawii. A. laidlawii has no cell wall and contains a small genome, 1 x 10/sup 9/ daltons, which is two to three times smaller than that of most bacteria. Infection of A. laidlawii by L2 is nonlytic. The studies in this thesis show that L2 DNA synthesis begins at about 1 hour of infection and lasts throughout the infection. Viral DNA synthesis is inhibited by chloramphenicol, streptomycin, and novobiocin. Packaging of L2 DNA into progeny virus is also inhibited by chloramphenicol and novobiocin. It is concluded that protein synthesis and probably DNA gyrase activity are required for L2 DNA synthesis, and for packaging of L2 DNA into progeny virus. DNA-DNA hybridization studies demonstrate that L2 DNA integrates into the host cell during infection, and subsequent to infection the cells are mycoplasma virus L2 lysogens. The viral site of integration has been roughly mapped. L2 virus is restricted and modified by A. laidlawii strains JA1 and K2. The nature of the modification in strain K2 has been elucidated. Two L2 variants containing insertions in the viral DNA were identified in these studies. Restriction endonuclease cleavage maps of these variants have been determined. DNA from L2 and another isolate of L2, MV-Lg-L 172, are compared in these studies. 74 references, 33 figures, 6 tables. (ACR)

  2. DNA SYNTHESIS IN THE FERTILIZING HAMSTER SPERM NUCLEUS: SPERM TEMPLATE AVAILABILITY AND EGG CYTOPLASMIC CONTROL

    EPA Science Inventory

    To assess the role of sperm template availability in the regulation of DNA synthesis, the morphological status of the fertilizing hamster sperm nucleus was correlated with its ability to synthesize DNA after in vivo and in vitro fertilization. Fertilized hamster eggs were incubat...

  3. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.

    2015-01-01

    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  4. DNA polymerase kappa deficiency does not affect somatic hypermutation in mice.

    PubMed

    Schenten, Dominik; Gerlach, Valerie L; Guo, Caixia; Velasco-Miguel, Susana; Hladik, Christa L; White, Charles L; Friedberg, Errol C; Rajewsky, Klaus; Esposito, Gloria

    2002-11-01

    Somatic hypermutation (SH) in B cells undergoing T cell-dependent immune responses generates high-affinity antibodies that provide protective immunity. Most current models of SH postulate the introduction of a nick into the DNA and subsequent replication-independent, error-prone short-patch synthesis by one or more DNA polymerases. The Pol kappa (DinB1) gene encodes a specialized mammalian DNA polymerase called DNA polymerase kappa (pol kappa), a member of the recently discovered Y family of DNA polymerases. The mouse PolK gene is expressed at high levels in the seminiferous tubules of the testis and in the adrenal cortex, and at lower levels in most other cells of the body including B lymphocytes. In vitro studies showed that pol kappa can act as an error-prone polymerase, although they failed to ascribe a clear function to this enzyme. The ability of pol kappa to generate mutations when extending primers on undamaged DNA templates identifies this enzyme as a potential candidate for the introduction of nucleotide changes in the immunoglobulin (Ig) genes during the process of SH. Here we show that pol kappa-deficient mice are viable, fertile and able to mount a normal immune response to the antigen (4-hydroxy-3-nitrophenyl)acetyl-chicken gamma-globulin (NP-GC). They also mutate their Ig genes normally. However, pol kappa-deficient embryonic fibroblasts are abnormally sensitive to killing following exposure to ultraviolet (UV) radiation, suggesting a role of pol kappa in translesion DNA synthesis. PMID:12555660

  5. Characterization of How DNA Modifications Affect DNA Binding by C2H2 Zinc Finger Proteins

    PubMed Central

    Patel, A.; Hashimoto, H.; Zhang, X.; Cheng, X.

    2016-01-01

    Much is known about vertebrate DNA methylation and oxidation; however, much less is known about how modified cytosine residues within particular sequences are recognized. Among the known methylated DNA-binding domains, the Cys2-His2 zinc finger (ZnF) protein superfamily is the largest with hundreds of members, each containing tandem ZnFs ranging from 3 to >30 fingers. We have begun to biochemically and structurally characterize these ZnFs not only on their sequence specificity but also on their sensitivity to various DNA modifications. Rather than following published methods of refolding insoluble ZnF arrays, we have expressed and purified soluble forms of ZnFs, ranging in size from a tandem array of two to six ZnFs, from seven different proteins. We also describe a fluorescence polarization assay to measure ZnFs affinity with oligonucleotides containing various modifications and our approaches for cocrystallization of ZnFs with oligonucleotides. PMID:27372763

  6. Effects of 3-aminobenzamide on DNA synthesis and cell cycle progression in Chinese hamster ovary cells

    SciTech Connect

    Schwartz, J.L.; Morgan, W.F.; Kapp, L.N.; Wolff, S.

    1983-01-01

    3-Aminobenzamide (3AB), in inhibitor of poly(ADP-ribose) polymerase, is a potent inducer of sister chromatid exchanges (SCEs). Because of the possible relation between SCEs and DNA synthesis, the effects of 3AB on DNA synthesis and cell cycle progression in Chinese hamster ovary (CHO) cells were examined. Unlike all other SCE-inducing agents whose effects on DNA synthesis have been studied, short term exposures (30-120 min) of 3AB did not inhibit the overall rate of DNA synthesis and this result was independent of the amount of bromodeoxyuridine (BrdU) in the DNA. Longer exposure times (>24 h) did result in an extended S phase, but this was not due to an effect on the rate of DNA chain elongation. 3AB also delayed the entry of cells into S phase. The overall cell cycle delay was dose dependent, approaching 9 h after a 54 h exposure to 10 mM 3AB. Earlier reports that 3AB is neither mutagenic nor cytotoxic were confirmed. Thus 3AB acts to increase SCE frequency by a mechanism distinct from that which causes cytotoxicity and mutagenicity, and does not involve any inhibition in the rate of DNA chain growth. 25 references, 3 figures, 2 tables.

  7. Multiple Post-translational Modifications Affect Heterologous Protein Synthesis*

    PubMed Central

    Tokmakov, Alexander A.; Kurotani, Atsushi; Takagi, Tetsuo; Toyama, Mitsutoshi; Shirouzu, Mikako; Fukami, Yasuo; Yokoyama, Shigeyuki

    2012-01-01

    Post-translational modifications (PTMs) are required for proper folding of many proteins. The low capacity for PTMs hinders the production of heterologous proteins in the widely used prokaryotic systems of protein synthesis. Until now, a systematic and comprehensive study concerning the specific effects of individual PTMs on heterologous protein synthesis has not been presented. To address this issue, we expressed 1488 human proteins and their domains in a bacterial cell-free system, and we examined the correlation of the expression yields with the presence of multiple PTM sites bioinformatically predicted in these proteins. This approach revealed a number of previously unknown statistically significant correlations. Prediction of some PTMs, such as myristoylation, glycosylation, palmitoylation, and disulfide bond formation, was found to significantly worsen protein amenability to soluble expression. The presence of other PTMs, such as aspartyl hydroxylation, C-terminal amidation, and Tyr sulfation, did not correlate with the yield of heterologous protein expression. Surprisingly, the predicted presence of several PTMs, such as phosphorylation, ubiquitination, SUMOylation, and prenylation, was associated with the increased production of properly folded soluble proteins. The plausible rationales for the existence of the observed correlations are presented. Our findings suggest that identification of potential PTMs in polypeptide sequences can be of practical use for predicting expression success and optimizing heterologous protein synthesis. In sum, this study provides the most compelling evidence so far for the role of multiple PTMs in the stability and solubility of heterologously expressed recombinant proteins. PMID:22674579

  8. Long-lived crowded-litter mice have an age-dependent increase in protein synthesis to DNA synthesis ratio and mTORC1 substrate phosphorylation

    PubMed Central

    Bruns, Danielle R.; Peelor, Frederick F.; Biela, Laurie M.; Miller, Richard A.; Hamilton, Karyn L.; Miller, Benjamin F.

    2014-01-01

    Increasing mouse litter size [crowded litter (CL)] presumably imposes a transient nutrient stress during suckling and extends lifespan through unknown mechanisms. Chronic calorically restricted and rapamycin-treated mice have decreased DNA synthesis and mTOR complex 1 (mTORC1) signaling but maintained protein synthesis, suggesting maintenance of existing cellular structures. We hypothesized that CL would exhibit similar synthetic and signaling responses to other long-lived models and, by comparing synthesis of new protein to new DNA, that insight may be gained into the potential preservation of existing cellular structures in the CL model. Protein and DNA synthesis was assessed in gastroc complex, heart, and liver of 4- and 7-mo CL mice. We also examined mTORC1 signaling in 3- and 7-mo aged animals. Compared with controls, 4-mo CL had greater DNA synthesis in gastroc complex with no differences in protein synthesis or mTORC1 substrate phosphorylation across tissues. Seven-month CL had less DNA synthesis than controls in heart and greater protein synthesis and mTORC1 substrate phosphorylation across tissues. The increased new protein-to-new DNA synthesis ratio suggests that new proteins are synthesized more so in existing cells at 7 mo, differing from 4 mo, in CL vs. controls. We propose that, in CL, protein synthesis shifts from being directed toward new cells (4 mo) to maintenance of existing cellular structures (7 mo), independently of decreased mTORC1. PMID:25205819

  9. The DNA intercalating alkaloid cryptolepine interferes with topoisomerase II and inhibits primarily DNA synthesis in B16 melanoma cells.

    PubMed

    Bonjean, K; De Pauw-Gillet, M C; Defresne, M P; Colson, P; Houssier, C; Dassonneville, L; Bailly, C; Greimers, R; Wright, C; Quetin-Leclercq, J; Tits, M; Angenot, L

    1998-04-14

    Cryptolepine hydrochloride is an indoloquinoline alkaloid isolated from the roots of Cryptolepis sanguinolenta. It is characterized by a multiplicity of host-mediated biological activities, including antibacterial, antiviral, and antimalarial properties. To date, the molecular basis for its diverse biological effects remains largely uncertain. Several lines of evidence strongly suggest that DNA might correspond to its principal cellular target. Consequently, we studied the strength and mode of binding to DNA of cryptolepine by means of absorption, fluorescence, circular, and linear dichroism, as well as by a relaxation assay using DNA topoisomerases. The results of various optical and gel electrophoresis techniques converge to reveal that the alkaloid binds tightly to DNA and behaves as a typical intercalating agent. In DNAase I footprinting experiments it was found that the drug interacts preferentially with GC-rich sequences and discriminates against homo-oligomeric runs of A and T. This study has also led to the discovery that cryptolepine is a potent topoisomerase II inhibitor and a promising antitumor agent. It stabilizes topoisomerase II-DNA covalent complexes and stimulates the cutting of DNA at a subset of preexisting topoisomerase II cleavage sites. Taking advantage of the fluorescence of the indoloquinoline chromophore, fluorescence microscopy was used to map cellular uptake of the drug. Cryptolepine easily crosses the cell membranes and accumulates selectively into the nuclei rather than in the cytoplasm of B16 melanoma cells. Quantitative analyses of DNA in cells after Feulgen reaction and image cytometry reveal that the drug blocks the cell cycle in G2/M phases. It is also shown that the alkaloid is more potent at inhibiting DNA synthesis rather than RNA and protein synthesis. Altogether, the results provide direct evidence that DNA is the primary target of cryptolepine and suggest that this alkaloid is a valid candidate for the development of tumor

  10. Fractional synthesis rates of DNA and protein in rabbit skin are not correlated.

    PubMed

    Zhang, Xiao-jun; Chinkes, David L; Wu, Zhanpin; Martini, Wenjun Z; Wolfe, Robert R

    2004-09-01

    We developed a method for measurement of skin DNA synthesis, reflecting cell division, in conscious rabbits by infusing D-[U-(13)C(6)]glucose and L-[(15)N]glycine. Cutaneous protein synthesis was simultaneously measured by infusion of L-[ring-(2)H(5)]phenylalanine. Rabbits were fitted with jugular venous and carotid arterial catheters, and were studied during the infusion of an amino acid solution (10% Travasol). The fractional synthetic rate (FSR) of DNA from the de novo nucleotide synthesis pathway, a reflection of total cell division, was 3.26 +/- 0.59%/d in whole skin and 3.08 +/- 1.86%/d in dermis (P = 0.38). The de novo base synthesis pathway accounted for 76 and 60% of the total DNA FSR in whole skin and dermis, respectively; the contribution from the base salvage pathway was 24% in whole skin and 40% in dermis. The FSR of protein in whole skin was 5.35 +/- 4.42%/d, which was greater (P < 0.05) than that in dermis (2.91 +/- 2.52%/d). The FSRs of DNA and protein were not correlated (P = 0.33), indicating that cell division and protein synthesis are likely regulated by different mechanisms. This new approach enables investigations of metabolic disorders of skin diseases and regulation of skin wound healing by distinguishing the 2 principal components of skin metabolism, which are cell division and protein synthesis. PMID:15333735

  11. Human CD4+ T cells require exogenous cystine for glutathione and DNA synthesis

    PubMed Central

    Levring, Trine B.; Kongsbak, Martin; Rode, Anna K. O.; Woetmann, Anders; Ødum, Niels; Bonefeld, Charlotte Menné; Geisler, Carsten

    2015-01-01

    Adaptive immune responses require activation and expansion of antigen-specific T cells. Whereas early T cell activation is independent of exogenous cystine (Cys2), T cell proliferation is dependent of Cys2. However, the exact roles of Cys2 in T cell proliferation still need to be determined. The aim of this study was to elucidate why activated human T cells require exogenous Cys2 in order to proliferate. We activated purified naïve human CD4+ T cells and found that glutathione (GSH) levels and DNA synthesis were dependent on Cys2 and increased in parallel with increasing concentrations of Cys2. Vice-versa, the GSH synthesis inhibitor L-buthionine-sulfoximine (BSO) and inhibition of Cys2 uptake with glutamate inhibited GSH and DNA synthesis in parallel. We further found that thioredoxin (Trx) can partly substitute for GSH during DNA synthesis. Finally, we show that GSH or Trx is required for the activity of ribonucleotide reductase (RNR), the enzyme responsible for generation of the deoxyribonucleotide DNA building blocks. In conclusion, we show that activated human T cells require exogenous Cys2 to proliferate and that this is partly explained by the fact that Cys2 is required for production of GSH, which in turn is required for optimal RNR-mediated deoxyribonucleotide synthesis and DNA replication. PMID:26392411

  12. Restriction and sequence alterations affect DNA uptake sequence-dependent transformation in Neisseria meningitidis.

    PubMed

    Ambur, Ole Herman; Frye, Stephan A; Nilsen, Mariann; Hovland, Eirik; Tønjum, Tone

    2012-01-01

    Transformation is a complex process that involves several interactions from the binding and uptake of naked DNA to homologous recombination. Some actions affect transformation favourably whereas others act to limit it. Here, meticulous manipulation of a single type of transforming DNA allowed for quantifying the impact of three different mediators of meningococcal transformation: NlaIV restriction, homologous recombination and the DNA Uptake Sequence (DUS). In the wildtype, an inverse relationship between the transformation frequency and the number of NlaIV restriction sites in DNA was observed when the transforming DNA harboured a heterologous region for selection (ermC) but not when the transforming DNA was homologous with only a single nucleotide heterology. The influence of homologous sequence in transforming DNA was further studied using plasmids with a small interruption or larger deletions in the recombinogenic region and these alterations were found to impair transformation frequency. In contrast, a particularly potent positive driver of DNA uptake in Neisseria sp. are short DUS in the transforming DNA. However, the molecular mechanism(s) responsible for DUS specificity remains unknown. Increasing the number of DUS in the transforming DNA was here shown to exert a positive effect on transformation. Furthermore, an influence of variable placement of DUS relative to the homologous region in the donor DNA was documented for the first time. No effect of altering the orientation of DUS was observed. These observations suggest that DUS is important at an early stage in the recognition of DNA, but does not exclude the existence of more than one level of DUS specificity in the sequence of events that constitute transformation. New knowledge on the positive and negative drivers of transformation may in a larger perspective illuminate both the mechanisms and the evolutionary role(s) of one of the most conserved mechanisms in nature: homologous recombination. PMID

  13. Restriction and Sequence Alterations Affect DNA Uptake Sequence-Dependent Transformation in Neisseria meningitidis

    PubMed Central

    Ambur, Ole Herman; Frye, Stephan A.; Nilsen, Mariann; Hovland, Eirik; Tønjum, Tone

    2012-01-01

    Transformation is a complex process that involves several interactions from the binding and uptake of naked DNA to homologous recombination. Some actions affect transformation favourably whereas others act to limit it. Here, meticulous manipulation of a single type of transforming DNA allowed for quantifying the impact of three different mediators of meningococcal transformation: NlaIV restriction, homologous recombination and the DNA Uptake Sequence (DUS). In the wildtype, an inverse relationship between the transformation frequency and the number of NlaIV restriction sites in DNA was observed when the transforming DNA harboured a heterologous region for selection (ermC) but not when the transforming DNA was homologous with only a single nucleotide heterology. The influence of homologous sequence in transforming DNA was further studied using plasmids with a small interruption or larger deletions in the recombinogenic region and these alterations were found to impair transformation frequency. In contrast, a particularly potent positive driver of DNA uptake in Neisseria sp. are short DUS in the transforming DNA. However, the molecular mechanism(s) responsible for DUS specificity remains unknown. Increasing the number of DUS in the transforming DNA was here shown to exert a positive effect on transformation. Furthermore, an influence of variable placement of DUS relative to the homologous region in the donor DNA was documented for the first time. No effect of altering the orientation of DUS was observed. These observations suggest that DUS is important at an early stage in the recognition of DNA, but does not exclude the existence of more than one level of DUS specificity in the sequence of events that constitute transformation. New knowledge on the positive and negative drivers of transformation may in a larger perspective illuminate both the mechanisms and the evolutionary role(s) of one of the most conserved mechanisms in nature: homologous recombination. PMID

  14. Hyperglycemia Differentially Affects Maternal and Fetal DNA Integrity and DNA Damage Response

    PubMed Central

    Moreli, Jusciele B.; Santos, Janine H.; Lorenzon-Ojea, Aline Rodrigues; Corrêa-Silva, Simone; Fortunato, Rodrigo S.; Rocha, Clarissa Ribeiro; Rudge, Marilza V.; Damasceno, Débora C.; Bevilacqua, Estela; Calderon, Iracema M.

    2016-01-01

    Objective: Investigate the DNA damage and its cellular response in blood samples from both mother and the umbilical cord of pregnancies complicated by hyperglycemia. Methods: A total of 144 subjects were divided into 4 groups: normoglycemia (ND; 46 cases), mild gestational hyperglycemia (MGH; 30 cases), gestational diabetes mellitus (GDM; 45 cases) and type-2 diabetes mellitus (DM2; 23 cases). Peripheral blood mononuclear cell (PBMC) isolation and/or leukocytes from whole maternal and umbilical cord blood were obtained from all groups at delivery. Nuclear and mitochondrial DNA damage were measured by gene-specific quantitative PCR, and the expression of mRNA and proteins involved in the base excision repair (BER) pathway were assessed by real-time qPCR and Western blot, respectively. Apoptosis was measured in vitro experiments by caspase 3/7 activity and ATP levels. Results: GDM and DM2 groups were characterized by an increase in oxidative stress biomarkers, an increase in nuclear and mitochondrial DNA damage, and decreased expression of mRNA (APE1, POLβ and FEN1) and proteins (hOGG1, APE1) involved in BER. The levels of hyperglycemia were associated with the in vitro apoptosis pathway. Blood levels of DNA damage in umbilical cord were similar among the groups. Newborns of diabetic mothers had increased expression of BER mRNA (APE1, POLβ and FEN1) and proteins (hOGG1, APE1, POLβ and FEN1). A diabetes-like environment was unable to induce apoptosis in the umbilical cord blood cells. Conclusions: Our data show relevant asymmetry between maternal and fetal blood cell susceptibility to DNA damage and apoptosis induction. Maternal cells seem to be more predisposed to changes in an adverse glucose environment. This may be due to differential ability in upregulating multiple genes involved in the activation of DNA repair response, especially the BER mechanism. However if this study shows a more effective adaptive response by the fetal organism, it also calls for

  15. DNA-Based Synthesis and Assembly of Organized Iron Oxide Nanostructures

    NASA Astrophysics Data System (ADS)

    Khomutov, Gennady B.

    Organized bio-inorganic and hybrid bio-organic-inorganic nanostructures consisting of iron oxide nanoparticles and DNA complexes have been formed using methods based on biomineralization, interfacial and bulk phase assembly, ligand exchange and substitution, Langmuir-Blodgett technique, DNA templating and scaffolding. Interfacially formed planar DNA complexes with water-insoluble amphiphilic polycation or intercalator Langmuir monolayers were prepared and deposited on solid substrates to form immobilized DNA complexes. Those complexes were then used for the synthesis of organized DNA-based iron oxide nanostructures. Planar net-like and circular nanostructures of magnetic Fe3O4 nanoparticles were obtained via interaction of cationic colloid magnetite nanoparticles with preformed immobilized DNA/amphiphilic polycation complexes of net-like and toroidal morphologies. The processes of the generation of iron oxide nanoparticles in immobilized DNA complexes via redox synthesis with various iron sources of biological (ferritin) and artificial (FeCl3) nature have been studied. Bulk-phase complexes of magnetite nanoparticles with biomolecular ligands (DNA, spermine) were formed and studied. Novel nano-scale organized bio-inorganic nanostructures - free-floating sheet-like spermine/magnetite nanoparticle complexes and DNA/spermine/magnetite nanoparticle complexes were synthesized in bulk aqueous phase and the effect of DNA molecules on the structure of complexes was discovered.

  16. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  17. Genomic assay reveals tolerance of DNA damage by both translesion DNA synthesis and homology-dependent repair in mammalian cells.

    PubMed

    Izhar, Lior; Ziv, Omer; Cohen, Isadora S; Geacintov, Nicholas E; Livneh, Zvi

    2013-04-16

    DNA lesions can block replication forks and lead to the formation of single-stranded gaps. These replication complications are mitigated by DNA damage tolerance mechanisms, which prevent deleterious outcomes such as cell death, genomic instability, and carcinogenesis. The two main tolerance strategies are translesion DNA synthesis (TLS), in which low-fidelity DNA polymerases bypass the blocking lesion, and homology-dependent repair (HDR; postreplication repair), which is based on the homologous sister chromatid. Here we describe a unique high-resolution method for the simultaneous analysis of TLS and HDR across defined DNA lesions in mammalian genomes. The method is based on insertion of plasmids carrying defined site-specific DNA lesions into mammalian chromosomes, using phage integrase-mediated integration. Using this method we show that mammalian cells use HDR to tolerate DNA damage in their genome. Moreover, analysis of the tolerance of the UV light-induced 6-4 photoproduct, the tobacco smoke-induced benzo[a]pyrene-guanine adduct, and an artificial trimethylene insert shows that each of these three lesions is tolerated by both TLS and HDR. We also determined the specificity of nucleotide insertion opposite these lesions during TLS in human genomes. This unique method will be useful in elucidating the mechanism of DNA damage tolerance in mammalian chromosomes and their connection to pathological processes such as carcinogenesis. PMID:23530190

  18. Marginal B-6 intake affects protein synthesis in rat tissues

    SciTech Connect

    Sampson, D.A.; Kretsch, M.J.; Young, L.A.; Jansen, G.R.

    1986-03-05

    The role of vitamin B-6 in amino acid metabolism suggests that inadequate B-6 intake may impair protein synthesis. To test this hypothesis, 30 male rats (initially 227 g) were fed AIN76A diets that contained control, marginal or devoid levels of B-6 (5.8, 1.2 or 0.1 mg B-6/kg diet, by analysis) ad libitum for 9 weeks. Protein synthesis rates (PSRs) were measured in liver, kidney and calf muscle using a flooding dose of /sup 3/H-phenylalanine. Marginal and control groups ate and gained weight at similar rates. The marginal diet did not elevate xanthurenic acid (XA) excretion following a tryptophan load. However, marginal B-6 intake did depress liver PSR by 29% (2182 vs 1549 mg/day, P<.05), liver wet weight by 15% (19.0 vs 16.1 g, P<.05) and muscle PSR by 23% (3.0 vs 2.3%/day, P<.10). Unexpectedly, marginal B-6 intake increased PSR in kidney 47% (90 vs 132 mg/day, P<.05). The devoid diet, which increased XA excretion following a tryptophan load by more than 3-fold, depressed PSRs 56% in liver and 31% in muscle. However, the devoid diet decreased food intake by 40% (25.0 vs 15.0 g/day); therefore effects of devoid B-6 intake on PSRs may have been confounded by deficits in protein-energy intake in devoid vs control groups. These data demonstrate that marginal B-6 intake alters protein synthesis in tissues of the rat.

  19. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases.

    PubMed

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-03-15

    New types of double-headed 2'-deoxycytidine 5'-O-triphosphates (dC(XC)TPs) bearing another cytosine or 5-fluorocytosine linked through a flexible propargyl, homopropargyl or pent-1-ynyl linker to position 5 were prepared by the aqueous Sonogashira cross-coupling reactions of 5-iodo-dCTP with the corresponding (fluoro)cytosine-alkynes. The modified dC(XC)TPs were good substrates for DNA polymerases and were used for enzymatic synthesis of cytosine-functionalized DNA by primer extension or PCR. The cytosine- or fluorocytosine-linked DNA probes did not significantly inhibit DNA methyltransferases and did not cross-link to these proteins. PMID:26899597

  20. Regulation of chloroplast number and DNA synthesis in higher plants. Final report, August 1995--August 1996

    SciTech Connect

    Mullet, J.E.

    1997-06-17

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focused on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The research focused on the isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  1. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?

    PubMed

    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro

    2015-06-25

    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair. PMID:26042867

  2. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements.

    PubMed

    Prior, Sara; Miousse, Isabelle R; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R; Allen, Antiño R; Raber, Jacob; Tackett, Alan J; Hauer-Jensen, Martin; Nelson, Gregory A; Koturbash, Igor

    2016-10-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2'-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5'-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. PMID:27419368

  3. DNA synthesis in mouse brown adipose tissue is under. beta. -adrenergic control

    SciTech Connect

    Rehnmark, S.; Nedergaard, J. )

    1989-02-01

    The rate of DNA synthesis in mouse brown adipose tissue was followed with injections of ({sup 3}H)thymidine. Cold exposure led to a large increase in the rate of ({sup 3}H)thymidine incorporation, reaching a maximum after 8 days, after which the activity abruptly ceased. A series of norepinephrine injections was in itself able to increase ({sup 3}H)thymidine incorporation. When norepinephrine was injected in combination with the {alpha}-adrenergic antagonist phentolamine or with the {beta}-adrenergic antagonist propranolol, the stimulation was fully blocked by propranolol. It is suggested that stimulation of DNA synthesis in brown adipose tissue is a {beta}-adrenergically mediated process and that the tissue is an interesting model for studies of physiological control of DNA synthesis.

  4. Baculovirus DNA Replication-Specific Expression Factors Trigger Apoptosis and Shutoff of Host Protein Synthesis during Infection▿

    PubMed Central

    Schultz, Kimberly L. W.; Friesen, Paul D.

    2009-01-01

    Apoptosis is an important antivirus defense. To define the poorly understood pathways by which invertebrates respond to viruses by inducing apoptosis, we have identified replication events that trigger apoptosis in baculovirus-infected cells. We used RNA silencing to ablate factors required for multiplication of Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV). Transfection with double-stranded RNA (dsRNA) complementary to the AcMNPV late expression factors (lefs) that are designated as replicative lefs (lef-1, lef-2, lef-3, lef-11, p143, dnapol, and ie-1/ie-0) blocked virus DNA synthesis and late gene expression in permissive Spodoptera frugiperda cells. dsRNAs specific to designated nonreplicative lefs (lef-8, lef-9, p47, and pp31) blocked late gene expression without affecting virus DNA replication. Thus, both classes of lefs functioned during infection as defined. Silencing the replicative lefs prevented AcMNPV-induced apoptosis of Spodoptera cells, whereas silencing the nonreplicative lefs did not. Thus, the activity of replicative lefs or virus DNA replication is sufficient to trigger apoptosis. Confirming this conclusion, AcMNPV-induced apoptosis was suppressed by silencing the replicative lefs in cells from a divergent species, Drosophila melanogaster. Silencing replicative but not nonreplicative lefs also abrogated AcMNPV-induced shutdown of host protein synthesis, suggesting that virus DNA replication triggers inhibition of host biosynthetic processes and that apoptosis and translational arrest are linked. Our findings suggest that baculovirus DNA replication triggers a host cell response similar to the DNA damage response in vertebrates, which causes translational arrest and apoptosis. Pathways for detecting virus invasion and triggering apoptosis may therefore be conserved between insects and mammals. PMID:19706708

  5. The Affinity of EBNA1 for Its Origin of DNA Synthesis Is a Determinant of the Origin's Replicative Efficiency▿ †

    PubMed Central

    Lindner, Scott E.; Zeller, Krisztina; Schepers, Aloys; Sugden, Bill

    2008-01-01

    Epstein-Barr virus (EBV) replicates its genome as a licensed plasmid in latently infected cells. Although replication of this plasmid is essential for EBV latent infection, its synthesis still fails for 16% of the templates in S phase. In order to understand these failures, we sought to determine whether the affinity of the initiator protein (EBNA1) for its binding sites in the origin affects the efficiency of plasmid replication. We have answered this question by using several engineered origins modeled upon the arrangement of EBNA1-binding sites found in DS, the major plasmid origin of EBV. The human TRF2 protein also binds to half-sites in DS and increases EBNA1's affinity for its own sites; we therefore also tested origin efficiency in the presence or absence of these sites. We have found that if TRF2-half-binding sites are present, the efficiency of supporting the initiation of DNA synthesis and of establishing a plasmid bearing that origin directly correlates with the affinity of EBNA1 for that origin. Moreover, the presence of TRF2-half-binding sites also increases the average level of EBNA1 and ORC2 bound to those origins in vivo, as measured by chromatin immunoprecipitation. Lastly, we have created an origin of DNA synthesis from high-affinity EBNA1-binding sites and TRF2-half-binding sites that functions severalfold more efficiently than does DS. This finding indicates that EBV has selected a submaximally efficient origin of DNA synthesis for the latent phase of its life cycle. This enhanced origin could be used practically in human gene vectors to improve their efficiency in therapy and basic research. PMID:18385243

  6. Agents that reverse UV-induced immune suppression and photocarcinogenesis affect DNA repair

    PubMed Central

    Sreevidya, Coimbatore S.; Fukunaga, Atsushi; Khaskhely, Noor M.; Masaki, Taro; Ono, Ryusuke; Nishigori, Chikako; Ullrich, Stephen E.

    2010-01-01

    UV exposure induces skin cancer, in part by inducing immune suppression. Repairing DNA damage, neutralizing the activity of cis-urocanic acid (cis-UCA), and reversing oxidative stress abrogates UV-induced immune suppression and skin cancer induction, suggesting the DNA, UCA and lipid photo-oxidation serves as UV photoreceptors. What is not clear is whether signaling through each of these different photoreceptors activates independent pathways to induce biological effects or whether there is a common checkpoint where these pathways converge. Here we show that agents known to reverse photocarcinogenesis and photoimmune suppression, such as platelet activating factor (PAF) and serotonin (5-HT) receptor antagonists regulate DNA repair. Pyrimidine dimer repair was accelerated in UV-irradiated mice injected with PAF and 5-HT receptor antagonists. Nucleotide excision repair, as measured by unscheduled DNA synthesis, was accelerated by PAF and 5-HT receptor antagonists. Injecting PAF and 5-HT receptor antagonists into UV-irradiated Xeroderma pigmentosum complementation group A (XPA) deficient mice, which lack the enzymes responsible for nucleotide excision repair, did not accelerate photoproduct repair. Similarly, UV-induced formation of 8-oxo-deoxyguanosine (8-oxo-dG) was reduced by PAF and 5-HT receptor antagonists. We conclude that PAF and 5-HT receptor antagonists accelerate DNA repair caused by UV radiation, which prevents immune suppression and interferes with photocarcinogenesis. PMID:19829299

  7. CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro.

    PubMed Central

    Usdin, K; Woodford, K J

    1995-01-01

    A large increase in the length of a CGG tandem array is associated with a number of triplet expansion diseases, including fragile X syndrome, the most common cause of heritable mental retardation in humans. Expansion results in the appearance of a fragile site on the X chromosome in the region of the CGG array. We show here that CGG repeats readily form a series of barriers to DNA synthesis in vitro. There barriers form only when the (CGG)n strand is used as the template, are K(+)-dependent, template concentration-independent, and involve hydrogen bonding between guanines. Chemical modification experiments suggest these blocks to DNA synthesis result from the formation of a series of intrastrand tetraplexes. A number of lines of evidence suggest that both triplet expansion and chromosome fragility are the result of replication defects. Our data are discussed in the light of such evidence. Images PMID:7479085

  8. Efficient Synthesis of Topologically Linked Three-Ring DNA Catenanes.

    PubMed

    Li, Qi; Wu, Guangqi; Wu, Wei; Liang, Xingguo

    2016-06-16

    Topologically controlled DNA catenanes are promising elements for the construction of molecular machines but present a significant effort in DNA nanotechnology. We report an efficient approach for preparing linear three-ring catenanes (L3C) composed of single-stranded DNA. The linking number was strictly controlled by using short complementary regions (6 nt) between each two DNA rings. High efficiency of forming three-ring catenanes (yield as high as 63 %) was obtained by using an 80 nt oligonucleotide as the scaffold to draw close the three pre-rings for hybridization between short complementary DNA. After assembly, three pre-rings were closed by DNA ligation using three 12 nt oligonucleotides as splints to form interlocked three-ring catenanes. L3C nanostructures were imaged in air by AFM: the catenane exhibited a smooth circular shape and was arranged in a line with well-defined structure, as expected. PMID:27214092

  9. Isolation of Chinese hamster ovary cells with reduced unscheduled DNA synthesis after UV irradiation

    SciTech Connect

    Stefanini, M.; Reuser, A.; Bootsma, D.

    1982-09-01

    A simple procedure has been worked out to obtain UV-sensitive mutants of Chinese hamster ovary (CHO) cells. In this procedure, conventional mutagenesis is followed by BrdU--light treatment to enrich the population for UV-sensitive cells. Colonies that are allowed to form subsequently are duplicated by replica plating and screened on the master plate for their UV sensitivity and their capacity to carry out UV-induced DNA repair synthesis. Putative mutants are isolated from the replica. With this combination of methods, we succeeded in isolating CHO mutants with an 85-95% reduced level of UV-induced DNA synthesis in combination with an increased UV sensitivity.

  10. Stimulation of adrenal DNA synthesis in cadmium-treated male rats

    SciTech Connect

    Nishiyama, S.; Nakamura, K.

    1984-07-01

    Cadmium chloride (CdCl2) at a dose of 1 mg/kg body wt was injected into male rats of the Wistar strain, weighing 250 g on the average, twice a day (12-hr intervals) for 7 consecutive days. DNA and RNA contents and (/sup 3/H)-thymidine and (/sup 3/H)-uridine incorporation into the acid-insoluble fraction significantly increased in the adrenals of rats treated with Cd for 2 and 7 consecutive days. Adrenal protein content and weight also significantly increased. These results indicate that continued treatment with Cd stimulates DNA and RNA synthesis in the adrenal cortex, which in turn results in the increase of the total protein contents of the adrenal gland and subsequently in the enlargement of the gland. Serum adrenocorticotrophin (ACTH) and insulin levels in Cd-treated rats were not higher than control levels, suggesting that the stimulation of DNA synthesis in the adrenals of Cd-treated rats is due to factor(s) other than serum ACTH and insulin. Treatment with Cd inhibited DNA synthesis in cultured adrenocortical cells at concentrations of 10(-4) to 10(-8) M, suggesting that Cd does not directly stimulate DNA synthesis in the adrenal gland in vivo. Although the adrenal gland became enlarged, the total adrenal corticosterone content decreased significantly. The decrease of total adrenal corticosterone content may be due to the fall in serum ACTH level of Cd-treated rats.

  11. In vivo measurement of DNA synthesis rates of colon epithelial cells in carcinogenesis

    SciTech Connect

    Kim, Sylvia Jeewon; Turner, Scott; Killion, Salena; Hellerstein, Marc K. . E-mail: march@nature.berkeley.edu

    2005-05-27

    We describe here a highly sensitive technique for measuring DNA synthesis rates of colon epithelial cells in vivo. Male SD rats were given {sup 2}H{sub 2}O (heavy water). Colon epithelial cells were isolated, DNA was extracted, hydrolyzed to deoxyribonucleosides, and the deuterium enrichment of the deoxyribose moiety was determined by gas chromatographic/mass spectrometry. Turnover time of colon crypts and the time for migration of cells from basal to top fraction of the crypts were measured. These data were consistent with cell cycle analysis and bromodeoxyuridine labeling. By giving different concentrations of a promoter, dose-dependent increases in DNA synthesis rates were detected, demonstrating the sensitivity of the method. Administration of a carcinogen increased DNA synthesis rates cell proliferation in all fractions of the crypt. In conclusion, DNA synthesis rates of colon epithelial cells can be measured directly in vivo using stable-isotope labeling. Potential applications in humans include use as a biomarker for cancer chemoprevention studies.

  12. How nanochannel confinement affects the DNA melting transition within the Poland-Scheraga model

    NASA Astrophysics Data System (ADS)

    Reiter-Schad, Michaela; Werner, Erik; Tegenfeldt, Jonas O.; Mehlig, Bernhard; Ambjörnsson, Tobias

    2015-09-01

    When double-stranded DNA molecules are heated, or exposed to denaturing agents, the two strands are separated. The statistical physics of this process has a long history and is commonly described in terms of the Poland-Scheraga (PS) model. Crucial to this model is the configurational entropy for a melted region (compared to the entropy of an intact region of the same size), quantified by the loop factor. In this study, we investigate how confinement affects the DNA melting transition, by using the loop factor for an ideal Gaussian chain. By subsequent numerical solutions of the PS model, we demonstrate that the melting temperature depends on the persistence lengths of single-stranded and double-stranded DNA. For realistic values of the persistence lengths, the melting temperature is predicted to decrease with decreasing channel diameter. We also demonstrate that confinement broadens the melting transition. These general findings hold for the three scenarios investigated: 1. homo-DNA, i.e., identical basepairs along the DNA molecule, 2. random sequence DNA, and 3. "real" DNA, here T4 phage DNA. We show that cases 2 and 3 in general give rise to broader transitions than case 1. Case 3 exhibits a similar phase transition as case 2 provided the random sequence DNA has the same ratio of AT to GC basepairs (A - adenine, T - thymine, G - guanine, C - cytosine). A simple analytical estimate for the shift in melting temperature is provided as a function of nanochannel diameter. For homo-DNA, we also present an analytical prediction of the melting probability as a function of temperature.

  13. The Transcription Factor TFII-I Promotes DNA Translesion Synthesis and Genomic Stability

    PubMed Central

    Fattah, Farjana J.; Hara, Kodai; Fattah, Kazi R.; Yang, Chenyi; Wu, Nan; Warrington, Ross; Chen, David J.; Zhou, Pengbo; Boothman, David A.; Yu, Hongtao

    2014-01-01

    Translesion synthesis (TLS) enables DNA replication through damaged bases, increases cellular DNA damage tolerance, and maintains genomic stability. The sliding clamp PCNA and the adaptor polymerase Rev1 coordinate polymerase switching during TLS. The polymerases Pol η, ι, and κ insert nucleotides opposite damaged bases. Pol ζ, consisting of the catalytic subunit Rev3 and the regulatory subunit Rev7, then extends DNA synthesis past the lesion. Here, we show that Rev7 binds to the transcription factor TFII-I in human cells. TFII-I is required for TLS and DNA damage tolerance. The TLS function of TFII-I appears to be independent of its role in transcription, but requires homodimerization and binding to PCNA. We propose that TFII-I bridges PCNA and Pol ζ to promote TLS. Our findings extend the general principle of component sharing among divergent nuclear processes and implicate TLS deficiency as a possible contributing factor in Williams-Beuren syndrome. PMID:24922507

  14. Solid-phase synthesis of DNA binding polyamides on oxime resin.

    PubMed

    Belitsky, J M; Nguyen, D H; Wurtz, N R; Dervan, Peter B

    2002-08-01

    Control of the energetics and specificity of DNA binding polyamides is necessary for inhibition of protein-DNA complex formation and gene regulation studies. Typically, solid-phase methods using Boc monomers for synthesis have depended on Boc-beta-Ala-PAM resin which affords a beta-alanine-Dp tail at the C-terminus, after cleavage with N,N-dimethylaminopropylamine (Dp). To address the energetic consequences of this tail for DNA minor groove binding, we describe an alternative solid phase method employing the Kaiser oxime resin which allows the synthesis of polyamides with incrementally shortened C-terminal tails. Polyamides without Dp and having methyl amide tails rather than beta-alanine show similar affinity relative to the standard beta-Dp tail. The truncated tail diminishes the A,T base pair energetic preference of the beta-Dp tail which will allow a greater variety of DNA sequences to be targeted by hairpin polyamides. PMID:12057666

  15. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics

    PubMed Central

    Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-01-01

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  16. Synthesis and cell-free cloning of DNA libraries using programmable microfluidics.

    PubMed

    Ben Yehezkel, Tuval; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

    2016-02-29

    Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

  17. Capture of a third Mg²⁺ is essential for catalyzing DNA synthesis.

    PubMed

    Gao, Yang; Yang, Wei

    2016-06-10

    It is generally assumed that an enzyme-substrate (ES) complex contains all components necessary for catalysis and that conversion to products occurs by rearrangement of atoms, protons, and electrons. However, we find that DNA synthesis does not occur in a fully assembled DNA polymerase-DNA-deoxynucleoside triphosphate complex with two canonical metal ions bound. Using time-resolved x-ray crystallography, we show that the phosphoryltransfer reaction takes place only after the ES complex captures a third divalent cation that is not coordinated by the enzyme. Binding of the third cation is incompatible with the basal ES complex and requires thermal activation of the ES for entry. It is likely that the third cation provides the ultimate boost over the energy barrier to catalysis of DNA synthesis. PMID:27284197

  18. The Affective Gatekeeper: A Synthesis of Perspectives on Creativity.

    ERIC Educational Resources Information Center

    Bagley, Dan S., III

    1979-01-01

    The article presents research reports on the nature of creativity, including such elements as its characteristics; the function of the affective gatekeeper (which filters the "reality" perceived by each individual); the constructs of perception; and the functions of role playing, altered states of consciousness, and fantasy. (PHR)

  19. Abnormal pattern of post-gamma-ray DNA replication in radioresistant fibroblast strains from affected members of a cancer-prone family with Li-Fraumeni syndrome.

    PubMed Central

    Mirzayans, R.; Aubin, R. A.; Bosnich, W.; Blattner, W. A.; Paterson, M. C.

    1995-01-01

    Non-malignant dermal fibroblast strains, cultured from affected members of a Li-Fraumeni syndrome (LFS) family with diverse neoplasms associated with radiation exposure, display a unique increased resistance to the lethal effects of gamma-radiation. In the studies reported here, this radioresistance (RR) trait has been found to correlate strongly with an abnormal pattern of post-gamma-ray DNA replicative synthesis, as monitored by radiolabelled thymidine incorporation and S-phase cell autoradiography. In particular, the time interval between the gamma-ray-induced shutdown of DNA synthesis and its subsequent recovery was greater in all four RR strains examined and the post-recovery replication rate was much higher and was maintained longer than in normal and spousal controls. Alkaline sucrose sedimentation profiles of pulse-labelled cellular DNA indicated that the unusual pattern of DNA replication in irradiated RR strains may be ascribed to anomalies in both replicon initiation and DNA chain elongation processes. Moreover, the RR strain which had previously displayed the highest post-gamma-ray clonogenic survival was found to harbour a somatic (codon 234) mutation (presumably acquired during culture in vitro) in the same conserved region of the p53 tumour-suppressor gene as the germline (codon 245) mutation in the remaining three RR strains from other family members, thus coupling the RR phenotype and abnormal post-gamma-ray DNA synthesis pattern with faulty p53 expression. Significantly, these two aberrant radioresponse end points, along with documented anomalies in c-myc and c-raf-1 proto-oncogenes, are unprecedented among other LFS families carrying p53 germline mutations. We thus speculate that this peculiar cancer-prone family may possess in its germ line a second, as yet unidentified, genetic defect in addition to the p53 mutation. Images Figure 8 PMID:7779715

  20. Study of design parameters affecting the motion of DNA for nanoinjection

    NASA Astrophysics Data System (ADS)

    David, Regis A.; Jensen, Brian D.; Black, Justin L.; Burnett, Sandra H.; Howell, Larry L.

    2012-05-01

    This paper reports the effects of various parameters on the attraction and repulsion of DNA to and from a silicon lance. An understanding of DNA motion is crucial for a new approach to insert DNA, or other foreign microscopic matter, into a living cell. The approach, called nanoinjection, uses electrical forces to attract and repel the desired substance to a micromachined lance designed to pierce the cell membranes. We have developed mathematical models to predict the trajectory of DNA. The mathematical model allows investigation of the attraction/repulsion process by varying specific parameters. We find that the ground electrode placement, lance orientation and lance penetration significantly affect attraction or repulsion efficiency, while the gap, lance direction, lance tip width, lance tip half-angle and lance tip height do not.

  1. Accurate multiplex gene synthesis from programmable DNA microchips

    NASA Astrophysics Data System (ADS)

    Tian, Jingdong; Gong, Hui; Sheng, Nijing; Zhou, Xiaochuan; Gulari, Erdogan; Gao, Xiaolian; Church, George

    2004-12-01

    Testing the many hypotheses from genomics and systems biology experiments demands accurate and cost-effective gene and genome synthesis. Here we describe a microchip-based technology for multiplex gene synthesis. Pools of thousands of `construction' oligonucleotides and tagged complementary `selection' oligonucleotides are synthesized on photo-programmable microfluidic chips, released, amplified and selected by hybridization to reduce synthesis errors ninefold. A one-step polymerase assembly multiplexing reaction assembles these into multiple genes. This technology enabled us to synthesize all 21 genes that encode the proteins of the Escherichia coli 30S ribosomal subunit, and to optimize their translation efficiency in vitro through alteration of codon bias. This is a significant step towards the synthesis of ribosomes in vitro and should have utility for synthetic biology in general.

  2. Glycans affect DNA extraction and induce substantial differences in gut metagenomic studies.

    PubMed

    Angelakis, Emmanouil; Bachar, Dipankar; Henrissat, Bernard; Armougom, Fabrice; Audoly, Gilles; Lagier, Jean-Christophe; Robert, Catherine; Raoult, Didier

    2016-01-01

    Exopolysaccharides produced by bacterial species and present in feces are extremely inhibitory to DNA restriction and can cause discrepancies in metagenomic studies. We determined the effects of different DNA extraction methods on the apparent composition of the gut microbiota using Illumina MiSeq deep sequencing technology. DNA was extracted from the stool from an obese female using 10 different methods and the choice of DNA extraction method affected the proportional abundance at the phylum level, species richness (Chao index, 227 to 2,714) and diversity (non parametric Shannon, 1.37 to 4.4). Moreover DNA was extracted from stools obtained from 83 different individuals by the fastest extraction assay and by an extraction assay that degradated exopolysaccharides. The fastest extraction method was able to detect 68% to 100% genera and 42% to 95% species whereas the glycan degradation extraction method was able to detect 56% to 93% genera and 25% to 87% species. To allow a good liberation of DNA from exopolysaccharides commonly presented in stools, we recommend the mechanical lysis of stools plus glycan degradation, used here for the first time. Caution must be taken in the interpretation of current metagenomic studies, as the efficiency of DNA extraction varies widely among stool samples. PMID:27188959

  3. Glycans affect DNA extraction and induce substantial differences in gut metagenomic studies

    PubMed Central

    Angelakis, Emmanouil; Bachar, Dipankar; Henrissat, Bernard; Armougom, Fabrice; Audoly, Gilles; Lagier, Jean-Christophe; Robert, Catherine; Raoult, Didier

    2016-01-01

    Exopolysaccharides produced by bacterial species and present in feces are extremely inhibitory to DNA restriction and can cause discrepancies in metagenomic studies. We determined the effects of different DNA extraction methods on the apparent composition of the gut microbiota using Illumina MiSeq deep sequencing technology. DNA was extracted from the stool from an obese female using 10 different methods and the choice of DNA extraction method affected the proportional abundance at the phylum level, species richness (Chao index, 227 to 2,714) and diversity (non parametric Shannon, 1.37 to 4.4). Moreover DNA was extracted from stools obtained from 83 different individuals by the fastest extraction assay and by an extraction assay that degradated exopolysaccharides. The fastest extraction method was able to detect 68% to 100% genera and 42% to 95% species whereas the glycan degradation extraction method was able to detect 56% to 93% genera and 25% to 87% species. To allow a good liberation of DNA from exopolysaccharides commonly presented in stools, we recommend the mechanical lysis of stools plus glycan degradation, used here for the first time. Caution must be taken in the interpretation of current metagenomic studies, as the efficiency of DNA extraction varies widely among stool samples. PMID:27188959

  4. DNA methylation affected by male sterile cytoplasm in rice (Oryza sativa L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Male sterile cytoplasm plays an important role in hybrid rice and cytoplasmic effects are sufficiently documented. However, no reports are available on DNA methylation affected by male sterile cytoplasm in hybrid rice. We used a methylation sensitive amplified polymorphism (MSAP) technique to charac...

  5. Preanalytical Conditions and DNA Isolation Methods Affect Telomere Length Quantification in Whole Blood.

    PubMed

    Tolios, Alexander; Teupser, Daniel; Holdt, Lesca M

    2015-01-01

    Telomeres are located at chromosome ends and their length (TL) has been associated with aging and human diseases such as cancer. Whole blood DNA is frequently used for TL measurements but the influence of preanalytical conditions and DNA isolation methods on TL quantification has not been thoroughly investigated. To evaluate potential preanalytical as well as methodological bias on TL, anonymized leftover EDTA-whole blood samples were pooled according to leukocyte counts and were incubated with and without actinomycin D to induce apoptosis as a prototype of sample degradation. DNA was isolated from fresh blood pools and after freezing at -80°C. Commercially available kits using beads (Invitrogen), spin columns (Qiagen, Macherey-Nagel and 5prime) or precipitation (Stratec/Invisorb) and a published isopropanol precipitation protocol (IPP) were used for DNA isolation. TL was assessed by qPCR, and normalized to the single copy reference gene 36B4 using two established single-plex and a new multiplex protocol. We show that the method of DNA isolation significantly affected TL (e.g. 1.86-fold longer TL when comparing IPP vs. Invitrogen). Sample degradation led to an average TL decrease of 22% when using all except for one DNA isolation method (5prime). Preanalytical storage conditions did not affect TL with exception of samples that were isolated with the 5prime kit, where a 27% increase in TL was observed after freezing. Finally, performance of the multiplex qPCR protocol was comparable to the single-plex assays, but showed superior time- and cost-effectiveness and required > 80% less DNA. Findings of the current study highlight the need for standardization of whole blood processing and DNA isolation in clinical study settings to avoid preanalytical bias of TL quantification and show that multiplex assays may improve TL/SCG measurements. PMID:26636575

  6. Preanalytical Conditions and DNA Isolation Methods Affect Telomere Length Quantification in Whole Blood

    PubMed Central

    Tolios, Alexander; Teupser, Daniel; Holdt, Lesca M.

    2015-01-01

    Telomeres are located at chromosome ends and their length (TL) has been associated with aging and human diseases such as cancer. Whole blood DNA is frequently used for TL measurements but the influence of preanalytical conditions and DNA isolation methods on TL quantification has not been thoroughly investigated. To evaluate potential preanalytical as well as methodological bias on TL, anonymized leftover EDTA-whole blood samples were pooled according to leukocyte counts and were incubated with and without actinomycin D to induce apoptosis as a prototype of sample degradation. DNA was isolated from fresh blood pools and after freezing at -80°C. Commercially available kits using beads (Invitrogen), spin columns (Qiagen, Macherey-Nagel and 5prime) or precipitation (Stratec/Invisorb) and a published isopropanol precipitation protocol (IPP) were used for DNA isolation. TL was assessed by qPCR, and normalized to the single copy reference gene 36B4 using two established single-plex and a new multiplex protocol. We show that the method of DNA isolation significantly affected TL (e.g. 1.86-fold longer TL when comparing IPP vs. Invitrogen). Sample degradation led to an average TL decrease of 22% when using all except for one DNA isolation method (5prime). Preanalytical storage conditions did not affect TL with exception of samples that were isolated with the 5prime kit, where a 27% increase in TL was observed after freezing. Finally, performance of the multiplex qPCR protocol was comparable to the single-plex assays, but showed superior time- and cost-effectiveness and required > 80% less DNA. Findings of the current study highlight the need for standardization of whole blood processing and DNA isolation in clinical study settings to avoid preanalytical bias of TL quantification and show that multiplex assays may improve TL/SCG measurements. PMID:26636575

  7. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    PubMed

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis. PMID:27333783

  8. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

    PubMed

    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

    2016-05-17

    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. PMID:27053724

  9. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.

    PubMed

    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J

    1995-06-01

    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  10. Synthesis of novel MMT/acyl-protected nucleo alanine monomers for the preparation of DNA/alanyl-PNA chimeras

    PubMed Central

    Roviello, G. N.; Gröschel, S.; Pedone, C.

    2009-01-01

    Alanyl-peptide nucleic acid (alanyl-PNA)/DNA chimeras are oligomers envisaged to be beneficial in efficient DNA diagnostics based on an improved molecular beacon concept. A synthesis of alanyl-PNA/DNA chimera can be based on the solid phase assembly of the oligomer with mixed oligonucleotide/peptide backbone under DNA synthesis conditions, in which the nucleotides are introduced as phosphoramidites, whereas the nucleo amino acids make use of the acid labile monomethoxytrityl (MMT) group for temporary protection of the α-amino groups and acyl protecting groups for the exocyclic amino functions of the nucleobases. In this work, we realized for the first time the synthesis of all four MMT/acyl-protected nucleo alanines, achieved by deprotection/reprotection of the newly synthesized Boc/acyl intermediates, useful monomers for the obtainment of (alanyl-PNA)/DNA chimeras by conditions fully compatible with the standard phosphoramidite DNA synthesis strategy. PMID:19629638

  11. Effects of starvation and hormones on DNA synthesis in silk gland cells of the silkworm, Bombyx mori.

    PubMed

    Li, Yao-Feng; Chen, Xiang-Yun; Zhang, Chun-Dong; Tang, Xiao-Fang; Wang, La; Liu, Tai-Hang; Pan, Min-Hui; Lu, Cheng

    2016-08-01

    Silk gland cells of silkworm larvae undergo multiple cycles of endomitosis for the synthesis of silk proteins during the spinning phase. In this paper, we analyzed the endomitotic DNA synthesis of silk gland cells during larval development, and found that it was a periodic fluctuation, increasing during the vigorous feeding phase and being gradually inhibited in the next molting phase. That means it might be activated by a self-regulating process after molting. The expression levels of cyclin E, cdt1 and pcna were consistent with these developmental changes. Moreover, we further examined whether these changes in endomitotic DNA synthesis resulted from feeding or hormonal stimulation. The results showed that DNA synthesis could be inhibited by starvation and re-activated by re-feeding, and therefore appears to be dependent on nutrition. DNA synthesis was suppressed by in vivo treatment with 20-hydroxyecdysone (20E). However, there was no effect on DNA synthesis by in vitro 20E treatment or by either in vivo or in vitro juvenile hormone treatment. The levels of Akt and 4E-BP phosphorylation in the silk glands were also reduced by starvation and in vivo treatment with 20E. These results indicate that the activation of endomitotic DNA synthesis during the intermolt stages is related to feeding and DNA synthesis is inhibited indirectly by 20E. PMID:25558018

  12. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    PubMed

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

  13. Assessment of potential damage to DNA in urine of coke oven workers: an assay of unscheduled DNA synthesis.

    PubMed Central

    Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C

    1997-01-01

    OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892

  14. Effects of platelet-derived growth factor and other polypeptide mitogens on DNA synthesis and growth of cultured rat liver fat-storing cells.

    PubMed Central

    Pinzani, M; Gesualdo, L; Sabbah, G M; Abboud, H E

    1989-01-01

    In vitro and in vivo studies suggest that liver fat-storing cells (FSC) may play an important role in the development of liver fibrosis. We explored the effects of platelet-derived growth factor (PDGF), epidermal growth factor (EGF), transforming growth factor (TGF)-alpha and TGF-beta, and basic fibroblast growth factor (bFGF) on DNA synthesis and growth of rat liver FSC. PDGF, EGF, TGF-alpha, and bFGF induced a dose-dependent increase in DNA synthesis with a peak effect at 24 h. PDGF produced the most striking effect with a maximum 18-fold increase over control. EGF, TGF-alpha, and bFGF elicited a maximum three- to fourfold increase in DNA synthesis. Analysis of growth curves revealed a similar pattern of potency of the growth factors. TGF-beta did not affect DNA synthesis of FSC; however, TGF-beta markedly potentiated the stimulatory effects of both EGF and PDGF. FSC showed high specific binding of 125I-PDGF and Scatchard analysis revealed high affinity receptors with an apparent Kd of 2.3 x 10(-10) M. Our data suggest that PDGF is a key mitogen for FSC and that the coordinate release of other growth factors together with PDGF by inflammatory cells represents a potent potential stimulus for FSC proliferation in conditions of chronic self-perpetuating liver inflammation. Images PMID:2592560

  15. Lability of DNA polymerase alpha correlated with decreased DNA synthesis and increased age in human cells

    SciTech Connect

    Busbee, D.; Sylvia, V.; Stec, J.; Cernosek, Z.; Norman, J.

    1987-12-01

    DNA excision repair and mitogen-initiated blastogenesis in human cells declined in efficiency as an apparent function of decreased DNA polymerase alpha specific activity with increased age of the cell donor. DNA polymerase alpha isolated from fetal cells contained a single, high-specific-activity enzyme form that could not be further activated and that was stable with regard to enzyme activity and affinity for DNA template-primer. DNA polymerase alpha isolated from adult-derived cells contained both low-specific-activity and high-specific-activity forms. The low-activity enzyme form, which showed low affinity of binding to DNA template-primer, was activated by treatment with phosphatidylinositol, /sup 32/P-ATP, and phosphatidylinositol kinase, resulting in a /sup 32/P-labeled enzyme that exhibited high affinity of binding to DNA template-primer. The activated enzyme was unstable, exhibiting a loss of /sup 32/P-label correlated with the loss of both specific activity and high affinity of binding to DNA template-primer. The data suggest that DNA polymerase alpha isolated from adult-derived human cells has low-activity and high-activity forms. Decreased specific activity of DNA polymerase alpha correlated with increased age of the donor appears to be a function of loss of an enzyme activator molecule resulting in diminished ability of the enzyme to bind DNA template-primer.

  16. NOREPINEPHRINE AND EPIDERMAL GROWTH FACTOR: DYNAMICS OF THEIR INTERACTION IN THE STIMULATION OF HEPATOCYTE DNA SYNTHESIS

    EPA Science Inventory

    Primary cultures of adult rat hepatocytes are stimulated to enter DNA synthesis by norepinephrine (NE). This stimulation is maximal if the hepatocytes are incubated with NE for more than 12 hr, beginning no later than 2-4 hr after the cells are first plated. After 24 hr in cultur...

  17. EFFECT OF NONGENOTOXIC ENVIRONMENTAL CONTAMINATION ON CHOLESTEROL AND DNA SYNTHESIS IN CULTURED PRIMARY RAT HEPATOCYTES

    EPA Science Inventory

    The effect of certain reputedly non genotoxic agents on cholesterol and DNA synthesis was investigated in cultured rat primary hepatocytes and liver slices. epatocytes in culture were incubated for 48, 60, and 72 hrs with one of the following chemicals; namely, chloroform (CHCl3)...

  18. Heparin effect on DNA synthesis in a murine fibrosarcoma cell line: influence of anionic density

    SciTech Connect

    Piepkorn, M.W.; Daynes, R.A.

    1983-09-01

    The effects of heparin subfractions on DNA synthesis in a murine cutaneous fibrosarcoma cell line were examined. Porcine mucosal heparin was preparatively fractionated for anionic charge density by DEAE-Sephadex chromatography and for molecular weight by Sephadex G-100 filtration. The cell line was plated from confluent monolayer cultures and grown in medium and fetal bovine serum, with or without a heparin fraction at a final concentration of 10 micrograms/ml. At intervals thereafter, the cells were pulsed with (/sup 3/H)thymidine. A low-charge density heparin fraction stimulated (/sup 3/H)thymidine incorporation (cpm/mg protein and cpm/cell) during the first 3 days of growth compared to control values without added heparin, whereas a high-charge density heparin fraction had little of this effect (186 +/- 35% of control vs. 101 +/- 14%, respectively; P less than .05). The augmentation of DNA synthesis observed with the low-charge density fraction correlated with increased proportions of cells in S and G2 phases compared with those of the controls, as determined by flow cytofluorometry. Low- and high-molecular-weight heparin fractions did not significantly alter DNA synthesis. Heparin subfractions are thus heterogeneous with respect to their effect on cellular DNA synthesis in this tumor line.

  19. Synthesis and Properties of Novel Silver-Containing DNA Molecules.

    PubMed

    Eidelshtein, Gennady; Fardian-Melamed, Natalie; Gutkin, Vitaly; Basmanov, Dmitry; Klinov, Dmitry; Rotem, Dvir; Levi-Kalisman, Yael; Porath, Danny; Kotlyar, Alexander

    2016-06-01

    Migration of silver atoms from silver nano-particles selectively to a double-stranded poly(dG)-poly(dC) polymer leads to metallization of the DNA. As a result the DNA molecules become shorter and thicker (higher), as evident from the atomic force microscopy imaging analysis. The metalized molecules can be detected by transmission and scanning electron microscopy in contrast to the initial non-metalized ones. PMID:27116695

  20. Deoxyribonucleotide synthesis and the emergence of DNA in molecular evolution

    NASA Astrophysics Data System (ADS)

    Follmann, Hartmut

    1982-02-01

    DNA replication requires monomeric deoxyribonucleotides, which cannot be regarded as primary products of organic syntheses on a primitive earth. However, the present biosynthetic pathway — reductive elimination of the 2'-OH group from ribonucleotides, catalyzed by ribonucleotide reductases and thioredoxins — suggests an early, polyphyletic combination of protein-nucleotide interactions and metal catalysis. That key process had to precede the upcome of RNA-DNA dualism on the way from RNA-protein protocells to true organisms.

  1. Satellite DNA from the brine shrimp Artemia affects the expression of a flanking gene in yeast.

    PubMed

    Maiorano, D; Cece, R; Badaracco, G

    1997-04-11

    We have previously revealed that in the brine shrimp Artemia franciscana an AluI DNA family of repeats, 113 bp in length, is the major component of the constitutive heterochromatin and that this repetitive DNA shows a stable curvature that confers a solenoidal geometry on the double helix in vitro. It was suggested that this particular structure may play a relevant role in determining the condensation of the heterochromatin. In this report we have cloned hexamers of highly-repetitive sequence (AluI-satellite DNA) in proximity to a yeast lacZ reporter gene on a plasmid. We find that the expression of the reporter gene is affected by the presence of this DNA in a dose- and orientation-dependent manner in the yeast, S. cerevisiae. We show that this effect is not dependent on under-replication or re-arrangements of the repetitive DNA in the cell but is due to decreased expression of the reporter gene. Our results indicate that the AluI-satellite DNA of Artemia per se is able to influence gene expression. PMID:9161405

  2. Purification, characterization and biological activity of tulipin, a novel inhibitor of DNA synthesis of plant origin.

    PubMed

    Gasperi-Campani, A; Lorenzoni, E; Abbondanza, A; Perocco, P; Falasca, A I

    1987-01-01

    A DNA synthesis-inhibiting protein (for which the term tulipin is proposed) was isolated from the bulbs of Tulipa sp. The yield ranged from 3.4 to 4.1 per cent of total protein content of the crude extract. Mr, isoelectric point, neutral and amino sugar and amino acid composition were determined. Inhibition of DNA synthesis varied in intact cells according to the cellular types studied, with a minimum ID 50% (concentration giving 50% inhibition) of 400 ng/ml in neuroblastoma cells. The effect was reversible. No effect was obtained in cell-lysate. RNA and protein synthesis were unaffected. The acute toxicity, evaluated in Swiss mice, gave an LD of 6.1 mg/kg body wt. Results of electron microscopy are also given. A second protein, called tulipin 2, has been isolated and partially characterized. PMID:3592627

  3. The HRDC domain of E. coli RecQ helicase controls single-stranded DNA translocation and double-stranded DNA unwinding rates without affecting mechanoenzymatic coupling

    PubMed Central

    Harami, Gábor M.; Nagy, Nikolett T.; Martina, Máté; Neuman, Keir C.; Kovács, Mihály

    2015-01-01

    DNA-restructuring activities of RecQ-family helicases play key roles in genome maintenance. These activities, driven by two tandem RecA-like core domains, are thought to be controlled by accessory DNA-binding elements including the helicase-and-RnaseD-C-terminal (HRDC) domain. The HRDC domain of human Bloom’s syndrome (BLM) helicase was shown to interact with the RecA core, raising the possibility that it may affect the coupling between ATP hydrolysis, translocation along single-stranded (ss)DNA and/or unwinding of double-stranded (ds)DNA. Here, we determined how these activities are affected by the abolition of the ssDNA interaction of the HRDC domain or the deletion of the entire domain in E. coli RecQ helicase. Our data show that the HRDC domain suppresses the rate of DNA-activated ATPase activity in parallel with those of ssDNA translocation and dsDNA unwinding, regardless of the ssDNA binding capability of this domain. The HRDC domain does not affect either the processivity of ssDNA translocation or the tight coupling between the ATPase, translocation, and unwinding activities. Thus, the mechanochemical coupling of E. coli RecQ appears to be independent of HRDC-ssDNA and HRDC-RecA core interactions, which may play roles in more specialized functions of the enzyme. PMID:26067769

  4. DNA polymerases drive DNA sequencing-by-synthesis technologies: both past and present

    PubMed Central

    Chen, Cheng-Yao

    2014-01-01

    Next-generation sequencing (NGS) technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. Escherichia coli DNA polymerase I proteolytic (Klenow) fragment was originally utilized in Sanger’s dideoxy chain-terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today’s standard capillary electrophoresis (CE) and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ϕ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ϕ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies. PMID:25009536

  5. Synthesis and evaluation of new spacers for use as dsDNA endcaps

    PubMed Central

    Ng, Pei-Sze; Laing, Brian M.; Balasundarum, Ganesan; Pingle, Maneesh; Friedman, Alan; Bergstrom, Donald E.

    2010-01-01

    A series of aliphatic and aromatic spacer molecules designed to cap the ends of DNA duplexes have been synthesized. The spacers were converted into dimethoxytrityl protected phosphoramidites as synthons for oligonucleotides synthesis. The effect of the spacers on the stability of short DNA duplexes was assessed by melting temperature studies. Endcaps containing amide groups were found to be less stabilizing than the hexaethylene glycol spacer. Endcaps containing either a terthiophene or a naphthalene tetracarboxylic acid dimide were found to be significantly more stabilizing. The former showed a preference for stacking above an A•T base pair. Spacers containing only methylene (-CH2-) and amide (-CONH-) groups interact weakly with DNA and consequently may be optimal for applications that require minimal influence on DNA structure but require a way to hold the ends of double-stranded DNA together. PMID:20715857

  6. DNA (deoxyribonucleic acid) synthesis following microinjection of heterologous sperm and somatic cell nuclei into hamster oocytes

    SciTech Connect

    Naish, S.J.; Perreault, S.D.; Zirkin, B.R.

    1987-01-01

    The authors investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in /sup 3/H-thymidine after being parthenogenetically activated by sham microinjection, or microinjected with hamster, mouse, rabbit, or fish sperm nuclei, or hamster hepatocyte nuclei. Within 6 hr of sham or nucleus microinjection, nuclei of each type underwent transformation into pronuclei and synthesized DNA. These results demonstrated that the hamster egg can access and utilize its own and each type of template provided, whether homologous or heterologous. However, pronuclei derived from hamster sperm nuclei were more likely to be synthesizing DNA at 6 hr than pronuclei derived from sperm nuclei of other species. The authors conclude that the mechanisms employed by the hamster oocyte to transform hamster sperm nuclei into pronuclei and to effect DNA synthesis in these nuclei are not specific for the hamster sperm nucleus. Nevertheless, these mechanisms apparently operate more efficiently when the hamster sperm nucleus, rather than a heterologous sperm nucleus, is present.

  7. In vivo effects of T-2 mycotoxin on synthesis of proteins and DNA in rat tissues

    SciTech Connect

    Thompson, W.L.; Wannemacher, R.W. Jr. )

    1990-09-15

    Rats were given an ip injection of T-2 mycotoxin (T-2), the T-2 metabolite, T-2 tetraol (tetraol), or cycloheximide. Serum, liver, heart, kidney, spleen, muscle, and intestine were collected at 3, 6, and 9 hr postinjection after a 2-hr pulse at each time with (14C)leucine and (3H)thymidine. Protein and DNA synthesis levels in rats were determined by dual-label counting of the acid-precipitable fraction of tissue homogenates. Rats given a lethal dose of T-2, tetraol, or cycloheximide died between 14 and 20 hr. Maximum inhibition of protein synthesis at the earliest time period was observed in additional rats given the same lethal dose of the three treatments and continued for the duration of the study (9 hr). With sublethal doses of T-2 or tetraol, the same early decrease in protein synthesis was observed but, in most of the tissues, recovery was seen with time. In the T-2-treated rats. DNA synthesis in the six tissues studied was also suppressed, although to a lesser degree. With sublethal doses, complete recovery of DNA synthesis took place in four of the six tissues by 9 hr after toxin exposure. The appearance of newly translated serum proteins did not occur in the animals treated with T-2 mycotoxin or cycloheximide, as evidenced by total and PCA-soluble serum levels of labeled leucine. An increase in tissue-pool levels of free leucine and thymidine in response to T-2 mycotoxin was also noted. T-2 mycotoxin, its metabolite, T-2 tetraol, and cycloheximide cause a rapid inhibition of protein and DNA synthesis in all tissue types studied. These results are compared with the responses seen in in vitro studies.

  8. Structural specificity of steroids in stimulating DNA synthesis and protooncogene expression in primary rat hepatocyte cultures.

    PubMed

    Lee, C H; Edwards, A M

    2002-05-01

    Among the chemical compounds of varied structure which possess liver tumour-promoting are steroids, such as estrogens, pregnenolone derivatives and anabolic steroids. Although the mechanism(s) of tumour promotion in liver by these xenobiotics is not well understood, it is clear that growth stimulation is one important element in their action. As a basis for better defining whether steroids stimulate growth by a common mechanism or fall into sub-groups with differing actions, the effects of 46 steroids on DNA synthesis and the expression of protooncogenes c-fos and c-myc were examined in primary cultures of normal rat hepatocytes. Tentative groupings of steroids have been identified based on apparent structural requirements for stimulation of DNA synthesis, and effects of auxiliary factors in modulating this growth stimulus. For a "progestin" group, insulin appeared to be permissive for stimulation of DNA synthesis, and presence of an ester or hydroxyl group at 17alpha-position in combination with a non-polar group at C(6) appeared to be required for stimulation. For the pregnenes, dexamethasone was stimulatory. Structural requirements include a non-polar substitution at 16alpha-position and presence of a 6alpha-methyl group. Androgens were weak or ineffective stimulators of DNA synthesis. Anabolic steroids were weak to strong stimulators and alteration to A ring structure in combination with non-polar substitution at 17alpha-position appeared to be required for the activity. With the exception of the anabolic steroid, dianabol, there do not appear to be strong correlation between ability to stimulate DNA synthesis and ability to induce protooncogene expression among the steroids. This study provides a starting point for future more detailed examination of growth-stimulatory mechanism(s) of action of steroids in the liver. PMID:12127039

  9. Base J glucosyltransferase does not regulate the sequence specificity of J synthesis in trypanosomatid telomeric DNA.

    PubMed

    Bullard, Whitney; Cliffe, Laura; Wang, Pengcheng; Wang, Yinsheng; Sabatini, Robert

    2015-12-01

    Telomeric DNA of trypanosomatids possesses a modified thymine base, called base J, that is synthesized in a two-step process; the base is hydroxylated by a thymidine hydroxylase forming hydroxymethyluracil (hmU) and a glucose moiety is then attached by the J-associated glucosyltransferase (JGT). To examine the importance of JGT in modifiying specific thymine in DNA, we used a Leishmania episome system to demonstrate that the telomeric repeat (GGGTTA) stimulates J synthesis in vivo while mutant telomeric sequences (GGGTTT, GGGATT, and GGGAAA) do not. Utilizing an in vitro GT assay we find that JGT can glycosylate hmU within any sequence with no significant change in Km or kcat, even mutant telomeric sequences that are unable to be J-modified in vivo. The data suggests that JGT possesses no DNA sequence specificity in vitro, lending support to the hypothesis that the specificity of base J synthesis is not at the level of the JGT reaction. PMID:26815240

  10. L-arginine improves DNA synthesis in LPS-challenged enterocytes.

    PubMed

    Tan, Bi'e; Xiao, Hao; Xiong, Xia; Wang, Jing; Li, Guangran; Yin, Yulong; Huang, Bo; Hou, Yongqing; Wu, Guoyao

    2015-01-01

    The neonatal small intestine is susceptible to damage by endotoxin, and this cytotoxicity may involve intracellular generation of reactive oxygen species (ROS), resulting in DNA damage and mitochondrial dysfunction. L-Arginine (Arg) confers a cytoprotective effect on lipopolysaccharide (LPS)-treated enterocytes through activation of the mammalian target of the rapamycin (mTOR) signaling pathway. Arg improves DNA synthesis and mitochondrial bioenergetics, which may also be responsible for beneficial effects of Arg on intestinal mucosal cells. In support of this notion, results of recent studies indicate that elevated Arg concentrations enhances DNA synthesis, cell-cycle progression, and mitochondrial bioenergetics in LPS-treated intestinal epithelial cells through mechanisms involving activation of the PI3K-Akt pathway. These findings provide a biochemical basis for dietary Arg supplementation to improve the regeneration and repair of the small-intestinal mucosa in both animals and humans. PMID:25961538

  11. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    SciTech Connect

    Jones, R.A.

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  12. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  13. The DNA methylation inhibitor 5-azacytidine decreases melanin synthesis by inhibiting CREB phosphorylation.

    PubMed

    Shin, Jun Seob; Jeong, Hyo-Soon; Kim, Myo-Kyoung; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Kim, Dong-Seok

    2015-10-01

    Here we examined the effects of a DNA methylation inhibitor, 5-azacytidine, on melanogenesis in Mel-Ab cells. We found that 5-azacytidine decreased the melanin content and tyrosinase activity in these cells in a dose-dependent manner; importantly, 5-azacytidine was not cytotoxic at the concentrations used in these experiments. On the other hand, 5-azacytidine did not affect tyrosinase activity in a cell-free system, indicating that 5-azacytidine is not a direct tyrosinase inhibitor. Instead, 5-azacytidine decreased the protein levels of microphthalmia-associated transcription factor (MITF) and tyrosinase. Thus, we investigated the effects of 5-azacytidine on signal transduction pathways related to melanogenesis. However, 5-azacytidine did not have any effect on either Akt or glycogen synthase kinase 3β (GSK3β) phosphorylation. The phosphorylation of cAMP response element-binding protein (CREB) is well known to regulate MITF expression, thereby also regulating tyrosinase expression. We found that 5-azacytidine decreased the phosphorylation of CREB. Therefore, we propose that 5-azacytidine may decrease melanin synthesis by downregulating MITF and tyrosinase via CREB inactivation. PMID:26601420

  14. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  15. Design and Synthesis of Triangulated DNA Origami Trusses.

    PubMed

    Matthies, Michael; Agarwal, Nayan P; Schmidt, Thorsten L

    2016-03-01

    DNA nanotechnology offers unique control over matter on the nanoscale. Here, we extend the DNA origami method to cover a range of wireframe truss structures composed of equilateral triangles, which use less material per volume than standard multiple-helix bundles. From a flat truss design, we folded tetrahedral, octahedral, or irregular dodecahedral trusses by exchanging few connector strands. Other than standard origami designs, the trusses can be folded in low-salt buffers that make them compatible with cell culture buffers. The structures also have defined cavities that may in the future be used to precisely position functional elements such as metallic nanoparticles or enzymes. Our graph routing program and a simple design pipeline will enable other laboratories to make use of this valuable and potent new construction principle for DNA-based nanoengineering. PMID:26883285

  16. A new synthesis in epigenetics: towards a unified function of DNA methylation from invertebrates to vertebrates.

    PubMed

    Mandrioli, M

    2007-10-01

    DNA methylation is generally limited to CpG doublets located at the gene promoter with an involvement in gene silencing. Surprisingly, two recent papers showed an extensive methylation affecting coding portions of transcriptionally active genes in human and plants prompting a rethink of DNA methylation in eukaryotes. Actually, gene body methylation is not surprising since it has been repeatedly reported in invertebrates, where it interferes with transcriptional elongation preventing aberrant transcription initiations. As a whole, the published data suggest that the most ancestral function of DNA methylation is the control of genes that are susceptible to transcriptional interference and not to gene silencing. The recruitment of DNA methylation for silencing represents a successive tinkered use. In view of this additional function, the invertebrate-vertebrate transition has been accompanied by new constraints on DNA methylation that resulted in the strong conservation of the DNA methylation machinery in vertebrates and in the non-viability of mutants lacking DNA methylation. PMID:17712527

  17. Synthesis of DNA Oligodeoxynucleotides Containing Site-Specific 1,3-Butadiene- Deoxyadenosine Lesions

    PubMed Central

    Wickramaratne, Susith; Seiler, Christopher L.

    2016-01-01

    Post-oligomerization synthesis is a useful technique for preparing site-specifically modified DNA oligomers. This approach involves site-specific incorporation of inherently reactive halogenated nucleobases into DNA strands using standard solid phase synthesis, followed by post-oligomerization nucleophilic aromatic substitution (SNAr) reactions with carcinogen-derived synthons. In these reactions, the inherent reactivities of DNA and carcinogen-derived species are reversed: the modified DNA nucleobase acts as an electrophile, while the carcinogen-derived species acts as a nucleophile. In the present protocol, we describe the use of the post-oligomerization approach to prepare DNA strands containing site- and stereospecific N6-adenine and N1, N6-adenine adducts induced by epoxide metabolites of the known human and animal carcinogen, 1,3-butadiene (BD). The resulting oligomers containing site specific, structurally defined DNA adducts can be used in structural and biological studies to reveal the roles of specific BD adducts in carcinogenesis and mutagenesis. PMID:26344227

  18. Structural Basis of High-Fidelity DNA Synthesis by Yeast DNA Polymerase δ

    SciTech Connect

    Swan, M.; Johnson, R; Prakash, L; Prakash, S; Aggarwal, A

    2009-01-01

    DNA polymerase ? (Pol ?) has a crucial role in eukaryotic replication. Now the crystal structure of the yeast DNA Pol ? catalytic subunit in complex with template primer and incoming nucleotide is presented at 2.0-A resolution, providing insight into its high fidelity and a framework to understand the effects of mutations involved in tumorigenesis.

  19. Synthesis of site-specific DNA-protein conjugates and their effects on DNA replication.

    PubMed

    Yeo, Jung Eun; Wickramaratne, Susith; Khatwani, Santoshkumar; Wang, Yen-Chih; Vervacke, Jeffrey; Distefano, Mark D; Tretyakova, Natalia Y

    2014-08-15

    DNA-protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA-protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases η, κ, ν, and ι. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  20. Synthesis of linear and cyclic peptide-PEG-lipids for stabilization and targeting of cationic liposome-DNA complexes.

    PubMed

    Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R

    2016-03-15

    Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles. PMID:26874401

  1. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  2. Remote Activation of Host Cell DNA Synthesis in Uninfected Cells Signaled by Infected Cells in Advance of Virus Transmission

    PubMed Central

    Schmidt, Nora; Hennig, Thomas; Serwa, Remigiusz A.; Marchetti, Magda

    2015-01-01

    ABSTRACT Viruses modulate cellular processes and metabolism in diverse ways, but these are almost universally studied in the infected cell itself. Here, we study spatial organization of DNA synthesis during multiround transmission of herpes simplex virus (HSV) using pulse-labeling with ethynyl nucleotides and cycloaddition of azide fluorophores. We report a hitherto unknown and unexpected outcome of virus-host interaction. Consistent with the current understanding of the single-step growth cycle, HSV suppresses host DNA synthesis and promotes viral DNA synthesis in spatially segregated compartments within the cell. In striking contrast, during progressive rounds of infection initiated at a single cell, we observe that infection induces a clear and pronounced stimulation of cellular DNA replication in remote uninfected cells. This induced DNA synthesis was observed in hundreds of uninfected cells at the extended border, outside the perimeter of the progressing infection. Moreover, using pulse-chase analysis, we show that this activation is maintained, resulting in a propagating wave of host DNA synthesis continually in advance of infection. As the virus reaches and infects these activated cells, host DNA synthesis is then shut off and replaced with virus DNA synthesis. Using nonpropagating viruses or conditioned medium, we demonstrate a paracrine effector of uninfected cell DNA synthesis in remote cells continually in advance of infection. These findings have significant implications, likely with broad applicability, for our understanding of the ways in which virus infection manipulates cell processes not only in the infected cell itself but also now in remote uninfected cells, as well as of mechanisms governing host DNA synthesis. IMPORTANCE We show that during infection initiated by a single particle with progressive cell-cell virus transmission (i.e., the normal situation), HSV induces host DNA synthesis in uninfected cells, mediated by a virus-induced paracrine

  3. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  4. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  5. Antibacterial activity and inhibition of protein synthesis in Escherichia coli by antisense DNA analogs.

    PubMed

    Rahman, M A; Summerton, J; Foster, E; Cunningham, K; Stirchak, E; Weller, D; Schaup, H W

    1991-01-01

    Protein synthesis, which takes place within ribosomes, is essential for the survival of any living organism. Ribosomes are composed of both proteins and RNA. Specific interaction between the 3' end CCUCC sequence of prokaryotic 16S rRNA and a partially complementary sequence preceding the initiating codon of mRNA is believed to be a prerequisite for initiation of protein synthesis. Here we report the use of short (three to six nucleotides) synthetic DNA analogs complementary to this sequence to block protein synthesis in vitro and in vivo in Escherichia coli. In the DNA analogs the normal phosphodiester bond in the antisense DNA was replaced by methylcarbamate internucleoside linkages to enhance transport across plasma membranes. Of the analogs tested, those with the sequence AGG and GGA inhibit protein synthesis and colony formation by E. coli strains lacking an outer cell wall. Polyethylene glycol 1000 (PEG 1000) was attached to the 5' end of some of the test methylcarbamate DNAs to enhance solubility. Analogs of AGG and GGAG with PEG 1000 attached inhibited colony formation in normal E. coli. These analogs may be useful food additives to control bacterial spoilage and biomedically as antibiotics. PMID:1821653

  6. An improved method of gene synthesis based on DNA works software and overlap extension PCR.

    PubMed

    Dong, Bingxue; Mao, Runqian; Li, Baojian; Liu, Qiuyun; Xu, Peilin; Li, Gang

    2007-11-01

    A bottleneck in recent gene synthesis technologies is the high cost of oligonucleotide synthesis and post-synthesis sequencing. In this article, a simple and rapid method for low-cost gene synthesis technology was developed based on DNAWorks program and an improved single-step overlap extension PCR (OE-PCR). This method enables any DNA sequence to be synthesized with few errors, then any mutated sites could be corrected by site-specific mutagenesis technology or PCR amplification-assembly method, which can amplify different DNA fragments of target gene followed by assembly into an entire gene through their overlapped region. Eventually, full-length DNA sequence without error was obtained via this novel method. Our method is simple, rapid and low-cost, and also easily amenable to automation based on a DNAWorks design program and defined set of OE-PCR reaction conditions suitable for different genes. Using this method, several genes including Manganese peroxidase gene (Mnp) of Phanerochaete chrysosporium (P. chrysosporium), Laccase gene (Lac) of Trametes versicolor (T. versicolor) and Cip1 peroxidase gene (cip 1) of Coprinus cinereus (C. cinereus) with sizes ranging from 1.0 kb to 1.5 kb have been synthesized successfully. PMID:17952664

  7. Induction of DNA synthesis in isolated nuclei by cytoplasmic factors: inhibition by protease inhibitors.

    PubMed Central

    Wong, R L; Gutowski, J K; Katz, M; Goldfarb, R H; Cohen, S

    1987-01-01

    Cytoplasmic extracts from spontaneously proliferating and mitogen-activated lymphoid cells contain a protein factor called ADR (activator of DNA replication) that induces DNA synthesis in isolated quiescent nuclei. ADR-containing preparations have proteolytic activity, as indicated by their ability to degrade fibrin in a plasminogen-independent and plasminogen-dependent manner. In addition, aprotinin, a nonspecific protease inhibitor, abrogates ADR-induced DNA synthesis in a dose-dependent fashion. Preincubation studies demonstrated that the effect of aprotinin is not due to its suppressive effects on the nuclei themselves. Other protease inhibitors such as leupeptin, p-aminobenzamidine, and N-alpha-tosyllysine chloromethyl ketone are also inhibitory, but soybean trypsin inhibitor is without effect. ADR activity can be removed from active extracts by adsorption with aprotinin-conjugated agarose beads and can be recovered by elution with an acetate buffer (pH 5). These findings are consistent with the interpretation that the initiation of DNA synthesis in resting nuclei may be protease dependent and, further, that the cytoplasmic stimulatory factor we have called ADR may be a protease itself. PMID:3540956

  8. Synthesis of Cross-Linked DNA Containing Oxidized Abasic Site Analogues

    PubMed Central

    2015-01-01

    DNA interstrand cross-links are an important family of DNA damage that block replication and transcription. Recently, it was discovered that oxidized abasic sites react with the opposing strand of DNA to produce interstrand cross-links. Some of the cross-links between 2′-deoxyadenosine and the oxidized abasic sites, 5′-(2-phosphoryl-1,4-dioxobutane) (DOB) and the C4-hydroxylated abasic site (C4-AP), are formed reversibly. Chemical instability hinders biochemical, structural, and physicochemical characterization of these cross-linked duplexes. To overcome these limitations, we developed methods for preparing stabilized analogues of DOB and C4-AP cross-links via solid-phase oligonucleotide synthesis. Oligonucleotides of any sequence are attainable by synthesizing phosphoramidites in which the hydroxyl groups of the cross-linked product were orthogonally protected using photochemically labile and hydrazine labile groups. Selective unmasking of a single hydroxyl group precedes solid-phase synthesis of one arm of the cross-linked DNA. The method is compatible with commercially available phosphoramidites and other oligonucleotide synthesis reagents. Cross-linked duplexes containing as many as 54 nt were synthesized on solid-phase supports. Subsequent enzyme ligation of one cross-link product provided a 60 bp duplex, which is suitable for nucleotide excision repair studies. PMID:24949656

  9. A new paradigm of DNA synthesis: three-metal-ion catalysis.

    PubMed

    Yang, Wei; Weng, Peter J; Gao, Yang

    2016-01-01

    Enzyme catalysis has been studied for over a century. How it actually occurs has not been visualized until recently. By combining in crystallo reaction and X-ray diffraction analysis of reaction intermediates, we have obtained unprecedented atomic details of the DNA synthesis process. Contrary to the established theory that enzyme-substrate complexes and transition states have identical atomic composition and catalysis occurs by the two-metal-ion mechanism, we have discovered that an additional divalent cation has to be captured en route to product formation. Unlike the canonical two metal ions, which are coordinated by DNA polymerases, this third metal ion is free of enzyme coordination. Its location between the α- and β-phosphates of dNTP suggests that the third metal ion may drive the phosphoryltransfer from the leaving group opposite to the 3'-OH nucleophile. Experimental data indicate that binding of the third metal ion may be the rate-limiting step in DNA synthesis and the free energy associated with the metal-ion binding can overcome the activation barrier to the DNA synthesis reaction. PMID:27602203

  10. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    DOEpatents

    Gardner, Shea N.; Mariella, Jr., Raymond P.; Christian, Allen T.; Young, Jennifer A.; Clague, David S.

    2011-01-18

    A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

  11. Endotoxin or cytokines attenuate ozone-induced DNA synthesis in rat nasal transitional epithelium

    SciTech Connect

    Hotchkiss, J.A.; Harkema, J.R. )

    1992-06-01

    Pretreatment of rats with endotoxin (E), a potent inducer of tumor necrosis factor alpha (TNF), and interleukin 1 beta (IL 1), or a combination of TNF and IL1, has been shown to increase levels of lung antioxidant enzymes and protect against pulmonary toxicity associated with hyperoxia. Inhalation of ozone (O3) induces cell injury, followed by increased DNA synthesis, cell proliferation, and secretory cell metaplasia in rat nasal transitional epithelium (NTE). This study was designed to test the effects of E, TNF, and IL1 pretreatment on acute O3-induced NTE cell injury as measured by changes in NTE cell DNA synthesis. Rats were exposed to either 0.8 ppm O3 or air for 6 hr in whole-body inhalation chambers. Immediately before exposure, rats in each group were injected intraperitoneally (ip) with either saline alone or saline containing E, TNF, IL1, or both TNF and IL1. Eighteen hours postexposure, rats were injected ip with bromodeoxyuridine to label cells undergoing DNA synthesis and were euthanized 2 hr later. NTE was processed for light microscopy and immunochemically stained to identify cells that had incorporated BrdU into nuclear DNA. The number of BrdU-labeled NTE nuclei per millimeter of basal lamina was quantitated. There were no significant differences in the number of BrdU-labeled NTE nuclei in air-exposed rats that were injected with E, TNF, IL1, or TNF/IL1 compared with those in saline-injected, air-exposed controls. Rats that were injected with saline and exposed to O3 had approximately 10 times the number of BrdU-labeled NTE nuclei than saline-injected, air-exposed control rats. O3 exposure also induced a significant increase in labeled nuclei in rats that were pretreated with TNF alone. In contrast, pretreatment with E, IL1, or TNF/IL1 attenuated the O3-induced increase in NTE DNA synthesis.

  12. 5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

    NASA Technical Reports Server (NTRS)

    Frank, Natia L.; Meade, Thomas J.

    2003-01-01

    Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

  13. The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ.

    PubMed

    Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E; Takeda, Shunichi

    2015-02-18

    The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

  14. Synthesis, characterization and chemoprotective activity of polyoxovanadates against DNA alkylation.

    PubMed

    Nunes, Giovana G; Bonatto, Ana C; de Albuquerque, Carla G; Barison, Andersson; Ribeiro, Ronny R; Back, Davi F; Andrade, André Vitor C; de Sá, Eduardo L; Pedrosa, Fábio de O; Soares, Jaísa F; de Souza, Emanuel M

    2012-03-01

    The alkylation of pUC19 plasmid DNA has been employed as a model reaction for the first studies on chemoprotective action by a mixed-valence (+IV/+V) polyoxovanadate. A new, non-hydrothermal route for the high yield preparation of the test compound is described. The deep green, microcrystalline solid A was isolated after a three-day reaction in water at 80°C and 1 atm, while the reaction at 100°C gave green crystals of B. Both solids were structurally characterized by X-ray diffractometry and FTIR, EPR, NMR and Raman spectroscopies. Product A was identified as (NH(4))(2)V(3)O(8), while B corresponds to the spherical polyoxoanion [V(15)O(36)(Cl)](6-), isolated as the NMe(4)(+) salt. The lack of solubility of A in water and buffers prevented its use in DNA interaction studies, which were then carried out with B. Complex B was also tested for its ability to react with DNA alkylating agents by incubation with diethylsulphate (DES) and dimethylsulphate (DMS) in both the absence and presence of pUC19. For DMS, the best results were obtained with 10 mM of B (48% protection); with DES, this percentage increased to 70%. The direct reaction of B with increasing amounts of DMS in both buffered (PIPES 50 mM) and non-buffered aqueous solutions revealed the sequential formation of several vanadium(IV), vanadium(V) and mixed-valence aggregates of different nuclearities, whose relevance to the DNA-protecting activity is discussed. PMID:22265837

  15. Nuclear reorganization of mammalian DNA synthesis prior to cell cycle exit.

    PubMed

    Barbie, David A; Kudlow, Brian A; Frock, Richard; Zhao, Jiyong; Johnson, Brett R; Dyson, Nicholas; Harlow, Ed; Kennedy, Brian K

    2004-01-01

    In primary mammalian cells, DNA replication initiates in a small number of perinucleolar, lamin A/C-associated foci. During S-phase progression in proliferating cells, replication foci distribute to hundreds of sites throughout the nucleus. In contrast, we find that the limited perinucleolar replication sites persist throughout S phase as cells prepare to exit the cell cycle in response to contact inhibition, serum starvation, or replicative senescence. Proteins known to be involved in DNA synthesis, such as PCNA and DNA polymerase delta, are concentrated in perinucleolar foci throughout S phase under these conditions. Moreover, chromosomal loci are redirected toward the nucleolus and overlap with the perinucleolar replication foci in cells poised to undergo cell cycle exit. These same loci remain in the periphery of the nucleus during replication under highly proliferative conditions. These results suggest that mammalian cells undergo a large-scale reorganization of chromatin during the rounds of DNA replication that precede cell cycle exit. PMID:14701733

  16. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    PubMed

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  17. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  18. Regulation of chloroplast number and DNA synthesis in higher plants. Final report

    SciTech Connect

    Mullet, J.E.

    1995-11-10

    The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailing description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.

  19. Synthesis and hybridization properties of an acyclic achiral phosphonate DNA analogue.

    PubMed

    Kehler, J; Henriksen, U; Vejbjerg, H; Dahl, O

    1998-03-01

    Protected N-(2-hydroxyethyl)-N-(nucleobase-acetyl)aminomethanephosphonic+ ++ acid (6a-d) of all four DNA nucleobases have been prepared and oligomerized by solid-phase synthesis. Four DNA decamers containing 1-10 of these 'PPNA' monomers were prepared and evaluated by Tm measurements (medium salt) for binding to their DNA and RNA complements. One central modification reduced the binding strongly (delta Tm = -10 degrees C), but contiguous PPNA monomers gave smaller effects, and the all-PPNA decamer bound to RNA with a delta Tm of -1.2 degrees C per modification. Thus PPNA oligomers are inferior DNA and RNA binders compared to the closely related and strongly binding PNA oligomers. PMID:9568285

  20. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  1. Synthesis, photochemical properties and DNA binding studies of dna cleaving agents based on chiral dipyridine dihydrodioxins salts

    NASA Astrophysics Data System (ADS)

    Shamaev, Alexei

    activated by UV-light. The mechanism of o-quinone release and intramolecular ET was studied in detail by methods of Ultrafast Transient Absortion Spectroscopy and supported by high-level quantum mechanical calculations. The binding properties of chiral intercalators based on PDHD to various DNA oligonucleotides were studied by various methods and DNA cleavage properties indicating strong binding and cleaving ability of the synthesized PDHDs. Also, a new method for synthesis of cyclohexa[e]pyrenes which possibly capable of intramolecular ET and electron transfer-oxidative stress (ET-OS) DNA cleavage was developed and partially accomplished.

  2. Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.

    PubMed

    Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan

    2013-02-26

    Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology. PMID:23272944

  3. Translesion synthesis is the main component of SOS repair in bacteriophage lambda DNA.

    PubMed Central

    Defais, M; Lesca, C; Monsarrat, B; Hanawalt, P

    1989-01-01

    Agents that interfere with DNA replication in Escherichia coli induce physiological adaptations that increase the probability of survival after DNA damage and the frequency of mutants among the survivors (the SOS response). Such agents also increase the survival rate and mutation frequency of irradiated bacteriophage after infection of treated bacteria, a phenomenon known as Weigle reactivation. In UV-irradiated single-stranded DNA phage, Weigle reactivation is thought to occur via induced, error-prone replication through template lesions (translesion synthesis [P. Caillet-Fauquet, M: Defais, and M. Radman, J. Mol. Biol. 117:95-112, 1977]). Weigle reactivation occurs with higher efficiency in double-stranded DNA phages such as lambda, and we therefore asked if another process, recombination between partially replicated daughter molecules, plays a major role in this case. To distinguish between translesion synthesis and recombinational repair, we studied the early replication of UV-irradiated bacteriophage lambda in SOS-induced and uninduced bacteria. To avoid complications arising from excision of UV lesions, we used bacterial uvrA mutants, in which such excision does not occur. Our evidence suggests that translesion synthesis is the primary component of Weigle reactivation of lambda phage in the absence of excision repair. The greater efficiency in Weigle reactivation of double-stranded DNA phage could thus be attributed to some inducible excision repair unable to occur on single-stranded DNA. In addition, after irradiation, lambda phage replication seems to switch prematurely from the theta mode to the rolling circle mode. Images PMID:2527845

  4. Mutagenicity and pausing of HIV reverse transcriptase during HIV plus-strand DNA synthesis.

    PubMed Central

    Ji, J; Hoffmann, J S; Loeb, L

    1994-01-01

    The unusually high frequency of misincorporation by HIV-1 reverse transcriptase (HIV RT) is likely to be the major factor in the rapid accumulation of viral mutations in AIDS, especially in the env gene. To investigate the ability of HIV RT to copy the env gene, we subcloned an HIV env gene fragment into a single-stranded DNA vector and measured the progression of synthesis by HIV RT. We observed that HIV RT, but not RT from avian myeloblastosis virus, DNA polymerase-alpha or T7 DNA polymerase, pauses specifically at poly-deoxyadenosine stretches within the env gene. The frequency of bypassing the polyadenosine stretches by HIV RT is enhanced by increasing the ratio of enzyme to template. We measured the fidelity of DNA synthesis within a segment of the hypervariable region 1 of the env gene (V-1) containing a poly-deoxyadenosine sequence by repetitively copying the DNA by HIV RT, and then cloning and sequencing the copied fragments. We found that 27% of the errors identified in V-1 sequence were frameshift mutations opposite the poly-adenosine tract, a site where strong pausing was observed. Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides. Moreover, netropsin increases the frequency of frameshift mutations in experiments in which HIV RT catalyzes gap filling synthesis within the lacZ gene in double-stranded circular M13mp2 DNA. These combined results suggest that the enhanced mutation frequency may be due to increased pausing at netropsin-modified polyadenosine tracts. Therefore, netropsin and related A-T binding chemicals may selectively enhance frameshift mutagenesis induced by HIV RT and yield predominantly non-viable virus. Images PMID:7510388

  5. Synthesis of a duplex oligonucleotide containing a nitrogen mustard interstrand DNA-DNA cross-link.

    PubMed

    Ojwang, J O; Grueneberg, D A; Loechler, E L

    1989-12-01

    Many cancer chemotherapeutic agents react with DNA and give adducts that block DNA replication, which is thought to result in cytotoxicity, especially in rapidly proliferating cells such as cancer cells. One class of these agents is bifunctionally reactive (e.g., the nitrogen mustards) and forms DNA-DNA cross-links. It is unknown whether inter- or intrastrand cross-links are more effective at blocking DNA replication. To evaluate this, a DNA shuttle vector is being constructed with an interstrand cross-link at a unique site. In the first step of this project, a duplex oligonucleotide containing an interstrand cross-link is isolated by denaturing polyacrylamide gel electrophoresis from the reaction of nitrogen mustard with two partially complementary oligodeoxynucleotides. The purified oligonucleotide product is characterized and shown to be cross-linked in a 5'-GAC-3' 3'-CTG-5' sequence by a nitrogen mustard moiety that is bound at the N(7)-position of the guanines in the opposing strands; the glycosylic bonds of these guanine adducts are stabilized in their corresponding imidazole ring-opened form. Nitrogen mustard is shown to react with a variety of oligonucleotides and, based upon these results, its preferred targets for interstrand cross-linking are 5'-GXC-3' sequences, where X can be any of the four deoxyribonucleotide bases. PMID:2819709

  6. Deoxynivalenol affects in vitro intestinal epithelial cell barrier integrity through inhibition of protein synthesis

    SciTech Connect

    Van De Walle, Jacqueline; Sergent, Therese; Piront, Neil; Toussaint, Olivier; Schneider, Yves-Jacques; Larondelle, Yvan

    2010-06-15

    Deoxynivalenol (DON), one of the most common mycotoxin contaminants of raw and processed cereal food, adversely affects the gastrointestinal tract. Since DON acts as a protein synthesis inhibitor, the constantly renewing intestinal epithelium could be particularly sensitive to DON. We analyzed the toxicological effects of DON on intestinal epithelial protein synthesis and barrier integrity. Differentiated Caco-2 cells, as a widely used model of the human intestinal barrier, were exposed to realistic intestinal concentrations of DON (50, 500 and 5000 ng/ml) during 24 h. DON caused a concentration-dependent decrease in total protein content associated with a reduction in the incorporation of [{sup 3}H]-leucine, demonstrating its inhibitory effect on protein synthesis. DON simultaneously increased the paracellular permeability of the monolayer as reflected through a decreased transepithelial electrical resistance associated with an increased paracellular flux of the tracer [{sup 3}H]-mannitol. A concentration-dependent reduction in the expression level of the tight junction constituent claudin-4 was demonstrated by Western blot, which was not due to diminished transcription, increased degradation, or NF-{kappa}B, ERK or JNK activation, and was also observed for a tight junction independent protein, i.e. intestinal alkaline phosphatase. These results demonstrate a dual toxicological effect of DON on differentiated Caco-2 cells consisting in an inhibition of protein synthesis as well as an increase in monolayer permeability, and moreover suggest a possible link between them through diminished synthesis of the tight junction constituent claudin-4.

  7. On-Flow Synthesis of Co-Polymerizable Oligo-Microspheres and Application in ssDNA Amplification

    PubMed Central

    Lee, Se Hee; Lee, Jae Ha; Lee, Ho Won; Kim, Yang-Hoon; Jeong, Ok Chan; Ahn, Ji-Young

    2016-01-01

    We fabricated droplet-based microfluidic platform for copolymerizable microspheres with acrydite modified DNA probe. The copolymerizable 3-D polyacrylamide microspheres were successfully produced from microcontinuous-flow synthesis with on-channel solidification. DNA copolymerization activity, surface presentation and thermostability were assessed by using fluorescent labeled complementary probe. The binding performance was only visible on the surface area of oligo-microspheres. We show that the resulting oligo-microspheres can be directly integrated into a streamlined microsphere-PCR protocol for amplifying ssDNA. Our microspheres could be utilized as a potential material for ssDNA analysis such as DNA microarray and automatic DNA SELEX process. PMID:27447941

  8. Design and synthesis of efficient fluorescent dyes for incorporation into DNA backbone and biomolecule detection.

    PubMed

    Wang, Wei; Li, Alexander D Q

    2007-01-01

    We report here the design and synthesis of a series of pi-conjugated fluorescent dyes with D-A-D (D, donor; A, acceptor), D-pi-D, A-pi-A, and D-pi-A for applications as the signaling motif in biological-synthetic hybrid foldamers for DNA detection. The Horner-Wadsworth-Emmons (HWE) reaction and Knoevenagel condensation were demonstrated as the optimum ways for construction of long pi-conjugated systems. Such rodlike chromophores have distinct advantages, as their fluorescence properties are not quenched by the presence of DNA. To be incorporated into the backbone of DNA, the chromophores need to be reasonably soluble in organic solvent for solid-phase synthesis, and therefore a strategy of using flexible tetraethylene glycol (TEG) linkers at either end of these rodlike dyes was developed. The presence of TEG facilitates the protection of the chain-growing hydroxyl group with DMTrCl (dimethoxytrityl chloride) as well as the activation of the coupling step with phosphoramidite chemistry on an automated DNA synthesizer. To form fluorescence resonance energy transfer (FRET) pairs, six synthetic chromophores with blue to red fluorescence have been developed, and those with orthogonal fluorescent emission were chosen for incorporation into DNA-chromophore hybrid foldamers. PMID:17508711

  9. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    PubMed

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed. PMID:27019201

  10. Factors affecting the isolation of CCC DNA from Streptomyces lividans and Escherichia coli.

    PubMed

    Kieser, T

    1984-07-01

    Based on the results of a systematic study of factors affecting plasmid yield and purity, a procedure suitable for the rapid screening for and isolation of covalently closed circular DNA from Streptomyces lividans and Escherichia coli was developed. The method consists of lysis of lysozyme-treated bacteria combined with alkaline denaturation of DNA at high temperature. Renaturation of CCC DNA and precipitation of single-stranded DNA together with protein is achieved by the addition of a minimal amount of phenol/chloroform. The screening procedure uses only a single tube and the samples can be analyzed by agarose gel electrophoresis about 30 min after lysis. Removal of phenol and further purification of the plasmid preparation is achieved by consecutive precipitations with isopropanol and spermine, followed by extraction with ethanol, producing samples suitable for restriction endonuclease digestion, ligation, and transformation of S. lividans protoplasts or competent E. coli cells in about 2 h. All steps of the procedure are explained in detail with information about the effects of changing parameters. This should help the experimenter to obtain reproducible results and may be useful if the method has to be adapted to new strains or plasmids. PMID:6387733

  11. DNA Hypomethylation Affects Cancer-Related Biological Functions and Genes Relevant in Neuroblastoma Pathogenesis

    PubMed Central

    Mayol, Gemma; Martín-Subero, José I.; Ríos, José; Queiros, Ana; Kulis, Marta; Suñol, Mariona; Esteller, Manel; Gómez, Soledad; Garcia, Idoia; de Torres, Carmen; Rodríguez, Eva; Galván, Patricia; Mora, Jaume; Lavarino, Cinzia

    2012-01-01

    Neuroblastoma (NB) pathogenesis has been reported to be closely associated with numerous genetic alterations. However, underlying DNA methylation patterns have not been extensively studied in this developmental malignancy. Here, we generated microarray-based DNA methylation profiles of primary neuroblastic tumors. Stringent supervised differential methylation analyses allowed us to identify epigenetic changes characteristic for NB tumors as well as for clinical and biological subtypes of NB. We observed that gene-specific loss of DNA methylation is more prevalent than promoter hypermethylation. Remarkably, such hypomethylation affected cancer-related biological functions and genes relevant to NB pathogenesis such as CCND1, SPRR3, BTC, EGF and FGF6. In particular, differential methylation in CCND1 affected mostly an evolutionary conserved functionally relevant 3′ untranslated region, suggesting that hypomethylation outside promoter regions may play a role in NB pathogenesis. Hypermethylation targeted genes involved in cell development and proliferation such as RASSF1A, POU2F2 or HOXD3, among others. The results derived from this study provide new candidate epigenetic biomarkers associated with NB as well as insights into the molecular pathogenesis of this tumor, which involves a marked gene-specific hypomethylation. PMID:23144874

  12. Synthesis, DNA-binding and biological activity of a double intercalating analog of ethidium bromide.

    PubMed Central

    Kuhlmann, K F; Charbeneau, N J; Mosher, C W

    1978-01-01

    A bis-phenanthridinium salt has been synthesized and its DNA-binding studied. Evidence provided by UV and CD spectra, by thermal denaturation profiles and by equilibrium dialysis of the drug-DNA complex lead to the conclusion that both phenanthridine moieties intercalate in the helix. The double intercalator appears to be less potent than ethidium chloride as an inhibitor of nucleic acid synthesis in cultured L1210 cells, though it is more potent than a monomeric analog. The low potency may be due to a low cell influx rate. PMID:673863

  13. A cis-acting mutation in the Sindbis virus junction region which affects subgenomic RNA synthesis.

    PubMed Central

    Grakoui, A; Levis, R; Raju, R; Huang, H V; Rice, C M

    1989-01-01

    The synthesis of Sindbis virus minus-strand and genomic and subgenomic RNAs is believed to require specific cis-acting sequences or structures in the template RNAs and a combination of virus-specific proteins and host components which act in trans. A conserved sequence of about 21 nucleotides in the junction region and encompassing the start site for the subgenomic RNA has been proposed to function as the promoter on the minus-strand template for synthesis of the subgenomic RNA (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982). We introduced a three-base insertion in this sequence, which also inserts a single amino acid near the COOH terminus of nsP4, in a cDNA clone of Sindbis virus from which infectious RNA transcripts can be generated. The phenotype of this mutant, called Toto1100CR4.1, was studied after RNA transfection of chicken embryo fibroblasts or BHK cells. The mutation leads to a drastic reduction in the level of the subgenomic RNA but does not alter the start site of the RNA. Probably as a consequence of depressed structural-protein synthesis, very few progeny virions are released and the mutant makes tiny or indistinct plaques even after prolonged incubation. The cis-acting effect of this mutation was demonstrated by incorporating either a wild-type or mutant junction region into a defective-interfering RNA and examining the relative synthesis of defective-interfering RNA-derived subgenomic RNA in vivo in the presence of wild-type helper virus. These results show that the junction region is recognized by yet unidentified viral trans-acting components for subgenomic RNA synthesis. When the Toto1100CR4.1 mutant was passaged in culture, plaque morphology variants readily arose. A total of 24 independent revertants were isolated, and 16 were characterized in detail. All revertants analyzed showed an increase in the level of subgenomic RNA synthesis. Sequence analysis of the junction region

  14. Synthesis of peptide-conjugated light-driven molecular motors and evaluation of their DNA-binding properties.

    PubMed

    Nagatsugi, Fumi; Takahashi, Yusuke; Kobayashi, Maiko; Kuwahara, Shunsuke; Kusano, Shuhei; Chikuni, Tomoko; Hagihara, Shinya; Harada, Nobuyuki

    2013-05-01

    Synthetic light-driven molecular motors are molecular machines capable of rotation under photo-irradiation. In this paper, we report the synthesis of peptide-conjugated molecular motors and evaluate their DNA-binding properties. PMID:23324812

  15. STRUCTURE-ACTIVITY STUDY OF PARACETAMOL ANALOGUES: INHIBITION OF REPLICATIVE DNA SYNTHESIS IN V79 CHINESE HAMSTER CELLS

    EPA Science Inventory

    Experimental and theoretical evidence pertaining to cytotoxic and genotoxic activity of paracetamol in biological systems was used to formulate a simple mechanistic hypothesis to explain the relative inhibition of replicative DNA synthesis by a series of 19 structurally similar p...

  16. Synthesis of Programmable Reaction-Diffusion Fronts Using DNA Catalyzers

    NASA Astrophysics Data System (ADS)

    Zadorin, Anton S.; Rondelez, Yannick; Galas, Jean-Christophe; Estevez-Torres, André

    2015-02-01

    We introduce a DNA-based reaction-diffusion (RD) system in which reaction and diffusion terms can be precisely and independently controlled. The effective diffusion coefficient of an individual reaction component, as we demonstrate on a traveling wave, can be reduced up to 2.7-fold using a self-assembled hydrodynamic drag. The intrinsic programmability of this RD system allows us to engineer, for the first time, orthogonal autocatalysts that counterpropagate with minimal interaction. Our results are in excellent quantitative agreement with predictions of the Fisher-Kolmogorov-Petrovskii-Piscunov model. These advances open the way for the rational engineering of pattern formation in pure chemical RD systems.

  17. [Intensity of DNA synthesis in animal organs after a flight on the Kosmos-782 biosatellite].

    PubMed

    Guseĭnov, F T; Egorov, I A; Komolova, G S; Tigranian, R A

    1979-01-01

    With respect to H3-thymidine incorporation the rate of DNA synthesis in the liver, spleen and thymus of rats was determined in flight and synchronous rats. Six hours post-flight the rate of H3-thymidine incorporation into the liver of flight rats did not differ from the normal (vivarium controls) and was 50% higher than in the synchronous rats. In the spleen and thymus of flight animals this parameter was 60 and 33% below the norm. Similar but less pronounced changes in the spleen were found in the synchronous rats. Twenty-five days postflight the rate of DNA synthesis in lymph organs recovered completely and tended to increase, whereas in the liver it remained significantly below the norm. PMID:459398

  18. Protein synthesis directly from PCR: progress and applications of cell-free protein synthesis with linear DNA.

    PubMed

    Schinn, Song-Min; Broadbent, Andrew; Bradley, William T; Bundy, Bradley C

    2016-06-25

    A rapid, versatile method of protein expression and screening can greatly facilitate the future development of therapeutic biologics, proteomic drug targets and biocatalysts. An attractive candidate is cell-free protein synthesis (CFPS), a cell-lysate-based in vitro expression system, which can utilize linear DNA as expression templates, bypassing time-consuming cloning steps of plasmid-based methods. Traditionally, such linear DNA expression templates (LET) have been vulnerable to degradation by nucleases present in the cell lysate, leading to lower yields. This challenge has been significantly addressed in the recent past, propelling LET-based CFPS as a useful tool for studying, screening and engineering proteins in a high-throughput manner. Currently, LET-based CFPS has promise in fields such as functional proteomics, protein microarrays, and the optimization of complex biological systems. PMID:27085957

  19. Host protein Snapin interacts with human cytomegalovirus pUL130 and affects viral DNA replication.

    PubMed

    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanpin; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang

    2016-06-01

    The interplay between the host and Human cytomegalovirus (HCMV) plays a pivotal role in the outcome of an infection. HCMV growth in endothelial and epithelial cells requires expression of viral proteins UL128, UL130, and UL131 proteins (UL128-131), of which UL130 is the largest gene and the only one that is not interrupted by introns.Mutation of the C terminus of the UL130 protein causes reduced tropism of endothelial cells (EC). However, very few host factors have been identified that interact with the UL130 protein. In this study, HCMV UL130 protein was shown to directly interact with the human protein Snapin in human embryonic kidney HEK293 cells by Yeast two-hybrid screening, in vitro glutathione S-transferase (GST) pull-down, and co-immunoprecipitation. Additionally, heterologous expression of protein UL130 revealed co-localization with Snapin in the cell membrane and cytoplasm of HEK293 cells using fluorescence confocal microscopy. Furthermore, decreasing the level of Snapin via specific small interfering RNAs decreased the number of viral DNA copies and titer inHCMV-infected U373-S cells. Taken together, these results suggest that Snapin, the pUL130 interacting protein, has a role in modulating HCMV DNA synthesis. PMID:27240978

  20. Synthesis, characterization and DNA cleaving studies of new organocobaloxime derivatives.

    PubMed

    Erdem-Tuncmen, Mukadder; Karipcin, Fatma; Ozmen, Ismail

    2013-01-01

    Dioxime ligand (H2L) was synthesized by condensation reaction between 4-biphenylchloroglyoxime and 4-chloroaniline. The metal complexes of the types, [Co(HL)2(i-Pr)Py], [CoL2(i-Pr)PyB2F4] and [CoL2(i-Pr)Py(Cu(phen))2](ClO4)2 [H2L = 4-(4-chlorophenylamino)biphenylglyoxime; phen = 1,10-phenanthroline; i-Pr = isopropyl; Py = pyridine] were synthesized and characterized by elemental analysis, FT-IR, 1H NMR and magnetic susceptibility, conductivity measurements. The results of elemental analyses, IR and NMR confirmed the stoichiometry of the complexes and the formation of ligand frameworks around the metal ions. The magnetic moment measurements of the complexes indicated that the complexes are diamagnetic (low-spin d6 octahedral) except trinuclear complex. Furthermore the interaction between the dioxime ligand and its complexes with DNA has also been investigated by agarose gel electrophoresis. The trinuclear Cu2Co complex with H2O2 as a cooxidant exhibited the strongest DNA cleaving activity. PMID:23841342

  1. The Foundry: the DNA synthesis and construction Foundry at Imperial College

    PubMed Central

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-01-01

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  2. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  3. The adenovirus E1A protein overrides the requirement for cellular ras in initiating DNA synthesis.

    PubMed Central

    Stacey, D W; Dobrowolski, S F; Piotrkowski, A; Harter, M L

    1994-01-01

    The adenovirus E1A protein can induce cellular DNA synthesis in growth-arrested cells by interacting with the cellular protein p300 or pRb. In addition, serum- and growth factor-dependent cells require ras activity to initiate DNA synthesis and recently we have shown that Balb/c 3T3 cells can be blocked in either early or late G1 following microinjection of an anti-ras antibody. In this study, the E1A 243 amino acid protein is shown through microinjection not only to shorten the G0 to S phase interval but, what is more important, to override the inhibitory effects exerted by the anti-ras antibody in either early or late G1. Specifically, whether E1A is co-injected with anti-ras into quiescent cells or injected 18 h following a separate injection of anti-ras after serum stimulation, it efficiently induces cellular DNA synthesis in cells that would otherwise be blocked in G0/G1. Moreover, injection of a mutant form of E1A that can no longer associate with p300 is just as efficient as wild-type E1A in stimulating DNA synthesis in cells whose ras activity has been neutralized by anti-ras. The results presented here show that E1A is capable of overriding the requirement of cellular ras activity in promoting the entry of cells into S phase. Moreover, the results suggest the possibility that pRb and/or pRb-related proteins may function in a ras-dependent pathway that enables E1A to achieve this activity. Images PMID:7813447

  4. The Foundry: the DNA synthesis and construction Foundry at Imperial College.

    PubMed

    Chambers, Stephen; Kitney, Richard; Freemont, Paul

    2016-06-15

    The establishment of a DNA synthesis and construction foundry at Imperial College in London heralds a new chapter in the development of synthetic biology to meet new global challenges. The Foundry employs the latest technology to make the process of engineering biology easier, faster and scalable. The integration of advanced software, automation and analytics allows the rapid design, build and testing of engineered organisms. PMID:27284027

  5. TrfA-Dependent Inner Membrane-Associated Plasmid RK2 DNA Synthesis and Association of TrfA with Membranes of Different Gram-Negative Hosts

    PubMed Central

    Banack, Trevor; Kim, Peter D.; Firshein, William

    2000-01-01

    TrfA, the replication initiator protein of broad-host-range plasmid RK2, was tested for its ability to bind to the membrane of four different gram-negative hosts in addition to Escherichia coli: Pseudomonas aeruginosa, Pseudomonas putida, Salmonella enterica serovar Typhimurium, and Rhodobacter sphaeroides. Cells harboring TrfA-encoding plasmids were fractionated into soluble, inner membrane, and outer membrane fractions. The fractions were subjected to Western blotting, and the blots were probed with antibody to the TrfA proteins. TrfA was found to fractionate with the cell membranes of all species tested. When the two membrane fractions of these species were tested for their ability to synthesize plasmid DNA endogenously (i.e., without added template or enzymes), only the inner membrane fraction was capable of extensive synthesis that was inhibited by anti-TrfA antibody in a manner similar to that of the original host species, E. coli. In addition, although DNA synthesis did occur in the outer membrane fraction, it was much less extensive than that exhibited by the inner membrane fraction and only slightly affected by anti-TrfA antibody. Plasmid DNA synthesized by the inner membrane fraction of one representative species, P. aeruginosa, was characteristic of supercoil and intermediate forms of the plasmid. Extensive DNA synthesis was observed in the soluble fraction of another representative species, R. sphaeroides, but it was completely unaffected by anti-TrfA antibody, suggesting that such synthesis was due to repair and/or nonspecific chain extension of plasmid DNA fragments. PMID:10913068

  6. Bombesin stimulation of DNA synthesis and cell division in cultures of Swiss 3T3 cells.

    PubMed Central

    Rozengurt, E; Sinnett-Smith, J

    1983-01-01

    Bombesin is shown to be a potent mitogen for Swiss 3T3 cells. At nanomolar concentrations the peptide markedly enhances the ability of fresh serum to stimulate DNA synthesis in confluent and quiescent cultures of these cells. In the presence of a low concentration (3.5%) of serum, bombesin stimulates 3T3 cell proliferation. In serum-free medium, bombesin induces DNA synthesis in the absence of any other added growth factor; half-maximal effect is obtained at 1 nM. The mitogenic effect of bombesin is dependent on dose and time, is mimicked by litorin, and is markedly potentiated by insulin, colchicine, platelet-derived growth factor, and fibroblast-derived growth factor. These mitogens increase the maximal response elicited by bombesin and decrease the bombesin concentration required to produce half-maximal effect (from 1 nM to 0.3 nM). In contrast, vasopressin, phorbol esters, or cAMP increasing agents fail to enhance the maximal level of DNA synthesis induced by bombesin. Bombesin and litorin may provide useful model peptides for studies on the mechanism(s) by which extracellular ligands control cell proliferation. PMID:6344074

  7. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis

    PubMed Central

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-01-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  8. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Sebesta, Marek; Sisakova, Alexandra; Plault, Nicolas; Szukacsov, Valeria; Robert, Thomas; Pinter, Lajos; Marini, Victoria; Kolesar, Peter; Haracska, Lajos; Gangloff, Serge; Krejci, Lumir

    2013-03-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. PMID:23395907

  9. Stimulation of DNA synthesis in human epidermis by UVB radiation and its inhibition by difluoromethylornithine

    SciTech Connect

    Eshbaugh, W.G. Jr.; Forley, B.G.; Ritter, E.F.; Serafin, D.; Klitzman, B. )

    1990-04-01

    The purpose of this study was to determine whether the rate of DNA synthesis in human skin could be increased by UVB radiation and to determine the potential for reversing the stimulatory effects of UVB radiation by alpha-difluoromethylornithine (DFMO). Split-thickness facial skin was grafted onto athymic CD-1 Nu/Nu mice on the anterolateral dorsal surface. Following graft healing for 6 weeks, grafts were treated with 0%, 2%, or 5% DFMO (a potent inhibitor of polyamine biosynthesis) and subsequently irradiated with 0.15 J/cm2 of UVB light. Two days after UVB exposure, ({sup 3}H)thymidine was injected and the grafts were dissected and counted. Ultraviolet radiation significantly increased thymidine incorporation, indicating increased DNA synthesis. The stimulatory effects of UV radiation were significantly reduced by topical application of 5% DFMO. Thus administration of DFMO most likely decreased the polyamine level and decreased the rate of DNA synthesis, which may have caused a decreased rate of epidermal proliferation. Thus the topical application of DFMO may prove beneficial for UVB exposure and other hyperproliferative states where a decrease in the rate of cell turnover might be desirable.

  10. Deoxyadenosine family: improved synthesis, DNA damage and repair, analogs as drugs.

    PubMed

    Biswas, Himadri; Kar, Indrani; Chattopadhyaya, Rajagopal

    2013-08-01

    Improved synthesis of 2'-deoxyadenosine using Escherichia coli overexpressing some enzymes and gram-scale chemical synthesis of 2'-deoxynucleoside 5'-triphosphates reported recently are described in this review. Other topics include DNA damage induced by chromium(VI), Fenton chemistry, photoinduction with lumazine, or by ultrasound in neutral solution; 8,5'-cyclo-2'-deoxyadenosine isomers as potential biomarkers; and a recapitulation of purine 5',8-cyclonucleoside studies. The mutagenicities of some products generated by oxidizing 2'-deoxyadenosine 5'-triphosphate, nucleotide pool sanitization, and translesion synthesis are also reviewed. Characterizing cross-linking between nucleosides in opposite strands of DNA and endonuclease V-mediated deoxyinosine excision repair are discussed. The use of purine nucleoside analogs in the treatment of rarer chronic lymphoid leukemias is reviewed. Some analogs at the C8 position induced delayed polymerization arrest during HIV-1 reverse transcription. The susceptibility of clinically metronidazole-resistant Trichomonas vaginalis to two analogs, toyocamycin and 2-fluoro-2'-deoxyadenosine, were tested in vitro. GS-9148, a dAMP analog, was translocated to the priming site in a complex with reverse transcriptase and double-stranded DNA to gain insight into the mechanism of reverse transcriptase inhibition. PMID:25436589

  11. Stimulation of DNA synthesis in rat and mouse liver by various tumor promoters.

    PubMed

    Büsser, M T; Lutz, W K

    1987-10-01

    In order to investigate whether the stimulation of liver DNA synthesis might be used to detect one class of hepatic tumor promoters, the incorporation of orally administered radiolabelled thymidine into liver DNA was determined in rats and mice 24 h after a single oral gavage of test compounds at various dose levels. Three DNA-binding hepatocarcinogens, aflatoxin B1, benzidine and carbon tetrachloride, did not stimulate but rather inhibited DNA synthesis (not for CCl4). Four hepatic tumor promoters, clofibrate, DDT, phenobarbital and thioacetamide, gave rise to a stimulation in a dose-dependent manner. Single oral doses between 0.02 and 0.3 mmol/kg were required to double the level of thymidine incorporation into liver DNA (= doubling dose, DD). Differences between species or sex as observed in long-term carcinogenicity studies were reflected by a different stimulation of liver DNA synthesis. In agreement with the bioassay data, aldrin was positive only in male mice (DD = 0.007 mmol/kg) but not in male rats of female mice. 2,3,7,8-TCDD was positive in male mice (DD = 10(-6) mmol/kg) and in female rats (DD = 2 X 10(-6) mmol/kg) but not in male rats. The assay was also able to distinguish between structural isomers with different carcinogenicities. [alpha]Hexachlorocyclohexane stimulated liver DNA synthesis with a doubling dose of about 0.2 mmol/kg in male rats whereas the [gamma]-isomer was ineffective even at 1 mmol/kg. So far, only one result was inconsistent with carcinogenicity bioassay data. The different carcinogenicity of di(2-ethylhexyl)adipate (negative in rats) and di(2-ethylhexyl)phthalate (positive) was not detectable. Both plasticizers were positive in this short-term system with DD's of 0.7 mmol/kg for DEHA and 0.5 mmol/kg for DEHP. The proposed assay is discussed as an attempt to devise short-term assays for carcinogens not detected by the routine genotoxicity test systems. PMID:2443263

  12. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed Central

    Horn, T; Chang, C A; Urdea, M S

    1997-01-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

  13. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.

    2014-01-01

    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  14. Centrosomal Localization of Cyclin E-Cdk2 is Required for Initiation of DNA Synthesis

    PubMed Central

    Ferguson, Rebecca L.; Maller, James L.

    2010-01-01

    Summary Cyclin E-Cdk2 is known to regulate both DNA replication and centrosome duplication during the G1-S transition in the cell cycle [1–4], and disruption of centrosomes results in a G1 arrest in some cell types [5–7]. Localization of cyclin E on centrosomes is mediated by a 20 amino acid domain termed the centrosomal localization sequence (CLS), and expression of the GFP-tagged CLS displaces both cyclin E and cyclin A from the centrosome [8]. In asynchronous cells CLS expression inhibits the incorporation of bromodeoxyuridine (BrdU) into DNA, an effect proposed to reflect a G1 arrest. Here we show in synchronized cells that the reduction in BrdU incorporation reflects not a G1 arrest but rather direct inhibition of the initiation of DNA replication in S phase. The loading of essential DNA replication factors such as Cdc45 and PCNA onto chromatin is blocked by CLS expression, but DNA synthesis can be rescued by retargeting active cyclin E-Cdk2 to the centrosome. These results suggest that initial steps of DNA replication require centrosomally localized Cdk activity and link the nuclear cycle with the centrosome cycle at the G1-S transition. PMID:20399658

  15. Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

    SciTech Connect

    Lovrinovic, Marina; Niemeyer, Christof M. . E-mail: christof.niemeyer@uni-dortmund.de

    2005-09-30

    We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter were ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.

  16. In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template.

    PubMed Central

    Hulen, C; Legault-Demare, J

    1975-01-01

    Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences. Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. PMID:1052527

  17. DNA topoisomerase III localizes to centromeres and affects centromeric CENP-A levels in fission yeast.

    PubMed

    Norman-Axelsson, Ulrika; Durand-Dubief, Mickaël; Prasad, Punit; Ekwall, Karl

    2013-01-01

    Centromeres are specialized chromatin regions marked by the presence of nucleosomes containing the centromere-specific histone H3 variant CENP-A, which is essential for chromosome segregation. Assembly and disassembly of nucleosomes is intimately linked to DNA topology, and DNA topoisomerases have previously been implicated in the dynamics of canonical H3 nucleosomes. Here we show that Schizosaccharomyces pombe Top3 and its partner Rqh1 are involved in controlling the levels of CENP-A(Cnp1) at centromeres. Both top3 and rqh1 mutants display defects in chromosome segregation. Using chromatin immunoprecipitation and tiling microarrays, we show that Top3, unlike Top1 and Top2, is highly enriched at centromeric central domains, demonstrating that Top3 is the major topoisomerase in this region. Moreover, centromeric Top3 occupancy positively correlates with CENP-A(Cnp1) occupancy. Intriguingly, both top3 and rqh1 mutants display increased relative enrichment of CENP-A(Cnp1) at centromeric central domains. Thus, Top3 and Rqh1 normally limit the levels of CENP-A(Cnp1) in this region. This new role is independent of the established function of Top3 and Rqh1 in homologous recombination downstream of Rad51. Therefore, we hypothesize that the Top3-Rqh1 complex has an important role in controlling centromere DNA topology, which in turn affects the dynamics of CENP-A(Cnp1) nucleosomes. PMID:23516381

  18. DNA Topoisomerase III Localizes to Centromeres and Affects Centromeric CENP-A Levels in Fission Yeast

    PubMed Central

    Norman-Axelsson, Ulrika; Durand-Dubief, Mickaël; Prasad, Punit; Ekwall, Karl

    2013-01-01

    Centromeres are specialized chromatin regions marked by the presence of nucleosomes containing the centromere-specific histone H3 variant CENP-A, which is essential for chromosome segregation. Assembly and disassembly of nucleosomes is intimately linked to DNA topology, and DNA topoisomerases have previously been implicated in the dynamics of canonical H3 nucleosomes. Here we show that Schizosaccharomyces pombe Top3 and its partner Rqh1 are involved in controlling the levels of CENP-ACnp1 at centromeres. Both top3 and rqh1 mutants display defects in chromosome segregation. Using chromatin immunoprecipitation and tiling microarrays, we show that Top3, unlike Top1 and Top2, is highly enriched at centromeric central domains, demonstrating that Top3 is the major topoisomerase in this region. Moreover, centromeric Top3 occupancy positively correlates with CENP-ACnp1 occupancy. Intriguingly, both top3 and rqh1 mutants display increased relative enrichment of CENP-ACnp1 at centromeric central domains. Thus, Top3 and Rqh1 normally limit the levels of CENP-ACnp1 in this region. This new role is independent of the established function of Top3 and Rqh1 in homologous recombination downstream of Rad51. Therefore, we hypothesize that the Top3-Rqh1 complex has an important role in controlling centromere DNA topology, which in turn affects the dynamics of CENP-ACnp1 nucleosomes. PMID:23516381

  19. Human cytomegalovirus RL13 protein interacts with host NUDT14 protein affecting viral DNA replication.

    PubMed

    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanping; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang

    2016-03-01

    The interaction between the host and human cytomegalovirus (HCMV) is important in determining the outcome of a viral infection. The HCMV RL13 gene product exerts independent, inhibitory effects on viral growth in fibroblasts and epithelial cells. At present, there are few reports on the interactions between the HCMV RL13 protein and human host proteins. The present study provided direct evidence for the specific interaction between HCMV RL13 and host nucleoside diphosphate linked moiety X (nudix)‑type motif 14 (NUDT14), a UDP‑glucose pyrophosphatase, using two‑hybrid screening, an in vitro glutathione S‑transferase pull‑down assay, and co‑immunoprecipitation in human embryonic kidney HEK293 cells. Additionally, the RL13 protein was shown to co‑localize with the NUDT14 protein in the HEK293 cell membrane and cytoplasm, demonstrated using fluorescence confocal microscopy. Decreasing the expression level of NUDT14 via NUDT14‑specific small interfering RNAs increased the number of viral DNA copies in the HCMV‑infected cells. However, the overexpression of NUDT14 in a stably expressing cell line did not affect viral DNA levels significantly in the HCMV infected cells. Based on the known functions of NUDT14, the results of the present study suggested that the interaction between the RL13 protein and NUDT14 protein may be involved in HCMV DNA replication, and that NUDT14 may offer potential in the modulation of viral infection. PMID:26781650

  20. Inhibitor of DNA synthesis is present in normal chicken serum

    SciTech Connect

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-03-05

    The authors have found that heat-inactivated serum (57/sup 0/C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in /sup 3/H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of /sup 3/H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both /sup 3/H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines.

  1. A versatile biosensing system for DNA-related enzyme activity assay via the synthesis of silver nanoclusters using enzymatically-generated DNA as template.

    PubMed

    Yuan, Yijia; Li, Wenhua; Liu, Zhuoliang; Nie, Zhou; Huang, Yan; Yao, Shouzhuo

    2014-11-15

    In the present day, oligonucleotide-encapsulated silver clusters (DNA-AgNCs) have been widely applied into bio-analysis as a signal producer. Herein, we developed a novel method to synthesize DNA-AgNCs encapsulated by long-chain cytosine (C)-rich DNA. Such DNA was polymerized in a template-free way by terminal deoxynucleotidyl transferase (TdT). We demonstrated that TdT-polymerized long chain C-rich DNA can serve as an excellent template for AgNCs synthesis. Based on this novel synthesis strategy, we developed a label-free and turn-on fluorescence assay to detect TdT activity with ultralow limit of detection (LOD) of 0.0318 U and ultrahigh signal to background (S/B) of 46.7. Furthermore, our proposed method was extended to a versatile biosensing strategy for turn-on nucleases activity assay based on the enzyme-activated TdT polymerization. Two nucleases, EcoRI and ExoIII as model of endonuclease and exonuclease, respectively, have been detected with high selectivity and competitive low LOD of 0.0629 U and 0.00867 U, respectively. Our work demonstrates the feasibility of TdT polymerization-based DNA-AgNCs synthesis strategy as a versatile and potent biosensing platform to detect the activity of DNA-related enzymes. PMID:24907540

  2. Implementing Prenatal Diagnosis Based on Cell-Free Fetal DNA: Accurate Identification of Factors Affecting Fetal DNA Yield

    PubMed Central

    Barrett, Angela N.; Zimmermann, Bernhard G.; Wang, Darrell; Holloway, Andrew; Chitty, Lyn S.

    2011-01-01

    Objective Cell-free fetal DNA is a source of fetal genetic material that can be used for non-invasive prenatal diagnosis. Usually constituting less than 10% of the total cell free DNA in maternal plasma, the majority is maternal in origin. Optimizing conditions for maximizing yield of cell-free fetal DNA will be crucial for effective implementation of testing. We explore factors influencing yield of fetal DNA from maternal blood samples, including assessment of collection tubes containing cell-stabilizing agents, storage temperature, interval to sample processing and DNA extraction method used. Methods Microfluidic digital PCR was performed to precisely quantify male (fetal) DNA, total DNA and long DNA fragments (indicative of maternal cellular DNA). Real-time qPCR was used to assay for the presence of male SRY signal in samples. Results Total cell-free DNA quantity increased significantly with time in samples stored in K3EDTA tubes, but only minimally in cell stabilizing tubes. This increase was solely due to the presence of additional long fragment DNA, with no change in quantity of fetal or short DNA, resulting in a significant decrease in proportion of cell-free fetal DNA over time. Storage at 4°C did not prevent these changes. Conclusion When samples can be processed within eight hours of blood draw, K3EDTA tubes can be used. Prolonged transfer times in K3EDTA tubes should be avoided as the proportion of fetal DNA present decreases significantly; in these situations the use of cell stabilising tubes is preferable. The DNA extraction kit used may influence success rate of diagnostic tests. PMID:21998643

  3. Nuclear DNA content affects the productivity of conifer forests by altering hydraulic architecture

    NASA Astrophysics Data System (ADS)

    Alday, Josu; Resco de Dios, Víctor

    2014-05-01

    Predictions of future global climate rely on feedbacks between terrestrial vegetation and the global carbon cycle, but the exact mechanisms underlying this relationship are still being discussed. One of the key knowledge gaps lies on the scaling of cellular processes to the ecosystem level. Here we examine whether an under-explored plant trait, inter-specific variation in the bulk amount of DNA in unreplicated somatic cells (2C DNA content), can explain inter-specific variation in the maximum productivity of conifer forests. We expected 2C DNA content to be negatively related to conifer productivity because: 1) it is positively correlated with cell volume (which, in turn, potentially affects structural features such as leaf mass area, a strong predictor of photosynthetic capacity); 2) it is positively correlated with stomatal size (with larger stomata leading to lower overall stomatal conductance and, by extension, lower CO2 uptake); and 3) larger genome sizes may reduce P availability in RNA (which has been hypothesized to slow growth). We present the results of regression and independent contrasts in different monospecific forests encompassing a 52º latitudinal gradient, each being dominated by 1 of 35 different conifer species. Contrary to expectations, we observed a positive correlation between genome size and maximum Gross Primary Productivity (R2 = 0.47) and also between genome size maximum tree height (R2 = 0.27). This correlation was apparently driven by the effects of genome size on stem hydraulics, since 2C DNA was positively correlated with wood density (R2 = 0.40) and also with resistance to cavitation (P50, R2 = 0.28). That is, increased genome sizes have a positive effect on the productivity of conifer forests by affecting the vascular tissues to increase their capacity for water transport. Our results shed a new light on the evolution of the vascular system of conifer forests and how they affect ecosystem productivity, and indicate the potential to

  4. The Tip of the Tail Needle Affects the Rate of DNA Delivery by Bacteriophage P22

    PubMed Central

    Leavitt, Justin C.; Gogokhia, Lasha; Gilcrease, Eddie B.; Bhardwaj, Anshul; Cingolani, Gino; Casjens, Sherwood R.

    2013-01-01

    The P22-like bacteriophages have short tails. Their virions bind to their polysaccharide receptors through six trimeric tailspike proteins that surround the tail tip. These short tails also have a trimeric needle protein that extends beyond the tailspikes from the center of the tail tip, in a position that suggests that it should make first contact with the host’s outer membrane during the infection process. The base of the needle serves as a plug that keeps the DNA in the virion, but role of the needle during adsorption and DNA injection is not well understood. Among the P22-like phages are needle types with two completely different C-terminal distal tip domains. In the phage Sf6-type needle, unlike the other P22-type needle, the distal tip folds into a “knob” with a TNF-like fold, similar to the fiber knobs of bacteriophage PRD1 and Adenovirus. The phage HS1 knob is very similar to that of Sf6, and we report here its crystal structure which, like the Sf6 knob, contains three bound L-glutamate molecules. A chimeric P22 phage with a tail needle that contains the HS1 terminal knob efficiently infects the P22 host, Salmonella enterica, suggesting the knob does not confer host specificity. Likewise, mutations that should abrogate the binding of L-glutamate to the needle do not appear to affect virion function, but several different other genetic changes to the tip of the needle slow down potassium release from the host during infection. These findings suggest that the needle plays a role in phage P22 DNA delivery by controlling the kinetics of DNA ejection into the host. PMID:23951045

  5. Listeria monocytogenes DNA Glycosylase AdlP Affects Flagellar Motility, Biofilm Formation, Virulence, and Stress Responses

    PubMed Central

    Zhang, Ting; Bae, Dongryeoul

    2016-01-01

    ABSTRACT The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is structurally similar to the Bacillus cereus alkyl base DNA glycosylase (AlkD), was identified. This determinant was involved in the transcriptional repression of flagellar motility genes and was named adlP (encoding an AlkD-like protein [AdlP]). Deletion of adlP activated the expression of flagellar motility genes at 37°C and disrupted the temperature-dependent inhibition of L. monocytogenes motility. The adlP null strains demonstrated decreased survival in murine macrophage-like RAW264.7 cells and less virulence in mice. Furthermore, the deletion of adlP significantly decreased biofilm formation and impaired the survival of bacteria under several stress conditions, including the presence of a DNA alkylation compound (methyl methanesulfonate), an oxidative agent (H2O2), and aminoglycoside antibiotics. Our findings strongly suggest that adlP may encode a bifunctional protein that transcriptionally represses the expression of flagellar motility genes and influences stress responses through its DNA glycosylase activity. IMPORTANCE We discovered a novel protein that we named AlkD-like protein (AdlP). This protein affected flagellar motility, biofilm formation, and virulence. Our data suggest that AdlP may be a bifunctional protein that represses flagellar motility genes and influences stress responses through its DNA glycosylase activity. PMID:27316964

  6. Concentration of carp edema virus (CEV) DNA in koi tissues affected by koi sleepy disease (KSD).

    PubMed

    Adamek, Mikolaj; Jung-Schroers, Verena; Hellmann, John; Teitge, Felix; Bergmann, Sven Michael; Runge, Martin; Kleingeld, Dirk Willem; Way, Keith; Stone, David Michael; Steinhagen, Dieter

    2016-05-26

    Carp edema virus (CEV), the causative agent of 'koi sleepy disease' (KSD), appears to be spreading worldwide and to be responsible for losses in koi, ornamental varieties of the common carp Cyprinus carpio. Clinical signs of KSD include lethargic behaviour, swollen gills, sunken eyes and skin alterations and can easily be mistaken for other diseases, such as infection with cyprinid herpesvirus 3 (CyHV-3). To improve the future diagnosis of CEV infection and to provide a tool to better explore the relationship between viral load and clinical disease, we developed a specific quantitative PCR (qPCR) for strains of the virus known to infect koi carp. In samples from several clinically affected koi, CEV-specific DNA was present in a range from 1 to 2,046,000 copies, with a mean of 129,982 copies and a median of 45 copies per 250 ng of isolated DNA, but virus DNA could not be detected in all clinically affected koi. A comparison of the newly developed qPCR, which is based on a dual-labelled probe, to an existing end-point PCR procedure revealed higher specificity and sensitivity of the qPCR and demonstrated that the new protocol could improve CEV detection in koi. In addition to improved diagnosis, the newly developed qPCR test would be a useful research tool. For example, studies on the pathobiology of CEV could employ controlled infection experiments in which the development of clinical signs could be examined in parallel with a quantitative determination of virus load. PMID:27225208

  7. Simultaneous measurement of unscheduled and replicating DNA synthesis by means of a new cell culture insert DNA retention method: rapid induction of replicating DNA synthesis in response to genotoxic carcinogens.

    PubMed

    Okumura, A; Tanaka, T; Mori, H

    1996-08-01

    In order to measure simultaneously replicating DNA synthesis (RDS) and unscheduled DNA synthesis (UDS) in rat hepatocytes responding to exposure to carcinogens, a new method, namely the "cell culture insert DNA retention (CDR)" method, was developed. All CDR procedures for cell culture, digestion of cytoplasm and retention of DNA were performed on membranes attached to cell culture containers. Four subgroups of primary cultures of hepatocytes prepared from rats were exposed to a genotoxic or non-genotoxic carcinogen with or without 10 mM hydroxyurea and incubated for 4 h with 10 microCi/ml [3H]thymidine. The membranes were then processed for both liquid scintillation and autoradiography. Among seven tested chemicals, three genotoxic agents, 3,2'-dimethyl-4-aminobiphenyl, 2-acetylaminofluorene and diethylnitrosamine, and two non-genotoxic carcinogens, nafenopin and phenobarbital, induced RDS within 4 h after the exposure, indicating that these carcinogenic agents induce cell proliferation is non-proliferating rat hepatocytes prior to the emergence of genotoxic changes. Several indices were devised to characterize the genotoxicity of the tested chemicals. The induction patterns obtained showed a wide variation in the individual characteristics of carcinogen-induced genotoxicity and mitogenicity in the early phase of initiation. This is the first report of simultaneous measurement, by using a combination of autoradiography and liquid scintillation, of UDS and RDS induced in rat hepatocytes. The described CDR approach will be useful for risk assessment and characterization of carcinogenic and tumor-promoting agents. PMID:8797886

  8. Amyloid Precursor Protein (APP) Affects Global Protein Synthesis in Dividing Human Cells

    PubMed Central

    Liang, Shuang; Rambo, Brittany; Skucha, Sylvia; Weber, Megan J.; Alani, Sara; Bocchetta, Maurizio

    2015-01-01

    Hypoxic non-small cell lung cancer (NSCLC) is dependent on Notch-1 signaling for survival. Targeting Notch-1 by means of γ-secretase inhibitors (GSI) proved effective in killing hypoxic NSCLC. Post-mortem analysis of GSI-treated, NSCLC-burdened mice suggested enhanced phosphorylation of 4E-BP1 at threonines 37/46 in hypoxic tumor tissues. In vitro dissection of this phenomenon revealed that Amyloid Precursor Protein (APP) inhibition was responsible for a non-canonical 4E-BP1 phosphorylation pattern rearrangement—a process, in part, mediated by APP regulation of the pseudophosphatase Styx. Upon APP depletion we observed modifications of eIF-4F composition indicating increased recruitment of eIF-4A to the mRNA cap. This phenomenon was supported by the observation that cells with depleted APP were partially resistant to silvestrol, an antibiotic that interferes with eIF-4A assembly into eIF-4F complexes. APP downregulation in dividing human cells increased the rate of global protein synthesis, both cap- and IRES-dependent. Such an increase seemed independent of mTOR inhibition. After administration of Torin-1, APP downregulation and Mechanistic Target of Rapamycin Complex 1 (mTORC-1) inhibition affected 4E-BP1 phosphorylation and global protein synthesis in opposite fashions. Additional investigations indicated that APP operates independently of mTORC-1. Key phenomena described in this study were reversed by overexpression of the APP C-terminal domain. The presented data suggest that APP may be a novel regulator of protein synthesis in dividing human cells, both cancerous and primary. Furthermore, APP appears to affect translation initiation using mechanisms seemingly dissimilar to mTORC-1 regulation of cap-dependent protein synthesis. PMID:25283437

  9. Amyloid precursor protein (APP) affects global protein synthesis in dividing human cells.

    PubMed

    Sobol, Anna; Galluzzo, Paola; Liang, Shuang; Rambo, Brittany; Skucha, Sylvia; Weber, Megan J; Alani, Sara; Bocchetta, Maurizio

    2015-05-01

    Hypoxic non-small cell lung cancer (NSCLC) is dependent on Notch-1 signaling for survival. Targeting Notch-1 by means of γ-secretase inhibitors (GSI) proved effective in killing hypoxic NSCLC. Post-mortem analysis of GSI-treated, NSCLC-burdened mice suggested enhanced phosphorylation of 4E-BP1 at threonines 37/46 in hypoxic tumor tissues. In vitro dissection of this phenomenon revealed that Amyloid Precursor Protein (APP) inhibition was responsible for a non-canonical 4E-BP1 phosphorylation pattern rearrangement-a process, in part, mediated by APP regulation of the pseudophosphatase Styx. Upon APP depletion we observed modifications of eIF-4F composition indicating increased recruitment of eIF-4A to the mRNA cap. This phenomenon was supported by the observation that cells with depleted APP were partially resistant to silvestrol, an antibiotic that interferes with eIF-4A assembly into eIF-4F complexes. APP downregulation in dividing human cells increased the rate of global protein synthesis, both cap- and IRES-dependent. Such an increase seemed independent of mTOR inhibition. After administration of Torin-1, APP downregulation and Mechanistic Target of Rapamycin Complex 1 (mTORC-1) inhibition affected 4E-BP1 phosphorylation and global protein synthesis in opposite fashions. Additional investigations indicated that APP operates independently of mTORC-1. Key phenomena described in this study were reversed by overexpression of the APP C-terminal domain. The presented data suggest that APP may be a novel regulator of protein synthesis in dividing human cells, both cancerous and primary. Furthermore, APP appears to affect translation initiation using mechanisms seemingly dissimilar to mTORC-1 regulation of cap-dependent protein synthesis. PMID:25283437

  10. Urinary tract infection drives genome instability in uropathogenic Escherichia coli and necessitates translesion synthesis DNA polymerase IV for virulence

    PubMed Central

    Gawel, Damian

    2011-01-01

    Uropathogenic Escherichia coli (UPEC) produces ∼80% of community-acquired UTI, the second most common infection in humans. During UTI, UPEC has a complex life cycle, replicating and persisting in intracellular and extracellular niches. Host and environmental stresses may affect the integrity of the UPEC genome and threaten its viability. We determined how the host inflammatory response during UTI drives UPEC genome instability and evaluated the role of multiple factors of genome replication and repair for their roles in the maintenance of genome integrity and thus virulence during UTI. The urinary tract environment enhanced the mutation frequency of UPEC ∼100-fold relative to in vitro levels. Abrogation of inflammation through a host TLR4-signaling defect significantly reduced the mutation frequency, demonstrating in the importance of the host response as a driver of UPEC genome instability. Inflammation induces the bacterial SOS response, leading to the hypothesis that the UPEC SOS-inducible translesion synthesis (TLS) DNA polymerases would be key factors in UPEC genome instability during UTI. However, while the TLS DNA polymerases enhanced in vitro, they did not increase in vivo mutagenesis. Although it is not a source of enhanced mutagenesis in vivo, the TLS DNA polymerase IV was critical for the survival of UPEC during UTI during an active inflammatory assault. Overall, this study provides the first evidence of a TLS DNA polymerase being critical for UPEC survival during urinary tract infection and points to independent mechanisms for genome instability and the maintenance of genome replication of UPEC under host inflammatory stress. PMID:21597325

  11. Prenatal Exposure to DEHP Affects Spermatogenesis and Sperm DNA Methylation in a Strain-Dependent Manner.

    PubMed

    Prados, Julien; Stenz, Ludwig; Somm, Emmanuel; Stouder, Christelle; Dayer, Alexandre; Paoloni-Giacobino, Ariane

    2015-01-01

    Di-(2-ethylhexyl)phtalate (DEHP) is a plasticizer with endocrine disrupting properties found ubiquitously in the environment and altering reproduction in rodents. Here we investigated the impact of prenatal exposure to DEHP on spermatogenesis and DNA sperm methylation in two distinct, selected, and sequenced mice strains. FVB/N and C57BL/6J mice were orally exposed to 300 mg/kg/day of DEHP from gestation day 9 to 19. Prenatal DEHP exposure significantly decreased spermatogenesis in C57BL/6J (fold-change = 0.6, p-value = 8.7*10-4), but not in FVB/N (fold-change = 1, p-value = 0.9). The number of differentially methylated regions (DMRs) by DEHP-exposure across the entire genome showed increased hyper- and decreased hypo-methylation in C57BL/6J compared to FVB/N. At the promoter level, three important subsets of genes were massively affected. Promoters of vomeronasal and olfactory receptors coding genes globally followed the same trend, more pronounced in the C57BL/6J strain, of being hyper-methylated in DEHP related conditions. In contrast, a large set of micro-RNAs were hypo-methylated, with a trend more pronounced in the FVB/N strain. We additionally analyze both the presence of functional genetic variations within genes that were associated with the detected DMRs and that could be involved in spermatogenesis, and DMRs related with the DEHP exposure that affected both strains in an opposite manner. The major finding in this study indicates that prenatal exposure to DEHP can decrease spermatogenesis in a strain-dependent manner and affects sperm DNA methylation in promoters of large sets of genes putatively involved in both sperm chemotaxis and post-transcriptional regulatory mechanisms. PMID:26244509

  12. Prenatal Exposure to DEHP Affects Spermatogenesis and Sperm DNA Methylation in a Strain-Dependent Manner

    PubMed Central

    Somm, Emmanuel; Stouder, Christelle; Dayer, Alexandre; Paoloni-Giacobino, Ariane

    2015-01-01

    Di-(2-ethylhexyl)phtalate (DEHP) is a plasticizer with endocrine disrupting properties found ubiquitously in the environment and altering reproduction in rodents. Here we investigated the impact of prenatal exposure to DEHP on spermatogenesis and DNA sperm methylation in two distinct, selected, and sequenced mice strains. FVB/N and C57BL/6J mice were orally exposed to 300 mg/kg/day of DEHP from gestation day 9 to 19. Prenatal DEHP exposure significantly decreased spermatogenesis in C57BL/6J (fold-change = 0.6, p-value = 8.7*10-4), but not in FVB/N (fold-change = 1, p-value = 0.9). The number of differentially methylated regions (DMRs) by DEHP-exposure across the entire genome showed increased hyper- and decreased hypo-methylation in C57BL/6J compared to FVB/N. At the promoter level, three important subsets of genes were massively affected. Promoters of vomeronasal and olfactory receptors coding genes globally followed the same trend, more pronounced in the C57BL/6J strain, of being hyper-methylated in DEHP related conditions. In contrast, a large set of micro-RNAs were hypo-methylated, with a trend more pronounced in the FVB/N strain. We additionally analyze both the presence of functional genetic variations within genes that were associated with the detected DMRs and that could be involved in spermatogenesis, and DMRs related with the DEHP exposure that affected both strains in an opposite manner. The major finding in this study indicates that prenatal exposure to DEHP can decrease spermatogenesis in a strain-dependent manner and affects sperm DNA methylation in promoters of large sets of genes putatively involved in both sperm chemotaxis and post-transcriptional regulatory mechanisms. PMID:26244509

  13. Timing of initiation of macronuclear DNA synthesis is set during the preceding cell cycle in Paramecium tetraurelia: analysis of the effects of abrupt changes in nutrient level

    SciTech Connect

    Ching, A.S.L.; Berger, J.D.

    1986-11-01

    In many eukaryotic organisms, initiation of DNA synthesis is associated with a major control point within the cell cycle and reflects the commitment of the cell to the DNA replication-division portion of the cell cycle. In paramecium, the timing of DNA synthesis initiation is established prior to fission during the preceding cell cycle. DNA synthesis normally starts at 0.25 in the cell cycle. When dividing cells are subjected to abrupt nutrient shift-up by transfer from a chemostat culture to medium with excess food, or shift-down from a well-fed culture to exhausted medium, DNA synthesis initiation in the post-shift cell cycle occurs at 0.25 of the parental cell cycle and not at either 0.25 in the post-shift cell cycle or at 0.25 in the equilibrium cell cycle produced under the post-shift conditions. The long delay prior to initiation of DNA synthesis following nutritional shift-up is not a consequence of continued slow growth because the rate of protein synthesis increases rapidly to the normal level after shift-up. Analysis of the relation between increase in cell mass and initiation of DNA synthesis following nutritional shifts indicates that increase in cell mass, per se, is neither a necessary nor a sufficient condition for initiation of DNA synthesis, in spite of the strong association between accumulation of cell mass and initiation of DNA synthesis in cells growing under steady-state conditions.

  14. DNA synthesis and tritiated thymidine incorporation by heterotrophic freshwater bacteria in continuous culture

    SciTech Connect

    Ellenbroek, F.M.; Cappenberg, T.E. )

    1991-06-01

    Continuous cultivation of heterotrophic freshwater bacteria was used to assess the relationship between DNA synthesis and tritiated thymidine incorporation. In six different continuous cultures, each inoculated with a grazer-free mixed bacterial sample from Lake Vechten (The Netherlands), tritiated thymidine incorporation into a cold trichloroacetic acid precipitate and bacterial cell production were measured simultaneously. Empirical conversion factors were determined by division of both parameters. They ranged from 0.25 {times} 10{sup 18} to 1.31 {times} 10{sup 18} cells mol of tritiated thymidine{sup {minus}1}. In addition, DNA concentrations were measured by fluorometry with Heochst 33258. The validity of this technique was confirmed. Down to a generation time of 0.67 day, bacterial DNA content showed little variation, with values of 3.8 to 4.9 fg of DNA cell{sup {minus}1}. Theoretical conversion factors, which can be derived from DNA content under several assumptions, were between 0.26 {times} 10{sup 18} and 0.34 {times} 10{sup 18} cells mol of thymidine{sup {minus}1}. Isotope dilution was considered the main factor in the observed discrepancy between the conversion factors. In all experiments, a tritiated thymidine concentration of 20 nM was used. It was concluded that the observed difference resulted from intracellular isotope dilution which cannot be detected by current techniques for isotope dilution analysis.

  15. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  16. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions.

    PubMed

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G; de Wind, Niels

    2015-04-13

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa-Atr-Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  17. Temporal and topographic changes in DNA synthesis after induced follicular atresia

    SciTech Connect

    Greenwald, G.S. )

    1989-07-01

    Hamsters were hypophysectomized on the morning of estrus (Day 1) and injected immediately with 30 IU pregnant mare's serum (PMS). This was followed on Day 4 by the injection of an antiserum to PMS (PMS-AS) that initiated follicular atresia (Time zero). From 0 to 72 h after PMS-AS, the animals were injected with (3H)thymidine and killed 4 h later. One ovary was saved for autoradiography and histology; from the other ovary, 5-10 large antral follicles were dissected and pooled, and incorporation into DNA was determined by scintillation counting. DNA synthesis dropped sharply between 12 and 18 h, coinciding with a fall in labeling index of the cumulus oophorus and thecal endothelial cells and a sharp fall in thecal vascularity. In contrast, for the mural granulosa cells bordering on the antral cavity, labeling index dropped sharply between 8 and 12 h when thecal vascularity was still high. The earliest sign of atresia was evident by 4 h in cumulus cells when, paradoxically, DNA synthesis was still high. It took 3 days for atresia of the antral follicles to progress to advanced stages, as evidenced by pseudo-pronuclei in the free floating ovum, further erosion of the mural granulosa, and minimal DNA/follicle. However, the theca still retained its histological integrity and contained no pyknotic cells. Although by 48 h the granulosal compartment was in disarray (DNA/follicle significantly different from earlier values), the egg was still viable, as judged by maximal fluorescence after the addition of fluoroscein diacetate.

  18. Inhibition by 2-deoxy-D-ribose of DNA synthesis and growth in Raji cells

    SciTech Connect

    Ulrich, F.

    1988-04-01

    When Raji cells were cultured for 3 days in serum-free medium, addition of 2-deoxy-D-ribose at the start of culture inhibited incorporation of (/sup 3/H)thymidine and cell division. At deoxyribose concentrations between 1 and 5 mM, viability was 80% or greater after 3 days of culture even though 5 mM deoxyribose inhibited thymidine incorporation 95-99%. Inhibition by deoxyribose could be completely reversed if the culture medium was replaced with fresh medium up to 8 hr after the start of culture. The inhibition was specific for deoxyribose since other monosaccharides had no effect. Inhibition of DNA synthesis did not appear to be due to depletion of essential nutrients in the medium since the percentage inhibition of thymidine incorporation by cells cultured either in suboptimal serum-free media or in media supplemented with 0.025-5% human AB serum was similar. When DNA repair synthesis was measured as hydroxyurea-resistant thymidine incorporation, addition of deoxyribose to Raji cultures caused increased thymidine incorporation. These results, together with data from others,suggest that deoxyribose damages DNA.

  19. Microinjection of fos-specific antibodies blocks DNA synthesis in fibroblast cells

    SciTech Connect

    Riabowol, K.T.; Vosatka, R.J.; Ziff, E.B.; Lamb, N.J.; Feramisco, J.R.

    1988-04-01

    Transcription of the protooncogene c-fos is increased >10-fold within minutes of treatment of fibroblasts with serum or purified growth factors. Recent experiments with mouse 3T3 cell lines containing inducible fos antisense RNA constructs have shown that induced fos antisense RNA transcripts cause either a marked inhibition of growth in continuously proliferating cells or, conversely, a minimal effect except during the transition from a quiescent (G/sub o/) state into the cell cycle. Since intracellular production of large amounts of antisense RNA does not completely block gene expression, the authors microinjected affinity-purified antibodies raised against fos to determine whether and when during the cell cycle c-fos expression was required for cell proliferation. Using this independent method, they found that microinjected fos antibodies efficiently blocked serum-stimulated DNA synthesis when injected up to 6 to 8 h after serum stimulation of quiescent REF-52 fibroblasts. Furthermore, when fos antibodies were injected into asynchronously growing cells, a consistently greater number of cells was prevented from synthesizing DNA than when cells were injected with nonspecific immunoglobulins. Thus, whereas the activity of c-fos may be necessary for transition of fibroblasts from G/sub o/ to G/sub 1/ of the cell cycle, its function is also required during the early G/sub 1/ portion of the cell cycle to allow subsequent DNA synthesis.

  20. Non-transcriptional action of oestradiol and progestin triggers DNA synthesis.

    PubMed Central

    Castoria, G; Barone, M V; Di Domenico, M; Bilancio, A; Ametrano, D; Migliaccio, A; Auricchio, F

    1999-01-01

    The recent findings that oestradiol and progestins activate the Src/Ras/Erks signalling pathway raise the question of the role of this stimulation. Microinjection experiments of human mammary cancer-derived cells (MCF-7 and T47D) with cDNA of catalytically inactive Src or anti-Ras antibody prove that Src and Ras are required for oestradiol and progestin-dependent progression of cells through the cell cycle. The antitumoral ansamycin antibiotic, geldanamycin, disrupts the steroid-induced Ras-Raf-1 association and prevents Raf-1 activation and steroid-induced DNA synthesis. Furthermore, the selective MEK 1 inhibitor, PD 98059, inhibits oestradiol and progestin stimulation of Erk-2 and the steroid-dependent S-phase entry. The MDA-MB231 cells, which do not express oestradiol receptor, fail to respond to oestradiol in terms of Erk-2 activation and S-phase entry. Fibroblasts are made equally oestradiol-responsive in terms of DNA synthesis by transient transfection with either the wild-type or the transcriptionally inactive mutant oestradiol receptor (HE241G). Co-transfection of catalytically inactive Src as well as treatment with PD98059 inhibit the oestradiol-dependent S-phase entry of fibroblasts expressing either the wild-type oestrogen receptor or its transcriptionally inactive mutant. The data presented support the view that non-transcriptional action of the two steroids plays a major role in cell cycle progression. PMID:10228164

  1. Stimulation by endothelin-1 of mitogen-activated protein kinases and DNA synthesis in bovine tracheal smooth muscle cells.

    PubMed Central

    Malarkey, K.; Chilvers, E. R.; Lawson, M. F.; Plevin, R.

    1995-01-01

    1. In cultures of bovine tracheal smooth muscle cells, platelet-derived growth factor-BB (PDGF), bradykinin (BK) and endothelin-1 (ET-1) stimulated the tyrosine phosphorylation and activation of both pp42 and pp44 kDa forms of mitogen-activated protein (MAP) kinase. 2. Both ET-1 and PDGF stimulated a sustained activation of MAP kinase whilst the response to BK was transient. 3. Activation of MAP kinase occurred in a concentration-dependent manner (EC50 values: ET-1, 2.3 +/- 1.3 nM; BK, 8.7 +/- 4.1 nM, PDGF, 9.7 +/- 3.2 ng ml-1). 4. Pretreatment with the protein kinase C (PKC) inhibitor Ro-318220, significantly reduced ET-1 activation of MAP kinase at 2 and 5 min but enhanced MAP kinase activation at 60 min. 5. Following chronic phorbol ester pretreatment, BK-stimulated activation of MAP kinase was abolished whilst the responses to PDGF and ET-1 were only partly reduced (80 and 45% inhibition respectively). 6. Pretreatment with pertussis toxin reduced ET-1 stimulated activation of MAP kinase particularly at later times (60 min), but left the responses to both PDGF and BK unaffected. 7. ET-1 also stimulated a 3 fold increase in [3H]-thymidine incorporation which was abolished by pertussis toxin pretreatment. In contrast, PDGF stimulated a 131 fold increase in [3H]-thymidine incorporation which was not affected by pertussis toxin. 8. These results suggest that a pertussis toxin-sensitive activation of MAP kinase may play an important role in ET-1-stimulated DNA synthesis but that activation of MAP kinase alone is not sufficient to induce the magnitude of DNA synthesis observed in response to PDGF. Images Figure 1 Figure 2 Figure 5 Figure 6 Figure 7 PMID:8564258

  2. Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

    SciTech Connect

    Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A. )

    1991-07-01

    Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population.

  3. Flavonoid accumulation in Arabidopsis repressed in lignin synthesis affects auxin transport and plant growth.

    PubMed

    Besseau, Sébastien; Hoffmann, Laurent; Geoffroy, Pierrette; Lapierre, Catherine; Pollet, Brigitte; Legrand, Michel

    2007-01-01

    In Arabidopsis thaliana, silencing of hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl transferase (HCT), a lignin biosynthetic gene, results in a strong reduction of plant growth. We show that, in HCT-silenced plants, lignin synthesis repression leads to the redirection of the metabolic flux into flavonoids through chalcone synthase activity. Several flavonol glycosides and acylated anthocyanin were shown to accumulate in higher amounts in silenced plants. By contrast, sinapoylmalate levels were barely affected, suggesting that the synthesis of that phenylpropanoid compound might be HCT-independent. The growth phenotype of HCT-silenced plants was shown to be controlled by light and to depend on chalcone synthase expression. Histochemical analysis of silenced stem tissues demonstrated altered tracheary elements. The level of plant growth reduction of HCT-deficient plants was correlated with the inhibition of auxin transport. Suppression of flavonoid accumulation by chalcone synthase repression in HCT-deficient plants restored normal auxin transport and wild-type plant growth. By contrast, the lignin structure of the plants simultaneously repressed for HCT and chalcone synthase remained as severely altered as in HCT-silenced plants, with a large predominance of nonmethoxylated H units. These data demonstrate that the reduced size phenotype of HCT-silenced plants is not due to the alteration of lignin synthesis but to flavonoid accumulation. PMID:17237352

  4. Food contaminant zearalenone and its metabolites affect cytokine synthesis and intestinal epithelial integrity of porcine cells.

    PubMed

    Marin, Daniela E; Motiu, Monica; Taranu, Ionelia

    2015-06-01

    The intestinal epithelium is the first barrier against food contaminants. Zearalenone (ZEN) is an estrogenic mycotoxin that was identified as a common contaminant of cereal grains and food and feedstuffs. In the present study, we have investigated the in vitro effects of ZEN and some of its metabolites (α-ZOL, β-ZOL) in concentrations of 10-100 µM on a swine epithelial cell line: Intestinal porcine epithelial cells (IPEC-1). We demonstrated that both ZEN metabolites were more toxic for IPEC cells as resulted from the XTT test, while for doses lower than 10 µM, only β-ZOL showed a more pronounced cytotoxicity versus epithelial cells as resulted from neutral red assay. ZEN has no effect on TER values, while α-ZOL significantly decreased the TER values, starting with day 4 of treatment. β-ZOL had a dual effect, firstly it induced a significant increase of TER, and then, starting on day 6, it induced a dramatic decrease of TER values as compared with on day 0. Concerning the cytokine synthesis, our results showed that ZEN has a tendency to increase the synthesis of IL-8 and IL-10. By contrast, α- and β-ZOL decreased the expression of both IL-8 and IL-10, in a dose dependent manner. In conclusion, our results showed that ZEN and its metabolites differently affected porcine intestinal cell viability, transepithelial resistance and cytokine synthesis with important implication for gut health. PMID:26035492

  5. Food Contaminant Zearalenone and Its Metabolites Affect Cytokine Synthesis and Intestinal Epithelial Integrity of Porcine Cells

    PubMed Central

    Marin, Daniela E.; Motiu, Monica; Taranu, Ionelia

    2015-01-01

    The intestinal epithelium is the first barrier against food contaminants. Zearalenone (ZEN) is an estrogenic mycotoxin that was identified as a common contaminant of cereal grains and food and feedstuffs. In the present study, we have investigated the in vitro effects of ZEN and some of its metabolites (α-ZOL, β-ZOL) in concentrations of 10–100 µM on a swine epithelial cell line: Intestinal porcine epithelial cells (IPEC-1). We demonstrated that both ZEN metabolites were more toxic for IPEC cells as resulted from the XTT test, while for doses lower than 10 µM, only β-ZOL showed a more pronounced cytotoxicity versus epithelial cells as resulted from neutral red assay. ZEN has no effect on TER values, while α-ZOL significantly decreased the TER values, starting with day 4 of treatment. β-ZOL had a dual effect, firstly it induced a significant increase of TER, and then, starting on day 6, it induced a dramatic decrease of TER values as compared with on day 0. Concerning the cytokine synthesis, our results showed that ZEN has a tendency to increase the synthesis of IL-8 and IL-10. By contrast, α- and β-ZOL decreased the expression of both IL-8 and IL-10, in a dose dependent manner. In conclusion, our results showed that ZEN and its metabolites differently affected porcine intestinal cell viability, transepithelial resistance and cytokine synthesis with important implication for gut health. PMID:26035492

  6. Reduction in DNA topoisomerase I level affects growth, phenotype and nucleoid architecture of Mycobacterium smegmatis.

    PubMed

    Ahmed, Wareed; Menon, Shruti; Karthik, Pullela V; Nagaraja, Valakunja

    2015-02-01

    The steady-state negative supercoiling of eubacterial genomes is maintained by the action of DNA topoisomerases. Topoisomerase distribution varies in different species of mycobacteria. While Mycobacterium tuberculosis (Mtb) contains a single type I (TopoI) and a single type II (Gyrase) enzyme, Mycobacterium smegmatis (Msm) and other members harbour additional relaxases. TopoI is essential for Mtb survival. However, the necessity of TopoI or other relaxases in Msm has not been investigated. To recognize the importance of TopoI for growth, physiology and gene expression of Msm, we have developed a conditional knock-down strain of TopoI in Msm. The TopoI-depleted strain exhibited extremely slow growth and drastic changes in phenotypic characteristics. The cessation of growth indicates the essential requirement of the enzyme for the organism in spite of having additional DNA relaxation enzymes in the cell. Notably, the imbalance in TopoI level led to the altered expression of topology modulatory proteins, resulting in a diffused nucleoid architecture. Proteomic and transcript analysis of the mutant indicated reduced expression of the genes involved in central metabolic pathways and core DNA transaction processes. RNA polymerase (RNAP) distribution on the transcription units was affected in the TopoI-depleted cells, suggesting global alteration in transcription. The study thus highlights the essential requirement of TopoI in the maintenance of cellular phenotype, growth characteristics and gene expression in mycobacteria. A decrease in TopoI level led to altered RNAP occupancy and impaired transcription elongation, causing severe downstream effects. PMID:25516959

  7. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. PMID:24571086

  8. Interconverting Conformations of Slipped-DNA Junctions Formed by Trinucleotide Repeats Affect Repair Outcome

    PubMed Central

    2013-01-01

    Expansions of (CTG)·(CAG) repeated DNAs are the mutagenic cause of 14 neurological diseases, likely arising through the formation and processing of slipped-strand DNAs. These transient intermediates of repeat length mutations are formed by out-of-register mispairing of repeat units on complementary strands. The three-way slipped-DNA junction, at which the excess repeats slip out from the duplex, is a poorly understood feature common to these mutagenic intermediates. Here, we reveal that slipped junctions can assume a surprising number of interconverting conformations where the strand opposite the slip-out either is fully base paired or has one or two unpaired nucleotides. These unpaired nucleotides can also arise opposite either of the nonslipped junction arms. Junction conformation can affect binding by various structure-specific DNA repair proteins and can also alter correct nick-directed repair levels. Junctions that have the potential to contain unpaired nucleotides are repaired with a significantly higher efficiency than constrained fully paired junctions. Surprisingly, certain junction conformations are aberrantly repaired to expansion mutations: misdirection of repair to the non-nicked strand opposite the slip-out leads to integration of the excess slipped-out repeats rather than their excision. Thus, slipped-junction structure can determine whether repair attempts lead to correction or expansion mutations. PMID:23339280

  9. Mutations affecting sensitivity of the cellular slime mold Dictyostelium discoideum to DNA-damaging agents.

    PubMed

    Bronner, C E; Welker, D L; Deering, R A

    1992-09-01

    We describe 22 new mutants of D. discoideum that are sensitive to DNA damage. These mutants were isolated on the basis of sensitivity to either temperature, gamma-rays, or 4-nitroquinolone-1-oxide (4NQO). The doses of gamma-rays, ultraviolet light (UV), and 4NQO required to reduce the survival of colony-forming ability of these mutants to 10% (D10) range from 2% to 100% of the D10s for the nonmutant, parent strains. For most of the mutants, those which are very sensitive to one agent are very sensitive to all agents tested and those which are moderately sensitive to one agent, are moderately sensitive to all agents tested. One mutant is sensitive only to 4NQO. Linkage relationships have been examined for 13 of these mutants. This linkage information was used to design complementation tests to determine allelism with previously characterized complementation groups affecting sensitivity to radiation. 4 of the new mutants fall within previously identified complementation groups and 3 new complementation groups have been identified (radJ, radK and radL). Other new loci probably also exist among these new mutants. This brings the number of characterized mutants of D. discoideum which are sensitive to DNA-damaging agents to 33 and the number of assigned complementation groups to 11. PMID:1380652

  10. Assessment of DNA synthesis in Islet-1{sup +} cells in the adult murine heart

    SciTech Connect

    Weinberger, Florian Mehrkens, Dennis Starbatty, Jutta Nicol, Philipp Eschenhagen, Thomas

    2015-01-02

    Highlights: • Islet-1 was expressed in the adult heart. • Islet-1-positive cells did not proliferate in the adult heart. • Sinoatrial node cells did not proliferate in the adult heart. - Abstract: Rationale: Islet-1 positive (Islet-1{sup +}) cardiac progenitor cells give rise to the right ventricle, atria and outflow tract during murine cardiac development. In the adult heart Islet-1 expression is limited to parasympathetic neurons, few cardiomyocytes, smooth muscle cells, within the proximal aorta and pulmonary artery and sinoatrial node cells. Its role in these cells is unknown. Here we tested the hypothesis that Islet-1{sup +} cells retain proliferative activity and may therefore play a role in regenerating specialized regions in the heart. Methods and results: DNA synthesis was analyzed by the incorporation of tritiated thymidine ({sup 3}H-thymidine) in Isl-1-nLacZ mice, a transgenic model with an insertion of a nuclear beta-galactosidase in the Islet-1 locus. Mice received daily injections of {sup 3}H-thymidine for 5 days. DNA synthesis was visualized throughout the heart by dipping autoradiography of cryosections. Colocalization of an nLacZ-signal and silver grains would indicate DNA synthesis in Islet-1{sup +} cells. Whereas Islet{sup −} non-myocyte nuclei were regularly marked by accumulation of silver grains, colocalization with nLacZ-signals was not detected in >25,000 cells analyzed. Conclusions: Islet-1{sup +} cells are quiescent in the adult heart, suggesting that, under normal conditions, even pacemaking cells do not proliferate at higher rates than normal cardiac myocytes.

  11. Modulation of the equilibrative nucleoside transporter by inhibitors of DNA synthesis.

    PubMed Central

    Pressacco, J.; Wiley, J. S.; Jamieson, G. P.; Erlichman, C.; Hedley, D. W.

    1995-01-01

    Expression of the equilibrative, S-(p-nitrobenzyl)-6-thioinosine (NBMPR)-sensitive nucleoside transporter (es), a component of the nucleoside salvage pathway, was measured during unperturbed growth and following exposure to various antimetabolites at growth-inhibitory concentrations. The probe 5-(SAENTA-x8)-fluorescein is a highly modified form of adenosine incorporating a fluorescein molecule. It binds. with high affinity and specificity to the (es) nucleoside transporter at a 1:1 stoichiometry, allowing reliable estimates of es expression by flow cytometry. Using a dual labelling technique which combined the vital DNA dye Hoechst-33342 and 5-(SAENTA-x8)-fluorescein, we found that surface expression of es approximately doubled between G1 and G2 + M phases of the cell cycle. To address the question of whether es expression could be modulated in cells exposed to drugs which inhibit de novo synthesis of nucleotides, cells were exposed to antimetabolite drugs having different modes of action. Hydroxyurea and 5-fluorouracil (5-FU), which inhibit the de novo synthesis of DNA precursors, produced increases in the expression of es. In contrast, cytosine arabinoside (ara-C) and aphidicolin, which directly inhibit DNA synthesis, produced no significant increase in es expression. Thymidine (TdR), which is an allosteric inhibitor of ribonucleotide reductase that depletes dATP, dCTP and dGTP pools while repleting the dTTP pool, had no significant effect on es expression. These data suggest that surface expression of the es nucleoside transporter is regulated by a mechanism which is sensitive to the supply of deoxynucleotides. Because 5-FU (which specifically depletes dTTP pools) causes a large increase in expression whereas TdR (which depletes all precursors except dTTP) does not, this mechanism might be particularly sensitive to dTTP pools. PMID:7547244

  12. 3-base periodicity in coding DNA is affected by intercodon dinucleotides

    PubMed Central

    Sánchez, Joaquín

    2011-01-01

    All coding DNAs exhibit 3-base periodicity (TBP), which may be defined as the tendency of nucleotides and higher order n-tuples, e.g. trinucleotides (triplets), to be preferentially spaced by 3, 6, 9 etc, bases, and we have proposed an association between TBP and clustering of same-phase triplets. We here investigated if TBP was affected by intercodon dinucleotide tendencies and whether clustering of same-phase triplets was involved. Under constant protein sequence intercodon dinucleotide frequencies depend on the distribution of synonymous codons. So, possible effects were revealed by randomly exchanging synonymous codons without altering protein sequences to subsequently document changes in TBP via frequency distribution of distances (FDD) of DNA triplets. A tripartite positive correlation was found between intercodon dinucleotide frequencies, clustering of same-phase triplets and TBP. So, intercodon C|A (where “|” indicates the boundary between codons) was more frequent in native human DNA than in the codon-shuffled sequences; higher C|A frequency occurred along with more frequent clustering of C|AN triplets (where N jointly represents A, C, G and T) and with intense CAN TBP. The opposite was found for C|G, which was less frequent in native than in shuffled sequences; lower C|G frequency occurred together with reduced clustering of C|GN triplets and with less intense CGN TBP. We hence propose that intercodon dinucleotides affect TBP via same-phase triplet clustering. A possible biological relevance of our findings is briefly discussed. PMID:21814388

  13. Fabrication of polyurethane molecular stamps for the synthesis of DNA microarray

    NASA Astrophysics Data System (ADS)

    Liu, Zhengchun; He, Quanguo; Xiao, Pengfeng; He, Nongyao; Lu, Zuhong; Bo, Liang

    2001-10-01

    Polyurethane based on polypropylene glycol (PPG) and Toluene diisocyanate (TDI) using 3,3'-dichloride-4,4'- methylenedianiline (MOCA) as the crosslinker is presented for the first time to fabricate molecular stamps (PU stamps) for the synthesis of DNA microarray with contact procedure. The predictability of the process is achieved by utilizing commercially available starting materials. SEM analysis of the morphology of PU stamps and master showed that PU elastometer could replicate subtly the motherboard's patterns with high fidelity. It was proved from the contact angle measurement that PU stamps surface has good affinity with acetonitrile, which guarantee the well-distribution of DNA monomers on patterned stamps. Laser confocal fluorescence microscopy images of oligonucleotide arrays confirmed polyurethane is an excellent material for molecular stamps.

  14. Inositol stimulates DNA and protein synthesis, and expansion by rabbit blastocysts in vitro.

    PubMed

    Fahy, M M; Kane, M T

    1992-04-01

    The effect of different concentrations (0, 0.6, 3, 15, 75 and 375 microM) of myo-inositol on the development of rabbit morulae to expanded blastocysts was investigated in terms of blastocyst expansion and synthesis of DNA and protein, as measured by incorporation of [3H]thymidine and [14C]amino acids into acid-precipitable material. A concentration of 15 microM inositol caused a 2.8-fold increase in blastocyst expansion (P less than 0.01), a 9.9-fold increase in thymidine incorporation into DNA (P less than 0.01) and a 3.6-fold increase in amino acid incorporation into protein (P less than 0.01). There were no significant differences in the range from 15 to 375 microM inositol. PMID:1522201

  15. Radiofrequency (microwave) radiation exposure of mammalian cells during UV-induced DNA repair synthesis

    SciTech Connect

    Meltz, M.L.; Walker, K.A.; Erwin, D.N.

    1987-05-01

    The effect of continuous-wave (CW) and pulsed-wave (PW) radiofrequency radiation (RFR) in the microwave range on UV-induced DNA repair has been investigated in MRC-5 normal human diploid fibroblasts. RFR exposure at power densities of 1 (or 5) and 10 mW/cm2 gave a maximum specific absorption rate (SAR) (at 10 mW/cm2) of 0.39 +/- 0.15 W/kg for 350 MHz RFR, 4.5 +/- 3.0 W/kg for 850 MHz RFR, and 2.7 +/- 1.6 W/kg for 1.2 GHz RFR. RFR exposures for 1 to 3 h at 37 degrees C, in either continuous-wave or pulsed-wave modes, had no effect on the rate of repair replication label incorporated into preexisting UV-damaged DNA. RFR exposures (PW), with a constant medium temperature of 39 degrees C at 350 and 850 MHz during the repair period after UV damage, also had no effect. Assay for induction of repair synthesis by RFR exposure alone in non-UV irradiated cells was negative for the 350-, 850-, and 1200-MHz CW and PW RFR at 37 degrees C and the 350- and 850-MHz PW RFR at 39 degrees C. RFR does not induce DNA repair under these exposure conditions. In preliminary experiments--with the tissue culture medium maintained at 39 degrees C and RFR exposures (PW) at the frequencies of 350, 850, and 1200 MHz--no effect on incorporation of (/sup 3/H)thymidine into DNA undergoing semiconservative synthesis was observed.

  16. Convergent DNA synthesis: a non-enzymatic dimerization approach to circular oligodeoxynucleotides.

    PubMed Central

    Rubin, E; Rumney, S; Wang, S; Kool, E T

    1995-01-01

    We report a novel convergent approach to the construction of circular DNA oligonucleotides from two smaller linear precursors. Circular DNAs 34-74 nucleotides (nt) in size are constructed non-enzymatically in a single step from two half-length oligomers. A DNA template is used to assemble the constituent parts into a triple helical complex which brings the four reactive ends together for chemical ligation with BrCN/imidazole/Ni2+. A homodimerization reaction strategy is successfully used on a small scale to construct circles 42, 58 and 74 nt in size. In addition, a heterodimerization strategy is successfully used in two cases to construct circular 34mers from different 16mer and 18mer precursors. Measurement of preparative yields for one biologically active 34mer circle shows that the dimerization strategy gives a yield higher than that from conventional cyclization and nearly as high as that for a normally synthesized linear DNA, establishing that there is not necessarily a yield penalty for circle construction. Six additional preparative circle constructions, giving conversions of approximately 33-85% from precursors to circular product, are also described. Convergent strategies allow the construction of medium and large size DNA molecules in higher yields than can be achieved by standard linear synthesis alone. Images PMID:7567468

  17. Replication Protein A: Single-stranded DNA's first responder : Dynamic DNA-interactions allow Replication Protein A to direct single-strand DNA intermediates into different pathways for synthesis or repair

    PubMed Central

    Chen, Ran; Wold, Marc S.

    2015-01-01

    Summary Replication Protein A (RPA), the major single-stranded DNA-binding protein in eukaryotic cells, is required for processing of single-stranded DNA (ssDNA) intermediates found in replication, repair and recombination. Recent studies have shown that RPA binding to ssDNA is highly dynamic and that more than high-affinity binding is needed for function. Analysis of DNA binding mutants identified forms of RPA with reduced affinity for ssDNA that are fully active, and other mutants with higher affinity that are inactive. Single molecule studies showed that while RPA binds ssDNA with high affinity, the RPA complex can rapidly diffuse along ssDNA and be displaced by other proteins that act on ssDNA. Finally, dynamic DNA binding allows RPA to prevent error-prone repair of double-stranded breaks and promote error-free repair. Together, these findings suggest a new paradigm where RPA acts as a first responder at sites with ssDNA, thereby actively coordinating DNA repair and DNA synthesis. PMID:25171654

  18. Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

    PubMed

    Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

    2012-10-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. PMID:22766489

  19. The exocyst affects protein synthesis by acting on the translocation machinery of the endoplasmic reticulum.

    PubMed

    Lipschutz, Joshua H; Lingappa, Vishwanath R; Mostov, Keith E

    2003-06-01

    We previously showed that the exocyst complex specifically affected the synthesis and delivery of secretory and basolateral plasma membrane proteins. Significantly, the entire spectrum of secreted proteins was increased when the hSec10 (human Sec10) component of the exocyst complex was overexpressed, suggestive of post-transcriptional regulation (Lipschutz, J. H., Guo, W., O'Brien, L. E., Nguyen, Y. H., Novick, P., and Mostov, K. E. (2000) Mol. Biol. Cell 11, 4259-4275). Here, using an exogenously transfected basolateral protein, the polymeric immunoglobulin receptor (pIgR), and a secretory protein, gp80, we show that pIgR and gp80 protein synthesis and delivery are increased in cells overexpressing Sec10 despite the fact that mRNA levels are unchanged, which is highly indicative of post-transcriptional regulation. To test specificity, we also examined the synthesis and delivery of an exogenous apical protein, CNT1 (concentrative nucleoside transporter 1), and found no increase in CNT1 protein synthesis, delivery, or mRNA levels in cells overexpressing Sec10. Sec10-GFP-overexpressing cell lines were created, and staining was seen in the endoplasmic reticulum. It was demonstrated previously in yeast that high levels of expression of SEB1, the Sec61beta homologue, suppressed sec15-1, an exocyst mutant (Toikkanen, J., Gatti, E., Takei, K., Saloheimo, M., Olkkonen, V. M., Soderlund, H., De Camilli, P., and Keranen, S. (1996) Yeast 12, 425-438). Sec61beta is a member of the Sec61 heterotrimer, which is the main component of the endoplasmic reticulum translocon. By co-immunoprecipitation we show that Sec10, which forms an exocyst subcomplex with Sec15, specifically associates with the Sec61beta component of the translocon and that Sec10 overexpression increases the association of other exocyst complex members with Sec61beta. Proteosome inhibition does not appear to be the mechanism by which increased protein synthesis occurs in the face of equivalent amounts of m

  20. In vivo evidence for translesion synthesis by the replicative DNA polymerase δ

    PubMed Central

    Hirota, Kouji; Tsuda, Masataka; Mohiuddin; Tsurimoto, Toshiki; Cohen, Isadora S.; Livneh, Zvi; Kobayashi, Kaori; Narita, Takeo; Nishihara, Kana; Murai, Junko; Iwai, Shigenori; Guilbaud, Guillaume; Sale, Julian E.; Takeda, Shunichi

    2016-01-01

    The intolerance of DNA polymerase δ (Polδ) to incorrect base pairing contributes to its extremely high accuracy during replication, but is believed to inhibit translesion synthesis (TLS). However, chicken DT40 cells lacking the POLD3 subunit of Polδ are deficient in TLS. Previous genetic and biochemical analysis showed that POLD3 may promote lesion bypass by Polδ itself independently of the translesion polymerase Polζ of which POLD3 is also a subunit. To test this hypothesis, we have inactivated Polδ proofreading in pold3 cells. This significantly restored TLS in pold3 mutants, enhancing dA incorporation opposite abasic sites. Purified proofreading-deficient human Polδ holoenzyme performs TLS of abasic sites in vitro much more efficiently than the wild type enzyme, with over 90% of TLS events resulting in dA incorporation. Furthermore, proofreading deficiency enhances the capability of Polδ to continue DNA synthesis over UV lesions both in vivo and in vitro. These data support Polδ contributing to TLS in vivo and suggest that the mutagenesis resulting from loss of Polδ proofreading activity may in part be explained by enhanced lesion bypass. PMID:27185888

  1. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    SciTech Connect

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-07-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were /sup 14/C-protein hydrolysate, (/sup 14/C)uridine, and (/sup 14/C) thymidine. Stimulation was determined by measuring incorporation of (/sup 14/C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules.

  2. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(A)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of know chemical and physical mutagens. Neither retinol or retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 ..mu..M to 50 ..mu..M. Retinol and retinoic acid did not significantly affect 200..mu..g/mL ethyl methanesulfonate (EMS)- or 32 J/m/sup 2/ ultraviolet light (UV)-induced UDS at concentrations ranging from 1..mu..M to 50 ..mu..M. In contrast, retinol and retinoic acid significantly inhibited 2.5 ..mu..g/mL and 5.0 ..mu..g/mL 7,12-dimethyl-benz(a)-anthracene(DMBA)-induced UDS at concentrations of 1..mu..M or greater. Retinol-and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 ..mu..M and 100 ..mu..M. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  3. Modulation of ultraviolet light-, ethyl methanesulfonate-, and 7,12-dimethylbenz(a)anthracene-induced unscheduled DNA synthesis by retinol and retinoic acid in the primary rat hepatocyte

    SciTech Connect

    Budroe, J.D.; Shaddock, J.G.; Casciano, D.A.

    1987-01-01

    The effects of retinol and retinoic acid on unscheduled DNA synthesis (UDS) in primary Sprague-Dawley rat hepatocytes were studied in the presence and absence of known chemical and physical mutagens. Neither retinol nor retinoic acid caused a significant increase in UDS over solvent control at concentrations ranging from 1 microM to 50 microM. Retinol and retinoic acid did not significantly affect 200 micrograms/mL ethyl methanesulfonate(EMS)- or 32 J/m2 ultraviolet light(UV)-induced UDS at concentrations ranging from 1 microM to 50 microM. In contrast, retinol and retinoic acid significantly inhibited 2.5 micrograms/mL and 5.0 micrograms/mL 7,12-dimethyl-benz(a)anthracene(DMBA)-induced UDS at concentrations of 1 microM or greater. Retinol- and retinoic acid-induced hepatocytotoxicity was studied in vitro using lactate dehydrogenase (LDH) release as an indicator of cytoxicity. Neither retinol nor retinoic acid caused significant increases in LDH release over solvent control 3 hours after treatment, whereas retinol caused a biologically significant increase in LDH release 24 hours posttreatment at concentrations of 50 microM and 100 microM. These data suggest that nontoxic concentrations of retinol and retinoic acid do not inhibit the DNA excision repair process but apparently affect the effective DNA adduct load due to the ultimate species of DMBA metabolite responsible for hepatocellular DNA damage.

  4. Synergistic template-free synthesis of dsDNA by Thermococcus nautili primase PolpTN2, DNA polymerase PolB, and pTN2 helicase.

    PubMed

    Béguin, Pierre; Gill, Sukhvinder; Charpin, Nicole; Forterre, Patrick

    2015-01-01

    A combination of three enzymes from the hyperthermophilic archaeon Thermococcus nautili, DNA primase PolpTN2, DNA polymerase PolB, and pTN2 DNA helicase, was found to synthesize up to 300-400 ng/µl dsDNA from deoxynucleotide triphosphates in less than 30 min in the absence of added template DNA and oligonucleotide primer. The reaction did not occur below 64 °C. No synthesis was observed if PolpTN2 or PolB were left out; helicase was not essential but accelerated the reaction. The DNA synthesized consisted of highly reiterated palindromic sequences reaching up to more that 10 kb. Sequence analysis of three independent reaction products synthesized at different temperatures showed that the palindromes shared a common pentanucleotide core, suggesting that random nucleic acid fragments were not responsible for priming the reaction. When enzymes were added sequentially, preincubation with primase plus helicase followed by PolB led to a shorter delay before the onset of the reaction as compared to preincubation with PolB plus helicase followed by primase. This suggests that the primase generates seeds that are subsequently amplified and elongated in synergy with PolB by a mechanism involving hairpin formation and slippage synthesis. PMID:25420601

  5. Induction of unscheduled DNA synthesis in suspensions of rat hepatocytes by an environmental toxicant, 3,3'4,4'-tetrachloroazobenzene.

    PubMed

    Hsia, M T; Kreamer, B L

    1979-04-01

    Unscheduled DNA synthesis was induced by 3,3'4,4'-tetrachloroazobenzene (TCAB)) in freshly isolated suspensions of rat hepatocytes. A dose-dependent response was demonstrated. Hepatocellular DNA was obtained after the chloroform-isoamyl alchohol-phenol extraction of the isolated nuclei. The induction of unscheduled DNA synthesis was measured by the incorporation of [3H]-thymidine in the presence of hydroxyurea as determined by the scintillation counting assay. DNA repair data obtained in this study on benzo[a]pyrene and methyl methanesulfonate are comparable to a previous report using primary cultures of hepatocytes and cesium chloride gradients. Hence, the present method offers promise as a rapid and sensitive screen for chemical carcinogens. PMID:436117

  6. Insights into eukaryotic primer synthesis from structures of the p48 subunit of human DNA primase

    PubMed Central

    Vaithiyalingam, Sivaraja; Arnett, Diana R.; Aggarwal, Amit; Eichman, Brandt F.; Fanning, Ellen; Chazin, Walter J.

    2013-01-01

    DNA replication in all organisms requires polymerases to synthesize copies of the genome. DNA polymerases are unable to function on a bare template and require a primer. Primases are crucial RNA polymerases that perform the initial de novo synthesis, generating the first 8–10 nucleotides of the primer. Although structures of archaeal and bacterial primases have provided insights into general priming mechanisms, these proteins are not well conserved with heterodimeric (p48/p58) primases in eukaryotes. Here, we present X-ray crystal structures of the catalytic engine of a eukaryotic primase, which is contained in the p48 subunit. The structures of p48 reveal eukaryotic primases maintain the conserved catalytic prim fold domain, but with a unique sub-domain not found in the archaeal and bacterial primases. Calorimetry experiments reveal Mn2+ but not Mg2+ significantly enhances the binding of nucleotide to primase, which correlates with in vitro higher catalytic efficiency. The structure of p48 with bound UTP and Mn2+ provides insights into the mechanism of nucleotide synthesis by primase. Substitution of conserved residues involved in either metal or nucleotide binding altered nucleotide binding affinities, and yeast strains containing the corresponding Pri1p substitutions were not viable. Our results revealed two residues (S160 and H166) in direct contact with the nucleotide that were previously unrecognized as critical to the human primase active site. Comparing p48 structures to those of similar polymerases in different states of action suggests changes that would be required to attain a catalytically competent conformation capable of initiating dinucleotide synthesis. PMID:24239947

  7. Synthesis, characterization, DNA binding and cleavage studies of chiral Ru(II) salen complexes

    NASA Astrophysics Data System (ADS)

    Khan, Noor-ul H.; Pandya, Nirali; Kureshy, Rukhsana I.; Abdi, Sayed H. R.; Agrawal, Santosh; Bajaj, Hari C.; Pandya, Jagruti; Gupte, Akashya

    2009-09-01

    Interaction of chiral Ru(II) salen complexes (S)-1 and (R)-1 with Calf Thymus DNA (CT-DNA) was studied by absorption spectroscopy, competitive binding study, viscosity measurements, CD measurements, thermal denaturation study and cleavage studies by agarose gel electrophoresis. The DNA binding affinity of (S)-1 (6.25 × 10 3 M -1) was found to be greater than (R)-1 (3.0 × 10 3 M -1). The antimicrobial studies of these complexes on five different gram (+)/(-) bacteria and three different fungal organisms showed selective inhibition of the growth of gram (+) bacteria and were not affective against gram (-) and fungal organisms. Further, the (S)-1 enantiomer inhibited the growth of organisms to a greater extent as compared to (R)-1 enantiomer.

  8. Measuring DNA synthesis rates with [1-13C]glycine.

    PubMed

    Chen, P; Abramson, F P

    1998-05-01

    We have devised and evaluated a stable-isotopic method for measuring DNA synthesis rates. The probe is [1-13C]-glycine that is incorporated into purines via de novo biosynthesis. The human hepatoma cell line HEP G2 was grown in medium containing [1-13C]glycine, the cells were harvested at various times, and the DNA was extracted. Following hydrolysis to the nucleosides, a reversed-phase HPLC separation was used to provide separate peaks for deoxythymidine (dT), deoxyadenosine (dA), and deoxyguanosine (dG). The HPLC effluent was continuously fed into a chemical reaction interface and an isotope ratio mass spectrometer (HPLC/CRI/IRMS). The isotope ratio of the CO2 produced in the CRI was used to monitor for enrichment. The cells were grown continuously for 5 days in labeled medium and also in a 1-day pulse labeling experiment where the washout of label was observed for the subsequent 9 days. As predicted from the role of glycine in de novo purine biosynthesis, the isotope ratio of the pyrimidine dT did not change. However, for the two purines, dA and dG, the characteristic log growth behavior of the cells was observed in their 13C/12C ratios and good agreement in the doubling time was obtained for each type of experiment. Parallel experiments that measured the HEP G2 doubling time in culture using tritiated thymidine incorporation and direct cell counts were carried out compare to our new method with established ones. We believe that the use of [1-13C]-glycine and the HPLC/CRI/IRMS is a highly sensitive and selective approach that forms the basis of a method that can measure DNA synthesis rates using a nonradioactive, nontoxic tracer. PMID:9599574

  9. 17β-Hydroxysteroid dehydrogenase type 10 predicts survival of patients with colorectal cancer and affects mitochondrial DNA content.

    PubMed

    Amberger, Albert; Deutschmann, Andrea J; Traunfellner, Pia; Moser, Patrizia; Feichtinger, René G; Kofler, Barbara; Zschocke, Johannes

    2016-04-28

    Mitochondrial energy production is reduced in tumor cells, and altered mitochondrial respiration contributes to tumor progression. Synthesis of proteins coded by mitochondrial DNA (mtDNA) requires the correct processing of long polycistronic precursor RNA molecules. Mitochondrial RNase P, composed of three different proteins (MRPP1, HSD10, and MRPP3), is necessary for correct RNA processing. Here we analyzed the role of RNase P proteins in colorectal cancer. High HSD10 expression was found in 28%; high MRPP1 expression in 40% of colorectal cancers, respectively. Expression of both proteins was not significantly associated with clinicopathological parameters. Survival analysis revealed that loss of HSD10 expression is associated with poor prognosis. Cox regression demonstrated that patients with high HSD10 tumors are at lower risk. High HSD10 expression was significantly associated with high mtDNA content in tumor tissue. A causal effect of HSD10 overexpression or knock down with increased or reduced mtDNA levels, respectively, was confirmed in tumor cell lines. Our data suggest that HSD10 plays a role in alterations of energy metabolism by regulating mtDNA content in colorectal carcinomas, and HSD10 protein analysis may be of prognostic value. PMID:26884257

  10. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1

    PubMed Central

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R.; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D.; Chen, Zhucheng; Xiao, Wei

    2016-01-01

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5–Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  11. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    PubMed

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  12. Involvement of budding yeast Rad5 in translesion DNA synthesis through physical interaction with Rev1.

    PubMed

    Xu, Xin; Lin, Aiyang; Zhou, Cuiyan; Blackwell, Susan R; Zhang, Yiran; Wang, Zihao; Feng, Qianqian; Guan, Ruifang; Hanna, Michelle D; Chen, Zhucheng; Xiao, Wei

    2016-06-20

    DNA damage tolerance (DDT) is responsible for genomic stability and cell viability by bypassing the replication block. In Saccharomyces cerevisiae DDT employs two parallel branch pathways to bypass the DNA lesion, namely translesion DNA synthesis (TLS) and error-free lesion bypass, which are mediated by sequential modifications of PCNA. Rad5 has been placed in the error-free branch of DDT because it contains an E3 ligase domain required for PCNA polyubiquitination. Rad5 is a multi-functional protein and may also play a role in TLS, since it interacts with the TLS polymerase Rev1. In this study we mapped the Rev1-interaction domain in Rad5 to the amino acid resolution and demonstrated that Rad5 is indeed involved in TLS possibly through recruitment of Rev1. Genetic analyses show that the dual functions of Rad5 can be separated and reconstituted. Crystal structure analysis of the Rad5-Rev1 interaction reveals a consensus RFF motif in the Rad5 N-terminus that binds to a hydrophobic pocket within the C-terminal domain of Rev1 that is highly conserved in eukaryotes. This study indicates that Rad5 plays a critical role in pathway choice between TLS and error-free DDT. PMID:27001510

  13. Antiproliferative activity of bicyclic benzimidazole nucleosides: synthesis, DNA-binding and cell cycle analysis.

    PubMed

    Sontakke, Vyankat A; Lawande, Pravin P; Kate, Anup N; Khan, Ayesha; Joshi, Rakesh; Kumbhar, Anupa A; Shinde, Vaishali S

    2016-04-26

    An efficient route was developed for synthesis of bicyclic benzimidazole nucleosides from readily available d-glucose. The key reactions were Vörbruggen glycosylation and ring closing metathesis (RCM). Primarily, to understand the mode of DNA binding, we performed a molecular docking study and the binding was found to be in the minor groove region. Based on the proposed binding model, UV-visible and fluorescence spectroscopic techniques using calf thymus DNA (CT-DNA) demonstrated a non-intercalative mode of binding. Antiproliferative activity of nucleosides was tested against MCF-7 and MDA-MB-231 breast cancer cell lines and found to be active at low micromolar concentrations. Compounds and displayed significant antiproliferative activity as compared to and with the reference anticancer drug, doxorubicin. Cell cycle analysis showed that nucleoside induced cell cycle arrest at the S-phase. Confocal microscopy has been performed to validate the induction of cellular apoptosis. Based on these findings, such modified bicyclic benzimidazole nucleosides will make a significant contribution to the development of anticancer drugs. PMID:27074628

  14. Cigarette toxicity triggers Leber's hereditary optic neuropathy by affecting mtDNA copy number, oxidative phosphorylation and ROS detoxification pathways

    PubMed Central

    Giordano, L; Deceglie, S; d'Adamo, P; Valentino, M L; La Morgia, C; Fracasso, F; Roberti, M; Cappellari, M; Petrosillo, G; Ciaravolo, S; Parente, D; Giordano, C; Maresca, A; Iommarini, L; Del Dotto, V; Ghelli, A M; Salomao, S R; Berezovsky, A; Belfort, R; Sadun, A A; Carelli, V; Loguercio Polosa, P; Cantatore, P

    2015-01-01

    Leber's hereditary optic neuropathy (LHON), the most frequent mitochondrial disease, is associated with mitochondrial DNA (mtDNA) point mutations affecting Complex I subunits, usually homoplasmic. This blinding disorder is characterized by incomplete penetrance, possibly related to several genetic modifying factors. We recently reported that increased mitochondrial biogenesis in unaffected mutation carriers is a compensatory mechanism, which reduces penetrance. Also, environmental factors such as cigarette smoking have been implicated as disease triggers. To investigate this issue further, we first assessed the relationship between cigarette smoke and mtDNA copy number in blood cells from large cohorts of LHON families, finding that smoking was significantly associated with the lowest mtDNA content in affected individuals. To unwrap the mechanism of tobacco toxicity in LHON, we exposed fibroblasts from affected individuals, unaffected mutation carriers and controls to cigarette smoke condensate (CSC). CSC decreased mtDNA copy number in all cells; moreover, it caused significant reduction of ATP level only in mutated cells including carriers. This implies that the bioenergetic compensation in carriers is hampered by exposure to smoke derivatives. We also observed that in untreated cells the level of carbonylated proteins was highest in affected individuals, whereas the level of several detoxifying enzymes was highest in carriers. Thus, carriers are particularly successful in reactive oxygen species (ROS) scavenging capacity. After CSC exposure, the amount of detoxifying enzymes increased in all cells, but carbonylated proteins increased only in LHON mutant cells, mostly from affected individuals. All considered, it appears that exposure to smoke derivatives has a more deleterious effect in affected individuals, whereas carriers are the most efficient in mitigating ROS rather than recovering bioenergetics. Therefore, the identification of genetic modifiers that

  15. Unscheduled deoxyribonucleic acid (DNA) synthesis assays for toxicological studies. May 1977-March 1990 (A Bibliography from the NTIS data base). Report for May 1977-March 1990

    SciTech Connect

    Not Available

    1990-04-01

    This bibliography contains citations concerning the unscheduled DNA synthesis (UDS) assay for toxicological studies. UDS assays provide very sensitive measures of damage to DNA by detecting induction of DNA synthesis in non-S-phase cells. UDS toxicological studies analyzing gamma radiation, drugs, pesticides, nerve gas, jet engine fuels, ultraviolet light, chlorated organic compounds, and aromatic compounds are discussed. UDS studies using both human and animal tissue cultures are described. (Contains 57 citations fully indexed and including a title list.)

  16. RNA interference knockdown of DNA methyl-transferase 3 affects gene alternative splicing in the honey bee

    PubMed Central

    Li-Byarlay, Hongmei; Li, Yang; Stroud, Hume; Feng, Suhua; Newman, Thomas C.; Kaneda, Megan; Hou, Kirk K.; Worley, Kim C.; Elsik, Christine G.; Wickline, Samuel A.; Jacobsen, Steven E.; Ma, Jian; Robinson, Gene E.

    2013-01-01

    Studies of DNA methylation from fungi, plants, and animals indicate that gene body methylation is ancient and highly conserved in eukaryotic genomes, but its role has not been clearly defined. It has been postulated that regulation of alternative splicing of transcripts was an original function of DNA methylation, but a direct experimental test of the effect of methylation on alternative slicing at the whole genome level has never been performed. To do this, we developed a unique method to administer RNA interference (RNAi) in a high-throughput and noninvasive manner and then used it to knock down the expression of DNA methyl-transferase 3 (dnmt3), which is required for de novo DNA methylation. We chose the honey bee (Apis mellifera) for this test because it has recently emerged as an important model organism for studying the effects of DNA methylation on development and social behavior, and DNA methylation in honey bees is predominantly on gene bodies. Here we show that dnmt3 RNAi decreased global genomic methylation level as expected and in addition caused widespread and diverse changes in alternative splicing in fat tissue. Four different types of splicing events were affected by dnmt3 gene knockdown, and change in two types, exon skipping and intron retention, was directly related to decreased methylation. These results demonstrate that one function of gene body DNA methylation is to regulate alternative splicing. PMID:23852726

  17. Repair synthesis by human cell extracts in cisplatin-damaged DNA is preferentially determined by minor adducts.

    PubMed Central

    Calsou, P; Frit, P; Salles, B

    1992-01-01

    During reaction of cis-diamminedichloroplatinum(II) (cis-DDP) with DNA, a number of adducts are formed which may be discriminated by the excision-repair system. An in vitro excision-repair assay with human cell-free extracts has been used to assess the relative repair extent of monofunctional adducts, intrastrand and interstrand cross-links of cis-DDP on plasmid DNA. Preferential removal of cis-DDP 1,2-intrastrand diadducts occurred in the presence of cyanide ions. In conditions where cyanide treatment removed 85% of total platinum adducts while approximately 70% of interstrand cross-links remained in plasmid DNA, no significant variation in repair synthesis by human cell extracts was observed. Then, we constructed three types of plasmid DNA substrates containing mainly either monoadducts, 1,2-intrastrand cross-links or interstrand cross-links lesions. The three plasmid species were modified in order to obtain the same extent of total platinum DNA adducts per plasmid. No DNA repair synthesis was detected with monofunctional adducts during incubation with human whole cell extracts. However, a two-fold increase in repair synthesis was found when the proportion of interstrand cross-links in plasmid DNA was increased by 2-3 fold. These findings suggest that (i) cis-DDP 1,2-intrastrand diadducts are poorly repaired by human cell extracts in vitro, (ii) among other minor lesions potentially cyanide-resistant, cis-DDP interstrand cross-links represent a major lesion contributing to the repair synthesis signal in the in vitro assay. These results could account for the drug efficiency in vivo. Images PMID:1475197

  18. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  19. Synthesis of herpes simplex virus, vaccinia virus, and adenovirus DNA in isolated HeLa cell nuclei. I. Effect of viral-specific antisera and phosphonoacetic acid.

    PubMed Central

    Bolden, A; Aucker, J; Weissbach, A

    1975-01-01

    Purified nuclei, isolated from appropriately infected HeLa cells, are shown to synthesize large amounts of either herpes simplex virus (HSV) or vaccinia virus DNA in vitro. The rate of synthesis of DNA by nuclei from infected cells is up to 30 times higher than the synthesis of host DNA in vitro by nuclei isolated from uninfected HeLa cells. Thus HSV nuclei obtained from HSV-infected cells make DNA in vitro at a rate comparable to that seen in the intact, infected cell. Molecular hybridization studies showed that 80% of the DNA sequences synthesized in vitro by nuclei from herpesvirus-infected cells are herpesvirus specific. Vaccinia virus nuclei from vaccinia virus-infected cells, also produce comparable percentages of vaccinia virus-specific DNA sequences. Adenovirus nuclei from adenovirus 2-infected HeLa cells, which also synthesize viral DNA in vitro, have been included in this study. Synthesis of DNA by HSV or vaccinia virus nuclei is markedly inhibited by the corresponding viral-specific antisera. These antisera inhibit in a similar fashion the purified herpesvirus-induced or vaccinia virus-induced DNA polymerase isolated from infected cells. Phosphonoacetic acid, reported to be a specific inhibitor of herpesvirus formation and the herpesvirus-induced DNA polymerase, is equally effective as an inhibitor of HSV DNA synthesis in isolated nuclei in vitro. However, we also find phosphonoacetic acid to be an effective inhibitor of vaccinia virus nuclear DNA synthesis and the purified vaccinia virus-induced DNA polymerase. In addition, this compound shows significant inhibition of DNA synthesis in isolated nuclei obtained from adenovirus-infected or uninfected cells and is a potent inhibitor of HeLa cell DNA polymerase alpha. PMID:172658

  20. The structure-based design, synthesis and biological evaluation of DNA-binding bisintercalating bisanthrapyrazole anticancer compounds

    PubMed Central

    Hasinoff, Brian B.; Liang, Hong; Wu, Xing; Guziec, Lynn J.; Guziec, Frank S.; Marshall, Kyle; Yalowich, Jack C.

    2008-01-01

    Anticancer drugs that bind to DNA and inhibit DNA-processing enzymes represent an important class of anticancer drugs. In order to find stronger DNA binding and more potent cytotoxic compounds, a series of ester-coupled bisanthrapyrazole derivatives of 7-chloro-2-[2-[(2-hydroxyethyl)methylamino]ethyl]anthra[1,9-cd]pyrazol-6(2H)-one (AP9) were designed and evaluated by molecular docking techniques. Because the anthrapyrazoles are unable to be reductively activated like doxorubicin and other anthracyclines, they should not be cardiotoxic like the anthracyclines. Based on the docking scores of a series of bisanthrapyrazoles with different numbers of methylene linkers (n) that were docked into an X-ray structure of double-stranded DNA, five bisanthrapyrazoles (n = 1 to 5) were selected for synthesis and physical and biological evaluation. The synthesized compounds were evaluated for DNA binding and bisintercalation by measuring the DNA melting temperature increase, for growth inhibitory effects on the human erythroleukemic K562 cell line, and for DNA topoisomerase IIα-mediated cleavage of DNA and inhibition of DNA topoisomerase IIα decatenation activities. The results suggest that the bisanthrapyrazoles with n = 2 to 5 formed bisintercalation complexes with DNA. In conclusion, a novel group of bisintercalating anthrapyrazole compounds have been designed, synthesized and biologically evaluated as possible anticancer agents. PMID:18258442

  1. SYNTHESIS, IN VITRO METABOLISM, MUTAGENICITY, AND DNA-ADDUCTION OF NAPHTHO[1,2-E]PYRENE

    EPA Science Inventory

    SYNTHESIS, IN V1TRO METABOLISM, MUTAGENICITY , AND DNA-ADDUCnON OF NAPHTHO[l ,2-e ]PYRENE

    Literature data, although limited, underscore the contribution of C24HI4 polycyclic aromatic hydrocarbons to the biological activity of the extracts of complex environmental samples....

  2. Synthesis of DNA templated trifunctional electrically conducting, optical, and magnetic nanochain of Nicore-Aushell for biodevice

    NASA Astrophysics Data System (ADS)

    Mandal, Madhuri; Mandal, Kalyan

    2009-07-01

    Synthesis of trifunctional, e.g., electrically conducting, optical, and magnetic nanochains of Nicore-Aushell, has been discussed here. Properties of the materials were investigated from the view of its application in bionanodevice. Our investigation indicates that such material attached to biomolecule "DNA chain" and having three main properties in one material will have great potentiality in medical instrumentation and biocomputer device.

  3. UAP56 is a novel interacting partner of Bcr in regulating vascular smooth muscle cell DNA synthesis

    SciTech Connect

    Sahni, Abha; Wang, Nadan; Alexis, Jeffrey D.

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer UAP56 is an important regulator of DNA synthesis in vascular smooth muscle cells. Black-Right-Pointing-Pointer UAP56 binds to Bcr. Black-Right-Pointing-Pointer Interaction between Bcr and UAP56 is critical for Bcr induced DNA synthesis. -- Abstract: Bcr is a serine/threonine kinase that is a critical regulator of vascular smooth muscle cell inflammation and proliferation. We have previously demonstrated that Bcr acts in part via phosphorylation and inhibition of PPAR{gamma}. We have identified the RNA helicase UAP56 as another substrate of Bcr. In this report we demonstrate that knockdown of UAP56 blocks Bcr induced DNA synthesis in vascular smooth muscle cells (VSMC). We also found that over expression of Bcr increased the expression of cyclin E and decreased the expression of p27. Knockdown of UAP56 reversed the effect of Bcr on cyclin E and p27 expression. Furthermore, we found that Bcr binds to UAP56 and demonstrate that binding of UAP56 to Bcr is critical for Bcr induced DNA synthesis in VSMC. Our data identify UAP56 as an important binding partner of Bcr and a novel target for inhibiting vascular smooth muscle cell proliferation.

  4. PROLINE IS REQUIRED FOR THE STIMULATION OF DNA SYNTHESIS IN HEPATOCYTE CULTURES BY EGF (EPIDERMAL GROWTH FACTOR)

    EPA Science Inventory

    Epidermal growth factor (EGF) has been shown to stimulate DNA synthesis in rat parenchymal hepatocytes both in vivo and in vitro (4,9). The authors report here that this response in vitro is dependent on the amino acids present in the media. Of all the amino acids, proline has th...

  5. Knockdown of prolactin receptors in a pancreatic beta cell line: effects on DNA synthesis, apoptosis, and gene expression.

    PubMed

    Arumugam, Ramamani; Fleenor, Don; Freemark, Michael

    2014-08-01

    Prolactin (PRL) and placental lactogen stimulate beta cell replication and insulin production in vitro and in vivo. The molecular mechanisms by which lactogens promote beta cell expansion are unclear. We treated rat insulinoma cells with a PRL receptor (PRLR) siRNA to determine if PRLR signaling is required for beta cell DNA synthesis and cell survival and to identify beta cell cycle genes whose expression depends upon lactogen action. Effects of PRLR knockdown were compared with those of PRL treatment. PRLR knockdown (-80 %) reduced DNA synthesis, increased apoptosis, and inhibited expression of cyclins D2 and B2, IRS-2, Tph1, and the anti-apoptotic protein PTTG1; p21 and BCL6 mRNAs increased. Conversely, PRL treatment increased DNA synthesis, reduced apoptosis, and enhanced expression of A, B and D2 cyclins, CDK1, IRS-2, FoxM1, BCLxL, and PTTG1; BCL6 declined. PRLR signaling is required for DNA synthesis and survival of rat insulinoma cells. The effects of lactogens are mediated by down-regulation of cell cycle inhibitors (BCL6, p21) and induction of A, B, and D2 cyclins, IRS-2, Tph1, FoxM1, and the anti-apoptotic proteins BCLxL and PTTG1. PMID:24114406

  6. Rational design, synthesis, and DNA binding properties of novel sequence-selective peptidyl congeners of ametantrone.

    PubMed

    Gianoncelli, Alessandra; Basili, Serena; Scalabrin, Matteo; Sosic, Alice; Moro, Stefano; Zagotto, Giuseppe; Palumbo, Manlio; Gresh, Nohad; Gatto, Barbara

    2010-07-01

    Natural and synthetic compounds characterized by an anthraquinone nucleus represent an important class of anti-neoplastic agents, the mechanism of action of which is related to intercalation into DNA. Ametantrone (AM) is a synthetic 9,10-anthracenedione bearing two (hydroxyethylamino)ethylamino residues at positions 1 and 4; along with other anthraquinones and anthracyclines, it shares a polycyclic intercalating moiety and charged side chains that stabilize DNA binding. All these drugs elicit adverse side effects, which represent a challenge for antitumor chemotherapy. In the present work the structure of AM was augmented with appropriate groups that target well-defined base pairs in the major groove. These should endow AM with DNA sequence selectivity. We describe the rationale for the synthesis and the evaluation of activity of a new series of compounds in which the planar anthraquinone is conjugated at positions 1 and 4 through the side chains of AM or other bioisosteric linkers to appropriate dipeptides. The designed novel AM derivatives were shown to selectively stabilize two oligonucleotide duplexes that both have a palindromic GC-rich hexanucleotide core, but their stabilizing effects on a random DNA sequence was negligible. In the case of the most effective compound, the 1,4-bis-[Gly-(L-Lys)] derivative of AM, the experimental results confirm the predictions of earlier theoretical computations. In contrast, AM had equal stabilizing effects on all three sequences and showed no preferential binding. This novel peptide derivative can be classified as a strong binder regarding the sequences that it selectively targets, possibly opening the exploitation of less cytotoxic conjugates of AM to the targeted treatment of oncological and viral diseases. PMID:20458714

  7. Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

    PubMed

    Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

    2014-08-01

    In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. PMID:24965874

  8. Simple, efficient protocol for enzymatic synthesis of uniformly 13C, 15N-labeled DNA for heteronuclear NMR studies.

    PubMed Central

    Masse, J E; Bortmann, P; Dieckmann, T; Feigon, J

    1998-01-01

    The use of uniformly 13C,15N-labeled RNA has greatly facilitated structural studies of RNA oligonucleotides by NMR. Application of similar methodologies for the study of DNA has been limited, primarily due to the lack of adequate methods for sample preparation. Methods for both chemical and enzymatic synthesis of DNA oligonucleotides uniformly labeled with 13C and/or 15N have been published, but have not yet been widely used. We have developed a modified procedure for preparing uniformly 13C,15N-labeled DNA based on enzymatic synthesis using Taq DNA polymerase. The highly efficient protocol results in quantitative polymerization of the template and approximately 80% incorporation of the labeled dNTPs. Procedures for avoiding non-templated addition of nucleotides or for their removal are given. The method has been used to synthesize several DNA oligonucleotides, including two complementary 15 base strands, a 32 base DNA oligonucleotide that folds to form an intramolecular triplex and a 12 base oligonucleotide that dimerizes and folds to form a quadruplex. Heteronuclear NMR spectra of the samples illustrate the quality of the labeled DNA obtained by these procedures. PMID:9592146

  9. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  10. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  11. DNA repair and replication fork helicases are differentially affected by alkyl phosphotriester lesion.

    PubMed

    Suhasini, Avvaru N; Sommers, Joshua A; Yu, Stephen; Wu, Yuliang; Xu, Ting; Kelman, Zvi; Kaplan, Daniel L; Brosh, Robert M

    2012-06-01

    DNA helicases are directly responsible for catalytically unwinding duplex DNA in an ATP-dependent and directionally specific manner and play essential roles in cellular nucleic acid metabolism. It has been conventionally thought that DNA helicases are inhibited by bulky covalent DNA adducts in a strand-specific manner. However, the effects of highly stable alkyl phosphotriester (PTE) lesions that are induced by chemical mutagens and refractory to DNA repair have not been previously studied for their effects on helicases. In this study, DNA repair and replication helicases were examined for unwinding a forked duplex DNA substrate harboring a single isopropyl PTE specifically positioned in the helicase-translocating or -nontranslocating strand within the double-stranded region. A comparison of SF2 helicases (RecQ, RECQ1, WRN, BLM, FANCJ, and ChlR1) with a SF1 DNA repair helicase (UvrD) and two replicative helicases (MCM and DnaB) demonstrates unique differences in the effect of the PTE on the DNA unwinding reactions catalyzed by these enzymes. All of the SF2 helicases tested were inhibited by the PTE lesion, whereas UvrD and the replication fork helicases were fully tolerant of the isopropyl backbone modification, irrespective of strand. Sequestration studies demonstrated that RECQ1 helicase was trapped by the PTE lesion only when it resided in the helicase-translocating strand. Our results are discussed in light of the current models for DNA unwinding by helicases that are likely to encounter sugar phosphate backbone damage during biological DNA transactions. PMID:22500020

  12. Corticosterone metabolism by chicken follicle cells does not affect ovarian reproductive hormone synthesis in vitro

    PubMed Central

    Rettenbacher, Sophie; Henriksen, Rie; Groothuids, Ton G.; Lepschy, Michael

    2013-01-01

    Glucocorticoids affect reproductive hormone production in many species. In chickens, elevated plasma corticosterone down-regulates testosterone and progesterone concentrations in plasma, but also in egg yolk. This suppression could be mediated via the hypothalamic-pituitary system but also via local inhibition of gonadal activity by glucocorticoids. As the latter has not been tested in birds yet, we tested if corticosterone directly inhibits ovarian steroid synthesis under in vitro conditions. We hypothesized that degradation of corticosterone by follicular cells impairs their ability to synthesize reproductive hormones due to either inhibition of enzymes or competition for common co-factors. Therefore, we first established whether follicles degrade corticosterone. Follicular tissue was harvested from freshly euthanized laying hens and incubated with radiolabelled corticosterone. Radioactive metabolites were visualized and quantified by autoradiography. Follicles converted corticosterone in a time-dependent manner into metabolites with a higher polarity than corticosterone. The predominant metabolite co-eluted with 20β-dihydrocorticosterone. Other chicken tissues mostly formed the same metabolite when incubated with corticosterone. In a second experiment, follicles were incubated with either progesterone or dehydroepiandrosterone. Corticosterone was added in increasing dosages up to 1000 ng per ml medium. Corticosterone did not inhibit the conversion of progesterone and dehydroepiandrosterone into a number of different metabolites, including 17α-hydroxyprogesterone, androstenedione and testosterone. In conclusion, avian tissues degrade corticosterone mostly to 20β-dihydrocorticosterone and even high corticosterone dosages do not affect follicular hormone production under in vitro conditions. PMID:23333751

  13. Polyhydroxyalkanoate synthesis affects biosurfactant production and cell attachment to hydrocarbons in Pseudomonas sp. KA-08.

    PubMed

    Di Martino, Carla; Catone, Mariela V; López, Nancy I; Raiger Iustman, Laura J

    2014-06-01

    Stressful conditions prevailing in hydrocarbon-contaminated sites influence the diversity, distribution, and activities of microorganisms. Oil bioremediation agents should develop special characteristics to cope with these environments like surfactant production and cellular affinity to hydrocarbons. Additionally, polyhydroxyalkanoate (PHA) accumulation was proven to improve tolerance to stressful conditions. Pseudomonas sp. KA-08 was isolated from a chronic oil-contaminated environment, it is highly tolerant to xylene, and it is able to accumulate PHA and to produce surfactant compounds that lower the water surface tension (ST) as well as bioemulsifiers. In this work, we studied the effect of the capability to accumulate PHAs on biosurfactant production and microbial attachment to hydrocarbons (MATH). Our results showed that PHA synthesis capability has a favorable effect in the production of compounds which affect the ST but not on the production of bioemulsifiers. On the other hand, PHA accumulation affects cellular affinity to xylene. MATH analysis showed that a PHA-negative mutant increased its affinity to xylene compared with the wild-type strain. This result was also observed in Pseudomonas putida GPp104 (a PHA(-) mutant), suggesting that this effect could be generalized to other Pseudomonas strains. PMID:24519857

  14. Peptide Nucleic Acid with a Lysine Side Chain at the β-Position: Synthesis and Application for DNA Cleavage.

    PubMed

    Sugiyama, Toru; Kuwata, Keiko; Imamura, Yasutada; Demizu, Yosuke; Kurihara, Masaaki; Takano, Masashi; Kittaka, Atsushi

    2016-01-01

    This paper reports the synthesis of new β-Lys peptide nucleic acid (PNA) monomers and their incorporation into a 10-residue PNA sequence. PNA containing β-Lys PNA units formed a stable hybrid duplex with DNA. However, incorporation of β-Lys PNA units caused destabilization of PNA-DNA duplexes to some extent. Electrostatic attractions between β-PNA and DNA could reduce this destabilization effect. Subsequently, bipyridine-conjugated β-Lys PNA was prepared and exhibited sequence selective cleavage of DNA. Based on the structures of the cleavage products and molecular modeling, we reasoned that bipyridine moiety locates within the minor groove of the PNA-DNA duplexes. The lysine side chain of β-PNA is a versatile handle for attaching various functional molecules. PMID:27373637

  15. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    SciTech Connect

    Kim, Sunyoung; Baltimore, D. Massachusetts Institute of Technology, Cambridge ); Byrn, R.; Groopman, J. )

    1989-09-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4{sup +} lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes.

  16. An Integrated System for DNA Sequencing by Synthesis Using Novel Nucleotide Analogues

    PubMed Central

    Guo, Jia; Yu, Lin; Turro, Nicholas J.; Ju, Jingyue

    2010-01-01

    Conspectus The Human Genome Project has concluded, but its successful completion has increased, rather than decreased, the need for high-throughput DNA sequencing technologies. The possibility of clinically screening a full genome for an individual's mutations offers tremendous benefits, both for pursuing personalized medicine as well as uncovering the genomic contributions to diseases. The Sanger sequencing method—although enormously productive for more than 30 years—requires an electrophoretic separation step that, unfortunately, remains a key technical obstacle for achieving economically acceptable full-genome results. Alternative sequencing approaches thus focus on innovations that can reduce costs. The DNA sequencing by synthesis (SBS) approach has shown great promise as a new sequencing platform, with particular progress reported recently. The general fluorescent SBS approach involves (i) incorporation of nucleotide analogs bearing fluorescent reporters, (ii) identification of the incorporated nucleotide by its fluorescent emissions, and (iii) cleavage of the fluorophore, along with the reinitiation of the polymerase reaction for continuing sequence determination. In this Account, we review the construction of a DNA-immobilized chip and the development of novel nucleotide reporters for the SBS sequencing platform. Click chemistry, with its high selectivity and coupling efficiency, was explored for surface immobilization of DNA. The first generation (G-1) modified nucleotides for SBS feature a small chemical moiety capping the 3′-OH and a fluorophore tethered to the base through a chemically cleavable linker; the design ensures that the nucleotide reporters are good substrates for the polymerase. The 3′-capping moiety and the fluorophore on the DNA extension products, generated by the incorporation of the G-1 modified nucleotides, are cleaved simultaneously to reinitiate the polymerase reaction. The sequence of a DNA template immobilized on a surface

  17. Different activities of unscheduled DNA synthesis in human melanoma and bone marrow cells

    SciTech Connect

    Lewensohn, R.; Ringborg, U.; Hansson, J.

    1982-01-01

    Unscheduled DNA synthesis (UDS) indicated by melphalan was studied in freshly collected tumor cells from human melanoma metastases. Comparative studies were done on human bone marrow blast cells. Significant levels of UDS comparable with those in myeloblasts were found in only two of eight melanoma cell populations. This difference between melanoma and blast cells was not related to different cellular uptake of melphalan. When UDS was induced by ultraviolet irradiation, significant levels of UDS were found in all melanoma and blast cell populations studied. Also, in a human melanoma cell line, high levels of UDS were found after exposure to ultraviolet irradiation, while treatment with melphalan did not result in detectable levels of UDS. Possible explanations for the divergent results of UDS in melphalan-exposed melanoma cells are discussed.

  18. Arginine Depletion by Arginine Deiminase Does Not Affect Whole Protein Metabolism or Muscle Fractional Protein Synthesis Rate in Mice

    PubMed Central

    Marini, Juan C.; Didelija, Inka Cajo

    2015-01-01

    Due to the absolute need for arginine that certain cancer cells have, arginine depletion is a therapy in clinical trials to treat several types of cancers. Arginine is an amino acids utilized not only as a precursor for other important molecules, but also for protein synthesis. Because arginine depletion can potentially exacerbate the progressive loss of body weight, and especially lean body mass, in cancer patients we determined the effect of arginine depletion by pegylated arginine deiminase (ADI-PEG 20) on whole body protein synthesis and fractional protein synthesis rate in multiple tissues of mice. ADI-PEG 20 successfully depleted circulating arginine (<1 μmol/L), and increased citrulline concentration more than tenfold. Body weight and body composition, however, were not affected by ADI-PEG 20. Despite the depletion of arginine, whole body protein synthesis and breakdown were maintained in the ADI-PEG 20 treated mice. The fractional protein synthesis rate of muscle was also not affected by arginine depletion. Most tissues (liver, kidney, spleen, heart, lungs, stomach, small and large intestine, pancreas) were able to maintain their fractional protein synthesis rate; however, the fractional protein synthesis rate of brain, thymus and testicles was reduced due to the ADI-PEG 20 treatment. Furthermore, these results were confirmed by the incorporation of ureido [14C]citrulline, which indicate the local conversion into arginine, into protein. In conclusion, the intracellular recycling pathway of citrulline is able to provide enough arginine to maintain protein synthesis rate and prevent the loss of lean body mass and body weight. PMID:25775142

  19. Defective oxidative phosphorylation in thyroid oncocytic carcinoma is associated with pathogenic mitochondrial DNA mutations affecting complexes I and III.

    PubMed

    Bonora, Elena; Porcelli, Anna Maria; Gasparre, Giuseppe; Biondi, Annalisa; Ghelli, Anna; Carelli, Valerio; Baracca, Alessandra; Tallini, Giovanni; Martinuzzi, Andrea; Lenaz, Giorgio; Rugolo, Michela; Romeo, Giovanni

    2006-06-15

    Oncocytic tumors are characterized by cells with an aberrant accumulation of mitochondria. To assess mitochondrial function in neoplastic oncocytic cells, we studied the thyroid oncocytic cell line XTC.UC1 and compared it with other thyroid non-oncocytic cell lines. Only XTC.UC1 cells were unable to survive in galactose, a condition forcing cells to rely solely on mitochondria for energy production. The rate of respiration and mitochondrial ATP synthesis driven by complex I substrates was severely reduced in XTC.UC1 cells. Furthermore, the enzymatic activity of complexes I and III was dramatically decreased in these cells compared with controls, in conjunction with a strongly enhanced production of reactive oxygen species. Osteosarcoma-derived transmitochondrial cell hybrids (cybrids) carrying XTC.UC1 mitochondrial DNA (mtDNA) were generated to discriminate whether the energetic failure depended on mitochondrial or nuclear DNA mutations. In galactose medium, XTC.UC1 cybrid clones showed reduced viability and ATP content, similarly to the parental XTC.UC1, clearly pointing to the existence of mtDNA alterations. Sequencing of XTC.UC1 mtDNA identified a frameshift mutation in ND1 and a nonconservative substitution in cytochrome b, two mutations with a clear pathogenic potential. In conclusion, this is the first demonstration that mitochondrial dysfunction of XTC.UC1 is due to a combined complex I/III defect associated with mtDNA mutations, as proven by the transfer of the defective energetic phenotype with the mitochondrial genome into the cybrids. PMID:16778181

  20. Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

    PubMed Central

    Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

    2014-01-01

    The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

  1. Synthesis and characterization of monomolecular DNA G-quadruplexes formed by tetra-end-linked oligonucleotides.

    PubMed

    Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Galeone, Aldo; Petraccone, Luigi; Varra, Michela; Piccialli, Gennaro; Mayol, Luciano

    2006-01-01

    Guanine-rich DNA sequences are widely dispersed in the eukaryotic genome and are abundant in regions with relevant biological significance. They can form quadruplex structures stabilized by guanine quartets. These structures differ for number and strand polarity, loop composition, and conformation. We report here the syntheses and the structural studies of a set of interconnected d(TG(4)T) fragments which are tethered, with different orientations, to a tetra-end-linker in an attempt to force the formation of specific four-stranded DNA quadruplex structures. Two synthetic strategies have been used to obtain oligodeoxyribonucleotide (ODN) strands linked with their 3'- or 5'-ends to each of the four arms of the linker. The first approach allowed the synthesis of tetra-end-linked ODN (TEL-ODN) containing the four ODN strands with a parallel orientation, while the latter synthetic pathway led to the synthesis of TEL-ODNs each containing antiparallel ODN pairs. The influence of the linker at 3'- or 5'-ODN, on the quadruplex typology and stability, in the presence of sodium or potassium ions, has been investigated by circular dichroism (CD), CD thermal denaturation, (1)H NMR experiments at variable temperature, and molecular modeling. All synthesized TEL-ODNs formed parallel G-quadruplex structures. Particularly, the TEL-ODN containing all parallel ODN tracts formed very stable parallel G-quadruplex complexes, whereas the TEL-ODNs containing antiparallel ODN pairs led to relatively less stable parallel G-quadruplexes. The molecular modeling data suggested that the above antiparallel TEL-ODNs can adopt parallel G-quadruplex structures thanks to a considerable folding of the tetra-end-linker around the whole quadruplex scaffold. PMID:16848394

  2. Long conducting polymer nanonecklaces with a `beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties

    NASA Astrophysics Data System (ADS)

    Chen, Guofang; Mao, Chengde

    2016-05-01

    Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k

  3. A Pleiotropic Regulator, Frp, Affects Exopolysaccharide Synthesis, Biofilm Formation, and Competence Development in Streptococcus mutans

    PubMed Central

    Wang, Bing; Kuramitsu, Howard K.

    2006-01-01

    Exopolysaccharide synthesis, biofilm formation, and competence are important physiologic functions and virulence factors for Streptococcus mutans. In this study, we report the role of Frp, a transcriptional regulator, on the regulation of these traits crucial to pathogenesis. An Frp-deficient mutant showed decreased transcription of several genes important in virulence, including those encoding fructosyltransferase (Ftf), glucosyltransferase B (GtfB), and GtfC, by reverse transcription and quantitative real-time PCR. Expression of Ftf was decreased in the frp mutant, as assessed by Western blotting as well as by the activity assays. Frp deficiency also inhibited the production of GtfB in the presence of glucose and sucrose as well as the production of GtfC in the presence of glucose. As a consequence of the effects on GtfB and -C, sucrose-induced biofilm formation was decreased in the frp mutant. The expression of competence mediated by the competence-signaling peptide (CSP) system, as assessed by comC gene transcription, was attenuated in the frp mutant. As a result, the transformation efficiency was decreased in the frp mutant but was partially restored by adding synthetic CSP. Transcription of the frp gene was significantly increased in the frp mutant under all conditions tested, indicating that frp transcription is autoregulated. Furthermore, complementation of the frp gene in the frp mutant restored transcription of the affected genes to levels similar to those in the wild-type strain. These results suggest that Frp is a novel pleiotropic effector of multiple cellular functions and is involved in the modulation of exopolysaccharide synthesis, sucrose-dependent biofilm formation, and competence development. PMID:16861645

  4. Speed matters: How subtle changes in DNA end resection rate affect repair

    PubMed Central

    Huertas, Pablo; Cruz-García, Andrés

    2015-01-01

    The contribution of BRCA1 (breast cancer 1) to the repair of broken DNA is well established, but its real role at the molecular level is less well understood. By developing a new high-resolution, single-molecule technique, we have now shown that BRCA1 accelerates the processing of DNA breaks that subsequently engage in homologous recombination. PMID:27308460

  5. Induction of unscheduled DNA synthesis in HeLa cells by allylic compounds.

    PubMed

    Schiffmann, D; Eder, E; Neudecker, T; Henschler, D

    1983-10-01

    Thirteen allylic compounds, mostly with close structural relationship, were tested for their ability to induce unscheduled DNA synthesis (UDS) in HeLa cells and mutations in the Ames test; 11 induced UDS in dose dependence. Allyl isothiocyanate was negative in UDS (borderline in the Ames test) and acrolein (positive in the Ames test) proved toxic to HeLa cells, therefore UDS measurement was excluded. In general, positive qualitative and quantitative correlation between UDS, Ames test and alkylating properties (as measured in the 4-nitrobenzyl-pyridine test, NBP) were found. Among structural analogs and typical allylic compounds with various leaving groups, the amount of induced DNA repair at equimolar concentrations decreased in the same order as the mutagenic and alkylating activities in the other 2 test systems: 1,3-dichloropropene (cis) greater than 1,3-dichloropropene (trans) greater than 2,3-dichloro-1-propene; 1-chloro-2-butene greater than 3-chloro-1-butene greater than 3-chloro-2-methyl-1-propene greater than allyl chloride; allyl-methane-sulfonate greater than -iodide greater than -bromide greater than -chloride. PMID:6627227

  6. Mutations that affect production of branched RNA-linked msDNA in Myxococcus xanthus.

    PubMed Central

    Dhundale, A; Furuichi, T; Inouye, M; Inouye, S

    1988-01-01

    A deletion mutation of the gene (msd-msr) for the branched RNA-linked msDNA of Myxococcus xanthus was constructed by replacing the chromosomal 0.7-kilobase (kb) SmaI-XhoI fragment encompassing msd-msr with a 1.4-kb fragment carrying a gene for kanamycin resistance. It was found that this deletion strain (delta msSX) could not produce msDNA, although it still contained another species of msDNA, mrDNA (msDNA, reduced size). No apparent differences between delta msSX and the wild-type strain were observed in terms of cell growth, morphogenesis, fruiting-body formation, or motility. Both a deletion mutation at the region 100 base pairs upstream of msd and an insertion mutation at a site 500 base pairs upstream of msd showed a significant reduction of msDNA production, indicating that there is a cis- or trans-acting positive element in this region. When the 3.5-kb BamHI fragment carrying msd-msr from Stigmatella aurantiaca was inserted into the M. xanthus chromosome, the S. aurantiaca msDNA was found to be produced in M. xanthus. Images PMID:2461359

  7. Synthesis, crystal structures, DNA binding and photoluminescence properties of [Cu(pzta)2Cl]Cl⋅H2O for DNA detection.

    PubMed

    Duan, Ran-ran; Wang, Lu; Huo, Wei-qiang; Chen, Shi; Zhou, Xiao-hua

    2014-07-15

    We report here the synthesis of a new copper(II) complex of 2,4-diamino-6-(2'-pyrazin)-1,3,5-triazine [Cu(pzta)2Cl]Cl·H2O and its characterization using UV and IR spectroscopy, elemental analysis, and X-ray diffraction. Fluorescence spectroscopy revealed that the complex was sensitive to oxygen and to the polarity of nonaqueous solvents. Binding of the complex to DNA was investigated using UV spectroscopy, ethidium bromide displacement from DNA, cyclic voltammetry, and viscometry. The results revealed the DNA binding mode was intercalation together with external static-electricity. However, the complex can be also used to DNA detection as DNA fluorescence probe with a LOD of 4.21 ng mL(-1) for the relative wide linear range between 0.2 and 17 μg mL(-1). In conclusion, that synthetic method of the complex was easy with low expense and was relatively rapid and sensitive compared to most toxic fluorescence dyes. This finding would indicate the complex may be a potential DNA-targeted probes and optical probes for oxygen-free environments in nonaqueous form. PMID:24691376

  8. Agrobacterium rhizogenes pRi8196 T-DNA: mapping and DNA sequence of functions involved in mannopine synthesis and hairy root differentiation.

    PubMed Central

    Hansen, G; Larribe, M; Vaubert, D; Tempé, J; Biermann, B J; Montoya, A L; Chilton, M D; Brevet, J

    1991-01-01

    This paper presents the map and DNA sequence analysis of pRi8196 transferred DNA (T-DNA) genes encoding root-inducing and mannopine synthesis functions. A canonical 24-base-pair border repeat as well as two "pseudoborders" are present at the functional right T-DNA border. To the left of this border are homologs of the mas1' and mas2' genes of TR pRiA4. Next to these are five open reading frames (ORFs) homologous to ORFs 10-14 of TL of pRiA4. ORFs 10-12 (rolA, rolB, and rolC) are less related to their pRiA4 homologs than are the other large ORFs analyzed here. In contrast to T-DNA genes of pRiA4, pRi8196 T-DNA ORFs 11 and 12 (rolB and rolC) are sufficient to induce hairy roots on carrot disks. Images PMID:1909028

  9. Effects of DNA synthesis inhibitors on post-traumatic glial cell proliferation

    SciTech Connect

    Billingsley, M.L.; Mandel, H.G.

    1982-09-01

    This study attempts to inhibit post-traumatic glial cell scarring in rats lesioned in the frontal cortex, by treatment with several antiproliferative drugs. (/sup 3/H)Thymidine ((/sup 3/H)TdR) incorporation into DNA served as the biochemical index of glial cell proliferation and histological observations confirmed the biochemical effects. Cytosine arabinoside (ara-C), given i.p. at a total daily dosage of 15 to 100 mg/kg, was found to inhibit the incorporation of (/sup 3/H)TdR into cortical DNA and also inhibited the proliferation of glial cells after cortical trauma. Treatment using ara-C induced marked histological changes in glial cells near the lesion, indicating that the inhibition by the drug of DNA synthesis correlated with cytotoxicity to proliferating glial cells. Experiments using (/sup 3/H)ara-C confirmed that this drug entered lesioned brain tissue, although at levels considerably lower than those found in the periphery. Cyclophosphamide also reduced (/sup 3/H)TdR incorporation into both lesioned and control cortices; however, this effect, unlike that of ara-C, was not proportionately greater in the lesioned cortex. Vincristine, but not vinblastine, also inhibited (/sup 3/H)TdR incorporation into the lesioned cortex, possibly reflecting differences in the neuronal uptake of the vinca alkaloids. We propose that ara-C can inhibit the proliferation of glial cells after neural trauma and that judicious use of this agent may lessen scarring in the injured central nervous system, possibly enhancing the regenerative capacity of the brain.

  10. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant.

    PubMed

    Durand, Adeline; Sinha, Anurag Kumar; Dard-Dascot, Cloelia; Michel, Bénédicte

    2016-06-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  11. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant

    PubMed Central

    Durand, Adeline

    2016-01-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  12. DNA Three Way Junction Core Decorated with Amino Acids-Like Residues-Synthesis and Characterization.

    PubMed

    Addamiano, Claudia; Gerland, Béatrice; Payrastre, Corinne; Escudier, Jean-Marc

    2016-01-01

    Construction and physico-chemical behavior of DNA three way junction (3WJ) functionalized by protein-like residues (imidazole, alcohol and carboxylic acid) at unpaired positions at the core is described. One 5'-C(S)-propargyl-thymidine nucleotide was specifically incorporated on each strand to react through a post synthetic CuACC reaction with either protected imidazolyl-, hydroxyl- or carboxyl-azide. Structural impacts of 5'-C(S)-functionalization were investigated to evaluate how 3WJ flexibility/stability is affected. PMID:27563857

  13. SMN affects membrane remodelling and anchoring of the protein synthesis machinery.

    PubMed

    Gabanella, Francesca; Pisani, Cinzia; Borreca, Antonella; Farioli-Vecchioli, Stefano; Ciotti, Maria Teresa; Ingegnere, Tiziano; Onori, Annalisa; Ammassari-Teule, Martine; Corbi, Nicoletta; Canu, Nadia; Monaco, Lucia; Passananti, Claudio; Di Certo, Maria Grazia

    2016-02-15

    Disconnection between membrane signalling and actin networks can have catastrophic effects depending on cell size and polarity. The survival motor neuron (SMN) protein is ubiquitously involved in assembly of spliceosomal small nuclear ribonucleoprotein particles. Other SMN functions could, however, affect cellular activities driving asymmetrical cell surface expansions. Genes able to mitigate SMN deficiency operate within pathways in which SMN can act, such as mRNA translation, actin network and endocytosis. Here, we found that SMN accumulates at membrane protrusions during the dynamic rearrangement of the actin filaments. In addition to localization data, we show that SMN interacts with caveolin-1, which mediates anchoring of translation machinery components. Importantly, SMN deficiency depletes the plasma membrane of ribosomes, and this correlates with the failure of fibroblasts to extend membrane protrusions. These findings strongly support a relationship between SMN and membrane dynamics. We propose that SMN could assembly translational platforms associated with and governed by the plasma membrane. This activity could be crucial in cells that have an exacerbated interdependence of membrane remodelling and local protein synthesis. PMID:26743087

  14. Loss of phylloquinone in Chlamydomonas affects plastoquinone pool size and photosystem II synthesis.

    PubMed

    Lefebvre-Legendre, Linnka; Rappaport, Fabrice; Finazzi, Giovanni; Ceol, Mauro; Grivet, Chantal; Hopfgartner, Gérard; Rochaix, Jean-David

    2007-05-01

    Phylloquinone functions as the electron transfer cofactor at the A(1) site of photosystem I. We have isolated and characterized a mutant of Chlamydomonas reinhardtii, menD1, that is deficient in MenD, which encodes 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase, an enzyme that catalyzes the first specific step of the phylloquinone biosynthetic pathway. The mutant is photosynthetically active but light-sensitive. Analysis of total pigments by mass spectrometry reveals that phylloquinone is absent in menD1, but plastoquinone levels are not affected. This is further confirmed by the rescue of menD1 by addition of phylloquinone to the growth medium. Analysis of electron transfer by absorption spectroscopy indicates that plastoquinone replaces phylloquinone in photosystem I and that electron transfer from A(1) to the iron-sulfur centers is slowed down at least 40-fold. Consistent with a replacement of phylloquinone by plastoquinone, the size of the free plastoquinone pool of menD1 is reduced by 20-30%. In contrast to cyanobacterial MenD-deficient mutants, photosystem I accumulates normally in menD1, whereas the level of photosystem II declines. This decrease is because of reduced synthesis of the photosystem II core subunits. The relationship between plastoquinone occupancy of the A(1) site in photosystem I and the reduced accumulation of photosystem II is discussed. PMID:17339322

  15. The Quorum Sensing Inhibitor Hamamelitannin Increases Antibiotic Susceptibility of Staphylococcus aureus Biofilms by Affecting Peptidoglycan Biosynthesis and eDNA Release

    PubMed Central

    Brackman, Gilles; Breyne, Koen; De Rycke, Riet; Vermote, Arno; Van Nieuwerburgh, Filip; Meyer, Evelyne; Van Calenbergh, Serge; Coenye, Tom

    2016-01-01

    Treatment of Staphylococcus aureus infections has become increasingly challenging due to the rapid emergence and dissemination of methicillin-resistant strains. In addition, S. aureus reside within biofilms at the site of infection. Few novel antibacterial agents have been developed in recent years and their bacteriostatic or bactericidal activity results in selective pressure, inevitably inducing antimicrobial resistance. Consequently, innovative antimicrobials with other modes of action are urgently needed. One alternative approach is targeting the bacterial quorum sensing (QS) system. Hamamelitannin (2′,5-di-O-galloyl-d-hamamelose; HAM) was previously suggested to block QS through the TraP QS system and was shown to increase S. aureus biofilm susceptibility towards vancomycin (VAN) although mechanistic insights are still lacking. In the present study we provide evidence that HAM specifically affects S. aureus biofilm susceptibility through the TraP receptor by affecting cell wall synthesis and extracellular DNA release of S. aureus. We further provide evidence that HAM can increase the susceptibility of S. aureus biofilms towards different classes of antibiotics in vitro. Finally, we show that HAM increases the susceptibility of S. aureus to antibiotic treatment in in vivo Caenorhabditis elegans and mouse mammary gland infection models. PMID:26828772

  16. Rabies RNA synthesis, detected with cDNA probes, as a marker for virus transport in the rat nervous system.

    PubMed

    Ermine, A; Ceccaldi, P E; Masson, G; Tsiang, H

    1993-02-01

    The kinetics of viral RNA synthesis in different parts of the rat brain, infected with fixed or street rabies virus strains, is correlated with their anatomical neuronal connections with the masseter muscles, using hybridization with rabies cDNA probes. Viral RNA synthesis is first detected in the brain-stem and in the pons where the direct anatomical projection of the masseter muscle nervous arborization into the sensory and motor nuclei is located, through the trigeminus nerve. Rabies RNA detection is delayed in the other regions of the rat brain depending on the time course of virus transport from the trigeminal nuclei through multiple nervous connections. PMID:7681151

  17. Synthesis, interaction with DNA, cytotoxicity, cell cycle arrest and apoptotic inducing properties of ruthenium(II) molecular "light switch" complexes.

    PubMed

    Shobha Devi, C; Anil Kumar, D; Singh, Surya S; Gabra, Nazar; Deepika, N; Kumar, Y Praveen; Satyanarayana, S

    2013-06-01

    In an endeavor toward the development of metal-based anticancer drugs, we present here the design, synthesis and characterization of three ruthenium(II) functionalized phenanthroline complexes with extended π-conjugation. These complexes have been shown to act as promising CT-DNA intercalators as evidenced by UV-visible, luminescence, emission quenching by [Fe(CN)6](4-), DNA competitive binding with ethidium bromide and salt dependent studies. All three complexes [Ru(Hdpa)2PPIP](2+) (1), [Ru(Hdpa)2PIP](2+) (2), [Ru(Hdpa)24HEPIP](2+) (3) clearly demonstrated that they can bind to DNA through the intercalation mode. Cell viability experiments indicated that all complexes showed significant dose dependent cytotoxicity in selected cell lines. The apoptosis and cell cycle arrest were also investigated. The complexes were docked into DNA-base-pairs using the 'GOLD' (Genetic Optimization for Ligand Docking), docking program. PMID:23665797

  18. Chemometric method of spectra analysis leading to isolation of lysozyme and CtDNA spectra affected by osmolytes.

    PubMed

    Bruździak, Piotr; Rakowska, Paulina W; Stangret, Janusz

    2012-11-01

    In this paper we present a chemometric method of analysis leading to isolation of Fourier transform infrared (FT-IR) spectra of biomacromolecules (HEW lysozyme, ctDNA) affected by osmolytes (trimethylamine-N-oxide and N,N,N-trimethylglycine, respectively) in aqueous solutions. The method is based on the difference spectra method primarily used to characterize the structure of solvent affected by solute. The cyclical usage of factor analysis allows precise information to be obtained on the shape of "affected spectra" of analyzed biomacromolecules. "Affected spectra" of selected biomacromolecules give valuable information on their structure in the presence of the osmolytes in solution, as well as on the level of perturbation in dependence of osmolyte concentration. The method also gives a possibility of insight into the mechanism of interaction in presented types of systems. It can be easily adapted to various chemical and biochemical problems where vibrational or ultraviolet-visible (UV-Vis) spectroscopy is used. PMID:23146186

  19. Multiple factors affect immunogenicity of DNA plasmid HIV vaccines in human clinical trials

    PubMed Central

    Jin, Xia; Morgan, Cecilia; Yu, Xuesong; DeRosa, Stephen; Tomaras, Georgia D.; Montefiori, David C.; Kublin, James; Corey, Larry; Keefer, Michael C.

    2015-01-01

    Plasmid DNA vaccines have been licensed for use in domesticated animals because of their excellent immunogenicity, but none have yet been licensed for use in humans. Here we report a retrospective analysis of 1218 healthy human volunteers enrolled in 10 phase I clinical trials in which DNA plasmids encoding HIV antigens were administered. Elicited T-cell immune responses were quantified by validated intracellular cytokine staining (ICS) stimulated with HIV peptide pools. HIV-specific binding and neutralizing antibody activities were also analyzed using validated assays. Results showed that, in the absence of adjuvants and boosting with alternative vaccines, DNA vaccines elicited CD8+ and CD4+ T-cell responses in an average of 13.3% (95% CI: 9.8% to 17.8%) and 37.7% (95% CI: 31.9% to 43.8%) of vaccine recipients, respectively. Three vaccinations (versus 2) improved the proportion of subjects with antigen-specific CD8+ responses (p=0.02), as did increased DNA dosage (p=0.007). Furthermore, female gender and participants having a lower Body Mass Index were independently associated with higher CD4+ T-cell response rate (p=0.001 and p=0.008, respectively). These vaccines elicited minimal neutralizing and binding antibody responses. These findings of the immunogenicity of HIV DNA vaccines in humans can provide guidance for future clinical trials. PMID:25820067

  20. UV-assisted photocatalytic synthesis of highly dispersed Ag nanoparticles supported on DNA decorated graphene for quantitative iodide analysis.

    PubMed

    Kong, Fen-Ying; Li, Wei-Wei; Wang, Jing-Yi; Wang, Wei

    2015-07-15

    Herein, we report, for the first time, the synthesis of reduced graphene oxide-DNA-Ag (RGO-DNA-Ag) nanohybrids by ultraviolet (UV) irradiation of aqueous solutions of GO and Ag ions in the presence of DNA. The morphology and microstructure characterizations of the resultant nanohybrids reveal that the proposed method leads to the simultaneous reduction of GO and Ag ions together with efficient dispersion of Ag nanoparticles on the surface of RGO sheets. This simple and fast synthesis route is carried out at ambient conditions without using any additional chemical reducing agents, which has the potential to provide new avenues for the green fabrication of various RGO-based nanomaterials. Additionally, the RGO-DNA-Ag nanohybrids can be utilized as a novel sensing interfacial for direct determination of iodide by simple differential pulse voltammetry (DPV), without requiring any preceding preconcentration of the analyte. Based on the RGO-DNA-Ag nanohybrids modified electrode, a wide linear range of 1μM-1mM and a low detection limit of 0.2μM were obtained. This sensitive and direct method of analysis can be applied successfully to the determination of iodide in real samples. PMID:25747505

  1. DNA polymerase beta-catalyzed-PCNA independent long patch base excision repair synthesis: a mechanism for repair of oxidatively damaged DNA ends in post-mitotic brain.

    PubMed

    Wei, Wei; Englander, Ella W

    2008-11-01

    Oxidative DNA damage incidental to normal respiratory metabolism poses a particular threat to genomes of highly metabolic-long lived cells. We show that post-mitotic brain has capacity to repair oxidatively damaged DNA ends, which are targets of the long patch (LP) base excision repair (BER) subpathway. LP-BER relies, in part, on proteins associated with DNA replication, including proliferating cell nuclear antigen and is inherent to proliferating cells. Nonetheless, repair products are generated with brain extracts, albeit at slow rates, in the case of 5'-DNA ends modeled with tetrahydrofuran (THF). THF at this position is refractory to DNA polymerase beta 5'-deoxyribose 5-phosphate lyase activity and drives repair into the LP-BER subpathway. Comparison of repair of 5'-THF-blocked termini in the post-mitotic rat brain and proliferative intestinal mucosa, revealed that in mucosa, resolution of damaged 5'-termini is accompanied by formation of larger repair products. In contrast, adducts targeted by the single nucleotide BER are proficiently repaired with both extracts. Our findings reveal mechanistic differences in BER processes selective for the brain versus proliferative tissues. The differences highlight the physiological relevance of the recently proposed 'Hit and Run' mechanism of alternating cleavage/synthesis steps, in the proliferating cell nuclear antigen-independent LP-BER process. PMID:18752643

  2. DNA-Metalization: Synthesis and Properties of Novel Silver-Containing DNA Molecules (Adv. Mater. 24/2016).

    PubMed

    Eidelshtein, Gennady; Fardian-Melamed, Natalie; Gutkin, Vitaly; Basmanov, Dmitry; Klinov, Dmitry; Rotem, Dvir; Levi-Kalisman, Yael; Porath, Danny; Kotlyar, Alexander

    2016-06-01

    D. Porath, A. Kotlyar, and co-workers transform DNA to a conducting material by metalization through coating or chemical modifications, as described on page 4839. Specific and reversible metalization of poly(dG)-poly(dC) DNA by migration of atoms from silver nanoparticles to the DNA is demonstrated. As the transformation occurs gradually, novel, truly hybrid molecular structures are obtained, paving the way to their usage as nanowires in programmable molecular electronic devices and circuits. PMID:27311096

  3. Pyridine and p-Nitrophenyl Oxime Esters with Possible Photochemotherapeutic Activity: Synthesis, DNA Photocleavage and DNA Binding Studies.

    PubMed

    Pasolli, Milena; Dafnopoulos, Konstantinos; Andreou, Nicolaos-Panagiotis; Gritzapis, Panagiotis S; Koffa, Maria; Koumbis, Alexandros E; Psomas, George; Fylaktakidou, Konstantina C

    2016-01-01

    Compared to standard treatments for various diseases, photochemotherapy and photo-dynamic therapy are less invasive approaches, in which DNA photocleavers represent promising tools for novel "on demand" chemotherapeutics. A series of p-nitrobenzoyl and p-pyridoyl ester conjugated aldoximes, amidoximes and ethanone oximes were subjected to UV irradiation at 312 nm with supercoiled circular plasmid DNA. The compounds which possessed appropriate properties were additionally subjected to UVA irradiation at 365 nm. The ability of most of the compounds to photocleave DNA was high at 312 nm, whereas higher concentrations were required at 365 nm as a result of their lower UV absorption. The affinity of selected compounds to calf-thymus (CT) DNA was studied by UV spectroscopy, viscosity experiments and competitive studies with ethidium bromide (EB) revealing that all compounds interacted with CT DNA. The fluorescence emission spectra of the pre-treated EB-DNA exhibited a moderate to significant quenching in the presence of the compounds indicating the binding of the compounds to CT DNA via intercalation as concluded also by DNA-viscosity experiments. For the oxime esters the DNA photocleavage and affinity studies aimed to clarify the role of the oxime nature (aldoxime, ketoxime, amidoxime) and the role of the pyridine and p-nitrophenyl moieties both as oxime substituents and ester conjugates. PMID:27376258

  4. Prolonged leucine infusion differentially affects tissue protein synthesis in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine (Leu) acutely stimulates protein synthesis by activating the mammalian target of rapamycin complex 1 (mTORC1) pathway. To determine whether Leu can stimulate protein synthesis in muscles of different fiber types and visceral tissues of the neonate for a prolonged period and to determine the ...

  5. Further verification of the isotope dilution approach for estimating the degree of participation of (/sup 3/H)thymidine in DNA synthesis in studies of aquatic bacterial production

    SciTech Connect

    Bell, R.T.

    1986-11-01

    The optimal concentration of (/sup 3/H)thymidine (i.e., the maximal degree of participation in DNA synthesis) as determined by adding increasing amounts of labeled thymidine at the same specific activity was similar to the concentration of thymidine inhibiting the de novo pathway as determined by isotope dilution plots. These experiments provide further verification of the isotope dilution approach for determining the degree of participation of (/sup 3/H)thymidine in DNA synthesis.

  6. DNA polymerase kappa microsatellite synthesis: two distinct mechanisms of slippage-mediated errors.

    PubMed

    Baptiste, Beverly A; Eckert, Kristin A

    2012-12-01

    Microsatellite tandem repeats are frequent sites of strand slippage mutagenesis in the human genome. Microsatellite mutations often occur as insertion/deletion of a repeat motif (unit-based indels), and increase in frequency with increasing repeat length after a threshold is reached. We recently demonstrated that DNA polymerase κ (Pol κ) produces fewer unit-based indel errors within dinucleotide microsatellites than does polymerase δ. Here, we examined human Pol κ's error profile within microsatellite alleles of varying sequence composition and length, using an in vitro HSV-tk gap-filling assay. We observed that Pol κ displays relatively accurate synthesis for unit-based indels, using di- and tetranucleotide repeat templates longer than the threshold length. We observed an abrupt increase in the unit-based indel frequency when the total microsatellite length exceeds 28 nucleotides, suggesting that extended Pol κ protein-DNA interactions enhance fidelity of the enzyme when synthesizing these microsatellite alleles. In contrast, Pol κ is error-prone within the HSV-tk coding sequence, producing frequent single-base errors in a manner that is highly biased with regard to sequence context. Single-nucleotide errors are also created by Pol κ within di- and tetranucleotide repeats, independently of the microsatellite allele length and at a frequency per nucleotide similar to the frequency of single base errors within the coding sequence. These single-base errors represent the mutational signature of Pol κ, and we propose them a mechanism independent of homology-stabilized slippage. Pol κ's dual fidelity nature provides a unique research tool to explore the distinct mechanisms of slippage-mediated mutagenesis. PMID:22965905

  7. Scorpion (Odontobuthus doriae) venom induces apoptosis and inhibits DNA synthesis in human neuroblastoma cells.

    PubMed

    Zargan, Jamil; Sajad, Mir; Umar, Sadiq; Naime, M; Ali, Shakir; Khan, Haider A

    2011-02-01

    Scorpion and its organs have been used to cure epilepsy, rheumatism, and male impotency since medieval times. Scorpion venom which contains different compounds like enzyme and non-enzyme proteins, ions, free amino acids, and other organic inorganic substances have been reported to posses antiproliferative, cytotoxic, apoptogenic, and immunosuppressive properties. We for the first time report the apoptotic and antiproliferative effects of scorpion venom (Odontobuthus doriae) in human neuroblastoma cells. After exposure of cells to medium containing varying concentrations of venom (10, 25, 50, 100, and 200 μg/ml), cell viability decreased to 90.75, 75.53, 55.52, 37.85, and 14.30%, respectively, after 24 h. Cells expressed morphological changes like swelling, inhibition of neurite outgrowth, irregular shape, aggregation, rupture of membrane, and release of cytosolic contents after treatment with venom. Lactate dehydrogenase (LDH) level increased in 50 and 100 μg/ml as compared to control, but there was no significant increase in LDH level at a dose of 10 and 20 μg/ml. Two concentrations viz. 50 and 100 μ/ml were selected because of the profound effect of these concentrations on the cellular health and population. Treatment with these two concentrations induced reactive nitrogen intermediates and depolarization in mitochondria. While caspase-3 activity increased in a concentration-dependent manner, only 50 μg/ml was able to fragment DNA. It was interesting to note that at higher dose, i.e., 100 μg/ml, the cells were killed, supposedly by acute necrosis. DNA synthesis evidenced by bromodeoxyuridine (BrdU) incorporation was inhibited in a concentration-dependent manner. The cells without treatment incorporated BrdU with high affinity confirming their cancerous nature whereas very less incorporation was noticed in treated cells. Our results show apoptotic and antiproliferative potential of scorpion venom (O. doriae) in human neuroblastoma cells. These properties

  8. DNA Binding Region” of BRCA1 Affects Genetic Stability through modulating the Intra-S-Phase Checkpoint

    PubMed Central

    Masuda, Takaaki; Xu, Xiaoling; Dimitriadis, Emilios K.; Lahusen, Tyler; Deng, Chu-Xia

    2016-01-01

    The breast cancer associated gene 1 (BRCA1) contains 3 domains: an N-terminal RING domain with ubiquitin E3 ligase activity, C-terminal BRCT protein interaction domain and a central region. RING and BRCT domains are well characterized, yet the function of the central region remains unclear. In this study, we identified an essential DNA binding region (DBR: 421-701 amino acids) within the central region of human BRCA1, and found that BRCA1 brings DNA together and preferably binds to splayed-arm DNA in a sequence-independent manner. To investigate the biological role of the DBR, we generated mouse ES cells, which lack the DBR (ΔDBR) by using the TALEN method. The ΔDBR cells exhibited decreased survival as compared to the wild type (WT) cells treated with a PARP inhibitor, however they have an intact ability to conduct DNA repair mediated by homologous recombination (HR). The ΔDBR cells continued to incorporate more EdU in the presence of hydroxyurea (HU), which causes replication stress and exhibited reduced viability than the WT cells. Moreover, phosphorylation of CHK1, which regulates the intra-S phase checkpoint, was moderately decreased in ΔDBR cells. These data suggest that DNA binding by BRCA1 affects the stability of DNA replication folks, resulting in weakened intra-S-phase checkpoint control in the ΔDBR cells. The ΔDBR cells also exhibited an increased number of abnormal chromosome structures as compared with WT cells, indicating that the ΔDBR cells have increased genetic instability. Thus, we demonstrated that the DBR of BRCA1 modulates genetic stability through the intra-S-phase checkpoint activated by replication stress. PMID:26884712

  9. SERBP1 affects homologous recombination-mediated DNA repair by regulation of CtIP translation during S phase

    PubMed Central

    Ahn, Jang-Won; Kim, Sunjik; Na, Wooju; Baek, Su-Jin; Kim, Jeong-Hwan; Min, Keehong; Yeom, Jeonghun; Kwak, Hoyun; Jeong, Sunjoo; Lee, Cheolju; Kim, Seon-Young; Choi, Cheol Yong

    2015-01-01

    DNA double-strand breaks (DSBs) are the most severe type of DNA damage and are primarily repaired by non-homologous end joining (NHEJ) and homologous recombination (HR) in the G1 and S/G2 phase, respectively. Although CtBP-interacting protein (CtIP) is crucial in DNA end resection during HR following DSBs, little is known about how CtIP levels increase in an S phase-specific manner. Here, we show that Serpine mRNA binding protein 1 (SERBP1) regulates CtIP expression at the translational level in S phase. In response to camptothecin-mediated DNA DSBs, CHK1 and RPA2 phosphorylation, which are hallmarks of HR activation, was abrogated in SERBP1-depleted cells. We identified CtIP mRNA as a binding target of SERBP1 using RNA immunoprecipitation-coupled RNA sequencing, and confirmed SERBP1 binding to CtIP mRNA in S phase. SERBP1 depletion resulted in reduction of polysome-associated CtIP mRNA and concomitant loss of CtIP expression in S phase. These effects were reversed by reconstituting cells with wild-type SERBP1, but not by SERBP1 ΔRGG, an RNA binding defective mutant, suggesting regulation of CtIP translation by SERBP1 association with CtIP mRNA. These results indicate that SERBP1 affects HR-mediated DNA repair in response to DNA DSBs by regulation of CtIP translation in S phase. PMID:26068472

  10. Psoralen covalently linked to oligodeoxyribonucleotides: synthesis, sequence specific recognition of DNA and photo-cross-linking to pyrimidine residues of DNA.

    PubMed Central

    Pieles, U; Englisch, U

    1989-01-01

    The psoralen derivative 4,5',8-trimethylpsoralen was covalently linked to the 5'-terminus of an 18mer oligodeoxyribonucleotide in the course of solid phase synthesis using phosphoroamidite chemistry. The derivative was introduced as a phosphitylation compound in the last cycle of the oligomer synthesis. The reagent was prepared by 4'-chloromethylation of 4,5',8-trimethylpsoralen, introduction of a linker by ethanediol and phosphitylation with chloro-[(beta-cyanoethoxy)-N,N-diisopropylamino]-phosphine. After oxydation and deprotection the 5'-psoralen modified oligodeoxyribonucleotide was characterised by HPLC. Hybridisation of the psoralen-modified oligomer to a complementary single stranded 21mer followed by irradiation at 350 nm revealed a photo-cross-linked double-stranded DNA fragment analysed on denaturing polyacrylamide gels. The cross-link could be reversed upon irradiation at 254nm. Images PMID:2911468

  11. Psoralen covalently linked to oligodeoxyribonucleotides: synthesis, sequence specific recognition of DNA and photo-cross-linking to pyrimidine residues of DNA.

    PubMed

    Pieles, U; Englisch, U

    1989-01-11

    The psoralen derivative 4,5',8-trimethylpsoralen was covalently linked to the 5'-terminus of an 18mer oligodeoxyribonucleotide in the course of solid phase synthesis using phosphoroamidite chemistry. The derivative was introduced as a phosphitylation compound in the last cycle of the oligomer synthesis. The reagent was prepared by 4'-chloromethylation of 4,5',8-trimethylpsoralen, introduction of a linker by ethanediol and phosphitylation with chloro-[(beta-cyanoethoxy)-N,N-diisopropylamino]-phosphine. After oxydation and deprotection the 5'-psoralen modified oligodeoxyribonucleotide was characterised by HPLC. Hybridisation of the psoralen-modified oligomer to a complementary single stranded 21mer followed by irradiation at 350 nm revealed a photo-cross-linked double-stranded DNA fragment analysed on denaturing polyacrylamide gels. The cross-link could be reversed upon irradiation at 254nm. PMID:2911468

  12. Folate supplementation differently affects uracil content in DNA in the mouse colon and liver

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High folate intake may increase the risk of cancer, especially in the elderly. The present study examined the effects of ageing and dietary folate on uracil misincorporation into DNA, which has a mutagenic effect, in the mouse colon and liver. Old (18 months; n 42) and young (4 months; n 42) male C5...

  13. Do DNA barcoding delimitation methods affect our view of stream biodiversity?

    EPA Science Inventory

    How we delimit molecular operational taxonomic units (MOTUs) is an important aspect in the use of DNA barcoding for bioassessment. Four delimitation methods were examined to gain an understanding of their relative strengths at organizing data from 5300 specimens collected during ...

  14. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  15. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

    PubMed

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

    2015-01-01

    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  16. Interacting RNA polymerase motors on a DNA track: effects of traffic congestion and intrinsic noise on RNA synthesis.

    PubMed

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions. PMID:18351890

  17. Sperm Chromatin Immaturity Observed in Short Abstinence Ejaculates Affects DNA Integrity and Longevity In Vitro

    PubMed Central

    Salian, Sujith Raj; Kumar, Dayanidhi; Singh, Vikram Jeet; D’Souza, Fiona; Kalthur, Guruprasad; Kamath, Asha; Adiga, Satish Kumar

    2016-01-01

    Background The influence of ejaculatory abstinence (EA) on semen parameters and subsequent reproductive outcome is still debatable; hence understanding the impact of EA on sperm structural and functional integrity may provide a valuable information on predicting successful clinical outcome. Objective To understand the influence of EA on sperm chromatin maturity, integrity, longevity and global methylation status. Methods This experimental prospective study included 76 ejaculates from 19 healthy volunteers who provided ejaculates after observing 1, 3, 5 and 7 days of abstinence. Sperm chromatin maturity, DNA integrity and global methylation status were assessed in the neat ejaculate. Sperm motility, DNA integrity and longevity were assessed in the processed fraction of the fresh and frozen-thawed ejaculates to determine their association with the length of EA. Results Spermatozoa from 1 day ejaculatory abstinence (EA-1) displayed significantly higher level of sperm chromatin immaturity in comparison to EA-3 (P < 0.05) and EA-5 (P < 0.01) whereas; the number of 5-methyl cytosine immunostained spermatozoa did not vary significantly across groups. On the other hand, in vitro incubation of processed ejaculate from EA-1 resulted in approximately 20 and 40 fold increase in the DNA fragmented spermatozoa at the end of 6 and 24h respectively (P < 0.01–0.001). Conclusion Use of short-term EA for therapeutic fertilization would be a clinically valuable strategy to improve the DNA quality. However, use of such spermatozoa after prolonged incubation in vitro should be avoided as it can carry a substantial risk of transmitting DNA fragmentation to the oocytes. PMID:27043437

  18. Suberoylanilide Hydroxyamic Acid Modification of Chromatin Architecture Affects DNA Break Formation and Repair

    SciTech Connect

    Singh, Sheetal; Le Hongan; Shih, S.-J.; Ho, Bay; Vaughan, Andrew T.

    2010-02-01

    Purpose: Chromatin-modifying compounds that inhibit the activity of histone deacetylases have shown potency as radiosensitizers, but the action of these drugs at a molecular level is not clear. Here we investigated the effect of suberoylanilide hydroxyamic acid (SAHA) on DNA breaks and their repair and induction of rearrangements. Methods and Materials: The effect of SAHA on both clonogenic survival and repair was assessed using cell lines SCC-25, MCF7, and TK6. In order to study unique DNA double-strand breaks, anti-CD95 antibody was employed to introduce a DNA double-strand break at a known location within the 11q23 region. The effects of SAHA on DNA cleavage and rearrangements were analyzed by ligation-mediated PCR and inverse PCR, respectively. Results: SAHA acts as radiosensitizer at 1 {mu}M, with dose enhancement factors (DEFs) at 10% survival of: SCC-25 - 1.24 +- 0.05; MCF7 - 1.16 +- 0.09 and TK6 - 1.17 +- 0.05, and it reduced the capacity of SCC-25 cells to repair radiation induced lesions. Additionally, SAHA treatment diffused site-specific fragmentation over at least 1 kbp in TK6 cells. Chromosomal rearrangements produced in TK6 cells exposed to SAHA showed a reduction in microhomology at the breakpoint between 11q23 and partner chromosomes. Conclusions: SAHA shows efficacy as a radiosensitizer at clinically obtainable levels. In its presence, targeted DNA strand breaks occur over an expanded region, indicating increased chromatin access. The rejoining of such breaks is degraded by SAHA when measured as rearrangements at the molecular level and rejoining that contributes to cell survival.

  19. Chemical synthesis of human papillomavirus type 16 E7 oncoprotein: autonomous protein domains for induction of cellular DNA synthesis and for trans activation.

    PubMed

    Rawls, J A; Pusztai, R; Green, M

    1990-12-01

    The human papillomavirus type 16 E7 protein belongs to a family of nuclear oncoproteins that share amino acid sequences and functional homology. To localize biochemical activities associated with E7, we chemically synthesized the full-length 98-amino-acid polypeptide and several deletion mutant peptides. We show that the E7 polypeptide is biologically active and possesses at least two functional domains; the first induces cellular DNA synthesis in quiescent rodent cells, and the second trans activates the adenovirus E1A-inducible early E2 promoter and binds zinc. Further, each domain is autonomous and can function on separate peptides. DNA synthesis induction activity maps within the N-terminal portion of the molecule, which contains sequences related to adenovirus E1A conserved domains 1 and 2 required for cell transformation and binding of the retinoblastoma gene product. trans-Activation and Zn-binding activities map within the C-terminal portion of the molecule, a region which contains Cys-X-X-Cys motifs. trans Activation does not require protein synthesis, implying a mechanism that involves interaction with a preexisting cellular factor(s). E7 trans activates the adenovirus E2 promoter but not other E1A-inducible viral promoters, suggesting the possibility that E7 trans activation involves interaction, directly or indirectly, with cellular transcription factor E2F. PMID:2173783

  20. Stimulators and inhibitors of lymphocyte DNA synthesis in supernatants from human lymphoid cell lines.

    PubMed

    Vesole, D H; Goust, J M; Fett, J W; Fudenberg, H H

    1979-09-01

    Some T and B lymphoid cell lines (LCL) were found to secrete into their supernatants a substance able to stimulate lymphocyte proliferation. This substance produced an increase in [3H]thymidine uptake by mononuclear cells when added to unstimulated cultures (mitogenic effect) or when added to cultures stimulated with phytohemagglutinin (PHA) or pokeweed mitogen (PWM) (potentiating effect). When complete supernatants were used, the potentiating effect was sometimes masked by an inhibitor of DNA synthesis. Fractionation on Sephadex G-100 separated these two activities. The stimulatory substance eluted at a m.w. range of 15,000 to 30,000, and the inhibitor eluted with the albumin peak. B cells with or without monocytes were the most sensitive to the mitogenic effect, whereas T cells were unaffected. Responses to PHA and PWM were potentiated when T cells were present, but the maximum effect was observed when the proportion of T cells was less than 50%. The stimulatory material may be similar to lymphocyte mitogenic factor and may function as a T cell-replacing factor in B cell stimulation. PMID:313950

  1. The mechanism of inhibition of endothelin-1-induced stimulation of DNA synthesis in rat articular chondrocytes.

    PubMed

    Khatib, A M; Ribault, D; Quintero, M; Barbara, A; Fiet, J; Mitrovic, D R

    1997-09-19

    Endothelin-1 (ET-1) is a potent mitogen for rat articular chondrocytes (AC) in short term culture (24 h). Prolonged incubation (72 h) of AC with ET-1 resulted in inhibition of [3H]thymidine incorporation. This inhibition seemed to be mediated by prostaglandins (PGs) released in response to ET-1, since indomethacin (INDO) enhanced ET-1-induced [3H]thymidine incorporation. In agreement with this hypothesis, exogenous prostaglandins (PGE2, PGF2alpha and TxB2) blocked all basal, ET-1-induced and ET-1 induced-INDO-enhanced [3H]thymidine incorporation and ET-1 stimulated PGE2 release in a time and concentration-dependent manner. INDO also blocked cGMP production and 6-anilino-5,8-quinolinedione, a relatively specific inhibitor of cGMP formation, enhanced the stimulation and suppressed the inhibition of ET-1-induced DNA synthesis. In addition, 8-bromo-cGMP, an analogue of cGMP, blocked at all time periods studied, both basal and ET-1-induced incorporations of [3H]thymidine. Thus, PGs produced in response to ET-1 counteract the ET-1-induced stimulation of [3H]thymidine incorporation into rat AC by increasing cGMP production. PMID:9324043

  2. Candida famata (Debaryomyces hansenii) DNA sequences containing genes involved in riboflavin synthesis.

    PubMed

    Voronovsky, Andriy Y; Abbas, Charles A; Dmytruk, Kostyantyn V; Ishchuk, Olena P; Kshanovska, Barbara V; Sybirna, Kateryna A; Gaillardin, Claude; Sibirny, Andriy A

    2004-11-01

    Previously cloned Candida famata (Debaryomyces hansenii) strain VKM Y-9 genomic DNA fragments containing genes RIB1 (codes for GTP cyclohydrolase II), RIB2 (encodes specific reductase), RIB5 (codes for dimethylribityllumazine synthase), RIB6 (encodes dihydroxybutanone phosphate synthase) and RIB7 (codes for riboflavin synthase) were sequenced. The derived amino acid sequences of C. famata RIB genes showed extensive homology to the corresponding sequences of riboflavin synthesis enzymes of other yeast species. The highest identity was observed to homologues of D. hansenii CBS767, as C. famata is the anamorph of this hemiascomycetous yeast. The D. hansenii CBS767 RIB3 gene encoding specific deaminase was cloned. This gene successfully complemented riboflavin auxotrophy of the rib3 mutant of flavinogenic yeast, Pichia guilliermondii. Putative iron-responsive elements (potential sites for binding of the transcription factors Fep1p or Aft1p and Aft2p) were found in the upstream regions of some C. famata and D. hansenii RIB genes. The sequences of C. famata RIB genes have been submitted to the EMBL data library under Accession Nos AJ810169-AJ810173. PMID:15543522

  3. Regulation of translesion DNA synthesis: posttranslational modification of lysine residues in key proteins

    PubMed Central

    McIntyre, Justyna; Woodgate, Roger

    2015-01-01

    Posttranslational modification of proteins often controls various aspects of their cellular function. Indeed, over the past decade or so, it has been discovered that posttranslational modification of lysine residues plays a major role in regulating translesion DNA synthesis (TLS) and perhaps the most appreciated lysine modification is that of ubiquitination. Much of the recent interest in ubiquitination stems from the fact that proliferating cell nuclear antigen (PCNA) was previously shown to be specifically ubiquitinated at K164 and that such ubiquitination plays a key role in regulating TLS. In addition, TLS polymerases themselves are now known to be ubiquitinated. In the case of human polymerase η, ubiquitination at four lysine residues in its C-terminus appears to regulate its ability to interact with PCNA and modulate TLS. Within the past few years, advances in global proteomic research has revealed that many proteins involved in TLS are, in fact, subject to a previously underappreciated number of lysine modifications. In this review, we will summarize the known lysine modifications of several key proteins involved in TLS; PCNA and Y-family polymerases η, ι, κ and Rev1 and we will discuss the potential regulatory effects of such modification in controlling TLS in vivo. PMID:25743599

  4. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates

    NASA Astrophysics Data System (ADS)

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

  5. Dihydrochelerythrine and its derivatives: Synthesis and their application as potential G-quadruplex DNA stabilizing agents.

    PubMed

    Malhotra, Rajesh; Rarhi, Chhanda; Diveshkumar, K V; Barik, Rajib; D'cunha, Ruhee; Dhar, Pranab; Kundu, Mrinalkanti; Chattopadhyay, Subrata; Roy, Subho; Basu, Sourav; Pradeepkumar, P I; Hajra, Saumen

    2016-07-01

    A convenient route was envisaged toward the synthesis of dihydrochelerythrine (DHCHL), 4 by intramolecular Suzuki coupling of 2-bromo-N-(2-bromobenzyl)-naphthalen-1-amine derivative 5 via in situ generated arylborane. This compound was converted to (±)-6-acetonyldihydrochelerythrine (ADC), 3 which was then resolved by chiral prep-HPLC. Efficiency of DHCHL for the stabilization of promoter quadruplex DNA structures and a comparison study with the parent natural alkaloid chelerythrine (CHL), 1 was performed. A thorough investigation was carried out to assess the quadruplex binding affinity by using various biophysical and biochemical studies and the binding mode was explained by using molecular modeling and dynamics studies. Results clearly indicate that DHCHL is a strong G-quadruplex stabilizer with affinity similar to that of the parent alkaloid CHL. Compounds ADC and DHCHL were also screened against different human cancer cell lines. Among the cancer cells, (±)-ADC and its enantiomers showed varied (15-48%) inhibition against human colorectal cell line HCT116 and breast cancer cell line MDA-MB-231 albeit low enantio-specificity in the inhibitory effect; whereas DHCHL showed 30% inhibition against A431 cell line only, suggesting the compounds are indeed cancer tissue specific. PMID:27234888

  6. Synthesis, spectroscopic characterization, biological screenings, DNA binding study and POM analyses of transition metal carboxylates.

    PubMed

    Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman

    2015-04-01

    This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out. PMID:25646895

  7. DNA interstrand crosslinking agents: synthesis, DNA interactions, and cytotoxicity of dimeric achiral seco-amino-CBI and conjugates of achiral seco-amino-CBI with pyrrolobenzodiazepine (PBD).

    PubMed

    Purnell, Bethany; Sato, Atsushi; O'kelley, Amanda; Price, Carly; Summerville, Kaitlin; Hudson, Stephen; O'hare, Caroline; Kiakos, Konstantinos; Asao, Tetsuji; Lee, Moses; Hartley, John A

    2006-11-01

    The design and synthesis of three novel bisalkylating agents derived from the achiral seco-duocarmycin or CC-1065 analogs and pyrrolobenzodiazepines (PBDs) are described: achiral seco-CBI (cyclopropanebenz[e]indoline)-PBD 11, achiral seco-CI-PBD 12, and achiral seco-CBI dimer 13. Compounds 11 and 12 demonstrated enhanced cytotoxicity over the monomer counterparts against the growth of P815 murine mastocytoma cells in culture. Conjugate 11 was found to covalently react with adenine-N3 positions within the minor groove at AT-rich sequences and to produce DNA interstrand crosslinks. Both compounds were found to induce apoptosis in P815 cells. Due to its poor water solubility, dimer 13 did not give any appreciable DNA binding or cytotoxicity. PMID:16919946

  8. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis.

    PubMed

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia; Altmannova, Veronika; Sebesta, Marek; Pacesa, Martin; Fugger, Kasper; Sorensen, Claus Storgaard; Lee, Marietta Y W T; Haracska, Lajos; Krejci, Lumir

    2016-04-20

    Successful and accurate completion of the replication of damage-containing DNA requires mainly recombination and RAD18-dependent DNA damage tolerance pathways. RAD18 governs at least two distinct mechanisms: translesion synthesis (TLS) and template switching (TS)-dependent pathways. Whereas TS is mainly error-free, TLS can work in an error-prone manner and, as such, the regulation of these pathways requires tight control to prevent DNA errors and potentially oncogenic transformation and tumorigenesis. In humans, the PCNA-associated recombination inhibitor (PARI) protein has recently been shown to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HRin vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits the extent of HR and represents a new potential target for anticancer therapy. PMID:26792895

  9. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis

    PubMed Central

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia; Altmannova, Veronika; Sebesta, Marek; Pacesa, Martin; Fugger, Kasper; Sorensen, Claus Storgaard; Lee, Marietta Y.W.T.; Haracska, Lajos; Krejci, Lumir

    2016-01-01

    Successful and accurate completion of the replication of damage-containing DNA requires mainly recombination and RAD18-dependent DNA damage tolerance pathways. RAD18 governs at least two distinct mechanisms: translesion synthesis (TLS) and template switching (TS)-dependent pathways. Whereas TS is mainly error-free, TLS can work in an error-prone manner and, as such, the regulation of these pathways requires tight control to prevent DNA errors and potentially oncogenic transformation and tumorigenesis. In humans, the PCNA-associated recombination inhibitor (PARI) protein has recently been shown to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HR in vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits the extent of HR and represents a new potential target for anticancer therapy. PMID:26792895

  10. DNA Methylation of Lipid-Related Genes Affects Blood Lipid Levels

    PubMed Central

    Pfeiffer, Liliane; Wahl, Simone; Pilling, Luke C.; Reischl, Eva; Sandling, Johanna K.; Kunze, Sonja; Holdt, Lesca M.; Kretschmer, Anja; Schramm, Katharina; Adamski, Jerzy; Klopp, Norman; Illig, Thomas; Hedman, Åsa K.; Roden, Michael; Hernandez, Dena G.; Singleton, Andrew B.; Thasler, Wolfgang E.; Grallert, Harald; Gieger, Christian; Herder, Christian; Teupser, Daniel; Meisinger, Christa; Spector, Timothy D.; Kronenberg, Florian; Prokisch, Holger; Melzer, David; Peters, Annette; Deloukas, Panos; Ferrucci, Luigi; Waldenberger, Melanie

    2016-01-01

    Background Epigenetic mechanisms might be involved in the regulation of interindividual lipid level variability and thus may contribute to the cardiovascular risk profile. The aim of this study was to investigate the association between genome-wide DNA methylation and blood lipid levels high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, triglycerides, and total cholesterol. Observed DNA methylation changes were also further analyzed to examine their relationship with previous hospitalized myocardial infarction. Methods and Results Genome-wide DNA methylation patterns were determined in whole blood samples of 1776 subjects of the Cooperative Health Research in the Region of Augsburg F4 cohort using the Infinium HumanMethylation450 BeadChip (Illumina). Ten novel lipid-related CpG sites annotated to various genes including ABCG1, MIR33B/SREBF1, and TNIP1 were identified. CpG cg06500161, located in ABCG1, was associated in opposite directions with both high-density lipoprotein cholesterol (β coefficient=−0.049; P=8.26E-17) and triglyceride levels (β=0.070; P=1.21E-27). Eight associations were confirmed by replication in the Cooperative Health Research in the Region of Augsburg F3 study (n=499) and in the Invecchiare in Chianti, Aging in the Chianti Area study (n=472). Associations between triglyceride levels and SREBF1 and ABCG1 were also found in adipose tissue of the Multiple Tissue Human Expression Resource cohort (n=634). Expression analysis revealed an association between ABCG1 methylation and lipid levels that might be partly mediated by ABCG1 expression. DNA methylation of ABCG1 might also play a role in previous hospitalized myocardial infarction (odds ratio, 1.15; 95% confidence interval=1.06–1.25). Conclusions Epigenetic modifications of the newly identified loci might regulate disturbed blood lipid levels and thus contribute to the development of complex lipid-related diseases. PMID:25583993

  11. Glycation of Ribonuclease A affects its enzymatic activity and DNA binding ability.

    PubMed

    Dinda, Amit Kumar; Tripathy, Debi Ranjan; Dasgupta, Swagata

    2015-11-01

    Prolonged non-enzymatic glycation of proteins results in the formation of advanced glycation end products (AGEs) that cause several diseases. The glycation of Ribonuclease A (RNase A) at pH 7.4 and 37 °C with ribose, glucose and fructose has been monitored by UV-vis, fluorescence, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and matrix assisted laser desorption ionization spectroscopy-time of flight (MALDI-TOF) methods. The enzymatic activity and DNA binding ability of glycated RNase A was also investigated by an agarose gel-based assay. A precipitation assay examined the ribonucleolytic activity of the glycated enzyme. An increase in incubation time resulted in the formation of high molecular weight AGEs with a decrease in ribonucleolytic activity. Ribose exhibits the highest potency as a glycating agent and showed the greatest reduction in the ribonucleolytic activity of the enzyme. Interestingly, glycated RNase A was unable to bind with the ribonuclease inhibitor (RI) and DNA. The glycated form of the protein was also found to be ineffective in DNA melting unlike native RNase A. PMID:26365067

  12. Factors affecting flow cytometric detection of apoptotic nuclei by DNA analysis

    SciTech Connect

    Elstein, K.H.; Thomas, D.J.; Zucker, R.M.

    1995-10-01

    Apoptotic thymocyte nuclei normally appear on a flow cytometric DNA histogram as a subdiploid peak. We observed that addition of a specific RNase A preparation to the detergent-based lysing buffer increased the fluorescence of toxicant-induced apoptotic nuclei to the level of untreated diploid nuclei. The chelating agent EDTA partially inhibited the RNase effect, suggesting contaminating divalent cations may have been involved. Moreover, spectrofluorometric analysis revealed that addition of RNase or divalent cations decreased the amount of DNA present in the lysate. This suggested that the upscale fluorescence shift was due to a decrease in the ability of the lysing buffer to extract DNA, possibly as a result of cation-induced chromatin condensation, rather than increased accessibility of fluorochrome binding sites due to apoptotic degeneration. Moreover, during a 16-h culture, we observed a similar, but time-dependent, upscale shift in the fluorescence of thymocytes undergoing apoptosis either spontaneously or as a result of exposure to 1 {mu}M tributyltin methoxide (TBT), 2% ethanol, 2% methanol, or 1 {mu}M dexamethasone phosphate (DEX). This commonality of effect suggests that a similar magnitude of chromatin reorganization occurs in apoptotic cells in prolonged culture regardless of the method of apoptotic induction. These findings should alert investigators to potential inaccuracies in the flow cytometric quantitation of apoptosis in vitro systems employing prolonged toxicant exposures or complex lysing cocktails that may contain active contaminants. 37 refs., 3 figs., 1 tab.

  13. Cisplatin-induced DNA damage activates replication checkpoint signaling components that differentially affect tumor cell survival.

    PubMed

    Wagner, Jill M; Karnitz, Larry M

    2009-07-01

    Cisplatin and other platinating agents are some of the most widely used chemotherapy agents. These drugs exert their antiproliferative effects by creating intrastrand and interstrand DNA cross-links, which block DNA replication. The cross-links mobilize signaling and repair pathways, including the Rad9-Hus1-Rad1-ATR-Chk1 pathway, a pathway that helps tumor cells survive the DNA damage inflicted by many chemotherapy agents. Here we show that Rad9 and ATR play critical roles in helping tumor cells survive cisplatin treatment. However, depleting Chk1 with small interfering RNA or inhibiting Chk1 with 3-(carbamoylamino)-5-(3-fluorophenyl)-N-(3-piperidyl)thiophene-2-carboxamide (AZD7762) did not sensitize these cells to cisplatin, oxaliplatin, or carboplatin. Moreover, when Rad18, Rad51, BRCA1, BRCA2, or FancD2 was disabled, Chk1 depletion did not further sensitize the cells to cisplatin. In fact, Chk1 depletion reversed the sensitivity seen when Rad18 was disabled. Collectively, these studies suggest that the pharmacological manipulation of Chk1 may not be an effective strategy to sensitize tumors to platinating agents. PMID:19403702

  14. Exploration of cellular DNA lesion, DNA-binding and biocidal ordeal of novel curcumin based Knoevenagel Schiff base complexes incorporating tryptophan: Synthesis and structural validation

    NASA Astrophysics Data System (ADS)

    Chandrasekar, Thiravidamani; Raman, Natarajan

    2016-07-01

    A few novel Schiff base transition metal complexes of general formula [MLCl] (where, L = Schiff base, obtained by the condensation reaction of Knoevenagel condensate of curcumin, L-tryptophan and M = Cu(II), Ni(II), Co(II), and Zn(II)), were prepared by stencil synthesis. They were typified using UV-vis, IR, EPR spectral techniques, micro analytical techniques, magnetic susceptibility and molar conductivity. Geometry of the metal complexes was examined and recognized as square planar. DNA binding and viscosity studies revealed that the metal(II) complexes powerfully bound via an intercalation mechanism with the calf thymus DNA. Gel-electrophoresis technique was used to investigate the DNA cleavage competence of the complexes and they establish to approve the cleavage of pBR322 DNA in presence of oxidant H2O2. This outcome inferred that the synthesized complexes showed better nuclease activity. Moreover, the complexes were monitored for antimicrobial activities. The results exposed that the synthesized compounds were forceful against all the microbes under exploration.

  15. Exploration of cellular DNA lesion, DNA-binding and biocidal ordeal of novel curcumin based Knoevenagel Schiff base complexes incorporating tryptophan: Synthesis and structural validation

    NASA Astrophysics Data System (ADS)

    Chandrasekar, Thiravidamani; Raman, Natarajan

    2016-07-01

    A few novel Schiff base transition metal complexes of general formula [MLCl] (where, L = Schiff base, obtained by the condensation reaction of Knoevenagel condensate of curcumin, L-tryptophan and M = Cu(II), Ni(II), Co(II), and Zn(II)), were prepared by stencil synthesis. They were typified using UV-vis, IR, EPR spectral techniques, micro analytical techniques, magnetic susceptibility and molar conductivity. Geometry of the metal complexes was examined and recognized as square planar. DNA binding and viscosity studies revealed that the metal(II) complexes powerfully bound via an intercalation mechanism with the calf thymus DNA. Gel-electrophoresis technique was used to investigate the DNA cleavage competence of the complexes and they establish to approve the cleavage of pBR322 DNA in presence of oxidant H2O2. This outcome inferred that the synthesized complexes showed better nuclease activity. Moreover, the complexes were monitored for antimicrobial activities. The results exposed that the synthesized compounds were forceful against all the microbes under exploration.

  16. Mutations for Worse or Better: Low-Fidelity DNA Synthesis by SOS DNA Polymerase V Is a Tightly Regulated Double-Edged Sword.

    PubMed

    Jaszczur, Malgorzata; Bertram, Jeffrey G; Robinson, Andrew; van Oijen, Antoine M; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

    2016-04-26

    1953, the year of Watson and Crick, bore witness to a less acclaimed yet highly influential discovery. Jean Weigle demonstrated that upon infection of Escherichia coli, λ phage deactivated by UV radiation, and thus unable to form progeny, could be reactivated by irradiation of the bacterial host. Evelyn Witkin and Miroslav Radman later revealed the presence of the SOS regulon. The more than 40 regulon genes are repressed by LexA protein and induced by the coproteolytic cleavage of LexA, catalyzed by RecA protein bound to single-stranded DNA, the RecA* nucleoprotein filament. Several SOS-induced proteins are engaged in repairing both cellular and extracellular damaged DNA. There's no "free lunch", however, because error-free repair is accompanied by error-prone translesion DNA synthesis (TLS), involving E. coli DNA polymerase V (UmuD'2C) and RecA*. This review describes the biochemical mechanisms of pol V-mediated TLS. pol V is active only as a mutasomal complex, pol V Mut = UmuD'2C-RecA-ATP. RecA* donates a single RecA subunit to pol V. We highlight three recent insights. (1) pol V Mut has an intrinsic DNA-dependent ATPase activity that governs polymerase binding and dissociation from DNA. (2) Active and inactive states of pol V Mut are determined at least in part by the distinct interactions between RecA and UmuC. (3) pol V is activated by RecA*, not at a blocked replisome, but at the inner cell membrane. PMID:27043933

  17. Synthesis of eight-arm, branched oligonucleotide hybrids and studies on the limits of DNA-driven assembly.

    PubMed

    Schwenger, Alexander; Gerlach, Claudia; Griesser, Helmut; Richert, Clemens

    2014-12-01

    Oligonucleotide hybrids with organic cores as rigid branching elements and four or six CG dimer strands have been shown to form porous materials from dilute aqueous solution. In order to explore the limits of this form of DNA-driven assembly, we prepared hybrids with three or eight DNA arms via solution-phase syntheses, using H-phosphonates of protected dinucleoside phosphates. This included the synthesis of (CG)8TREA, where TREA stands for the tetrakis[4-(resorcin-5-ylethynyl)phenyl]adamantane core. The ability of the new compounds to assemble in a DNA-driven fashion was studied by UV-melting analysis and NMR, using hybrids with self-complementary CG zipper arms or non-self-complementary TC dimer arms. The three-arm hybrid failed to form a material under conditions where four-arm hybrids did so. Further, the assembly of TREA hybrids appears to be dominated by hydrophobic interactions, not base pairing of the DNA arms. These results help in the design of materials forming by multivalent DNA-DNA interactions. PMID:25407332

  18. Effects of 8-halo-7-deaza-2'-deoxyguanosine triphosphate on DNA synthesis by DNA polymerases and cell proliferation.

    PubMed

    Yin, Yizhen; Sasaki, Shigeki; Taniguchi, Yosuke

    2016-08-15

    8-OxodG (8-oxo-2'-deoxyguanosine) is representative of nucleoside damage and shows a genotoxicity. To significantly reveal the contributions of 7-NH and C8-oxygen to the mutagenic effect of 8-oxodG by DNA polymerases, we evaluated the effects of the 8-halo-7-deaza-dG (8-halogenated 7-deaza-2'-deoxyguanosine) derivatives by DNA polymerases. 8-Halo-7-deaza-dGTPs were poorly incorporated by both KF(exo(-)) and human DNA polymerase β opposite dC or dA into the template DNA. Furthermore, it was found that KF(exo(-)) was very sensitive to the introduction of the C8-halogen, while polymerase β can accommodate the C8-halogen resulting in an efficient dCTP insertion opposite the 8-halo-7-deaza-dG in the template DNA. These results indicate that strong hydrogen bonding between 7-NH in the 8-oxo-G nucleobase and 1-N in the adenine at the active site of the DNA polymerase is required for the mutagenic effects. Whereas, I-deaza-dGTP shows an antiproliferative effect for the HeLa cells, suggesting that it could become a candidate as a new antitumor agent. PMID:27372838

  19. Effects of cryopreservation on sperm viability, synthesis of reactive oxygen species, and DNA damage of bovine sperm.

    PubMed

    Gürler, H; Malama, E; Heppelmann, M; Calisici, O; Leiding, C; Kastelic, J P; Bollwein, H

    2016-07-15

    The objective was to examine if there are relationships between alterations in sperm viability, reactive oxygen species (ROS) synthesis, and DNA integrity induced by cryopreservation of bovine sperm. Four ejaculates were collected from each of six bulls. Each ejaculate was diluted and divided into two aliquots; one was incubated for 24 hours at 37 °C, and the other frozen, thawed, and incubated for 24 hours at 37 °C. Analyses of quality of sperm were performed after 0, 3, 6, 12, and 24 hours of incubation. Progressive motile sperm was determined with computer assisted sperm analysis. Percentages of plasma membrane- and acrosome-intact sperm, sperm with a high mitochondrial membrane potential, sperm showing a high degree of DNA fragmentation (%DFI), and their reactive oxygen species content were assessed with dichlorofluorescein-diacetate, dihydrorhodamine, diaminofluorescein diacetate, and mitochondrial superoxide indicator using flow cytometry. Although all other sperm parameters showed alterations (P < 0.05) during the 24-hour incubation time, %DFI stayed constant (P > 0.05, 0.91 ± 0.23) in nonfrozen sperm. Cryopreservation induced changes of all sperm parameters (P < 0.05). In contrast to all other sperm parameters, dichlorofluorescein-diacetate-fluoroescence indicating the synthesis of H2O2 showed a similar exponential rise (P < 0.05) like the %DFI values in frozen sperm. In conclusion, changes of DNA integrity in frozen sperm seem to be related to synthesis of H2O2 but not to sperm viability and synthesis of other reactive oxygen species. PMID:27039074

  20. CTP:phosphocholine cytidylyltransferase α (CCTα) and lamins alter nuclear membrane structure without affecting phosphatidylcholine synthesis.

    PubMed

    Gehrig, Karsten; Ridgway, Neale D

    2011-06-01

    CTP:phosphocholine cytidylyltransferase α (CCTα) is a nuclear enzyme that catalyzes the rate-limiting step in the CDP-choline pathway for phosphatidylcholine (PC) synthesis. Lipid activation of CCTα results in its translocation to the nuclear envelope and expansion of an intranuclear membrane network termed the nucleoplasmic reticulum (NR) by a mechanism involving membrane deformation. Nuclear lamins are also required for stability and proliferation of the NR, but whether this unique structure, or the nuclear lamina in general, is required for PC synthesis is not known. To examine this relationship, the nuclear lamina was depleted by RNAi or disrupted by expression of the Hutchinson-Gilford progeria syndrome (HGPS) mutant lamin A (progerin), and the effect on CCTα and choline metabolism was analyzed. siRNA-mediated silencing of lamin A/C or lamin B1 in CHO cells to diminish the NR had no effect on PC synthesis, while double knockdown non-specifically inhibited the pathway. Confirming this minor role in PC synthesis, only 10% of transiently overexpressed choline/ethanolamine phosphotransferase was detected in the NR. In CHO cells, CCTα was nucleoplasmic and co-localized with GFP-progerin in nuclear folds and invaginations; however, HGPS fibroblasts displayed an abnormal distribution of CCTα in the cytoplasm and nuclear envelope that was accompanied by a 2-fold reduction in PC synthesis. In spite of its altered localization, choline-labeling experiments showed that CCT activity was unaffected, and inhibition of PC synthesis was traced to reduced activity of a hemicholinium-sensitive choline transporter. We conclude that CCTα and lamins specifically cooperate to form the NR, but the overall structure of the nuclear envelope has a minimal impact on CCT activity and PC synthesis. PMID:21504799

  1. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  2. Class I HDACs Affect DNA Replication, Repair, and Chromatin Structure: Implications for Cancer Therapy

    PubMed Central

    Stengel, Kristy R.

    2015-01-01

    Abstract Significance: The contribution of epigenetic alterations to cancer development and progression is becoming increasingly clear, prompting the development of epigenetic therapies. Histone deacetylase inhibitors (HDIs) represent one of the first classes of such therapy. Two HDIs, Vorinostat and Romidepsin, are broad-spectrum inhibitors that target multiple histone deacetylases (HDACs) and are FDA approved for the treatment of cutaneous T-cell lymphoma. However, the mechanism of action and the basis for the cancer-selective effects of these inhibitors are still unclear. Recent Advances: While the anti-tumor effects of HDIs have traditionally been attributed to their ability to modify gene expression after the accumulation of histone acetylation, recent studies have identified the effects of HDACs on DNA replication, DNA repair, and genome stability. In addition, the HDIs available in the clinic target multiple HDACs, making it difficult to assign either their anti-tumor effects or their associated toxicities to the inhibition of a single protein. However, recent studies in mouse models provide insights into the tissue-specific functions of individual HDACs and their involvement in mediating the effects of HDI therapy. Critical Issues: Here, we describe how altered replication contributes to the efficacy of HDAC-targeted therapies as well as discuss what knowledge mouse models have provided to our understanding of the specific functions of class I HDACs, their potential involvement in tumorigenesis, and how their disruption may contribute to toxicities associated with HDI treatment. Future Directions: Impairment of DNA replication by HDIs has important therapeutic implications. Future studies should assess how best to exploit these findings for therapeutic gain. Antioxid. Redox Signal. 23, 51–65. PMID:24730655

  3. A High Phosphorus Diet Affects Lipid Metabolism in Rat Liver: A DNA Microarray Analysis

    PubMed Central

    Chun, Sunwoo; Bamba, Takeshi; Suyama, Tatsuya; Ishijima, Tomoko; Fukusaki, Eiichiro; Abe, Keiko; Nakai, Yuji

    2016-01-01

    A high phosphorus (HP) diet causes disorders of renal function, bone metabolism, and vascular function. We previously demonstrated that DNA microarray analysis is an appropriate method to comprehensively evaluate the effects of a HP diet on kidney dysfunction such as calcification, fibrillization, and inflammation. We reported that type IIb sodium-dependent phosphate transporter is significantly up-regulated in this context. In the present study, we performed DNA microarray analysis to investigate the effects of a HP diet on the liver, which plays a pivotal role in energy metabolism. DNA microarray analysis was performed with total RNA isolated from the livers of rats fed a control diet (containing 0.3% phosphorus) or a HP diet (containing 1.2% phosphorus). Gene Ontology analysis of differentially expressed genes (DEGs) revealed that the HP diet induced down-regulation of genes involved in hepatic amino acid catabolism and lipogenesis, while genes related to fatty acid β-oxidation process were up-regulated. Although genes related to fatty acid biosynthesis were down-regulated in HP diet-fed rats, genes important for the elongation and desaturation reactions of omega-3 and -6 fatty acids were up-regulated. Concentrations of hepatic arachidonic acid and eicosapentaenoic acid were increased in HP diet-fed rats. These essential fatty acids activate peroxisome proliferator-activated receptor alpha (PPARα), a transcription factor for fatty acid β-oxidation. Evaluation of the upstream regulators of DEGs using Ingenuity Pathway Analysis indicated that PPARα was activated in the livers of HP diet-fed rats. Furthermore, the serum concentration of fibroblast growth factor 21, a hormone secreted from the liver that promotes fatty acid utilization in adipose tissue as a PPARα target gene, was higher (p = 0.054) in HP diet-fed rats than in control diet-fed rats. These data suggest that a HP diet enhances energy expenditure through the utilization of free fatty acids

  4. Nerve growth factor inhibits the synthesis of a single-stranded DNA binding protein in pheochromocytoma cells (clone PC12).

    PubMed Central

    Biocca, S; Cattaneo, A; Calissano, P

    1984-01-01

    Arrest of mitosis and neurite outgrowth induced by nerve growth factor (NGF) in rat pheochromocytoma cells (clone PC12) is accompanied by a progressive inhibition of the synthesis of a protein that binds to single-stranded but not to double-stranded DNA. Time course experiments show that this inhibition is already apparent after a 2-day incubation with NGF and is maximum (85-95%) upon achievement of complete PC12 cell differentiation. Inhibition of the synthesis of this single-stranded DNA binding protein after 48 hr of incubation with NGF is potentiated by concomitant treatment of PC12 cells with antimitotic drugs acting at different levels of DNA replication. Purification on a preparative scale of this protein and analysis of its major physicochemical properties show that: (i) it constitutes 0.5% of total soluble proteins of naive PC12 cells; (ii) its molecular weight measured by NaDodSO4/PAGE is Mr 34,000 (sucrose gradient centrifugation under nondenaturing conditions yields a sedimentation coefficient s20,w of 8.1 S, indicating that the native protein is an oligomer); (iii) amino acid analysis demonstrates a preponderance of acidic over basic residues, while electrofocusing experiments show that it has an isoelectric point around 8.0; (iv) approximately 15% of the protein is phosphorylated in vivo. It is postulated that control of the synthesis of this protein is connected with activation of a differentiative program triggered by NGF in the PC12 neoplastic cell line at some step(s) of DNA activity. Images PMID:6585787

  5. Synthesis of bisphosphonate derivatives of ATP by T4 DNA ligase, ubiquitin activating enzyme (E1) and other ligases.

    PubMed

    Günther Sillero, María A; de Diego, Anabel; Pérez-Zúñiga, Francisco J; Sillero, Antonio

    2008-05-15

    T4 DNA ligase and the ubiquitin activating enzyme (E1), catalyze the synthesis of ATP beta,gamma-bisphosphonate derivatives. Concerning T4 DNA ligase: (i) etidronate (pC(OH)(CH(3))p) displaced the AMP moiety of the complex E-AMP in a concentration dependent manner; (ii) the K(m) values and the rate of synthesis k(cat) (s(-1)), determined for the following compounds were, respectively: etidronate, 0.73+/-0.09 mM and (70+/-10)x10(-3) s(-1); clodronate (pCCl(2)p), 0.08+/-0.01 mM and (4.1+/-0.3)x10(-3) s(-1); methylenebisphosphonate (pCH(2)p), 0.024+/-0.001 mM and (0.6+/-0.1)x10(-3) s(-1); tripolyphosphate (P(3)) (in the synthesis of adenosine 5'-tetraphosphate, p(4)A), 1.30+/-0.30 mM and (6.2+/-1.1)x10(-3) s(-1); (iii) in the presence of GTP and ATP, inhibition of the synthesis of Ap(4)G was observed with clodronate but not with pamidronate (pC(OH)(CH(2)-CH(2)-NH(3))p). Concerning the ubiquitin activating enzyme (E1): methylenebisphosphonate was the only bisphosphonate, out of the ones tested, that served as substrate for the synthesis of an ATP derivative (K(m)=0.36+/-0.09 mM and k(cat)=0.15+/-0.02 s(-1)). None of the above bisphosphonates were substrates of the reaction catalyzed by luciferase or by acyl-CoA synthetase. The ability of acetyl-CoA synthetase to use methylenebisphosphonate as substrate depended on the commercial source of the enzyme. In our view this report widens our knowledge of the enzymes able to metabolize bisphosphonates, a therapeutic tool widely used in the treatment of osteoporosis. PMID:18378215

  6. Ultrastructural Studies of H-1 Parvovirus Replication VI. Simultaneous Autoradiographic and Immunochemical Intranuclear Localization of Viral DNA Synthesis and Protein Accumulation

    PubMed Central

    Singer, Irwin I.; Rhode, Solon L.

    1978-01-01

    The localization of H-1 viral replicative-form double-stranded DNA and progeny single-stranded DNA replication in parasynchronously infected, simian virus 40-transformed newborn human kidney cells was studied with high-resolution electron microscope autoradiography (80-nm silver grains). We analyzed wild-type H-1 and ts1 H-1 (a conditional mutant defective in progeny single-stranded DNA synthesis). The proportion of the total DNA synthesis that was viral was estimated to be >90% by comparing the amount of [3H]thymidine uptake in cultures infected with wild-type H-1 versus ts14 (an H-1 mutant defective in DNA replication). Simultaneous staining with cytochrome c-conjugated anti-H-1 immunoglobulin G was performed to ensure that cells incorporating [3H]thymidine (2- to 60-min pulses) were H-1 infected. The sites of H-1 replicative-form (in ts1-infected cells) and progeny (in wild-type-infected cells) DNA synthesis were identical. Immunospecifically labeled nuclei at the earliest stages of infection exhibited dense clusters of silver grains over material extruded from nucleolar fibrillar centers. These foci became larger with increasing cellular damage, forming a limited number of H-1 DNA synthetic centers in the euchromatin. Each island-like focus was surrounded by tufts of heterochromatin containing high concentrations of unassembled H-1 capsid proteins. In late phases of infection, the heterochromatin became completely marginated, and the nucleoplasm contained only euchromatin that exhibited randomly distributed sites of H-1 DNA replication. This indicates that H-1 DNA synthesis begins at localized euchromatic or nucleolar sites and then spreads outward. Immunostained heterochromatin and nucleolar chromatin never incorporated [3H]thymidine. Our results suggest that H-1 proteins and cellular cofactors associated with the fibrillar component of the nucleolus and the euchromatin may play a role in the regulation of H-1 DNA synthesis. Images PMID:340710

  7. Arbuscular mycorrhiza differentially affects synthesis of essential oils in coriander and dill.

    PubMed

    Rydlová, Jana; Jelínková, Marcela; Dušek, Karel; Dušková, Elena; Vosátka, Miroslav; Püschel, David

    2016-02-01

    Research on the role of arbuscular mycorrhizal fungi (AMF) in the synthesis of essential oils (EOs) by aromatic plants has seldom been conducted in field-relevant conditions, and then, only limited spectra of EO constituents have been analyzed. The effect was investigated of inoculation with AMF on the synthesis of a wide range of EO in two aromatic species, coriander (Coriandrum sativum) and dill (Anethum graveolens), in a garden experiment under outdoor conditions. Plants were grown in 4-l pots filled with soil, which was either γ-irradiated (eliminating native AMF) or left non-sterile (containing native AMF), and inoculated or not with an isolate of Rhizophagus irregularis. AMF inoculation significantly stimulated EO synthesis in both plant species. EO synthesis (total EO and several individual constituents) was increased in dill in all mycorrhizal treatments (containing native and/or inoculated AMF) compared to non-mycorrhizal plants. In contrast, EO concentrations in coriander (total EO and most constituents) were increased only in the treatment combining both inoculated and native AMF. A clear positive effect of AMF on EO synthesis was found for both aromatic plants, which was, however, specific for each plant species and modified by the pool of AMF present in the soil. PMID:26070450

  8. Optimizing stem-loop qPCR assays through multiplexed cDNA synthesis of U6 and miRNAs

    PubMed Central

    Turner, Marie; Adhikari, Sajag; Subramanian, Senthil

    2013-01-01

    We recently reported that hairpin (or stem-loop) priming is better-suited than polyA tailing to generate cDNA for plant microRNA qPCR. One major limitation of this method is the need to perform individual cDNA synthesis reactions for the reference gene and test miRNAs. Here, we report a novel fusion primer that allows multiplexed hairpin cDNA synthesis of the most-commonly used reference gene, nucleolar small RNA U6, together with test miRNAs. We also propose the use of miR1515 as a house keeping control for tropical legumes. We show that multiplexed cDNA synthesis does not result in loss of sensitivity and reduces the amount of RNA required for miRNA gene expression assays. PMID:23673353

  9. Physical Factors Affecting Plasmid DNA Compaction in Stearylamine-Containing Nanoemulsions Intended for Gene Delivery

    PubMed Central

    Silva, André Leandro; Júnior, Francisco Alexandrino; Verissimo, Lourena Mafra; Agnez-Lima, Lucymara Fassarella; Egito, Lucila Carmem Monte; de Oliveira, Anselmo Gomes; do Egito, Eryvaldo Socrates Tabosa

    2012-01-01

    Cationic lipids have been used in the development of non-viral gene delivery systems as lipoplexes. Stearylamine, a cationic lipid that presents a primary amine group when in solution, is able to compact genetic material by electrostatic interactions. In dispersed systems such as nanoemulsions this lipid anchors on the oil/water interface confering a positive charge to them. The aim of this work was to evaluate factors that influence DNA compaction in cationic nanoemulsions containing stearylamine. The influence of the stearylamine incorporation phase (water or oil), time of complexation, and different incubation temperatures were studied. The complexation rate was assessed by electrophoresis migration on agarose gel 0.7%, and nanoemulsion and lipoplex characterization was done by Dynamic Light Scattering (DLS). The results demonstrate that the best DNA compaction process occurs after 120 min of complexation, at low temperature (4 ± 1 °C), and after incorporation of the cationic lipid into the aqueous phase. Although the zeta potential of lipoplexes was lower than the results found for basic nanoemulsions, the granulometry did not change. Moreover, it was demonstrated that lipoplexes are suitable vehicles for gene delivery. PMID:24281666

  10. DNA Replication Licensing Affects Cell Proliferation or Endoreplication in a Cell Type–Specific Manner

    PubMed Central

    del Mar Castellano, María; Boniotti, María Beatrice; Caro, Elena; Schnittger, Arp; Gutierrez, Crisanto

    2004-01-01

    In eukaryotic cells, the function of DNA replication licensing components (Cdc6 and Cdt1, among others) is crucial for cell proliferation and genome stability. However, little is known about their role in whole organisms and whether licensing control interfaces with differentiation and developmental programs. Here, we study Arabidopsis thaliana CDT1, its regulation, and the consequences of overriding licensing control. The availability of AtCDT1 is strictly regulated at two levels: (1) at the transcription level, by E2F and growth-arresting signals, and (2) posttranscriptionally, by CDK phosphorylation, a step that is required for its proteasome-mediated degradation. We also show that CDC6 and CDT1 are key targets for the coordination of cell proliferation, differentiation, and development. Indeed, altered CDT1 or CDC6 levels have cell type–specific effects in developing Arabidopsis plants: in leaf cells competent to divide, cell proliferation is stimulated, whereas in cells programmed to undergo differentiation-associated endoreplication rounds, extra endocycles are triggered. Thus, we propose that DNA replication licensing control is critical for the proper maintenance of proliferative potential, developmental programs, and morphogenetic patterns. PMID:15316110

  11. Physical factors affecting plasmid DNA compaction in stearylamine-containing nanoemulsions intended for gene delivery.

    PubMed

    Silva, André Leandro; Alexandrino, Francisco; Verissimo, Lourena Mafra; Agnez-Lima, Lucymara Fassarella; Egito, Lucila Carmem Monte; de Oliveira, Anselmo Gomes; do Egito, Eryvaldo Socrates Tabosa

    2012-01-01

    Cationic lipids have been used in the development of non-viral gene delivery systems as lipoplexes. Stearylamine, a cationic lipid that presents a primary amine group when in solution, is able to compact genetic material by electrostatic interactions. In dispersed systems such as nanoemulsions this lipid anchors on the oil/water interface confering a positive charge to them. The aim of this work was to evaluate factors that influence DNA compaction in cationic nanoemulsions containing stearylamine. The influence of the stearylamine incorporation phase (water or oil), time of complexation, and different incubation temperatures were studied. The complexation rate was assessed by electrophoresis migration on agarose gel 0.7%, and nanoemulsion and lipoplex characterization was done by Dynamic Light Scattering (DLS). The results demonstrate that the best DNA compaction process occurs after 120 min of complexation, at low temperature (4 ± 1 °C), and after incorporation of the cationic lipid into the aqueous phase. Although the zeta potential of lipoplexes was lower than the results found for basic nanoemulsions, the granulometry did not change. Moreover, it was demonstrated that lipoplexes are suitable vehicles for gene delivery. PMID:24281666

  12. Dithiocarbamate/piperazine bridged pyrrolobenzodiazepines as DNA-minor groove binders: synthesis, DNA-binding affinity and cytotoxic activity.

    PubMed

    Kamal, Ahmed; Sreekanth, Kokkonda; Shankaraiah, Nagula; Sathish, Manda; Nekkanti, Shalini; Srinivasulu, Vunnam

    2015-04-01

    A new series of C8-linked dithiocarbamate/piperazine bridged pyrrolo[2,1-c][1,4]benzodiazepine conjugates (5a-c, 6a,b) have been synthesized and evaluated for their cytotoxic potential and DNA-binding ability. The representative conjugates 5a and 5b have been screened for their cytotoxicity against a panel of 60 human cancer cell lines. Compound 5a has shown promising cytotoxic activity on selected cancer cell lines that display melanoma, leukemia, CNS, ovarian, breast and renal cancer phenotypes. The consequence of further replacement of the 3-cyano-3,3-diphenylpropyl 1-piperazinecarbodithioate in 5b and 5c with 4-methylpiperazine-1-carbodithioate yielded new conjugates 6a and 6b respectively. In addition, the compounds 5c and 6a,b have been evaluated for their in vitro cytotoxicity on some of the selected human cancer cell lines and these conjugates have exhibited significant cytotoxic activity. Further, the DNA-binding ability of these new conjugates has been evaluated by using thermal denaturation (ΔTm) studies. The correlation between structure and DNA-binding ability has been investigated by molecular modeling studies which predicted that 6b exhibits superior DNA-binding ability and these are in agreement with the experimental DNA-binding studies. PMID:25665519

  13. Hydrogenase synthesis in Bradyrhizobium japonicum Hupc mutants is altered in sensitivity to DNA gyrase inhibitors.

    PubMed Central

    Novak, P D; Maier, R J

    1989-01-01

    In the Hupc mutants of Bradyrhizobium japonicum SR, regulation of expression of hydrogenase is altered; the mutants synthesize hydrogenase constitutively in the presence of atmospheric levels of oxygen. The DNA gyrase inhibitors nalidixic acid, novobiocin, and coumermycin were used to inhibit growth of wild-type and mutant cells. For each inhibitor tested, growth of mutant and wild-type strains was equally sensitive. However, in contrast to the wild type, the Hupc mutants synthesized hydrogenase in the presence of high levels of any inhibitor. Cells were incubated with the drugs and simultaneously labeled with 14C-labeled amino acids, and hydrogenase was immunoprecipitated with antibody to the large subunit of the enzyme. Fluorograms of antibody blots then were scanned to determine the relative amount of hydrogenase (large subunit) synthesized in the presence or absence of the gyrase inhibitors. The amount of hydrogenase synthesized by the Hupc mutants in the presence of 300 micrograms of nalidixic acid per ml was near the level of enzyme synthesized in the absence of the inhibitor. No hydrogenase was detected in antibody blots of wild-type cultures which were derepressed for hydrogenase in the presence of 100 micrograms of coumermycin or novobiocin per ml. In contrast, hydrogenase was synthesized by the Hupc mutants in the presence of 100 micrograms of either drug per ml. The amount synthesized ranged from 5 to 32% and 20 to 49%, respectively, of that in the absence of those inhibitors, but nevertheless, hydrogenase synthesis was detected in all of the mutants examined.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2547335

  14. In vivo effects of endotoxin on DNA synthesis in rat nasal epithelium

    SciTech Connect

    Harkema, J.R.; Hotchkiss, J.A. )

    1993-12-01

    Airway inflammation in bacterial infections is characterized by the presence of neutrophils and often epithelial injury and repair. Release of endotoxin from bacteria may contribute to these processes. The purpose of this study was to determine the in vivo effects of repeated endotoxin exposure on DNA synthesis in rat nasal epithelium in the presence and absence of neutrophilic influx. Rats were intranasally instilled, once a day for 3 days, with endotoxin or saline (controls). Before the first and third instillations, half of the saline and endotoxin-instilled animals were depleted of circulating blood neutrophils by administering a rabbit anti-rat neutrophil antiserum. Rats were sacrificed 6 or 24 h after the last instillation. Two hours prior to sacrifice, rats were intraperitoneally injected with bromodeoxyuridine (BrdU), an analog of thymidine that is incorporated in the nucleus of cells in the S-phase of the cell cycle. Nasal tissues were processed for light microscopy and immunohistochemical detection of BrdU in nasal epithelial cells. The numbers of nasal epithelial cells, BrdU-labeled epithelial nuclei, and neutrophils per millimeter of basal lamina in the epithelium lining the nasal turbinates in the proximal nasal passages were determined by morphometric analysis. The authors did not observe a neutrophilic influx in the nasal tissues of neutrophil-depleted rats at 6 or 24 h after the last endotoxin instillation; however, the numbers of nasal epithelial cells and the BrdU-labeling index were significantly increased compared to saline-instilled controls. In contrast, non-neutrophil-depleted rats instilled with endotoxin had a marked neutrophilic influx, but no significant differences in the number of nasal epithelial cells at 6 or 24 h, compared to controls. In addition, the BrdU-labeling index in neutrophil-sufficient rats was increased only 6 h after the last instillation, compared to controls.

  15. Mutation at position 791 in Escherichia coli 16S ribosomal RNA affects processes involved in the initiation of protein synthesis.

    PubMed Central

    Tapprich, W E; Goss, D J; Dahlberg, A E

    1989-01-01

    A single base was mutated from guanine to adenine at position 791 in 16S rRNA in the Escherichia coli rrnB operon on the multicopy plasmid pKK3535. The plasmid-coded rRNA was processed and assembled into 30S ribosomal subunits in E. coli and caused a retardation of cell growth. The mutation affected crucial functional roles of the 30S subunit in the initiation of protein synthesis. The affinity of the mutant 30S subunits for 50S subunits was reduced and the association equilibrium constant for initiation factor 3 was decreased by a factor of 10 compared to wild-type 30S subunits. The interrelationship among the region of residue 790 in 16S rRNA, subunit association, and initiation factor 3 binding during initiation complex formation, as revealed by this study, offers insights into the functional role of rRNA in protein synthesis. PMID:2662189

  16. DNA sequencing by synthesis using 3′-O-azidomethyl nucleotide reversible terminators and surface-enhanced Raman spectroscopic detection

    PubMed Central

    Palla, Mirkó; Guo, Wenjing; Shi, Shundi; Li, Zengmin; Wu, Jian; Jockusch, Steffen; Guo, Cheng; Russo, James J.; Turro, Nicholas J.; Ju, Jingyue

    2014-01-01

    As an alternative to fluorescence-based DNA sequencing by synthesis (SBS), we report here an approach using an azido moiety (N3) that has an intense, narrow and unique Raman shift at 2125 cm−1, where virtually all biological molecules are transparent, as a label for SBS. We first demonstrated that the four 3′-O-azidomethyl nucleotide reversible terminators (3′-O-azidomethyl-dNTPs) displayed surface enhanced Raman scattering (SERS) at 2125 cm−1. Using these 4 nucleotide analogues as substrates, we then performed a complete 4-step SBS reaction. We used SERS to monitor the appearance of the azide-specific Raman peak at 2125 cm−1 as a result of polymerase extension by a single 3′-O-azidomethyl-dNTP into the growing DNA strand and disappearance of this Raman peak with cleavage of the azido label to permit the next nucleotide incorporation, thereby continuously determining the DNA sequence. Due to the small size of the azido label, the 3′-O-azidomethyl-dNTPs are efficient substrates for the DNA polymerase. In the SBS cycles, the natural nucleotides are restored after each incorporation and cleavage, producing a growing DNA strand that bears no modifications and will not impede further polymerase reactions. Thus, with further improvements in SERS for the azido moiety, this approach has the potential to provide an attractive alternative to fluorescence-based SBS. PMID:25396047

  17. Excision of ultraviolet damage and the effect of irradiation on DNA synthesis in a strain of Bloom's syndrome fibroblasts

    SciTech Connect

    Henson, P.; Selsky, C.A.; Little, J.B.

    1981-03-01

    Researchers have studied repair of ultraviolet light-induced damage in a strain of Bloom's syndrome cells which we have shown to be defective in host cell reactivation of uv-irradiated herpes simplex virus. Excision repair was monitored by following loss of sensitivity of DNA in permeabilized cells to digestion by the Micrococcus luteus uv endonuclease preparation. The Bloom's syndrome fibroblasts apparently removed endonuclease-sensitive sites from the DNA slightly less efficiently than did normal strains. After 24 h, 38% of the sites remained in the Bloom's syndrome cells in comparison with 16% in normal fibroblasts. DNA newly synthesized in uv-irradiated Bloom's syndrome cells sedimented less far into alkaline sucrose gradients than did DNA from similarly treated normal cells. In other respects, including the effect of caffeine exposure, DNA synthesis in Bloom's syndrome cells was indistinguishable from that in normal cells. We were therefore able to detect only minor defects in the repair of uv-induced damage in Bloom's syndrome fibroblasts. This is consistent with the normal survival exhibited by these cells. The defect in excision repair may, however, be sufficient to allow the cellular repair capacity to become saturated at high infecting multiplicities of uv-irradiated herpes simplex virus.

  18. Smoking and polymorphisms in xenobiotic metabolism and DNA repair genes are additive risk factors affecting bladder cancer in Northern Tunisia.

    PubMed

    Rouissi, Kamel; Ouerhani, Slah; Hamrita, Bechr; Bougatef, Karim; Marrakchi, Raja; Cherif, Mohamed; Ben Slama, Mohamed Riadh; Bouzouita, Mohamed; Chebil, Mohamed; Ben Ammar Elgaaied, Amel

    2011-12-01

    Cancer epidemiology has undergone marked development since the nineteen-fifties. One of the most spectacular and specific contributions was the demonstration of the massive effect of smoking and genetic polymorphisms on the occurrence of bladder cancer. The tobacco carcinogens are metabolized by various xenobiotic metabolizing enzymes, such as the super-families of N-acetyltransferases (NAT) and glutathione S-transferases (GST). DNA repair is essential to an individual's ability to respond to damage caused by tobacco carcinogens. Alterations in DNA repair genes may affect cancer risk by influencing individual susceptibility to this environmental exposure. Polymorphisms in NAT2, GST and DNA repair genes alter the ability of these enzymes to metabolize carcinogens or to repair alterations caused by this process. We have conducted a case-control study to assess the role of smoking, slow NAT2 variants, GSTM1 and GSTT1 null, and XPC, XPD, XPG nucleotide excision-repair (NER) genotypes in bladder cancer development in North Tunisia. Taken alone, each gene unless NAT2 did not appear to be a factor affecting bladder cancer susceptibility. For the NAT2 slow acetylator genotypes, the NAT2*5/*7 diplotype was found to have a 7-fold increased risk to develop bladder cancer (OR = 7.14; 95% CI: 1.30-51.41). However, in tobacco consumers, we have shown that Null GSTM1, Wild GSTT1, Slow NAT2, XPC (CC) and XPG (CC) are genetic risk factors for the disease. When combined together in susceptible individuals compared to protected individuals these risk factors give an elevated OR (OR = 61). So, we have shown a strong cumulative effect of tobacco and different combinations of studied genetic risk factors which lead to a great susceptibility to bladder cancer. PMID:21647780

  19. Association of a DNA virus with grapevines affected by red blotch disease in California.

    PubMed

    Al Rwahnih, Maher; Dave, Ashita; Anderson, Michael M; Rowhani, Adib; Uyemoto, Jerry K; Sudarshana, Mysore R

    2013-10-01

    In the Napa Valley of California, vineyards of 'Cabernet Franc' (CF) clone 214, 'Cabernet Sauvignon' clone 337, and 'Zinfandel' clone 1A (Z1A) with grapevines exhibiting foliar symptoms of red blotches, marginal reddening, and red veins that were accompanied by reduced sugar accumulation in fruit at harvest were initially suspected to be infected with leafroll-associated viruses. However, reverse-transcription polymerase chain reaction (PCR) tests were negative for all known leafroll-associated viruses, with the exception of Grapevine leafroll-associated virus 2 in Z1A. Metagenomic analysis of cDNA libraries obtained from double-stranded RNA enriched nucleic acid (NA) preparations from bark scrapings of dormant canes on an Illumina platform revealed sequences having a distant relationship with members of the family Geminiviridae. Sequencing of products obtained by PCR assays using overlapping primers and rolling circle amplification (RCA) confirmed the presence of a single circular genome of 3,206 nucleotides which was nearly identical to the genome of a recently reported Grapevine cabernet franc-associated virus found in declining grapevines in New York. We propose to call this virus "Grapevine red blotch-associated virus" (GRBaV) to describe its association with grapevine red blotch disease. Primers specific to GRBaV amplified a product of expected size (557 bp) from NA preparations obtained from petioles of several diseased source vines. Chip bud inoculations successfully transmitted GRBaV to test plants of CF, as confirmed by PCR analysis. This is the first report of a DNA virus associated with red blotch disease of grapevines in California. PMID:23656312

  20. Tales from scales: old DNA yields insights into contemporary evolutionary processes affecting fishes.

    PubMed

    Quinn, Thomas P; Seamons, Todd R

    2009-06-01

    Salmon and trout populations are suffering declines in abundance and diversity over much of their range around the Atlantic and Pacific rims as a consequence of many factors. One method of dealing with the decline has been to produce them in hatcheries but the wisdom of this approach has been hotly debated (e.g. Hilborn & Winton 1993; Waples 1999; Brannon et al. 2004). One concern is that domesticated hatchery strains will interbreed with locally adapted wild fish; but how do we study the genetic effects if the introgression might have occurred in the past? Hansen (2002) used DNA isolated from archived scales from brown trout, Salmo trutta (Fig. 1), to show that domesticated trout had, to varying degrees, genetically introgressed with wild, native trout in two Danish rivers. Extending that study, Hansen et al. (2009) have examined DNA from brown trout scales in six Danish rivers collected during historical (1927-1956) and contemporary (2000-2006) periods and from two hatchery source populations, to assess the effects of stocking nonlocal strains of hatchery trout and declining abundance on genetic diversity. Using 21 microsatellite loci, they revealed that genetic change occurred between the historic and contemporary time periods. Many populations appeared to have some low level of introgression from hatchery stocks and two populations apparently experienced high levels of introgression. Hansen et al. (2009) also showed that population structure persists in contemporary populations despite apparent admixture and migration among populations, providing evidence that the locally adapted populations have struggled against and, to some extent, resisted being overwhelmed by repeated introductions of and interbreeding with non-native, hatchery-produced conspecifics. PMID:19457205

  1. Macrophages do not inhibit the participation of the nuclei of nonmalignant proliferating cells in DNA synthesis in heterokaryons

    SciTech Connect

    Egorov, E.E.; Prudovskii, I.A.; Zelenin, A.V.

    1985-07-01

    The authors continue their investigations into types of heterokaryons in an effort to detect an inhibition of nondividing macrophages (differentiated cells) on the entry of the nuclei of proliferating cells into replication. For the experiments described in this paper, the authors used asynchronous cultures of mouse diploid fibroblasts (MDF), 3T3 mouse cells from continuous culture, and malignant SV3T3 cells (3T3 cells transformed by SV40). Fusion of the cells of the cultures with macrophages was performed using PEG at various periods after deposition (2, 8, 12, and 20 h). The authors used double isotope marking to identify DNA synthesis in the heterokaryons. For this purpose, the nuclei of the culture cells were labeled with (/sup 3/H)thymidine before fusion with macrophages. All the nuclei of the culture cells intensively incorporated the label. After fusion, (/sup 14/C)thymidine was introduced into the incubation medium. If the cell nucleus began to synthesize DNA, it incorporated (/sup 14/C)thymidine, and a supplementary relatively weak label appeared on the auto-radiographic preparations, both above the nuclei themselves and next to them. The nuclei of macrophages in which DNA synthesis was reactivated contained only the (/sup 14/C)label. Fixation was performed 26 h after stimulation (in the case of 3T3) or 35 h after stimulation (for MDF). The percentages of nuclei of culture cells labeled with (/sup 14/C)thymidine were determined in the heterokaryons and free-lying cells.

  2. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.

    1987-05-01

    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  3. A model of binding on DNA microarrays: understanding the combined effect of probe synthesis failure, cross-hybridization, DNA fragmentation and other experimental details of affymetrix arrays

    PubMed Central

    2012-01-01

    Background DNA microarrays are used both for research and for diagnostics. In research, Affymetrix arrays are commonly used for genome wide association studies, resequencing, and for gene expression analysis. These arrays provide large amounts of data. This data is analyzed using statistical methods that quite often discard a large portion of the information. Most of the information that is lost comes from probes that systematically fail across chips and from batch effects. The aim of this study was to develop a comprehensive model for hybridization that predicts probe intensities for Affymetrix arrays and that could provide a basis for improved microarray analysis and probe development. The first part of the model calculates probe binding affinities to all the possible targets in the hybridization solution using the Langmuir isotherm. In the second part of the model we integrate details that are specific to each experiment and contribute to the differences between hybridization in solution and on the microarray. These details include fragmentation, wash stringency, temperature, salt concentration, and scanner settings. Furthermore, the model fits probe synthesis efficiency and target concentration parameters directly to the data. All the parameters used in the model have a well-established physical origin. Results For the 302 chips that were analyzed the mean correlation between expected and observed probe intensities was 0.701 with a range of 0.88 to 0.55. All available chips were included in the analysis regardless of the data quality. Our results show that batch effects arise from differences in probe synthesis, scanner settings, wash strength, and target fragmentation. We also show that probe synthesis efficiencies for different nucleotides are not uniform. Conclusions To date this is the most complete model for binding on microarrays. This is the first model that includes both probe synthesis efficiency and hybridization kinetics/cross-hybridization. These

  4. WR-1065 and radioprotection of vascular endothelial cells. I. Cell proliferation, DNA synthesis and damage

    SciTech Connect

    Rubin, D.B.; Drab, E.A.; Kang, H.J.; Baumann, F.E.; Blazek, E.R.

    1996-02-01

    Normal tissue toxicity limits radiation therapy and could depend on the extent of damage to the vascular endothelium. Aminothiols such as WR-1065 [N-(2-mercaptoethyl)-1,3-diaminopropane] provide radioprotection for normal tissues, but little is known about how the aminothiols specifically affect the endothelium. Bovine aortic endothelial cells in culture were exposed to WR-1065 for 2 h before irradiation ({sup 137}Cs {gamma} rays, 1 Gy/min). Alone, WR-1065 demonstrated an antiproliferative effect that was related to dose (0.5-4 mM) and was evident by lowered counts of adherent cells 48 h after exposure. WR-1065 was clearly radioprotective when assessed by colony formation and incorporation of [{sup 3}H]thymidine. However, when the number of adherent cells was evaluated, radioprotection appeared to be slight and evident only in logarithmically growing cells. WR-1065 at 2 mM suppressed single-strand DNA breaks after 3 Gy by 22% and double-strand breaks after 9 Gy by 47%. Also in the irradiated cells, WR-1065 more than doubled the rate of progression of cells from G{sub 1} to S phase. WR-1065 pretreatment elevated cellular glutathione (GSH) content more than twofold. Although pretreatment with buthionine sulfoximine inhibited the elevation of GSH, the radioprotective impact of WR-1065 on total DNA strand breaks and colony formation was unaffected. These results suggest that WR-1065 may enable tissue recovery from irradiation by promoting the replication of endothelial cells, possibly by mechanisms independent of GSH. 46 refs., 6 figs., 2 tabs.

  5. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  6. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  7. TWINKLE is an essential mitochondrial helicase required for synthesis of nascent D-loop strands and complete mtDNA replication

    PubMed Central

    Milenkovic, Dusanka; Matic, Stanka; Kühl, Inge; Ruzzenente, Benedetta; Freyer, Christoph; Jemt, Elisabeth; Park, Chan Bae; Falkenberg, Maria; Larsson, Nils-Göran

    2013-01-01

    Replication of the mammalian mitochondrial DNA (mtDNA) is dependent on the minimal replisome, consisting of the heterotrimeric mtDNA polymerase (POLG), the hexameric DNA helicase TWINKLE and the tetrameric single-stranded DNA-binding protein (mtSSB). TWINKLE has been shown to unwind DNA during the replication process and many disease-causing mutations have been mapped to its gene. Patients carrying Twinkle mutations develop multiple deletions of mtDNA, deficient respiratory chain function and neuromuscular symptoms. Despite its importance in human disease, it has been unclear whether TWINKLE is the only replicative DNA helicase in mammalian mitochondria. Furthermore, a substantial portion of mtDNA replication events is prematurely terminated at the end of mitochondrial control region (D-loop) and it is unknown whether TWINKLE also has a role in this abortive replication. Here, we present a conditional mouse knockout for Twinkle and demonstrate that TWINKLE is essential for mouse embryonic development and thus is the only replicative DNA helicase in mammalian mitochondria. Conditional knockout of Twinkle results in severe and rapid mtDNA depletion in heart and skeletal muscle. No replication intermediates or deleted mtDNA molecules are observed after Twinkle knockout, suggesting that TWINKLE once loaded is very processive. We also demonstrate that TWINKLE is essential for nascent H-strand synthesis in the D-loop, thus showing that there is no separate DNA helicase responsible for replication of this region. Our data thus suggest that the relative levels of abortive D-loop synthesis versus complete mtDNA replication are regulated and may provide a mechanism to control progression to complete mtDNA replication. PMID:23393161

  8. On-Electrode Synthesis of Shape-Controlled Hierarchical Flower-Like Gold Nanostructures for Efficient Interfacial DNA Assembly and Sensitive Electrochemical Sensing of MicroRNA.

    PubMed

    Su, Shao; Wu, Yan; Zhu, Dan; Chao, Jie; Liu, Xingfen; Wan, Ying; Su, Yan; Zuo, Xiaolei; Fan, Chunhai; Wang, Lianhui

    2016-07-01

    The performance for biomolecular detection is closely associated with the interfacial structure of a biosensor, which profoundly affects both thermodynamics and kinetics of the assembly, binding and signal transduction of biomolecules. Herein, it is reported on a one-step and template-free on-electrode synthesis method for making shape-controlled gold nanostructures on indium tin oxide substrates, which provide an electrochemical sensing platform for ultrasensitive detection of nucleic acids. Thus-prepared hierarchical flower-like gold nanostructures (HFGNs) possess large surface area that can readily accommodate the assembly of DNA probes for subsequent hybridization detection. It is found that the sensitivity for electrochemical DNA sensing is critically dependent on the morphology of HFGNs. By using this new strategy, a highly sensitive electrochemical biosensor is developed for label-free detection of microRNA-21 (miRNA-21), a biomarker for lung cancers. Importantly, it is demonstrated that this biosensor can be employed to measure the miRNA-21 expression level from human lung cancer cell (A549) lysates and worked well in 100% serum, suggesting its potential for applications in clinical diagnosis and a wide range of bioanalysis. PMID:27305644

  9. Complementation of defective translesion synthesis and UV light sensitivity in xeroderma pigmentosum variant cells by human and mouse DNA polymerase eta.

    PubMed

    Yamada, A; Masutani, C; Iwai, S; Hanaoka, F

    2000-07-01

    Defects in the human gene XPV result in the variant form of the genetic disease xeroderma pigmentosum (XP-V). XPV encodes DNA polymerase eta, a novel DNA polymerase that belongs to the UmuC/DinB/Rad30 superfamily. This polymerase catalyzes the efficient and accurate translesion synthesis of DNA past cis-syn cyclobutane di-thymine lesions. In this report we present the cDNA sequence and expression profiles of the mouse XPV gene and demonstrate its ability to complement defective DNA synthesis in XP-V cells. The mouse XPV protein shares 80.3% amino acid identity and 86.9% similarity with the human XPV protein. The recombinant mouse XPV protein corrected the inability of XP-V cell extracts to carry out DNA replication, by bypassing thymine dimers on template DNA. Transfection of the mouse or human XPV cDNA into human XP-V cells corrected UV sensitivity. Northern blot analysis revealed that the mouse XPV gene is expressed ubiquitously, but at a higher level in testis, liver, skin and thymus compared to other tissues. Although the mouse XPV gene was not induced by UV irradiation, its expression was elevated approximately 4-fold during cell proliferation. These results suggest that DNA polymerase eta plays a role in DNA replication, though the enzyme is not essential for viability. PMID:10871396

  10. Fetal cell-free DNA fraction in maternal plasma is affected by fetal trisomy.

    PubMed

    Suzumori, Nobuhiro; Ebara, Takeshi; Yamada, Takahiro; Samura, Osamu; Yotsumoto, Junko; Nishiyama, Miyuki; Miura, Kiyonori; Sawai, Hideaki; Murotsuki, Jun; Kitagawa, Michihiro; Kamei, Yoshimasa; Masuzaki, Hideaki; Hirahara, Fumiki; Saldivar, Juan-Sebastian; Dharajiya, Nilesh; Sago, Haruhiko; Sekizawa, Akihiko

    2016-07-01

    The purpose of this noninvasive prenatal testing (NIPT) study was to compare the fetal fraction of singleton gestations by gestational age, maternal characteristics and chromosome-specific aneuploidies as indicated by z-scores. This study was a multicenter prospective cohort study. Test data were collected from women who underwent NIPT by the massively parallel sequencing method. We used sequencing-based fetal fraction calculations in which we estimated fetal DNA fraction by simply counting the number of reads aligned within specific autosomal regions and applying a weighting scheme derived from a multivariate model. Relationships between fetal fractions and gestational age, maternal weight and height, and z-scores for chromosomes 21, 18 and 13 were assessed. A total of 7740 pregnant women enrolled in the study, of which 6993 met the study criteria. As expected, fetal fraction was inversely correlated with maternal weight (P<0.001). The median fetal fraction of samples with euploid result (n=6850) and trisomy 21 (n=70) were 13.7% and 13.6%, respectively. In contrast, the median fetal fraction values for samples with trisomies 18 (n=35) and 13 (n=9) were 11.0% and 8.0%, respectively. The fetal fraction of samples with trisomy 21 NIPT result is comparable to that of samples with euploid result. However, the fetal fractions of samples with trisomies 13 and 18 are significantly lower compared with that of euploid result. We conclude that it may make detecting these two trisomies more challenging. PMID:26984559

  11. Translation Start Sequences Affect the Efficiency of Silencing of Agrobacterium tumefaciens T-DNA Oncogenes1

    PubMed Central

    Lee, Hyewon; Humann, Jodi L.; Pitrak, Jennifer S.; Cuperus, Josh T.; Parks, T. Dawn; Whistler, Cheryl A.; Mok, Machteld C.; Ream, L. Walt

    2003-01-01

    Agrobacterium tumefaciens oncogenes cause transformed plant cells to overproduce auxin and cytokinin. Two oncogenes encode enzymes that convert tryptophan to indole-3-acetic acid (auxin): iaaM (tryptophan mono-oxygenase) and iaaH (indole-3-acetamide hydrolase). A third oncogene (ipt) encodes AMP isopentenyl transferase, which produces cytokinin (isopentenyl-AMP). Inactivation of ipt and iaaM (or iaaH) abolishes tumorigenesis. Because adequate means do not exist to control crown gall, we created resistant plants by introducing transgenes designed to elicit posttranscriptional gene silencing (PTGS) of iaaM and ipt. Transgenes that elicit silencing trigger sequence-specific destruction of the inducing RNA and messenger RNAs with related sequences. Although PTGS has proven effective against a variety of target genes, we found that a much higher percentage of transgenic lines silenced iaaM than ipt, suggesting that transgene sequences influenced the effectiveness of PTGS. Sequences required for oncogene silencing included a translation start site. A transgene encoding a translatable sense-strand RNA from the 5′ end of iaaM silenced the iaaM oncogene, but deletion of the translation start site abolished the ability of the transgene to silence iaaM. Silencing A. tumefaciens T-DNA oncogenes is a new and effective method to produce plants resistant to crown gall disease. PMID:12972655

  12. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  13. Cucurbitacin I blocks cerebrospinal fluid and platelet derived growth factor-BB stimulation of leptomeningeal and meningioma DNA synthesis

    PubMed Central

    2013-01-01

    Background Currently, there are no consistently effective chemotherapies for recurrent and inoperable meningiomas. Recently, cucurbitacin I (JSI-124), a naturally occurring tetracyclic triterpenoid compound used as folk medicines has been found to have cytoxic and anti-proliferative properties in several malignancies thru inhibition of activator of transcription (STAT3) activation. Previously, we have found STAT3 to be activated in meningiomas, particularly higher grade tumors. Methods Primary leptomeningeal cultures were established from 17, 20 and 22 week human fetuses and meningioma cell cultures were established from 6 World Health Organization (WHO) grade I or II meningiomas. Cells were treated with cerebrospinal fluid from patients without neurologic disease. The effects of cucurbitacin I on cerebrospinal fluid stimulation of meningioma cell DNA synthesis phosphorylation/activation of JAK1, STAT3, pMEK1/2, p44/42MAPK, Akt, mTOR, Rb and caspase 3 activation were analyzed in human leptomeningeal and meningioma cells. Results Cerebrospinal fluid significantly stimulated DNA synthesis in leptomeningeal cells. Co-administration of cucurbitacin I (250 nM) produces a significant blockade of this effect. Cucurbitacin I alone also produced a significant reduction in basal DNA synthesis. In grade I and II meningiomas, cerebrospinal fluid also significantly stimulated DNA synthesis. Co-administration of cucurbitacin I (250 nM) blocked this effect. In the leptomeningeal cultures, cerebrospinal fluid stimulated STAT3 phosphorylation but not p44/42MAPK, Akt or mTOR. Cucurbitacin I had no effect on basal STAT3 phosphorylation but co-administration with cerebrospinal fluid blocked cerebrospinal fluid stimulation of STAT3 phosphorylation in each. In the grade I meningiomas, cerebrospinal fluid stimulated phosphorylation of STAT3 and decreased MEK1/2 and cucurbitacin I had no effect on basal STAT3, p44/42MAPK, Akt, JAK1, mTOR, or Rb phosphorylation. In the grade II

  14. Induction of maturation of human B-cell lymphomas in vitro. Morphologic changes in relation to immunoglobulin and DNA synthesis.

    PubMed Central

    Beiske, K.; Ruud, E.; Drack, A.; Marton, P. F.; Godal, T.

    1984-01-01

    In vitro stimulation of cells from 8 non-Hodgkin's lymphomas comprising several histologic types with a tumor promotor (TPA) and with or without anti-immunoglobulins directed against the surface immunoglobulin of the tumor cells is reported. Morphologic transformation to immunoblastic and plasmablastic cells, but not to plasma cells, and induction of Ig and DNA synthesis were observed. A comparative analysis, including flow cytofluorometry, light microscopy combined with immunocytochemistry, and electron microscopy, suggests that the three events may not always be associated phenomena at the single-cell level even in monoclonal cell populations. Images Figure 1 Figure 3 Figure 4 Figure 5 Figure 6 PMID:6375389

  15. Sequence identity of the terminal redundancies on the minus-strand DNA template is necessary but not sufficient for the template switch during hepadnavirus plus-strand DNA synthesis.

    PubMed Central

    Loeb, D D; Gulya, K J; Tian, R

    1997-01-01

    The template for hepadnavirus plus-strand DNA synthesis is a terminally redundant minus-strand DNA. An intramolecular template switch during plus-strand DNA synthesis, which permits plus-strand DNA elongation, has been proposed to be facilitated by this terminal redundancy, which is 7 to 9 nucleotides long. The aim of this study was to determine whether the presence of identical copies of the redundancy on the minus-strand DNA template was necessary and/or sufficient for the template switch and at what position(s) within the redundancy the switch occurs for duck hepatitis B virus. When dinucleotide insertions were placed within the copy of the redundancy at the 3' end of the minus-strand DNA template, novel sequences were copied into plus-strand DNA. The generation of these novel sequences could be explained by complete copying of the redundancy at the 5' end of the minus-strand DNA template followed by a template switch and then extension from a mismatched 3' terminus. In a second set of experiments, it was found that when one copy of the redundancy had either three or five nucleotides replaced the template switch was inhibited. When the identical, albeit mutant, sequences were restored in both copies of the redundancy, template switching was not necessarily restored. Our results indicate that the terminal redundancy on the minus-strand DNA template is necessary but not sufficient for template switching. PMID:8985334

  16. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA

    PubMed Central

    Turner, Tychele N.; Hormozdiari, Fereydoun; Duyzend, Michael H.; McClymont, Sarah A.; Hook, Paul W.; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A.; Zody, Michael C.; Nelson, Bradley J.; Huddleston, John; Sandstrom, Richard; Smith, Joshua D.; Hanna, David; Swanson, James M.; Faustman, Elaine M.; Bamshad, Michael J.; Stamatoyannopoulos, John; Nickerson, Deborah A.; McCallion, Andrew S.; Darnell, Robert; Eichler, Evan E.

    2016-01-01

    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  17. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA.

    PubMed

    Turner, Tychele N; Hormozdiari, Fereydoun; Duyzend, Michael H; McClymont, Sarah A; Hook, Paul W; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A; Zody, Michael C; Nelson, Bradley J; Huddleston, John; Sandstrom, Richard; Smith, Joshua D; Hanna, David; Swanson, James M; Faustman, Elaine M; Bamshad, Michael J; Stamatoyannopoulos, John; Nickerson, Deborah A; McCallion, Andrew S; Darnell, Robert; Eichler, Evan E

    2016-01-01

    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  18. The feed contaminant deoxynivalenol affects the intestinal barrier permeability through inhibition of protein synthesis.

    PubMed

    Awad, Wageha A; Zentek, Jürgen

    2015-06-01

    Deoxynivalenol (DON) has critical health effects if the contaminated grains consumed by humans or animals. DON can have negative effects on the active transport of glucose and amino acids in the small intestine of chickens. As the underlying mechanisms are not fully elucidated, the present study was performed to delineate more precisely the effects of cycloheximide (protein synthesis inhibitor, CHX) and DON on the intestinal absorption of nutrients. This was to confirm whether DON effects on nutrient absorption are due to an inhibition of protein synthesis. Changes in ion transport and barrier function were assessed by short-circuit current (Isc) and transepithelial ion conductance (Gt) in Ussing chambers. Addition of D-glucose or L-glutamine to the luminal side of the isolated mucosa of the jejunum increased (P < 0.001) the Isc compared with basal conditions in the control tissues. However, the Isc was not increased by the glucose or glutamine addition after pre-incubation of tissues with DON or CHX. Furthermore, both DON and CHX reduced Gt, indicating that the intestinal barrier is compromised and consequently induced a greater impairment of the barrier function. The remarkable similarity between the activity of CHX and DON on nutrient uptake is consistent with their common ability to inhibit protein synthesis. It can be concluded that the decreases in transport activity by CHX was evident in this study using the chicken as experimental model. Similarly, DON has negative effects on the active transport of some nutrients, and these can be explained by its influence on protein synthesis. PMID:24888376

  19. Photoinduced interactions of supramolecular ruthenium(II) complexes with plasmid DNA: synthesis and spectroscopic, electrochemical, and DNA photocleavage studies.

    PubMed

    Swavey, Shawn; DeBeer, Madeleine; Li, Kaiyu

    2015-04-01

    Two new bridging ligands have been synthesized by combining substituted benzaldehydes with phenanthrolinopyrrole (php), resulting in new polyazine bridging ligands. The ligands have been characterized by (1)H NMR, mass spectroscopy, and elemental analysis. These new ligands display π-π* transitions above 500 nm with modest molar absorptivities. Upon excitation at the ligand-centered charge-transfer transition, weak emission with a maximum wavelength of 612 nm is observed. When coordinated to two ruthenium(II) bis(bipyridyl) groups, the new bimetallic complexes generated give an overall 4+ charge. The electronic transitions of the bimetallic ruthenium(II) complexes display traditional π-π* transitions at 287 nm and metal-to-ligand charge-transfer transitions at 452 nm with molar absorptivities greater than 30000 M(-1) cm(-1). Oxidation of the ruthenium(II) metal centers to ruthenium(III) occurs at potentials above 1.4 V versus the Ag/AgCl reference electrode. Spectroscopic and electrochemical measurements indicate that the ruthenium(II) moieties behave independently. Both complexes are water-soluble and show the ability to photonick plasmid DNA when irradiated with low-energy light above 550 nm. In addition, one of the complexes, [Ru(bpy)2php]2Van(4+), shows the ability to linearize plasmid DNA and gives evidence, by gel electrophoresis, of photoinduced binding to plasmid DNA. PMID:25798576

  20. Synthesis, DNA Polymerase Incorporation, and Enzymatic Phosphate Hydrolysis of Formamidopyrimidine Nucleoside Triphosphates

    PubMed Central

    Imoto, Shuhei; Patro, Jennifer N.; Jiang, Yu Lin; Oka, Natsuhisa; Greenberg, Marc M.

    2007-01-01

    The nucleoside triphosphates of N6-(2-deoxy-α,β-d-erythro-pentofuranosyl)-2,6-diamino-4-hydroxy-5-formamidopyrimidine (Fapy·dGTP) and its C-nucleoside analogue (β-C-Fapy·dGTP) were synthesized. The lability of the formamide group required that nucleoside triphosphate formation be carried out using an umpolung strategy in which pyrophosphate was activated toward nucleophilic attack. The Klenow fragment of DNA polymerase I from Escherichia coli accepted Fapy·dGTP and β-C-Fapy·dGTP as substrates much less efficiently than it did dGTP. Subsequent extension of a primer containing either modified nucleotide was less affected compared to when the native nucleotide is present at the 3′-terminus. The specificity constants are sufficiently large that nucleoside triphosphate incorporation could account for the level of Fapy·dG observed in cells if 1% of the dGTP pool is converted to Fapy·dGTP. Similarly, polymerase-mediated introduction of β-C-Fapy·dG could be useful for incorporating useful amounts of this nonhydrolyzable analogue for use as an inhibitor of base excision repair. The kinetic viability of these processes is enhanced by inefficient hydrolysis of Fapy·dGTP and β-C-Fapy·dGTP by MutT, the E. coli enzyme that releases pyrophosphate and the corresponding nucleoside monophosphate upon reaction with structurally related nucleoside triphosphates. PMID:17090045

  1. Validity of the tritiated thymidine method for estimating bacterial growth rates: measurement of isotope dilution during DNA synthesis

    SciTech Connect

    Pollard, P.C.; Moriarty, D.J.W.

    1984-12-01

    The rate of tritiated thymidine incorporation into DNA was used to estimate bacterial growth rates in aquatic environments. To be accurate, the calculation of growth rates has to include a factor for the dilution of isotope before incorporation. The validity of an isotope dilution analysis to determine this factor was verified in experiments reported here with cultures of a marine bacterium growing in a chemostat. Growth rates calculated from data on chemostat dilution rates and cell density agreed well with rates calculated by tritiated thymidine incorporation into DNA and isotope dilution analysis. With sufficiently high concentrations of exogenous thymidine, de novo synthesis of deoxythymidine monophosphate was inhibited, thereby preventing the endogenous dilution of isoope. The thymidine technique was also shown to be useful for measuring growth rates of mixed suspensions of bacteria growing anaerobically. Thymidine was incorporated into the DNA of a range of marine pseudomonads that were investigated. Three species did not take up thymidine. The common marine cyanobacterium Synechococcus species did not incorporate thymidine into DNA.

  2. DNA-templated microwave-hydrothermal synthesis of nanostructured hydroxyapatite for storing and sustained release of an antibacterial protein.

    PubMed

    Chen, Xi; Yang, Bin; Qi, Chao; Sun, Tuan-Wei; Chen, Feng; Wu, Jin; Feng, Xi-Ping; Zhu, Ying-Jie

    2016-01-28

    Hydroxyapatite (HA) is promising in various biomedical applications owing to its similar chemical composition, structure and properties to the inorganic component in natural hard tissues. Herein, we report a DNA-templated microwave-assisted hydrothermal strategy for the preparation of HA nanostructured materials. As a kind of natural biomacromolecule, DNA molecules open up a new way to the synthesis of HA nanostructured materials with well-defined structures and morphologies. The HA nanostructured materials with a nanosheet-assembled hierarchical structure and a HA nanorod ordered structure are successfully prepared. The important roles of DNA molecules and pH values in the formation of HA nanostructured materials are investigated, and a possible formation mechanism is proposed. The as-prepared HA nanostructured materials exhibit a relatively high adsorption ability for chicken immunoglobulin Y (IgY) protein and a sustained protein release behavior. The as-prepared HA nanostructured materials after loading the IgY protein show a high antimicrobial activity. Thus, the HA nanostructured materials prepared by the DNA-templated microwave hydrothermal method are promising for the applications in various areas such as the prevention and treatment of dental caries. PMID:26696032

  3. Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

    2016-09-01

    Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. PMID:27187190

  4. Synthesis, antiproliferative activity and DNA binding properties of novel 5-aminobenzimidazo[1,2-a]quinoline-6-carbonitriles.

    PubMed

    Perin, Nataša; Nhili, Raja; Ester, Katja; Laine, William; Karminski-Zamola, Grace; Kralj, Marijeta; David-Cordonnier, Marie-Hélène; Hranjec, Marijana

    2014-06-10

    The synthesis of 5-amino substituted benzimidazo[1,2-a]quinolines prepared by microwave assisted amination from halogeno substituted precursor was described. The majority of compounds were active at micromolar concentrations against colon, lung and breast carcinoma cell lines in vitro. The N,N-dimethylaminopropyl 9 and piperazinyl substituted derivative 19 showed the most pronounced activity towards all of the three tested tumor cell lines, which could be correlated to the presence of another N heteroatom and its potential interactions with biological targets. The DNA binding studies, consisting of UV/Visible absorbency, melting temperature studies, and fluorescence and circular dichroism titrations, revealed that compounds 9, 19 and 20 bind to DNA as strong intercalators. The cellular distribution analysis, based on compounds' intrinsic fluorescence, showed that compound 20 does not enter the cell, while compounds 9 and 19 do, which is in agreement with their cytotoxic effects. Compound 9 efficiently targets the nucleus whereas 19, which also showed DNA intercalating properties in vitro, was mostly localised in the cytoplasm suggesting that the antitumor mechanism of action is DNA-independent. PMID:24780599

  5. SYNTHESIS OF THE FULLY PROTECTED PHOSPHORAMIDITE OF THE BENZENE-DNA ADDUCT, N2- (4-HYDROXYPHENYL)-2'-DEOXYGUANOSINE AND INCORPORATION OF THE LATER INTO DNA OLIGOMERS

    SciTech Connect

    Chenna, Ahmed; Gupta, Ramesh C.; Bonala, Radha R.; Johnson, Francis; Huang, Bo

    2008-06-09

    N2-(4-Hydroxyphenyl)-2'-deoxyguanosine-5'-O-DMT-3'-phosphoramidite has been synthesized and used to incorporate the N2-(4-hydroxyphenyl)-2'-dG (N2-4-HOPh-dG) into DNA, using solid-state synthesis technology. The key step to obtaining the xenonucleoside is a palladium (Xantphos-chelated) catalyzed N2-arylation (Buchwald-Hartwig reaction) of a fully protected 2'-deoxyguanosine derivative by 4-isobutyryloxybromobenzene. The reaction proceeded in good yield and the adduct was converted to the required 5'-O-DMT-3'-O-phosphoramidite by standard methods. The latter was used to synthesize oligodeoxynucleotides in which the N2-4-HOPh-dG adduct was incorporated site-specifically. The oligomers were purified by reverse-phase HPLC. Enzymatic hydrolysis and HPLC analysis confirmed the presence of this adduct in the oligomers.

  6. Synthesis and in vitro characterization of antigen-conjugated polysaccharide as a CpG DNA carrier.

    PubMed

    Shimada, Naohiko; Ishii, Ken J; Takeda, Yoichi; Coban, Cevayir; Torii, Yuichi; Shinkai, Seiji; Akira, Shizuo; Sakurai, Kazuo

    2006-01-01

    Oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNAs) are known as an immune adjuvant. CpG DNAs coupled with a particular antigen enabling both CpG DNA and antigen delivery to the same antigen-presenting cell have been shown to be more effective. Based on our previous finding that beta-(1-->3)-D-glucan schizophyllan (SPG) can be used as a CpG DNA carrier, here we present the synthesis of an antigen-conjugated SPG and the characterization of the conjugate. Ovalbumin (OVA, 43 kDa) was used as a model antigen, and two OVA were conjugated to one SPG molecule (M(w) = 150,000), denoted by OVA-SPG. Circular dichroism and gel electrophoresis showed that OVA-SPG could form a complex with a (dA)(40)-tailed CpG DNA at the 3' end (1,668-(dA)(40)). When OVA-SPG was added to macrophages (J774.A1), the amount of the ingested OVA-SPG was increased compared with that of OVA itself, suggesting that Dectin-1 (proinflammatory nonopsonic receptor for beta-glucans) is involved to ingest OVA-SPG. Furthermore, the complex of the conjugate and DNA was co-localized in the same vesicles, implying that OVA (antigen) and CpG DNA (adjuvant) were ingested into the cell at the same time. This paper shows that OVA-SPG can be used as a CpG DNA carrier to induce antigen-specific immune responses. PMID:16984120

  7. Amplified and multiplexed detection of DNA using the dendritic rolling circle amplified synthesis of DNAzyme reporter units.

    PubMed

    Wang, Fuan; Lu, Chun-Hua; Liu, Xiaoqing; Freage, Lina; Willner, Itamar

    2014-02-01

    The amplified, highly sensitive detection of DNA using the dendritic rolling circle amplification (RCA) is introduced. The analytical platform includes a circular DNA and a structurally tailored hairpin structure. The circular nucleic acid template includes a recognition sequence for the analyte DNA (the Tay-Sachs mutant gene), a complementary sequence to the Mg(2+)-dependent DNAzyme, and a sequence identical to the loop region of the coadded hairpin structure. The functional hairpin in the system consists of the analyte-sequence that is caged in the stem region and a single-stranded loop domain that communicates with the RCA product. The analyte activates the RCA process, leading to DNA chains consisting of the Mg(2+)-dependent DNAzyme and sequences that are complementary to the loop of the functional hairpin structure. Opening of the coadded hairpin releases the caged analyte sequence, resulting in the dendritic RCA-induced synthesis of the Mg(2+)-dependent DNAzyme units. The DNAzyme-catalyzed cleavage of a fluorophore/quencher-modified substrate leads to a fluorescence readout signal. The method enabled the analysis of the target DNA with a detection limit corresponding to 1 aM. By the design of two different circular DNAs that include recognition sites for two different target genes, complementary sequences for two different Mg(2+)-dependent DNAzyme sequences and two different functional hairpin structures, the dendritic RCA-stimulated multiplexed analysis of two different genes is demonstrated. The amplified dendritic RCA detection of DNA is further implemented to yield the hemin/G-quadruplex horseradish peroxidase (HRP)-mimicking DNAzyme as catalytic labels that provide colorimetric or chemiluminescent readout signals. PMID:24377284

  8. PATTERNS OF RNA SYNTHESIS IN T5-INFECTED CELLS I. AS STUDIED BY THE TECHNIQUE OF DNA-RNA HYBRIDIZATION-COMPETITION*

    PubMed Central

    Moyer, Richard W.; Buchanan, John M.

    1969-01-01

    The RNA-labeling patterns obtained after T5 infection of Escherichia coli F agree with the patterns of protein labeling published by McCorquodale and Buchanan.1 Three distinct classes of RNA formed sequentially during the period of viral development can be recognized by the DNA-RNA hybridization-competition technique. Class I RNA is formed within 5 minutes after the beginning of viral metabolism and corresponds to the RNA synthesized in response to infection with the 8 per cent segment of T5 DNA. Protein synthesis directed by this 8 per cent segment is required in some capacity for the cessation of class I synthesis and the beginning of the synthesis of class II at 4 to 5 min after infection. Class III RNA synthesis begins between 9 and 12 minutes. Its appearance is prevented when chloramphenicol is added immediately after complete expression of class I functions. PMID:4916923

  9. The DnaJ-Like Zinc Finger Domain Protein PSA2 Affects Light Acclimation and Chloroplast Development in Arabidopsis thaliana.

    PubMed

    Wang, Yan-Wen; Chen, Si-Ming; Wang, Wei-Jie; Huang, Xing-Qi; Zhou, Chang-Fang; Zhuang, Zhong; Lu, Shan

    2016-01-01

    The biosynthesis of chlorophylls and carotenoids and the assembly of thylakoid membranes are critical for the photoautotrophic growth of plants. Different factors are involved in these two processes. In recent years, members of the DnaJ-like zinc finger domain proteins have been found to take part in the biogenesis and/or the maintenance of plastids. One member of this family of proteins, PSA2, was recently found to localize to the thylakoid lumen and regulate the accumulation of photosystem I. In this study, we report that the silencing of PSA2 in Arabidopsis thaliana resulted in variegated leaves and retarded growth. Although both chlorophylls and total carotenoids decreased in the psa2 mutant, violaxanthin, and zeaxanthin accumulated in the mutant seedlings grown under growth condition. Lower levels of non-photochemical quenching and electron transport rate were also found in the psa2 mutant seedlings under growth condition compared with those of the wild-type plants, indicating an impaired capability to acclimate to normal light irradiance when PSA2 was silenced. Moreover, we also observed an abnormal assembly of grana thylakoids and poorly developed stroma thylakoids in psa2 chloroplasts. Taken together, our results demonstrate that PSA2 is a member of the DnaJ-like zinc finger domain protein family that affects light acclimation and chloroplast development. PMID:27047527

  10. The DnaJ-Like Zinc Finger Domain Protein PSA2 Affects Light Acclimation and Chloroplast Development in Arabidopsis thaliana

    PubMed Central

    Wang, Yan-Wen; Chen, Si-Ming; Wang, Wei-Jie; Huang, Xing-Qi; Zhou, Chang-Fang; Zhuang, Zhong; Lu, Shan

    2016-01-01

    The biosynthesis of chlorophylls and carotenoids and the assembly of thylakoid membranes are critical for the photoautotrophic growth of plants. Different factors are involved in these two processes. In recent years, members of the DnaJ-like zinc finger domain proteins have been found to take part in the biogenesis and/or the maintenance of plastids. One member of this family of proteins, PSA2, was recently found to localize to the thylakoid lumen and regulate the accumulation of photosystem I. In this study, we report that the silencing of PSA2 in Arabidopsis thaliana resulted in variegated leaves and retarded growth. Although both chlorophylls and total carotenoids decreased in the psa2 mutant, violaxanthin, and zeaxanthin accumulated in the mutant seedlings grown under growth condition. Lower levels of non-photochemical quenching and electron transport rate were also found in the psa2 mutant seedlings under growth condition compared with those of the wild-type plants, indicating an impaired capability to acclimate to normal light irradiance when PSA2 was silenced. Moreover, we also observed an abnormal assembly of grana thylakoids and poorly developed stroma thylakoids in psa2 chloroplasts. Taken together, our results demonstrate that PSA2 is a member of the DnaJ-like zinc finger domain protein family that affects light acclimation and chloroplast development. PMID:27047527

  11. The mycotoxins alternariol and alternariol methyl ether negatively affect progesterone synthesis in porcine granulosa cells in vitro.

    PubMed

    Tiemann, U; Tomek, W; Schneider, F; Müller, M; Pöhland, R; Vanselow, J

    2009-04-25

    Mycotoxins as contaminants of animal food can impair fertility in farm animals. In the regulation of female fertility the ovarian steroid hormone progesterone (P(4)) plays an important role. In the present study we have investigated the influence of the mycotoxins alternariol (AOH), alternariol mono-methyl ether (AME), and tenuazonic acid (TeA) on cell viability, P(4) synthesis, abundance of the key enzymes of P(4) synthesis, P450 cholesterol side-chain cleavage enzyme (P450SCC) and 3-beta-hydroxysteroid dehydrogenase (3-beta-HSD), and of the corresponding Cyp11a1 and Hsd3b transcripts in cultured pig granulosa cells. Already 0.8 microM, AOH and AME inhibited P(4) secretion and 1.6 microM also significantly reduced cell viability. The abundance of P450scc protein but not of Cyp11a1 or Hsd3b transcripts was already significantly reduced by 0.8 microM AOH and AME. 1.6 microM AOH but not AME significantly reduced the abundance of alpha-tubulin and also clearly affected actin protein concentrations. TeA neither impaired viability nor P(4) secretion. Also mycotoxin extracts isolated from naturally occurring Alternaria strains by HPLC purification inhibited cell viability and P(4) synthesis, however at higher concentrations compared to AOH and AME. In conclusion, AOH and AME, but not TeA specifically inhibited P(4) secretion in cultured porcine granulosa cells. Alternaria toxin contaminated food may therefore affect reproductive performance in pig and other mammalian species. PMID:19429235

  12. Induction of human beta-interferon synthesis with poly(rI . rC) in mouse cells transfected with cloned cDNA plasmids.

    PubMed Central

    Pitha, P M; Ciufo, D M; Kellum, M; Raj, N B; Reyes, G R; Hayward, G S

    1982-01-01

    Human genomic DNA and plasmids carrying portions of the cDNA gene for human beta-interferon have been introduced into mouse Ltk- cells by cotransfection with a herpes simplex virus thymidine kinase (TK) gene. One plasmid contains 840 base pairs of human DNA complementary to pre-beta-interferon mRNA inserted into pBR322, whereas the other plasmids have hybrid genes containing only the 560-base pair coding region inserted under the transcriptional control of the TK promoter. Constitutive interferon production could not be detected in any of the mouse TK+ cell lines tested. Nevertheless, synthesis of interferon could be induced by poly(rI . rC) treatment in at least 16 of these cell lines, including clones transfected with genomic DNA, the beta-interferon cDNA, and the TK-beta-interferon cDNA hybrid gene. The interferon produced was specific for human cells and could be neutralized by antiserum against human beta-interferon. In contrast to human fibroblast cells, in which the synthesis of induced beta-interferon is transient, the poly(rI . rC)-induced TK+ lines continued to produce beta-interferon for prolonged periods of time and did not respond to superinduction conditions. Therefore, in transfected mouse cells, the coding DNA sequence from the human beta-interferon gene, without any of the adjacent 3' or 5' flanking human DNA sequences, was sufficient both to direct synthesis of biologically active product and to respond to the specific induction system that operates in human cells. However, the mechanism that switches off the synthesis of induced interferon in human cells appears not to operate in mouse cells transfected with beta-interferon cDNA. PMID:6956863

  13. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  14. Mitochondrial transcription terminator family members mTTF and mTerf5 have opposing roles in coordination of mtDNA synthesis.

    PubMed

    Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T

    2013-01-01

    All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965

  15. DNA synthesis and microtubule assembly-related events in fertilized Paracentrotus lividus eggs: reversible inhibition by 10 mM procaine.

    PubMed

    Raymond, M N; Foucault, G; Coffe, G; Pudles, J

    1986-04-01

    This report describes the effects of 10 mM procaine on microtubule assembly and on DNA synthesis, as followed by [3H]colchicine binding assays and [3H]thymidine incorporation respectively, in fertilized Paracentrotus lividus eggs. In the absence of microtubule assembly inhibitors, about 25% of the total egg tubulin is submitted to two cycles of polymerization prior to the first cell division, this polymerization process precedes DNA synthesis. If the zygotes are treated with 10 mM procaine in the course of the cell cycle, tubulin polymerization is inhibited or microtubules are disassembled. DNA synthesis is inhibited when procaine treatment is performed 10 min, before the initiation of the S-period. However, when the drug is applied in the course of this synthetic period, the process is normally accomplished, but the next S-period becomes inhibited. Moreover, procaine treatment increases the cytoplasmic pH of the fertilized eggs by about 0.6 to 0.8 pH units. This pH increase precedes microtubule disassembly and inhibition of DNA synthesis. Washing out the drug induces a decrease of the intracellular pH which returns to about the same value as that of the fertilized egg controls. This pH change is then followed by the reinitiation of microtubule assembly, DNA synthesis and cell division. Our results show that the inhibition of both tubulin polymerization and DNA synthesis in fertilized eggs treated with 10 mM procaine, appears to be related to the drug-induced increase in cytoplasmic pH. PMID:3709552

  16. Campomanesia adamantium extract induces DNA damage, apoptosis, and affects cyclophosphamide metabolism.

    PubMed

    Martello, M D; David, N; Matuo, R; Carvalho, P C; Navarro, S D; Monreal, A C D; Cunha-Laura, A L; Cardoso, C A L; Kassuya, C A L; Oliveira, R J

    2016-01-01

    Campomanesia adamantium (Cambess.) O. Berg. is originally from Brazil. Its leaves and fruits have medicinal properties such as anti-inflammatory, antidiarrheal and antiseptic properties. However, the mutagenic potential of this species has been reported in few studies. This study describes the mutagenic/antimutagenic, splenic phagocytic, and apoptotic activities of C. adamantium hydroethanolic extract with or without cyclophosphamide in Swiss mice. The animals orally received the hydroethanolic extract at doses of 30, 100, or 300 mg/kg with or without 100 mg/kg cyclophosphamide. Mutagenesis was evaluated by performing the micronucleus assay after treatment for 24, 48, and 72 h, while splenic phagocytic and apoptotic effects were investigated after 72 h. Short-term exposure of 30 and 100 mg/kg extract induced mild clastogenic/aneugenic effects and increased splenic phagocytosis and apoptosis in the liver, spleen, and kidneys. When the extract was administered in combination with cyclophosphamide, micronucleus frequency and apoptosis reduced. Extract components might affect cyclophosphamide metabolism, which possibly leads to increased clearance of this chemotherapeutic agent. C. adamantium showed mutagenic activity and it may decrease the effectiveness of drugs with metabolic pathways similar to those associated with cyclophosphamide. Thus, caution should be exercised while consuming these extracts, especially when received in combination with other drugs. PMID:27173259

  17. Novel Organotin(IV)-Schiff Base Complexes: Synthesis, Characterization, Antimicrobial Activity, and DNA Interaction Studies

    PubMed Central

    Prasad, K. Shiva; Kumar, L. Shiva; Prasad, Melvin; Revanasiddappa, Hosakere D.

    2010-01-01

    Four organotin(IV) complexes with 2-(2-hydroxybenzylideneamino)isoindoline-1,3-dione (L1), and 4-(4-hydroxy-3-methoxybenzylideneamino-N-(pyrimidin-2-yl)benzenesulfonamide (L2) were synthesized and well characterized by analytical and spectral studies. The synthesized compounds were tested for antimicrobial activity by disc diffusion method. The DNA binding of the complexes 1 and 3 with CT-DNA has been performed with absorption spectroscopy, which showed that both the complexes are avid binders of CT-DNA. Also the nuclease activity of complexes 1 and 3 with plasmid DNA (pUC19) was studied using agarose gel electrophoresis. The complex 1 can act as effective DNA cleaving agent when compared to complex 3 resulting in the nicked form of DNA under physiological conditions. The gel was run both in the absence and presence of the oxidizing agent. PMID:21253533

  18. A Novel Styryldehydropyridocolinium Homodimer: Synthesis and Fluorescence Properties Upon Interaction with DNA.

    PubMed

    Yao, Huirong; Chang, Lifang; Liu, Chang; Jiao, Xiaojie; He, Song; Liu, Haijun; Zeng, Xianshun

    2015-11-01

    A novel homodimer of the styryldehydropyridocolinium dye (TPTP) has been synthesized and characterized. Free TPTP exhibited low fluorescence quantum yield and large Stokes shift (over 160 nm) in water. However, it showed a significant fluorescence turn-on effect upon intercalation into DNA base pairs. Meanwhile, the fluorescence intensity of the intercalated structures formed by TPTP and DNA decreased quickly upon addition of deoxyribonuclease I, indicating that the dye can be used to monitor deoxyribonuclease I activity and DNA hydrolysis. Electrophoresis analysis revealed that the dye had intercalative binding to DNA and can potentially be used for DNA staining in electrophoresis. Thus, the innate nature of large Stokes shift and excellent fluorescence turn on effect upon interaction with DNA endue the dye with a wide range of applications. PMID:26384336

  19. Modifications to the translational apparatus which affect the regulation of protein synthesis in sea urchin embryos

    SciTech Connect

    Scalise, F.W.

    1988-01-01

    Protein synthesis can be regulated at a number of cellular levels. I have examined how modifications to specific components of the protein synthetic machinery are involved in regulating the efficiency of initiation of translation during early sea urchin embryogenesis. It is demonstrated that Ca{sup 2+} concentrations exceeding 500 uM cause the inhibition of protein synthesis in cell-free translation lysates prepared from sea urchin embryos. Specific changes in the state of phosphorylation of at least 8 proteins occur during this Ca{sup 2+}-mediated repression of translation. Analysis of these proteins has indicated that, unlike mammalian systems, there is no detectable level of Ca{sup 2+}-dependent phosphorylation of the {alpha}subunit eIF-2. Two of the proteins which do become phosphorylated in response to Ca{sup 2+} are calmodulin and an isoelectric form of sea urchin eIF-4D. In addition, 2 proteins which share similarities with kinases involved in the regulation of protein synthesis in mammalian cells, also become phosphorylated. I have investigated the consequences of changes in eIF-4D during sea urchin embryogenesis because it has been proposed that a polyamine-mediated conversion of lysine to hypusine in this factor may enhance translational activity. It is demonstrated that ({sup 3}H) spermidine-derived radioactivity is incorporated into a number of proteins when sea urchin embryos are labeled in vivo, and that the pattern of individual proteins that become labeled changes over the course of the first 30 hr of development.

  20. Inhibition of human carcinoma cell growth and DNA synthesis by silibinin, an active constituent of milk thistle: comparison with silymarin.

    PubMed

    Bhatia, N; Zhao, J; Wolf, D M; Agarwal, R

    1999-12-01

    Several studies from our laboratory have shown the cancer chemopreventive and anti-carcinogenic effects of silymarin, a flavonoid antioxidant isolated from milk thistle, in long-term tumorigenesis models and in human prostate, breast and cervical carcinoma cells. Since silymarin is composed mainly of silibinin with small amounts of other stereoisomers of silibinin, in the present communication, studies were performed to assess whether the cancer preventive and anti-carcinogenic effects of silymarin are due to its major component silibinin. Treatment of different prostate, breast, and cervical human carcinoma cells with silibinin resulted in a highly significant inhibition of both cell growth and DNA synthesis in a time-dependent manner with large loss of cell viability only in case of cervical carcinoma cells. When compared with silymarin, these effects of silibinin were consistent and comparable in terms of cell growth and DNA synthesis inhibition, and loss of cell viability. Based on the comparable results of silibinin and silymarin, we suggest that the cancer chemopreventive and anti-carcinogenic effects of silymarin reported earlier are due to the main constituent silibinin. PMID:10660092

  1. Mitochondrial DNA, RNA and protein synthesis in normal, hypothyroid and mildly hyperthyroid rat liver during cold exposure.

    PubMed

    Goglia, F; Liverini, G; Lanni, A; Barletta, A

    1988-02-01

    We have examined in isolated liver mitochondria the effect of cold exposure on DNA, RNA and protein synthesis in normal, hypothyroid and mildly hyperthyroid rats. In normal rats DNA polymerase activity increased from the first day of cold exposure remaining high up to the fifteenth day. RNA polymerase and protein synthesis were stimulated from the fifth day of cold exposure, maintaining a high level up to the fifteenth day. These activities were related to serum triiodothyronine (T3) levels. Indeed propylthiouracil (PTU) administration to cold-exposed rats drastically depressed the above activities, whereas T3 administration to PTU-treated cold-exposed rats restored them to about the values prevalent in normal cold-exposed rats. The translation products analyzed by gel electrophoresis showed that different effects may be exerted by T3 depending on whether its circulating levels are physiologically or pharmacologically modified. These findings suggest that T3 may be involved in the regulation of the acclimation process by acting, presumably with a permissive role, on those activities which determine a modification of the mitochondrial morphometric features and an increase in mitochondria number and turnover. PMID:2451625

  2. ES936 stimulates DNA synthesis in HeLa cells independently on NAD(P)H:quinone oxidoreductase 1 inhibition, through a mechanism involving p38 MAPK.

    PubMed

    González-Aragón, David; Alcaín, Francisco J; Ariza, Julia; Jódar, Laura; Barbarroja, Nuria; López-Pedrera, Chary; Villalba, José M

    2010-07-30

    The indolequinone ES936 (5-methoxy-1,2-dimethyl-3-[(4-nitrophenol)methyl]-indole-4,7-dione) is a potent mechanism-based inhibitor of NAD(P)H:quinone oxidoreductase 1 (NQO1). Here, we report that ES936 significantly stimulated thymidine incorporation in sparse cultures of human adenocarcinoma HeLa cells, but was without effect in dense cultures. Stimulation of DNA synthesis was not related with a DNA repair response because an increase in thymidine incorporation was not observed in cells treated with 2,5 bis-[1-aziridyl]-1,4 benzoquinone, a well-established antitumor quinone that causes DNA damage. Conversely, it was related with an increase of cell growth. NQO1 inhibition was not involved in ES936 stimulation of DNA synthesis, because the same response was observed in cells where NQO1 expression had been knocked down by small interfering RNA. Stimulation of DNA synthesis was reverted by treatment with ambroxol, a SOD mimetic, and by pyruvate, an efficient peroxide scavenger, supporting the involvement of alterations in cellular redox state. Pharmacological inhibition of p38 with either SB203580 or PD169316 completely abolished ES936-stimulated DNA synthesis, indicating the requirement of p38 activity. This is the first report that demonstrates the existence of an ES936-sensitive system which is separate from NQO1, modulating the redox state and cell growth in HeLa cells through a p38-dependent mechanism. Our results show that the effect ES936 exerts on DNA synthesis may be either positive or negative depending on the cellular context and growth conditions. PMID:20433816

  3. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives.

    PubMed

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; da Silva, Lúcia Patrícia Bezerra Gomes; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Ruiz, Ana Lucia Tasca Gois; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a-h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 10(4) to 1.0 × 10(6) M(-1) and quenching constants from -0.2 × 10(4) to 2.18 × 10(4) M(-1) indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N- (4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  4. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  5. Synthesis of a novel water-soluble zinc phthalocyanine and its CT DNA-damaging studies

    NASA Astrophysics Data System (ADS)

    Wang, Tianhui; Wang, Ao; Zhou, Lin; Lu, Shan; Jiang, Weiwei; Lin, Yun; Zhou, Jiahong; Wei, Shaohua

    2013-11-01

    A novel 3-(4-methoxybenzylamino) propanoic acid substituted water-soluble zinc phthalocyanine (CNPcZn) was synthesized. The interaction between CNPcZn with calf thymus DNA (CT DNA) was studied using spectroscopic methods. The studies indicated that CNPcZn has strong affinity to CT DNA, and furthermore, CNZnPc showed excellent photodamaging activity to CT DNA. Above results indicated that such CNPcZn has great potential to be used as an effective photosensitizer in the field of photodynamic therapy.

  6. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools. PMID:26494264

  7. Complex Multiple-Nucleotide Substitution Mutations Causing Human Inherited Disease Reveal Novel Insights into the Action of Translesion Synthesis DNA Polymerases.

    PubMed

    Chen, Jian-Min; Férec, Claude; Cooper, David N

    2015-11-01

    Translesion synthesis (TLS) DNA polymerases allow the bypass of unrepaired lesions during DNA replication. Based upon mutational signatures of a subtype of multiple-nucleotide substitution (MNS) mutations causing human inherited disease, we have recently postulated two properties of TLS DNA polymerases in DNA repair, namely, the generation of neo-microhomologies potentiating strand-misalignment, and additional microlesions within the templated inserts when recruited to stalled replication forks. To provide further support for this postulate, we analyzed the mutational signatures of a new and complex subtype of pathogenic MNS mutation. Several mutations containing long templated inserts (8-19 bp) that are highly informative with regard to their underlying mutational mechanisms, harbor imprints of TLS DNA polymerase action. Dissecting the mechanism underlying the generation of the 19-bp insert implicated repeated participation of TLS DNA polymerases in the conversion of a damaged base into a complex MNS lesion through a process of successive template switching and bypass repair. PMID:26172832

  8. The Effects of Magnesium Ions on the Enzymatic Synthesis of Ligand-Bearing Artificial DNA by Template-Independent Polymerase

    PubMed Central

    Takezawa, Yusuke; Kobayashi, Teruki; Shionoya, Mitsuhiko

    2016-01-01

    A metal-mediated base pair, composed of two ligand-bearing nucleotides and a bridging metal ion, is one of the most promising components for developing DNA-based functional molecules. We have recently reported an enzymatic method to synthesize hydroxypyridone (H)-type ligand-bearing artificial DNA strands. Terminal deoxynucleotidyl transferase (TdT), a template-independent DNA polymerase, was found to oligomerize H nucleotides to afford ligand-bearing DNAs, which were subsequently hybridized through copper-mediated base pairing (H–CuII–H). In this study, we investigated the effects of a metal cofactor, MgII ion, on the TdT-catalyzed polymerization of H nucleotides. At a high MgII concentration (10 mM), the reaction was halted after several H nucleotides were appended. In contrast, at lower MgII concentrations, H nucleotides were further appended to the H-tailed product to afford longer ligand-bearing DNA strands. An electrophoresis mobility shift assay revealed that the binding affinity of TdT to the H-tailed DNAs depends on the MgII concentration. In the presence of excess MgII ions, TdT did not bind to the H-tailed strands; thus, further elongation was impeded. This is possibly because the interaction with MgII ions caused folding of the H-tailed strands into unfavorable secondary structures. This finding provides an insight into the enzymatic synthesis of longer ligand-bearing DNA strands. PMID:27338351

  9. Boron Clusters as a Platform for New Materials: Synthesis of Functionalized o-Carborane (C2 B10 H12 ) Derivatives Incorporating DNA Fragments.

    PubMed

    Janczak, Slawomir; Olejniczak, Agnieszka; Balabańska, Sandra; Chmielewski, Marcin K; Lupu, Marius; Viñas, Clara; Lesnikowski, Zbigniew J

    2015-10-19

    A synthetic strategy for functionalization of the three vertices of o-carborane and the attachment of the obtained triped to the solid support was developed. Further functionalization of the triped with short DNA sequences by automated DNA synthesis was achieved. The proposed methodology is a first example of boron cluster chemistry on a solid support opening new perspectives in boron cluster functionalization. PMID:26346614

  10. Microtubule configurations and nuclear DNA synthesis during initiation of suspensor-bearing embryos from Brassica napus cv. Topas microspores.

    PubMed

    Dubas, Ewa; Custers, Jan; Kieft, Henk; Wędzony, Maria; van Lammeren, André A M

    2011-11-01

    In the new Brassica napus microspore culture system, wherein embryos with suspensors are formed, ab initio mimics zygotic embryogenesis. The system provides a powerful in vitro tool for studying the diverse developmental processes that take place during early stages of plant embryogenesis. Here, we studied in this new culture system both the temporal and spatial distribution of nuclear DNA synthesis places and the organization of the microtubular (MT) cytoskeleton, which were visualized with a refined whole mount immunolocalization technology and 3D confocal laser scanning microscopy. A 'mild' heat stress induced microspores to elongate, to rearrange their MT cytoskeleton and to re-enter the cell cycle and perform a predictable sequence of divisions. These events led to the formation of a filamentous suspensor-like structure, of which the distal tip cell gave rise to the embryo proper. Cells of the developing pro-embryo characterized endoplasmic (EMTs) and cortical microtubules (CMTs) in various configurations in the successive stages of the cell cycle. However, the most prominent changes in MT configurations and nuclear DNA replication concerned the first sporophytic division occurring within microspores and the apical cell of the pro-embryo. Microspore embryogenesis was preceded by pre-prophase band formation and DNA synthesis. The apical cell of the pro-embryo exhibited a random organization of CMTs and, in relation to this, isotropic expansion occurred, mimicking the development of the apical cell of the zygotic situation. Moreover, the apical cell entered the S phase shortly before it divided transversally at the stage that the suspensor was 3-8 celled. PMID:21779827

  11. Synthesis of Sequence-Specific DNA-Protein Conjugates via a Reductive Amination Strategy

    PubMed Central

    Wickramaratne, Susith; Mukherjee, Shivam; Villalta, Peter W.; Schärer, Orlando D.; Tretyakova, Natalia

    2013-01-01

    DNA-protein cross-links (DPCs) are ubiquitous, structurally diverse DNA lesions formed upon exposure to bis-electrophiles, transition metals, UV light, and reactive oxygen species. Because of their super-bulky, helix distorting nature, DPCs interfere with DNA replication, transcription, and repair, potentially contributing to mutagenesis and carcinogenesis. However, the biological implications of DPC lesions have not been fully elucidated due to the difficulty of generating site-specific DNA substrates representative of DPC lesions formed in vivo. In the present study, a novel approach involving post-synthetic reductive amination has been developed to prepare a range of hydrolytically stable lesions structurally mimicking the DPCs produced between the N7 position of guanine in DNA and basic lysine or arginine side chains of proteins and peptides. PMID:23885807

  12. Disruption of the serine/threonine protein kinase H affects phthiocerol dimycocerosates synthesis in Mycobacterium tuberculosis

    PubMed Central

    Gómez-Velasco, Anaximandro; Bach, Horacio; Rana, Amrita K.; Cox, Liam R.; Bhatt, Apoorva; Besra, Gurdyal S.

    2013-01-01

    Mycobacterium tuberculosis possesses a complex cell wall that is unique and essential for interaction of the pathogen with its human host. Emerging evidence suggests that the biosynthesis of complex cell-wall lipids is mediated by serine/threonine protein kinases (STPKs). Herein, we show, using in vivo radiolabelling, MS and immunostaining analyses, that targeted deletion of one of the STPKs, pknH, attenuates the production of phthiocerol dimycocerosates (PDIMs), a major M. tuberculosis virulence lipid. Comparative protein expression analysis revealed that proteins in the PDIM biosynthetic pathway are differentially expressed in a deleted pknH strain. Furthermore, we analysed the composition of the major lipoglycans, lipoarabinomannan (LAM) and lipomannan (LM), and found a twofold higher LAM/LM ratio in the mutant strain. Thus, we provide experimental evidence that PknH contributes to the production and synthesis of M. tuberculosis cell-wall components. PMID:23412844

  13. Nitrogen Assimilation and Protein Synthesis in Wheat Seedlings As Affected by Mineral Nutrition. I. Macronutrients 1

    PubMed Central

    Harper, James E.; Paulsen, Gary M.

    1969-01-01

    Deficiencies of each macronutrient (N, P, K, Ca. Mg, S, and Fe) decreased the specific activity of nitrate reductase from Triticum aestivum L. seedlings. Nitrate content was decreased by N, P, K, Ca, and Mg deficiencies and unaffected by S and Fe deficiencies. Glutamic acid dehydrogenase activity was decreased by N, P, and S deficiencies, unchanged by K deficiency, and increased by Ca, Mg, and Fe deficiencies. Glutamine synthetase activity closely paralleled nitrate reductase activity and was decreased by deficiencies of N, P, K, Ca, Mg, and S. Glutamic-oxaloacetic transaminase was not sensitive to macronutrient deficiencies. High 14C-leucine incorporation into tissue sections of N-, P-, K-, Ca-, and S-deficient seedlings did not appear indicative of protein synthesis rates in intact seedlings. Nutritional deficiencies apparently depleted endogenous amino acid pools and caused less inhibition of exogenous 14C-leucine incorporation into protein. PMID:16657034

  14. (Starch synthesis in the maize endosperm as affected by starch synthesizing mutants)

    SciTech Connect

    Not Available

    1985-01-01

    The goal of this project is to investigate the steps necessary to effect starch synthesis in developing endosperms of maize with the primary experimental probes being the mutants in which this process is disrupted. The authors have given considerable attention to the presence of a soluble enzyme complex which can synthesize de novo phospho-oligosaccharides with Glc-1-P and Glc-1,6-bisP as substrates. If Glc-1,6-bisP is not present in the reaction mixture, it can be synthesized slowly from Glc-1-P, but its presence in the reaction mixture markedly accelerates the synthesis of phospho-oligosaccharides. The enzyme complex is capable of synthesizing Glc-1,6-bisP and Glc when given either Glc-1-P or Glc-6-P as a substrate. Glc-1,6-bisP can also be formed from Fru-1,6-bisP. The enzyme complex with amylopectin and Glc-1,6-bisP as substrates will add Glc-6-P to the nonreducing ends of the amylopectin molecules. There is also a starch granule-bound phospho-oligosaccharide synthase present in the developing endosperms, but it has been less intensively investigated than the soluble form. They hypothesize that these enzymes synthesize the primers to which the enzymes capable of synthesizing alpha-1,4 glucans add glucose molecules and that their ability to utilize Glc-1,6-bisP accounts for the phosphate groups esterified to some glucose moieties of the starch.

  15. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    PubMed

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone. PMID:27139727

  16. Alteration of mitochondrial DNA and RNA level in human fibroblasts with impaired vitamin B12 coenzyme synthesis.

    PubMed

    Cantatore, P; Petruzzella, V; Nicoletti, C; Papadia, F; Fracasso, F; Rustin, P; Gadaleta, M N

    1998-08-01

    Alterations of mitochondrial (mt) nucleic acid metabolism in methylmalonic aciduria (MMA) were studied in two cell lines from skin fibroblasts of patients with mitochondrial (GM00595) or cytosolic (GM10011) defects in the biosynthesis pathways of cobalamin coenzymes. The mtDNA level increased two-fold in GM00595 cells, which carry a mt defect in the adenosylcobalamin synthesis, whereas no appreciable change was found in GM10011 cells. The content of the two rRNAs 16S and 12S mtRNAs, normalized for the mtDNA copy number, decreased by 70% and 50% in GM00595 and GM10011, respectively. The normalized content of ND1, ND2 and CO I mRNAs decreased in GM00595, but was unchanged in GM10011. Respiratory chain complex activities measured in these two cell lines were not different from control activities. These data suggest that the maintenance of the mt function is due to doubling of mtDNA and that this compensatory response takes place only in those cells in which the greater reduction of the level of rRNA might have brought the content of these transcripts below the threshold value for optimal expression of the mt genome. PMID:9720919

  17. Nitrogen Assimilation and Protein Synthesis in Wheat Seedlings as Affected by Mineral Nutrition. II. Micronutrients 1

    PubMed Central

    Harper, James E.; Paulsen, Gary M.

    1969-01-01

    Activity of nitrate reductase from Triticum aestivum L. seedlings was decreased by deficiencies of molybdenum, zinc, and chlorine. Nitrate accumulated in molybdenum-deficient seedlings, declined in zinc-deficient seedlings, and was unaffected by the other micronutrient treatments. Glutamic acid dehydrogenase activity was decreased by deficiency of molybdenum, the only nutrient that affected the enzyme. Glutamine synthetase activity was decreased only by copper deficiency, and glutamic-oxaloacetic transaminase was not affected by any micronutrient deficiencies. Incorporation of 14C-leucine into protein by wheat seedlings was increased by molybdenum deficiency, apparently because of decreased inhibition from endogenous amino acids, and was decreased by copper deficiency. Protein content was not affected significantly by the micronutrient treatments. PMID:16657114

  18. Longer resistance of some DNA traits from BT176 maize to gastric juice from gastrointestinal affected patients.

    PubMed

    Ferrini, A M; Mannoni, V; Pontieri, E; Pourshaban, M

    2007-01-01

    The presence of antibiotic resistance marker genes in genetically engineered plants is one of the most controversial issues related to Genetically Modified Organism (GMO)-containing food, raising concern about the possibility that these markers could increase the pool of antibiotic resistance genes. This study investigates the in vitro survival of genes bla and cryIA(b) of maize Bt176 in human gastric juice samples. Five samples of gastric juice were collected from patients affected by gastro-esophageal reflux or celiac disease and three additional samples were obtained by pH modification with NaHCO3. DNA was extracted from maize Bt176 and incubated with samples of gastric juices at different times. The survival of the target traits (bla gene, whole 1914 bp gene cry1A(b), and its 211 bp fragment) was determined using PCR. The stability of the target genes was an inverse function of their lengths in all the samples. Survival in samples from untreated subjects was below the normal physiological time of gastric digestion. On the contrary, survival time in samples from patients under anti-acid drug treatment or in samples whose pH was modified, resulted strongly increased. Our data indicate the possibility that in particular cases the survival time could be so delayed that, as a consequence, some traits of DNA could reach the intestine. In general, this aspect must be considered for vulnerable consumers (people suffering from gastrointestinal diseases related to altered digestive functionality, physiological problems or drug side-effects) in the risk analysis usually referred to healthy subjects. PMID:17346434

  19. Gas-phase synthesis of solid state DNA nanoparticles stabilized by l-leucine.

    PubMed

    Raula, Janne; Hanzlíková, Martina; Rahikkala, Antti; Hautala, Juho; Kauppinen, Esko I; Urtti, Arto; Yliperttula, Marjo

    2013-02-28

    Aerosol flow reactor is used to generate solid-state nanoparticles in a one-step process that is based on drying of aerosol droplets in continuous flow. We investigated the applicability of aerosol flow reactor method to prepare solid state DNA nanoparticles. Precursor solutions of plasmid DNA with or without complexing agent (polyethylenimine), coating material (l-leucine) and mannitol (bulking material) were dispersed to nanosized droplets and instantly dried in laminar heat flow. Particle morphology, integrity and stability were studied by scanning electron microscopy. The stability of DNA was studied by gel electrophoresis. Plasmid DNA as such degraded in the aerosol flow process. Complexing agent protected DNA from degradation and coating material enabled production of dispersed, non-aggregated, nanoparticles. The resulting nanoparticles were spherical and their mean diameter ranged from 65 to 125nm. The nanoparticles were structurally stable at room temperature and their DNA content was about 10%. We present herein the proof of principle for the production of dispersed solid state nanoparticles with relevant size and intact plasmid DNA. PMID:23352859

  20. Dietary fiber and short-chain fatty acids affect cell proliferation and protein synthesis in isolated rat colonocytes.

    PubMed

    Marsman, K E; McBurney, M I

    1996-05-01

    Colonic metabolism may be affected by dietary fiber and short-chain fatty acids, the products of fiber fermentation. The aim of this study was to assess the effects of fiber supplementation (150 g/kg diet) on dynamic measurements of metabolism in isolated rat colonic epithelial cells. Additionally, we investigated the effect of in vitro short-chain fatty acid and glutamine concentrations and media osmolarity on oxygen uptake, protein synthesis, cell proliferation and anaplerotic flux. Colonocyte oxygen consumption did not differ due to fiber supplementation or the inclusion of short -chain fatty acids in incubation media. Cell proliferation (3H-thymidine uptake) was increased by fiber consumption (P synthesis (3H-phenylalanine incorporation) was unaffected by fiber supplementation but was decreased when short-chain fatty acids were present in incubation media (P

  1. Light intensity affects chlorophyll synthesis during greening process by metabolite signal from mitochondrial alternative oxidase in Arabidopsis.

    PubMed

    Zhang, Da-Wei; Yuan, Shu; Xu, Fei; Zhu, Feng; Yuan, Ming; Ye, Hua-Xun; Guo, Hong-Qing; Lv, Xin; Yin, Yanhai; Lin, Hong-Hui

    2016-01-01

    Although mitochondrial alternative oxidase (AOX) has been proposed to play essential roles in high light stress tolerance, the effects of AOX on chlorophyll synthesis are unclear. Previous studies indicated that during greening, chlorophyll accumulation was largely delayed in plants whose mitochondrial cyanide-resistant respiration was inhibited by knocking out nuclear encoded AOX gene. Here, we showed that this delay of chlorophyll accumulation was more significant under high light condition. Inhibition of cyanide-resistant respiration was also accompanied by the increase of plastid NADPH/NADP(+) ratio, especially under high light treatment which subsequently blocked the import of multiple plastidial proteins, such as some components of the photosynthetic electron transport chain, the Calvin-Benson cycle enzymes and malate/oxaloacetate shuttle components. Overexpression of AOX1a rescued the aox1a mutant phenotype, including the chlorophyll accumulation during greening and plastidial protein import. It thus suggests that light intensity affects chlorophyll synthesis during greening process by a metabolic signal, the AOX-derived plastidial NADPH/NADP(+) ratio change. Further, our results thus revealed a molecular mechanism of chloroplast-mitochondria interactions. PMID:25158995

  2. Retention of OsNMD3 in the cytoplasm disturbs protein synthesis efficiency and affects plant development in rice.

    PubMed

    Shi, Yanyun; Liu, Xiangling; Li, Rui; Gao, Yaping; Xu, Zuopeng; Zhang, Baocai; Zhou, Yihua

    2014-07-01

    The ribosome is the basic machinery for translation, and biogenesis of ribosomes involves many coordinated events. However, knowledge about ribosomal dynamics in higher plants is very limited. This study chose a highly conserved trans-factor, the 60S ribosomal subunit nuclear export adaptor NMD3, to characterize the mechanism of ribosome biogenesis in the monocot plant Oryza sativa (rice). O. sativa NMD3 (OsNMD3) shares all the common motifs and shuttles between the nucleus and cytoplasm via CRM1/XPO1. A dominant negative form of OsNMD3 with a truncated nuclear localization sequence (OsNMD3(ΔNLS)) was retained in the cytoplasm, consequently interfering with the release of OsNMD3 from pre-60S particles and disturbing the assembly of ribosome subunits. Analyses of the transactivation activity and cellulose biosynthesis level revealed low protein synthesis efficiency in the transgenic plants compared with the wild-type plants. Pharmaceutical treatments demonstrated structural alterations in ribosomes in the transgenic plants. Moreover, global expression profiles of the wild-type and transgenic plants were investigated using the Illumina RNA sequencing approach. These expression profiles suggested that overexpression of OsNMD3(ΔNLS) affected ribosome biogenesis and certain basic pathways, leading to pleiotropic abnormalities in plant growth. Taken together, these results strongly suggest that OsNMD3 is important for ribosome assembly and the maintenance of normal protein synthesis efficiency. PMID:24723395

  3. The carbocyclic analog of 2'-deoxyguanosine induces a prolonged inhibition of duck hepatitis B virus DNA synthesis in primary hepatocyte cultures and in the liver.

    PubMed Central

    Fourel, I; Saputelli, J; Schaffer, P; Mason, W S

    1994-01-01

    The carbocyclic analog of 2'-deoxyguanosine (2'-CDG) is a strong inhibitor of hepatitis B virus (HBV) DNA synthesis in HepG2 cells (P.M. Price, R. Banerjee, and G. Acs, Proc. Natl. Acad. USA 86:8543-8544, 1989). We now report that 2'-CDG inhibited duck hepatitis B virus (DHBV) DNA synthesis in primary cultures of duck hepatocytes and in experimentally infected ducks. Like foscarnet (phosphonoformic acid [PFA]) and 2'-,3'-dideoxycytidine (ddC), 2'-CDG blocked viral DNA replication in primary hepatocyte cultures when present during an infection but failed to inhibit the DNA repair reaction that occurs during the initiation of infection to convert virion relaxed circular DNA to covalently closed circular DNA, the template for viral mRNA transcription. Moreover, as for PFA and ddC, viral RNA synthesis was detected when infection was initiated in the presence 2'-CDG. In another respect, however, 2'-CDG exhibited antiviral activity unlike that of ddC or PFA: a single 1-day treatment of hepatocytes with 2'-CDG blocked initiation of viral DNA synthesis for at least 8 days, irrespective of whether DHBV infection was carried out at the time of drug treatment or several days later. Furthermore, orally administered 2'-CDG was long-acting against DHBV in experimentally infected ducklings. Virus replication was delayed by up to 4 days in ducklings infected after administration of 2'-CDG. These observations of long-lasting efficacy in vitro and in vivo even after oral administration suggest that this inhibitor or a nucleoside with similar pharmacological properties may be ideal for reducing virus replication in patients with chronic HBV infection. Images PMID:8289335

  4. Particle length of silages affects apparent ruminal synthesis of B vitamins in lactating dairy cows.

    PubMed

    Castagnino, D S; Kammes, K L; Allen, M S; Gervais, R; Chouinard, P Y; Girard, C L

    2016-08-01

    Effects of particle length of silages on apparent ruminal synthesis (ARS) and postruminal supply of B vitamins were evaluated in 2 feeding trials. Diets containing alfalfa (trial 1) or orchardgrass (trial 2) silages, chopped to either 19mm (long cut, LC) or 10mm (short cut, SC) theoretical particle length, as the sole forage were offered to ruminally and duodenally cannulated lactating Holstein cows in crossover design experiments. Forages chopped to a theoretical particle length of 19 and 10mm had mean particles sizes of 14.1 and 8.1mm, respectively, in trial 1, and 15.3 and 11.3mm, respectively, in trial 2. Trial 1 was conducted with 13 multiparous cows in two 19-d treatment periods; both diets contained approximately 20% forage neutral detergent fiber (NDF), 25% total NDF, and forage-to-concentrate ratios were approximately 47:53. Trial 2 was conducted with 15 cows in two 18-d treatment periods; both diets contained approximately 23% forage NDF, 28% total NDF, and had a forage-to-concentrate ratio of 50:50. Thiamine, riboflavin, niacin, vitamin B6, folates, and vitamin B12 were measured in feed and duodenal content. Daily ARS was calculated as the duodenal flow minus the intake. In trial 1, daily intake of individual B vitamins was increased with the LC diet, but ARS of thiamine, riboflavin, vitamin B6, and folates was reduced. In trial 2, except for folates, intakes of the other B vitamins were decreased with the LC diets, whereas ARS of riboflavin, niacin, and vitamin B6 was increased. Daily ARS of thiamine, riboflavin, niacin, and vitamin B6 were correlated negatively with their intake, suggesting that ruminal bacteria reduced their synthesis when dietary supply increased. Microbial activity could have also reduced degradation of thiamine, riboflavin, and niacin, which is supported by (1) the negative correlation between ARS of these vitamins and ruminal pH or microbial N duodenal flow; and (2) the positive correlation between ARS and ruminal concentrations

  5. [DNA methylation in obesity].

    PubMed

    Pokrywka, Małgorzata; Kieć-Wilk, Beata; Polus, Anna; Wybrańska, Iwona

    2014-01-01

    The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes), have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA) synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described. PMID:25531701

  6. Fluorescent DNA Nanotags Featuring Covalently Attached Intercalating Dyes: Synthesis, Antibody Conjugation and Intracellular Imaging

    PubMed Central

    Stadler, Andrea L.; Santos, Junriz Delos; Stensrud, Elizabeth S.; Dembska, Anna; Silva, Gloria L.; Liu, Shengpeng; Shank, Nathaniel I.; Kunttas-Tatli, Ezgi; Sobers, Courtney J.; Gramlich, Philipp M. E.; Carell, Thomas; Peteanu, Linda A.; McCartney, Brooke M.; Armitage, Bruce A.

    2011-01-01

    We have synthesized fluorescent DNA duplexes featuring multiple thiazole orange (TO) intercalating dyes covalently attached to the DNA via a triazole linkage. The intercalating dyes stabilize the duplex against thermal denaturation and show bright fluorescence in the green. The emission color can be changed to orange or red by addition of energy-accepting Cy3 or Cy5 dyes attached covalently to the DNA duplex. The dye-modified DNA duplexes were then attached to a secondary antibody for intracellular fluorescence imaging of centrosomes in Drosophila embryos. Bright fluorescent foci were observed at the centrosomes in both the donor (TO) and acceptor (Cy5) channels, due to the fact that the energy transfer efficiency is moderate. Monitoring the Cy5 emission channel significantly minimized the background signal due to the large shift in emission wavelength allowed by energy transfer. PMID:21755981

  7. DNA Storage under High Temperature Conditions Does Not Affect Performance in Human Leukocyte Antigen Genotyping via Next-Generation Sequencing (DNA Integrity Maintained in Extreme Conditions)

    PubMed Central

    McDevitt, Shana L; Hogan, Michael E; Pappas, Derek J; Wong, Lily Y

    2014-01-01

    Background: Stable dry-state storage of DNA is desirable to minimize required storage space and to reduce electrical and shipping costs. DNA purified from various commercially available dry-state stabilization matrices has been used successfully in downstream molecular applications (e.g., quantitative polymerase chain reaction [qPCR], microarray, and sequence-based genotyping). However, standard DNA storage conditions still include freezing of DNA eluted in aqueous buffers or nuclease-free water. Broad implementation of dry-state, long-term DNA storage requires enhancement of such dry-state DNA stabilization products to control for temperature fluctuations at specimen collection, transit, and storage. This study tested the integrity of genomic DNA subjected to long-term storage on GenTegra™ DNA stabilization matrices (GenTegra LLC, Pleasanton, CA) at extreme conditions, as defined by a 4-year storage period at ambient temperature with an initial incubation for 7 months at 37°C, 56°C, or ambient temperature. Subsequently, purified DNA performance and integrity were measured by qPCR and next-generation sequencing (NGS)-based human leokocyte antigen (HLA) genotyping. Results: High molecular weight genomic DNA samples were recovered from the GenTegra product matrix and exhibited integrity comparable to a highly characterized commercial standard under assessment by qPCR. Samples were genotyped for classical HLA loci using next generation sequencing-based methodolgy on the Roche 454 GS Junior instrument. Amplification efficiency, sequence coverage, and sequence quality were all comparable with those produced from a cell line DNA sequenced as a control. No significant differences were observed in the mean, median, or mode quality scores between samples and controls (p≥0.4). Conclusions: Next generation HLA genotyping was chosen to test the integrity of GenTegra-treated genomic DNA due to the requirment for long sequence reads to genotype the highly polymorphic

  8. Cell division and subsequent radicle protrusion in tomato seeds are inhibited by osmotic stress but DNA synthesis and formation of microtubular cytoskeleton are not.

    PubMed

    de Castro, R D; van Lammeren, A A; Groot, S P; Bino, R J; Hilhorst, H W

    2000-02-01

    We studied cell cycle events in embryos of tomato (Lycopersicon esculentum Mill. cv Moneymaker) seeds during imbibition in water and during osmoconditioning ("priming") using both quantitative and cytological analysis of DNA synthesis and beta-tubulin accumulation. Most embryonic nuclei of dry, untreated control seeds were arrested in the G(1) phase of the cell cycle. This indicated the absence of DNA synthesis (the S-phase), as confirmed by the absence of bromodeoxyuridine incorporation. In addition, beta-tubulin was not detected on western blots and microtubules were not present. During imbibition in water, DNA synthesis was activated in the radicle tip and then spread toward the cotyledons, resulting in an increase in the number of nuclei in G(2). Concomitantly, beta-tubulin accumulated and was assembled into microtubular cytoskeleton networks. Both of these cell cycle events preceded cell expansion and division and subsequent growth of the radicle through the seed coat. The activation of DNA synthesis and the formation of microtubular cytoskeleton networks were also observed throughout the embryo when seeds were osmoconditioned. However, this pre-activation of the cell cycle appeared to become arrested in the G(2) phase since no mitosis was observed. The pre-activation of cell cycle events in osmoconditioned seeds appeared to be correlated with enhanced germination performance during re-imbibition in water. PMID:10677426

  9. DNA Synthesis during Endomitosis Is Stimulated by Insulin via the PI3K/Akt and TOR Signaling Pathways in the Silk Gland Cells of Bombyx mori

    PubMed Central

    Li, Yaofeng; Chen, Xiangyun; Tang, Xiaofang; Zhang, Chundong; Wang, La; Chen, Peng; Pan, Minhui; Lu, Cheng

    2015-01-01

    Silk gland cells undergo multiple endomitotic cell cycles during silkworm larval ontogeny. Our previous study demonstrated that feeding is required for continued endomitosis in the silk gland cells of silkworm larvae. Furthermore, the insulin signaling pathway is closely related to nutritional signals. To investigate whether the insulin signaling pathway is involved in endomitosis in silk gland cells, in this study, we initially analyzed the effects of bovine insulin on DNA synthesis in endomitotic silk gland cells using 5-bromo-2'-deoxyuridine (BrdU) labeling technology, and found that bovine insulin can stimulate DNA synthesis. Insulin signal transduction is mainly mediated via phosphoinositide 3-kinase (PI3K)/Akt, the target of rapamycin (TOR) and the extracellular signal-regulated kinase (ERK) pathways in vertebrates. We ascertained that these three pathways are involved in DNA synthesis in endomitotic silk gland cells using specific inhibitors against each pathway. Moreover, we investigated whether these three pathways are involved in insulin-stimulated DNA synthesis in endomitotic silk gland cells, and found that the PI3K/Akt and TOR pathways, but not the ERK pathway, are involved in this process. These results provide an important theoretical foundation for the further investigations of the mechanism underlying efficient endomitosis in silk gland cells. PMID:25794286

  10. DNA synthesis during endomitosis is stimulated by insulin via the PI3K/Akt and TOR signaling pathways in the silk gland cells of Bombyx mori.

    PubMed

    Li, Yaofeng; Chen, Xiangyun; Tang, Xiaofang; Zhang, Chundong; Wang, La; Chen, Peng; Pan, Minhui; Lu, Cheng

    2015-01-01

    Silk gland cells undergo multiple endomitotic cell cycles during silkworm larval ontogeny. Our previous study demonstrated that feeding is required for continued endomitosis in the silk gland cells of silkworm larvae. Furthermore, the insulin signaling pathway is closely related to nutritional signals. To investigate whether the insulin signaling pathway is involved in endomitosis in silk gland cells, in this study, we initially analyzed the effects of bovine insulin on DNA synthesis in endomitotic silk gland cells using 5-bromo-2'-deoxyuridine (BrdU) labeling technology, and found that bovine insulin can stimulate DNA synthesis. Insulin signal transduction is mainly mediated via phosphoinositide 3-kinase (PI3K)/Akt, the target of rapamycin (TOR) and the extracellular signal-regulated kinase (ERK) pathways in vertebrates. We ascertained that these three pathways are involved in DNA synthesis in endomitotic silk gland cells using specific inhibitors against each pathway. Moreover, we investigated whether these three pathways are involved in insulin-stimulated DNA synthesis in endomitotic silk gland cells, and found that the PI3K/Akt and TOR pathways, but not the ERK pathway, are involved in this process. These results provide an important theoretical foundation for the further investigations of the mechanism underlying efficient endomitosis in silk gland cells. PMID:25794286

  11. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  12. A mutation affecting the synthesis of 4-chloroindole-3-acetic acid.

    PubMed

    Ross, John J; Tivendale, Nathan D; Davidson, Sandra E; Reid, James B; Davies, Noel W; Quittenden, Laura J; Smith, Jason A

    2012-12-01

    Traditionally, schemes depicting auxin biosynthesis in plants have been notoriously complex. They have involved up to four possible pathways by which the amino acid tryptophan might be converted to the main active auxin, indole-3-acetic acid (IAA), while another pathway was suggested to bypass tryptophan altogether. It was also postulated that different plants use different pathways, further adding to the complexity. In 2011, however, it was suggested that one of the four tryptophan-dependent pathways, via indole-3-pyruvic acid (IPyA), is the main pathway in Arabidopsis thaliana, although concurrent operation of one or more other pathways has not been excluded. We recently showed that, for seeds of Pisum sativum (pea), it is possible to go one step further. Our new evidence indicates that the IPyA pathway is the only tryptophan-dependent IAA synthesis pathway operating in pea seeds. We also demonstrated that the main auxin in developing pea seeds, 4-chloroindole-3-acetic acid (4-Cl-IAA), which accumulates to levels far exceeding those of IAA, is synthesized via a chlorinated version of the IPyA pathway. PMID:23073010

  13. Dietary Restriction Affects Neuronal Response Property and GABA Synthesis in the Primary Visual Cortex.

    PubMed

    Yang, Jinfang; Wang, Qian; He, Fenfen; Ding, Yanxia; Sun, Qingyan; Hua, Tianmiao; Xi, Minmin

    2016-01-01

    Previous studies have reported inconsistent effects of dietary restriction (DR) on cortical inhibition. To clarify this issue, we examined the response properties of neurons in the primary visual cortex (V1) of DR and control groups of cats using in vivo extracellular single-unit recording techniques, and assessed the synthesis of inhibitory neurotransmitter GABA in the V1 of cats from both groups using immunohistochemical and Western blot techniques. Our results showed that the response of V1 neurons to visual stimuli was significantly modified by DR, as indicated by an enhanced selectivity for stimulus orientations and motion directions, decreased visually-evoked response, lowered spontaneous activity and increased signal-to-noise ratio in DR cats relative to control cats. Further, it was shown that, accompanied with these changes of neuronal responsiveness, GABA immunoreactivity and the expression of a key GABA-synthesizing enzyme GAD67 in the V1 were significantly increased by DR. These results demonstrate that DR may retard brain aging by increasing the intracortical inhibition effect and improve the function of visual cortical neurons in visual information processing. This DR-induced elevation of cortical inhibition may favor the brain in modulating energy expenditure based on food availability. PMID:26863207

  14. Glucosylceramide synthesis inhibition affects cell cycle progression, membrane trafficking, and stage differentiation in Giardia lamblia.

    PubMed

    Stefanić, Sasa; Spycher, Cornelia; Morf, Laura; Fabriàs, Gemma; Casas, Josefina; Schraner, Elisabeth; Wild, Peter; Hehl, Adrian B; Sonda, Sabrina

    2010-09-01

    Synthesis of glucosylceramide via glucosylceramide synthase (GCS) is a crucial event in higher eukaryotes, both for the production of complex glycosphingolipids and for regulating cellular levels of ceramide, a potent antiproliferative second messenger. In this study, we explored the dependence of the early branching eukaryote Giardia lamblia on GCS activity. Biochemical analyses revealed that the parasite has a GCS located in endoplasmic reticulum (ER) membranes that is active in proliferating and encysting trophozoites. Pharmacological inhibition of GCS induced aberrant cell division, characterized by arrest of cytokinesis, incomplete cleavage furrow formation, and consequent block of replication. Importantly, we showed that increased ceramide levels were responsible for the cytokinesis arrest. In addition, GCS inhibition resulted in prominent ultrastructural abnormalities, including accumulation of cytosolic vesicles, enlarged lysosomes, and clathrin disorganization. Moreover, anterograde trafficking of the encystations-specific protein CWP1 was severely compromised and resulted in inhibition of stage differentiation. Our results reveal novel aspects of lipid metabolism in G. lamblia and specifically highlight the vital role of GCS in regulating cell cycle progression, membrane trafficking events, and stage differentiation in this parasite. In addition, we identified ceramide as a potent bioactive molecule, underscoring the universal conservation of ceramide signaling in eukaryotes. PMID:20335568

  15. Dietary Restriction Affects Neuronal Response Property and GABA Synthesis in the Primary Visual Cortex

    PubMed Central

    Sun, Qingyan; Hua, Tianmiao; Xi, Minmin

    2016-01-01

    Previous studies have reported inconsistent effects of dietary restriction (DR) on cortical inhibition. To clarify this issue, we examined the response properties of neurons in the primary visual cortex (V1) of DR and control groups of cats using in vivo extracellular single-unit recording techniques, and assessed the synthesis of inhibitory neurotransmitter GABA in the V1 of cats from both groups using immunohistochemical and Western blot techniques. Our results showed that the response of V1 neurons to visual stimuli was significantly modified by DR, as indicated by an enhanced selectivity for stimulus orientations and motion directions, decreased visually-evoked response, lowered spontaneous activity and increased signal-to-noise ratio in DR cats relative to control cats. Further, it was shown that, accompanied with these changes of neuronal responsiveness, GABA immunoreactivity and the expression of a key GABA-synthesizing enzyme GAD67 in the V1 were significantly increased by DR. These results demonstrate that DR may retard brain aging by increasing the intracortical inhibition effect and improve the function of visual cortical neurons in visual information processing. This DR-induced elevation of cortical inhibition may favor the brain in modulating energy expenditure based on food availability. PMID:26863207

  16. Design, synthesis, physicochemical studies, solvation, and DNA damage of quinoline-appended chalcone derivative: comprehensive spectroscopic approach toward drug discovery.

    PubMed

    Kumar, Himank; Chattopadhyay, Anjan; Prasath, R; Devaraji, Vinod; Joshi, Ritika; Bhavana, P; Saini, Praveen; Ghosh, Sujit Kumar

    2014-07-01

    The present study epitomizes the design, synthesis, photophysics, solvation, and interaction with calf-thymus DNA of a potential antitumor, anticancer quinoline-appended chalcone derivative, (E)-3-(anthracen-10-yl)-1-(6,8-dibromo-2-methylquinolin-3-yl)prop-2-en-1-one (ADMQ) using steady state absorption and fluorescence spectroscopy, molecular modeling, molecular docking, Fourier-transform infrared spectroscopy (FTIR), molecular dynamics (MD) simulation, and gel electrophoresis studies. ADMQ shows an unusual photophysical behavior in a variety of solvents of different polarity. The dual emission has been observed along with the formation of twisted intramolecular charge transfer (TICT) excited state. The radiationless deactivation of the TICT state is found to be promoted strongly by hydrogen bonding. Quantum mechanical (DFT, TDDFT, and ZINDO-CI) calculations show that the ADMQ is sort of molecular rotor which undergoes intramolecular twist followed by a complete charge transfer in the optimized excited state. FTIR studies reveals that ADMQ undergoes important structural change from its native structure to a β-hydroxy keto form in water at physiological pH. The concentration-dependent DNA cleavage has been identified in agarose gel DNA electrophoresis experiment and has been further supported by MD simulation. ADMQ forms hydrogen bond with the deoxyribose sugar attached with the nucleobase adenine DA-17 (chain A) and result in significant structural changes which potentially cleave DNA double helix. The compound does not exhibit any deleterious effect or toxicity to the E. coli strain in cytotoxicity studies. The consolidated spectroscopic research described herein can provide enormous information to open up new avenues for designing and synthesizing chalcone derivatives with low systematic toxicity for medicinal chemistry research. PMID:24962605

  17. Study of DNA light switch Ru(II) complexes: synthesis, characterization, photocleavage and antimicrobial activity.

    PubMed

    Yata, Praveen Kumar; Shilpa, M; Nagababu, P; Reddy, M Rajender; Kotha, Laxma Reddy; Gabra, Nazar Md; Satyanarayana, S

    2012-05-01

    The three Ru(II) complexes of [Ru(phen)(2)dppca](2+) (1) [Ru(bpy)(2)dppca](2+) (2) and [Ru(dmb)(2)dppca](2+) (3) (where phen = 1,10 phenanthroline, bpy = 2,2-bipyridine, dmb = 2 ,2-dimethyl 2',2'-bipyridine and polypyridyl ligand containing a single carboxylate functionality dppca ligand (dipyridophenazine-11-carboxylic acid) have been synthesized and characterized. These complexes have been shown to act as promising calf thymus DNA intercalators and a new class of DNA light switches, as evidenced by UV-visible and luminescence titrations with Co(2+) and EDTA, steady-state emission quenching by [Fe(CN)(6)](4-) and KI, DNA competitive binding with ethidium bromide, viscosity measurements, and DNA melting experiments. The results suggest that 1, 2, and 3 complexes bind to CT-DNA through intercalation and follows the order 1 > 2 > 3. Under irradiation at 365 nm, the three complexes have also been found to promote the photocleavage of plasmid pBR322 DNA. PMID:22194001

  18. Synthesis of Site-Specific DNA–Protein Conjugates and Their Effects on DNA Replication

    PubMed Central

    2015-01-01

    DNA–protein cross-links (DPCs) are bulky, helix-distorting DNA lesions that form in the genome upon exposure to common antitumor drugs, environmental/occupational toxins, ionizing radiation, and endogenous free-radical-generating systems. As a result of their considerable size and their pronounced effects on DNA–protein interactions, DPCs can interfere with DNA replication, transcription, and repair, potentially leading to mutagenesis, genotoxicity, and cytotoxicity. However, the biological consequences of these ubiquitous lesions are not fully understood due to the difficulty of generating DNA substrates containing structurally defined, site-specific DPCs. In the present study, site-specific cross-links between the two biomolecules were generated by copper-catalyzed [3 + 2] Huisgen cycloaddition (click reaction) between an alkyne group from 5-(octa-1,7-diynyl)-uracil in DNA and an azide group within engineered proteins/polypeptides. The resulting DPC substrates were subjected to in vitro primer extension in the presence of human lesion bypass DNA polymerases η, κ, ν, and ι. We found that DPC lesions to the green fluorescent protein and a 23-mer peptide completely blocked DNA replication, while the cross-link to a 10-mer peptide was bypassed. These results indicate that the polymerases cannot read through the larger DPC lesions and further suggest that proteolytic degradation may be required to remove the replication block imposed by bulky DPC adducts. PMID:24918113

  19. UvrD Participation in Nucleotide Excision Repair Is Required for the Recovery of DNA Synthesis following UV-Induced Damage in Escherichia coli.

    PubMed

    Newton, Kelley N; Courcelle, Charmain T; Courcelle, Justin

    2012-01-01

    UvrD is a DNA helicase that participates in nucleotide excision repair and several replication-associated processes, including methyl-directed mismatch repair and recombination. UvrD is capable of displacing oligonucleotides from synthetic forked DNA structures in vitro and is essential for viability in the absence of Rep, a helicase associated with processing replication forks. These observations have led others to propose that UvrD may promote fork regression and facilitate resetting of the replication fork following arrest. However, the molecular activity of UvrD at replication forks in vivo has not been directly examined. In this study, we characterized the role UvrD has in processing and restoring replication forks following arrest by UV-induced DNA damage. We show that UvrD is required for DNA synthesis to recover. However, in the absence of UvrD, the displacement and partial degradation of the nascent DNA at the arrested fork occur normally. In addition, damage-induced replication intermediates persist and accumulate in uvrD mutants in a manner that is similar to that observed in other nucleotide excision repair mutants. These data indicate that, following arrest by DNA damage, UvrD is not required to catalyze fork regression in vivo and suggest that the failure of uvrD mutants to restore DNA synthesis following UV-induced arrest relates to its role in nucleotide excision repair. PMID:23056919

  20. Kinetics of mouse jejunum radiosensitization by 2',2'-difluorodeoxycytidine (gemcitabine) and its relationship with pharmacodynamics of DNA synthesis inhibition and cell cycle redistribution in crypt cells.

    PubMed Central

    Grégoire, V.; Beauduin, M.; Rosier, J. F.; De Coster, B.; Bruniaux, M.; Octave-Prignot, M.; Scalliet, P.

    1997-01-01

    Gemcitabine (dFdC), a deoxycitidine nucleoside analogue, inhibits DNA synthesis and repair of radiation-induced chromosome breaks in vitro, radiosensitizes various human and mouse cells in vitro and shows clinical activity in several tumours. Limited data are however available on the effect of dFdC on normal tissue radiotolerance and on factors associated with dFdC's radiosensitization in vivo. The purpose of this study was to determine the effect of dFdC on mouse jejunum radiosensitization and to investigate the kinetics of DNA synthesis inhibition and cell cycle redistribution in the jejunal crypts as surrogates of radiosensitization in vivo. For assessment of jejunum tolerance, the mice were irradiated on the whole body with 60Co gamma rays (3.5-18 Gy single dose) with or without prior administration of dFdC (150 mg kg-1). Jejunum tolerance was evaluated by the number of regenerated crypts per circumference at 86 h after irradiation. For pharmacodynamic studies, dFdC (150 or 600 mg kg-1) was given i.p. and jejunum was harvested at various times (0-48 h), preceded by a pulse BrdUrd labelling. Labelled cells were detected by immunohistochemistry on paraffin-embedded sections. DNA synthesis was inhibited within 3 h after dFdC administration. After an early wave of apoptosis (3-6 h), DNA synthesis recovered by 6 h, and crypt cells became synchronized. At 48 h, the labelling index returned almost to background level. At a level of 40 regenerated crypts, radiosensitization was observed for a 3 h time interval (dose modification factor of 1.3) and was associated with DNA synthesis inhibition, whereas a slight radioprotection was observed for a 48-h time interval (dose modification factor of 0.9) when DNA synthesis has reinitiated. In conclusion, dFdC altered the radioresponse of the mouse jejunum in a schedule-dependent fashion. Our data tend to support the hypothesis that DNA synthesis inhibition and cell cycle redistribution are surrogates for radiosensitization

  1. Study of mitochondrial DNA alteration in the exhaled breath condensate of patients affected by obstructive lung diseases.

    PubMed

    Carpagnano, G E; Lacedonia, D; Carone, M; Soccio, P; Cotugno, G; Palmiotti, G A; Scioscia, G; Foschino Barbaro, M P

    2016-06-01

    Mitochondrial DNA (MtDNA) has been studied as an expression of oxidative stress in asthma, COPD, lung cancer and obstructive sleep apnea, but it has been mainly investigated systemically, although the pathogenetic mechanisms begin in the airways and only later progress to systemic circulation. The aim of this study was to investigate the MtDNA alterations in the exhaled breath condensate (EBC) of patients with asthma, COPD and asthma-COPD overlap syndrome (ACOS). In order to analyze better what happens to mitochondria, both locally and systemically, we compared MtDNA/nDNA in blood and EBC of paired patients. Thirteen (13) COPD patients, 14 asthmatics, 23 ACOS (10 according to Spanish guidelines, 13 in line with GINA guidelines) and 12 healthy subjects were enrolled. Patients underwent clinical and functional diagnostic tests as foreseen by the guidelines. They underwent blood and EBC collection. Content of MtDNA and nuclear DNA (nDNA) was measured in the blood cells and EBC of patients by Real Time PCR. The ratio between MtDNA/nDNA was calculated. For the first time we were able to detect MtDNA/nDNA in the EBC. We found higher exhaled MtDNA/nDNA in COPD, asthmatic and ACOS patients respectively compared to healthy subjects (21.9  ±  4.9 versus 6.51  ±  0.21, p  <  0.05; 7.9  ±  2.5 versus 6.51  ±  0.21, p  =  0.06; 18.3  ±  3.4 versus 6.51  ±  0.21, p  <  0.05). The level of exhaled MtDNA/nDNA was positively correlated with the plasmatic one. The levels of MtDNA/nDNA in the EBC, as expression of oxidative stress, are increased in COPD, asthmatic and ACOS patients compared to healthy subjects. These are preliminary results in a small number of well characterized patients that requires confirmation on a larger population. We support new studies directed toward the analysis of exhaled MtDNA/nDNA as a new exhaled non-invasive marker in other inflammatory/oxidative airways diseases. PMID

  2. Novel sphingosine-containing analogues selectively inhibit sphingosine kinase (SK) isozymes, induce SK1 proteasomal degradation and reduce DNA synthesis in human pulmonary arterial smooth muscle cells

    PubMed Central

    Byun, Hoe-Sup; Pyne, Susan; MacRitchie, Neil; Pyne, Nigel J.

    2013-01-01

    Sphingosine 1-phosphate (S1P) is involved in hyper-proliferative diseases such as cancer and pulmonary arterial hypertension. We have synthesized inhibitors that are selective for the two isoforms of sphingosine kinase (SK1 and SK2) that catalyze the synthesis of S1P. A thiourea adduct of sphinganine (F02) is selective for SK2 whereas the 1-deoxysphinganines 55-21 and 77-7 are selective for SK1. (2S,3R)-1-Deoxysphinganine (55-21) induced the proteasomal degradation of SK1 in human pulmonary arterial smooth muscle cells and inhibited DNA synthesis, while the more potent SK1 inhibitors PF-543 and VPC96091 failed to inhibit DNA synthesis. These findings indicate that moderate potency inhibitors such as 55-21 are likely to have utility in unraveling the functions of SK1 in inflammatory and hyperproliferative disorders. PMID:24396570

  3. The DUF579 domain containing proteins IRX15 and IRX15-L affect xylan synthesis in Arabidopsis.

    PubMed

    Jensen, Jacob K; Kim, Hoon; Cocuron, Jean-Christophe; Orler, Robert; Ralph, John; Wilkerson, Curtis G

    2011-05-01

    Xylan is the principal hemicellulose in the secondary cell walls of eudicots and in the primary and secondary cell walls of grasses and cereals. The biosynthesis of this important cell wall component has yet to be fully determined although a number of proteins have been shown to be required for xylan synthesis. To discover new genes involved in xylan biosynthesis we explored the psyllium (Plantago ovata Forsk) seed mucilaginous layer through EST profiling. This tissue synthesizes large amounts of a complex heteroxylan over a short period of time. By comparing abundant transcripts in this tissue with abundant transcripts specifically present during secondary cell wall formation in Arabidopsis thaliana, where glucuronoxylan biosynthesis is pronounced, we identified two Arabidopsis genes likely involved in xylan biosynthesis. These genes encode proteins containing a Domain of Unknown Function (DUF) 579 and were designated IRREGULAR XYLEM (IRX) 15 and IRX15-LIKE (IRX15-L). We obtained Arabidopsis T-DNA knockout lines for the two genes and analyzed their lower stems for changes in neutral monosaccharide composition. No changes were observed in each of these mutants, although the irx15 irx15-L double mutant displayed a moderate reduction in stem xylose. Further characterization of the irx15 irx15-L mutant revealed irregular secondary cell wall margins in fiber cells and a lower xylan degree of polymerization. Through these studies we conclude that IRX15 and IRX15-L function in a redundant manner and are involved in xylan biosynthesis. PMID:21288268

  4. Factors That Affect Large Subunit Ribosomal DNA Amplicon Sequencing Studies of Fungal Communities: Classification Method, Primer Choice, and Error

    PubMed Central

    Porter, Teresita M.; Golding, G. Brian

    2012-01-01

    Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1) a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN); 2) a composition-based method (Ribosomal Database Project naïve Bayesian classifier, NBC); and, 3) a phylogeny-based method (Statistical Assignment Package, SAP). We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50–100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys. PMID:22558215

  5. DNA synthesis in alveolar macrophages and other changes in lavaged cells following exposure of CBA/H mice to cigarette smoke

    SciTech Connect

    Hornby, S.B.; Kellington, J.P. )

    1990-04-01

    Traditional methods to determine the proportion of cells in S-phase use radiolabeled precursors of DNA, such as {sup 3}H-thymidine, which become incorporated into DNA during its synthesis and are visualized either in tissue sections or in cell preparations by autoradiography. At the Harwell Laboratory the effects of inhaled {alpha}-emitting actinides on the pulmonary alveolar macrophage population of the rodent lung are being studied. For this research the use of an autoradiographic technique to determine the proportion of cells in S-phase is inappropriate, because of the possible presence of competing sources of radioactivity in the cells under investigation. Consequently, an alternative method has been developed. In this method, 5-bromodeoxyuridine (BrdU), an analogue of thymidine, is incorporated into cells undergoing DNA synthesis. Fluorescein-conjugated monoclonal antibodies, highly specific for BrdU substituted DNA, are available commercially and may be used as a probe for BrdU-labeled cells. This technique for identifying cells in S-phase has been described previously for the flow cytometric analysis of cell suspensions and for cells in tissue sections. An adaptation of this technique for use on cytocentrifuge preparations of cells recovered from mouse lung by bronchoalveolar lavage has been developed and its use is described. Some preliminary results of a short-term experiment with CBA/H mice to determine the effects of exposure to cigarette smoke on the DNA synthesis of alveolar macrophages are also included.

  6. Simulated Screens of DNA Encoded Libraries: The Potential Influence of Chemical Synthesis Fidelity on Interpretation of Structure-Activity Relationships.

    PubMed

    Satz, Alexander L

    2016-07-11

    Simulated screening of DNA encoded libraries indicates that the presence of truncated byproducts complicates the relationship between library member enrichment and equilibrium association constant (these truncates result from incomplete chemical reactions during library synthesis). Further, simulations indicate that some patterns observed in reported experimental data may result from the presence of truncated byproducts in the library mixture and not structure-activity relationships. Potential experimental methods of minimizing the presence of truncates are assessed via simulation; the relationship between enrichment and equilibrium association constant for libraries of differing purities is investigated. Data aggregation techniques are demonstrated that allow for more accurate analysis of screening results, in particular when the screened library contains significant quantities of truncates. PMID:27116029

  7. Purification of a Factor from Human Placenta That Stimulates Capillary Endothelial Cell Protease Production, DNA Synthesis, and Migration

    NASA Astrophysics Data System (ADS)

    Moscatelli, David; Presta, Marco; Rifkin, Daniel B.

    1986-04-01

    A protein that stimulates the production of plasminogen activator and latent collagenase in cultured bovine capillary endothelial cells has been purified 106-fold from term human placenta by using a combination of heparin affinity chromatography, ion-exchange chromatography, and gel chromatography. The purified molecule has a molecular weight of 18,700 as determined by NaDodSO4/PAGE under both reducing and nonreducing conditions. The purified molecule stimulates the production of plasminogen activator and latent collagenase in a dose-dependent manner between 0.1 and 10 ng of protein/ml. The purified protein also stimulates DNA synthesis and chemotaxis in capillary endothelial cells in the same concentration range. Thus, this molecule has all of the properties predicted for an angiogenic factor.

  8. The application of the AMB protective group in the solid-phase synthesis of methylphosphonate DNA analogues.

    PubMed Central

    Kuijpers, W H; Kuyl-Yeheskiely, E; van Boom, J H; van Boeckel, C A

    1993-01-01

    Partially methylphosphonate-modified oligodeoxynucleotides were synthesized on solid-phase by employing the easily removable 2-(acetoxymethyl)benzoyl (AMB) group as base-protecting group. Although a rapid AMB deprotection can be accomplished in methanolic potassium carbonate, the lability of the methylphosphonate linkage towards potassium carbonate/methanol excludes the use of this deprotection reagent. Thus, saturated ammonia solution in methanol was investigated as an alternative reagent for AMB removal. It is demonstrated that the combination of the AMB protective group and ammonia/methanol as deprotection reagent significantly improves the synthesis of methylphosphonate-modified DNA fragments. A mild overnight treatment at room temperature is sufficient for complete removal of the AMB group, whereas deprotection of conventionally protected oligonucleotides requires much longer exposure to basic conditions at elevated temperatures. PMID:8346028

  9. Synthesis, characterization; DNA binding and antitumor activity of ruthenium(II) polypyridyl complexes.

    PubMed

    Srishailam, A; Gabra, Nazar Mohammed; Kumar, Yata Praveen; Reddy, Kotha Laxma; Devi, C Shobha; Anil Kumar, D; Singh, Surya S; Satyanarayana, S

    2014-12-01

    Three new ruthenium(II) polypyridyl complexes [Ru(phen)2BrIPC](2+) (1), [Ru(bpy)2 BrIPC](2+) (2) and [Ru(dmb)2BrIPC](2+) (3) where, BrIPC = (6-bromo-3-(1H-imidazo[4,5-f] [1,10]-phenanthroline, phen = 1,10-phenanthroline, bpy = 2,2' bipyridine, dmb = 4,4'-dimethyl 2,2' bipyridine, were synthesised and characterised. DNA-binding nature was investigated by spectroscopic titrations and mode of binding was assessed by viscosity measurements. The DNA-binding constants Kb of complexes 1, 2 and 3 were determined to be in the order of 10(5). Experimental results showed that these complexes interact with CT-DNA by intercalative mode. Photocleavage and antimicrobial activities were complex concentration dependent, at high concentration, high activity and vice versa. MTT assay was performed on HeLa cell lines, IC50 values of complexes in the order of 3 > 2 > 1 > cisplatin. From comet assay, cellular uptake studies, we observed that complexes could enter into the cell membrane and accumulate inside the nucleus. Molecular docking studies support the DNA binding affinity with hydrogen bonding and van der Waals attractions between base pairs and phosphate backbone of DNA with metal complexes. PMID:25318017

  10. Synthesis, Characterization, Molecular Modeling, and DNA Interaction Studies of Copper Complex Containing Food Additive Carmoisine Dye.

    PubMed

    Shahabadi, Nahid; Akbari, Alireza; Jamshidbeigi, Mina; Khodarahmi, Reza

    2016-06-01

    A copper complex of carmoisine dye; [Cu(carmoisine)2(H2O)2]; was synthesized and characterized by using physico-chemical and spectroscopic methods. The binding of this complex with calf thymus (ct) DNA was investigated by circular dichroism, absorption studies, emission spectroscopy, and viscosity measurements. UV-vis results confirmed that the Cu complex interacted with DNA to form a ground-state complex and the observed binding constant (2× 10(4) M(-1)) is more in keeping with the groove bindings with DNA. Furthermore, the viscosity measurement result showed that the addition of complex causes no significant change on DNA viscosity and it indicated that the intercalation mode is ruled out. The thermodynamic parameters are calculated by van't Hoff equation, which demonstrated that hydrogen bonds and van der Waals interactions played major roles in the reaction. The results of circular dichroism (CD) suggested that the complex can change the conformation of DNA from B-like form toward A-like conformation. The cytotoxicity studies of the carmoisine dye and its copper complex indicated that both of them had anticancer effects on HT-29 (colon cancer) cell line and they may be new candidates for treatment of the colon cancer. PMID:27152751

  11. Synthesis and evaluation of gold(III) complexes as efficient DNA binders and cytotoxic agents

    NASA Astrophysics Data System (ADS)

    Patel, Mohan N.; Bhatt, Bhupesh S.; Dosi, Promise A.

    2013-06-01

    In recent years, great interest has been focused on gold(III) complexes as cytotoxic and antitumor drugs. Recent studies demonstrated that simple bidentate or polydentate ligands containing nitrogen donor atoms may offer sufficient redox stabilization to produce viable Au(III) anticancer drug targets under physiologic conditions. So, we have synthesized square planer Au(III) complexes of type [Au(An)Clx]·Cly and characterized them using UV-Vis absorption, C, H, N elemental analysis, FT-IR, LC-MS, 1H and 13C NMR spectroscopy. These compounds manifested significant cytotoxic properties in vitro for brine shrimp lethality bioassay. The metal complexes were screened for series of DNA binding activity using UV-Vis absorption titration, hydrodynamic measurement and thermal DNA denaturation study. The nucleolytic activity was performed on plasmid pUC19 DNA. The Michaelis-Menten kinetic studies were performed to evaluate rate of enhancement in metal complexes mediated DNA cleavage over the non-catalyzed DNA cleavage.

  12. Translesion synthesis mechanisms depend on the nature of DNA damage in UV-irradiated human cells

    PubMed Central

    Quinet, Annabel; Martins, Davi Jardim; Vessoni, Alexandre Teixeira; Biard, Denis; Sarasin, Alain; Stary, Anne; Menck, Carlos Frederico Martins

    2016-01-01

    Ultraviolet-induced 6-4 photoproducts (6-4PP) and cyclobutane pyrimidine dimers (CPD) can be tolerated by translesion DNA polymerases (TLS Pols) at stalled replication forks or by gap-filling. Here, we investigated the involvement of Polη, Rev1 and Rev3L (Polζ catalytic subunit) in the specific bypass of 6-4PP and CPD in repair-deficient XP-C human cells. We combined DNA fiber assay and novel methodologies for detection and quantification of single-stranded DNA (ssDNA) gaps on ongoing replication forks and postreplication repair (PRR) tracts in the human genome. We demonstrated that Rev3L, but not Rev1, is required for postreplicative gap-filling, while Polη and Rev1 are responsible for TLS at stalled replication forks. Moreover, specific photolyases were employed to show that in XP-C cells, CPD arrest replication forks, while 6-4PP are responsible for the generation of ssDNA gaps and PRR tracts. On the other hand, in the absence of Polη or Rev1, both types of lesion block replication forks progression. Altogether, the data directly show that, in the human genome, Polη and Rev1 bypass CPD and 6-4PP at replication forks, while only 6-4PP are also tolerated b