Science.gov

Sample records for affect gene regulation

  1. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    SciTech Connect

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-04-23

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic {beta}-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  2. Identification of Common Regulators of Genes in Co-Expression Networks Affecting Muscle and Meat Properties

    PubMed Central

    Ponsuksili, Siriluck; Siengdee, Puntita; Du, Yang; Trakooljul, Nares; Murani, Eduard; Schwerin, Manfred; Wimmers, Klaus

    2015-01-01

    Understanding the genetic contributions behind skeletal muscle composition and metabolism is of great interest in medicine and agriculture. Attempts to dissect these complex traits combine genome-wide genotyping, expression data analyses and network analyses. Weighted gene co-expression network analysis (WGCNA) groups genes into modules based on patterns of co-expression, which can be linked to phenotypes by correlation analysis of trait values and the module eigengenes, i.e. the first principal component of a given module. Network hub genes and regulators of the genes in the modules are likely to play an important role in the emergence of respective traits. In order to detect common regulators of genes in modules showing association with meat quality traits, we identified eQTL for each of these genes, including the highly connected hub genes. Additionally, the module eigengene values were used for association analyses in order to derive a joint eQTL for the respective module. Thereby major sites of orchestrated regulation of genes within trait-associated modules were detected as hotspots of eQTL of many genes of a module and of its eigengene. These sites harbor likely common regulators of genes in the modules. We exemplarily showed the consistent impact of candidate common regulators on the expression of members of respective modules by RNAi knockdown experiments. In fact, Cxcr7 was identified and validated as a regulator of genes in a module, which is involved in the function of defense response in muscle cells. Zfp36l2 was confirmed as a regulator of genes of a module related to cell death or apoptosis pathways. The integration of eQTL in module networks enabled to interpret the differentially-regulated genes from a systems perspective. By integrating genome-wide genomic and transcriptomic data, employing co-expression and eQTL analyses, the study revealed likely regulators that are involved in the fine-tuning and synchronization of genes with trait

  3. Cis elements and trans-acting factors affecting regulation of a nonphotosynthetic light-regulated gene for chloroplast glutamine synthetase.

    PubMed Central

    Tjaden, G; Edwards, J W; Coruzzi, G M

    1995-01-01

    The glutamine synthetase (GS) gene family in pea (Pisum sativum) consists of four nuclear genes encoding distinct isoenzymes. Molecular studies have show that the GS2 gene encoding chloroplast-localized GS is expected in specific cell types and is regulated by diverse factors such as light and photorespiration. Here, we present the nucleotide sequence of the pea GS2 gene promoter. To identify the elements involved in regulation of GS2 expression, GS2 promoter-deletion analyses were performed using GS2-GUS fusions in tobacco (Nicotiana tabacum). This analysis revealed that the GS2 transit peptide is not required for mesophyll cell-specific expression of beta-glucuronidase (GUS). GUS activity was induced 2- to 4-fold in light-grown versus etiolated T1 seedlings. However, high levels of GUS activity were observed in etiolated seedlings. This observation demonstrated that regulation of expression of GS2, a nonphotosynthetic light-regulated gene, involves additional factors. A 323-bp GS2 promoter sequence is sufficient to confer light regulation to the GUS reporter gene in leaves of mature transgenic tobacco. Light-regulated expression of this pea gene promoter is observed in both tobacco and Arabidopsis, suggesting that the regulatory elements are conserved. Gel-shift analysis detected DNA-protein complexes formed with potential transcription elements within this short, light-responsive GS2 promoter fragment. PMID:7630938

  4. The Magea gene cluster regulates male germ cell apoptosis without affecting the fertility in mice.

    PubMed

    Hou, Siyuan; Xian, Li; Shi, Peiliang; Li, Chaojun; Lin, Zhaoyu; Gao, Xiang

    2016-01-01

    While apoptosis is essential for male germ cell development, improper activation of apoptosis in the testis can affect spermatogenesis and cause reproduction defects. Members of the MAGE-A (melanoma antigen family A) gene family are frequently clustered in mammalian genomes and are exclusively expressed in the testes of normal animals but abnormally activated in a wide variety of cancers. We investigated the potential roles of these genes in spermatogenesis by generating a mouse model with a 210-kb genomic deletion encompassing six members of the Magea gene cluster (Magea1, Magea2, Magea3, Magea5, Magea6 and Magea8). Male mice carrying the deletion displayed smaller testes from 2 months old with a marked increase in apoptotic germ cells in the first wave of spermatogenesis. Furthermore, we found that Magea genes prevented stress-induced spermatogenic apoptosis after N-ethyl-N-nitrosourea (ENU) treatment during the adult stage. Mechanistically, deletion of the Magea gene cluster resulted in a dramatic increase in apoptotic germ cells, predominantly spermatocytes, with activation of p53 and induction of Bax in the testes. These observations demonstrate that the Magea genes are crucial in maintaining normal testicular size and protecting germ cells from excessive apoptosis under genotoxic stress. PMID:27226137

  5. The Magea gene cluster regulates male germ cell apoptosis without affecting the fertility in mice

    PubMed Central

    Hou, Siyuan; Xian, Li; Shi, Peiliang; Li, Chaojun; Lin, Zhaoyu; Gao, Xiang

    2016-01-01

    While apoptosis is essential for male germ cell development, improper activation of apoptosis in the testis can affect spermatogenesis and cause reproduction defects. Members of the MAGE-A (melanoma antigen family A) gene family are frequently clustered in mammalian genomes and are exclusively expressed in the testes of normal animals but abnormally activated in a wide variety of cancers. We investigated the potential roles of these genes in spermatogenesis by generating a mouse model with a 210-kb genomic deletion encompassing six members of the Magea gene cluster (Magea1, Magea2, Magea3, Magea5, Magea6 and Magea8). Male mice carrying the deletion displayed smaller testes from 2 months old with a marked increase in apoptotic germ cells in the first wave of spermatogenesis. Furthermore, we found that Magea genes prevented stress-induced spermatogenic apoptosis after N-ethyl-N-nitrosourea (ENU) treatment during the adult stage. Mechanistically, deletion of the Magea gene cluster resulted in a dramatic increase in apoptotic germ cells, predominantly spermatocytes, with activation of p53 and induction of Bax in the testes. These observations demonstrate that the Magea genes are crucial in maintaining normal testicular size and protecting germ cells from excessive apoptosis under genotoxic stress. PMID:27226137

  6. Copy number variants in patients with intellectual disability affect the regulation of ARX transcription factor gene.

    PubMed

    Ishibashi, Minaka; Manning, Elizabeth; Shoubridge, Cheryl; Krecsmarik, Monika; Hawkins, Thomas A; Giacomotto, Jean; Zhao, Ting; Mueller, Thomas; Bader, Patricia I; Cheung, Sau W; Stankiewicz, Pawel; Bain, Nicole L; Hackett, Anna; Reddy, Chilamakuri C S; Mechaly, Alejandro S; Peers, Bernard; Wilson, Stephen W; Lenhard, Boris; Bally-Cuif, Laure; Gecz, Jozef; Becker, Thomas S; Rinkwitz, Silke

    2015-11-01

    Protein-coding mutations in the transcription factor-encoding gene ARX cause various forms of intellectual disability (ID) and epilepsy. In contrast, variations in surrounding non-coding sequences are correlated with milder forms of non-syndromic ID and autism and had suggested the importance of ARX gene regulation in the etiology of these disorders. We compile data on several novel and some already identified patients with or without ID that carry duplications of ARX genomic region and consider likely genetic mechanisms underlying the neurodevelopmental defects. We establish the long-range regulatory domain of ARX and identify its brain region-specific autoregulation. We conclude that neurodevelopmental disturbances in the patients may not simply arise from increased dosage due to ARX duplication. This is further exemplified by a small duplication involving a non-functional ARX copy, but with duplicated enhancers. ARX enhancers are located within a 504-kb region and regulate expression specifically in the forebrain in developing and adult zebrafish. Transgenic enhancer-reporter lines were used as in vivo tools to delineate a brain region-specific negative and positive autoregulation of ARX. We find autorepression of ARX in the telencephalon and autoactivation in the ventral thalamus. Fluorescently labeled brain regions in the transgenic lines facilitated the identification of neuronal outgrowth and pathfinding disturbances in the ventral thalamus and telencephalon that occur when arxa dosage is diminished. In summary, we have established a model for how breakpoints in long-range gene regulation alter the expression levels of a target gene brain region-specifically, and how this can cause subtle neuronal phenotypes relating to the etiology of associated neuropsychiatric disease.

  7. Genes and gene regulation

    SciTech Connect

    MacLean, N.

    1988-01-01

    Genetics has long been a central topic for biologists, and recent progress has captured the public imagination as well. This book addresses questions that are at the leading edge of this continually advancing discipline. In tune with the increasing emphasis on molecular biology and genetic engineering, this text emphasizes the molecular aspects of gene expression, and the evolution of gene sequence organization and control. It reviews the genetic material of viruses, bacteria, and of higher organisms. Cells and organisms are compared in terms of gene numbers, their arrangements within a cell, and the control mechanisms which regulate the activity of genes.

  8. SNHG16 is regulated by the Wnt pathway in colorectal cancer and affects genes involved in lipid metabolism.

    PubMed

    Christensen, Lise Lotte; True, Kirsten; Hamilton, Mark P; Nielsen, Morten M; Damas, Nkerorema D; Damgaard, Christian K; Ongen, Halit; Dermitzakis, Emmanouil; Bramsen, Jesper B; Pedersen, Jakob S; Lund, Anders H; Vang, Søren; Stribolt, Katrine; Madsen, Mogens R; Laurberg, Søren; McGuire, Sean E; Ørntoft, Torben F; Andersen, Claus L

    2016-10-01

    It is well established that lncRNAs are aberrantly expressed in cancer where they have been shown to act as oncogenes or tumor suppressors. RNA profiling of 314 colorectal adenomas/adenocarcinomas and 292 adjacent normal colon mucosa samples using RNA-sequencing demonstrated that the snoRNA host gene 16 (SNHG16) is significantly up-regulated in adenomas and all stages of CRC. SNHG16 expression was positively correlated to the expression of Wnt-regulated transcription factors, including ASCL2, ETS2, and c-Myc. In vitro abrogation of Wnt signaling in CRC cells reduced the expression of SNHG16 indicating that SNHG16 is regulated by the Wnt pathway. Silencing of SNHG16 resulted in reduced viability, increased apoptotic cell death and impaired cell migration. The SNHG16 silencing particularly affected expression of genes involved in lipid metabolism. A connection between SNHG16 and genes involved in lipid metabolism was also observed in clinical tumors. Argonaute CrossLinking and ImmunoPrecipitation (AGO-CLIP) demonstrated that SNHG16 heavily binds AGO and has 27 AGO/miRNA target sites along its length, indicating that SNHG16 may act as a competing endogenous RNA (ceRNA) "sponging" miRNAs off their cognate targets. Most interestingly, half of the miRNA families with high confidence targets on SNHG16 also target the 3'UTR of Stearoyl-CoA Desaturase (SCD). SCD is involved in lipid metabolism and is down-regulated upon SNHG16 silencing. In conclusion, up-regulation of SNHG16 is a frequent event in CRC, likely caused by deregulated Wnt signaling. In vitro analyses demonstrate that SNHG16 may play an oncogenic role in CRC and that it affects genes involved in lipid metabolism, possible through ceRNA related mechanisms.

  9. Sphingolipids regulate telomere clustering by affecting the transcription of genes involved in telomere homeostasis.

    PubMed

    Ikeda, Atsuko; Muneoka, Tetsuya; Murakami, Suguru; Hirota, Ayaka; Yabuki, Yukari; Karashima, Takefumi; Nakazono, Kota; Tsuruno, Masahiro; Pichler, Harald; Shirahige, Katsuhiko; Kodama, Yukiko; Shimamoto, Toshi; Mizuta, Keiko; Funato, Kouichi

    2015-07-15

    In eukaryotic organisms, including mammals, nematodes and yeasts, the ends of chromosomes, telomeres are clustered at the nuclear periphery. Telomere clustering is assumed to be functionally important because proper organization of chromosomes is necessary for proper genome function and stability. However, the mechanisms and physiological roles of telomere clustering remain poorly understood. In this study, we demonstrate a role for sphingolipids in telomere clustering in the budding yeast Saccharomyces cerevisiae. Because abnormal sphingolipid metabolism causes downregulation of expression levels of genes involved in telomere organization, sphingolipids appear to control telomere clustering at the transcriptional level. In addition, the data presented here provide evidence that telomere clustering is required to protect chromosome ends from DNA-damage checkpoint signaling. As sphingolipids are found in all eukaryotes, we speculate that sphingolipid-based regulation of telomere clustering and the protective role of telomere clusters in maintaining genome stability might be conserved in eukaryotes.

  10. Stiff mutant genes of phycomyces affect turgor pressure and wall mechanical properties to regulate elongation growth rate.

    PubMed

    Ortega, Joseph K E; Munoz, Cindy M; Blakley, Scott E; Truong, Jason T; Ortega, Elena L

    2012-01-01

    Regulation of cell growth is paramount to all living organisms. In plants, algae and fungi, regulation of expansive growth of cells is required for development and morphogenesis. Also, many sensory responses of stage IVb sporangiophores of Phycomyces blakesleeanus are produced by regulating elongation growth rate (growth responses) and differential elongation growth rate (tropic responses). "Stiff" mutant sporangiophores exhibit diminished tropic responses and are found to be defective in at least five genes; madD, E, F, G, and J. Prior experimental research suggests that the defective genes affect growth regulation, but this was not verified. All the growth of the single-celled stalk of the stage IVb sporangiophore occurs in a short region termed the "growth zone." Prior experimental and theoretical research indicates that elongation growth rate of the stage IVb sporangiophore can be regulated by controlling the cell wall mechanical properties within the growth zone and the magnitude of the turgor pressure. A quantitative biophysical model for elongation growth rate is required to elucidate the relationship between wall mechanical properties and turgor pressure during growth regulation. In this study, it is hypothesized that the mechanical properties of the wall within the growth zone of stiff mutant sporangiophores are different compared to wild type (WT). A biophysical equation for elongation growth rate is derived for fungal and plant cells with a growth zone. Two strains of stiff mutants are studied, C149 madD120 (-) and C216 geo- (-). Experimental results demonstrate that turgor pressure is larger but irreversible wall deformation rates within the growth zone and growth zone length are smaller for stiff mutant sporangiophores compared to WT. These findings can explain the diminished tropic responses of the stiff mutant sporangiophores. It is speculated that the defective genes affect the amount of wall-building material delivered to the inner cell wall.

  11. Mutations in the bvgA gene of Bordetella pertussis that differentially affect regulation of virulence determinants.

    PubMed Central

    Stibitz, S

    1994-01-01

    By using chemical mutagenesis and genetic mapping, a search was undertaken for previously undescribed genes which may be involved in different regulatory mechanisms governing different virulence factors of Bordetella pertussis. Previous studies have shown that the fha locus encoding filamentous hemagglutinin is regulated directly by the bvgAS two component system, while regulation of ptx encoding pertussis toxin is less direct or occurs by a different mechanism. With a strain containing gene fusions to each of these regulated loci, screening was done for mutations which were defective for ptx expression but maintained normal or nearly normal levels of fha expression. Two mutations which had such a phenotype and were also deficient in adenylate cyclase toxin/hemolysin expression were found and characterized more fully. Both were found to affect residues in the C-terminal portion of the BvgA response regulator protein, a domain which shares sequence similarity with a family of regulatory proteins including FixJ, UhpA, MalT, RcsA, RcsB, and LuxR. The residues affected are within a region which, by extension from studies on the LuxR protein, may be involved in transcriptional activation. Images PMID:8083156

  12. JMJD2A attenuation affects cell cycle and tumourigenic inflammatory gene regulation in lipopolysaccharide stimulated neuroectodermal stem cells

    SciTech Connect

    Das, Amitabh; Chai, Jin Choul; Jung, Kyoung Hwa; Das, Nando Dulal; Kang, Sung Chul; Lee, Young Seek; Seo, Hyemyung; Chai, Young Gyu

    2014-11-01

    JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuation significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup

  13. In Ovo Injection of Betaine Affects Hepatic Cholesterol Metabolism through Epigenetic Gene Regulation in Newly Hatched Chicks

    PubMed Central

    Hu, Yun; Sun, Qinwei; Li, Xiaoliang; Wang, Min; Cai, Demin; Li, Xi; Zhao, Ruqian

    2015-01-01

    Betaine is reported to regulate hepatic cholesterol metabolism in mammals. Chicken eggs contain considerable amount of betaine, yet it remains unknown whether and how betaine in the egg affects hepatic cholesterol metabolism in chicks. In this study, eggs were injected with betaine at 2.5 mg/egg and the hepatic cholesterol metabolism was investigated in newly hatched chicks. Betaine did not affect body weight or liver weight, but significantly increased the serum concentration (P < 0.05) and the hepatic content (P < 0.01) of cholesterol. Accordingly, the cholesterol biosynthetic enzyme HMGCR was up-regulated (P < 0.05 for both mRNA and protein), while CYP7A1 which converts cholesterol to bile acids was down-regulated (P < 0.05 for mRNA and P = 0.07 for protein). Moreover, hepatic protein content of the sterol-regulatory element binding protein 1 which regulates cholesterol and lipid biosynthesis, and the mRNA abundance of ATP binding cassette sub-family A member 1 (ABCA1) which mediates cholesterol counter transport were significantly (P < 0.05) increased in betaine-treated chicks. Meanwhile, hepatic protein contents of DNA methyltransferases 1 and adenosylhomocysteinase-like 1 were increased (P < 0.05), which was associated with global genomic DNA hypermethylation (P < 0.05) and diminished gene repression mark histone H3 lysine 27 trimethylation (P < 0.05). Furthermore, CpG methylation level on gene promoters was found to be increased (P < 0.05) for CYP7A1 yet decreased (P < 0.05) for ABCA1. These results indicate that in ovo betaine injection regulates hepatic cholesterol metabolism in chicks through epigenetic mechanisms including DNA and histone methylations. PMID:25860502

  14. In Ovo injection of betaine affects hepatic cholesterol metabolism through epigenetic gene regulation in newly hatched chicks.

    PubMed

    Hu, Yun; Sun, Qinwei; Li, Xiaoliang; Wang, Min; Cai, Demin; Li, Xi; Zhao, Ruqian

    2015-01-01

    Betaine is reported to regulate hepatic cholesterol metabolism in mammals. Chicken eggs contain considerable amount of betaine, yet it remains unknown whether and how betaine in the egg affects hepatic cholesterol metabolism in chicks. In this study, eggs were injected with betaine at 2.5 mg/egg and the hepatic cholesterol metabolism was investigated in newly hatched chicks. Betaine did not affect body weight or liver weight, but significantly increased the serum concentration (P < 0.05) and the hepatic content (P < 0.01) of cholesterol. Accordingly, the cholesterol biosynthetic enzyme HMGCR was up-regulated (P < 0.05 for both mRNA and protein), while CYP7A1 which converts cholesterol to bile acids was down-regulated (P < 0.05 for mRNA and P = 0.07 for protein). Moreover, hepatic protein content of the sterol-regulatory element binding protein 1 which regulates cholesterol and lipid biosynthesis, and the mRNA abundance of ATP binding cassette sub-family A member 1 (ABCA1) which mediates cholesterol counter transport were significantly (P < 0.05) increased in betaine-treated chicks. Meanwhile, hepatic protein contents of DNA methyltransferases 1 and adenosylhomocysteinase-like 1 were increased (P < 0.05), which was associated with global genomic DNA hypermethylation (P < 0.05) and diminished gene repression mark histone H3 lysine 27 trimethylation (P < 0.05). Furthermore, CpG methylation level on gene promoters was found to be increased (P < 0.05) for CYP7A1 yet decreased (P < 0.05) for ABCA1. These results indicate that in ovo betaine injection regulates hepatic cholesterol metabolism in chicks through epigenetic mechanisms including DNA and histone methylations.

  15. Altered cobalamin metabolism in Escherichia coli btuR mutants affects btuB gene regulation.

    PubMed Central

    Lundrigan, M D; Kadner, R J

    1989-01-01

    Synthesis of the Escherichia coli outer membrane protein BtuB, which mediates the binding and transport of vitamin B12, is repressed when cells are grown in the presence of vitamin B12. Expression of btuB-lacZ fusions was also found to be repressed, and selection for constitutive production of beta-galactosidase in the presence of vitamin B12 yielded mutations at btuR. The btuR locus, at 27.9 min on the chromosome map, was isolated on a 952-base-pair EcoRV fragment, and its nucleotide sequence was determined. The BtuR protein was identified in maxicells as a 22,000-dalton polypeptide, as predicted from the nucleotide sequence. Strains mutant at btuR had negligible pools of adenosylcobalamin but did convert vitamin B12 into other derivatives. Although btuB expression in a btuR strain could not be repressed by cyano- or methylcobalamin, it was repressed by adenosylcobalamin. Growth on ethanolamine as the sole nitrogen source requires adenosylcobalamin. btuR mutants grew on ethanolamine but were affected in the length of the lag period before initiation of growth, which suggested that an alternative route for adenosylcobalamin synthesis might exist. No mutations were found that conferred constitutive btuB expression in the presence of adenosylcobalamin. Other genes near btuR may also be involved in cobalamin metabolism, as suggested from the complementation behavior of strains generated by excision of the Tn10 element in btuR. These results indicated that the btuR product is involved in the metabolism of adenosylcobalamin and that this cofactor, or some derivative, controls btuB expression. Images PMID:2644187

  16. The gene vitellogenin affects microRNA regulation in honey bee (Apis mellifera) fat body and brain.

    PubMed

    Nunes, Francis M F; Ihle, Kate E; Mutti, Navdeep S; Simões, Zilá L P; Amdam, Gro V

    2013-10-01

    In honey bees, vitellogenin (Vg) is hypothesized to be a major factor affecting hormone signaling, food-related behavior, immunity, stress resistance and lifespan. MicroRNAs, which play important roles in post-transcriptional gene regulation, likewise affect many biological processes. The actions of microRNAs and Vg are known to intersect in the context of reproduction; however, the role of these associations on social behavior is unknown. The phenotypic effects of Vg knockdown are best established and studied in the forager stage of workers. Thus, we exploited the well-established RNA interference (RNAi) protocol for Vg knockdown to investigate its downstream effects on microRNA population in honey bee foragers' brain and fat body tissue. To identify microRNAs that are differentially expressed between tissues in control and knockdown foragers, we used μParaflo microfluidic oligonucleotide microRNA microarrays. Our results showed that 76 and 74 microRNAs were expressed in the brain of control and knockdown foragers whereas 66 and 69 microRNAs were expressed in the fat body of control and knockdown foragers, respectively. Target prediction identified potential seed matches for a differentially expressed subset of microRNAs affected by Vg knockdown. These candidate genes are involved in a broad range of biological processes including insulin signaling, juvenile hormone (JH) and ecdysteroid signaling previously shown to affect foraging behavior. Thus, here we demonstrate a causal link between the Vg knockdown forager phenotype and variation in the abundance of microRNAs in different tissues, with possible consequences for the regulation of foraging behavior.

  17. Photoperiodic regulation of the sucrose transporter StSUT4 affects the expression of circadian-regulated genes and ethylene production

    PubMed Central

    Chincinska, Izabela; Gier, Konstanze; Krügel, Undine; Liesche, Johannes; He, Hongxia; Grimm, Bernhard; Harren, Frans J. M.; Cristescu, Simona M.; Kühn, Christina

    2012-01-01

    Several recent publications reported different subcellular localization of the sucrose transporters belonging to the SUT4 subfamily. The physiological function of the SUT4 sucrose transporters requires clarification, because down-regulation of the members of the SUT4 clade had different effects in rice, poplar, and potato. Here, we provide new data for the localization and function of the Solanaceous StSUT4 protein, further elucidating involvement in the onset of flowering, tuberization and in the shade avoidance syndrome of potato plants. Induction of an early flowering and a tuberization in the SUT4-inhibited potato plants correlates with increased sucrose export from leaves and increased sucrose and starch accumulation in terminal sink organs, such as developing tubers. SUT4 affects expression of the enzymes involved in gibberellin and ethylene biosynthesis, as well as the rate of ethylene biosynthesis in potato. In the SUT4-inhibited plants, the ethylene production no longer follows a diurnal rhythm. Thus it was concluded that StSUT4 controls circadian gene expression, potentially by regulating sucrose export from leaves. Furthermore, SUT4 expression affects clock-regulated genes such as StFT, StSOC1, and StCO, which might be also involved in a photoperiod-dependent tuberization. A model is proposed in which StSUT4 controls a phloem-mobile signaling molecule generated in leaves, which together with enhanced sucrose export affects developmental switches in apical meristems. SUT4 seems to link photoreceptor-perceived information about the light quality and day length with phytohormone biosynthesis and the expression of circadian-regulated genes. PMID:23429841

  18. Dexamethasone acutely regulates endocrine parameters in stallions and subsequently affects gene expression in testicular germ cells.

    PubMed

    Ing, N H; Brinsko, S P; Curley, K O; Forrest, D W; Love, C C; Hinrichs, K; Vogelsang, M M; Varner, D D; Welsh, T H

    2015-01-01

    Testicular steroidogenesis and spermatogenesis are negatively impacted by stress-related hormones such as glucocorticoids. The effects of two injections of a therapeutic dose of dexamethasone (a synthetic glucocorticoid, 0.1mg/kg; i.v.) given 24h apart to each of three stallions were investigated and compared to three saline-injected control stallions. Dexamethasone decreased circulating concentrations of cortisol by 50% at 24h after the initial injection. Serum testosterone decreased by a maximum of 94% from 4 to 20h after the initial injection of dexamethasone. Semen parameters of the dexamethasone-treated stallions were unchanged in the subsequent two weeks. Two weeks after treatment, stallions were castrated. Functional genomic analyses of the testes revealed that, of eight gene products analyzed, dexamethasone depressed concentrations of heat shock protein DNAJC4 and sperm-specific calcium channel CATSPER1 mRNAs by more than 60%. Both genes are expressed in germ cells during spermiogenesis and have been related to male fertility in other species, including humans. This is the first report of decreased DNAJC4 and CATSPER1 mRNA concentrations in testes weeks after dexamethasone treatment. Concentrations of these mRNAs in sperm may be useful as novel markers of fertility in stallions. PMID:25487569

  19. The Role of Genetic Sex in Affect Regulation and Expression of GABA-Related Genes Across Species

    PubMed Central

    Seney, Marianne L.; Chang, Lun-Ching; Oh, Hyunjung; Wang, Xingbin; Tseng, George C.; Lewis, David A.; Sibille, Etienne

    2013-01-01

    Although circulating hormones and inhibitory gamma-aminobutyric acid (GABA)-related factors are known to affect mood, considerable knowledge gaps persist for biological mechanisms underlying the female bias in mood disorders. Here, we combine human and mouse studies to investigate sexual dimorphism in the GABA system in the context of major depressive disorder (MDD) and then use a genetic model to dissect the role of sex-related factors in GABA-related gene expression and anxiety-/depressive-like behaviors in mice. First, using meta-analysis of gene array data in human postmortem brain (N = 51 MDD subjects, 50 controls), we show that the previously reported down-regulation in MDD of somatostatin (SST), a marker of a GABA neuron subtype, is significantly greater in women with MDD. Second, using gene co-expression network analysis in control human subjects (N = 214; two frontal cortex regions) and expression quantitative trait loci mapping (N = 170 subjects), we show that expression of SST and the GABA-synthesizing enzymes glutamate decarboxylase 67 (GAD67) and GAD65 are tightly co-regulated and influenced by X-chromosome genetic polymorphisms. Third, using a rodent genetic model [Four Core Genotypes (FCG) mice], in which genetic and gonadal sex are artificially dissociated (N ≥ 12/group), we show that genetic sex (i.e., X/Y-chromosome) influences both gene expression (lower Sst, Gad67, Gad65 in XY mice) and anxiety-like behaviors (higher in XY mice). This suggests that in an intact male animal, the observed behavior represents the outcomes of male genetic sex increasing and male-like testosterone decreasing anxiety-like behaviors. Gonadal sex was the only factor influencing depressive-like behavior (gonadal males < gonadal females). Collectively, these combined human and mouse studies provide mechanistic insight into sexual dimorphism in mood disorders, and specifically demonstrate an unexpected role of male-like factors (XY genetic sex) on

  20. Aspergillus asexual reproduction and sexual reproduction are differentially affected by transcriptional and translational mechanisms regulating stunted gene expression.

    PubMed Central

    Wu, J; Miller, B L

    1997-01-01

    The Stunted protein (StuAp) is a member of a family of transcription factors that regulate fungal development and cell cycle progression. Regulated stuA gene expression is required for correct cell pattern formation during asexual reproduction (conidiation) and for initiation of the sexual reproductive cycle in Aspergillus nidulans. Transcriptional initiation from two different promoters yields overlapping mRNAs (stuA alpha and stuAbeta) that upon translation yield the same protein. Here we show that multiple regulatory mechanisms interact to control (i) developmental competence-dependent expression of both transcripts and (ii) induction-dependent expression of stuA alpha, but not stuAbeta, by the conidiation-specific Bristle (BrlAp) transcriptional activator. Quantitative levels of both mRNAs are further modulated by (i) an activator(s) located at a far-upstream upstream activation sequence, (ii) feedback regulation by StuAp, and (iii) positive translational regulation that requires the peptide product of a micro-open reading frame unique to the stuA alpha mRNA 5' untranslated region. Gradients in stuA alpha expression were most important for correct cell and tissue type development. Threshold requirements were as follows: metula-phialide differentiation < ascosporogenesis < cleistothecial shell-Hülle cell differentiation. Altered stuA expression affected conidiophore morphology and conidial yields quantitatively but did not alter the temporal development of cell types or conidiophore density. By contrast, the sexual cycle showed both temporal delay and quantitative reduction in the number of cleistothecial initials but normal morphogenesis of tissue types. PMID:9315680

  1. Glucocorticoid status affects antidepressant regulation of locus coeruleus tyrosine hydroxylase and dorsal raphé tryptophan hydroxylase gene expression

    PubMed Central

    Heydendael, Willem; Jacobson, Lauren

    2009-01-01

    Brainstem monoaminergic nuclei express glucocorticoid receptors (GR), and glucocorticoids have been shown to inhibit expression of enzymes involved in monoamine synthesis. Monoamine deficits have been implicated in depression pathology. However, it is unknown if antidepressants regulate brainstem GR, and if glucocorticoids might influence antidepressant effects on monoamine-synthesizing enzymes. Our lab has found opposing effects of the monoamine oxidase inhibitor phenelzine and the tricyclic antidepressant imipramine on HPA activity and forebrain GR expression. We therefore hypothesized that phenelzine and imipramine would also affect brainstem GR gene expression differentially, and that antidepressant-induced changes in GR expression would correlate with effects on monoamine-synthesizing enzyme expression. Using in situ hybridization, we measured effects of chronic antidepressant treatment on brainstem GR, locus coeruleus and ventral tegmental area (VTA) tyrosine hydroxylase (TH), and dorsal raphé tryptophan hydroxylase (TPH2) gene expression in male C57BL/6 mice that were adrenalectomized and replaced with defined levels of corticosterone. GR expression was decreased by phenelzine in the locus coeruleus and decreased by imipramine in the dorsal raphé. Phenelzine increased locus coeruleus TH and imipramine increased dorsal raphé TPH2 gene expression in a glucocorticoid-dependent manner, suggesting that increases in these enzymes were due to relief of inhibitory glucocorticoid signaling. We did not find antidepressant effects on GR or TH expression in the VTA or on MR expression in any of the nuclei examined. Our findings represent a potential mechanism through which antidepressants and glucocorticoids could alter both HPA activity and mood via effects on brainstem GR, norepinephrine, and serotonin. PMID:19577549

  2. Sodium houttuyfonate affects production of N-acyl homoserine lactone and quorum sensing-regulated genes expression in Pseudomonas aeruginosa

    PubMed Central

    Wu, Daqiang; Huang, Weifeng; Duan, Qiangjun; Li, Fang; Cheng, Huijuan

    2014-01-01

    Quorum sensing (QS) is a means of cell-to-cell communication that uses diffusible signaling molecules that are sensed by the population to determine population density, thus allowing co-ordinate gene regulation in response to population density. In Pseudomonas aeruginosa, production of the QS signaling molecule, N-acyl homoserine lactone (AHL), co-ordinates expression of key factors of pathogenesis, including biofilm formation and toxin secretion. It is predicted that the inhibition of AHL sensing would provide an effective clinical treatment to reduce the expression of virulence factors and increase the effectiveness of antimicrobial agents. We previously demonstrated that sodium houttuyfonate (SH), commonly used in traditional Chinese medicine to treat infectious diseases, can effectively inhibit QS-regulated processes, including biofilm formation. Here, using a model system, we demonstrate that SH causes the dose-dependent inhibition of AHL production, through down-regulation of the AHL biosynthesis gene, lasI. Addition of SH also resulted in down-regulation of expression of the AHL sensor and transcriptional regulator, LasR, and inhibited the production of the QS-regulated virulence factors, pyocyanin and LasA. These results suggest that the antimicrobial activity of SH may be due to its ability to disrupt QS in P. aeruginosa. PMID:25505457

  3. Affect and Self-Regulation

    ERIC Educational Resources Information Center

    Malmivuori, Marja-Liisa

    2006-01-01

    This paper presents affect as an essential aspect of students' self-reflection and self-regulation. The introduced concepts of self-system and self-system process stress the importance of self-appraisals of personal competence and agency in affective responses and self-regulation in problem solving. Students are viewed as agents who constantly…

  4. Expression-based GWAS identifies variants, gene interactions and key regulators affecting intramuscular fatty acid content and composition in porcine meat

    PubMed Central

    Puig-Oliveras, Anna; Revilla, Manuel; Castelló, Anna; Fernández, Ana I.; Folch, Josep M.; Ballester, Maria

    2016-01-01

    The aim of this work is to better understand the genetic mechanisms determining two complex traits affecting porcine meat quality: intramuscular fat (IMF) content and its fatty acid (FA) composition. With this purpose, expression Genome-Wide Association Study (eGWAS) of 45 lipid-related genes associated with meat quality traits in swine muscle (Longissimus dorsi) of 114 Iberian × Landrace backcross animals was performed. The eGWAS identified 241 SNPs associated with 11 genes: ACSM5, CROT, FABP3, FOS, HIF1AN, IGF2, MGLL, NCOA1, PIK3R1, PLA2G12A and PPARA. Three expression Quantitative Trait Loci (eQTLs) for IGF2, ACSM5 and MGLL were identified, showing cis-acting effects, whereas 16 eQTLs had trans regulatory effects. A polymorphism in the ACSM5 promoter region associated with its expression was identified. In addition, strong candidate genes regulating ACSM5, FOS, PPARA, PIK3R1, PLA2G12A and HIF1AN gene expression were also seen. Notably, the analysis highlighted the NR3C1 transcription factor as a strong candidate gene involved in the regulation of the 45 genes analysed. Finally, the IGF2, MGLL, MC2R, ARHGAP6, and NR3C1 genes were identified as potential regulators co-localizing within QTLs for fatness and growth traits in the IBMAP population. The results obtained increase our knowledge in the functional regulatory mechanisms involved in these complex traits.

  5. Expression-based GWAS identifies variants, gene interactions and key regulators affecting intramuscular fatty acid content and composition in porcine meat

    PubMed Central

    Puig-Oliveras, Anna; Revilla, Manuel; Castelló, Anna; Fernández, Ana I.; Folch, Josep M.; Ballester, Maria

    2016-01-01

    The aim of this work is to better understand the genetic mechanisms determining two complex traits affecting porcine meat quality: intramuscular fat (IMF) content and its fatty acid (FA) composition. With this purpose, expression Genome-Wide Association Study (eGWAS) of 45 lipid-related genes associated with meat quality traits in swine muscle (Longissimus dorsi) of 114 Iberian × Landrace backcross animals was performed. The eGWAS identified 241 SNPs associated with 11 genes: ACSM5, CROT, FABP3, FOS, HIF1AN, IGF2, MGLL, NCOA1, PIK3R1, PLA2G12A and PPARA. Three expression Quantitative Trait Loci (eQTLs) for IGF2, ACSM5 and MGLL were identified, showing cis-acting effects, whereas 16 eQTLs had trans regulatory effects. A polymorphism in the ACSM5 promoter region associated with its expression was identified. In addition, strong candidate genes regulating ACSM5, FOS, PPARA, PIK3R1, PLA2G12A and HIF1AN gene expression were also seen. Notably, the analysis highlighted the NR3C1 transcription factor as a strong candidate gene involved in the regulation of the 45 genes analysed. Finally, the IGF2, MGLL, MC2R, ARHGAP6, and NR3C1 genes were identified as potential regulators co-localizing within QTLs for fatness and growth traits in the IBMAP population. The results obtained increase our knowledge in the functional regulatory mechanisms involved in these complex traits. PMID:27666082

  6. Peach ( Prunus persica L. Batsch) allergen-encoding genes are developmentally regulated and affected by fruit load and light radiation.

    PubMed

    Botton, Alessandro; Andreotti, Carlo; Costa, Guglielmo; Ramina, Angelo

    2009-01-28

    The fruits of Rosaceae species may frequently induce allergic reactions in both adults and children, especially in the Mediterranean area. In peach, true allergens and cross-reactive proteins may cause hypersensitive reactions involving a wide diversity of symptoms. Three known classes of allergenic proteins, namely, Pru p 1, Pru p 3, and Pru p 4, have been reported to be mostly involved, but an exhaustive survey of the proteins determining the overall allergenic potential, their biological functions, and the factors affecting the expression of the related genes is still missing. In the present study, the expression profiles of some selected genes encoding peach allergen isoforms were studied during fruit growth and development and upon different fruit load and light radiation regimens. The results indicate that the majority of allergen-encoding genes are expressed at their maximum during the ripening stage, therefore representing a potential risk for peach consumers. Nevertheless, enhancing the light radiation and decreasing the fruit load achieved a reduction of the transcription rate of most genes and a possible decrease of the overall allergenic potential at harvest. According to these data, new growing practices could be set up to obtain hypoallergenic peach fruits and eventually combined with the cultivation of hypoallergenic genotypes to obtain a significant reduction of the allergenic potential.

  7. Regulated Gene Therapy.

    PubMed

    Breger, Ludivine; Wettergren, Erika Elgstrand; Quintino, Luis; Lundberg, Cecilia

    2016-01-01

    Gene therapy represents a promising approach for the treatment of monogenic and multifactorial neurological disorders. It can be used to replace a missing gene and mutated gene or downregulate a causal gene. Despite the versatility of gene therapy, one of the main limitations lies in the irreversibility of the process: once delivered to target cells, the gene of interest is constitutively expressed and cannot be removed. Therefore, efficient, safe and long-term gene modification requires a system allowing fine control of transgene expression.Different systems have been developed over the past decades to regulate transgene expression after in vivo delivery, either at transcriptional or post-translational levels. The purpose of this chapter is to give an overview on current regulatory system used in the context of gene therapy for neurological disorders. Systems using external regulation of transgenes using antibiotics are commonly used to control either gene expression using tetracycline-controlled transcription or protein levels using destabilizing domain technology. Alternatively, specific promoters of genes that are regulated by disease mechanisms, increasing expression as the disease progresses or decreasing expression as disease regresses, are also examined. Overall, this chapter discusses advantages and drawbacks of current molecular methods for regulated gene therapy in the central nervous system.

  8. Regulation of sulfate uptake and expression of sulfate transporter genes in Brassica oleracea as affected by atmospheric H(2)S and pedospheric sulfate nutrition.

    PubMed

    Buchner, Peter; Stuiver, C Elisabeth E; Westerman, Sue; Wirtz, Markus; Hell, Rüdiger; Hawkesford, Malcolm J; De Kok, Luit J

    2004-10-01

    Demand-driven signaling will contribute to regulation of sulfur acquisition and distribution within the plant. To investigate the regulatory mechanisms pedospheric sulfate and atmospheric H(2)S supply were manipulated in Brassica oleracea. Sulfate deprivation of B. oleracea seedlings induced a rapid increase of the sulfate uptake capacity by the roots, accompanied by an increased expression of genes encoding specific sulfate transporters in roots and other plant parts. More prolonged sulfate deprivation resulted in an altered shoot-root partitioning of biomass in favor of the root. B. oleracea was able to utilize atmospheric H(2)S as S-source; however, root proliferation and increased sulfate transporter expression occurred as in S-deficient plants. It was evident that in B. oleracea there was a poor shoot to root signaling for the regulation of sulfate uptake and expression of the sulfate transporters. cDNAs corresponding to 12 different sulfate transporter genes representing the complete gene family were isolated from Brassica napus and B. oleracea species. The sequence analysis classified the Brassica sulfate transporter genes into four different groups. The expression of the different sulfate transporters showed a complex pattern of tissue specificity and regulation by sulfur nutritional status. The sulfate transporter genes of Groups 1, 2, and 4 were induced or up-regulated under sulfate deprivation, although the expression of Group 3 sulfate transporters was not affected by the sulfate status. The significance of sulfate, thiols, and O-acetylserine as possible signal compounds in the regulation of the sulfate uptake and expression of the transporter genes is evaluated. PMID:15377780

  9. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

    PubMed Central

    De la Cruz, Miguel A.; Pérez-Morales, Deyanira; Palacios, Irene J.; Fernández-Mora, Marcos; Calva, Edmundo; Bustamante, Víctor H.

    2015-01-01

    Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella. PMID:26300871

  10. Mutations That Affect Transcription and Cyclic Amp-Crp Regulation of the Adenylate Cyclase Gene (Cya) of Salmonella Typhimurium

    PubMed Central

    Fandl, J. P.; Thorner, L. K.; Artz, S. W.

    1990-01-01

    We studied the expression of the cya promoter(s) in cya-lac fusion strains of Salmonella typhimurium and demonstrated cAMP receptor protein (CRP)-dependent repression by cAMP. Expression of cya was reduced about fourfold in cultures grown in acetate minimal medium as compared to cultures grown in glucose-6-phosphate minimal medium. Expression of cya was also reduced about fourfold by addition of 5 mM cAMP to cultures grown in glucose minimal medium. We constructed in vitro deletion and insertion mutations altering a major cya promoter (P2) and a putative CRP binding site overlapping P2. These mutations were recombined into the chromosome by allele replacement with M13mp::cya recombinant phages and the regulation of the mutant promoters was analyzed. A 4-bp deletion of the CRP binding site and a 4-bp insertion in this site nearly eliminated repression by cAMP. A mutant with the P2 promoter and the CRP binding site both deleted exhibited an 80% reduction in cya expression; the 20% residual expression was insensitive to cAMP repression. This mutant retained a Cya(+) phenotype. Taken together, the results establish that the cya gene is transcribed from multiple promoters one of which, P2, is negatively regulated by the cAMP-CRP complex. Correction for the contribution to transcription by the cAMP-CRP nonregulated cya promoters indicates that the P2 promoter is repressed at least eightfold by cAMP-CRP. PMID:2168849

  11. Silencing BMI1 eliminates tumor formation of pediatric glioma CD133+ cells not by affecting known targets but by down-regulating a novel set of core genes.

    PubMed

    Baxter, Patricia A; Lin, Qi; Mao, Hua; Kogiso, Mari; Zhao, Xiumei; Liu, Zhigang; Huang, Yulun; Voicu, Horatiu; Gurusiddappa, Sivashankarappa; Su, Jack M; Adesina, Adekunle M; Perlaky, Laszlo; Dauser, Robert C; Leung, Hon-chiu Eastwood; Muraszko, Karin M; Heth, Jason A; Fan, Xing; Lau, Ching C; Man, Tsz-Kwong; Chintagumpala, Murali; Li, Xiao-Nan

    2014-01-01

    Clinical outcome of children with malignant glioma remains dismal. Here, we examined the role of over-expressed BMI1, a regulator of stem cell self-renewal, in sustaining tumor formation in pediatric glioma stem cells. Our investigation revealed BMI1 over-expression in 29 of 54 (53.7%) pediatric gliomas, 8 of 8 (100%) patient derived orthotopic xenograft (PDOX) mouse models, and in both CD133+ and CD133- glioma cells. We demonstrated that lentiviral-shRNA mediated silencing of suppressed cell proliferation in vitro in cells derived from 3 independent PDOX models and eliminated tumor-forming capacity of CD133+ and CD133- cells derived from 2 PDOX models in mouse brains. Gene expression profiling showed that most of the molecular targets of BMI1 ablation in CD133+ cells were different from that in CD133- cells. Importantly, we found that silencing BMI1 in CD133+ cells derived from 3 PDOX models did not affect most of the known genes previously associated with the activated BMI1, but modulated a novel set of core genes, including RPS6KA2, ALDH3A2, FMFB, DTL, API5, EIF4G2, KIF5c, LOC650152, C20ORF121, LOC203547, LOC653308, and LOC642489, to mediate the elimination of tumor formation. In summary, we identified the over-expressed BMI1 as a promising therapeutic target for glioma stem cells, and suggest that the signaling pathways associated with activated BMI1 in promoting tumor growth may be different from those induced by silencing BMI1 in blocking tumor formation. These findings highlighted the importance of careful re-analysis of the affected genes following the inhibition of abnormally activated oncogenic pathways to identify determinants that can potentially predict therapeutic efficacy.

  12. Identification of the genes affecting the regulation of riboflavin synthesis in the flavinogenic yeast Pichia guilliermondii using insertion mutagenesis.

    PubMed

    Boretsky, Yuriy R; Pynyaha, Yuriy V; Boretsky, Volodymyr Y; Fedorovych, Dariya V; Fayura, Lyubov R; Protchenko, Olha; Philpott, Caroline C; Sibirny, Andriy A

    2011-05-01

    Pichia guilliermondii is a representative of a group of so-called flavinogenic yeast species that overproduce riboflavin (vitamin B(2)) in response to iron limitation. Using insertion mutagenesis, we isolated P. guilliermondii mutants overproducing riboflavin. Analysis of nucleotide sequence of recombination sites revealed that insertion cassettes integrated into the genome disrupting P. guilliermondii genes similar to the VMA1 gene of Ashbya gossypii and Saccharomyces cerevisiae and FES1 and FRA1 genes of S. cerevisiae. The constructed P. guilliermondiiΔvma1-17 mutant possessed five- to sevenfold elevated riboflavin production and twofold decreased iron cell content as compared with the parental strain. Pichia guilliermondiiΔfra1-45 mutant accumulated 1.8-2.2-fold more iron in the cells and produced five- to sevenfold more riboflavin as compared with the parental strain. Both Δvma1-17 and Δfes1-77 knockout strains could not grow at 37 °C in contrast to the wild-type strain and the Δfra1-45 mutant. Increased riboflavin production by the wild-type strain was observed at 37 °C. Although the Δfes1-77 mutant did not overproduce riboflavin, it showed partial complementation when crossed with previously isolated P. guilliermondii riboflavin-overproducing mutant rib80-22. Complementation analysis revealed that Δvma1-17 and Δfra1-45 mutants are distinct from previously reported riboflavin-producing mutants hit1-1, rib80-22 and rib81-31 of this yeast. PMID:21261808

  13. Identification of the genes affecting the regulation of riboflavin synthesis in the flavinogenic yeast Pichia guilliermondii using insertion mutagenesis

    PubMed Central

    Boretsky, Yuriy R.; Pynyaha, Yuriy V.; Boretsky, Volodymyr Y.; Fedorovych, Dariya V.; Fayura, Lyubov R.; Protchenko, Olha; Philpott, Caroline C.; Sibirny, Andriy A.

    2012-01-01

    Pichia guilliermondii is a representative of a group of so-called flavinogenic yeast species that overproduce riboflavin (vitamin B2) in response to iron limitation. Using insertion mutagenesis, we isolated P. guilliermondii mutants overproducing riboflavin. Analysis of nucleotide sequence of recombination sites revealed that insertion cassettes integrated into the genome disrupting P. guilliermondii genes similar to the VMA1 gene of Ashbya gossypii and Saccharomyces cerevisiae and FES1 and FRA1 genes of S. cerevisiae. The constructed P. guilliermondii Δvma1–17 mutant possessed five- to sevenfold elevated riboflavin production and twofold decreased iron cell content as compared with the parental strain. Pichia guilliermondii Δfra1–45 mutant accumulated 1.8–2.2-fold more iron in the cells and produced five- to sevenfold more riboflavin as compared with the parental strain. Both Δvma1–17 and Δfes1–77 knockout strains could not grow at 37 °C in contrast to the wild-type strain and the Δfra1–45 mutant. Increased riboflavin production by the wild-type strain was observed at 37 °C. Although the Δfes1–77 mutant did not overproduce riboflavin, it showed partial complementation when crossed with previously isolated P. guilliermondii riboflavin-overproducing mutant rib80–22. Complementation analysis revealed that Δvma1–17 and Δfra1–45 mutants are distinct from previously reported riboflavin-producing mutants hit1-1, rib80-22 and rib81-31 of this yeast. PMID:21261808

  14. Genotype on the pigmentation regulating PMEL17 gene affects behavior in chickens raised without physical contact with conspecifics.

    PubMed

    Karlsson, Anna-Carin; Mormede, Pierre; Kerje, Susanne; Jensen, Per

    2011-03-01

    Chickens homozygous for the Dominant white or wild-type allele of PMEL17 were subjected to a broad phenotyping in order to detect consistent differences between genotypes. To exclude feather pecking, the chickens were individually housed without physical contact, from the day of hatching, and tested for social, aggressive, fear and exploratory behaviors, and corticosterone and testosterone levels were assessed. In a principal component analysis, 53.2% of the behavior variation was explained by two factors. Factor one was an activity and social factor, and there was a significant effect of genotype on the factor scores. On factor two, related to aggressive behavior, there were significant effects of genotype, sex and their interaction. There were no genotype effects on hormone levels or any other measured non-behavioral phenotypes. Hence, differences in behavior between PMEL17 genotypes remained when negative social experiences were excluded, indicating a direct pleiotropic effect of the gene on behavior.

  15. Characterization of a Disease-associated Mutation Affecting a Putative Splicing Regulatory Element in Intron 6b of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene*

    PubMed Central

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A. Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M. Cristina

    2009-01-01

    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as “splicing mutations,” but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002–1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5′- and 3′-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002–1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75. PMID:19759008

  16. Expression pattern of cellulolytic and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1 are affected by carbon source in Trichoderma reesei.

    PubMed

    Castro, Lilian dos Santos; Antoniêto, Amanda Cristina Campos; Pedersoli, Wellington Ramos; Silva-Rocha, Rafael; Persinoti, Gabriela F; Silva, Roberto Nascimento

    2014-03-01

    Trichoderma reesei is the most important fungus for the industrial production of enzymes to biomass deconstruction. Most of the genes encoding cellulases and hemicellulases are regulated by the transcription factors CRE1 and XYR1. In this work, the regulation of 22 genes of cellulases and xylanases by these transcription factors was investigated under three different carbon sources. Analysis of gene expression and enzymatic profiles of CMCase, β-glucosidase, and xylanases showed different regulation that was depended of the carbon source in both Δxyr1 and Δcre1 mutants. In the presence of glucose, the majority of genes evaluated (82%) showed increased expression levels in the Δcre1 mutant compared to the parental QM9414 strain. In the Δxyr1 mutant, it was observed that expression of cellulase and xylanase genes was reduced compared to the parental QM9414 strain, when cultured in the presence of cellulose or sophorose. Interesting, in the presence of glucose, approximately 60% of the analyzed genes had increased expression in the Δxyr1 mutant compared to parental strain. Furthermore, no correlation between gene expression and the number of putative binding sites of XYR1 and CRE1 to promoter region of cellulolytic and xylanolytic studied genes was observed. Therefore, these results demonstrated that the regulation of cellulase and xylanase by the transcription factors CRE1 and XYR1 is influenced by different carbon sources.

  17. Trace concentrations of imazethapyr (IM) affect floral organs development and reproduction in Arabidopsis thaliana: IM-induced inhibition of key genes regulating anther and pollen biosynthesis.

    PubMed

    Qian, Haifeng; Li, Yali; Sun, Chongchong; Lavoie, Michel; Xie, Jun; Bai, Xiaocui; Fu, Zhengwei

    2015-01-01

    Understanding how herbicides affect plant reproduction and growth is critical to develop herbicide toxicity model and refine herbicide risk assessment. Although our knowledge of herbicides toxicity mechanisms at the physiological and molecular level in plant vegetative phase has increased substantially in the last decades, few studies have addressed the herbicide toxicity problematic on plant reproduction. Here, we determined the long-term (4-8 weeks) effect of a chiral herbicide, imazethapyr (IM), which has been increasingly used in plant crops, on floral organ development and reproduction in the model plant Arabidopsis thaliana. More specifically, we followed the effect of two IM enantiomers (R- and S-IM) on floral organ structure, seed production, pollen viability and the transcription of key genes involved in anther and pollen development. The results showed that IM strongly inhibited the transcripts of genes regulating A. thaliana tapetum development (DYT1: DYSFUNCTIONAL TAPETUM 1), tapetal differentiation and function (TDF1: TAPETAL DEVELOPMENT AND FUNCTION1), and pollen wall formation and developments (AMS: ABORTED MICROSPORES, MYB103: MYB DOMAIN PROTEIN 103, MS1: MALE STERILITY 1, MS2: MALE STERILITY 2). Since DYT1 positively regulates 33 genes involved in cell-wall modification (such as, TDF1, AMS, MYB103, MS1, MS2) that can catalyze the breakdown of polysaccharides to facilitate anther dehiscence, the consistent decrease in the transcription of these genes after IM exposure should hamper anther opening as observed under scanning electron microscopy. The toxicity of IM on anther opening further lead to a decrease in pollen production and pollen viability. Furthermore, long-term IM exposure increased the number of apurinic/apyrimidinic sites (AP sites) in the DNA of A. thaliana and also altered the DNA of A. thaliana offspring grown in IM-free soils. Toxicity of IM on floral organs development and reproduction was generally higher in the presence of the R

  18. RNA-Seq Analysis Identifies New Genes Regulated by the Histone-Like Nucleoid Structuring Protein (H-NS) Affecting Vibrio cholerae Virulence, Stress Response and Chemotaxis

    PubMed Central

    Wang, Hongxia; Ayala, Julio C.; Benitez, Jorge A.; Silva, Anisia J.

    2015-01-01

    The histone-like nucleoid structuring protein (H-NS) functions as a transcriptional silencer by binding to AT-rich sequences at bacterial promoters. However, H-NS repression can be counteracted by other transcription factors in response to environmental changes. The identification of potential toxic factors, the expression of which is prevented by H-NS could facilitate the discovery of new regulatory proteins that may contribute to the emergence of new pathogenic variants by anti-silencing. Vibrio cholerae hns mutants of the El Tor biotype exhibit altered virulence, motility and environmental stress response phenotypes compared to wild type. We used an RNA-seq analysis approach to determine the basis of the above hns phenotypes and identify new targets of H-NS transcriptional silencing. H-NS affected the expression of 18% of all predicted genes in a growth phase-dependent manner. Loss of H-NS resulted in diminished expression of numerous genes encoding methyl-accepting chemotaxis proteins as well as chemotaxis toward the attractants glycine and serine. Deletion of hns also induced an endogenous envelope stress response resulting in elevated expression of rpoE encoding the extracytoplamic sigma factor E (σE). The RNA-seq analysis identified new genes directly repressed by H-NS that can affect virulence and biofilm development in the El Tor biotype cholera bacterium. We show that H-NS and the quorum sensing regulator HapR silence the transcription of the vieSAB three-component regulatory system in El Tor biotype V. cholerae. We also demonstrate that H-NS directly represses the transcription of hlyA (hemolysin), rtxCA (the repeat in toxin or RTX), rtxBDE (RTX transport) and the biosynthesis of indole. Of these genes, H-NS occupancy at the hlyA promoter was diminished by overexpression of the transcription activator HlyU. We discuss the role of H-NS transcriptional silencing in phenotypic differences exhibited by V. cholerae biotypes. PMID:25679988

  19. RNA-seq analysis identifies new genes regulated by the histone-like nucleoid structuring protein (H-NS) affecting Vibrio cholerae virulence, stress response and chemotaxis.

    PubMed

    Wang, Hongxia; Ayala, Julio C; Benitez, Jorge A; Silva, Anisia J

    2015-01-01

    The histone-like nucleoid structuring protein (H-NS) functions as a transcriptional silencer by binding to AT-rich sequences at bacterial promoters. However, H-NS repression can be counteracted by other transcription factors in response to environmental changes. The identification of potential toxic factors, the expression of which is prevented by H-NS could facilitate the discovery of new regulatory proteins that may contribute to the emergence of new pathogenic variants by anti-silencing. Vibrio cholerae hns mutants of the El Tor biotype exhibit altered virulence, motility and environmental stress response phenotypes compared to wild type. We used an RNA-seq analysis approach to determine the basis of the above hns phenotypes and identify new targets of H-NS transcriptional silencing. H-NS affected the expression of 18% of all predicted genes in a growth phase-dependent manner. Loss of H-NS resulted in diminished expression of numerous genes encoding methyl-accepting chemotaxis proteins as well as chemotaxis toward the attractants glycine and serine. Deletion of hns also induced an endogenous envelope stress response resulting in elevated expression of rpoE encoding the extracytoplamic sigma factor E (σE). The RNA-seq analysis identified new genes directly repressed by H-NS that can affect virulence and biofilm development in the El Tor biotype cholera bacterium. We show that H-NS and the quorum sensing regulator HapR silence the transcription of the vieSAB three-component regulatory system in El Tor biotype V. cholerae. We also demonstrate that H-NS directly represses the transcription of hlyA (hemolysin), rtxCA (the repeat in toxin or RTX), rtxBDE (RTX transport) and the biosynthesis of indole. Of these genes, H-NS occupancy at the hlyA promoter was diminished by overexpression of the transcription activator HlyU. We discuss the role of H-NS transcriptional silencing in phenotypic differences exhibited by V. cholerae biotypes.

  20. Gene regulation by mechanical forces

    NASA Technical Reports Server (NTRS)

    Oluwole, B. O.; Du, W.; Mills, I.; Sumpio, B. E.

    1997-01-01

    Endothelial cells are subjected to various mechanical forces in vivo from the flow of blood across the luminal surface of the blood vessel. The purpose of this review was to examine the data available on how these mechanical forces, in particular cyclic strain, affect the expression and regulation of endothelial cell function. Studies from various investigators using models of cyclic strain in vitro have shown that various vasoactive mediators such as nitric oxide and prostacyclin are induced by the effect of mechanical deformation, and that the expression of these mediators may be regulated at the transcription level by mechanical forces. There also seems to be emerging evidence that endothelial cells may also act as mechanotransducers, whereby the transmission of external forces induces various cytoskeletal changes and second messenger cascades. Furthermore, it seems these forces may act on specific response elements of promoter genes.

  1. An 11-nt sequence polymorphism at the 3′UTR of human SFTPA1 and SFTPA2 gene variants differentially affect gene expression levels and miRNA regulation in cell culture

    PubMed Central

    Silveyra, Patricia; DiAngelo, Susan L.

    2014-01-01

    Surfactant protein A (SP-A) plays a vital role in maintaining normal lung function and in host defense. Two genes encode SP-A in humans (SFTPA1, SFTPA2), and several gene variants have been identified for these. We have previously shown that sequence elements of SFTPA1 and SFTPA2 3′ untranslated regions (UTRs) differentially affect translation efficiency in vitro. Polymorphisms at the 3′UTRs of mRNA variants may account for differential binding of miRNAs, a class of small noncoding RNAs that regulate gene expression. In this work, we generated 3′UTR reporter constructs of the SFTPA1 and SFTPA2 variants most frequently found in the population, as well as mutants of a previously described 11-nt indel element (refSNP rs368700152). Reporter constructs were transfected in NCI-H441 cells in the presence or absence of miRNA mimics, and reporter gene expression was analyzed. We found that human miRNA mir-767 negatively affected expression of constructs containing SFTPA1 and SFTPA2 variants, whereas mir-4507 affected only constructs with 3′UTRs of SFTPA1 variants 6A, 6A3, and 6A4 (not containing the 11-nt element). Three miRNAs (mir-183, mir-449b, and mir-612) inhibited expression of recombinants of SFTPA2 variants and the SFTPA1 variant 6A2, all containing the 11-nt element. Similar results were obtained for SP-A expression when these miRNAs were transfected in Chinese hamster ovary cells expressing SFTPA1 or SFTPA2 variants or in NCI-H441 cells (genotype 1A5/1A5-6A4/6A4). Moreover, transfection with a specific antagomir (antagomir-183) reversed the effects of mir-183 on SP-A mRNA levels. Our results indicate that sequence variability at the 3′UTR of SP-A variants differentially affects miRNA regulation of gene expression. PMID:24793167

  2. Regulation of the NRSF/REST gene by methylation and CREB affects the cellular phenotype of small-cell lung cancer.

    PubMed

    Kreisler, A; Strissel, P L; Strick, R; Neumann, S B; Schumacher, U; Becker, C-M

    2010-10-28

    The neuron-restrictive silencer factor/RE1-silencing transcription factor (NRSF/REST) is a negative regulator of gene expression restricting the expression of neuronal genes to the nervous system. NRSF/REST is highly expressed in non-neuronal tissues like the lung. In previous work, we identified small-cell lung cancer (SCLC) cell lines with no detectable NRSF/REST expression that, as a consequence, expressed neuronal markers like L1-cell adhesion molecule (L1-CAM) and neural cell adhesion molecule (NCAM). The loss of NRSF/REST expression was linked to malignant progression; however, its mechanistic role remained elusive. Here, we show that NRSF/REST itself, rather than one of its regulated genes, acts like a classic tumour suppressor, being in part regulated by methylation. In SCLCs, NRSF/REST is positively regulated by CREB, with an NRSF/REST promoter fragment showing cell type specificity. Downstream, NRSF/REST directly regulates AKT2, in which NRSF/REST loss leads to an epidermal growth factor-mediated de-regulation of AKT-Serine473 phosphorylation, important for cellular proliferation and survival. Assaying anchorage-independent growth, we observed that with reduced NRSF/REST expression, proliferation was significantly enhanced, whereas NRSF/REST rescue decreased the potential of cells to grow anchorage independently. Our observations support the fact that NRSF/REST may act as an important modulator of malignant progression in SCLC. PMID:20697351

  3. Transcriptional regulation of tenascin genes

    PubMed Central

    Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias

    2015-01-01

    Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an “oncofetal” protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

  4. The Affective Regulation of Cognitive Priming

    PubMed Central

    Storbeck, Justin; Clore, Gerald L.

    2008-01-01

    Semantic and affective priming are classic effects observed in cognitive and social psychology, respectively. We discovered that affect regulates such priming effects. In Experiment 1, positive and negative moods were induced prior to one of three priming tasks; evaluation, categorization, or lexical decision. As predicted, positive affect led to both affective priming (evaluation task) and semantic priming (category and lexical decision tasks). However, negative affect inhibited such effects. In Experiment 2, participants in their natural affective state completed the same priming tasks as in Experiment 1. As expected, affective priming (evaluation task) and category priming (categorization and lexical decision tasks) were observed in such resting affective states. Hence, we conclude that negative affect inhibits semantic and affective priming. These results support recent theoretical models, which suggest that positive affect promotes associations among strong and weak concepts, and that negative affect impairs such associations (Kuhl, 2000; Clore & Storbeck, 2006). PMID:18410195

  5. Ectopic Expression of a Maize Hybrid Down-Regulated Gene ZmARF25 Decreases Organ Size by Affecting Cellular Proliferation in Arabidopsis

    PubMed Central

    Meng, Lingxue; Xing, Jiewen; Wang, Tianya; Yang, Hua; Yao, Yingyin; Peng, Huiru; Hu, Zhaorong; Sun, Qixin; Ni, Zhongfu

    2014-01-01

    Heterosis is associated with differential gene expression between hybrids and their parental lines, and the genes involved in cell proliferation played important roles. AtARF2 is a general cell proliferation repressor in Arabidopsis. In our previous study, two homologues (ZmARF10 and ZmARF25) of AtARF2 were identified in maize, but their relationship with heterosis was not elucidated. Here, the expression patterns of ZmARF10 and ZmARF25 in seedling leaves of maize hybrids and their parental lines were analyzed. The results of qRT-PCR exhibited that ZmARF25 was down-regulated in leaf basal region of hybrids. Moreover, overexpression of ZmARF25 led to reduced organ size in Arabidopsis, which was mainly due to the decrease in cell number, not cell size. In addition, the cell proliferation related genes AtANT, AtGIF1 and AtGRF5 were down-regulated in 35S::ZmARF25 transgenic lines. Collectively, we proposed that the down-regulation of ZmARF25 in maize hybrid may accelerate cell proliferation and promote leaf development, which, in turn, contributes to the observed leaf size heterosis in maize. PMID:24756087

  6. The yeast MOT2 gene encodes a putative zinc finger protein that serves as a global negative regulator affecting expression of several categories of genes, including mating-pheromone-responsive genes.

    PubMed

    Irie, K; Yamaguchi, K; Kawase, K; Matsumoto, K

    1994-05-01

    The STE4 gene encodes the beta subunit of a heterotrimeric G protein that is an essential component of the pheromone signal transduction pathway. To identify downstream component(s) of Ste4, we sought pseudo-revertants that restored mating competence to ste4 mutants. The suppressor mot2 was isolated as a recessive mutation that restored conjugational competence to a temperature-sensitive ste4 mutant and simultaneously conferred a temperature-sensitive growth phenotype. The MOT2 gene encodes a putative zinc finger protein, the deletion of which resulted in temperature-sensitive growth, increased expression of FUS1 in the absence of pheromones, and suppression of a deletion of the alpha-factor receptor. On the other hand, sterility resulting from deletion of STE4 was not suppressed by the mot2 deletion. These phenotypes are similar to those associated with temperature-sensitive mutations in CDC36 and CDC39, which are proposed to encode general negative regulators of transcription rather than factors involved in the pheromone response pathway. Deletion of MOT2 also caused increased transcription of unrelated genes such as GAL7 and PHO84. Overexpression of MOT2 suppresses the growth defect of temperature-sensitive mutations in CDC36 and CDC39. These observations suggest that Mot2 functions as a general negative regulator of transcription in the same processes as Cdc36 and Cdc39.

  7. Down regulation of StGA3ox genes in potato results in altered GA content and affect plant and tuber growth characteristics.

    PubMed

    Roumeliotis, Efstathios; Kloosterman, Bjorn; Oortwijn, Marian; Lange, Theo; Visser, Richard G F; Bachem, Christian W B

    2013-09-15

    GA biosynthesis and catabolism has been shown to play an important role in regulating tuberization in potato. Active GAs are inactivated in the stolon tips shortly after induction to tuberization. Overexpression of a GA inactivation gene results in an earlier tuberization phenotype, while reducing expression of the same gene results in delayed tuberization. In addition, overexpression of genes involved in GA biosynthesis results in delayed tuberization, while decreased expression of those genes results in earlied tuberization. The final step in GA biosynthesis is catalysed by StGA3ox1 and StGA3ox2 activity, that convert inactive forms of GA into active GA1 and GA4. In this study we cloned StGA3ox2 gene in an RNAi construct and used this construct to transform potato plants. The StGA3ox2 silenced plants were smaller and had shorter internodes. In addition, we assayed the concentrations of various GAs in the transgenic plants and showed an altered GA content. No difference was observed on the time point of tuber initiation. However, the transgenic clones had increased number of tubers with the same yield, resulting in smaller average tuber weight. In addition, we cloned the promoter of StGA3ox2 to direct expression of the GUS reporter gene to visualize the sites of GA biosynthesis in the potato plant. Finally, we discuss how changes of several GA levels can have an impact on shoot, stolon and tuber development, as well as the possible mechanisms that mediate feed-forward and feed-back regulation loops in the GA biosynthetic pathway in potato.

  8. Different mating-type-regulated genes affect the DNA repair defects of Saccharomyces RAD51, RAD52 and RAD55 mutants.

    PubMed

    Valencia-Burton, Maria; Oki, Masaya; Johnson, Jean; Seier, Tracey A; Kamakaka, Rohinton; Haber, James E

    2006-09-01

    Saccharomyces cerevisiae cells expressing both a- and alpha-mating-type (MAT) genes (termed mating-type heterozygosity) exhibit higher rates of spontaneous recombination and greater radiation resistance than cells expressing only MATa or MATalpha. MAT heterozygosity suppresses recombination defects of four mutations involved in homologous recombination: complete deletions of RAD55 or RAD57, an ATPase-defective Rad51 mutation (rad51-K191R), and a C-terminal truncation of Rad52, rad52-Delta327. We investigated the genetic basis of MAT-dependent suppression of these mutants by deleting genes whose expression is controlled by the Mata1-Matalpha2 repressor and scoring resistance to both campothecin (CPT) and phleomycin. Haploid rad55Delta strains became more damage resistant after deleting genes required for nonhomologous end-joining (NHEJ), a process that is repressed in MATa/MATalpha cells. Surprisingly, NHEJ mutations do not suppress CPT sensitivity of rad51-K191R or rad52-Delta327. However, rad51-K191R is uniquely suppressed by deleting the RME1 gene encoding a repressor of meiosis or its coregulator SIN4; this effect is independent of the meiosis-specific homolog, Dmc1. Sensitivity of rad52-Delta327 to CPT was unexpectedly increased by the MATa/MATalpha-repressed gene YGL193C, emphasizing the complex ways in which MAT regulates homologous recombination. The rad52-Delta327 mutation is suppressed by deleting the prolyl isomerase Fpr3, which is not MAT regulated. rad55Delta is also suppressed by deletion of PST2 and/or YBR052C (RFS1, rad55 suppressor), two members of a three-gene family of flavodoxin-fold proteins that associate in a nonrandom fashion with chromatin. All three recombination-defective mutations are made more sensitive by deletions of Rad6 and of the histone deacetylases Rpd3 and Ume6, although these mutations are not themselves CPT or phleomycin sensitive.

  9. The Shwachman-Bodian-Diamond syndrome associated protein interacts with HsNip7 and its down-regulation affects gene expression at the transcriptional and translational levels

    SciTech Connect

    Hesling, Cedric; Oliveira, Carla C.; Castilho, Beatriz A.; Zanchin, Nilson I.T.

    2007-12-10

    The Shwachman-Bodian-Diamond syndrome (SDS) is an autosomal disorder with pleiotropic phenotypes including pancreatic, skeletal and bone marrow deficiencies and predisposition to hematological dysfunctions. SDS has been associated to mutations in the SBDS gene, encoding a highly conserved protein that was shown to function in ribosome biogenesis in yeast. In this work, we show that SBDS is found in complexes containing the human Nip7 ortholog. Analysis of pre-rRNA processing in a stable SBDS knock-down HEK293-derivative cell line revealed accumulation of a small RNA which is a further indication of SBDS involvement in rRNA biosynthesis. Global transcription and polysome-bound mRNA profiling revealed that SBDS knock-down affects expression of critical genes involved in brain development and function, bone morphogenesis, blood cell proliferation and differentiation, and cell adhesion. Expression of a group of growth and signal transduction factors and of DNA damage response genes is also affected. In SBDS knock-down cells, 34 mRNAs showed decreased and 55 mRNAs showed increased association to polysomes, among which is a group encoding proteins involved in alternative splicing and RNA modification. These results indicate that SBDS is required for accurate expression of genes important for proper brain, skeletal, and blood cell development.

  10. Affect regulation: holding, containing and mirroring.

    PubMed

    Pedersen, Signe Holm; Poulsen, Stig; Lunn, Susanne

    2014-10-01

    Gergely and colleagues' state that their "Social Biofeedback Theory of Parental Affect Mirroring" can be seen as a kind of operationalization of the classical psychoanalytic concepts of holding, containing and mirroring. This article examines to what extent the social biofeedback theory of parental affect mirroring may be understood as a specification of these concepts. It is argued that despite similarities at a descriptive level the concepts are embedded in theories with different ideas of subjectivity. Hence an understanding of the concept of affect regulation as a concretization and specification of the classical concepts dilutes the complexity of both the concept of affect regulation and of the classical concepts. PMID:25351730

  11. Transcription factor CecR (YbiH) regulates a set of genes affecting the sensitivity of Escherichia coli against cefoperazone and chloramphenicol.

    PubMed

    Yamanaka, Yuki; Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2016-07-01

    Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening was performed for identification of the binding site of YbiH, an as yet uncharacterized TetR-family transcription factor, on the Escherichia coli genome. YbiH was found to be a unique single-target regulator that binds in vitro within the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses indicated one clear binding site of YbiH, including a complete palindromic sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of the ybiH operon and activation of the rhlE operon by YbiH. After phenotype microarray screening, YbiH was indicated to confer resistance to chloramphenicol and cefazoline (a first-generation cephalosporin). A systematic survey of the participation of each of the predicted YbiH-regulated genes in the antibiotic sensitivity indicated involvement of the YbhFSR ABC-type transporter in the sensitivity to cefoperazone (a third-generation cephalosporin) and of the membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken together with the growth test in the presence of these two antibiotics and in vitro transcription assay, it was concluded that the hitherto uncharacterized YbiH regulates transcription of both the bidirectional transcription units, the ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the control of sensitivity to cefoperazone and chloramphenicol. We thus propose to rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity). PMID:27112147

  12. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  13. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits

    PubMed Central

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-01-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. ‘Superficial scald’ of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  14. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  15. Exporting licensing regulations affecting US geothermal firms

    SciTech Connect

    Not Available

    1988-08-01

    This document presents a brief introduction and overview of the Department of Commerce's Export Administration Regulations which might affect potential US geothermal goods exporters. It is intended to make US geothermal firms officials aware of the existence of such regulations and to provide them with references, contacts and phone numbers where they can obtain specific and detailed information and assistance. It must be stressed however, that the ultimate responsibility for complying with the above mentioned regulations lies with the exporter who must consult the complete version of the regulations.

  16. Cloning of the major histocompatibility complex class II promoter binding protein affected in a hereditary defect in class II gene regulation.

    PubMed Central

    Reith, W; Barras, E; Satola, S; Kobr, M; Reinhart, D; Sanchez, C H; Mach, B

    1989-01-01

    The regulation of major histocompatibility complex class II gene expression is directly involved in the control of normal and abnormal immune responses. In humans, HLA-DR, -DQ, and -DP class II heterodimers are encoded by a family of alpha- and beta-chain genes clustered in the major histocompatibility complex. Their expression is developmentally controlled and normally restricted to certain cell types. This control is mediated by cis-acting sequences in class II promoters and by trans-acting regulatory factors. Several nuclear proteins bind to class II promoter sequences. In a form of hereditary immunodeficiency characterized by a defect in a trans-acting regulatory factor controlling class II gene transcription, we have observed that one of these nuclear factors (RF-X) does not bind to its target sequence (the class II X box). A cDNA encoding RF-X was isolated by screening a phage expression library with an X-box binding-site probe. The recombinant protein has the binding specificity of RF-X, including a characteristic gradient of affinity for the X boxes of HLA-DR, -DP, and -DQ promoters. RF-X mRNA is present in the regulatory mutants, indicating a defect in the synthesis of a functional form of the RF-X protein. Images PMID:2498880

  17. Silencing of molt-regulating transcription factor gene, CiHR3, affects growth and development of sugarcane stem borer, Chilo infuscatellus.

    PubMed

    Zhang, Yu-liang; Zhang, Shu-zhen; Kulye, Mahesh; Wu, Su-ran; Yu, Nai-tong; Wang, Jian-hua; Zeng, Hong-mei; Liu, Zhi-xin

    2012-01-01

    RNA interference (RNAi) is a technology for conducting functional genomic studies and a potential tool for crop protection against insect pests. Development of reliable methods for production and delivery of double-stranded RNA (dsRNA) is the major challenge for efficient pest control. In this study, Chilo infuscatellus Snellen (Crambidae: Lepidoptera) was fed with CiHR3 dsRNA expressed in bacteria or synthesized in vitro. The dsRNA ingested by C. infuscatellus successfully triggered silencing of the molt-regulating transcription factor CiHR3, an important gene for insect growth and development, and caused significant abnormalities and weight loss in insects within seven days of treatment. This study is an ideal example of feeding-based RNAi mediated by dsRNA expressed in bacteria or synthesized in vitro. The results also suggested that feeding-based RNA interference is a potential method for the management of C. infuscatellus. PMID:23427912

  18. Vernalization Requirement and the Chromosomal VRN1-Region can Affect Freezing Tolerance and Expression of Cold-Regulated Genes in Festuca pratensis

    PubMed Central

    Ergon, Åshild; Melby, Tone I.; Höglind, Mats; Rognli, Odd A.

    2016-01-01

    Plants adapted to cold winters go through annual cycles of gain followed by loss of freezing tolerance (cold acclimation and deacclimation). Warm spells during winter and early spring can cause deacclimation, and if temperatures drop, freezing damage may occur. Many plants are vernalized during winter, a process making them competent to flower in the following summer. In winter cereals, a coincidence in the timing of vernalization saturation, deacclimation, downregulation of cold-induced genes, and reduced ability to reacclimate, occurs under long photoperiods and is under control of the main regulator of vernalization requirement in cereals, VRN1, and/or closely linked gene(s). Thus, the probability of freezing damage after a warm spell may depend on both vernalization saturation and photoperiod. We investigated the role of vernalization and the VRN1-region on freezing tolerance of meadow fescue (Festuca pratensis Huds.), a perennial grass species. Two F2 populations, divergently selected for high and low vernalization requirement, were studied. Each genotype was characterized for the copy number of one of the four parental haplotypes of the VRN1-region. Clonal plants were cold acclimated for 2 weeks or vernalized/cold acclimated for a total of 9 weeks, after which the F2 populations reached different levels of vernalization saturation. Vernalized and cold acclimated plants were deacclimated for 1 week and then reacclimated for 2 weeks. All treatments were given at 8 h photoperiod. Flowering response, freezing tolerance and expression of the cold-induced genes VRN1, MADS3, CBF6, COR14B, CR7 (BLT14), LOS2, and IRI1 was measured. We found that some genotypes can lose some freezing tolerance after vernalization and a deacclimation–reacclimation cycle. The relationship between vernalization and freezing tolerance was complex. We found effects of the VRN1-region on freezing tolerance in plants cold acclimated for 2 weeks, timing of heading after 9 weeks of

  19. New Regulations Affect School Debt Financing.

    ERIC Educational Resources Information Center

    Olson, Carol Duane

    1993-01-01

    Provides an overview of changes in Treasury Regulations as they affect school debt financing, including bond and note construction and acquisition issues, other types of equipment and property financing, as well as tax and revenue anticipation notes for working capital needs. (MLF)

  20. Nutritional regulation of gene expression.

    PubMed

    Cousins, R J

    1999-01-25

    Genes are regulated by complex arrays of response elements that influence the rate of transcription. Nutrients and hormones either act directly to influence these rates or act indirectly through specialized signaling pathways. Metabolites of vitamins A and D, fatty acids, some sterols, and zinc are among the nutrients that influence transcription directly. Components of dietary fiber may influence gene expression indirectly through changes in hormonal signaling, mechanical stimuli, and metabolites produced by the intestinal microflora. In addition, consumption of water-soluble fibers may lead to changes in gene expression mediated through indirect mechanisms that influence transcription rates. In the large intestine, short-chain fatty acids, including butyric acid, are produced by microflora. Butyric acid can indirectly influence gene expression. Some sources of fiber limit nutrient absorption, particularly of trace elements. This could have direct or indirect effects on gene expression. Identification of genes in colonic epithelial cells that are differentially regulated by dietary fiber will be an important step toward understanding the role of dietary factors in colorectal cancer progression.

  1. Gene regulation by dietary microRNAs.

    PubMed

    Zempleni, Janos; Baier, Scott R; Howard, Katherine M; Cui, Juan

    2015-12-01

    MicroRNAs (miRNAs) silence genes through destabilizing mRNA or preventing translation of mRNA, thereby playing an essential role in gene silencing. Traditionally, miRNAs have been considered endogenous regulators of genes, i.e., miRNAs synthesized by an organism regulate the genes in that organism. Recently, that dogma has been challenged in studies suggesting that food-borne miRNAs are bioavailable and affect gene expression in mice and humans. While the evidence in support of this theory may be considered weak for miRNAs that originate in plants, there is compelling evidence to suggest that humans use bovine miRNAs in cow's milk and avian miRNAs in chicken eggs for gene regulation. Importantly, evidence also suggests that mice fed a miRNA-depleted diet cannot compensate for dietary depletion by increased endogenous synthesis. Bioinformatics predictions implicate bovine miRNAs in the regulation of genes that play roles in human health and development. Current challenges in this area of research include that some miRNAs are unable to establish a cause-and-effect between miRNA depletion and disease in miRNA knockout mice, and sequence similarities and identities for bovine and human miRNAs render it difficult to distinguish between exogenous and endogenous miRNAs. Based on what is currently known about dietary miRNAs, the body of evidence appears to be sufficient to consider milk miRNA bioactive compounds in foods, and to increase research activities in this field.

  2. Cytoskeletal genes regulating brain size.

    PubMed

    Bond, Jacquelyn; Woods, C Geoffrey

    2006-02-01

    One of the most notable trends in human evolution is the dramatic increase in brain size that has occurred in the great ape clade, culminating in humans. Of particular interest is the vast expanse of the cerebral cortex, which is believed to have resulted in our ability to perform higher cognitive functions. Recent investigations of congenital microcephaly in humans have resulted in the identification of several genes that non-redundantly and specifically influence mammalian brain size. These genes appear to affect neural progenitor cell number through microtubular organisation at the centrosome. PMID:16337370

  3. IBD Candidate Genes and Intestinal Barrier Regulation

    PubMed Central

    McCole, Declan F.

    2015-01-01

    Technological advances in the large scale analysis of human genetics have generated profound insights into possible genetic contributions to chronic diseases including the inflammatory bowel diseases (IBDs), Crohn’s disease and ulcerative colitis. To date, 163 distinct genetic risk loci have been associated with either Crohn’s disease or ulcerative colitis, with a substantial degree of genetic overlap between these 2 conditions. Although many risk variants show a reproducible correlation with disease, individual gene associations only affect a subset of patients, and the functional contribution(s) of these risk variants to the onset of IBD is largely undetermined. Although studies in twins have demonstrated that the development of IBD is not mediated solely by genetic risk, it is nevertheless important to elucidate the functional consequences of risk variants for gene function in relevant cell types known to regulate key physiological processes that are compromised in IBD. This article will discuss IBD candidate genes that are known to be, or are suspected of being, involved in regulating the intestinal epithelial barrier and several of the physiological processes presided over by this dynamic and versatile layer of cells. This will include assembly and regulation of tight junctions, cell adhesion and polarity, mucus and glycoprotein regulation, bacterial sensing, membrane transport, epithelial differentiation, and restitution. PMID:25215613

  4. How Europe regulates its genes

    SciTech Connect

    Balter, M.

    1991-06-07

    As Europe moves toward unification in 1992, more than two dozen regulations and directives that will affect biotech are working their way through the complex European legislative system. The result could mean tough scrutiny for genetically engineered products. One reason is that the European Community (EC) has chosen to examine genetically engineered products as a special category - an approach the FDA has rejected. Another is that the EC is considering enacting regulations that would mandate consideration of the socioeconomic effects of biotech products in addition to their safety. In addition, some - particularly in industry - fear a nightmare of overlapping and contradictory regulations. It's too soon to tell how well the European system will work, or how stifling the regulations might be. In all likelihood the regulations emerging in Europe won't be demonstrably superior - or inferior - to the American ones, just different, with different strengths and weaknesses. But since many US biotech companies are looking to the huge market that a unified Europe represents, the specifics of those strengths and weaknesses will ultimately be of more than passing interest.

  5. QB1 - Stochastic Gene Regulation

    SciTech Connect

    Munsky, Brian

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  6. Mathematical Models of Gene Regulation

    NASA Astrophysics Data System (ADS)

    Mackey, Michael C.

    2004-03-01

    This talk will focus on examples of mathematical models for the regulation of repressible operons (e.g. the tryptophan operon), inducible operons (e.g. the lactose operon), and the lysis/lysogeny switch in phage λ. These ``simple" gene regulatory elements can display characteristics experimentally of rapid response to perturbations and bistability, and biologically accurate mathematical models capture these aspects of the dynamics. The models, if realistic, are always nonlinear and contain significant time delays due to transcriptional and translational delays that pose substantial problems for the analysis of the possible ranges of dynamics.

  7. Linker histones in hormonal gene regulation.

    PubMed

    Vicent, G P; Wright, R H G; Beato, M

    2016-03-01

    In the present review, we summarize advances in our knowledge on the role of the histone H1 family of proteins in breast cancer cells, focusing on their response to progestins. Histone H1 plays a dual role in gene regulation by hormones, both as a structural component of chromatin and as a dynamic modulator of transcription. It contributes to hormonal regulation of the MMTV promoter by stabilizing a homogeneous nucleosome positioning, which reduces basal transcription whereas at the same time promoting progesterone receptor binding and nucleosome remodeling. These combined effects enhance hormone dependent gene transcription, which eventually requires H1 phosphorylation and displacement. Various isoforms of histone H1 have specific functions in differentiated breast cancer cells and compact nucleosomal arrays to different extents in vitro. Genome-wide studies show that histone H1 has a key role in chromatin dynamics of hormone regulated genes. A complex sequence of enzymatic events, including phosphorylation by CDK2, PARylation by PARP1 and the ATP-dependent activity of NURF, are required for H1 displacement and gene de-repression, as a prerequisite for further nucleosome remodeling. Similarly, during hormone-dependent gene repression a dedicated enzymatic mechanism controls H1 deposition at promoters by a complex containing HP1γ, LSD1 and BRG1, the ATPase of the BAF complex. Thus, a broader vision of the histone code should include histone H1, as the linker histone variants actively participate in the regulation of the chromatin structure. How modifications of the core histones tails affect H1 modifications and vice versa is one of the many questions that remains to be addressed to provide a more comprehensive view of the histone cross-talk mechanisms.

  8. Asymmetric Regulation of Peripheral Genes by Two Transcriptional Regulatory Networks

    PubMed Central

    Li, Jing-Ru; Suzuki, Takahiro; Nishimura, Hajime; Kishima, Mami; Maeda, Shiori; Suzuki, Harukazu

    2016-01-01

    Transcriptional regulatory network (TRN) reconstitution and deconstruction occur simultaneously during reprogramming; however, it remains unclear how the starting and targeting TRNs regulate the induction and suppression of peripheral genes. Here we analyzed the regulation using direct cell reprogramming from human dermal fibroblasts to monocytes as the platform. We simultaneously deconstructed fibroblastic TRN and reconstituted monocytic TRN; monocytic and fibroblastic gene expression were analyzed in comparison with that of fibroblastic TRN deconstruction only or monocytic TRN reconstitution only. Global gene expression analysis showed cross-regulation of TRNs. Detailed analysis revealed that knocking down fibroblastic TRN positively affected half of the upregulated monocytic genes, indicating that intrinsic fibroblastic TRN interfered with the expression of induced genes. In contrast, reconstitution of monocytic TRN showed neutral effects on the majority of fibroblastic gene downregulation. This study provides an explicit example that demonstrates how two networks together regulate gene expression during cell reprogramming processes and contributes to the elaborate exploration of TRNs. PMID:27483142

  9. Coactivators in PPAR-Regulated Gene Expression

    PubMed Central

    Viswakarma, Navin; Jia, Yuzhi; Bai, Liang; Vluggens, Aurore; Borensztajn, Jayme; Xu, Jianming; Reddy, Janardan K.

    2010-01-01

    Peroxisome proliferator-activated receptor (PPAR)α, β (also known as δ), and γ function as sensors for fatty acids and fatty acid derivatives and control important metabolic pathways involved in the maintenance of energy balance. PPARs also regulate other diverse biological processes such as development, differentiation, inflammation, and neoplasia. In the nucleus, PPARs exist as heterodimers with retinoid X receptor-α bound to DNA with corepressor molecules. Upon ligand activation, PPARs undergo conformational changes that facilitate the dissociation of corepressor molecules and invoke a spatiotemporally orchestrated recruitment of transcription cofactors including coactivators and coactivator-associated proteins. While a given nuclear receptor regulates the expression of a prescribed set of target genes, coactivators are likely to influence the functioning of many regulators and thus affect the transcription of many genes. Evidence suggests that some of the coactivators such as PPAR-binding protein (PBP/PPARBP), thyroid hormone receptor-associated protein 220 (TRAP220), and mediator complex subunit 1 (MED1) may exert a broader influence on the functions of several nuclear receptors and their target genes. Investigations into the role of coactivators in the function of PPARs should strengthen our understanding of the complexities of metabolic diseases associated with energy metabolism. PMID:20814439

  10. Down-regulation of MHC Class I by the Marek's Disease Virus (MDV) UL49.5 Gene Product Mildly Affects Virulence in a Haplotype-specific Fashion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marek’s disease is a devastating neoplastic disease of chickens caused by gallid herpesvirus 2 or Marek’s disease virus (MDV), which is characterized by massive visceral tumors, immune suppression, neurologic syndromes, and peracute deaths. It has been reported that MDV down-regulates surface expre...

  11. The A2 gene of alcelaphine herpesvirus-1 is a transcriptional regulator affecting cytotoxicity in virus-infected T cells but is not required for malignant catarrhal fever induction in rabbits.

    PubMed

    Parameswaran, Nevi; Dewals, Benjamin G; Giles, Tom C; Deppmann, Christopher; Blythe, Martin; Vanderplasschen, Alain; Emes, Richard D; Haig, David

    2014-08-01

    Alcelaphine herpesvirus-1 (AlHV-1) causes malignant catarrhal fever (MCF). The A2 gene of AlHV-1 is a member of the bZIP transcription factor family. We wished to determine whether A2 is a virulence gene or not and whether it is involved in pathogenesis by interference with host transcription pathways. An A2 gene knockout (A2ΔAlHV-1) virus, revertant (A2revAlHV-1) virus, and wild-type virus (wtAlHV-1) were used to infect three groups of rabbits. A2ΔAlHV-1-infected rabbits succumbed to MCF, albeit with a delayed onset compared to the control groups, so A2 is not a critical virulence factor. Differential gene transcription analysis by RNAseq and qRT-PCR validation of a selection of these was performed in infected large granular lymphocyte (LGL) T cells obtained in culture from the MCF-affected animals. A2 was involved in the transcriptional regulation of immunological, cell cycle and apoptosis pathways. In particular, there was a bias towards γδ T cell receptor (TCR) expression and downregulation of αβ TCR. TCR signalling, apoptosis, cell cycle, IFN-γ and NFAT pathways were affected. Of particular interest was partial inhibition of the cytotoxicity-associated pathways involving perforin and the granzymes A and B in the A2ΔAlHV-1-infected LGLs compared to controls. In functional assays, A2ΔAlHV-1-infected LGLs were significantly less cytotoxic than wtAlHV-1- and A2revAlHV-1-infected LGLs using rabbit corneal epithelial cells (SIRC) as targets. This implies that A2 is involved in a pathway enhancing the expression of LGL cytotoxicity. This is important as virus-infected T cell cytotoxicity in vivo has been suggested as a potential mechanism of disease induction in MCF.

  12. The A2 gene of alcelaphine herpesvirus-1 is a transcriptional regulator affecting cytotoxicity in virus-infected T cells but is not required for malignant catarrhal fever induction in rabbits.

    PubMed

    Parameswaran, Nevi; Dewals, Benjamin G; Giles, Tom C; Deppmann, Christopher; Blythe, Martin; Vanderplasschen, Alain; Emes, Richard D; Haig, David

    2014-08-01

    Alcelaphine herpesvirus-1 (AlHV-1) causes malignant catarrhal fever (MCF). The A2 gene of AlHV-1 is a member of the bZIP transcription factor family. We wished to determine whether A2 is a virulence gene or not and whether it is involved in pathogenesis by interference with host transcription pathways. An A2 gene knockout (A2ΔAlHV-1) virus, revertant (A2revAlHV-1) virus, and wild-type virus (wtAlHV-1) were used to infect three groups of rabbits. A2ΔAlHV-1-infected rabbits succumbed to MCF, albeit with a delayed onset compared to the control groups, so A2 is not a critical virulence factor. Differential gene transcription analysis by RNAseq and qRT-PCR validation of a selection of these was performed in infected large granular lymphocyte (LGL) T cells obtained in culture from the MCF-affected animals. A2 was involved in the transcriptional regulation of immunological, cell cycle and apoptosis pathways. In particular, there was a bias towards γδ T cell receptor (TCR) expression and downregulation of αβ TCR. TCR signalling, apoptosis, cell cycle, IFN-γ and NFAT pathways were affected. Of particular interest was partial inhibition of the cytotoxicity-associated pathways involving perforin and the granzymes A and B in the A2ΔAlHV-1-infected LGLs compared to controls. In functional assays, A2ΔAlHV-1-infected LGLs were significantly less cytotoxic than wtAlHV-1- and A2revAlHV-1-infected LGLs using rabbit corneal epithelial cells (SIRC) as targets. This implies that A2 is involved in a pathway enhancing the expression of LGL cytotoxicity. This is important as virus-infected T cell cytotoxicity in vivo has been suggested as a potential mechanism of disease induction in MCF. PMID:24732177

  13. Mutations in Protein-Binding Hot-Spots on the Hub Protein Smad3 Differentially Affect Its Protein Interactions and Smad3-Regulated Gene Expression

    PubMed Central

    Schiro, Michelle M.; Stauber, Sara E.; Peterson, Tami L.; Krueger, Chateen; Darnell, Steven J.; Satyshur, Kenneth A.; Drinkwater, Norman R.; Newton, Michael A.; Hoffmann, F. Michael

    2011-01-01

    Background Hub proteins are connected through binding interactions to many other proteins. Smad3, a mediator of signal transduction induced by transforming growth factor beta (TGF-β), serves as a hub protein for over 50 protein-protein interactions. Different cellular responses mediated by Smad3 are the product of cell-type and context dependent Smad3-nucleated protein complexes acting in concert. Our hypothesis is that perturbation of this spectrum of protein complexes by mutation of single protein-binding hot-spots on Smad3 will have distinct consequences on Smad3-mediated responses. Methodology/Principal Findings We mutated 28 amino acids on the surface of the Smad3 MH2 domain and identified 22 Smad3 variants with reduced binding to subsets of 17 Smad3-binding proteins including Smad4, SARA, Ski, Smurf2 and SIP1. Mutations defective in binding to Smad4, e.g., D408H, or defective in nucleocytoplasmic shuttling, e.g., W406A, were compromised in modulating the expression levels of a Smad3-dependent reporter gene or six endogenous Smad3-responsive genes: Mmp9, IL11, Tnfaip6, Fermt1, Olfm2 and Wnt11. However, the Smad3 mutants Y226A, Y297A, W326A, K341A, and E267A had distinct differences on TGF-β signaling. For example, K341A and Y226A both reduced the Smad3-mediated activation of the reporter gene by ∼50% but K341A only reduced the TGF-β inducibilty of Olfm2 in contrast to Y226A which reduced the TGF-β inducibility of all six endogenous genes as severely as the W406A mutation. E267A had increased protein binding but reduced TGF-β inducibility because it caused higher basal levels of expression. Y297A had increased TGF-β inducibility because it caused lower Smad3-induced basal levels of gene expression. Conclusions/Significance Mutations in protein binding hot-spots on Smad3 reduced the binding to different subsets of interacting proteins and caused a range of quantitative changes in the expression of genes induced by Smad3. This approach should be useful

  14. Dynamics of bacterial gene regulation

    NASA Astrophysics Data System (ADS)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  15. Retrotransposons as regulators of gene expression.

    PubMed

    Elbarbary, Reyad A; Lucas, Bronwyn A; Maquat, Lynne E

    2016-02-12

    Transposable elements (TEs) are both a boon and a bane to eukaryotic organisms, depending on where they integrate into the genome and how their sequences function once integrated. We focus on two types of TEs: long interspersed elements (LINEs) and short interspersed elements (SINEs). LINEs and SINEs are retrotransposons; that is, they transpose via an RNA intermediate. We discuss how LINEs and SINEs have expanded in eukaryotic genomes and contribute to genome evolution. An emerging body of evidence indicates that LINEs and SINEs function to regulate gene expression by affecting chromatin structure, gene transcription, pre-mRNA processing, or aspects of mRNA metabolism. We also describe how adenosine-to-inosine editing influences SINE function and how ongoing retrotransposition is countered by the body's defense mechanisms.

  16. Legislation. Legislation and Regulations Affecting Libraries in 2001; Legislation and Regulations Affecting Publishing in 2001.

    ERIC Educational Resources Information Center

    Sheketoff, Emily; Costabile, Mary R.; Adler, Allan

    2002-01-01

    These two reports discuss federal legislation and regulations that affect libraries and the publishing industry. Topics include funding for federal library and related programs; ESEA (Elementary and Secondary Education Act) reauthorization; E-rate; the USA Patriot Act and other actions after the September terrorist attacks; intellectual property;…

  17. Legislation: Legislation and Regulations Affecting Libraries in 2002; Legislation and Regulations Affecting Publishing in 2002.

    ERIC Educational Resources Information Center

    Sheketoff, Emily; Costabile, Mary R.; Adler, Allan

    2003-01-01

    Reviews legislation and regulations affecting libraries and the publishing industry, including the Museum and Library Services Act; Office of Educational Research and Improvement (OERI); copyright; access to electronic government information; telecommunications and technology; electronic surveillance and privacy, including the USA Patriot Act;…

  18. Methylation Affects Transposition and Splicing of a Large CACTA Transposon from a MYB Transcription Factor Regulating Anthocyanin Synthase Genes in Soybean Seed Coats

    PubMed Central

    Zabala, Gracia; Vodkin, Lila O.

    2014-01-01

    We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-rm is homozygous for a mutable allele (rm) that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-rm line had a 13 kb CACTA subfamily transposon insertion (designated TgmR*) at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3) to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-rm progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element. PMID:25369033

  19. Brain regions and genes affecting postural control.

    PubMed

    Lalonde, R; Strazielle, C

    2007-01-01

    Postural control is integrated in all facets of motor commands. The role of cortico-subcortical pathways underlying postural control, including cerebellum and its afferents (climbing, mossy, and noradrenergic fibers), basal ganglia, motor thalamus, and parieto-frontal neocortex has been identified in animal models, notably through the brain lesion technique in rats and in mice with spontaneous and induced mutations. These studies are complemented by analyses of the factors underlying postural deficiencies in patients with cerebellar atrophy. With the gene deletion technique in mice, specific genes expressed in cerebellum encoding glutamate receptors (Grid2 and Grm1) and other molecules (Prkcc, Cntn6, Klf9, Syt4, and En2) have also been shown to affect postural control. In addition, transgenic mouse models of the synucleinopathies and of Huntington's disease cause deficiencies of motor coordination resembling those of patients with basal ganglia damage.

  20. Alteration of O-GlcNAcylation affects serine phosphorylation and regulates gene expression and activity of pyruvate kinase M2 in colorectal cancer cells.

    PubMed

    Chaiyawat, Parunya; Chokchaichamnankit, Daranee; Lirdprapamongkol, Kriengsak; Srisomsap, Chantragan; Svasti, Jisnuson; Champattanachai, Voraratt

    2015-10-01

    O-GlcNAcylation is a dynamic post-translational modification that has extensive crosstalk with phosphorylation either at the same or adjacent sites of various proteins. We have previously reported that O-GlcNAcylation level was increased in primary breast and colorectal cancer, but the interplay of the two modifications remains unclear. Therefore, we explored crosstalk of the modifications by RNA interference against O-GlcNAc transferase (OGT) in colorectal cancer cells. Two-dimensional immunoblotting and mass spectrometric analysis showed that the levels of O-GlcNAc and serine phosphorylation of many proteins including serine hydroxymethyltransferase, cytokeratin-8, pyruvate kinase M2 (PKM2), heterogeneous nuclear ribonucleoprotein L, and lamin-B1, were reduced in siOGT cells compared to siScramble cells. In HT29 cells, immunoprecipitated PKM2 revealed decreased O-GlcNAc and serine phosphorylation levels after siOGT knockdown, but increased levels after treatment with Thiamet-G, an inhibitor of O-GlcNAcase (OGA). In addition, when global O-GlcNAcylation was enhanced by treating cells with Thiamet-G, PKM2 expression level was upregulated, but PKM2-specific activity was decreased. On the other hand, in OGT knockdown cells, PKM2 expression level was downregulated, but PKM2-specific activity was increased. Moreover, the metastatic colorectal cancer cells, SW620, had more O-GlcNAc-PKM2 and showed lower PKM2-specific activity compared to the non-metastatic colorectal cancer SW480 cells. These results suggested roles of O-GlcNAcylation in modulating serine phosphorylation, as well as in regulating PKM2 activity and expression. Interfering levels of O-GlcNAcylation of PKM2 may be a novel target in controlling cancer metabolism and tumorigenesis of colorectal cancer.

  1. Pathophysiological factors affecting CAR gene expression.

    PubMed

    Pascussi, Jean Marc; Dvorák, Zdenek; Gerbal-Chaloin, Sabine; Assenat, Eric; Maurel, Patrick; Vilarem, Marie José

    2003-11-01

    The body defends itself against potentially harmful compounds, such as drugs and toxic endogenous compounds and their metabolites, by inducing the expression of enzymes and transporters involved in their metabolism and elimination. The orphan nuclear receptor CAR (NR1I3 controls phase I (CYP2B, CYP2C, CYP3A), phase II (UGT1A1), and transporter (SLC21A6, MRP2) genes involved in drug metabolism and bilirubin clearance. Constitutive androstane receptor (CAR) is activated by xenobiotics, such as phenobarbital, but also by toxic endogenous compounds such as bilirubin metabolite(s). To better understand the inter- and intravariability in drug detoxification, we studied the molecular mechanisms involved in CAR gene expression in human hepatocytes. We clearly identified CAR as a glucocorticoid receptor (GR) target gene, and we proposed the hypothesis of a signal transduction where the activation of GR plays a critical function in CAR-mediated cellular response. According to our model, chemicals or pathophysiological factors that affect GR function should decrease CAR function. To test this hypothesis, we recently investigated the effect of microtubule disrupting agents (MIAs) or proinflammatory cytokines. These compounds are well-known inhibitors of GR transactivation property. MIAs activate c-Jun N-terminal kinase (JNK), which phosphorylates and inactivates GR, whereas proinflammatory cytokines, such as IL-6 or IL1beta, induce AP-1 or NF-kB activation, respectively, leading to GR inhibition. As expected, we observed that these molecules inhibit both CAR gene expression and phenobarbital-mediated CYP gene expression in human hepatocytes. PMID:14705859

  2. Lysyl Oxidase (Lox) Gene Deficiency Affects Osteoblastic Phenotype

    PubMed Central

    Pischon, N.; Mäki, J. M.; Weisshaupt, P.; Heng, N.; Palamakumbura, A. H.; N'Guessan, P.; Ding, A.; Radlanski, R.; Renz, H.; Bronckers, T. A. L. J. J.; Myllyharju, J.; Kielbassa, A.; Kleber, B. M.; Bernimoulin, J.-P.; Trackman, P.C.

    2010-01-01

    Lysyl oxidase (LOX) catalyzes cross-linking of elastin and collagen, which is essential for structural integrity and function of bone tissue. The present study examined the role of Lox gene deficiency for the osteoblast phenotype in primary calvarial osteoblasts from E18.5 Lox knockout (Lox-/-) and wild type (wt) (C57 BL/6) mice. Next to Lox gene depletion, mRNA expression of Lox isoforms, LOXL1-4, was significantly down-regulated in Lox-/- bone tissue. A significant decrease of DNA synthesis of Lox-/- osteoblasts compared to wt was found. Early stages of osteoblastic apoptosis studied by Annexin-V binding as well as later stages of DNA fragmentation were not affected. However, mineral nodule formation and osteoblastic differentiation were markedly decreased, as revealed by significant down-regulation of osteoblastic markers, type I collagen, BSP and Runx2/Cbfa1. PMID:19458888

  3. Social regulation of cortisol receptor gene expression

    PubMed Central

    Korzan, Wayne J.; Grone, Brian P.; Fernald, Russell D.

    2014-01-01

    In many social species, individuals influence the reproductive capacity of conspecifics. In a well-studied African cichlid fish species, Astatotilapia burtoni, males are either dominant (D) and reproductively competent or non-dominant (ND) and reproductively suppressed as evidenced by reduced gonadotropin releasing hormone (GnRH1) release, regressed gonads, lower levels of androgens and elevated levels of cortisol. Here, we asked whether androgen and cortisol levels might regulate this reproductive suppression. Astatotilapia burtoni has four glucocorticoid receptors (GR1a, GR1b, GR2 and MR), encoded by three genes, and two androgen receptors (ARα and ARβ), encoded by two genes. We previously showed that ARα and ARβ are expressed in GnRH1 neurons in the preoptic area (POA), which regulates reproduction, and that the mRNA levels of these receptors are regulated by social status. Here, we show that GR1, GR2 and MR mRNAs are also expressed in GnRH1 neurons in the POA, revealing potential mechanisms for both androgens and cortisol to influence reproductive capacity. We measured AR, MR and GR mRNA expression levels in a microdissected region of the POA containing GnRH1 neurons, comparing D and ND males. Using quantitative PCR (qPCR), we found D males had higher mRNA levels of ARα, MR, total GR1a and GR2 in the POA compared with ND males. In contrast, ND males had significantly higher levels of GR1b mRNA, a receptor subtype with a reduced transcriptional response to cortisol. Through this novel regulation of receptor type, neurons in the POA of an ND male will be less affected by the higher levels of cortisol typical of low status, suggesting GR receptor type change as a potential adaptive mechanism to mediate high cortisol levels during social suppression. PMID:25013108

  4. Genes Affecting Sensitivity to Serotonin in Caenorhabditis Elegans

    PubMed Central

    Schafer, W. R.; Sanchez, B. M.; Kenyon, C. J.

    1996-01-01

    Regulating the response of a postsynaptic cell to neurotransmitter is an important mechanism for controlling synaptic strength, a process critical to learning. We have begun to define and characterize genes that may control sensitivity to the neurotransmitter serotonin in the nematode Caenorhabditis elegans by identifying serotonin-hypersensitive mutants. We reported previously that mutations in the gene unc-2, which encodes a putative calcium channel subunit, result in hypersensitivity to serotonin. Here we report that mutants defective in the unc-36 gene, which encodes a homologue of a calcium channel auxiliary subunit, are also serotonin-hypersensitive. Moreover, the unc-36 gene appears to be required in the same cells as unc-2 for control of the same behaviors. Mutations in several other genes, including unc-8, unc-10, unc-20, unc-35, unc-75, unc-77, and snt-1 also result in hypersensitivity to serotonin. Several of these mutations have previously been shown to confer resistance to acetylcholinesterase inhibitors, suggesting that they may affect acetylcholine release. Moreover, we found that mutations that decrease acetylcholine synthesis cause defective egg-laying and serotonin hypersensitivity. Thus, acetylcholine appears to negatively regulate the response to serotonin and may participate in the process of serotonin desensitization. PMID:8807295

  5. The Affective Regulation of Social Interaction

    ERIC Educational Resources Information Center

    Clore, Gerald L.; Pappas, Jesse

    2007-01-01

    The recent publication of David Heise's "Expressive Order" (2007) provides an occasion for discussing some of the key ideas in Affect Control Theory. The theory proposes that a few dimensions of affective meaning provide a common basis for interrelating personal identities and social actions. It holds that during interpersonal interactions, social…

  6. Regulation of Neuronal Gene Expression

    NASA Astrophysics Data System (ADS)

    Thiel, Gerald; Lietz, Michael; Leichter, Michael

    Humans as multicellular organisms contain a variety of different cell types where each cell population must fulfill a distinct function in the interest of the whole organism. The molecular basis for the variations in morphology, biochemistry, molecular biology, and function of the various cell types is the cell-type specific expression of genes. These genes encode proteins necessary for executing the specialized functions of each cell type within an organism. We describe here a regulatory mechanism for the expression of neuronal genes. The zinc finger protein REST binds to the regulatory region of many neuronal genes and represses neuronal gene expression in nonneuronal tissues. A negative regulatory mechanism, involving a transcriptional repressor, seems to play an important role in establishing the neuronal phenotype.

  7. Implicit emotion regulation affects outcome evaluation.

    PubMed

    Yang, Qiwei; Tang, Ping; Gu, Ruolei; Luo, Wenbo; Luo, Yue-jia

    2015-06-01

    Efficient implicit emotion regulation processes, which run without awareness, are important for human well-being. In this study, to investigate the influence of implicit emotion regulation on psychological and electrophysiological responses to gains and losses, participants were required to select between two Chinese four-character idioms to match the meaning of the third one before they performed a monetary gambling task. According to whether their meanings were related to emotion regulation, the idioms fell into two categories. Event-related potentials and self-rating emotional experiences to outcome feedback were recorded during the task. Priming emotion regulation reduced subjective emotional experience to both gains and losses and the amplitudes of the feedback-related negativity, while the P3 component was not influenced. According to these results, we suggest that the application of implicit emotion regulation effectively modulated the subjective emotional experience and the motivational salience of current outcomes without the cost of cognitive resources. This study implicates the potential significance of implicit emotion regulation in decision-making processes. PMID:25332404

  8. Implicit emotion regulation affects outcome evaluation.

    PubMed

    Yang, Qiwei; Tang, Ping; Gu, Ruolei; Luo, Wenbo; Luo, Yue-jia

    2015-06-01

    Efficient implicit emotion regulation processes, which run without awareness, are important for human well-being. In this study, to investigate the influence of implicit emotion regulation on psychological and electrophysiological responses to gains and losses, participants were required to select between two Chinese four-character idioms to match the meaning of the third one before they performed a monetary gambling task. According to whether their meanings were related to emotion regulation, the idioms fell into two categories. Event-related potentials and self-rating emotional experiences to outcome feedback were recorded during the task. Priming emotion regulation reduced subjective emotional experience to both gains and losses and the amplitudes of the feedback-related negativity, while the P3 component was not influenced. According to these results, we suggest that the application of implicit emotion regulation effectively modulated the subjective emotional experience and the motivational salience of current outcomes without the cost of cognitive resources. This study implicates the potential significance of implicit emotion regulation in decision-making processes.

  9. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes.

    PubMed

    Zhao, Huayan; Lü, Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P; Xiong, Liming

    2015-11-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  10. Gasoline Composition Regulations Affecting LUST Sites

    EPA Science Inventory

    Passage of the Clean Air Act Amendments in 1990 imposed requirements on gasoline composition in the United States. Impacts to ground water are affected by the provisions that required oxygenated additives and limited benzene concentration. Reformulated and oxygenated gasoline w...

  11. Self-regulation and Beyond: Affect Regulation and the Infant–Caregiver Dyad

    PubMed Central

    Taipale, Joona

    2016-01-01

    In the available psychological literature, affect regulation is fundamentally considered in terms of self-regulation, and according to this standard picture, the contribution of other people in our affect regulation has been viewed in terms of socially assisted self-regulation. The present article challenges this standard picture. By focusing on affect regulation as it unfolds in early infancy, it will be argued that instead of being something original and fundamental, self-regulation developmentally emerges from the basis of a further type of affect regulation. While infants’ capacities in recognizing, understanding, and modifying their own affective states are initially immature and undeveloped, affect regulation is initially managed by the other: it is initially the self, and not the other, that plays the role of an assistant in affect regulation. To capture this phenomenon, the concepts of “auto-matic,” “hetero-matic,” and “altero-matic” affect regulation will be introduced and their interrelations elaborated. By showing how the capacity of affective self-regulation, which is characteristic to maturity, is developmentally achieved by internalizing regulative functions that, at the outset of development, are managed by the caregiver, it will be argued that altero-matic affect regulation is an autonomous type of affect regulation and the developmental basis for self-regulation. PMID:27378984

  12. Gene Regulation Networks for Modeling Drosophila Development

    NASA Technical Reports Server (NTRS)

    Mjolsness, E.

    1999-01-01

    This chapter will very briefly introduce and review some computational experiments in using trainable gene regulation network models to simulate and understand selected episodes in the development of the fruit fly, Drosophila Melanogaster.

  13. INHIBITION OF ERN1 SIGNALING ENZYME AFFECTS HYPOXIC REGULATION OF THE EXPRESSION OF E2F8, EPAS1, HOXC6, ATF3, TBX3 AND FOXF1 GENES IN U87 GLIOMA CELLS.

    PubMed

    Minchenko, O H; Tsymbal, D O; Minchenko, D O; Kovalevska, O V; Karbovskyi, L L; Bikfalvi, A

    2015-01-01

    Hypoxia as well as the endoplasmic reticulum stress are important factors of malignant tumor growth and control of the expression of genes, which regulate numerous metabolic processes and cell proliferation. Furthermore, blockade of ERN1 (endoplasmic reticulum to nucleus 1) suppresses cell proliferation and tumor growth. We studied the effect of hypoxia on the expression of genes encoding the transcription factors such as E2F8 (E2F transcription factor 8), EPAS1 (endothelial PAS domain protein 1), TBX3 (T-box 3), ATF3 (activating transcription factor 3), FOXF1 (forkhead box F), and HOXC6 (homeobox C6) in U87 glioma cells with and without ERN1 signaling enzyme function. We have established that hypoxia enhances the expression of HOXC6, E2F8, ATF3, and EPAS1 genes but does not change TBX3 and FOXF1 gene expression in glioma cells with ERNI function. At the same time, the expression level of all studied genes is strongly decreased, except for TBX3 gene, in glioma cells without ERN1 function. Moreover, the inhibition of ERN1 signaling enzyme function significantly modifies the effect of hypoxia on the expression of these transcription factor genes. removes or introduces this regulation as well as changes a direction or magnitude of hypoxic regulation. Present study demonstrates that fine-tuning of the expression of proliferation related genes depends upon hypoxia and ERN1-mediated endoplasmic reticulum stress signaling and correlates with slower proliferation rate of glioma cells without ERN1 function. PMID:26255341

  14. Regulation of Flagellar Gene Expression in Bacteria.

    PubMed

    Osterman, I A; Dikhtyar, Yu Yu; Bogdanov, A A; Dontsova, O A; Sergiev, P V

    2015-11-01

    The flagellum of a bacterium is a supramolecular structure of extreme complexity comprising simultaneously both a unique system of protein transport and a molecular machine that enables the bacterial cell movement. The cascade of expression of genes encoding flagellar components is closely coordinated with the steps of molecular machine assembly, constituting an amazing regulatory system. Data on structure, assembly, and regulation of flagellar gene expression are summarized in this review. The regulatory mechanisms and correlation of the process of regulation of gene expression and flagellum assembly known from the literature are described. PMID:26615435

  15. Affect regulation and HIV risk among youth in therapeutic schools

    PubMed Central

    Brown, Larry K.; Houck, Christopher; Lescano, Celia; Donenberg, Geri; Tolou-Shams, Marina; Mello, Justin

    2012-01-01

    The acquisition of affect regulation skills is often impaired or delayed in youth with mental health problems but the relationship between affect dysregulation and risk behaviors has not been well studied. Baseline data from adolescents (N =418; ages 13–19) recruited from therapeutic school settings examined the relationship between affect dysregulation, substance use, self-cutting, and sexual risk behavior. Analyses of covariance demonstrated that adolescents who did not use condoms at last sex, ever self-cut, attempted suicide, used alcohol and other drugs and reported less condom use self-efficacy when emotionally aroused were significantly more likely (p < .01) to report greater difficulty with affect regulation than peers who did not exhibit these behaviors. General patterns of difficulty with affect regulation may be linked to HIV risk behavior, including condom use at last sex. HIV prevention strategies for youth in mental health treatment should target affect regulation in relation to multiple risk behaviors. PMID:22669595

  16. [Expression and regulation of the SOST gene].

    PubMed

    Qin, Long-Juan; Ding, Da-Xia; Cui, Lu-Lu; Huang, Qing-Yang

    2013-08-01

    Sclerostin(SOST), mainly expressed in osteocytes, is a negative regulator of bone formation. Hormones PTH and E2 inhibit the expression of the SOST gene. Transcription factors Osterix, Runx2, and Mef2c promote the SOST expression, while Sirt1 negatively regulates the SOST expression. In addition, the expression of the SOST gene is regulated by epigenetic mechanisms, such as DNA methylation and microRNA. Mutations in the SOST gene, which cause sclerosteosis and Van Buchem diseases, are associated with osteoporosis. Wnt and BMP are two important signaling pathways in bone metabolic regulation. SOST can regulate osteoblastic differentiation and bone formation by binding type I/II receptors and co-receptor LRP5/6 to inhibit BMP and Wnt signaling pathways. Suppression of SOST provides a new approach for osteoporosis treatment. This review covers the structure, function and expression regulation of the SOST gene, human disease association, mechanism in the regulation of bone metabolism and prospect in clinical application.

  17. Gonadotropin-releasing hormone: gene evolution, expression, and regulation.

    PubMed

    Belsham, Denise D; Lovejoy, David A

    2005-01-01

    The gonadotropin-releasing hormone (GnRH) gene is a superb example of the diverse regulation that is required to maintain the function of an evolutionarily conserved and fundamental gene. Because reproductive capacity is critical to the survival of the species, physiological homeostasis dictates optimal conditions for reproductive success, and any perturbation from this balance may affect GnRH expression. These disturbances may include alterations in signals dictated by stress, nutritional imbalance, body weight, and neurological problems; therefore, changes in other neuroendocrine systems may directly influence the hypothalamic-pituitary-gonadal axis through direct regulation of GnRH. Thus, to maintain optimal reproductive capacity, the regulation of the GnRH gene is tightly constrained by a number of diverse signaling pathways and neuromodulators. In this review, we summarize what is currently known of GnRH gene structure, the location and function of the two isoforms of the GnRH gene, some of the many hormones and neuromodulators found to affect GnRH expression, and the molecular mechanisms responsible for the regulation of the GnRH gene. We also discuss the latest models used to study the transcriptional regulation of the GnRH gene, from cell models to evolving in vivo technologies. Although we have come a long way in the last two decades toward uncovering the intricacies behind the control of the GnRH neuron, there remain vast distances to cover before direct therapeutic manipulation of the GnRH gene to control reproductive competence is possible.

  18. ADP1 affects plant architecture by regulating local auxin biosynthesis.

    PubMed

    Li, Ruixi; Li, Jieru; Li, Shibai; Qin, Genji; Novák, Ondřej; Pěnčík, Aleš; Ljung, Karin; Aoyama, Takashi; Liu, Jingjing; Murphy, Angus; Gu, Hongya; Tsuge, Tomohiko; Qu, Li-Jia

    2014-01-01

    Plant architecture is one of the key factors that affect plant survival and productivity. Plant body structure is established through the iterative initiation and outgrowth of lateral organs, which are derived from the shoot apical meristem and root apical meristem, after embryogenesis. Here we report that ADP1, a putative MATE (multidrug and toxic compound extrusion) transporter, plays an essential role in regulating lateral organ outgrowth, and thus in maintaining normal architecture of Arabidopsis. Elevated expression levels of ADP1 resulted in accelerated plant growth rate, and increased the numbers of axillary branches and flowers. Our molecular and genetic evidence demonstrated that the phenotypes of plants over-expressing ADP1 were caused by reduction of local auxin levels in the meristematic regions. We further discovered that this reduction was probably due to decreased levels of auxin biosynthesis in the local meristematic regions based on the measured reduction in IAA levels and the gene expression data. Simultaneous inactivation of ADP1 and its three closest homologs led to growth retardation, relative reduction of lateral organ number and slightly elevated auxin level. Our results indicated that ADP1-mediated regulation of the local auxin level in meristematic regions is an essential determinant for plant architecture maintenance by restraining the outgrowth of lateral organs. PMID:24391508

  19. Major genes affecting ovulation rate in sheep

    PubMed Central

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection. PMID:15601592

  20. Let there be light: Regulation of gene expression in plants

    PubMed Central

    Petrillo, Ezequiel; Godoy Herz, Micaela A; Barta, Andrea; Kalyna, Maria; Kornblihtt, Alberto R

    2014-01-01

    Gene expression regulation relies on a variety of molecular mechanisms affecting different steps of a messenger RNA (mRNA) life: transcription, processing, splicing, alternative splicing, transport, translation, storage and decay. Light induces massive reprogramming of gene expression in plants. Differences in alternative splicing patterns in response to environmental stimuli suggest that alternative splicing plays an important role in plant adaptation to changing life conditions. In a recent publication, our laboratories showed that light regulates alternative splicing of a subset of Arabidopsis genes encoding proteins involved in RNA processing by chloroplast retrograde signals. The light effect on alternative splicing is also observed in roots when the communication with the photosynthetic tissues is not interrupted, suggesting that a signaling molecule travels through the plant. These results point at alternative splicing regulation by retrograde signals as an important mechanism for plant adaptation to their environment. PMID:25590224

  1. Influence of gene copy number on self-regulated gene expression.

    PubMed

    Jędrak, Jakub; Ochab-Marcinek, Anna

    2016-11-01

    Using an analytically solvable stochastic model, we study the properties of a simple genetic circuit consisting of multiple copies of a self-regulating gene. We analyse how the variation in gene copy number and the mutations changing the auto-regulation strength affect the steady-state distribution of protein concentration. We predict that one-reporter assay, an experimental method where the extrinsic noise level is inferred from the comparison of expression variance of a single and duplicated reporter gene, may give an incorrect estimation of the extrinsic noise contribution when applied to self-regulating genes. We also show that an imperfect duplication of an auto-activated gene, changing the regulation strength of one of the copies, may lead to a hybrid, binary+graded response of these genes to external signal. The analysis of relative changes in mean gene expression before and after duplication suggests that evolutionary accumulation of gene duplications may, at a given mean burst size, non-trivially depend on the inherent noisiness of a given gene, quantified by the inverse of the maximal mean frequency of bursts. Moreover, we find that the dependence of gene expression noise on gene copy number and auto-regulation strength may qualitatively differ, e.g. in monotonicity, depending on whether the noise is measured by Fano factor or coefficient of variation. Thus, experimentally-based hypotheses linking gene expression noise and evolutionary optimisation in the context of gene copy number variation may be ambiguous as they are dependent on the particular function chosen to quantify noise. PMID:27528448

  2. Developmental regulation of embryonic genes in plants

    SciTech Connect

    Borkird, C.; Choi, Jung, H.; Jin, Zhenghua; Franz, G.; Hatzopoulos, P.; Chorneaus, R.; Bonas, U.; Pelegri, F.; Sung, Z.R.

    1988-09-01

    Somatic embryogenesis from cultured carrot cells progresses through successive morphogenetic stages termed globular, heart, and torpedo. To understand the molecular mechanisms underlying plant embryogenesis, the authors isolated two genes differentially expressed during embryo development. The expression of these two genes is associated with heart-stage embryogenesis. By altering the culture conditions and examining their expressions in a developmental variant cell line, they found that these genes were controlled by the developmental program of embryogenesis and were not directly regulated by 2,4-dichlorophenoxyacetic acid, the growth regulator that promotes unorganized growth of cultured cells and suppresses embryo morphogenesis. These genes are also expressed in carrot zygotic embryos but not in seedlings or mature plants.

  3. Global identification of target genes regulated by APETALA3 and PISTILLATA floral homeotic gene action.

    PubMed

    Zik, Moriyah; Irish, Vivian F

    2003-01-01

    Identifying the genes regulated by the floral homeotic genes APETALA3 (AP3) and PISTILLATA (PI) is crucial for understanding the molecular mechanisms that lead to petal and stamen formation. We have used microarray analysis to conduct a broad survey of genes whose expression is affected by AP3 and PI activity. DNA microarrays consisting of 9216 Arabidopsis ESTs were screened with probes corresponding to mRNAs from different mutant and transgenic lines that misexpress AP3 and/or PI. The microarray results were further confirmed by RNA gel blot analyses. Our results suggest that AP3 and PI regulate a relatively small number of genes, implying that many genes used in petal and stamen development are not tissue specific and likely have roles in other processes as well. We recovered genes similar to previously identified petal- and stamen-expressed genes as well as genes that were not implicated previously in petal and stamen development. A very low percentage of the genes recovered encoded transcription factors. This finding suggests that AP3 and PI act relatively directly to regulate the genes required for the basic cellular processes responsible for petal and stamen morphogenesis.

  4. Regulation of Gene Expression in Protozoa Parasites

    PubMed Central

    Gomez, Consuelo; Esther Ramirez, M.; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A.

    2010-01-01

    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis. PMID:20204171

  5. GENE REGULATION BY MAPK SUBSTRATE COMPETITION

    PubMed Central

    Kim, Yoosik; Andreu, María José; Lim, Bomyi; Chung, Kwanghun; Terayama, Mark; Jiménez, Gerardo; Berg, Celeste A.; Lu, Hang; Shvartsman, Stanislav Y.

    2011-01-01

    SUMMARY Developing tissues are patterned by coordinated activities of signaling systems, which can be integrated by a regulatory region of a gene that binds multiple transcription factors or by a transcription factor that is modified by multiple enzymes. Based on a combination of genetic and imaging experiments in the early Drosophila embryo, we describe a signal integration mechanism that cannot be reduced to a single gene regulatory element or a single transcription factor. This mechanism relies on an enzymatic network formed by Mitogen Activated Protein Kinase (MAPK) and its substrates. Specifically, anteriorly localized MAPK substrates, such as Bicoid, antagonize MAPK-dependent downregulation of Capicua, a repressor which is involved in gene regulation along the dorsoventral axis of the embryo. MAPK substrate competition provides a basis for ternary interaction of the anterior, dorsoventral, and terminal patterning systems. A mathematical model of this interaction can explain gene expression patterns with both anteroposterior and dorsoventral polarities. PMID:21664584

  6. Identification of Master Regulator Genes in Human Periodontitis.

    PubMed

    Sawle, A D; Kebschull, M; Demmer, R T; Papapanou, P N

    2016-08-01

    Analytic approaches confined to fold-change comparisons of gene expression patterns between states of health and disease are unable to distinguish between primary causal disease drivers and secondary noncausal events. Genome-wide reverse engineering approaches can facilitate the identification of candidate genes that may distinguish between causal and associative interactions and may account for the emergence or maintenance of pathologic phenotypes. In this work, we used the algorithm for the reconstruction of accurate cellular networks (ARACNE) to analyze a large gene expression profile data set (313 gingival tissue samples from a cross-sectional study of 120 periodontitis patients) obtained from clinically healthy (n = 70) or periodontitis-affected (n = 243) gingival sites. The generated transcriptional regulatory network of the gingival interactome was subsequently interrogated with the master regulator inference algorithm (MARINA) and gene expression signature data from healthy and periodontitis-affected gingiva. Our analyses identified 41 consensus master regulator genes (MRs), the regulons of which comprised between 25 and 833 genes. Regulons of 7 MRs (HCLS1, ZNF823, XBP1, ZNF750, RORA, TFAP2C, and ZNF57) included >500 genes each. Gene set enrichment analysis indicated differential expression of these regulons in gingival health versus disease with a type 1 error between 2% and 0.5% and with >80% of the regulon genes in the leading edge. Ingenuity pathway analysis showed significant enrichment of 36 regulons for several pathways, while 6 regulons (those of MRs HCLS1, IKZF3, ETS1, NHLH2, POU2F2, and VAV1) were enriched for >10 pathways. Pathways related to immune system signaling and development were the ones most frequently enriched across all regulons. The unbiased analysis of genome-wide regulatory networks can enhance our understanding of the pathobiology of human periodontitis and, after appropriate validation, ultimately identify target molecules of

  7. Gene expression regulation in roots under drought.

    PubMed

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona

    2016-02-01

    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots.

  8. Transposable element origins of epigenetic gene regulation.

    PubMed

    Lisch, Damon; Bennetzen, Jeffrey L

    2011-04-01

    Transposable elements (TEs) are massively abundant and unstable in all plant genomes, but are mostly silent because of epigenetic suppression. Because all known epigenetic pathways act on all TEs, it is likely that the specialized epigenetic regulation of regular host genes (RHGs) was co-opted from this ubiquitous need for the silencing of TEs and viruses. With their internally repetitive and rearranging structures, and the acquisition of fragments of RHGs, the expression of TEs commonly makes antisense RNAs for both TE genes and RHGs. These antisense RNAs, particularly from heterochromatic reservoirs of 'zombie' TEs that are rearranged to form variously internally repetitive structures, may be advantageous because their induction will help rapidly suppress active TEs of the same family. RHG fragments within rapidly rearranging TEs may also provide the raw material for the ongoing generation of miRNA genes. TE gene expression is regulated by both environmental and developmental signals, and insertions can place nearby RHGs under the regulation (both standard and epigenetic) of the TE. The ubiquity of TEs, their frequent preferential association with RHGs, and their ability to be programmed by epigenetic signals all indicate that RGHs have nearly unlimited access to novel regulatory cassettes to assist plant adaptation. PMID:21444239

  9. Gene regulation and speciation in house mice

    PubMed Central

    Mack, Katya L.; Campbell, Polly; Nachman, Michael W.

    2016-01-01

    One approach to understanding the process of speciation is to characterize the genetic architecture of post-zygotic isolation. As gene regulation requires interactions between loci, negative epistatic interactions between divergent regulatory elements might underlie hybrid incompatibilities and contribute to reproductive isolation. Here, we take advantage of a cross between house mouse subspecies, where hybrid dysfunction is largely unidirectional, to test several key predictions about regulatory divergence and reproductive isolation. Regulatory divergence between Mus musculus musculus and M. m. domesticus was characterized by studying allele-specific expression in fertile hybrid males using mRNA-sequencing of whole testes. We found extensive regulatory divergence between M. m. musculus and M. m. domesticus, largely attributable to cis-regulatory changes. When both cis and trans changes occurred, they were observed in opposition much more often than expected under a neutral model, providing strong evidence of widespread compensatory evolution. We also found evidence for lineage-specific positive selection on a subset of genes related to transcriptional regulation. Comparisons of fertile and sterile hybrid males identified a set of genes that were uniquely misexpressed in sterile individuals. Lastly, we discovered a nonrandom association between these genes and genes showing evidence of compensatory evolution, consistent with the idea that regulatory interactions might contribute to Dobzhansky-Muller incompatibilities and be important in speciation. PMID:26833790

  10. Regulation of gene expression by hypoxia.

    PubMed

    Kenneth, Niall Steven; Rocha, Sonia

    2008-08-15

    Hypoxia induces profound changes in the cellular gene expression profile. The discovery of a major transcription factor family activated by hypoxia, HIF (hypoxia-inducible factor), and the factors that contribute to HIF regulation have greatly enhanced our knowledge of the molecular aspects of the hypoxic response. However, in addition to HIF, other transcription factors and cellular pathways are activated by exposure to reduced oxygen. In the present review, we summarize the current knowledge of how additional hypoxia-responsive transcription factors integrate with HIF and how other cellular pathways such as chromatin remodelling, translation regulation and microRNA induction, contribute to the co-ordinated cellular response observed following hypoxic stress.

  11. Age and Diet Affect Gene Expression Profile in Canine Skeletal Muscle

    PubMed Central

    Middelbos, Ingmar S.; Vester, Brittany M.; Karr-Lilienthal, Lisa K.; Schook, Lawrence B.; Swanson, Kelly S.

    2009-01-01

    We evaluated gene transcription in canine skeletal muscle (biceps femoris) using microarray analysis to identify effects of age and diet on gene expression. Twelve female beagles were used (six 1-year olds and six 12-year olds) and they were fed one of two experimental diets for 12 months. One diet contained primarily plant-based protein sources (PPB), whereas the second diet contained primarily animal-based protein sources (APB). Affymetrix GeneChip Canine Genome Arrays were used to hybridize extracted RNA. Age had the greatest effect on gene transcription (262 differentially expressed genes), whereas the effect of diet was relatively small (22 differentially expressed genes). Effects of age (regardless of diet) were most notable on genes related to metabolism, cell cycle and cell development, and transcription function. All these genes were predominantly down-regulated in geriatric dogs. Age-affected genes that were differentially expressed on only one of two diets were primarily noted in the PPB diet group (144/165 genes). Again, genes related to cell cycle (22/35) and metabolism (15/19) had predominantly decreased transcription in geriatric dogs, but 6/8 genes related to muscle development had increased expression. Effects of diet on muscle gene expression were mostly noted in geriatric dogs, but no consistent patterns in transcription were observed. The insight these data provide into gene expression profiles of canine skeletal muscle as affected by age, could serve as a foundation for future research pertaining to age-related muscle diseases. PMID:19221602

  12. Early postnatal feed restriction reduces liver connective tissue levels and affects H3K9 acetylation state of regulated genes associated with protein metabolism in low birth weight pigs.

    PubMed

    Nebendahl, Constance; Görs, Solvig; Albrecht, Elke; Krüger, Ricarda; Martens, Karen; Giller, Katrin; Hammon, Harald M; Rimbach, Gerald; Metges, Cornelia C

    2016-03-01

    Intrauterine growth retardation is associated with metabolic consequences in adulthood. Since our previous data indicate birth weight-dependent effects of feed restriction (R) on protein degradation processes in the liver, it should be investigated whether effects on connective tissue turnover are obvious and could be explained by global changes of histone H3K9me3 and H3K9ac states in regulated genes. For this purpose, female littermate pigs with low (U) or normal (N) birth weight were subjected to 3-week R (60% of ad libitum fed controls) with subsequent refeeding (REF) for further 5 weeks. The 3-week R-period induced a significant reduction of connective tissue area by 43% in the liver of U animals at 98 d of age, which was not found in age-matched N animals. Of note, after REF at 131 d of age, in previously feed-restricted U animals (UR), the percentage of mean connective tissue was only 53% of ad libitum fed controls (UK), indicating a persistent effect. In U animals, R induced H3K9 acetylation of regulated genes (e.g. XBP1, ERLEC1, GALNT2, PTRH2), which were inter alia associated with protein metabolism. In contrast, REF was mostly accompanied by deacetylation in U and N animals. Thus, our epigenetic data may give a first explanation for the observed birth weight-dependent differences in this connective tissue phenotype.

  13. Combinatorial Transcription Control in Gene Regulation

    NASA Astrophysics Data System (ADS)

    Hwa, Terence; Buchler, Nicolas E.; Gerland, Ulrich

    2003-03-01

    We develop a simple thermodynamic model for the regulation of gene transcription and explore the limits of combinatorial control. Our model is based on the ``regulated recruitment'' mechanism [M. Ptashne and A. Gann, Nature 386 (1997) 569], assuming weak contact interaction between the regulatory proteins together with specific protein-DNA interactions. We further assume "programmability" in the strengths of these interactions within a biophysically allowed range [U. Gerland, J.D. Moroz, and T.Hwa, PNAS 99 (2002) 12015], through the choices and the locations of the protein-binding DNA sequences in the regulatory region. Within our thermodynamic model, we demonstrate the implementability of various binary logic functions (including XOR) by computing the degree of gene transcription (output) for all combinations of regulatory protein concentrations (input).

  14. Gravity-regulated gene expression in Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  15. Regulation of methane genes and genome expression

    SciTech Connect

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  16. Regulation of gene expression in human tendinopathy

    PubMed Central

    2011-01-01

    Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics. PMID:21539748

  17. Gene therapy on demand: site specific regulation of gene therapy.

    PubMed

    Jazwa, Agnieszka; Florczyk, Urszula; Jozkowicz, Alicja; Dulak, Jozef

    2013-08-10

    Since 1990 when the first clinical gene therapy trial was conducted, much attention and considerable promise have been given to this form of treatment. Gene therapy has been used with success in patients suffering from severe combined immunodeficiency syndromes (X-SCID and ADA-deficiency), Leber's congenital amaurosis, hemophilia, β-thalassemia and adrenoleukodystrophy. Last year, the first therapeutic vector (Glybera) for treatment of lipoprotein lipase deficiency has been registered in the European Union. Nevertheless, there are still several numerous issues that need to be improved to make this technique more safe, effective and easily accessible for patients. Introduction of the therapeutic gene to the given cells should provide the level of expression which will restore the production of therapeutic protein to normal values or will provide therapeutic efficacy despite not fully physiological expression. However, in numerous diseases the expression of therapeutic genes has to be kept at certain level for some time, and then might be required to be switched off to be activated again when worsening of the symptoms may aggravate the risk of disease relapse. In such cases the promoters which are regulated by local conditions may be more required. In this article the special emphasis is to discuss the strategies of regulation of gene expression by endogenous stimuli. Particularly, the hypoxia- or miRNA-regulated vectors offer the possibilities of tight but, at the same time, condition-dependent and cell-specific expression. Such means have been already tested in certain pathophysiological conditions. This creates the chance for the translational approaches required for development of effective treatments of so far incurable diseases. PMID:23566848

  18. Gene regulation in parthenocarpic tomato fruit.

    PubMed

    Martinelli, Federico; Uratsu, Sandra L; Reagan, Russell L; Chen, Ying; Tricoli, David; Fiehn, Oliver; Rocke, David M; Gasser, Charles S; Dandekar, Abhaya M

    2009-01-01

    Parthenocarpy is potentially a desirable trait for many commercially grown fruits if undesirable changes to structure, flavour, or nutrition can be avoided. Parthenocarpic transgenic tomato plants (cv MicroTom) were obtained by the regulation of genes for auxin synthesis (iaaM) or responsiveness (rolB) driven by DefH9 or the INNER NO OUTER (INO) promoter from Arabidopsis thaliana. Fruits at a breaker stage were analysed at a transcriptomic and metabolomic level using microarrays, real-time reverse transcription-polymerase chain reaction (RT-PCR) and a Pegasus III TOF (time of flight) mass spectrometer. Although differences were observed in the shape of fully ripe fruits, no clear correlation could be made between the number of seeds, transgene, and fruit size. Expression of auxin synthesis or responsiveness genes by both of these promoters produced seedless parthenocarpic fruits. Eighty-three percent of the genes measured showed no significant differences in expression due to parthenocarpy. The remaining 17% with significant variation (P <0.05) (1748 genes) were studied by assigning a predicted function (when known) based on BLAST to the TAIR database. Among them several genes belong to cell wall, hormone metabolism and response (auxin in particular), and metabolism of sugars and lipids. Up-regulation of lipid transfer proteins and differential expression of several indole-3-acetic acid (IAA)- and ethylene-associated genes were observed in transgenic parthenocarpic fruits. Despite differences in several fatty acids, amino acids, and other metabolites, the fundamental metabolic profile remains unchanged. This work showed that parthenocarpy with ovule-specific alteration of auxin synthesis or response driven by the INO promoter could be effectively applied where such changes are commercially desirable. PMID:19700496

  19. Genes regulating touch cell development in Caenorhabditis elegans.

    PubMed Central

    Du, H; Chalfie, M

    2001-01-01

    To identify genes regulating the development of the six touch receptor neurons, we screened the F(2) progeny of mutated animals expressing an integrated mec-2::gfp transgene that is expressed mainly in these touch cells. From 2638 mutated haploid genomes, we obtained 11 mutations representing 11 genes that affected the production, migration, or outgrowth of the touch cells. Eight of these mutations were in known genes, and 2 defined new genes (mig-21 and vab-15). The mig-21 mutation is the first known to affect the asymmetry of the migrations of Q neuroblasts, the cells that give rise to two of the six touch cells. vab-15 is a msh-like homeobox gene that appears to be needed for the proper production of touch cell precursors, since vab-15 animals lacked the four more posterior touch cells. The remaining touch cells (the ALM cells) were present but mispositioned. A similar touch cell phenotype is produced by mutations in lin-32. A more severe phenotype; i.e., animals often lacked ALM cells, was seen in lin-32 vab-15 double mutants, suggesting that these genes acted redundantly in ALM differentiation. In addition to the touch cell abnormalities, vab-15 animals variably exhibit embryonic or larval lethality, cell degenerations, malformation of the posterior body, uncoordinated movement, and defective egg laying. PMID:11333230

  20. Gene and genon concept: coding versus regulation

    PubMed Central

    2007-01-01

    We analyse here the definition of the gene in order to distinguish, on the basis of modern insight in molecular biology, what the gene is coding for, namely a specific polypeptide, and how its expression is realized and controlled. Before the coding role of the DNA was discovered, a gene was identified with a specific phenotypic trait, from Mendel through Morgan up to Benzer. Subsequently, however, molecular biologists ventured to define a gene at the level of the DNA sequence in terms of coding. As is becoming ever more evident, the relations between information stored at DNA level and functional products are very intricate, and the regulatory aspects are as important and essential as the information coding for products. This approach led, thus, to a conceptual hybrid that confused coding, regulation and functional aspects. In this essay, we develop a definition of the gene that once again starts from the functional aspect. A cellular function can be represented by a polypeptide or an RNA. In the case of the polypeptide, its biochemical identity is determined by the mRNA prior to translation, and that is where we locate the gene. The steps from specific, but possibly separated sequence fragments at DNA level to that final mRNA then can be analysed in terms of regulation. For that purpose, we coin the new term “genon”. In that manner, we can clearly separate product and regulative information while keeping the fundamental relation between coding and function without the need to introduce a conceptual hybrid. In mRNA, the program regulating the expression of a gene is superimposed onto and added to the coding sequence in cis - we call it the genon. The complementary external control of a given mRNA by trans-acting factors is incorporated in its transgenon. A consequence of this definition is that, in eukaryotes, the gene is, in most cases, not yet present at DNA level. Rather, it is assembled by RNA processing, including differential splicing, from various

  1. Intron retention-dependent gene regulation in Cryptococcus neoformans.

    PubMed

    Gonzalez-Hilarion, Sara; Paulet, Damien; Lee, Kyung-Tae; Hon, Chung-Chau; Lechat, Pierre; Mogensen, Estelle; Moyrand, Frédérique; Proux, Caroline; Barboux, Rony; Bussotti, Giovanni; Hwang, Jungwook; Coppée, Jean-Yves; Bahn, Yong-Sun; Janbon, Guilhem

    2016-01-01

    The biological impact of alternative splicing is poorly understood in fungi, although recent studies have shown that these microorganisms are usually intron-rich. In this study, we re-annotated the genome of C. neoformans var. neoformans using RNA-Seq data. Comparison with C. neoformans var. grubii revealed that more than 99% of ORF-introns are in the same exact position in the two varieties whereas UTR-introns are much less evolutionary conserved. We also confirmed that alternative splicing is very common in C. neoformans, affecting nearly all expressed genes. We also observed specific regulation of alternative splicing by environmental cues in this yeast. However, alternative splicing does not appear to be an efficient method to diversify the C. neoformans proteome. Instead, our data suggest the existence of an intron retention-dependent mechanism of gene expression regulation that is not dependent on NMD. This regulatory process represents an additional layer of gene expression regulation in fungi and provides a mechanism to tune gene expression levels in response to any environmental modification. PMID:27577684

  2. Intron retention-dependent gene regulation in Cryptococcus neoformans

    PubMed Central

    Gonzalez-Hilarion, Sara; Paulet, Damien; Lee, Kyung-Tae; Hon, Chung-Chau; Lechat, Pierre; Mogensen, Estelle; Moyrand, Frédérique; Proux, Caroline; Barboux, Rony; Bussotti, Giovanni; Hwang, Jungwook; Coppée, Jean-Yves; Bahn, Yong-Sun; Janbon, Guilhem

    2016-01-01

    The biological impact of alternative splicing is poorly understood in fungi, although recent studies have shown that these microorganisms are usually intron-rich. In this study, we re-annotated the genome of C. neoformans var. neoformans using RNA-Seq data. Comparison with C. neoformans var. grubii revealed that more than 99% of ORF-introns are in the same exact position in the two varieties whereas UTR-introns are much less evolutionary conserved. We also confirmed that alternative splicing is very common in C. neoformans, affecting nearly all expressed genes. We also observed specific regulation of alternative splicing by environmental cues in this yeast. However, alternative splicing does not appear to be an efficient method to diversify the C. neoformans proteome. Instead, our data suggest the existence of an intron retention-dependent mechanism of gene expression regulation that is not dependent on NMD. This regulatory process represents an additional layer of gene expression regulation in fungi and provides a mechanism to tune gene expression levels in response to any environmental modification. PMID:27577684

  3. Following the Footsteps of Chlamydial Gene Regulation

    PubMed Central

    Domman, D.; Horn, M.

    2015-01-01

    Regulation of gene expression ensures an organism responds to stimuli and undergoes proper development. Although the regulatory networks in bacteria have been investigated in model microorganisms, nearly nothing is known about the evolution and plasticity of these networks in obligate, intracellular bacteria. The phylum Chlamydiae contains a vast array of host-associated microbes, including several human pathogens. The Chlamydiae are unique among obligate, intracellular bacteria as they undergo a complex biphasic developmental cycle in which large swaths of genes are temporally regulated. Coupled with the low number of transcription factors, these organisms offer a model to study the evolution of regulatory networks in intracellular organisms. We provide the first comprehensive analysis exploring the diversity and evolution of regulatory networks across the phylum. We utilized a comparative genomics approach to construct predicted coregulatory networks, which unveiled genus- and family-specific regulatory motifs and architectures, most notably those of virulence-associated genes. Surprisingly, our analysis suggests that few regulatory components are conserved across the phylum, and those that are conserved are involved in the exploitation of the intracellular niche. Our study thus lends insight into a component of chlamydial evolution that has otherwise remained largely unexplored. PMID:26424812

  4. Tight junctions and the regulation of gene expression.

    PubMed

    Balda, Maria S; Matter, Karl

    2009-04-01

    Cell adhesion is a key regulator of cell differentiation. Cell interactions with neighboring cells and the extracellular matrix regulate gene expression, cell proliferation, polarity and apoptosis. Apical cell-cell junctions participate in these processes using different types of proteins, some of them exhibit nuclear and junctional localization and are called NACos for Nuclear Adhesion Complexes. Tight junctions are one type of such cell-cell junctions and several signaling complexes have been identified to associate with them. In general, expression of tight junction components suppresses proliferation to allow differentiation in a coordinated manner with adherens junctions and extracellular matrix adhesion. These tight junction components have been shown to affect several signaling and transcriptional pathways, and changes in the expression of tight junction proteins are associated with several disease conditions, such as cancer. Here, we will review how tight junction proteins participate in the regulation of gene expression and cell proliferation, as well as how they are regulated themselves by different mechanisms involved in gene expression and cell differentiation.

  5. Lack of linkage between the corticotropin-releasing hormone (CRH) gene and bipolar affective disorder.

    PubMed

    Stratakis, C A; Sarlis, N J; Berrettini, W H; Badner, J A; Chrousos, G P; Gershon, E S; Detera-Wadleigh, S D

    1997-01-01

    Corticotropin-releasing hormone (CRH) plays a key role in the regulation of the stress response. Abnormalities in CRH secretion have been documented in both the depression and manic phases of bipolar disorder (BPD). In the present study, we investigated genetic linkage between the CRH gene and BPD in 22 pedigrees. A highly informative, short tandem repeat (STR) polymorphism adjacent to the CRH gene on human chromosomal region 8q13 was used to examine linkage. Affected sibling pair (ASP) and the likelihood-based disequilibrium tests revealed nonsignificant values. We conclude that the CRH gene is not linked to BPD; if genes involved in the regulation of stress response are indeed linked to BPD, the search should be directed towards those that regulate CRH secretion or its effects on target tissues.

  6. [The Affect Experience and Affect Regulation Q-Sort Test (AREQ): validation and short version].

    PubMed

    Löffler-Stastka, Henriette; Stigler, Katharina

    2011-05-01

    Affect experience and affect regulation are based on varying concepts and the integration of this constructs is discussed controversy. The AREQ - Affect Experience and Affect Regulation Q-sort Test, an expert rating, covers the need of an integrated method to explore the emotional functioning of patients. This is the validation of the german version of the AREQ. Based on statistical considerations and in order to create a practicable and time efficient instrument, which is necessary to display the course and process of a therapy, we created a short version of the AREQ. In this short version only significant items are included, and therefore the time for the implementation is much shorter. The results of the statistical calculations show better psychometric properties for the short version. Especially the scales, which are defined by the original version, show better reliability and account in different samples for 60-73% of the variance. PMID:20845255

  7. Compassion-based emotion regulation up-regulates experienced positive affect and associated neural networks

    PubMed Central

    Singer, Tania

    2015-01-01

    Emotion regulation research has primarily focused on techniques that attenuate or modulate the impact of emotional stimuli. Recent evidence suggests that this mode regulation can be problematic in the context of regulation of emotion elicited by the suffering of others, resulting in reduced emotional connectedness. Here, we investigated the effects of an alternative emotion regulation technique based on the up-regulation of positive affect via Compassion-meditation on experiential and neural affective responses to depictions of individuals in distress, and compared these with the established emotion regulation strategy of Reappraisal. Using fMRI, we scanned 15 expert practitioners of Compassion-meditation either passively viewing, or using Compassion-meditation or Reappraisal to modulate their emotional reactions to film clips depicting people in distress. Both strategies effectively, but differentially regulated experienced affect, with Compassion primarily increasing positive and Reappraisal primarily decreasing negative affect. Imaging results showed that Compassion, relative to both passive-viewing and Reappraisal increased activation in regions involved in affiliation, positive affect and reward processing including ventral striatum and medial orbitfrontal cortex. This network was shown to be active prior to stimulus presentation, suggesting that the regulatory mechanism of Compassion is the stimulus-independent endogenous generation of positive affect. PMID:25698699

  8. Compassion-based emotion regulation up-regulates experienced positive affect and associated neural networks.

    PubMed

    Engen, Haakon G; Singer, Tania

    2015-09-01

    Emotion regulation research has primarily focused on techniques that attenuate or modulate the impact of emotional stimuli. Recent evidence suggests that this mode regulation can be problematic in the context of regulation of emotion elicited by the suffering of others, resulting in reduced emotional connectedness. Here, we investigated the effects of an alternative emotion regulation technique based on the up-regulation of positive affect via Compassion-meditation on experiential and neural affective responses to depictions of individuals in distress, and compared these with the established emotion regulation strategy of Reappraisal. Using fMRI, we scanned 15 expert practitioners of Compassion-meditation either passively viewing, or using Compassion-meditation or Reappraisal to modulate their emotional reactions to film clips depicting people in distress. Both strategies effectively, but differentially regulated experienced affect, with Compassion primarily increasing positive and Reappraisal primarily decreasing negative affect. Imaging results showed that Compassion, relative to both passive-viewing and Reappraisal increased activation in regions involved in affiliation, positive affect and reward processing including ventral striatum and medial orbitfrontal cortex. This network was shown to be active prior to stimulus presentation, suggesting that the regulatory mechanism of Compassion is the stimulus-independent endogenous generation of positive affect. PMID:25698699

  9. Compassion-based emotion regulation up-regulates experienced positive affect and associated neural networks.

    PubMed

    Engen, Haakon G; Singer, Tania

    2015-09-01

    Emotion regulation research has primarily focused on techniques that attenuate or modulate the impact of emotional stimuli. Recent evidence suggests that this mode regulation can be problematic in the context of regulation of emotion elicited by the suffering of others, resulting in reduced emotional connectedness. Here, we investigated the effects of an alternative emotion regulation technique based on the up-regulation of positive affect via Compassion-meditation on experiential and neural affective responses to depictions of individuals in distress, and compared these with the established emotion regulation strategy of Reappraisal. Using fMRI, we scanned 15 expert practitioners of Compassion-meditation either passively viewing, or using Compassion-meditation or Reappraisal to modulate their emotional reactions to film clips depicting people in distress. Both strategies effectively, but differentially regulated experienced affect, with Compassion primarily increasing positive and Reappraisal primarily decreasing negative affect. Imaging results showed that Compassion, relative to both passive-viewing and Reappraisal increased activation in regions involved in affiliation, positive affect and reward processing including ventral striatum and medial orbitfrontal cortex. This network was shown to be active prior to stimulus presentation, suggesting that the regulatory mechanism of Compassion is the stimulus-independent endogenous generation of positive affect.

  10. Riboswitch-Mediated Gene Regulation: Novel RNA Architectures Dictate Gene Expression Responses.

    PubMed

    Sherwood, Anna V; Henkin, Tina M

    2016-09-01

    Riboswitches are RNA elements that act on the mRNA with which they are cotranscribed to modulate expression of that mRNA. These elements are widely found in bacteria, where they have a broad impact on gene expression. The defining feature of riboswitches is that they directly recognize a physiological signal, and the resulting shift in RNA structure affects gene regulation. The majority of riboswitches respond to cellular metabolites, often in a feedback loop to repress synthesis of the enzymes used to produce the metabolite. Related elements respond to the aminoacylation status of a specific tRNA or to a physical parameter, such as temperature or pH. Recent studies have identified new classes of riboswitches and have revealed new insights into the molecular mechanisms of signal recognition and gene regulation. Application of structural and biophysical approaches has complemented previous genetic and biochemical studies, yielding new information about how different riboswitches operate. PMID:27607554

  11. Dietary Methanol Regulates Human Gene Activity

    PubMed Central

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  12. GLAST: gene expression regulation by phorbol esters.

    PubMed

    Espinoza-Rojo, M; López-Bayghen, E; Ortega, A

    2000-08-21

    The gene expression regulation of the Na+-dependent high affinity glutamate/aspartate transporter GLAST expressed in cultured Bergmann glia cells from chick cerebellum was studied. A 679 bp fragment of the chick GLAST cDNA was cloned and sequenced. Specific PCR primers were used to quantify chick GLAST mRNA levels. Treatment of the cells with the Ca2+/diacylglycerol dependent protein kinase C (PKC) activator, phorbol 12-tetradecanoyl-13-acetate (TPA) produced a decrease in transporter mRNA levels, without an effect in its mRNA half life, suggesting a transcriptional down regulation. Activation of the cAMP pathway results in a transient decrease in GLAST mRNA levels, in contrast with the TPA effect. These findings suggest that GLAST expression is under control of distinct signaling pathways.

  13. Regulation of gene transcription by Polycomb proteins

    PubMed Central

    Aranda, Sergi; Mas, Gloria; Di Croce, Luciano

    2015-01-01

    The Polycomb group (PcG) of proteins defines a subset of factors that physically associate and function to maintain the positional identity of cells from the embryo to adult stages. PcG has long been considered a paradigmatic model for epigenetic maintenance of gene transcription programs. Despite intensive research efforts to unveil the molecular mechanisms of action of PcG proteins, several fundamental questions remain unresolved: How many different PcG complexes exist in mammalian cells? How are PcG complexes targeted to specific loci? How does PcG regulate transcription? In this review, we discuss the diversity of PcG complexes in mammalian cells, examine newly identified modes of recruitment to chromatin, and highlight the latest insights into the molecular mechanisms underlying the function of PcGs in transcription regulation and three-dimensional chromatin conformation. PMID:26665172

  14. Regulation of affect by the lateral septum: implications for neuropsychiatry.

    PubMed

    Sheehan, Teige P; Chambers, R Andrew; Russell, David S

    2004-08-01

    Substantial evidence indicates that the lateral septum (LS) plays a critical role in regulating processes related to mood and motivation. This review presents findings from the basic neuroscience literature and from some clinically oriented research, drawing from behavioral, neuroanatomical, electrophysiological, and molecular studies in support of such a role, and articulates models and hypotheses intended to advance our understanding of these functions. Neuroanatomically, the LS is connected with numerous regions known to regulate affect, such as the hippocampus, amygdala, and hypothalamus. Through its connections with the mesocorticolimbic dopamine system, the LS regulates motivation, both by stimulating the activity of midbrain dopamine neurons and regulating the consequences of this activity on the ventral striatum. Evidence that LS function could impact processes related to schizophrenia and other psychotic spectrum disorders, such as alterations in LS function following administration of antipsychotics and psychotomimetics in animals, will also be presented. The LS can also diminish or enable fear responding when its neural activity is stimulated or inhibited, respectively, perhaps through its projections to the hypothalamus. It also regulates behavioral manifestations of depression, with antidepressants stimulating the activity of LS neurons, and depression-like phenotypes corresponding to blunted activity of LS neurons; serotonin likely plays a key role in modulating these functions by influencing the responsiveness of the LS to hippocampal input. In conclusion, a better understanding of the LS may provide important and useful information in the pursuit of better treatments for a wide range of psychiatric conditions typified by disregulation of affective functions.

  15. The Discoidin I Gene Family of Dictyostelium Discoideum Is Linked to Genes Regulating Its Expression

    PubMed Central

    Welker, D. L.

    1988-01-01

    The discoidin I protein has been studied extensively as a marker of early development in the cellular slime mold Dictyostelium discoideum. However, like most other developmentally regulated proteins in this system, no reliable information was available on the linkage of the discoidin genes to other known genes. Analysis of the linkage of the discoidin I genes by use of restriction fragment length polymorphisms revealed that all three discoidin I genes as well as a pseudogene are located on linkage group II. This evidence is consistent with the discoidin I genes forming a gene cluster that may be under the control of a single regulatory element. The discoidin I genes are linked to three genetic loci (disA, motA, daxA) that affect the expression of the discoidin I protein. Linkage of the gene family members to regulatory loci may be important in the coordinate maintenance of the gene family and regulatory loci. A duplication affecting the entire discoidin gene family is also linked to group II; this appears to be a small tandem duplication. This duplication was mapped using a DNA polymorphism generated by insertion of the Tdd-3 mobile genetic element into a Tdd-2 element flanking the γ gene. A probe for Tdd-2 identified a restriction fragment length polymorphism in strain AX3K that was consistent with generation by a previously proposed Tdd-3 insertion event. A putative duplication or rearrangement of a second Tdd-2 element on linkage group IV of strain AX3K was also identified. This is the first linkage information available for mobile genetic elements in D. discoideum. PMID:3402731

  16. Regulation of gene expression by hypoxia.

    PubMed

    Millhorn, D E; Czyzyk-Krzeska, M; Bayliss, D A; Lawson, E E

    1993-12-01

    The present study was undertaken to determine if gene expression for tyrosine hydroxylase (TH), the rate limiting enzyme in the biosynthesis of catecholamines, is regulated in the carotid body, sympathetic ganglia and adrenal medulla by hypoxia. We found that a reduction in oxygen tension from 21% to 10% caused a substantial increase (200% at 1 hour and 500% at 6 hours exposure) in the concentration of TH mRNA in carotid body type I cells but not in either the sympathetic ganglia or adrenal gland. In addition, we found that hypercapnia, another natural stimulus of carotid body activity, failed to enhance TH mRNA in type I cells. Removal of the sensory and sympathetic innervation of the carotid body failed to prevent the induction of TH mRNA by hypoxia in type I cells. Our results show that TH gene expression is regulated by hypoxia in the carotid body but not in other peripheral catecholamine synthesizing tissue and that the regulatory mechanism is intrinsic to type I cells. PMID:7909954

  17. Abscisic acid (ABA) regulation of Arabidopsis SR protein gene expression.

    PubMed

    Cruz, Tiago M D; Carvalho, Raquel F; Richardson, Dale N; Duque, Paula

    2014-01-01

    Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

  18. Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression

    PubMed Central

    Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula

    2014-01-01

    Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

  19. Plant defense genes are regulated by ethylene

    SciTech Connect

    Ecker, J.R.; Davis, R.W.

    1987-08-01

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase (4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12), enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes.

  20. Fusarium verticillioides SGE1 is required for full virulence and regulates expression of protein effector and secondary metabolite biosynthetic genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The transition from one lifestyle to another in some fungi is initiated by a single orthologous gene, SGE1 in Fusarium oxysporum, that regulates markedly different gene sets in different fungi. Despite these differences, many of the regulated genes affect pathogenicity as they encode effector protei...

  1. Redox regulation of photosynthetic gene expression

    PubMed Central

    Queval, Guillaume; Foyer, Christine H.

    2012-01-01

    Redox chemistry and redox regulation are central to the operation of photosynthesis and respiration. However, the roles of different oxidants and antioxidants in the regulation of photosynthetic or respiratory gene expression remain poorly understood. Leaf transcriptome profiles of a range of Arabidopsis thaliana genotypes that are deficient in either hydrogen peroxide processing enzymes or in low molecular weight antioxidant were therefore compared to determine how different antioxidant systems that process hydrogen peroxide influence transcripts encoding proteins targeted to the chloroplasts or mitochondria. Less than 10 per cent overlap was observed in the transcriptome patterns of leaves that are deficient in either photorespiratory (catalase (cat)2) or chloroplastic (thylakoid ascorbate peroxidase (tapx)) hydrogen peroxide processing. Transcripts encoding photosystem II (PSII) repair cycle components were lower in glutathione-deficient leaves, as were the thylakoid NAD(P)H (nicotinamide adenine dinucleotide (phosphate)) dehydrogenases (NDH) mRNAs. Some thylakoid NDH mRNAs were also less abundant in tAPX-deficient and ascorbate-deficient leaves. Transcripts encoding the external and internal respiratory NDHs were increased by low glutathione and low ascorbate. Regulation of transcripts encoding specific components of the photosynthetic and respiratory electron transport chains by hydrogen peroxide, ascorbate and glutathione may serve to balance non-cyclic and cyclic electron flow pathways in relation to oxidant production and reductant availability. PMID:23148274

  2. Amino Acid Supplementation Affects Imprinted Gene Transcription Patterns in Parthenogenetic Porcine Blastocysts

    PubMed Central

    Park, Chi-Hun; Jeong, Young-Hee; Jeong, Yeun-Ik; Kwon, Jeong-Woo; Shin, Taeyoung; Hyun, Sang-Hwan; Jeung, Eui-Bae; Kim, Nam-Hyung; Seo, Sang-Kyo; Lee, Chang-Kyu; Hwang, Woo-Suk

    2014-01-01

    To determine whether exogenous amino acids affect gene transcription patterns in parthenogenetic porcine embryos, we investigated the effects of amino acid mixtures in culture medium. Parthenogenetic embryos were cultured in PZM3 medium under four experimental conditions: 1) control (no amino acids except L-glutamine and taurine); 2) nonessential amino acids (NEAA); 3) essential amino acids (EAA); and 4) NEAA and EAA. The rate of development of embryos to the four-cell stage was not affected by treatment. However, fewer (P<0.05) embryos cultured with EAA (12.8%) reached the blastocyst stage as compared with the control group (25.6%) and NEAA group (30.3%). Based on these findings, we identified genes with altered expression in parthenogenetic embryos exposed to medium with or without EAAs. The results indicated that EAA influenced gene expression patterns, particularly those of imprinted genes (e.g., H19, IGF2R, PEG1, XIST). However, NEAAs did not affect impaired imprinted gene expressions induced by EAA. The results also showed that mechanistic target of rapamycin (MTOR) mRNA expression was significantly increased by EAA alone as compared with control cultures, and that the combined treatment with NEAA and EAA did not differ significantly from those of control cultures. Our results revealed that gene transcription levels in porcine embryos changed differentially depending on the presence of EAA or NEAA. However, the changes in the H19 mRNA observed in the parthenogenetic blastocysts expression level was not related to the DNA methylation status in the IGF2/H19 domain. The addition of exogenous amino acid mixtures affected not only early embryonic development, but also gene transcription levels, particularly those of imprinted genes. However, this study did not reveal how amino acids affect expression of imprinted genes under the culture conditions used. Further studies are thus required to fully evaluate how amino acids affect transcriptional regulation in porcine

  3. Identification and validation of genes affecting aortic lesions in mice.

    PubMed

    Yang, Xia; Peterson, Larry; Thieringer, Rolf; Deignan, Joshua L; Wang, Xuping; Zhu, Jun; Wang, Susanna; Zhong, Hua; Stepaniants, Serguei; Beaulaurier, John; Wang, I-Ming; Rosa, Ray; Cumiskey, Anne-Marie; Luo, Jane Ming-Juan; Luo, Qi; Shah, Kashmira; Xiao, Jianying; Nickle, David; Plump, Andrew; Schadt, Eric E; Lusis, Aldons J; Lum, Pek Yee

    2010-07-01

    Atherosclerosis represents the most significant risk factor for coronary artery disease (CAD), the leading cause of death in developed countries. To better understand the pathogenesis of atherosclerosis, we applied a likeli-hood-based model selection method to infer gene-disease causality relationships for the aortic lesion trait in a segregating mouse population demonstrating a spectrum of susceptibility to developing atherosclerotic lesions. We identified 292 genes that tested causal for aortic lesions from liver and adipose tissues of these mice, and we experimentally validated one of these candidate causal genes, complement component 3a receptor 1 (C3ar1), using a knockout mouse model. We also found that genes identified by this method overlapped with genes progressively regulated in the aortic arches of 2 mouse models of atherosclerosis during atherosclerotic lesion development. By comparing our gene set with findings from public human genome-wide association studies (GWAS) of CAD and related traits, we found that 5 genes identified by our study overlapped with published studies in humans in which they were identified as risk factors for multiple atherosclerosis-related pathologies, including myocardial infarction, serum uric acid levels, mean platelet volume, aortic root size, and heart failure. Candidate causal genes were also found to be enriched with CAD risk polymorphisms identified by the Wellcome Trust Case Control Consortium (WTCCC). Our findings therefore validate the ability of causality testing procedures to provide insights into the mechanisms underlying atherosclerosis development.

  4. Bioinformatics analysis of time-series genes profiling to explore key genes affected by age in fracture healing.

    PubMed

    Wang, Wei; Shen, Hao; Xie, Jingjing; Zhou, Qiang; Chen, Yu; Lu, Hua

    2014-06-01

    The present study was aimed to explore possible key genes and bioprocess affected by age during fracture healing. GSE589, GSE592 and GSE1371 were downloaded from gene expression omnibus database. The time-series genes of three age levels rats were firstly identified with hclust function in R. Then functional and pathway enrichment analysis for selected time-series genes were performed. Finally, the VennDiagram package of R language was used to screen overlapping n time-series genes. The expression changes of time-series genes in the rats of three age levels were classified into two types: one was higher expressed at 0 day, decreased at 3 day to 2 week, and increased from 4 to 6 week; the other was the opposite. Functional and pathways enrichment analysis showed that 12 time-series genes of adult and old rats were significantly involved in ECM-receptor interaction pathway. The expression changes of 11 genes were consistent with time axis, 10 genes were up-regulated at 3 days after fracture, and increased slowly in 6 week, while Itga2b was down-regulated. The functions of 106 overlapping genes were all associated with growth and development of bone after fracture. The key genes in ECM-receptor interaction pathway including Spp1, Ibsp, Tnn and Col3a1 have been reported to be related to fracture in literatures. The difference during fracture healing in three age levels rats is mainly related to age. The Spp1, Ibsp, Tnn and Col3a1 are possible potential age-related genes and ECM-receptor interaction pathway is the potential age-related process during fracture healing. PMID:24627361

  5. Osmotic stress at the barley root affects expression of circadian clock genes in the shoot.

    PubMed

    Habte, Ermias; Müller, Lukas M; Shtaya, Munqez; Davis, Seth J; von Korff, Maria

    2014-06-01

    The circadian clock is an important timing system that controls physiological responses to abiotic stresses in plants. However, there is little information on the effects of the clock on stress adaptation in important crops, like barley. In addition, we do not know how osmotic stress perceived at the roots affect the shoot circadian clock. Barley genotypes, carrying natural variation at the photoperiod response and clock genes Ppd-H1 and HvELF3, were grown under control and osmotic stress conditions to record changes in the diurnal expression of clock and stress-response genes and in physiological traits. Variation at HvELF3 affected the expression phase and shape of clock and stress-response genes, while variation at Ppd-H1 only affected the expression levels of stress genes. Osmotic stress up-regulated expression of clock and stress-response genes and advanced their expression peaks. Clock genes controlled the expression of stress-response genes, but had minor effects on gas exchange and leaf transpiration. This study demonstrated that osmotic stress at the barley root altered clock gene expression in the shoot and acted as a spatial input signal into the clock. Unlike in Arabidopsis, barley primary assimilation was less controlled by the clock and more responsive to environmental perturbations, such as osmotic stress. PMID:24895755

  6. In silico analysis of polymorphisms in microRNAs that target genes affecting aerobic glycolysis

    PubMed Central

    Venkatesh, Thejaswini; Tsutsumi, Rie

    2016-01-01

    Background Cancer cells preferentially metabolize glucose through aerobic glycolysis, an observation known as the Warburg effect. Recently, studies have deciphered the role of oncogenes and tumor suppressor genes in regulating the Warburg effect. Furthermore, mutations in glycolytic enzymes identified in various cancers highlight the importance of the Warburg effect at the molecular and cellular level. MicroRNAs (miRNAs) are non-coding RNAs that posttranscriptionally regulate gene expression and are dysregulated in the pathogenesis of various types of human cancers. Single nucleotide polymorphisms (SNPs) in miRNA genes may affect miRNA biogenesis, processing, function, and stability and provide additional complexity in the pathogenesis of cancer. Moreover, mutations in miRNA target sequences in target mRNAs can affect expression. Methods In silico analysis and cataloguing polymorphisms in miRNA genes that target genes directly or indirectly controlling aerobic glycolysis was carried out using different publically available databases. Results miRNA SNP2.0 database revealed several SNPs in miR-126 and miR-25 in the upstream and downstream pre-miRNA flanking regions respectively should be inserted after flanking regions and miR-504 and miR-451 had the fewest. These miRNAs target genes that control aerobic glycolysis indirectly. SNPs in premiRNA genes were found in miR-96, miR-155, miR-25 and miR34a by miRNASNP. Dragon database of polymorphic regulation of miRNA genes (dPORE-miRNA) database revealed several SNPs that modify transcription factor binding sites (TFBS) or creating new TFBS in promoter regions of selected miRNA genes as analyzed by dPORE-miRNA. Conclusions Our results raise the possibility that integration of SNP analysis in miRNA genes with studies of metabolic adaptations in cancer cells could provide greater understanding of oncogenic mechanisms. PMID:27004216

  7. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway. PMID:24389954

  8. Interspecies systems biology uncovers metabolites affecting C. elegans gene expression and life history traits.

    PubMed

    Watson, Emma; MacNeil, Lesley T; Ritter, Ashlyn D; Yilmaz, L Safak; Rosebrock, Adam P; Caudy, Amy A; Walhout, Albertha J M

    2014-02-13

    Diet greatly influences gene expression and physiology. In mammals, elucidating the effects and mechanisms of individual nutrients is challenging due to the complexity of both the animal and its diet. Here, we used an interspecies systems biology approach with Caenorhabditis elegans and two of its bacterial diets, Escherichia coli and Comamonas aquatica, to identify metabolites that affect the animal's gene expression and physiology. We identify vitamin B12 as the major dilutable metabolite provided by Comamonas aq. that regulates gene expression, accelerates development, and reduces fertility but does not affect lifespan. We find that vitamin B12 has a dual role in the animal: it affects development and fertility via the methionine/S-Adenosylmethionine (SAM) cycle and breaks down the short-chain fatty acid propionic acid, preventing its toxic buildup. Our interspecies systems biology approach provides a paradigm for understanding complex interactions between diet and physiology.

  9. Interspecies Systems Biology Uncovers Metabolites Affecting C. elegans Gene Expression and Life History Traits

    PubMed Central

    Watson, Emma; MacNeil, Lesley T.; Ritter, Ashlyn D.; Yilmaz, L. Safak; Rosebrock, Adam P.; Caudy, Amy A.; Walhout, Albertha J. M.

    2014-01-01

    SUMMARY Diet greatly influences gene expression and physiology. In mammals, elucidating the effects and mechanisms of individual nutrients is challenging due to the complexity of both the animal and its diet. Here we used an interspecies systems biology approach with Caenorhabditis elegans and two if its bacterial diets, Escherichia coli and Comamonas aquatica, to identify metabolites that affect the animal’s gene expression and physiology. We identify vitamin B12 as the major dilutable metabolite provided by Comamonas aq. that regulates gene expression, accelerates development and reduces fertility, but does not affect lifespan. We find that vitamin B12 has a dual role in the animal: it affects development and fertility via the methionine/S-Adenosylmethionine (SAM) cycle and breaks down the short-chain fatty acid propionic acid preventing its toxic buildup. Our interspecies systems biology approach provides a paradigm for understanding complex interactions between diet and physiology. PMID:24529378

  10. Gene regulation by non-coding RNAs.

    PubMed

    Patil, Veena S; Zhou, Rui; Rana, Tariq M

    2014-01-01

    The past two decades have seen an explosion in research on non-coding RNAs and their physiological and pathological functions. Several classes of small (20-30 nucleotides) and long (>200 nucleotides) non-coding RNAs have been firmly established as key regulators of gene expression in myriad processes ranging from embryonic development to innate immunity. In this review, we focus on our current understanding of the molecular mechanisms underlying the biogenesis and function of small interfering RNAs (siRNAs), microRNAs (miRNAs) and Piwi-interacting RNAs (piRNAs). In addition, we briefly review the relevance of small and long non-coding RNAs to human physiology and pathology and their potential to be exploited as therapeutic agents.

  11. Melatonin regulation of antioxidant enzyme gene expression.

    PubMed

    Mayo, J C; Sainz, R M; Antoli, I; Herrera, F; Martin, V; Rodriguez, C

    2002-10-01

    Antioxidant enzymes (AOEs) are part of the primary cellular defense against free radicals induced by toxins and/or spontaneously formed in cells. Melatonin (MLT) has received much attention in recent years due to its direct free radical scavenging and antioxidant properties. In the present work we report that MLT, at physiological serum concentrations (1 nM), increases the mRNA of both superoxide dismutases (SODs) and glutathione peroxidase (GPx) in two neuronal cell lines. The MLT effect on both SODs and GPx mRNA was mediated by a de novo synthesized protein. MLT alters mRNA stability for Cu-Zn SOD and GPx. Experiments with a short time treatment (pulse action) of MLT suggest that the regulation of AOE gene expression is likely to be receptor mediated, because 1-h treatment with MLT results in the same response as a 24-h treatment.

  12. Negative Regulation of Phosphate Starvation-Induced Genes1

    PubMed Central

    Mukatira, Uthappa T.; Liu, Chunming; Varadarajan, Deepa K.; Raghothama, Kashchandra G.

    2001-01-01

    Phosphate (Pi) deficiency is a major nutritional problem faced by plants in many agro-ecosystems. This deficiency results in altered gene expression leading to physiological and morphological changes in plants. Altered gene expression is presumed to be due to interaction of regulatory sequences (cis-elements) present in the promoters with DNA binding factors (trans-factors). In this study, we analyzed the expression and DNA-protein interaction of promoter regions of Pi starvation-induced genes AtPT2 and TPSI1. AtPT2 encodes the high-affinity Pi transporter in Arabidopsis, whereas TPSI1 codes for a novel gene induced in the Pi-starved tomato (Lycopersicon esculentum). Expression of AtPT2 was induced rapidly under Pi deficiency and increased with decreasing concentrations of Pi. Abiotic stresses except Pi starvation had no affect on the expression of TPSI1. DNA mobility-shift assays indicated that specific sequences of AtPT2 and TPSI1 promoter interact with nuclear protein factors. Two regions of AtPT2 and TPSI1 promoters specifically bound nuclear protein factors from Pi-sufficient plants. Interestingly, the DNA binding activity disappeared during Pi starvation, leading to the hypothesis that Pi starvation-induced genes may be under negative regulation. PMID:11743129

  13. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  14. Expression of Selenoprotein Genes Is Affected by Heat Stress in IPEC-J2 Cells.

    PubMed

    Cao, Lei; Tang, Jiayong; Li, Qiang; Xu, Jingyang; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Shang, Haiying; Cai, Jingyi; Zhao, Hua

    2016-08-01

    The aim of this study was to explore the impacts of heat stress (HS) on expressions of selenoprotein genes in IPEC-J2 cells. Cells were cultured with 5 % CO2-humidified chamber at 37 °C until the cells grew to complete confluence and then exposed to a mild hyperthermia at 41.5 °C (HS) or 37 °C (control) for another 24 h, finally harvested for total RNA or protein extraction. Real-time quantitative PCRs (qPCRs) were performed to compare gene expression of 25 selenoprotein genes, 3 tight junction-related genes, and 10 inflammation-related genes. Protein expressions of heat shock protein 70 (Hsp70) and selenoprotein X and P (SelX and SelP) were also investigated by Western blot. The results showed that HS up-regulated (P < 0.05) Hsp70 and one tight junction-related gene [zonula occludens-1 (Zo-1)] in IPEC-J2 cells. At the same time, HS up-regulated (P < 0.05) 4 selenoprotein genes (Gpx3, Dio2, Selk, Sels) and three inflammation-related genes (Il-6, Icam-1, Tgf-β) and down-regulated (P < 0.05 or as indicated) six selenoprotein genes (Gpx2, Gpx6, Txnrd1, Selh, Selm, Selx) and three inflammation-related genes (Ifn-β, Mcp-1, Tnf-α) in the cells. HS also exhibited impacts on protein expressions, which up-regulated Hsp70, down-regulated SelX, and showed no effect on SelP in IPEC-J2 cells. Our results showed that HS affected the expression of inflammation-related genes and up-regulated gene and protein expressions of Hsp70. The changes of so many selenoprotein genes expression implied a potential link between selenoprotein genes and HS. Moreover, the results provided by this IPEC-J2 model may be used to further study the interactive mechanisms between selenoprotein function and potential intestinal damage induced by HS.

  15. Gene expression profiles in rice gametes and zygotes: identification of gamete-enriched genes and up- or down-regulated genes in zygotes after fertilization.

    PubMed

    Abiko, Mafumi; Maeda, Hiroki; Tamura, Kentaro; Hara-Nishimura, Ikuko; Okamoto, Takashi

    2013-04-01

    In angiosperms, fertilization and subsequent zygotic development occur in embryo sacs deeply embedded in the ovaries; therefore, these processes are poorly elucidated. In this study, microarray-based transcriptome analyses were conducted on rice sperm cells, egg cells, and zygotes isolated from flowers to identify candidate genes involved in gametic and/or early zygotic development. Cell type-specific transcriptomes were obtained, and up- or down-regulated genes in zygotes after fertilization were identified, in addition to genes enriched in male and female gametes. A total of 325 putatively up-regulated and 94 putatively down-regulated genes in zygotes were obtained. Interestingly, several genes encoding homeobox proteins or transcription factors were identified as highly up-regulated genes after fertilization, and the gene ontology for up-regulated genes was highly enriched in functions related to chromatin/DNA organization and assembly. Because a gene encoding methyltransferase 1 was identified as a highly up-regulated gene in zygotes after fertilization, the effect of an inhibitor of this enzyme on zygote development was monitored. The inhibitor appeared partially to affect polarity or division asymmetry in rice zygotes, but it did not block normal embryo generation.

  16. Network-based characterization of drug-regulated genes, drug targets, and toxicity.

    PubMed

    Kotlyar, Max; Fortney, Kristen; Jurisica, Igor

    2012-08-01

    Proteins do not exert their effects in isolation of one another, but interact together in complex networks. In recent years, sophisticated methods have been developed to leverage protein-protein interaction (PPI) network structure to improve several stages of the drug discovery process. Network-based methods have been applied to predict drug targets, drug side effects, and new therapeutic indications. In this paper we have two aims. First, we review the past contributions of network approaches and methods to drug discovery, and discuss their limitations and possible future directions. Second, we show how past work can be generalized to gain a more complete understanding of how drugs perturb networks. Previous network-based characterizations of drug effects focused on the small number of known drug targets, i.e., direct binding partners of drugs. However, drugs affect many more genes than their targets - they can profoundly affect the cell's transcriptome. For the first time, we use networks to characterize genes that are differentially regulated by drugs. We found that drug-regulated genes differed from drug targets in terms of functional annotations, cellular localizations, and topological properties. Drug targets mainly included receptors on the plasma membrane, down-regulated genes were largely in the nucleus and were enriched for DNA binding, and genes lacking drug relationships were enriched in the extracellular region. Network topology analysis indicated several significant graph properties, including high degree and betweenness for the drug targets and drug-regulated genes, though possibly due to network biases. Topological analysis also showed that proteins of down-regulated genes appear to be frequently involved in complexes. Analyzing network distances between regulated genes, we found that genes regulated by structurally similar drugs were significantly closer than genes regulated by dissimilar drugs. Finally, network centrality of a drug

  17. Conditional gene vectors regulated in cis

    PubMed Central

    Pich, Dagmar; Humme, Sibille; Spindler, Mark-Peter; Schepers, Aloys; Hammerschmidt, Wolfgang

    2008-01-01

    Non-integrating gene vectors, which are stably and extrachromosomally maintained in transduced cells would be perfect tools to support long-term expression of therapeutic genes but preserve the genomic integrity of the cellular host. Small extrachromosomal plasmids share some of these ideal characteristics but are primarily based on virus blueprints. These plasmids are dependent on viral trans-acting factors but they can replicate their DNA molecules in synchrony with the chromosome of the cellular host and segregate to daughter cells in an autonomous fashion. On the basis of the concept of the latent origin of DNA replication of Epstein-Barr virus, oriP, we devised novel derivatives, which exclusively rely on an artificial replication factor for both nuclear retention and replication of plasmid DNA. In addition, an allosteric switch regulates the fate of the plasmid molecules, which are rapidly lost upon addition of doxycycline. Conditional maintenance of these novel plasmid vectors allows the reversible transfer of genetic information into target cells for the first time. PMID:18566006

  18. Pharmacological and Genetic Modulation of REV-ERB Activity and Expression Affects Orexigenic Gene Expression

    PubMed Central

    Amador, Ariadna; Wang, Yongjun; Banerjee, Subhashis; Kameneka, Theodore M.; Solt, Laura A.; Burris, Thomas P.

    2016-01-01

    The nuclear receptors REV-ERBα and REV-ERBβ are transcription factors that play pivotal roles in the regulation of the circadian rhythm and various metabolic processes. The circadian rhythm is an endogenous mechanism, which generates entrainable biological changes that follow a 24-hour period. It regulates a number of physiological processes, including sleep/wakeful cycles and feeding behaviors. We recently demonstrated that REV-ERB-specific small molecules affect sleep and anxiety. The orexinergic system also plays a significant role in mammalian physiology and behavior, including the regulation of sleep and food intake. Importantly, orexin genes are expressed in a circadian manner. Given these overlaps in function and circadian expression, we wanted to determine whether the REV-ERBs might regulate orexin. We found that acute in vivo modulation of REV-ERB activity, with the REV-ERB-specific synthetic ligand SR9009, affects the circadian expression of orexinergic genes in mice. Long term dosing with SR9009 also suppresses orexinergic gene expression in mice. Finally, REV-ERBβ-deficient mice present with increased orexinergic transcripts. These data suggest that the REV-ERBs may be involved in the repression of orexinergic gene expression. PMID:26963516

  19. An overview of ABC and SLC drug transporter gene regulation.

    PubMed

    Chen, Qiu-Xia; Hu, Hai-Hong; Zhou, Quan; Yu, Ai-Ming; Zeng, Su

    2013-02-01

    Membrane transporters play a significant role in drug absorption, distribution and excretion, and they consequently affect the pharmacokinetics, efficacy and safety of a drug. Under certain circumstances, such as pathological processes or exposure to certain substances, the expression of drug transporters is modified in cells. Change in transporter expression and function may affect cellular drug disposition resulting in different drug responses. This raises a number of questions such as which drugs are likely to modulate the expression of drug transporters, what factors support this process, and which transporters are influenced in a particular situation. In this paper, we summarize recent findings to find an answer to these questions. Particularly, we present an overview of the transcription factors involved in the regulation of a given drug transporter, the signaling transduction pathways that contribute to drug transporter gene expression, and xenobiotics and endobiotics that initiate the processes.

  20. Maternal Obesity Affects Fetal Neurodevelopmental and Metabolic Gene Expression: A Pilot Study

    PubMed Central

    Edlow, Andrea G.; Vora, Neeta L.; Hui, Lisa; Wick, Heather C.; Cowan, Janet M.; Bianchi, Diana W.

    2014-01-01

    Objective One in three pregnant women in the United States is obese. Their offspring are at increased risk for neurodevelopmental and metabolic morbidity. Underlying molecular mechanisms are poorly understood. We performed a global gene expression analysis of mid-trimester amniotic fluid cell-free fetal RNA in obese versus lean pregnant women. Methods This prospective pilot study included eight obese (BMI≥30) and eight lean (BMI<25) women undergoing clinically indicated mid-trimester genetic amniocentesis. Subjects were matched for gestational age and fetal sex. Fetuses with abnormal karyotype or structural anomalies were excluded. Cell-free fetal RNA was extracted from amniotic fluid and hybridized to whole genome expression arrays. Genes significantly differentially regulated in 8/8 obese-lean pairs were identified using paired t-tests with the Benjamini-Hochberg correction (false discovery rate of <0.05). Biological interpretation was performed with Ingenuity Pathway Analysis and the BioGPS gene expression atlas. Results In fetuses of obese pregnant women, 205 genes were significantly differentially regulated. Apolipoprotein D, a gene highly expressed in the central nervous system and integral to lipid regulation, was the most up-regulated gene (9-fold). Apoptotic cell death was significantly down-regulated, particularly within nervous system pathways involving the cerebral cortex. Activation of the transcriptional regulators estrogen receptor, FOS, and STAT3 was predicted in fetuses of obese women, suggesting a pro-estrogenic, pro-inflammatory milieu. Conclusion Maternal obesity affects fetal neurodevelopmental and metabolic gene expression as early as the second trimester. These findings may have implications for postnatal neurodevelopmental and metabolic abnormalities described in the offspring of obese women. PMID:24558408

  1. Ethanol-Regulated Genes That Contribute to Ethanol Sensitivity and Rapid Tolerance in Drosophila

    PubMed Central

    Kong, Eric C.; Allouche, Lorien; Chapot, Paul A.; Vranizan, Karen; Moore, Monica S.; Heberlein, Ulrike; Wolf, Fred W.

    2010-01-01

    Background Increased ethanol intake, a major predictor for the development of alcohol use disorders, is facilitated by the development of tolerance to both the aversive and pleasurable effects of the drug. The molecular mechanisms underlying ethanol tolerance development are complex and are not yet well understood. Methods To identify genetic mechanisms that contribute to ethanol tolerance, we examined the time course of gene expression changes elicited by a single sedating dose of ethanol in Drosophila, and completed a behavioral survey of strains harboring mutations in ethanol-regulated genes. Results Enrichment for genes in metabolism, nucleic acid binding, olfaction, regulation of signal transduction, and stress suggests that these biological processes are coordinately affected by ethanol exposure. We also detected a coordinate up-regulation of genes in the Toll and Imd innate immunity signal transduction pathways. A multi-study comparison revealed a small set of genes showing similar regulation, including increased expression of 3 genes for serine biosynthesis. A survey of Drosophila strains harboring mutations in ethanol-regulated genes for ethanol sensitivity and tolerance phenotypes revealed roles for serine biosynthesis, olfaction, transcriptional regulation, immunity, and metabolism. Flies harboring deletions of the genes encoding the olfactory co-receptor Or83b or the sirtuin Sir2 showed marked changes in the development of ethanol tolerance. Conclusions Our findings implicate novel roles for these genes in regulating ethanol behavioral responses. PMID:19951294

  2. The Microarray Gene Profiling Analysis of Glioblastoma Cancer Cells Reveals Genes Affected by FAK Inhibitor Y15 and Combination of Y15 and Temozolomide

    PubMed Central

    Huang, Grace; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Qiang, Hu; Golubovskaya, Vita

    2013-01-01

    Focal adhesion is known to be highly expressed and activated in glioma cells. Recently, we demonstrated that FAK autophosphorylation inhibitor, Y15 significantly decreased tumor growth of DBTRG and U87 cells, especially in combination with temozolomide. In the present report, we performed gene expression analysis in these cells to reveal genes affected by Y15, temozolomide and combination of Y15 and temozolomide. We tested the effect of Y15 on gene expression by Illumina Human HT12v4 microarray assay and detected 8087 and 6555 genes, which were significantly either up- or down-regulated by Y15-treatment in DBTRG and U87 cells, respectively (p<0.05). Moreover, DBTRG and U87 cells treated with Y15 changed expression of 1332 and 462 genes more than 1.5 fold, p<0.05, respectively and had 237 common genes affected by Y15. The common genes up-regulated by Y15 included GADD45A, HSPA6 (heat-shock 70); DUSP1, DUSP 5 (dual-phosphatase 5); CDKN1A (p21) and common down-regulated genes included kinesins, such as KIF11, 14, 20A, 20B; topoisomerase II, TOP2A; cyclin F; cell cycle protein: BUB1; PARP1, POLA1. In addition, we detected genes affected by temozolomide and by combination of Y15 and temozolomide treatment in U87 cells. Among genes up-regulated by Y15 and temozolomide more significantly than by each agent alone were: COX7B; interferon, gamma-inducible transcript: IFI16; DDIT4; GADD45G and down-regulated: KIF3A, AKT1; ABL; JAK1, GLI3 and ALDH1A3. Thus, microarray gene expression analysis can be effective in establishing genes affected in response to FAK inhibitor alone and in response to combination of Y15 with temozolomide that is important for glioblastoma therapy. PMID:23387973

  3. Reward and Affective Regulation in Depression-Prone Smokers

    PubMed Central

    Audrain-McGovern, Janet; Wileyto, E. Paul; Ashare, Rebecca; Cuevas, Jocelyn; Strasser, Andrew A.

    2014-01-01

    Background There is a disproportionately high smoking prevalence among individuals who are prone to depression. While depression has been conceptualized as a disorder of dysregulated positive affect and disrupted reward processing, little research has been conducted to determine the role of smoking in these processes among depression-prone smokers. Methods Depression-prone smokers (DP+; n = 34) and smokers not depression-prone (DP-; n=49) underwent two laboratory sessions, once while smoking abstinent and once while smoking ad-libitum, to assess the relative reinforcing value of smoking and reward sensitivity. Using experience sampling methods, participants completed self-report measures of subjective reward, positive affect, and negative affect across three days while smoking as usual and three days while smoking abstinent. Results DP+ were two times more likely to work for cigarette puffs versus money in a progressive ratio, choice task (OR 2.05; CI 95% 1.04 to 4.06, p=0.039) compared to DP-. Reward sensitivity as measured by the signal detection task did not yield any significant findings. Mixed models regressions revealed a 3-way interaction (depression group, smoking phase, and time) for subjective reward, negative affect and positive affect. For all three of these outcomes, the slopes for DP- and DP+ differed significantly from each other (p's < 0.05), and the effect of smoking (vs. abstinence) over time was greater for DP+ than DP- smokers (p's <0.05). Conclusions These findings indicate that the effects of smoking on reward and positive affect regulation are specific to DP+ smokers and highlight novel targets for smoking cessation treatment in this population. PMID:24947541

  4. Brief Exercises Affect Gene Expression in Circulating Monocytes.

    PubMed

    Wang, D; Cai, F; Ge, J; Yin, L

    2015-11-01

    We aimed to give a systematic hypothesis on the functions of exercise on circulating monocytes by identifying a discrete set of genes in circulating monocytes that were altered by exercise. The microarray expression profile of GSE51835 was downloaded from gene expression omnibus (GEO) database for the identification of differentially expressed genes (DEGs) using limma and affy packages in R language. Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed for DEGs, followed by the construction of co-expression network and protein-protein interaction (PPI) network. The top 10 nodes in PPI network were screened, and subnetwork was constructed for the key genes identification. Totally, 35 DEGs, including 2 upregulated genes and 33 downregulated genes, were identified. The enriched GO terms were mainly linked to immune response and defence response, and the enriched KEGG pathways were mainly associated with natural killer cell-mediated cytotoxicity and graft-versus-host disease. Dual-specificity phosphatase 2 (DUSP2) was identified as a key node in the co-expression network. In the PPI network, CD247 module (CD247), chemokine (C-X-C motif) receptor 4 (CXCR4), granzyme B (GZMB) and perforin 1 (PRF1) were identified as key nodes. An important interaction, GZMB/PRF1, was detected. Five key genes, including DUSP2, CD247, CXCR4, GZMB and PRF1, and an interaction of GZMB/PRF1, were significant factors in the immune processes of circulating monocytes, which might be regulated by brief exercises, leading to the enhancement of immune function.

  5. Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

    PubMed

    Gancarz, Brandi L; Hao, Linhui; He, Qiuling; Newton, Michael A; Ahlquist, Paul

    2011-01-01

    Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV) is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol) levels were significantly increased in strains depleted for a heat shock protein (HSF1) or proteasome components (PRE1 and RPT6), suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol) localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

  6. Dietary polyunsaturated fatty acid regulation of gene transcription.

    PubMed

    Clarke, S D; Jump, D B

    1994-01-01

    We have known for nearly 30 years that dietary polyenoic (n-6) and (n-3) fatty acids potentially inhibit hepatic fatty acid biosynthesis. The teleological explanation for this unique action of PUFAs resides in their ability to suppress the synthesis of (n-9) fatty acids. By inhibiting fatty acid biosynthesis, dietary PUFAs reduce the availability of substrate for delta 9 desaturase (7, 22, 34, 36) and in turn reduce the availability of (n-9) fatty acids for incorporation into plasma membranes. In this way, essential biological processes dependent on essential fatty acids (e.g. reproduction and trans-dermal water loss) continue to operate normally. Therefore, if essential fatty acid intake did not regulate (n-9) fatty acid synthesis, the survival of the organism would be threatened. During the past 20 years, we have gradually elucidated the cellular and molecular mechanisms by which dietary PUFAs modulate fatty acid biosynthesis and (n-9) fatty acid availability. Central to this mechanism has been our ability to determine that dietary PUFAs regulate the transcription of genes coding for lipogenic enzymes (12, 40). The potential mechanisms by which PUFAs govern gene transcription are numerous, and it is unlikely that any one mechanism can fully elucidate the nuclear actions of PUFA. The difficulty in providing a unifying hypothesis at this time stems from: (a) the many metabolic routes taken by PUFAs upon entering the hepatocyte (Figure 1); and (b) the lack of identity of a specific PUFA-regulated trans-acting factor. However, the studies described above indicate that macronutrients, like PUFA, are not only utilized as fuel and structural components of cells, but also serve as important mediators of gene expression (12, 14, 40). As regulators of gene expression, PUFAs (or metabolites) are thought to affect the activity of transcription factors, which in turn target key cis-linked elements associated with specific genes. Whether this targeting involves DNA

  7. Regulation of collagen I gene expression by ras.

    PubMed Central

    Slack, J L; Parker, M I; Robinson, V R; Bornstein, P

    1992-01-01

    Although transformation of rodent fibroblasts can lead to dramatic changes in expression of extracellular matrix genes, the molecular basis and physiological significance of these changes remain poorly understood. In this study, we have investigated the mechanism(s) by which ras affects expression of the genes encoding type I collagen. Levels of both alpha 1(I) and alpha 2(I) collagen mRNAs were markedly reduced in Rat 1 fibroblasts overexpressing either the N-rasLys-61 or the Ha-rasVal-12 oncogene. In fibroblasts conditionally transformed with N-rasLys-61, alpha 1(I) transcript levels began to decline within 8 h of ras induction and reached 1 to 5% of control levels after 96 h. In contrast, overexpression of normal ras p21 had no effect on alpha 1(I) or alpha 2(I) mRNA levels. Nuclear run-on experiments demonstrated that the transcription rates of both the alpha 1(I) and alpha 2(I) genes were significantly reduced in ras-transformed cells compared with those in parental cells. In addition, the alpha 1(I) transcript was less stable in transformed cells. Chimeric plasmids containing up to 3.6 kb of alpha 1(I) 5'-flanking DNA and up to 2.3 kb of the 3'-flanking region were expressed at equivalent levels in both normal and ras-transformed fibroblasts. However, a cosmid clone containing the entire mouse alpha 1(I) gene, including 3.7 kb of 5'- and 4 kb of 3'-flanking DNA, was expressed at reduced levels in fibroblasts overexpressing oncogenic ras. We conclude that oncogenic ras regulates the type I collagen genes at both transcriptional and posttranscriptional levels and that this effect, at least for the alpha 1(I) gene, may be mediated by sequences located either within the body of the gene itself or in the distal 3'-flanking region. Images PMID:1406656

  8. Toxic Diatom Aldehydes Affect Defence Gene Networks in Sea Urchins

    PubMed Central

    Varrella, Stefano; Ruocco, Nadia; Ianora, Adrianna; Bentley, Matt G.; Costantini, Maria

    2016-01-01

    Marine organisms possess a series of cellular strategies to counteract the negative effects of toxic compounds, including the massive reorganization of gene expression networks. Here we report the modulated dose-dependent response of activated genes by diatom polyunsaturated aldehydes (PUAs) in the sea urchin Paracentrotus lividus. PUAs are secondary metabolites deriving from the oxidation of fatty acids, inducing deleterious effects on the reproduction and development of planktonic and benthic organisms that feed on these unicellular algae and with anti-cancer activity. Our previous results showed that PUAs target several genes, implicated in different functional processes in this sea urchin. Using interactomic Ingenuity Pathway Analysis we now show that the genes targeted by PUAs are correlated with four HUB genes, NF-κB, p53, δ-2-catenin and HIF1A, which have not been previously reported for P. lividus. We propose a working model describing hypothetical pathways potentially involved in toxic aldehyde stress response in sea urchins. This represents the first report on gene networks affected by PUAs, opening new perspectives in understanding the cellular mechanisms underlying the response of benthic organisms to diatom exposure. PMID:26914213

  9. Toxic Diatom Aldehydes Affect Defence Gene Networks in Sea Urchins.

    PubMed

    Varrella, Stefano; Romano, Giovanna; Costantini, Susan; Ruocco, Nadia; Ianora, Adrianna; Bentley, Matt G; Costantini, Maria

    2016-01-01

    Marine organisms possess a series of cellular strategies to counteract the negative effects of toxic compounds, including the massive reorganization of gene expression networks. Here we report the modulated dose-dependent response of activated genes by diatom polyunsaturated aldehydes (PUAs) in the sea urchin Paracentrotus lividus. PUAs are secondary metabolites deriving from the oxidation of fatty acids, inducing deleterious effects on the reproduction and development of planktonic and benthic organisms that feed on these unicellular algae and with anti-cancer activity. Our previous results showed that PUAs target several genes, implicated in different functional processes in this sea urchin. Using interactomic Ingenuity Pathway Analysis we now show that the genes targeted by PUAs are correlated with four HUB genes, NF-κB, p53, δ-2-catenin and HIF1A, which have not been previously reported for P. lividus. We propose a working model describing hypothetical pathways potentially involved in toxic aldehyde stress response in sea urchins. This represents the first report on gene networks affected by PUAs, opening new perspectives in understanding the cellular mechanisms underlying the response of benthic organisms to diatom exposure. PMID:26914213

  10. Light regulation of gene expression in higher plants

    SciTech Connect

    Tobin, E.M.; Silverthorne, J.

    1985-01-01

    In this review areas of currently active research are considered which have demonstrated that a plant's response to light involves changes in the expression of specific genes at the level of RNA. The regulation of gene expression by phytochrome and the UV-sensitive photoreceptor have been studied most extensively at the molecular level, and this review particularly focuses on such studies in higher plants. Some of the observations made on the differences in gene expression between light-grown and dark-grown plants are also included, although the photoreceptor(s) responsible for the differences may not have been ascertained. In some of these cases, phytochrome involvement has been or may be demonstrated in later studies, while in others the observed differences may be a result of the action of other photoreceptors or of multiple light-affected processes. One such process is the development of chloroplasts, a major developmental step triggered by light in angiosperms. In addition, many of the genes whose expression is changed by light and which have been studied at a molecular level encode chloroplast proteins. 156 references.

  11. Circuit-level input integration in bacterial gene regulation.

    PubMed

    Espinar, Lorena; Dies, Marta; Cagatay, Tolga; Süel, Gürol M; Garcia-Ojalvo, Jordi

    2013-04-23

    Gene regulatory circuits can receive multiple simultaneous inputs, which can enter the system through different locations. It is thus necessary to establish how these genetic circuits integrate multiple inputs as a function of their relative entry points. Here, we use the dynamic circuit regulating competence for DNA uptake in Bacillus subtilis as a model system to investigate this issue. Specifically, we map the response of single cells in vivo to a combination of (i) a chemical signal controlling the constitutive expression of key competence genes, and (ii) a genetic perturbation in the form of copy number variation of one of these genes, which mimics the level of stress signals sensed by the bacteria. Quantitative time-lapse fluorescence microscopy shows that a variety of dynamical behaviors can be reached by the combination of the two inputs. Additionally, the integration depends strongly on the relative locations where the two perturbations enter the circuit. Specifically, when the two inputs act upon different circuit elements, their integration generates novel dynamical behavior, whereas inputs affecting the same element do not. An in silico bidimensional bifurcation analysis of a mathematical model of the circuit offers good quantitative agreement with the experimental observations, and sheds light on the dynamical mechanisms leading to the different integrated responses exhibited by the gene regulatory circuit.

  12. European Regulation Affecting Nanomaterials - Review of Limitations and Future Recommendations

    PubMed Central

    Hansen, Steffen Foss; Baun, Anders

    2012-01-01

    After learning about the potential risks associated with various specific nanomaterials, concerns have been raised about adequacy of existing regulation in Europe and what should be done to address any potential regulatory gaps related to nanomaterials. Understanding the limitations of the current regulation in regard to nanomaterials is a starting point in a democratic and transparent process towards adapting existing laws and facilitating an informed discussion about which kind of regulatory options best address the identified limitations. In the following we will introduce key pieces of European legislation affecting nanomaterials, analyze their limitations, and provide a number of recommendations on how these can be overcome. We find that, although nanomaterials are in principle covered by the scope of many of the existing legislative frameworks, it is often unclear, if current regulations are actually applicable when it comes to specific nanomaterials and their diverse applications. Main limitations seem to be: that requirements to do safety evaluations are triggered by production volumes by tonnage not tailored to the nanoscale, the profound lack of (eco)toxicological data, and that thresholds values and occupational exposure limits cannot be established with existing methodologies. PMID:22942870

  13. Another player joins the complex field of sugar-regulated gene expression in plants

    SciTech Connect

    Gibson, Susan I.; Graham, Ian A.

    1999-04-01

    This article summarizes recent progress in understanding the molecular mechanisms by which soluble sugar levels affect plant development and gene expression. The article focuses on the role played by a newly identified protein, the PRL1 protein. The PRL1 protein has been found to interact with the SNF1 protein. Previously, SNF1 was shown to function in sugar-regulated gene expression in yeast. Mutations in the gene encoding PRL1 confer increased sensitivity to sugar and to several phytohormones.

  14. Regulation of gonadotropin gene expression by Mullerian inhibiting substance.

    PubMed

    Bédécarrats, Grégoy Y; O'Neill, Francis H; Norwitz, Errol R; Kaiser, Ursula B; Teixeira, Jose

    2003-08-01

    In addition to its role in causing Müllerian duct regression, Müllerian inhibiting substance (MIS) is implicated in the regulation of steroidogenesis, breast and prostate growth, and ovarian follicle recruitment, all of which are processes controlled or influenced by the hypothalamic-pituitary-gonadal axis. Whereas the direct effect of MIS on gonadal, prostate, and breast cells is under investigation, the ability of MIS to modulate pituitary function, thereby affecting those tissues indirectly, has not yet been studied. Using LbetaT2 cells, a murine gonadotrope-derived cell line, we have evaluated the effects of MIS on the expression of the gonadotropin genes. We show that both LbetaT2 cells and adult rat pituitaries express MIS type II receptor (MISRII) mRNA. Within 2 h, follicle-stimulating hormone beta subunit (FSHbeta) mRNA levels are significantly induced by addition of MIS to LbetaT2 cells and remain elevated through 8 h of treatment. Transcriptional activation of both the FSHbeta and luteinizing hormone beta subunit (LHbeta) gene promoters was observed by MIS, which enhances the effect of gonadotropin-releasing hormone (GnRH) agonist on the FSHbeta gene promoter and synergizes with the GnRH agonist to stimulate LHbeta gene promoter activity. Addition of MIS to LbetaT2 cells stimulates the activity of the rat LHbeta gene promoter with as little as 1 microg/ml and in a dose-dependent manner. These studies report both MISRII expression in rat pituitary cells and a gonadotrope-derived cell line and MIS-mediated activation of LHbeta and FSHbeta gene expression, and suggest that MIS may modulate the hypothalamic-pituitary-gonadal axis at more than one level.

  15. Identification of FHL2-regulated genes in liver by microarray and bioinformatics analysis.

    PubMed

    Ng, Chor-Fung; Xu, Jia-Ying; Li, Man-Shan; Tsui, Stephen Kwok-Wing

    2014-04-01

    FHL2 is a LIM domain protein that is able to form various protein complexes and regulate gene transcription. Recent findings showed that FHL2 is a potential tumor suppressor gene that was down-regulated in hepatocellular carcinoma. In the present study, microarray profiling of gene expression was performed to identify the genes regulated by FHL2 in mouse livers. The differentially expressed genes were further analyzed by bioinformatics tools including DAVID, KEGG, and STRING. Our data illustrate that FHL2 affects genes involved in various functions including signal transduction, responses to external stimulus, cancer-related pathways, cardiovascular function and regulation of actin cytoskeleton. Moreover, a network of differentially expressed genes identified in this study and known FHL2-interacting proteins was constructed. Then, genes identified by bioinformatics tools and most functional relevant to FHL2 were selected for further validation. Finally, the differential expression of Ar, Id3, Inhbe, Alas1, Bcl6, Pparδ, Angptl4, and Erbb4 were confirmed by quantitative real-time PCR. In summary, we have established a database of genes that are potentially regulated by FHL2 and these genes should be future targets for the elucidation of functional roles of FHL2.

  16. Epigenetic and Genetic Alterations Affect the WWOX Gene in Head and Neck Squamous Cell Carcinoma

    PubMed Central

    Ekizoglu, Seda; Bulut, Pelin; Karaman, Emin; Kilic, Erkan; Buyru, Nur

    2015-01-01

    Different types of genetic and epigenetic changes are associated with HNSCC. The molecular mechanisms of HNSCC carcinogenesis are still undergoing intensive investigation. WWOX gene expression is altered in many cancers and in a recent work reduced WWOX expression has been associated with miR-134 expression in HNSCC. In this study we investigated the WWOX messenger RNA expression levels in association with the promoter methylation of the WWOX gene and miR-134 expression levels in 80 HNSCC tumor and non-cancerous tissue samples. Our results show that WWOX expression is down-regulated especially in advanced-stage tumor samples or in tumors with SCC. This down-regulation was associated with methylation of the WWOX promoter region but not with miR-134 expression. There was an inverse correlation between the expression level and promoter methylation. We also analyzed whole exons and exon/intron boundries of the WWOX gene by direct sequencing. In our study group we observed 10 different alterations in the coding sequences and 18 different alterations in the non-coding sequences of the WWOX gene in HNSCC tumor samples. These results indicate that the WWOX gene can be functionally inactivated by promoter methylation, epigenetically or by mutations affecting the sequences coding for the enzymatic domain of the gene, functionally. We conclude that inactivation of WWOX gene contributes to the progression of HNSCC. PMID:25612104

  17. Pluralistic and stochastic gene regulation: examples, models and consistent theory

    PubMed Central

    Salas, Elisa N.; Shu, Jiang; Cserhati, Matyas F.; Weeks, Donald P.; Ladunga, Istvan

    2016-01-01

    We present a theory of pluralistic and stochastic gene regulation. To bridge the gap between empirical studies and mathematical models, we integrate pre-existing observations with our meta-analyses of the ENCODE ChIP-Seq experiments. Earlier evidence includes fluctuations in levels, location, activity, and binding of transcription factors, variable DNA motifs, and bursts in gene expression. Stochastic regulation is also indicated by frequently subdued effects of knockout mutants of regulators, their evolutionary losses/gains and massive rewiring of regulatory sites. We report wide-spread pluralistic regulation in ≈800 000 tightly co-expressed pairs of diverse human genes. Typically, half of ≈50 observed regulators bind to both genes reproducibly, twice more than in independently expressed gene pairs. We also examine the largest set of co-expressed genes, which code for cytoplasmic ribosomal proteins. Numerous regulatory complexes are highly significant enriched in ribosomal genes compared to highly expressed non-ribosomal genes. We could not find any DNA-associated, strict sense master regulator. Despite major fluctuations in transcription factor binding, our machine learning model accurately predicted transcript levels using binding sites of 20+ regulators. Our pluralistic and stochastic theory is consistent with partially random binding patterns, redundancy, stochastic regulator binding, burst-like expression, degeneracy of binding motifs and massive regulatory rewiring during evolution. PMID:26823500

  18. Pluralistic and stochastic gene regulation: examples, models and consistent theory.

    PubMed

    Salas, Elisa N; Shu, Jiang; Cserhati, Matyas F; Weeks, Donald P; Ladunga, Istvan

    2016-06-01

    We present a theory of pluralistic and stochastic gene regulation. To bridge the gap between empirical studies and mathematical models, we integrate pre-existing observations with our meta-analyses of the ENCODE ChIP-Seq experiments. Earlier evidence includes fluctuations in levels, location, activity, and binding of transcription factors, variable DNA motifs, and bursts in gene expression. Stochastic regulation is also indicated by frequently subdued effects of knockout mutants of regulators, their evolutionary losses/gains and massive rewiring of regulatory sites. We report wide-spread pluralistic regulation in ≈800 000 tightly co-expressed pairs of diverse human genes. Typically, half of ≈50 observed regulators bind to both genes reproducibly, twice more than in independently expressed gene pairs. We also examine the largest set of co-expressed genes, which code for cytoplasmic ribosomal proteins. Numerous regulatory complexes are highly significant enriched in ribosomal genes compared to highly expressed non-ribosomal genes. We could not find any DNA-associated, strict sense master regulator. Despite major fluctuations in transcription factor binding, our machine learning model accurately predicted transcript levels using binding sites of 20+ regulators. Our pluralistic and stochastic theory is consistent with partially random binding patterns, redundancy, stochastic regulator binding, burst-like expression, degeneracy of binding motifs and massive regulatory rewiring during evolution.

  19. Chronic mild stressors and diet affect gene expression differently in male and female rats.

    PubMed

    Liang, Shuwen; Byers, Donna M; Irwin, Louis N

    2007-01-01

    While depression is reportedly more prevalent in women than men, a neurobiological basis for this difference has not been documented. Chronic mild stress (CMS) is a widely recognized animal model, which uses mild and unpredictable environmental stressors to induce depression. Studies of chronic stress, mainly in males, have reported an increase in the relative intake of "comfort food" as a means of counteracting the effects of stress. This study was designed to test the hypothesis that genes for certain neurotrophic factors, stress markers, and appetite regulators would be expressed differentially in male and female rats exposed to chronic, mild stressors with access to a preferred diet. Gene expression for neuropeptide Y was upregulated in females purely in response to stressors, whereas that for the epidermal growth factor receptor (EGFR) and arginine vasopressin (AVP) in males and fatty acid synthase (FASN) in females responded primarily to diet. Genes for brain-derived neurotrophic factor (BDNF), AVP, and the cocaine-amphetamine regulator of transcription (CART) in males, and leptin in females, showed a significant response to the interaction between stressors and diet. Every affected gene showed a different pattern of expression in males and females. This study confirms the intimate relationship between dietary intake and response to stress at the molecular level, and emphasizes the sex- and gene-specific nature of those interactions. Therefore, it supports a neurobiological basis for differences in the affective state response to stress in males and females. PMID:17917078

  20. Global identification of bursicon-regulated genes in Drosophila melanogaster

    PubMed Central

    An, Shiheng; Wang, Songjie; Gilbert, Lawrence I; Beerntsen, Brenda; Ellersieck, Mark; Song, Qisheng

    2008-01-01

    Background Bursicon is a heterodimer neuropeptide responsible for regulating cuticle sclerotization and wing expansion in several insect species. Recent studies indicate that the action of bursicon is mediated by a specific G protein-coupled receptor DLGR2 and the cAMP/PKA signaling pathway. However, little is known regarding the genes that are regulated by bursicon. The identification of bursicon-regulated genes is the focus of this investigation. Results We used DNA microarray analysis to identify bursicon-regulated genes in neck-ligated flies (Drosophila melanogaster) that received recombinant bursicon (r-bursicon). Fifty four genes were found to be regulated by bursicon 1 h post r-bursicon injection, 52 being up-regulated and 2 down-regulated while 33 genes were influenced by r-bursicon 3 h post-injection (24 up-regulated and 9 down-regulated genes). Analysis of these genes by inference from the fly database revealed that these genes encode proteins with diverse functions, including cell signaling, gene transcription, DNA/RNA binding, ion trafficking, proteolysis-peptidolysis, metabolism, cytoskeleton formation, immune response and cell-adhesion. Twenty eight genes randomly selected from the microarray-identified list were verified by real time PCR (qPCR) which supported the microarray data. Temporal response studies of 13 identified and verified genes by qPCR revealed that the temporal expression patterns of these genes are consistent with the microarray data. Conclusion Using r-bursicon, we identified 87 genes that are regulated by bursicon, 30 of which have no previously known function. Most importantly, all genes randomly selected from the microarray-identified list were verified by real time PCR. Temporal analysis of 13 verified genes revealed that the expression of these genes was indeed induced by bursicon and correlated well with the cuticle sclerotization process. The composite data suggest that these genes play important roles in regulating the

  1. Associations between the oxytocin receptor gene (OXTR) and affect, loneliness and intelligence in normal subjects.

    PubMed

    Lucht, Michael J; Barnow, Sven; Sonnenfeld, Christine; Rosenberger, Albert; Grabe, Hans Joergen; Schroeder, Winnie; Völzke, Henry; Freyberger, Harald J; Herrmann, Falko H; Kroemer, Heyo; Rosskopf, Dieter

    2009-08-01

    Associations of oxytocin receptor gene (OXTR) variants and autism spectrum disorders (ASD) have been reported in earlier studies; in one of the studies associations with IQ and daily living skills were found additionally. Variations of the oxytocin receptor gene might also regulate affect, attachment and separation beyond the diagnostic borders of autism. We tested hypotheses of associations between positive and negative affects and social and emotional loneliness (285 adults), IQ (117 adolescents) and polymorphisms of the oxytocin receptor gene (OXTR rs53576, rs2254298 and rs2228485) in normal subjects. Individuals with the oxytocin OXTR rs53576 A/A genotype showed lower positive affect scores (F=5.532, df=1; p=0.019). This effect was restricted to males (F=13.098, df=1; p=0.00047). Haplotypes constructed with the three markers were associated with positive affect (p=0.0012), negative affect (p<0.0001) and emotional loneliness (p<0.0001). Non-verbal intelligence was significantly reduced in rs53576 A/A adolescents (T=2.247, p=0.027). Our findings support a role for the oxytocin receptor haplotypes in the generation of affectivity, emotional loneliness and IQ. PMID:19376182

  2. Antipsychotic Induced Gene Regulation in Multiple Brain Regions

    PubMed Central

    Girgenti, Matthew James; Nisenbaum, Laura K.; Bymaster, Franklin; Terwilliger, Rosemarie; Duman, Ronald S; Newton, Samuel Sathyanesan

    2010-01-01

    The molecular mechanism of action of antipsychotic drugs is not well understood. Their complex receptor affinity profiles indicate that their action could extend beyond dopamine receptor blockade. Single gene expression studies and high-throughput gene profiling have shown the induction of genes from several molecular classes and functional categories. Using a focused microarray approach we investigated gene regulation in rat striatum, frontal cortex and hippocampus after chronic administration of haloperidol or olanzapine. Regulated genes were validated by in-situ hybridization, realtime PCR and immunohistochemistry. Only limited overlap was observed in genes regulated by haloperidol and olanzapine. Both drugs elicited maximal gene regulation in the striatum and least in the hippocampus. Striatal gene induction by haloperidol was predominantly in neurotransmitter signaling, G-protein coupled receptors and transcription factors. Olanzapine prominently induced retinoic acid and trophic factor signaling genes in the frontal cortex. The data also revealed the induction of several genes that could be targeted in future drug development efforts. The study uncovered the induction of several novel genes, including somatostatin receptors and metabotropic glutamate receptors. The results demonstrating the regulation of multiple receptors and transcription factors suggests that both typical and atypical antipsychotics could possess a complex molecular mechanism of action. PMID:20070867

  3. Thiol-Based Redox Switches and Gene Regulation

    PubMed Central

    2011-01-01

    Abstract Cysteine is notable among the universal, proteinogenic amino acids for its facile redox chemistry. Cysteine thiolates are readily modified by reactive oxygen species (ROS), reactive electrophilic species (RES), and reactive nitrogen species (RNS). Although thiol switches are commonly triggered by disulfide bond formation, they can also be controlled by S-thiolation, S-alkylation, or modification by RNS. Thiol-based switches are common in both prokaryotic and eukaryotic organisms and activate functions that detoxify reactive species and restore thiol homeostasis while repressing functions that would be deleterious if expressed under oxidizing conditions. Here, we provide an overview of the best-understood examples of thiol-based redox switches that affect gene expression. Intra- or intermolecular disulfide bond formation serves as a direct regulatory switch for several bacterial transcription factors (OxyR, OhrR/2-Cys, Spx, YodB, CrtJ, and CprK) and indirectly regulates others (the RsrA anti-σ factor and RegB sensory histidine kinase). In eukaryotes, thiol-based switches control the yeast Yap1p transcription factor, the Nrf2/Keap1 electrophile and oxidative stress response, and the Chlamydomonas NAB1 translational repressor. Collectively, these regulators reveal a remarkable range of chemical modifications exploited by Cys residues to effect changes in gene expression. Antioxid. Redox Signal. 14, 1049—1063. PMID:20626317

  4. Trainable Gene Regulation Networks with Applications to Drosophila Pattern Formation

    NASA Technical Reports Server (NTRS)

    Mjolsness, Eric

    2000-01-01

    This chapter will very briefly introduce and review some computational experiments in using trainable gene regulation network models to simulate and understand selected episodes in the development of the fruit fly, Drosophila melanogaster. For details the reader is referred to the papers introduced below. It will then introduce a new gene regulation network model which can describe promoter-level substructure in gene regulation. As described in chapter 2, gene regulation may be thought of as a combination of cis-acting regulation by the extended promoter of a gene (including all regulatory sequences) by way of the transcription complex, and of trans-acting regulation by the transcription factor products of other genes. If we simplify the cis-action by using a phenomenological model which can be tuned to data, such as a unit or other small portion of an artificial neural network, then the full transacting interaction between multiple genes during development can be modelled as a larger network which can again be tuned or trained to data. The larger network will in general need to have recurrent (feedback) connections since at least some real gene regulation networks do. This is the basic modeling approach taken, which describes how a set of recurrent neural networks can be used as a modeling language for multiple developmental processes including gene regulation within a single cell, cell-cell communication, and cell division. Such network models have been called "gene circuits", "gene regulation networks", or "genetic regulatory networks", sometimes without distinguishing the models from the actual modeled systems.

  5. Identification of the key regulating genes of diminished ovarian reserve (DOR) by network and gene ontology analysis.

    PubMed

    Pashaiasl, Maryam; Ebrahimi, Mansour; Ebrahimie, Esmaeil

    2016-09-01

    Diminished ovarian reserve (DOR) is one of the reasons for infertility that not only affects both older and young women. Ovarian reserve assessment can be used as a new prognostic tool for infertility treatment decision making. Here, up- and down-regulated gene expression profiles of granulosa cells were analysed to generate a putative interaction map of the involved genes. In addition, gene ontology (GO) analysis was used to get insight intol the biological processes and molecular functions of involved proteins in DOR. Eleven up-regulated genes and nine down-regulated genes were identified and assessed by constructing interaction networks based on their biological processes. PTGS2, CTGF, LHCGR, CITED, SOCS2, STAR and FSTL3 were the key nodes in the up-regulated networks, while the IGF2, AMH, GREM, and FOXC1 proteins were key in the down-regulated networks. MIRN101-1, MIRN153-1 and MIRN194-1 inhibited the expression of SOCS2, while CSH1 and BMP2 positively regulated IGF1 and IGF2. Ossification, ovarian follicle development, vasculogenesis, sequence-specific DNA binding transcription factor activity, and golgi apparatus are the major differential groups between up-regulated and down-regulated genes in DOR. Meta-analysis of publicly available transcriptomic data highlighted the high coexpression of CTGF, connective tissue growth factor, with the other key regulators of DOR. CTGF is involved in organ senescence and focal adhesion pathway according to GO analysis. These findings provide a comprehensive system biology based insight into the aetiology of DOR through network and gene ontology analyses. PMID:27324248

  6. Screening for gene regulation mutants by bioluminescence imaging.

    PubMed

    Chinnusamy, Viswanathan; Stevenson, Becky; Lee, Byeong-ha; Zhu, Jian-Kang

    2002-07-09

    Because plants cannot move, they have evolved complex sensing and response systems to cope with the physical environment. Adverse environmental conditions, such as those causing abiotic stress, often cause significant losses in crop productivity and quality. Because of a paucity of well-defined visible phenotypes, conventional genetic screens have not been very successful in isolating abiotic stress signal transduction mutants of plants. Here, we describe a reporter gene-based strategy to screen for mutants affected in abiotic stress-regulated gene transcription. Our genetic screen uses the firefly luciferase reporter gene driven by the cold, drought, salt, and abscisic acid (ABA)-responsive RD29A promoter (RD29A::LUC). Arabidopsis plants transformed with the RD29A::LUC reporter emit bioluminescence in response to cold, drought, salt, or ABA treatment. After mutagenesis of these plants with ethyl methanesulfonate (EMS), mutants can be screened from the M2 population by monitoring the level of stress-inducible bioluminescence with a high-throughput, low-light imaging system. This protocol describes in detail the procedures for this luciferase reporter-based genetic screen for Arabidopsis mutants defective in abiotic stress signaling.

  7. Whole gene family expression and drought stress regulation of aquaporins.

    PubMed

    Alexandersson, Erik; Fraysse, Laure; Sjövall-Larsen, Sara; Gustavsson, Sofia; Fellert, Maria; Karlsson, Maria; Johanson, Urban; Kjellbom, Per

    2005-10-01

    Since many aquaporins (AQPs) act as water channels, they are thought to play an important role in plant water relations. It is therefore of interest to study the expression patterns of AQP isoforms in order to further elucidate their involvement in plant water transport. We have monitored the expression patterns of all 35 Arabidopsis AQPs in leaves, roots and flowers by cDNA microarrays, specially designed for AQPs, and by quantitative real-time reverse transcriptase PCR (Q-RT-PCR). This showed that many AQPs are pre-dominantly expressed in either root or flower organs, whereas no AQP isoform seem to be leaf specific. Looking at the AQP subfamilies, most plasma membrane intrinsic proteins (PIPs) and some tonoplast intrinsic proteins (TIPs) have a high level of expression, while NOD26-like proteins (NIPs) are present at a much lower level. In addition, we show that PIP transcripts are generally down-regulated upon gradual drought stress in leaves, with the exception of AtPIP1;4 and AtPIP2;5, which are up-regulated. AtPIP2;6 and AtSIP1;1 are constitutively expressed and not significantly affected by the drought stress. The transcriptional down-regulation of PIP genes upon drought stress could also be observed on the protein level. PMID:16235111

  8. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection.

    PubMed

    Katsarou, Konstantina; Wu, Yun; Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E; Bryan, Glenn J; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection.

  9. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection

    PubMed Central

    Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E.; Bryan, Glenn J.; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection. PMID:26937634

  10. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection.

    PubMed

    Katsarou, Konstantina; Wu, Yun; Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E; Bryan, Glenn J; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection. PMID:26937634

  11. Identification of mouse retinal genes differentially regulated by dim and bright cyclic light rearing.

    PubMed

    Huang, Hu; Frank, Mark Barton; Dozmorov, Igor; Cao, Wei; Cadwell, Craig; Knowlton, Nick; Centola, Michael; Anderson, Robert E

    2005-05-01

    Bright cyclic light rearing protects BALB/c mice from light-induced photoreceptor apoptosis compared to dim cyclic light rearing. We used a microarray approach to search for putative neuroprotection genes that were up- or down-regulated under these environmental conditions. Retinal protection by bright cyclic rearing was determined by quantitative histology and DNA fragmentation analysis. Total RNA was isolated from 5-week-old mice raised in bright (400 lux) or dim (5 lux) cyclic light and prepared for analysis on microarrays produced using a 70-mer oligonucleotide library that represented 16,463 mouse genes. Genes of interest were identified using statistically robust bioinformatics analysis methods that were developed in-house. Changes in some genes were confirmed with quantitative real time PCR. We found that 952 genes were up- or down-regulated by bright cyclic light rearing compared to dim cyclic light rearing. One hundred and eighty-four of them, having >/=2-fold differences, were grouped into 13 categories, and selected for further consideration. Eleven up-regulated and two down-regulated genes were confirmed by semi-quantitative PCR. Five neuroprotection-associated genes were up-regulated by bright cyclic light rearing as confirmed by real-time PCR. The human orthologue chromosomal location of 22 differentially expressed genes map to known retinal degeneration loci. Using PathwayAssist software, we modeled the pathway networks of up- and down-regulated genes that are functionally related to the retina. We identified retinal genes that are differentially regulated by environmental light history. Those that directly affect cell processes such as survival, apoptosis, and transcription are likely play a pivotal role in the regulation of retinal neuroprotection against light-induced photoreceptor apoptosis.

  12. Global Regulator MorA Affects Virulence-Associated Protease Secretion in Pseudomonas aeruginosa PAO1

    PubMed Central

    Ravichandran, Ayshwarya; Wong, Chui Ching; Swarup, Sanjay

    2015-01-01

    Bacterial invasion plays a critical role in the establishment of Pseudomonas aeruginosa infection and is aided by two major virulence factors – surface appendages and secreted proteases. The second messenger cyclic diguanylate (c-di-GMP) is known to affect bacterial attachment to surfaces, biofilm formation and related virulence phenomena. Here we report that MorA, a global regulator with GGDEF and EAL domains that was previously reported to affect virulence factors, negatively regulates protease secretion via the type II secretion system (T2SS) in P. aeruginosa PAO1. Infection assays with mutant strains carrying gene deletion and domain mutants show that host cell invasion is dependent on the active domain function of MorA. Further investigations suggest that the MorA-mediated c-di-GMP signaling affects protease secretion largely at a post-translational level. We thus report c-di-GMP second messenger system as a novel regulator of T2SS function in P. aeruginosa. Given that T2SS is a central and constitutive pump, and the secreted proteases are involved in interactions with the microbial surroundings, our data broadens the significance of c-di-GMP signaling in P. aeruginosa pathogenesis and ecological fitness. PMID:25894344

  13. Integrating Negative Affect Measures in a Measurement Model: Assessing the Function of Negative Affect as Interference to Self-Regulation

    ERIC Educational Resources Information Center

    Magno, Carlo

    2010-01-01

    The present study investigated the composition of negative affect and its function as inhibitory to thought processes such as self-regulation. Negative affect in the present study were composed of anxiety, worry, thought suppression, and fear of negative evaluation. These four factors were selected based on the criteria of negative affect by…

  14. Natural variation in ARF18 gene simultaneously affects seed weight and silique length in polyploid rapeseed.

    PubMed

    Liu, Jing; Hua, Wei; Hu, Zhiyong; Yang, Hongli; Zhang, Liang; Li, Rongjun; Deng, Linbin; Sun, Xingchao; Wang, Xinfa; Wang, Hanzhong

    2015-09-15

    Seed weight (SW), which is one of the three major factors influencing grain yield, has been widely accepted as a complex trait that is controlled by polygenes, particularly in polyploid crops. Brassica napus L., which is the second leading crop source for vegetable oil around the world, is a tetraploid (4×) species. In the present study, we identified a major quantitative trait locus (QTL) on chromosome A9 of rapeseed in which the genes for SW and silique length (SL) were colocated. By fine mapping and association analysis, we uncovered a 165-bp deletion in the auxin-response factor 18 (ARF18) gene associated with increased SW and SL. ARF18 encodes an auxin-response factor and shows inhibitory activity on downstream auxin genes. This 55-aa deletion prevents ARF18 from forming homodimers, in turn resulting in the loss of binding activity. Furthermore, reciprocal crossing has shown that this QTL affects SW by maternal effects. Transcription analysis has shown that ARF18 regulates cell growth in the silique wall by acting via an auxin-response pathway. Together, our results suggest that ARF18 regulates silique wall development and determines SW via maternal regulation. In addition, our study reveals the first (to our knowledge) QTL in rapeseed and may provide insights into gene cloning involving polyploid crops.

  15. Natural variation in ARF18 gene simultaneously affects seed weight and silique length in polyploid rapeseed

    PubMed Central

    Liu, Jing; Hua, Wei; Hu, Zhiyong; Yang, Hongli; Zhang, Liang; Li, Rongjun; Deng, Linbin; Sun, Xingchao; Wang, Xinfa; Wang, Hanzhong

    2015-01-01

    Seed weight (SW), which is one of the three major factors influencing grain yield, has been widely accepted as a complex trait that is controlled by polygenes, particularly in polyploid crops. Brassica napus L., which is the second leading crop source for vegetable oil around the world, is a tetraploid (4×) species. In the present study, we identified a major quantitative trait locus (QTL) on chromosome A9 of rapeseed in which the genes for SW and silique length (SL) were colocated. By fine mapping and association analysis, we uncovered a 165-bp deletion in the auxin-response factor 18 (ARF18) gene associated with increased SW and SL. ARF18 encodes an auxin-response factor and shows inhibitory activity on downstream auxin genes. This 55-aa deletion prevents ARF18 from forming homodimers, in turn resulting in the loss of binding activity. Furthermore, reciprocal crossing has shown that this QTL affects SW by maternal effects. Transcription analysis has shown that ARF18 regulates cell growth in the silique wall by acting via an auxin-response pathway. Together, our results suggest that ARF18 regulates silique wall development and determines SW via maternal regulation. In addition, our study reveals the first (to our knowledge) QTL in rapeseed and may provide insights into gene cloning involving polyploid crops. PMID:26324896

  16. Natural variation in ARF18 gene simultaneously affects seed weight and silique length in polyploid rapeseed.

    PubMed

    Liu, Jing; Hua, Wei; Hu, Zhiyong; Yang, Hongli; Zhang, Liang; Li, Rongjun; Deng, Linbin; Sun, Xingchao; Wang, Xinfa; Wang, Hanzhong

    2015-09-15

    Seed weight (SW), which is one of the three major factors influencing grain yield, has been widely accepted as a complex trait that is controlled by polygenes, particularly in polyploid crops. Brassica napus L., which is the second leading crop source for vegetable oil around the world, is a tetraploid (4×) species. In the present study, we identified a major quantitative trait locus (QTL) on chromosome A9 of rapeseed in which the genes for SW and silique length (SL) were colocated. By fine mapping and association analysis, we uncovered a 165-bp deletion in the auxin-response factor 18 (ARF18) gene associated with increased SW and SL. ARF18 encodes an auxin-response factor and shows inhibitory activity on downstream auxin genes. This 55-aa deletion prevents ARF18 from forming homodimers, in turn resulting in the loss of binding activity. Furthermore, reciprocal crossing has shown that this QTL affects SW by maternal effects. Transcription analysis has shown that ARF18 regulates cell growth in the silique wall by acting via an auxin-response pathway. Together, our results suggest that ARF18 regulates silique wall development and determines SW via maternal regulation. In addition, our study reveals the first (to our knowledge) QTL in rapeseed and may provide insights into gene cloning involving polyploid crops. PMID:26324896

  17. Adult Antisocial Behavior and Affect Regulation among Primary Crack/Cocaine-Using Women

    ERIC Educational Resources Information Center

    Litt, Lisa Caren; Hien, Denise A.; Levin, Deborah

    2003-01-01

    The relationship between deficits in affect regulation and Adult Antisocial Behavior (ASB) in primary crack/cocaine-using women was explored in a sample of 80 inner-city women. Narrative early memories were coded for two components of affect regulation, Affect Tolerance and Affect Expression, using the Epigenetic Assessment Rating Scale (EARS;…

  18. Prediction of epigenetically regulated genes in breast cancer cell lines

    SciTech Connect

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  19. Regulation of genes encoding cellulolytic enzymes by Pal-PacC signaling in Aspergillus nidulans.

    PubMed

    Kunitake, Emi; Hagiwara, Daisuke; Miyamoto, Kentaro; Kanamaru, Kyoko; Kimura, Makoto; Kobayashi, Tetsuo

    2016-04-01

    Cellulosic biomass represents a valuable potential substitute for fossil-based fuels. As such, there is a strong need to develop efficient biotechnological processes for the enzymatic hydrolysis of cellulosic biomass via the optimization of cellulase production by fungi. Ambient pH is an important factor affecting the industrial production of cellulase. In the present study, we demonstrate that several Aspergillus nidulans genes encoding cellulolytic enzymes are regulated by Pal-PacC-mediated pH signaling, as evidenced by the decreased cellulase productivity of the palC mutant and pacC deletants of A. nidulans. The deletion of pacC was observed to result in delayed induction and decreased expression of the cellulase genes based on time course expression analysis. The genome-wide identification of PacC-regulated genes under cellobiose-induced conditions demonstrated that genes expressed in a PacC-dependent manner included 82 % of ClrB (a transcriptional activator of the cellulase genes)-regulated genes, including orthologs of various transporter and β-glucosidase genes considered to be involved in cellobiose uptake or production of stronger inducer molecules. Together with the significant overlap between ClrB- and PacC-regulated genes, the results suggest that PacC-mediated regulation of the cellulase genes involves not only direct regulation by binding to their promoter regions but also indirect regulation via modulation of the expression of genes involved in ClrB-dependent transcriptional activation. Our findings are expected to contribute to the development of more efficient industrial cellulase production methods.

  20. A Discovery Lab for Studying Gene Regulation.

    ERIC Educational Resources Information Center

    Moss, Robert

    1997-01-01

    Presents a laboratory in which students are provided with cultures of three bacterial strains. Using the results, students will determine which of the strains corresponds to a mutant lacking a particular functional gene. (DDR)

  1. 'Obesity Gene' Doesn't Affect Ability to Lose Weight: Report

    MedlinePlus

    ... page: https://medlineplus.gov/news/fullstory_161090.html 'Obesity Gene' Doesn't Affect Ability to Lose Weight: ... 21, 2016 (HealthDay News) -- Having the so-called "obesity gene" doesn't affect people's ability to shed ...

  2. Regulation of Expressive Behavior as Reflecting Affect Socialization.

    ERIC Educational Resources Information Center

    Saarni, Carolyn

    Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

  3. Lentivectors for regulated and reversible cutaneous gene delivery.

    PubMed

    Siprashvili, Zurab; Khavari, Paul A

    2004-01-01

    Systemic administration of therapeutic proteins has value in treating a wide variety of disorders, including erythropoietin (Epo)-responsive anemias. Recombinant proteins, however, are costly and require repeated injections, while gene delivery approaches have suffered from inefficiency and difficulties with regulation. The skin effectively delivers polypeptides to the circulation, and improved approaches would support sustainable, topically regulated protein expression after a single vector injection. Toward this goal, we generated lentivectors in which both gene delivery and persistence in skin are regulated by administration of distinct steroid ligands. Following a single injection of regulated lentivector into human skin regenerated on immunodeficient mice, topical glucocorticoid ligands regulated Epo levels and hematocrit over time. Abrogation of gene delivery was achieved by both glucocorticoid cessation and proviral excision via a 4-hydroxytamoxifen-inducible Cre recombinase. These findings establish an approach to durable, topically controlled systemic delivery of therapeutic proteins from human skin tissue.

  4. Does regulating others' feelings influence people's own affective well-being?

    PubMed

    Niven, Karen; Totterdell, Peter; Holman, David; Headley, Tara

    2012-01-01

    Individuals in a variety of social contexts try to regulate other people's feelings, but how does this process affect the regulators themselves? This research aimed to establish a relationship between people's use of interpersonal affect regulation and their own affective well-being. In a field study, self- and other-reported data were collected from prisoners and staff members in a therapeutic prison using two surveys separated in time. In a laboratory study, a student sample reported their affect before and after attempting to influence the feelings of talent show contestants in a role-play task. The results of both studies indicated congruent associations between the use of affect-improving and affect-worsening interpersonal affect regulation and strategy agents' affective well-being. Our findings highlight that, when performing interpersonal affect regulation, people may not be immune from the effects of their own actions.

  5. Regulation of gene expression in the intestinal epithelium.

    PubMed

    Richmond, Camilla A; Breault, David T

    2010-01-01

    Regulation of gene expression within the intestinal epithelium is complex and controlled by various signaling pathways that regulate the balance between proliferation and differentiation. Proliferation is required both to grow and to replace cells lost through apoptosis and attrition, yet in all but a few cells, differentiation must take place to prevent uncontrolled growth (cancer) and to provide essential functions. In this chapter, we review the major signaling pathways underlying regulation of gene expression within the intestinal epithelium, based primarily on data from mouse models, as well as specific morphogens and transcription factor families that have a major role in regulating intestinal gene expression, including the Hedgehog family, Forkhead Box (FOX) factors, Homeobox (HOX) genes, ParaHox genes, GATA transcription factors, canonical Wnt/β-catenin signaling, EPH/Ephrins, Sox9, BMP signaling, PTEN/PI3K, LKB1, K-RAS, Notch pathway, HNF, and MATH1. We also briefly highlight important emerging areas of gene regulation, including microRNA (miRNA) and epigenetic regulation. PMID:21075346

  6. REGULATION OF GENE EXPRESSION IN THE INTESTINAL EPITHELIUM

    PubMed Central

    Richmond, Camilla A.; Breault, David T.

    2013-01-01

    Regulation of gene expression within the intestinal epithelium is complex and controlled by various signaling pathways that regulate the balance between proliferation and differentiation. Proliferation is required both to grow and to replace cells lost through apoptosis and attrition, yet in all but a few cells, differentiation must take place to prevent uncontrolled growth (cancer) and to provide essential functions. In this chapter, we will review the major signaling pathways underlying regulation of gene expression within the intestinal epithelium, based primarily on data from mouse models, as well as specific morphogens and transcription factor families that have a major role in regulating intestinal gene expression, including: the Hedgehog family, Forkhead Box (FOX) factors, Homeobox (HOX) genes, ParaHox genes, GATA transcription factors, canonical Wnt/β-catenin signaling, EPH/Ephrins, Sox9, BMP signaling, PTEN/PI3K, LKB1, K-RAS, Notch pathway, HNF and MATH1. We will also briefly highlight important emerging areas of gene regulation including microRNA and epigenetic regulation. PMID:21075346

  7. Nerve growth factor regulates gene expression by several distinct mechanisms

    SciTech Connect

    Cho, K.O.; Skarnes, W.C. ); Minsk, B.; Palmier, S. ); Jackson-Grusby, L.; Wagner, J.A. . Dept. of Biological Chemistry)

    1989-01-01

    To help elucidate the mechanisms by which nerve growth factor (NGF) regulates gene expression, the authors have identified and studied four genes (a-2, d-2, d-4, and d-5) that are positively regulated by NGF in PC12 cells, including one (d-2) which has previously been identified as a putative transcription factor (NGF I-A). Three of these genes, including d-2, were induced very rapidly at the transcriptional level, but the relative time courses of transcription and mRNA accumulation of each of these three genes were distinct. The fourth gene (d-4) displayed no apparent increase in transcription that corresponded to the increase in its mRNA, suggesting that NGF may regulate its expression at a posttranscriptional level. Thus NGF positively regulates gene expression by more than one mechanism. The study of the regulation of the expression of these and other NGF-inducible genes should provide valuable new information concerning how NGF and other growth factors cause neural differentiation.

  8. Stochastic models of gene expression and post-transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Pendar, Hodjat; Kulkarni, Rahul; Jia, Tao

    2011-10-01

    The intrinsic stochasticity of gene expression can give rise to phenotypic heterogeneity in a population of genetically identical cells. Correspondingly, there is considerable interest in understanding how different molecular mechanisms impact the 'noise' in gene expression. Of particular interest are post-transcriptional regulatory mechanisms involving genes called small RNAs, which control important processes such as development and cancer. We propose and analyze general stochastic models of gene expression and derive exact analytical expressions quantifying the noise in protein distributions [1]. Focusing on specific regulatory mechanisms, we analyze a general model for post-transcriptional regulation of stochastic gene expression [2]. The results obtained provide new insights into the role of post-transcriptional regulation in controlling the noise in gene expression. [4pt] [1] T. Jia and R. V. Kulkarni, Phys. Rev. Lett.,106, 058102 (2011) [0pt] [2] T. Jia and R. V. Kulkarni, Phys. Rev. Lett., 105, 018101 (2010)

  9. Identification of LytSR-regulated genes from Staphylococcus aureus.

    PubMed

    Brunskill, E W; Bayles, K W

    1996-10-01

    In this report, the characterization of a Staphylococcus aureus operon containing two LytSR-regulated genes, lrgA and lrgB, is described. Sequence and mutagenesis studies of these genes suggest that lrgA encodes a murein hydrolase exporter similar to bacteriophage holin proteins while lrgB may encode a protein having murein hydrolase activity. PMID:8824633

  10. Gene regulation: hacking the network on a sugar high.

    PubMed

    Ellis, Tom; Wang, Xiao; Collins, James J

    2008-04-11

    In a recent issue of Molecular Cell, Kaplan et al. (2008) determine the input functions for 19 E. coli sugar-utilization genes by using a two-dimensional high-throughput approach. The resulting input-function map reveals that gene network regulation follows non-Boolean, and often nonmonotonic, logic.

  11. Bassoon and piccolo regulate ubiquitination and link presynaptic molecular dynamics with activity-regulated gene expression.

    PubMed

    Ivanova, Daniela; Dirks, Anika; Fejtova, Anna

    2016-10-01

    Release of neurotransmitter is executed by complex multiprotein machinery, which is assembled around the presynaptic cytomatrix at the active zone. One well-established function of this proteinaceous scaffold is the spatial organization of synaptic vesicle cluster, the protein complexes that execute membrane fusion and compensatory endocytosis, and the transmembrane molecules important for alignment of pre- and postsynaptic structures. The presynaptic cytomatrix proteins function also in processes other than the formation of a static frame for assembly of the release apparatus and synaptic vesicle cycling. They actively contribute to the regulation of multiple steps in this process and are themselves an important subject of regulation during neuronal plasticity. We are only beginning to understand the mechanisms and signalling pathways controlling these regulations. They are mainly dependent on posttranslational modifications, including phosphorylation and small-molecules conjugation, such as ubiquitination. Ubiquitination of presynaptic proteins might lead to their degradation by proteasomes, but evidence is growing that this modification also affects their function independently of their degradation. Signalling from presynapse to nucleus, which works on a much slower time scale and more globally, emerged as an important mechanism for persistent usage-dependent and homeostatic neuronal plasticity. Recently, two new functions for the largest presynaptic scaffolding proteins bassoon and piccolo emerged. They were implied (1) in the regulation of specific protein ubiquitination and proteasome-mediated proteolysis that potentially contributes to short-term plasticity at the presynapse and (2) in the coupling of activity-induced molecular rearrangements at the presynapse with reprogramming of expression of neuronal activity-regulated genes.

  12. Oncodevelopmental and hormonal regulation of alpha 1-fetoprotein gene expression.

    PubMed

    Belanger, L; Baril, P; Guertin, M; Gingras, M C; Gourdeau, H; Anderson, A; Hamel, D; Boucher, J M

    1983-01-01

    The main features of the oncodevelopmental biology of alpha 1-fetoprotein (AFP) are reviewed. Progress made in the molecular biology of AFP gene regulation is discussed and we present our recent data on the mechanisms of AFP suppression by glucocorticoid hormones. The relationship between AFP gene transcription and cell replication is examined, and it is suggested that the degree of methylation of the AFP gene (or of co-methylated regulatory DNA sequences) conditions its response to hormones.

  13. Role of NRSF/REST in the regulation of cardiac gene expression and function.

    PubMed

    Kuwahara, Koichiro

    2013-01-01

    Alterations in the cardiac gene program affect both cardiac structure and function, and play a key role in the progression of pathological cardiac remodeling and heart failure. For instance, reactivation of fetal cardiac genes in adults is a consistent feature of cardiac hypertrophy and heart failure. Investigation of the transcriptional regulation of cardiac genes revealed a transcriptional repressor, neuron-restrictive silencer factor (NRSF), also called repressor element-1 silencing factor (REST), to be an important regulator of multiple fetal cardiac genes. Inhibition of NRSF in the heart leads to cardiac dysfunction and sudden arrhythmic death accompanied by re-expression of various fetal genes, including those encoding fetal ion channels, such as the HCN channels and T-type Ca(2+) channels. These findings shed light on the crucial regulatory function of NRSF in the heart and its importance for maintaining normal cardiac integrity. PMID:24126098

  14. Dietary n-3 PUFA affect lipid metabolism and tissue function-related genes in bovine muscle.

    PubMed

    Hiller, Beate; Hocquette, Jean-Francois; Cassar-Malek, Isabelle; Nuernberg, Gerd; Nuernberg, Karin

    2012-09-01

    Gene expression profiles of bovine longissimus muscle as affected by dietary n-3 v. n-6 fatty acid (FA) intervention were analysed by microarray pre-screening of >3000 muscle biology/meat quality-related genes as well as subsequent quantitative RT-PCR gene expression validation of genes encoding lipogenesis-related transcription factors (CCAAT/enhancer-binding protein β, sterol regulatory element-binding transcription factor 1), key-lipogenic enzymes (acetyl-CoA carboxylase α (ACACA), fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD)), lipid storage-associated proteins (adipose differentiation-related protein (ADFP)) and muscle biology-related proteins (cholinergic receptor, nicotinic, α1, farnesyl diphosphate farnesyl transferase 1, sema domain 3C (SEMA3C)). Down-regulation of ACACA (P = 0·00), FASN (P = 0·09) and SCD (P = 0·02) gene expression upon an n-3 FA intervention directly corresponded to reduced SFA, MUFA and total FA concentrations in longissimus muscle, whereas changes in ADFP (P = 0·00) and SEMA3C (P = 0·05) gene expression indicated improved muscle function via enhanced energy metabolism, vasculogenesis, innervation and mediator synthesis. The present study highlights the significance of dietary n-3 FA intervention on muscle development, maintenance and function, which are relevant for meat quality tailoring of bovine tissues and modulating animal production-relevant physiological processes.

  15. Pristinamycin-inducible gene regulation in mycobacteria.

    PubMed

    Forti, Francesca; Crosta, Andrea; Ghisotti, Daniela

    2009-03-25

    In this work the Pip-inducible system, already used in eukaryotes, was tested in mycobacteria. This system is based on the Streptomyces coelicolor Pip repressor, the Streptomyces pristinaespiralis ptr promoter and the inducer pristinamycin I. By cloning in an integrative plasmid the ptr promoter upstream of the lacZ reporter gene and the pip gene under the control of a constitutive mycobacterial promoter, we demonstrated that the ptr promoter activity increased up to 50-fold in Mycobacterium smegmatis and up to 400-fold in Mycobacterium tuberculosis, in dependence on pristinamycin I concentration, and that the promoter was fully repressed in the absence of the inducer. Three mycobacterial genes were cloned under pptr-Pip control, both in sense and antisense direction; both proteins and antisense RNAs could be over-expressed, the antisenses causing a partial reduction of the amount of the targeted proteins. This system was used to obtain two M. tuberculosis conditional mutants in the fadD32 and pknB genes: the mutant strains grew only in the presence of the inducer pristinamycin I. Thus it showed to be an effective inducible system in mycobacteria. PMID:19428723

  16. TBR1 regulates autism risk genes in the developing neocortex.

    PubMed

    Notwell, James H; Heavner, Whitney E; Darbandi, Siavash Fazel; Katzman, Sol; McKenna, William L; Ortiz-Londono, Christian F; Tastad, David; Eckler, Matthew J; Rubenstein, John L R; McConnell, Susan K; Chen, Bin; Bejerano, Gill

    2016-08-01

    Exome sequencing studies have identified multiple genes harboring de novo loss-of-function (LoF) variants in individuals with autism spectrum disorders (ASD), including TBR1, a master regulator of cortical development. We performed ChIP-seq for TBR1 during mouse cortical neurogenesis and show that TBR1-bound regions are enriched adjacent to ASD genes. ASD genes were also enriched among genes that are differentially expressed in Tbr1 knockouts, which together with the ChIP-seq data, suggests direct transcriptional regulation. Of the nine ASD genes examined, seven were misexpressed in the cortices of Tbr1 knockout mice, including six with increased expression in the deep cortical layers. ASD genes with adjacent cortical TBR1 ChIP-seq peaks also showed unusually low levels of LoF mutations in a reference human population and among Icelanders. We then leveraged TBR1 binding to identify an appealing subset of candidate ASD genes. Our findings highlight a TBR1-regulated network of ASD genes in the developing neocortex that are relatively intolerant to LoF mutations, indicating that these genes may play critical roles in normal cortical development. PMID:27325115

  17. l-Ornithine affects peripheral clock gene expression in mice

    PubMed Central

    Fukuda, Takafumi; Haraguchi, Atsushi; Kuwahara, Mari; Nakamura, Kaai; Hamaguchi, Yutaro; Ikeda, Yuko; Ishida, Yuko; Wang, Guanying; Shirakawa, Chise; Tanihata, Yoko; Ohara, Kazuaki; Shibata, Shigenobu

    2016-01-01

    The peripheral circadian clock is entrained by factors in the external environment such as scheduled feeding, exercise, and mental and physical stresses. In addition, recent studies in mice demonstrated that some food components have the potential to control the peripheral circadian clock during scheduled feeding, although information about these components remains limited. l-Ornithine is a type of non-protein amino acid that is present in foods and has been reported to have various physiological functions. In human trials, for example, l-ornithine intake improved a subjective index of sleep quality. Here we demonstrate, using an in vivo monitoring system, that repeated oral administration of l-ornithine at an early inactive period in mice induced a phase advance in the rhythm of PER2 expression. By contrast, l-ornithine administration to mouse embryonic fibroblasts did not affect the expression of PER2, indicating that l-ornithine indirectly alters the phase of PER2. l-Ornithine also increased plasma levels of insulin, glucose and glucagon-like peptide-1 alongside mPer2 expression, suggesting that it exerts its effects probably via insulin secretion. Collectively, these findings demonstrate that l-ornithine affects peripheral clock gene expression and may expand the possibilities of L-ornithine as a health food. PMID:27703199

  18. Expression Regulation of Polycistronic lee3 Genes of Enterohaemorrhagic Escherichia coli

    PubMed Central

    Sun, Wei-Sheng W.; Chen, Jenn-Wei; Wu, Yi-Chih; Tsai, Hsing-Yuan; Kuo, Yu-Liang; Syu, Wan-Jr

    2016-01-01

    Enterohaemorrhagic Escherichia coli O157:H7 (EHEC) carries a pathogenic island LEE that is consisted mainly of five polycistronic operons. In the lee3 operon, mpc is the first gene and has been reported to down regulate the type-3 secretion system of EHEC when its gene product is over-expressed. Furthermore, mpc has been suggested to have a regulation function via translation but the mechanism remains unclear. To clarify this hypothesis, we dissected the polycistron and examined the translated products. We conclude that translation of mpc detrimentally governs the translation of the second gene, escV, which in turn affects the translation of the third gene, escN. Then sequentially, escN affects the expression of the downstream genes. Furthermore, we located a critical cis element within the mpc open-reading frame that plays a negative role in the translation-dependent regulation of lee3. Using qRT-PCR, we found that the amount of mpc RNA transcript present in EHEC was relatively limited when compared to any other genes within lee3. Taken together, when the transcription of LEE is activated, expression of mpc is tightly controlled by a restriction of the RNA transcript of mpc, translation of which is then critical for the efficient production of the operon’s downstream gene products. PMID:27182989

  19. Cost benefit theory and optimal design of gene regulation functions

    NASA Astrophysics Data System (ADS)

    Kalisky, Tomer; Dekel, Erez; Alon, Uri

    2007-12-01

    Cells respond to the environment by regulating the expression of genes according to environmental signals. The relation between the input signal level and the expression of the gene is called the gene regulation function. It is of interest to understand the shape of a gene regulation function in terms of the environment in which it has evolved and the basic constraints of biological systems. Here we address this by presenting a cost-benefit theory for gene regulation functions that takes into account temporally varying inputs in the environment and stochastic noise in the biological components. We apply this theory to the well-studied lac operon of E. coli. The present theory explains the shape of this regulation function in terms of temporal variation of the input signals, and of minimizing the deleterious effect of cell-cell variability in regulatory protein levels. We also apply the theory to understand the evolutionary tradeoffs in setting the number of regulatory proteins and for selection of feed-forward loops in genetic circuits. The present cost-benefit theory can be used to understand the shape of other gene regulatory functions in terms of environment and noise constraints.

  20. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    SciTech Connect

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  1. Nutritional regulation of genome-wide association obesity genes in a tissue-dependent manner

    PubMed Central

    2012-01-01

    Background Genome-wide association studies (GWAS) have recently identified several new genetic variants associated with obesity. The majority of the variants are within introns or between genes, suggesting they affect gene expression, although it is not clear which of the nearby genes they affect. Understanding the regulation of these genes will be key to determining the role of these variants in the development of obesity and will provide support for a role of these genes in the development of obesity. Methods We examined the expression of 19 GWAS obesity genes in the brain and specifically the hypothalamus, adipose tissue and liver of mice by real-time quantitative PCR. To determine whether these genes are nutritionally regulated, as may be expected for genes affecting obesity, we compared tissues from fasting and non-fasting animals and tissues from mice consuming a high fat high sucrose diet in comparison to standard rodent chow. Results We found complex, tissue-dependent patterns of nutritional regulation of most of these genes. For example, Bat2 expression was increased ~10-fold in the brain of fed mice but was lower or unchanged in the hypothalamus and adipose tissue. Kctd15 expression was upregulated in the hypothalamus, brain and adipose tissue of fed mice and downregulated by high fat feeding in liver, adipose tissue and the hypothalamus but not the remainder of the brain. Sh2b1 expression in the brain and Faim2 expression in adipose tissue were specifically increased >20-fold in fed mice. Tmem18 expression in adipose tissue but not the brain was reduced 80% by high fat feeding. Few changes in the expression of these genes were observed in liver. Conclusions These data show nutritional regulation of nearly all these GWAS obesity genes, particularly in the brain and adipose tissue, and provide support for their role in the development of obesity. The complex patterns of nutritional and tissue-dependent regulation also highlight the difficulty that may be

  2. Post-Transcriptional Regulation of Gene Expression in Yersinia Species

    PubMed Central

    Schiano, Chelsea A.; Lathem, Wyndham W.

    2012-01-01

    Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host. PMID:23162797

  3. Mechanism of Gene Regulation by a Staphylococcus aureus Toxin

    PubMed Central

    Joo, Hwang-Soo; Chatterjee, Som S.; Villaruz, Amer E.; Dickey, Seth W.; Tan, Vee Y.; Chen, Yan; Sturdevant, Daniel E.; Ricklefs, Stacy M.

    2016-01-01

    ABSTRACT The virulence of many bacterial pathogens, including the important human pathogen Staphylococcus aureus, depends on the secretion of frequently large amounts of toxins. Toxin production involves the need for the bacteria to make physiological adjustments for energy conservation. While toxins are primarily targets of gene regulation, such changes may be accomplished by regulatory functions of the toxins themselves. However, mechanisms by which toxins regulate gene expression have remained poorly understood. We show here that the staphylococcal phenol-soluble modulin (PSM) toxins have gene regulatory functions that, in particular, include inducing expression of their own transport system by direct interference with a GntR-type repressor protein. This capacity was most pronounced in PSMs with low cytolytic capacity, demonstrating functional specification among closely related members of that toxin family during evolution. Our study presents a molecular mechanism of gene regulation by a bacterial toxin that adapts bacterial physiology to enhanced toxin production. PMID:27795396

  4. Intrinsic limits to gene regulation by global crosstalk

    PubMed Central

    Friedlander, Tamar; Prizak, Roshan; Guet, Călin C.; Barton, Nicholas H.; Tkačik, Gašper

    2016-01-01

    Gene regulation relies on the specificity of transcription factor (TF)–DNA interactions. Limited specificity may lead to crosstalk: a regulatory state in which a gene is either incorrectly activated due to noncognate TF–DNA interactions or remains erroneously inactive. As each TF can have numerous interactions with noncognate cis-regulatory elements, crosstalk is inherently a global problem, yet has previously not been studied as such. We construct a theoretical framework to analyse the effects of global crosstalk on gene regulation. We find that crosstalk presents a significant challenge for organisms with low-specificity TFs, such as metazoans. Crosstalk is not easily mitigated by known regulatory schemes acting at equilibrium, including variants of cooperativity and combinatorial regulation. Our results suggest that crosstalk imposes a previously unexplored global constraint on the functioning and evolution of regulatory networks, which is qualitatively distinct from the known constraints that act at the level of individual gene regulatory elements. PMID:27489144

  5. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  6. Sperm is epigenetically programmed to regulate gene transcription in embryos.

    PubMed

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M; Zegerman, Philip; Bradshaw, Charles R; Peters, Antoine H F M; Gurdon, John B; Jullien, Jerome

    2016-08-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  7. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  8. Modeling Gene Regulation in Liver Hepatocellular Carcinoma with Random Forests

    PubMed Central

    2016-01-01

    Liver hepatocellular carcinoma (HCC) remains a leading cause of cancer-related death. Poor understanding of the mechanisms underlying HCC prevents early detection and leads to high mortality. We developed a random forest model that incorporates copy-number variation, DNA methylation, transcription factor, and microRNA binding information as features to predict gene expression in HCC. Our model achieved a highly significant correlation between predicted and measured expression of held-out genes. Furthermore, we identified potential regulators of gene expression in HCC. Many of these regulators have been previously found to be associated with cancer and are differentially expressed in HCC. We also evaluated our predicted target sets for these regulators by making comparison with experimental results. Lastly, we found that the transcription factor E2F6, one of the candidate regulators inferred by our model, is predictive of survival rate in HCC. Results of this study will provide directions for future prospective studies in HCC.

  9. ALDH isozymes downregulation affects cell growth, cell motility and gene expression in lung cancer cells

    PubMed Central

    Moreb, Jan S; Baker, Henry V; Chang, Lung-Ji; Amaya, Maria; Lopez, M Cecilia; Ostmark, Blanca; Chou, Wayne

    2008-01-01

    Background Aldehyde dehydrogenase isozymes ALDH1A1 and ALDH3A1 are highly expressed in non small cell lung cancer. Neither the mechanisms nor the biologic significance for such over expression have been studied. Methods We have employed oligonucleotide microarrays to analyze changes in gene profiles in A549 lung cancer cell line in which ALDH activity was reduced by up to 95% using lentiviral mediated expression of siRNA against both isozymes (Lenti 1+3). Stringent analysis methods were used to identify gene expression patterns that are specific to the knock down of ALDH activity and significantly different in comparison to wild type A549 cells (WT) or cells similarly transduced with green fluorescent protein (GFP) siRNA. Results We confirmed significant and specific down regulation of ALDH1A1 and ALDH3A1 in Lenti 1+3 cells and in comparison to 12 other ALDH genes detected. The results of the microarray analysis were validated by real time RT-PCR on RNA obtained from Lenti 1+3 or WT cells treated with ALDH activity inhibitors. Detailed functional analysis was performed on 101 genes that were significantly different (P < 0.001) and their expression changed by ≥ 2 folds in the Lenti 1+3 group versus the control groups. There were 75 down regulated and 26 up regulated genes. Protein binding, organ development, signal transduction, transcription, lipid metabolism, and cell migration and adhesion were among the most affected pathways. Conclusion These molecular effects of the ALDH knock-down are associated with in vitro functional changes in the proliferation and motility of these cells and demonstrate the significance of ALDH enzymes in cell homeostasis with a potentially significant impact on the treatment of lung cancer. PMID:19025616

  10. DNA Methylation is Developmentally Regulated for Genes Essential for Cardiogenesis

    PubMed Central

    Chamberlain, Alyssa A.; Lin, Mingyan; Lister, Rolanda L.; Maslov, Alex A.; Wang, Yidong; Suzuki, Masako; Wu, Bingruo; Greally, John M.; Zheng, Deyou; Zhou, Bin

    2014-01-01

    Background DNA methylation is a major epigenetic mechanism altering gene expression in development and disease. However, its role in the regulation of gene expression during heart development is incompletely understood. The aim of this study is to reveal DNA methylation in mouse embryonic hearts and its role in regulating gene expression during heart development. Methods and Results We performed the genome‐wide DNA methylation profiling of mouse embryonic hearts using methyl‐sensitive, tiny fragment enrichment/massively parallel sequencing to determine methylation levels at ACGT sites. The results showed that while global methylation of 1.64 million ACGT sites in developing hearts remains stable between embryonic day (E) 11.5 and E14.5, a small fraction (2901) of them exhibit differential methylation. Gene Ontology analysis revealed that these sites are enriched at genes involved in heart development. Quantitative real‐time PCR analysis of 350 genes with differential DNA methylation showed that the expression of 181 genes is developmentally regulated, and 79 genes have correlative changes between methylation and expression, including hyaluronan synthase 2 (Has2). Required for heart valve formation, Has2 expression in the developing heart valves is downregulated at E14.5, accompanied with increased DNA methylation in its enhancer. Genetic knockout further showed that the downregulation of Has2 expression is dependent on DNA methyltransferase 3b, which is co‐expressed with Has2 in the forming heart valve region, indicating that the DNA methylation change may contribute to the Has2 enhancer's regulating function. Conclusions DNA methylation is developmentally regulated for genes essential to heart development, and abnormal DNA methylation may contribute to congenital heart disease. PMID:24947998

  11. [Novel phosphate regulating genes and osteoporosis].

    PubMed

    Miyamoto, Kenichi; Ito, Mikiko; Segawa, Hiroko

    2005-05-01

    The hormones currently believe to influence inorganic phosphate (Pi) metabolism are parathyroid hormone (PTH) and the active metabolite to vitamin D. A new class of phosphate-regulating factors, collectively known as the phosphatonins have been shown to be associated with the hypophosphatemic diseases. The reabsorption of Pi in the kidney is a major determinant of the plasma Pi level. Reabsorption is largely regulated by the type II a sodium-dependent Pi cotransporter (NPT2a) that is expressed in renal proximal tubular cells. Phosphatonins cause Pi wasting by controlling the amount of NPT2a on the apical surface of the proximal tubular cell. A recent finding indicates that mutations in NPT2a can contribute to nephrolithiasis and osteoporosis in humans and suggests that changes in NPT2a levels may also cause other human disease. We discuss the roles of phosphatonins and NPT2a in bone formation. PMID:15876740

  12. Spatial organization of genes as a component of regulated expression

    PubMed Central

    Pai, Dave A.

    2009-01-01

    The DNA of living cells is highly compacted. Inherent in this spatial constraint is the need for cells to organize individual genetic loci so as to facilitate orderly retrieval of information. Complex genetic regulatory mechanisms are crucial to all organisms, and it is becoming increasingly evident that spatial organization of genes is one very important mode of regulation for many groups of genes. In eukaryotic nuclei, it appears not only that DNA is organized in three-dimensional space but also that this organization is dynamic and interactive with the transcriptional state of the genes. Spatial organization occurs throughout evolution and with genes transcribed by all classes of RNA polymerases in all eukaryotic nuclei, from yeast to human. There is an increasing body of work examining the ways in which this organization and consequent regulation are accomplished. In this review, we discuss the diverse strategies that cells use to preferentially localize various classes of genes. PMID:19727792

  13. Identification of NDRG1-regulated genes associated with invasive potential in cervical and ovarian cancer cells

    SciTech Connect

    Zhao, Gang; Chen, Jiawei; Deng, Yanqiu; Gao, Feng; Zhu, Jiwei; Feng, Zhenzhong; Lv, Xiuhong; Zhao, Zheng

    2011-04-29

    Highlights: {yields} NDRG1 was knockdown in cervical and ovarian cancer cell lines by shRNA technology. {yields} NDRG1 knockdown resulted in increased cell invasion activities. {yields} Ninety-six common deregulated genes in both cell lines were identified by cDNA microarray. {yields} Eleven common NDRG1-regulated genes might enhance cell invasive activity. {yields} Regulation of invasion by NDRG1 is an indirect and complicated process. -- Abstract: N-myc downstream regulated gene 1 (NDRG1) is an important gene regulating tumor invasion. In this study, shRNA technology was used to suppress NDRG1 expression in CaSki (a cervical cancer cell line) and HO-8910PM (an ovarian cancer cell line). In vitro assays showed that NDRG1 knockdown enhanced tumor cell adhesion, migration and invasion activities without affecting cell proliferation. cDNA microarray analysis revealed 96 deregulated genes with more than 2-fold changes in both cell lines after NDRG1 knockdown. Ten common upregulated genes (LPXN, DDR2, COL6A1, IL6, IL8, FYN, PTP4A3, PAPPA, ETV5 and CYGB) and one common downregulated gene (CLCA2) were considered to enhance tumor cell invasive activity. BisoGenet network analysis indicated that NDRG1 regulated these invasion effector genes/proteins in an indirect manner. Moreover, NDRG1 knockdown also reduced pro-invasion genes expression such as MMP7, TMPRSS4 and CTSK. These results suggest that regulation of invasion and metastasis by NDRG1 is a highly complicated process.

  14. Gravity regulated genes in Arabidopsis thaliana (GENARA experiment)

    NASA Astrophysics Data System (ADS)

    Boucheron-Dubuisson, Elodie; Carnero-D&íaz, Eugénie; Medina, Francisco Javier; Gasset, Gilbert; Pereda-Loth, Veronica; Graziana, Annick; Mazars, Christian; Le Disquet, Isabelle; Eche, Brigitte; Grat, Sabine; Gauquelin-Koch, Guillemette

    2012-07-01

    In higher plants, post-embryonic development is possible through the expression of a set of genes constituting the morphogenetic program that contribute to the production of tissues and organs during the whole plant life cycle. Plant development is mainly controlled by internal factors such as phytohormones, as well as by environmental factors, among which gravity plays a key role (gravi-morphogenetic program). The GENARA space experiment has been designed with the goal of contributing to a better understanding of this gravi-morphogenetic program through the identification and characterization of some gravity regulated proteins (GR proteins) by using quantitative proteomic methods, and through the study of the impact of plant hormones on the expression of this program. Among plant hormones, auxin is the major regulator of organogenesis. In fact, it affects numerous plant developmental processes, e.g. cell division and elongation, autumnal loss of leaves, and the formation of buds, roots, flowers and fruits. Furthermore, it also plays a key role in the mechanisms of different tropisms (including gravitropism) that modulate fundamental features of plant growth. The expression of significant genes involved in auxin transport and in auxin signal perception in root cells is being studied in space-grown seedlings and compared with the corresponding ground controls. This experiment was scheduled to be performed in The European Modular Cultivation System (EMCS), a new facility for plant cultivation and Plant Molecular Biology studies, at ISS. However only one aspect of this experiment was flown and concerns the qualitative and quantitative changes in membrane proteins supposed to be mainly associated with cell signaling and has been called GENARA A. The second part dealing with the function of auxin in the gravi-morphogenetic program and the alterations induced by microgravity will be studied through mutants affected on biosynthesis, transport or perception of auxin in a

  15. Divergence of gene regulation through chromosomal rearrangements

    PubMed Central

    2010-01-01

    Background The molecular mechanisms that modify genome structures to give birth and death to alleles are still not well understood. To investigate the causative chromosomal rearrangements, we took advantage of the allelic diversity of the duplicated p1 and p2 genes in maize. Both genes encode a transcription factor involved in maysin synthesis, which confers resistance to corn earworm. However, p1 also controls accumulation of reddish pigments in floral tissues and has therefore acquired a new function after gene duplication. p1 alleles vary in their tissue-specific expression, which is indicated in their allele designation: the first suffix refers to red or white pericarp pigmentation and the second to red or white glume pigmentation. Results Comparing chromosomal regions comprising p1-ww[4Co63], P1-rw1077 and P1-rr4B2 alleles with that of the reference genome, P1-wr[B73], enabled us to reconstruct additive events of transposition, chromosome breaks and repairs, and recombination that resulted in phenotypic variation and chimeric regulatory signals. The p1-ww[4Co63] null allele is probably derived from P1-wr[B73] by unequal crossover between large flanking sequences. A transposon insertion in a P1-wr-like allele and NHEJ (non-homologous end-joining) could have resulted in the formation of the P1-rw1077 allele. A second NHEJ event, followed by unequal crossover, probably led to the duplication of an enhancer region, creating the P1-rr4B2 allele. Moreover, a rather dynamic picture emerged in the use of polyadenylation signals by different p1 alleles. Interestingly, p1 alleles can be placed on both sides of a large retrotransposon cluster through recombination, while functional p2 alleles have only been found proximal to the cluster. Conclusions Allelic diversity of the p locus exemplifies how gene duplications promote phenotypic variability through composite regulatory signals. Transposition events increase the level of genomic complexity based not only on

  16. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  17. The Tzs protein and exogenous cytokinin affect virulence gene expression and bacterial growth of Agrobacterium tumefaciens.

    PubMed

    Hwang, Hau-Hsuan; Yang, Fong-Jhih; Cheng, Tun-Fang; Chen, Yi-Chun; Lee, Ying-Ling; Tsai, Yun-Long; Lai, Erh-Min

    2013-09-01

    The soil phytopathogen Agrobacterium tumefaciens causes crown gall disease in a wide range of plant species. The neoplastic growth at the infection sites is caused by transferring, integrating, and expressing transfer DNA (T-DNA) from A. tumefaciens into plant cells. A trans-zeatin synthesizing (tzs) gene is located in the nopaline-type tumor-inducing plasmid and causes trans-zeatin production in A. tumefaciens. Similar to known virulence (Vir) proteins that are induced by the vir gene inducer acetosyringone (AS) at acidic pH 5.5, Tzs protein is highly induced by AS under this growth condition but also constitutively expressed and moderately upregulated by AS at neutral pH 7.0. We found that the promoter activities and protein levels of several AS-induced vir genes increased in the tzs deletion mutant, a mutant with decreased tumorigenesis and transient transformation efficiencies, in Arabidopsis roots. During AS induction and infection of Arabidopsis roots, the tzs deletion mutant conferred impaired growth, which could be rescued by genetic complementation and supplementing exogenous cytokinin. Exogenous cytokinin also repressed vir promoter activities and Vir protein accumulation in both the wild-type and tzs mutant bacteria with AS induction. Thus, the tzs gene or its product, cytokinin, may be involved in regulating AS-induced vir gene expression and, therefore, affect bacterial growth and virulence during A. tumefaciens infection. PMID:23593941

  18. The Tzs protein and exogenous cytokinin affect virulence gene expression and bacterial growth of Agrobacterium tumefaciens.

    PubMed

    Hwang, Hau-Hsuan; Yang, Fong-Jhih; Cheng, Tun-Fang; Chen, Yi-Chun; Lee, Ying-Ling; Tsai, Yun-Long; Lai, Erh-Min

    2013-09-01

    The soil phytopathogen Agrobacterium tumefaciens causes crown gall disease in a wide range of plant species. The neoplastic growth at the infection sites is caused by transferring, integrating, and expressing transfer DNA (T-DNA) from A. tumefaciens into plant cells. A trans-zeatin synthesizing (tzs) gene is located in the nopaline-type tumor-inducing plasmid and causes trans-zeatin production in A. tumefaciens. Similar to known virulence (Vir) proteins that are induced by the vir gene inducer acetosyringone (AS) at acidic pH 5.5, Tzs protein is highly induced by AS under this growth condition but also constitutively expressed and moderately upregulated by AS at neutral pH 7.0. We found that the promoter activities and protein levels of several AS-induced vir genes increased in the tzs deletion mutant, a mutant with decreased tumorigenesis and transient transformation efficiencies, in Arabidopsis roots. During AS induction and infection of Arabidopsis roots, the tzs deletion mutant conferred impaired growth, which could be rescued by genetic complementation and supplementing exogenous cytokinin. Exogenous cytokinin also repressed vir promoter activities and Vir protein accumulation in both the wild-type and tzs mutant bacteria with AS induction. Thus, the tzs gene or its product, cytokinin, may be involved in regulating AS-induced vir gene expression and, therefore, affect bacterial growth and virulence during A. tumefaciens infection.

  19. Pleiotropic Genes Affecting Carcass Traits in Bos indicus (Nellore) Cattle Are Modulators of Growth.

    PubMed

    G T Pereira, Anirene; Utsunomiya, Yuri T; Milanesi, Marco; Torrecilha, Rafaela B P; Carmo, Adriana S; Neves, Haroldo H R; Carvalheiro, Roberto; Ajmone-Marsan, Paolo; Sonstegard, Tad S; Sölkner, Johann; Contreras-Castillo, Carmen J; Garcia, José F

    2016-01-01

    Two complementary methods, namely Multi-Trait Meta-Analysis and Versatile Gene-Based Test for Genome-wide Association Studies (VEGAS), were used to identify putative pleiotropic genes affecting carcass traits in Bos indicus (Nellore) cattle. The genotypic data comprised over 777,000 single-nucleotide polymorphism markers scored in 995 bulls, and the phenotypic data included deregressed breeding values (dEBV) for weight measurements at birth, weaning and yearling, as well visual scores taken at weaning and yearling for carcass finishing precocity, conformation and muscling. Both analyses pointed to the pleomorphic adenoma gene 1 (PLAG1) as a major pleiotropic gene. VEGAS analysis revealed 224 additional candidates. From these, 57 participated, together with PLAG1, in a network involved in the modulation of the function and expression of IGF1 (insulin like growth factor 1), IGF2 (insulin like growth factor 2), GH1 (growth hormone 1), IGF1R (insulin like growth factor 1 receptor) and GHR (growth hormone receptor), suggesting that those pleiotropic genes operate as satellite regulators of the growth pathway. PMID:27410030

  20. Melatonin enhances DNA repair capacity possibly by affecting genes involved in DNA damage responsive pathways

    PubMed Central

    2013-01-01

    Background Melatonin, a hormone-like substance involved in the regulation of the circadian rhythm, has been demonstrated to protect cells against oxidative DNA damage and to inhibit tumorigenesis. Results In the current study, we investigated the effect of melatonin on DNA strand breaks using the alkaline DNA comet assay in breast cancer (MCF-7) and colon cancer (HCT-15) cell lines. Our results demonstrated that cells pretreated with melatonin had significantly shorter Olive tail moments compared to non-melatonin treated cells upon mutagen (methyl methanesulfonate, MMS) exposure, indicating an increased DNA repair capacity after melatonin treatment. We further examined the genome-wide gene expression in melatonin pretreated MCF-7 cells upon carcinogen exposure and detected altered expression of many genes involved in multiple DNA damage responsive pathways. Genes exhibiting altered expression were further analyzed for functional interrelatedness using network- and pathway-based bioinformatics analysis. The top functional network was defined as having relevance for “DNA Replication, Recombination, and Repair, Gene Expression, [and] Cancer”. Conclusions These findings suggest that melatonin may enhance DNA repair capacity by affecting several key genes involved in DNA damage responsive pathways. PMID:23294620

  1. Pleiotropic Genes Affecting Carcass Traits in Bos indicus (Nellore) Cattle Are Modulators of Growth

    PubMed Central

    Milanesi, Marco; Torrecilha, Rafaela B. P.; Carmo, Adriana S.; Neves, Haroldo H. R.; Carvalheiro, Roberto; Ajmone-Marsan, Paolo; Sonstegard, Tad S.; Sölkner, Johann; Contreras-Castillo, Carmen J.; Garcia, José F.

    2016-01-01

    Two complementary methods, namely Multi-Trait Meta-Analysis and Versatile Gene-Based Test for Genome-wide Association Studies (VEGAS), were used to identify putative pleiotropic genes affecting carcass traits in Bos indicus (Nellore) cattle. The genotypic data comprised over 777,000 single-nucleotide polymorphism markers scored in 995 bulls, and the phenotypic data included deregressed breeding values (dEBV) for weight measurements at birth, weaning and yearling, as well visual scores taken at weaning and yearling for carcass finishing precocity, conformation and muscling. Both analyses pointed to the pleomorphic adenoma gene 1 (PLAG1) as a major pleiotropic gene. VEGAS analysis revealed 224 additional candidates. From these, 57 participated, together with PLAG1, in a network involved in the modulation of the function and expression of IGF1 (insulin like growth factor 1), IGF2 (insulin like growth factor 2), GH1 (growth hormone 1), IGF1R (insulin like growth factor 1 receptor) and GHR (growth hormone receptor), suggesting that those pleiotropic genes operate as satellite regulators of the growth pathway. PMID:27410030

  2. Identification of the NAC1-regulated genes in ovarian cancer.

    PubMed

    Gao, Min; Wu, Ren-Chin; Herlinger, Alice L; Yap, Kailee; Kim, Jung-Won; Wang, Tian-Li; Shih, Ie-Ming

    2014-01-01

    Nucleus accumbens-associated protein 1 (NAC1), encoded by the NACC1 gene, is a transcription co-regulator that plays a multifaceted role in promoting tumorigenesis. However, the NAC1-regulated transcriptome has not been comprehensively defined. In this study, we compared the global gene expression profiles of NAC1-overexpressing SKOV3 ovarian cancer cells and NAC1-knockdown SKOV3 cells. We found that NAC1 knockdown was associated with up-regulation of apoptotic genes and down-regulation of genes involved in cell movement, proliferation, Notch signaling, and epithelial-mesenchymal transition. Among NAC1-regulated genes, FOXQ1 was further characterized because it is involved in cell motility and epithelial-mesenchymal transition. NAC1 knockdown decreased FOXQ1 expression and promoter activity. Similarly, inactivation of NAC1 by expression of a dominant-negative construct of NAC1 suppressed FOXQ1 expression. Ectopic expression of NAC1 in NACC1 null cells induced FOXQ1 expression. NAC1 knockdown resulted in decreased cell motility and invasion, whereas constitutive expression of FOXQ1 rescued motility in cells after NAC1 silencing. Moreover, in silico analysis revealed a significant co-up-regulation of NAC1 and FOXQ1 in ovarian carcinoma tissues. On the basis of transcription profiling, we report a group of NAC1-regulated genes that may participate in multiple cancer-related pathways. We further demonstrate that NAC1 is essential and sufficient for activation of FOXQ1 transcription and that the role of NAC1 in cell motility is mediated, at least in part, by FOXQ1.

  3. Oncogene regulation of tumor suppressor genes in tumorigenesis.

    PubMed

    Sung, Jimmy; Turner, Joel; McCarthy, Susan; Enkemann, Steve; Li, Chan Gong; Yan, Perally; Huang, Timothy; Yeatman, Timothy J

    2005-02-01

    We attempted to demonstrate whether there is an epigenetic link between oncogenes and tumor suppression genes in tumorigenesis. We designed a high throughput model to identify a candidate group of tumor suppressor genes potentially regulated by oncogenes. Gene expression profiling of mock-transfected versus v-src-transfected 3Y1 rat fibroblasts identified significant overexpression of DNA methyltransferase 1, the enzyme responsible for aberrant genome methylation, in v-src-transfected fibroblasts. Secondary microarray analyses identified a number of candidate tumor suppressor genes that were down-regulated by v-src but were also re-expressed following treatment with 5-aza-2'-deoxycytidine, a potent demethylating agent. This candidate group included both tumor suppressor genes that are known to be silenced by DNA hypermethylation and those that have not been previously identified with promoter hypermethylation. To further validate our model, we identified tsg, a tumor suppressor gene that was shown to be down-regulated by v-src and found to harbor dense promoter hypermethylation. Our model demonstrates a cooperative relationship between oncogenes and tumor suppressor genes mediated through promoter hypermethylation.

  4. All-optical regulation of gene expression in targeted cells

    NASA Astrophysics Data System (ADS)

    Wang, Yisen; He, Hao; Li, Shiyang; Liu, Dayong; Lan, Bei; Hu, Minglie; Cao, Youjia; Wang, Chingyue

    2014-06-01

    Controllable gene expression is always a challenge and of great significance to biomedical research and clinical applications. Recently, various approaches based on extra-engineered light-sensitive proteins have been developed to provide optogenetic actuators for gene expression. Complicated biomedical techniques including exogenous genes engineering, transfection, and material delivery are needed. Here we present an all-optical method to regulate gene expression in targeted cells. Intrinsic or exogenous genes can be activated by a Ca2+-sensitive transcription factor nuclear factor of activated T cells (NFAT) driven by a short flash of femtosecond-laser irradiation. When applied to mesenchymal stem cells, expression of a differentiation regulator Osterix can be activated by this method to potentially induce differentiation of them. A laser-induced ``Ca2+-comb'' (LiCCo) by multi-time laser exposure is further developed to enhance gene expression efficiency. This noninvasive method hence provides an encouraging advance of gene expression regulation, with promising potential of applying in cell biology and stem-cell science.

  5. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator.

    PubMed

    Wood, Ashley M; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C; Jones, Keith C; Corces, Victor G

    2011-10-01

    Insulators are multiprotein-DNA complexes thought to affect gene expression by mediating inter- and intrachromosomal interactions. Drosophila insulators contain specific DNA-binding proteins plus common components, such as CP190, that facilitate these interactions. Here, we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA-binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to DNA to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. PMID:21981916

  6. Epigenetics, cellular memory and gene regulation.

    PubMed

    Henikoff, Steven; Greally, John M

    2016-07-25

    The field described as 'epigenetics' has captured the imagination of scientists and the lay public. Advances in our understanding of chromatin and gene regulatory mechanisms have had impact on drug development, fueling excitement in the lay public about the prospects of applying this knowledge to address health issues. However, when describing these scientific advances as 'epigenetic', we encounter the problem that this term means different things to different people, starting within the scientific community and amplified in the popular press. To help researchers understand some of the misconceptions in the field and to communicate the science accurately to each other and the lay audience, here we review the basis for many of the assumptions made about what are currently referred to as epigenetic processes. PMID:27458904

  7. Gene duplication and divergence affecting drug content in Cannabis sativa.

    PubMed

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. PMID:26189495

  8. Gene duplication and divergence affecting drug content in Cannabis sativa.

    PubMed

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency.

  9. Oxytocin Regulates Stress-Induced Crf Gene Transcription through CREB-Regulated Transcription Coactivator 3

    PubMed Central

    Jurek, Benjamin; Slattery, David A.; Hiraoka, Yuichi; Liu, Ying; Nishimori, Katsuhiko; Aguilera, Greti; van den Burg, Erwin H.

    2015-01-01

    The major regulator of the neuroendocrine stress response in the brain is corticotropin releasing factor (CRF), whose transcription is controlled by CREB and its cofactors CRTC2/3 (TORC2/3). Phosphorylated CRTCs are sequestered in the cytoplasm, but rapidly dephosphorylated and translocated into the nucleus following a stressful stimulus. As the stress response is attenuated by oxytocin (OT), we tested whether OT interferes with CRTC translocation and, thereby, Crf expression. OT (1 nmol, i.c.v.) delayed the stress-induced increase of nuclear CRTC3 and Crf hnRNA levels in the paraventricular nucleus of male rats and mice, but did not affect either parameter in the absence of the stressor. The increase in Crf hnRNA levels at later time points was parallel to elevated nuclear CRTC2/3 levels. A direct effect of Thr4 Gly7-OT (TGOT) on CRTC3 translocation and Crf expression was found in rat primary hypothalamic neurons, amygdaloid (Ar-5), hypothalamic (H32), and human neuroblastoma (Be(2)M17) cell lines. CRTC3, but not CRCT2, knockdown using siRNA in Be(2)M17 cells prevented the effect of TGOT on Crf hnRNA levels. Chromatin-immunoprecipitation demonstrated that TGOT reduced CRTC3, but not CRTC2, binding to the Crf promoter after 10 min of forskolin stimulation. Together, the results indicate that OT modulates CRTC3 translocation, the binding of CRTC3 to the Crf promoter and, ultimately, transcription of the Crf gene. SIGNIFICANCE STATEMENT The neuropeptide oxytocin has been proposed to reduce hypothalamic-pituitary-adrenal (HPA) axis activation during stress. The underlying mechanisms are, however, elusive. In this study we show that activation of the oxytocin receptor in the paraventricular nucleus delays transcription of the gene encoding corticotropin releasing factor (Crf), the main regulator of the stress response. It does so by sequestering the coactivator of the transcription factor CREB, CRTC3, in the cytosol, resulting in reduced binding of CRTC3 to the Crf

  10. Acetylation of RNA Polymerase II Regulates Growth-Factor-Induced Gene Transcription in Mammalian Cells

    PubMed Central

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A.; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S.; Capra, John A.; Schnölzer, Martina; Cole, Philip A.; Geyer, Matthias; Bruneau, Benoit G.; Adelman, Karen; Ott, Melanie

    2014-01-01

    SUMMARY Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes. PMID:24207025

  11. Toehold Switches: De-Novo-Designed Regulators of Gene Expression

    PubMed Central

    Green, Alexander A.; Silver, Pamela A.; Collins, James J.; Yin, Peng

    2014-01-01

    SUMMARY Efforts to construct synthetic networks in living cells have been hindered by the limited number of regulatory components that provide wide dynamic range and low crosstalk. Here, we report a new class of de-novo-designed prokaryotic riboregulators called toehold switches that activate gene expression in response to cognate RNAs with arbitrary sequences. Toehold switches provide a high level of orthogonality and can be forward-engineered to provide average dynamic range above 400. We show that switches can be integrated into the genome to regulate endogenous genes and use them as sensors that respond to endogenous RNAs. We exploit the orthogonality of toehold switches to regulate 12 genes independently and to construct a genetic circuit that evaluates 4-input AND logic. Toehold switches, with their wide dynamic range, orthogonality, and programmability, represent a versatile and powerful platform for regulation of translation, offering diverse applications in molecular biology, synthetic biology, and biotechnology. PMID:25417166

  12. Absence of canonical active chromatin marks in developmentally regulated genes

    PubMed Central

    Ruiz-Romero, Marina; Corominas, Montserrat; Guigó, Roderic

    2015-01-01

    The interplay of active and repressive histone modifications is assumed to play a key role in the regulation of gene expression. In contrast to this generally accepted view, we show that transcription of genes temporally regulated during fly and worm development occurs in the absence of canonically active histone modifications. Conversely, strong chromatin marking is related to transcriptional and post-transcriptional stability, an association that we also observe in mammals. Our results support a model in which chromatin marking is associated to stable production of RNA, while unmarked chromatin would permit rapid gene activation and de-activation during development. In this case, regulation by transcription factors would play a comparatively more important regulatory role. PMID:26280901

  13. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  14. A mutation in the Xanthomonas oryzae pv. oryzae wxoD gene affects xanthan production and chemotaxis.

    PubMed

    Nam, Jae-Young; Kim, Hong-Il; Lee, Chang-Soo; Park, Young-Jin

    2013-11-01

    Xanthomonas oryzae pv. oryzae causes bacterial blight in rice (Oryza sativa L.). The effect of a mutation in the wxoD gene, that encodes a putative O-antigen acetylase, on xanthan production as well as bacterial chemotaxis was investigated. The mutation increased xanthan production by 52 %. The mutant strain was non-motile on semi-solid agar swarm plates. In addition, several genes involved in chemotaxis, including the cheW, cheV, cheR, and cheD genes, were down-regulated by a mutation in the wxoD gene. Thus, the mutation in the wxoD gene affects xanthan production as well as bacterial chemotaxis. However, the wxoD gene is not essential for the virulence of X. oryzae.

  15. Chromatin Remodeling Inactivates Activity Genes and Regulates Neural Coding

    PubMed Central

    Hill, Kelly K.; Hemberg, Martin; Reddy, Naveen C.; Cho, Ha Y.; Guthrie, Arden N.; Oldenborg, Anna; Heiney, Shane A.; Ohmae, Shogo; Medina, Javier F.; Holy, Timothy E.; Bonni, Azad

    2016-01-01

    Activity-dependent transcription influences neuronal connectivity, but the roles and mechanisms of inactivation of activity-dependent genes have remained poorly understood. Genome-wide analyses in the mouse cerebellum revealed that the nucleosome remodeling and deacetylase (NuRD) complex deposits the histone variant H2A.z at promoters of activity-dependent genes, thereby triggering their inactivation. Purification of translating mRNAs from synchronously developing granule neurons (Sync-TRAP) showed that conditional knockout of the core NuRD subunit Chd4 impairs inactivation of activity-dependent genes when neurons undergo dendrite pruning. Chd4 knockout or expression of NuRD-regulated activity genes impairs dendrite pruning. Imaging of behaving mice revealed hyperresponsivity of granule neurons to sensorimotor stimuli upon Chd4 knockout. Our findings define an epigenetic mechanism that inactivates activity-dependent transcription and regulates dendrite patterning and sensorimotor encoding in the brain. PMID:27418512

  16. Cloning-free regulated monitoring of reporter and gene expression

    PubMed Central

    al-Haj, Latifa; Al-Ahmadi, Wijdan; Al-Saif, Maher; Demirkaya, Omer; Khabar, Khalid SA

    2009-01-01

    Background The majority of the promoters, their regulatory elements, and their variations in the human genome remain unknown. Reporter gene technology for transcriptional activity is a widely used tool for the study of promoter structure, gene regulation, and signaling pathways. Construction of transcriptional reporter vectors, including use of cis-acting sequences, requires cloning and time-demanding manipulations, particularly with introduced mutations. Results In this report, we describe a cloning-free strategy to generate transcriptionally-controllable linear reporter constructs. This approach was applied in common transcriptional models of inflammatory response and the interferon system. In addition, it was used to delineate minimal transcriptional activity of selected ribosomal protein promoters. The approach was tested for conversion of genes into TetO-inducible/repressible expression cassettes. Conclusion The simple introduction and tuning of any transcriptional control in the linear DNA product renders promoter activation and regulated gene studies simple and versatile. PMID:19267938

  17. Methylation of microRNA genes regulates gene expression in bisexual flower development in andromonoecious poplar.

    PubMed

    Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang

    2015-04-01

    Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5' and 3' flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes.

  18. Methylation of microRNA genes regulates gene expression in bisexual flower development in andromonoecious poplar

    PubMed Central

    Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang

    2015-01-01

    Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5′ and 3′ flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes. PMID:25617468

  19. Mutations in TSPEAR, Encoding a Regulator of Notch Signaling, Affect Tooth and Hair Follicle Morphogenesis

    PubMed Central

    Samuelov, Liat; Bertolini, Marta; Weissglas-Volkov, Daphna; Eskin-Schwartz, Marina; Malchin, Natalia; Bochner, Ron; Fainberg, Gilad; Goldberg, Ilan; Sugawara, Koji; Tsuruta, Daisuke; Morasso, Maria; Shalev, Stavit; Gallo, Richard L.; Shomron, Noam; Paus, Ralf; Sprecher, Eli

    2016-01-01

    Despite recent advances in our understanding of the pathogenesis of ectodermal dysplasias (EDs), the molecular basis of many of these disorders remains unknown. In the present study, we aimed at elucidating the genetic basis of a new form of ED featuring facial dysmorphism, scalp hypotrichosis and hypodontia. Using whole exome sequencing, we identified 2 frameshift and 2 missense mutations in TSPEAR segregating with the disease phenotype in 3 families. TSPEAR encodes the thrombospondin-type laminin G domain and EAR repeats (TSPEAR) protein, whose function is poorly understood. TSPEAR knock-down resulted in altered expression of genes known to be regulated by NOTCH and to be involved in murine hair and tooth development. Pathway analysis confirmed that down-regulation of TSPEAR in keratinocytes is likely to affect Notch signaling. Accordingly, using a luciferase-based reporter assay, we showed that TSPEAR knock-down is associated with decreased Notch signaling. In addition, NOTCH1 protein expression was reduced in patient scalp skin. Moreover, TSPEAR silencing in mouse hair follicle organ cultures was found to induce apoptosis in follicular epithelial cells, resulting in decreased hair bulb diameter. Collectively, these observations indicate that TSPEAR plays a critical, previously unrecognized role in human tooth and hair follicle morphogenesis through regulation of the Notch signaling pathway. PMID:27736875

  20. TAM receptors affect adult brain neurogenesis by negative regulation of microglial cell activation.

    PubMed

    Ji, Rui; Tian, Shifu; Lu, Helen J; Lu, Qingjun; Zheng, Yan; Wang, Xiaomin; Ding, Jixiang; Li, Qiutang; Lu, Qingxian

    2013-12-15

    TAM tyrosine kinases play multiple functional roles, including regulation of the target genes important in homeostatic regulation of cytokine receptors or TLR-mediated signal transduction pathways. In this study, we show that TAM receptors affect adult hippocampal neurogenesis and loss of TAM receptors impairs hippocampal neurogenesis, largely attributed to exaggerated inflammatory responses by microglia characterized by increased MAPK and NF-κB activation and elevated production of proinflammatory cytokines that are detrimental to neuron stem cell proliferation and neuronal differentiation. Injection of LPS causes even more severe inhibition of BrdU incorporation in the Tyro3(-/-)Axl(-/-)Mertk(-/-) triple-knockout (TKO) brains, consistent with the LPS-elicited enhanced expression of proinflammatory mediators, for example, IL-1β, IL-6, TNF-α, and inducible NO synthase, and this effect is antagonized by coinjection of the anti-inflammatory drug indomethacin in wild-type but not TKO brains. Conditioned medium from TKO microglia cultures inhibits neuron stem cell proliferation and neuronal differentiation. IL-6 knockout in Axl(-/-)Mertk(-/-) double-knockout mice overcomes the inflammatory inhibition of neurogenesis, suggesting that IL-6 is a major downstream neurotoxic mediator under homeostatic regulation by TAM receptors in microglia. Additionally, autonomous trophic function of the TAM receptors on the proliferating neuronal progenitors may also promote progenitor differentiation into immature neurons.

  1. Adviser's Manual of Federal Regulations Affecting Foreign Students and Scholars.

    ERIC Educational Resources Information Center

    National Association for Foreign Student Affairs, Washington, DC.

    A manual of U.S. immigration law and regulations pertaining to foreign students and scholars is presented to assist foreign student advisers. Overall topics include nonimmigrant status, student (F) status, exchange visitor (J) status, temporary worker or trainee (H) status, other nonimmigrant classes, and immigrant status. Specific areas include:…

  2. Economic Approaches to Estimating Benefits of Regulations Affecting Addictive Goods.

    PubMed

    Cutler, David M; Jessup, Amber I; Kenkel, Donald S; Starr, Martha A

    2016-05-01

    The question of how to evaluate lost consumer surplus in benefit-cost analyses has been contentious. There are clear health benefits of regulations that curb consumption of goods with health risks, such as tobacco products and foods high in fats, calories, sugar, and sodium. Yet, if regulations cause consumers to give up goods they like, the health benefits they experience may be offset by some utility loss, which benefit-cost analyses of regulations need to take into account. This paper lays out the complications of measuring benefits of regulations aiming to curb consumption of addictive and habitual goods, rooted in the fact that consumers' observed demand for such goods may not be in line with their true preferences. Focusing on the important case of tobacco products, the paper describes four possible approaches for estimating benefits when consumers' preferences may not be aligned with their behavior, and identifies one as having the best feasibility for use in applied benefit-cost analyses in the near term.

  3. SHORT INTERNODES-like genes regulate shoot growth and xylem proliferation in Populus.

    PubMed

    Zawaski, Christine; Kadmiel, Mahita; Ma, Cathleen; Gai, Ying; Jiang, Xiangning; Strauss, Steve H; Busov, Victor B

    2011-08-01

    Genes controlling plant growth and form are of considerable interest, because they affect survival and productivity traits, and are largely unknown or poorly characterized. The SHORT INTERNODES(SHI) gene is one of a 10-member SHI-RELATED SEQUENCE (SRS) gene family in Arabidopsis that includes important developmental regulators. • Using comparative sequence analysis of the SRS gene families in poplar and Arabidopsis, we identified two poplar proteins that are most similar to SHI and its closely related gene STYLISH1 (STY1). The two poplar genes are very similar in sequence and expression and are therefore probably paralogs with redundant functions. • RNAi suppression of the two Populus genes enhanced shoot and root growth, whereas the overexpression of Arabidopsis SHI in poplar reduced internode and petiole length. The suppression of the two genes increased fiber length and the proportion of xylem tissue, mainly through increased xylem cell proliferation. The transgenic modifications were also associated with significant changes in the concentrations of gibberellins and cytokinin. • We conclude that Populus SHI-RELATED SEQUENCE (SRS) genes play an important role in the regulation of vegetative growth, including wood formation, and thus could be useful tools for the modification of biomass productivity, wood quality or plant form.

  4. SUI-family genes encode phosphatidylserine synthases and regulate stem development in rice.

    PubMed

    Yin, Hengfu; Gao, Peng; Liu, Chengwu; Yang, Jun; Liu, Zhongchi; Luo, Da

    2013-01-01

    In vascular plants, the regulation of stem cell niche determines development of aerial shoot which consists of stems and lateral organs. Intercalary meristem (IM) controls internode elongation in rice and other grasses, however little attention has been paid to the underlying mechanism of stem cell maintenance. Here, we investigated the stem development in rice and showed that the Shortened Uppermost Internode 1 (SUI1) family of genes are pivotal for development of rice stems. We demonstrated that SUI-family genes regulate the development of IM for internode elongation and also the cell expansion of the panicle stem rachis in rice. The SUI-family genes encoded base-exchange types of phosphatidylserine synthases (PSSs), which possessed enzymatic activity in a yeast complementary assay. Overexpression of SUI1 and SUI2 caused outgrowths of internodes during vegetative development, and we showed that expression patterns of Oryza Sativa Homeobox 15 (OSH15) and Histone4 were impaired. Furthermore, genome-wide gene expression analysis revealed that overexpression and RNA knockdown of SUI-family genes affected downstream gene expression related to phospholipid metabolic pathways. Moreover, using Ultra-performance liquid chromatography-quadrupole time of flight-mass spectrometry, we analyzed PS contents in different genetic backgrounds of rice and showed that the quantity of very long chain fatty acids PS is affected by transgene of SUI-family genes. Our study reveals a new mechanism conveyed by the SUI1 pathway and provides evidence to link lipid metabolism with plant stem cell maintenance.

  5. Verticillium dahliae Sge1 differentially regulates expression of candidate effector genes.

    PubMed

    Santhanam, Parthasarathy; Thomma, Bart P H J

    2013-02-01

    The ascomycete fungus Verticillium dahliae causes vascular wilt diseases in hundreds of dicotyledonous plant species. However, thus far, only few V. dahliae effectors have been identified, and regulators of pathogenicity remain unknown. In this study, we investigated the role of the V. dahliae homolog of Sge1, a transcriptional regulator that was previously implicated in pathogenicity and effector gene expression in Fusarium oxysporum. We show that V. dahliae Sge1 (VdSge1) is required for radial growth and production of asexual conidiospores, because VdSge1 deletion strains display reduced radial growth and reduced conidia production. Furthermore, we show that VdSge1 deletion strains have lost pathogenicity on tomato. Remarkably, VdSge1 is not required for induction of Ave1, the recently identified V. dahliae effector that activates resistance mediated by the Ve1 immune receptor in tomato. Further assessment of the role of VdSge1 in the induction of the nine most highly in-planta-induced genes that encode putative effectors revealed differential activity. Although the expression of one putative effector gene in addition to Ave1 was not affected by VdSge1 deletion, VdSge1 appeared to be required for the expression of six putative effector genes, whereas two of the putative effectors genes were found to be negatively regulated by VdSge1. In conclusion, our data suggest that VdSge1 differentially regulates V. dahliae effector gene expression.

  6. Affect regulation training (ART) for alcohol use disorders: development of a novel intervention for negative affect drinkers.

    PubMed

    Stasiewicz, Paul R; Bradizza, Clara M; Schlauch, Robert C; Coffey, Scott F; Gulliver, Suzy B; Gudleski, Gregory D; Bole, Christopher W

    2013-01-01

    Although negative affect is a common precipitant of alcohol relapse, there are few interventions for alcohol dependence that specifically target negative affect. In this stage 1a/1b treatment development study, several affect regulation strategies (e.g., mindfulness, prolonged exposure, distress tolerance) were combined to create a new treatment supplement called affect regulation training (ART), which could be added to enhance cognitive-behavioral therapy (CBT) for alcohol dependence. A draft therapy manual was given to therapists and treatment experts before being administered to several patients who also provided input. After two rounds of manual development (stage 1a), a pilot randomized clinical trial (N=77) of alcohol-dependent outpatients who reported drinking often in negative affect situations was conducted (stage 1b). Participants received 12-weekly, 90-minute sessions of either CBT for alcohol dependence plus ART (CBT+ART) or CBT plus a healthy lifestyles control condition (CBT+HLS). Baseline, end-of-treatment, and 3- and 6-month posttreatment interviews were conducted. For both treatment conditions, participant ratings of treatment satisfaction were high, with CBT+ART rated significantly higher. Drinking outcome results indicated greater reductions in alcohol use for CBT+ART when compared to CBT+HLS, with moderate effect sizes for percent days abstinent, drinks per day, drinks per drinking day, and percent heavy drinking days. Overall, findings support further research on affect regulation interventions for negative affect drinkers.

  7. Affect Regulation Training (ART) for Alcohol Use Disorders: Development of a Novel Intervention for Negative Affect Drinkers

    PubMed Central

    Stasiewicz, Paul R.; Bradizza, Clara M.; Schlauch, Robert C.; Coffey, Scott F.; Gulliver, Suzy B.; Gudleski, Gregory; Bole, Christopher W.

    2013-01-01

    Although negative affect is a common precipitant of alcohol relapse, there are few interventions for alcohol dependence that specifically target negative affect. In this Stage 1a/1b treatment development study, several affect regulation strategies (e.g., mindfulness, prolonged exposure, distress tolerance) were combined to create a new treatment supplement called Affect Regulation Training (ART), which could be added to enhance Cognitive-Behavioral Therapy (CBT) for alcohol dependence. A draft therapy manual was given to therapists and treatment experts before being administered to several patients who also provided input. After two rounds of manual development (Stage 1a), a pilot randomized clinical trial (N = 77) of alcohol-dependent outpatients who reported drinking often in negative affect situations was conducted (Stage 1b). Participants received 12-weekly, 90-minute sessions of either CBT for alcohol dependence plus ART (CBT + ART) or CBT plus a healthy lifestyles control condition (CBT + HLS). Baseline, end-of-treatment, and 3- and 6-month posttreatment interviews were conducted. For both treatment conditions, participant ratings of treatment satisfaction were high, with CBT + ART rated significantly higher. Drinking outcome results indicated greater reductions in alcohol use for CBT + ART when compared to CBT + HLS, with moderate effect sizes for percent days abstinent, drinks per day, drinks per drinking day, and percent heavy drinking days. Overall, findings support further research on affect regulation interventions for negative affect drinkers. PMID:23876455

  8. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  9. Regulation of Gene Expression Patterns in Mosquito Reproduction.

    PubMed

    Roy, Sourav; Saha, Tusar T; Johnson, Lisa; Zhao, Bo; Ha, Jisu; White, Kevin P; Girke, Thomas; Zou, Zhen; Raikhel, Alexander S

    2015-08-01

    In multicellular organisms, development, growth and reproduction require coordinated expression of numerous functional and regulatory genes. Insects, in addition to being the most speciose animal group with enormous biological and economical significance, represent outstanding model organisms for studying regulation of synchronized gene expression due to their rapid development and reproduction. Disease-transmitting female mosquitoes have adapted uniquely for ingestion and utilization of the huge blood meal required for swift reproductive events to complete egg development within a 72-h period. We investigated the network of regulatory factors mediating sequential gene expression in the fat body, a multifunctional organ analogous to the vertebrate liver and adipose tissue, of the female Aedes aegypti mosquito. Transcriptomic and bioinformatics analyses revealed that ~7500 transcripts are differentially expressed in four sequential waves during the 72-h reproductive period. A combination of RNA-interference gene-silencing and in-vitro organ culture identified the major regulators for each of these waves. Amino acids (AAs) regulate the first wave of gene activation between 3 h and 12 h post-blood meal (PBM). During the second wave, between 12 h and 36 h, most genes are highly upregulated by a synergistic action of AAs, 20-hydroxyecdysone (20E) and the Ecdysone-Receptor (EcR). Between 36 h and 48 h, the third wave of gene activation-regulated mainly by HR3-occurs. Juvenile Hormone (JH) and its receptor Methoprene-Tolerant (Met) are major regulators for the final wave between 48 h and 72 h. Each of these key regulators also has repressive effects on one or more gene sets. Our study provides a better understanding of the complexity of the regulatory mechanisms related to temporal coordination of gene expression during reproduction. We have detected the novel function of 20E/EcR responsible for transcriptional repression. This study also reveals the previously

  10. Regulation of Gene Expression Patterns in Mosquito Reproduction.

    PubMed

    Roy, Sourav; Saha, Tusar T; Johnson, Lisa; Zhao, Bo; Ha, Jisu; White, Kevin P; Girke, Thomas; Zou, Zhen; Raikhel, Alexander S

    2015-08-01

    In multicellular organisms, development, growth and reproduction require coordinated expression of numerous functional and regulatory genes. Insects, in addition to being the most speciose animal group with enormous biological and economical significance, represent outstanding model organisms for studying regulation of synchronized gene expression due to their rapid development and reproduction. Disease-transmitting female mosquitoes have adapted uniquely for ingestion and utilization of the huge blood meal required for swift reproductive events to complete egg development within a 72-h period. We investigated the network of regulatory factors mediating sequential gene expression in the fat body, a multifunctional organ analogous to the vertebrate liver and adipose tissue, of the female Aedes aegypti mosquito. Transcriptomic and bioinformatics analyses revealed that ~7500 transcripts are differentially expressed in four sequential waves during the 72-h reproductive period. A combination of RNA-interference gene-silencing and in-vitro organ culture identified the major regulators for each of these waves. Amino acids (AAs) regulate the first wave of gene activation between 3 h and 12 h post-blood meal (PBM). During the second wave, between 12 h and 36 h, most genes are highly upregulated by a synergistic action of AAs, 20-hydroxyecdysone (20E) and the Ecdysone-Receptor (EcR). Between 36 h and 48 h, the third wave of gene activation-regulated mainly by HR3-occurs. Juvenile Hormone (JH) and its receptor Methoprene-Tolerant (Met) are major regulators for the final wave between 48 h and 72 h. Each of these key regulators also has repressive effects on one or more gene sets. Our study provides a better understanding of the complexity of the regulatory mechanisms related to temporal coordination of gene expression during reproduction. We have detected the novel function of 20E/EcR responsible for transcriptional repression. This study also reveals the previously

  11. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    SciTech Connect

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  12. Role of iron in regulation of virulence genes.

    PubMed Central

    Litwin, C M; Calderwood, S B

    1993-01-01

    The abilities of bacterial pathogens to adapt to the environment within the host are essential to their virulence. Microorganisms have adapted to the iron limitation present in mammalian hosts by evolving diverse mechanisms for the assimilation of iron sufficient for growth. In addition, many bacterial pathogens have used the low concentration of iron present in the host as an important signal to enhance the expression of a wide variety of bacterial toxins and other virulence determinants. The molecular basis of coordinate regulation by iron has been most thoroughly studied in Escherichia coli. In this organism, coordinate regulation of gene expression by iron depends on the regulatory gene, fur. Regulation of gene expression by iron in a number of pathogenic organisms is coordinated by proteins homologous to the Fur protein of E. coli. Additional regulatory proteins may be superimposed on the Fur repressor to provide the fine-tuning necessary for the precise regulation of individual virulence genes in response to iron and other environmental signals. Studies of the mechanisms of regulation of iron acquisition systems and virulence determinants by iron should lead to a better understanding of the adaptive response of bacteria to the low-iron environment of the host and its importance in virulence. PMID:8472246

  13. Identification of Fur-regulated genes in Actinobacillus actinomycetemcomitans.

    PubMed

    Haraszthy, Violet I; Jordan, Shawn F; Zambon, Joseph J

    2006-03-01

    Actinobacillus actinomycetemcomitans is an oral pathogen that causes aggressive periodontitis as well as sometimes life-threatening, extra-oral infections. Iron regulation is thought to be important in the pathogenesis of A. actinomycetemcomitans infections and, consistent with this hypothesis, the fur gene has recently been identified and characterized in A. actinomycetemcomitans. In this study, 14 putatively Fur-regulated genes were identified by Fur titration assay (Furta) in A. actinomycetemcomitans, including afuA, dgt, eno, hemA, tbpA, recO and yfe - some of which are known to be Fur regulated in other species. A fur mutant A. actinomycetemcomitans strain was created by selecting for manganese resistance in order to study the Fur regulon. Comparisons between the fur gene sequences revealed that nucleotide 66 changed from C in the wild-type to T in the mutant strain, changing leucine to isoleucine. The fur mutant strain expressed a nonfunctional Fur protein as determined by Escherichia coli-based ferric uptake assays and Western blotting. It was also more sensitive to acid stress and expressed higher levels of minC than the wild-type strain. minC, which inhibits cell division in other bacterial species and whose regulation by iron has not been previously described, was found to be Fur regulated in A. actinomycetemcomitans by Furta, by gel shift assays, and by RT-qPCR assays for gene expression. PMID:16514158

  14. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  15. Computational Genomics: From Genome Sequence To Global Gene Regulation

    NASA Astrophysics Data System (ADS)

    Li, Hao

    2000-03-01

    As various genome projects are shifting to the post-sequencing phase, it becomes a big challenge to analyze the sequence data and extract biological information using computational tools. In the past, computational genomics has mainly focused on finding new genes and mapping out their biological functions. With the rapid accumulation of experimental data on genome-wide gene activities, it is now possible to understand how genes are regulated on a genomic scale. A major mechanism for gene regulation is to control the level of transcription, which is achieved by regulatory proteins that bind to short DNA sequences - the regulatory elements. We have developed a new approach to identifying regulatory elements in genomes. The approach formalizes how one would proceed to decipher a ``text'' consisting of a long string of letters written in an unknown language that did not delineate words. The algorithm is based on a statistical mechanics model in which the sequence is segmented probabilistically into ``words'' and a ``dictionary'' of ``words'' is built concurrently. For the control regions in the yeast genome, we built a ``dictionary'' of about one thousand words which includes many known as well as putative regulatory elements. I will discuss how we can use this dictionary to search for genes that are likely to be regulated in a similar fashion and to analyze gene expression data generated from DNA micro-array experiments.

  16. GLK gene pairs regulate chloroplast development in diverse plant species.

    PubMed

    Fitter, David W; Martin, David J; Copley, Martin J; Scotland, Robert W; Langdale, Jane A

    2002-09-01

    Chloroplast biogenesis is a complex process that requires close co-ordination between two genomes. Many of the proteins that accumulate in the chloroplast are encoded by the nuclear genome, and the developmental transition from proplastid to chloroplast is regulated by nuclear genes. Here we show that a pair of Golden 2-like (GLK) genes regulates chloroplast development in Arabidopsis. The GLK proteins are members of the GARP superfamily of transcription factors, and phylogenetic analysis demonstrates that the maize, rice and Arabidopsis GLK gene pairs comprise a distinct group within the GARP superfamily. Further phylogenetic analysis suggests that the gene pairs arose through separate duplication events in the monocot and dicot lineages. As in rice, AtGLK1 and AtGLK2 are expressed in partially overlapping domains in photosynthetic tissue. Insertion mutants demonstrate that this expression pattern reflects a degree of functional redundancy as single mutants display normal phenotypes in most photosynthetic tissues. However, double mutants are pale green in all photosynthetic tissues and chloroplasts exhibit a reduction in granal thylakoids. Products of several genes involved in light harvesting also accumulate at reduced levels in double mutant chloroplasts. GLK genes therefore regulate chloroplast development in diverse plant species.

  17. Denitrification Genes Regulate Brucella Virulence in Mice

    PubMed Central

    Baek, Seung-Hun; Rajashekara, Gireesh; Splitter, Gary A.; Shapleigh, James P.

    2004-01-01

    Brucella is the causative agent of the zoonotic disease brucellosis, which is endemic in many parts of the world. Genome sequencing of B. suis and B. melitensis revealed that both are complete denitrifiers. To learn more about the role of denitrification in these animal pathogens, a study of the role of denitrification in the closely related B. neotomae was undertaken. In contrast to B. suis and B. melitensis, it was found that B. neotomae is a partial denitrifier that can reduce nitrate to nitrite but no further. Examination of the B. neotomae genome showed that a deletion in the denitrification gene cluster resulted in complete loss of nirV and the partial deletion of nirK and nnrA. Even though the nor operon is intact, a norC-lacZ promoter fusion was not expressed in B. neotomae. However, the norC-lacZ fusion was expressed in the related denitrifier Agrobacterium tumefaciens, suggesting that the lack of expression in B. neotomae is due to inactivation of NnrA. A narK-lacZ promoter fusion was found to exhibit nitrate-dependent expression consistent with the partial denitrifier phenotype. Complementation of the deleted region in B. neotomae by using nirK, nirV, and nnrA from B. melitensis restored the ability of B. neotomae to reduce nitrite. There was a significant difference in the death of IRF-1−/− mice when infected with B. neotomae containing nirK, nirV, and nnrA and those infected with wild-type B. neotomae. The wild-type strain killed all the infected mice, whereas most of the mice infected with B. neotomae containing nirK, nirV, and nnrA survived. PMID:15342571

  18. Automatic goals and conscious regulation in social cognitive affective neuroscience.

    PubMed

    Sripada, Chandra; Swain, John D; Ho, S Shaun; Swain, James E

    2014-04-01

    The Selfish Goal model challenges traditional agentic models that place conscious systems at the helm of motivation. We highlight the need for ongoing supervision and intervention of automatic goals by higher-order conscious systems with examples from social cognitive affective neuroscience. We contend that interplay between automatic and supervisory systems is required for adaptive human behavior. PMID:24775144

  19. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer’s Disease Affected Brain Regions

    PubMed Central

    Berretta, Regina; Moscato, Pablo

    2016-01-01

    Background Alzheimer’s disease (AD) is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation. Methods The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD) from the Entorhinal Cortex (EC), Hippocampus (HIP), Middle temporal gyrus (MTG), Posterior cingulate cortex (PC), Superior frontal gyrus (SFG) and visual cortex (VCX) brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets. Results We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD

  20. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation

    PubMed Central

    2013-01-01

    Background The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. Results We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Conclusion Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is

  1. Affect Regulation as a Mediator of Attachment and Deliberate Self-Harm

    ERIC Educational Resources Information Center

    Kimball, Joan S.; Diddams, Margaret

    2007-01-01

    The authors used structural equation modeling to test the mediational role of affect regulation on attachment and deliberate self-harm in 216 undergraduates. Results suggest that affect regulation mediates the relationship between attachment and deliberate self-harm, providing support for the theoretical importance of attachment and affect…

  2. Accuracy and Generalizability in Summaries of Affect Regulation Strategies: Comment on Webb, Miles, and Sheeran (2012)

    ERIC Educational Resources Information Center

    Augustine, Adam A.; Hemenover, Scott H.

    2013-01-01

    In their examination of the effectiveness of affect regulation strategies, Webb, Miles, and Sheeran (2012) offered the results of a broad meta-analysis of studies on regulatory interventions. Their analysis provides an alternative to our earlier, more focused meta-analysis of the affect regulation literature (Augustine & Hemenover, 2009).…

  3. Interactions of Metacognition with Motivation and Affect in Self-Regulated Learning: The MASRL Model

    ERIC Educational Resources Information Center

    Efklides, Anastasia

    2011-01-01

    Metacognition, motivation, and affect are components of self-regulated learning (SRL) that interact. The "metacognitive and affective model of self-regulated learning" (the MASRL model) distinguishes two levels of functioning in SRL, namely, the Person level and the Task x Person level. At the Person level interactions between trait-like…

  4. 25 CFR 542.5 - How do these regulations affect state jurisdiction?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false How do these regulations affect state jurisdiction? 542.5 Section 542.5 Indians NATIONAL INDIAN GAMING COMMISSION, DEPARTMENT OF THE INTERIOR HUMAN SERVICES MINIMUM INTERNAL CONTROL STANDARDS § 542.5 How do these regulations affect state jurisdiction? Nothing in this...

  5. A recent evolutionary change affects a regulatory element in the human FOXP2 gene.

    PubMed

    Maricic, Tomislav; Günther, Viola; Georgiev, Oleg; Gehre, Sabine; Curlin, Marija; Schreiweis, Christiane; Naumann, Ronald; Burbano, Hernán A; Meyer, Matthias; Lalueza-Fox, Carles; de la Rasilla, Marco; Rosas, Antonio; Gajovic, Srecko; Kelso, Janet; Enard, Wolfgang; Schaffner, Walter; Pääbo, Svante

    2013-04-01

    The FOXP2 gene is required for normal development of speech and language. By isolating and sequencing FOXP2 genomic DNA fragments from a 49,000-year-old Iberian Neandertal and 50 present-day humans, we have identified substitutions in the gene shared by all or nearly all present-day humans but absent or polymorphic in Neandertals. One such substitution is localized in intron 8 and affects a binding site for the transcription factor POU3F2, which is highly conserved among vertebrates. We find that the derived allele of this site is less efficient than the ancestral allele in activating transcription from a reporter construct. The derived allele also binds less POU3F2 dimers than POU3F2 monomers compared with the ancestral allele. Because the substitution in the POU3F2 binding site is likely to alter the regulation of FOXP2 expression, and because it is localized in a region of the gene associated with a previously described signal of positive selection, it is a plausible candidate for having caused a recent selective sweep in the FOXP2 gene.

  6. Regulation of major histocompatibility complex class II genes

    PubMed Central

    Choi, Nancy M.; Majumder, Parimal; Boss, Jeremy M.

    2010-01-01

    Summary The major histocompatibility complex class II (MHC-II) genes are regulated at the level of transcription. Recent studies have shown that chromatin modification is critical for efficient transcription of these genes, and a number of chromatin modifying complexes recruited to MHC-II genes have been described. The MHC-II genes are segregated from each other by a series of chromatin elements, termed MHC-II insulators. Interactions between MHC-insulators and the promoters of MHC-II genes are mediated by the insulator factor CCCTC-binding protein and are critical for efficient expression. This regulatory mechanism provides a novel view of how the entire MHC-II locus is assembled architecturally and can be coordinately controlled. PMID:20970972

  7. Epigenetic regulation of cardiac myofibril gene expression during heart development.

    PubMed

    Zhao, Weian; Liu, Lingjuan; Pan, Bo; Xu, Yang; Zhu, Jing; Nan, Changlong; Huang, Xupei; Tian, Jie

    2015-07-01

    Cardiac gene expression regulation is controlled not only by genetic factors but also by environmental, i.e., epigenetic factors. Several environmental toxic effects such as oxidative stress and ischemia can result in abnormal myofibril gene expression during heart development. Troponin, one of the regulatory myofibril proteins in the heart, is a well-known model in study of cardiac gene regulation during the development. In our previous studies, we have demonstrated that fetal form troponin I (ssTnI) expression in the heart is partially regulated by hormones, such as thyroid hormone. In the present study, we have explored the epigenetic role of histone modification in the regulation of ssTnI expression. Mouse hearts were collected at different time of heart development, i.e., embryonic day 15.5, postnatal day 1, day 7, day 14 and day 21. Levels of histone H3 acetylation (acH3) and histone H3 lysine 9 trimethylation (H3K9me(3)) were detected using chromatin immunoprecipitation assays in slow upstream regulatory element (SURE) domain (TnI slow upstream regulatory element), 300-bp proximal upstream domain and the first intron of ssTnI gene, which are recognized as critical regions for ssTnI regulation. We found that the levels of acH3 on the SURE region were gradually decreased, corresponding to a similar decrease of ssTnI expression in the heart, whereas the levels of H3K9me(3) in the first intron of ssTnI gene were gradually increased. Our results indicate that both histone acetylation and methylation are involved in the epigenetic regulation of ssTnI expression in the heart during the development, which are the targets for environmental factors.

  8. Regulation of human autoimmune regulator (AIRE) gene translation by miR-220b.

    PubMed

    Matsuo, Tomohito; Noguchi, Yukiko; Shindo, Mieko; Morita, Yoshifumi; Oda, Yoshie; Yoshida, Eiko; Hamada, Hiroko; Harada, Mine; Shiokawa, Yuichi; Nishida, Takahiro; Tominaga, Ryuji; Kikushige, Yoshikane; Akashi, Koichi; Kudoh, Jun; Shimizu, Nobuyoshi; Tanaka, Yuka; Umemura, Tsukuru; Taniguchi, Taketoshi; Yoshimura, Akihiko; Kobayashi, Takashi; Mitsuyama, Masao; Kurisaki, Hironori; Katsuta, Hitoshi; Nagafuchi, Seiho

    2013-11-01

    Although mutations of autoimmune regulator (AIRE) gene are responsible for autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED), presenting a wide spectrum of many characteristic and non-characteristic clinical features, some patients lack AIRE gene mutations. Therefore, something other than a mutation, such as dysregulation of AIRE gene, may be a causal factor for APECED or its related diseases. However, regulatory mechanisms for AIRE gene expression and/or translation have still remained elusive. We found that IL-2-stimulated CD4(+) T (IL-2T) cells showed a high expression of AIRE gene, but very low AIRE protein production, while Epstein-Barr virus-transformed B (EBV-B) cells express both AIRE gene and AIRE protein. By using microarray analysis, we could identify miR-220b as a possible regulatory mechanism for AIRE gene translation in IL-2T cells. Here we report that miR-220b significantly reduced the expression of AIRE protein in AIRE gene with 3'UTR region transfected 293T cells, whereas no alteration of AIRE protein production was observed in the open reading frame of AIRE gene alone transfected cells. In addition, anti-miR-220b reversed the inhibitory function of miR-220b for the expression of AIRE protein in AIRE gene with 3'UTR region transfected cells. Moreover, when AIRE gene transfected cells with mutated 3'UTR were transfected with miR-220b, no reduction of AIRE protein production was observed. Taken together, it was concluded that miR-220b inhibited the AIRE gene translation through the 3'UTR region of AIRE gene, indicating that miR-220b could serve as a regulator for human AIRE gene translation.

  9. Querying Co-regulated Genes on Diverse Gene Expression Datasets Via Biclustering.

    PubMed

    Deveci, Mehmet; Küçüktunç, Onur; Eren, Kemal; Bozdağ, Doruk; Kaya, Kamer; Çatalyürek, Ümit V

    2016-01-01

    Rapid development and increasing popularity of gene expression microarrays have resulted in a number of studies on the discovery of co-regulated genes. One important way of discovering such co-regulations is the query-based search since gene co-expressions may indicate a shared role in a biological process. Although there exist promising query-driven search methods adapting clustering, they fail to capture many genes that function in the same biological pathway because microarray datasets are fraught with spurious samples or samples of diverse origin, or the pathways might be regulated under only a subset of samples. On the other hand, a class of clustering algorithms known as biclustering algorithms which simultaneously cluster both the items and their features are useful while analyzing gene expression data, or any data in which items are related in only a subset of their samples. This means that genes need not be related in all samples to be clustered together. Because many genes only interact under specific circumstances, biclustering may recover the relationships that traditional clustering algorithms can easily miss. In this chapter, we briefly summarize the literature using biclustering for querying co-regulated genes. Then we present a novel biclustering approach and evaluate its performance by a thorough experimental analysis.

  10. NF-Y transcriptionally regulates the Drosophila p53 gene.

    PubMed

    Tue, Nguyen Trong; Yoshioka, Yasuhide; Yamaguchi, Masamitsu

    2011-02-15

    The p53 protein is important in multicellular organisms, where it regulates the cell cycle and thus functions as a tumor suppressor that contributes to preventing cancer. However, molecular regulation of p53 gene expression is not fully understood. NF-YA is a subunit of the NF-Y trimeric complex, a transcription factor that binds to CCAAT motifs in the promoter regions of a variety of genes playing key roles in cell cycle regulation. We have identified four potential Drosophila NF-Y (dNF-Y)-binding sites located in the 5'-flanking region of the Drosophila p53 (dmp53) gene. Chromatin immunoprecipitation analyses using anti-dNF-YA antibodies confirmed that dNF-YA binds specifically to the genomic region containing CCAAT boxes in the dmp53 gene promoter in vivo. Furthermore, the thorax disclosed phenotype of dNF-YA knockdown flies can be enhanced by dmp53 mutation. In addition, the level of dmp53 mRNA was found to be decreased in the dNF-YA knockdown cells and transient expression of the luciferase gene revealed that wild-type dmp53 gene promoter activity is much stronger than mutated promoter activity in S2 cells. The requirement of CCAAT boxes for dmp53 promoter activity was further confirmed by expression of EGFP in various tissues from transgenic flies carrying wild-type and CCAAT box-mutated versions of dmp53 promoter-GFP fusion genes. These results taken together indicate that dNF-Y is necessary for dmp53 gene promoter activity.

  11. Darwinian and demographic forces affecting human protein coding genes

    PubMed Central

    Nielsen, Rasmus; Hubisz, Melissa J.; Hellmann, Ines; Torgerson, Dara; Andrés, Aida M.; Albrechtsen, Anders; Gutenkunst, Ryan; Adams, Mark D.; Cargill, Michele; Boyko, Adam; Indap, Amit; Bustamante, Carlos D.; Clark, Andrew G.

    2009-01-01

    Past demographic changes can produce distortions in patterns of genetic variation that can mimic the appearance of natural selection unless the demographic effects are explicitly removed. Here we fit a detailed model of human demography that incorporates divergence, migration, admixture, and changes in population size to directly sequenced data from 13,400 protein coding genes from 20 European-American and 19 African-American individuals. Based on this demographic model, we use several new and established statistical methods for identifying genes with extreme patterns of polymorphism likely to be caused by Darwinian selection, providing the first genome-wide analysis of allele frequency distributions in humans based on directly sequenced data. The tests are based on observations of excesses of high frequency–derived alleles, excesses of low frequency–derived alleles, and excesses of differences in allele frequencies between populations. We detect numerous new genes with strong evidence of selection, including a number of genes related to psychiatric and other diseases. We also show that microRNA controlled genes evolve under extremely high constraints and are more likely to undergo negative selection than other genes. Furthermore, we show that genes involved in muscle development have been subject to positive selection during recent human history. In accordance with previous studies, we find evidence for negative selection against mutations in genes associated with Mendelian disease and positive selection acting on genes associated with several complex diseases. PMID:19279335

  12. Bioinformatics-Based Identification of MicroRNA-Regulated and Rheumatoid Arthritis-Associated Genes.

    PubMed

    Song, Yi-Jiang; Li, Guiling; He, Jian-Hua; Guo, Yao; Yang, Li

    2015-01-01

    MicroRNAs (miRNAs) act as epigenetic markers and regulate the expression of their target genes, including those characterized as regulators in autoimmune diseases. Rheumatoid arthritis (RA) is one of the most common autoimmune diseases. The potential roles of miRNA-regulated genes in RA pathogenesis have greatly aroused the interest of clinicians and researchers in recent years. In the current study, RA-related miRNAs records were obtained from PubMed through conditional literature retrieval. After analyzing the selected records, miRNA targeted genes were predicted. We identified 14 RA-associated miRNAs, and their sub-analysis in 5 microarray or RNA sequencing (RNA-seq) datasets was performed. The microarray and RNA-seq data of RA were also downloaded from NCBI Gene Expression Omnibus (GEO) and Sequence Read Archive (SRA), analyzed, and annotated. Using a bioinformatics approach, we identified a series of differentially expressed genes (DEGs) by comparing studies on RA and the controls. The RA-related gene expression profile was thus obtained and the expression of miRNA-regulated genes was analyzed. After functional annotation analysis, we found GO molecular function (MF) terms significantly enriched in calcium ion binding (GO: 0005509). Moreover, some novel dysregulated target genes were identified in RA through integrated analysis of miRNA/mRNA expression. The result revealed that the expression of a number of genes, including ROR2, ABI3BP, SMOC2, etc., was not only affected by dysregulated miRNAs, but also altered in RA. Our findings indicate that there is a close association between negatively correlated mRNA/miRNA pairs and RA. These findings may be applied to identify genetic markers for RA diagnosis and treatment in the future.

  13. Molecular mechanisms of gonadotropin-releasing hormone receptor gene regulation.

    PubMed

    Norwitz, E R; Jeong, K H; Chin, W W

    1999-01-01

    GnRH plays a critical role in regulating mammalian reproductive development and function. At the level of the anterior pituitary, GnRH binds to the GnRH receptor (GnRHR) on the cell surface of pituitary gonadotropes. Here, it activates intracellular signal transduction pathways to effect both the synthesis and intermittent release of the gonadotropins LH and FSH. These hormones then enter the systemic circulation to regulate gonadal function, including steroid hormone synthesis and gametogenesis. The response of pituitary gonadotropes to GnRH correlates directly with the concentration of GnRHR on the cell surface, which is mediated, at least in part, at the level of gene expression. A number of endocrine, paracrine, and autocrine factors are known to regulate GnRHR gene expression. This article reviews in detail the role of the GnRHR in the hypothalamic-pituitary-gonadal axis and the factors mediating expression of this gene. A better understanding of the molecular mechanisms that regulate transcription of the GnRHR gene will further our knowledge about the role of this receptor in mammalian reproductive physiology in health and disease.

  14. Regulation of nuclear genes encoding mitochondrial proteins in Saccharomyces cerevisiae.

    PubMed

    Brown, T A; Evangelista, C; Trumpower, B L

    1995-12-01

    Selection for mutants which release glucose repression of the CYB2 gene was used to identify genes which regulate repression of mitochondrial biogenesis. We have identified two of these as the previously described GRR1/CAT80 and ROX3 genes. Mutations in these genes not only release glucose repression of CYB2 but also generally release respiration of the mutants from glucose repression. In addition, both mutants are partially defective in CYB2 expression when grown on nonfermentable carbon sources, indicating a positive regulatory role as well. ROX3 was cloned by complementation of a glucose-inducible flocculating phenotype of an amber mutant and has been mapped as a new leftmost marker on chromosome 2. The ROX3 mutant has only a modest defect in glucose repression of GAL1 but is substantially compromised in galactose induction of GAL1 expression. This mutant also has increased SUC2 expression on nonrepressing carbon sources. We have also characterized the regulation of CYB2 in strains carrying null mutation in two other glucose repression genes, HXK2 and SSN6, and show that HXK2 is a negative regulator of CYB2, whereas SSN6 appears to be a positive effector of CYB2 expression.

  15. Phosphate regulation of gene expression in Vibrio parahaemolyticus.

    PubMed Central

    McCarter, L L; Silverman, M

    1987-01-01

    The synthesis of a major outer membrane protein, OmpP, in Vibrio parahaemolyticus was induced by growth in media deficient in phosphate. The gene, ompP, encoding this protein was cloned. Synthesis of OmpP in Escherichia coli was regulated by the availability of phosphate, and this control required the function of pho regulatory genes of E. coli. Analysis of gene fusion strains constructed by mutagenesis with transposon mini-Mulux revealed that ompP was transcriptionally regulated in V. parahaemolyticus. Impaired growth of a strain with an ompP defect was observed in media which contained large linear polyphosphates as the phosphate source. This and other evidence suggested that OmpP functions as a porin channel for the entry of phosphate into the cell. A number of other proteins or activities were induced by phosphate limitation including hemolysin, phospholipase C, and phosphatase activities. A regulatory locus controlling expression of phosphate-regulated genes was identified and cloned. This regulatory locus cloned from V. parahaemolyticus was shown to complement E. coli strains with defects in pho regulatory genes. Images PMID:3038839

  16. Transcriptional regulation of cathelicidin genes in chicken bone marrow cells.

    PubMed

    Lee, Sang In; Jang, Hyun June; Jeon, Mi-hyang; Lee, Mi Ock; Kim, Jeom Sun; Jeon, Ik-Soo; Byun, Sung June

    2016-04-01

    Cathelicidins form a family of vertebrate-specific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription factors (TFs) that bind to the 5'-flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5'-flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.

  17. Cortical spreading depression and gene regulation: relevance to migraine.

    PubMed

    Choudhuri, Rajani; Cui, Lisa; Yong, Chi; Bowyer, Susan; Klein, Robert M; Welch, K M A; Berman, Nancy E J

    2002-04-01

    Cortical spreading depression (CSD) may be the underlying mechanism of migraine aura. The role of CSD in initiating a migraine headache remains to be determined, but it might involve specific changes in gene expression in the brain. To examine these changes, four episodes of CSD at 5-minute intervals were induced in the mouse brain by application of 300mM KCl, and gene expression was examined 2 hours later using cDNA array and reverse transcriptase-polymerase chain reaction. Controls consisted of groups that received anesthesia only, attachment of recording electrodes only, and application of 0.9% NaCl. Of the over 1,180 genes examined in our experiments, those consistently regulated by CSD included vasoactive peptides; the vasodilator atrial natriuretic peptide was induced by CSD, while the vasoconstrictor neuropeptide Y was downregulated. Other genes specifically regulated by CSD were involved in oxidative stress responses (major prion protein, glutathione-S-transferase-5, and apolipoprotein E). L-type calcium channel mRNA was upregulated. In summary, CSD regulates genes that are intrinsic to its propagation, that identify accompanying vascular responses as a potential source of pain, and that protect against its potential pathological consequences. We believe these observations have strong relevance to the mechanisms of migraine and its outcomes.

  18. Androgen-induced Rhox homeobox genes modulate the expression of AR-regulated genes.

    PubMed

    Hu, Zhiying; Dandekar, Dineshkumar; O'Shaughnessy, Peter J; De Gendt, Karel; Verhoeven, Guido; Wilkinson, Miles F

    2010-01-01

    Rhox5, the founding member of the reproductive homeobox on the X chromosome (Rhox) gene cluster, encodes a homeodomain-containing transcription factor that is selectively expressed in Sertoli cells, where it promotes the survival of male germ cells. To identify Rhox5-regulated genes, we generated 15P-1 Sertoli cell clones expressing physiological levels of Rhox5 from a stably transfected expression vector. Microarray analysis identified many genes altered in expression in response to Rhox5, including those encoding proteins controlling cell cycle regulation, apoptosis, metabolism, and cell-cell interactions. Fifteen of these Rhox5-regulated genes were chosen for further analysis. Analysis of Rhox5-null male mice indicated that at least nine of these are Rhox5-regulated in the testes in vivo. Many of them have distinct postnatal expression patterns and are regulated by Rhox5 at different postnatal time points. Most of them are expressed in Sertoli cells, indicating that they are candidates to be directly regulated by Rhox5. Transfection analysis with expression vectors encoding different mouse and human Rhox family members revealed that the regulatory response of a subset of these Rhox5-regulated genes is both conserved and redundant. Given that Rhox5 depends on androgen receptor (AR) for expression in Sertoli cells, we examined whether some Rhox5-regulated genes are also regulated by AR. We provide several lines of evidence that this is the case, leading us to propose that RHOX5 serves as a key intermediate transcription factor that directs some of the actions of AR in the testes.

  19. Light-Inducible Gene Regulation with Engineered Zinc Finger Proteins

    PubMed Central

    Polstein, Lauren R.; Gersbach, Charles A.

    2014-01-01

    The coupling of light-inducible protein-protein interactions with gene regulation systems has enabled the control of gene expression with light. In particular, heterodimer protein pairs from plants can be used to engineer a gene regulation system in mammalian cells that is reversible, repeatable, tunable, controllable in a spatiotemporal manner, and targetable to any DNA sequence. This system, Light-Inducible Transcription using Engineered Zinc finger proteins (LITEZ), is based on the blue light-induced interaction of GIGANTEA and the LOV domain of FKF1 that drives the localization of a transcriptional activator to the DNA-binding site of a highly customizable engineered zinc finger protein. This chapter provides methods for modifying LITEZ to target new DNA sequences, engineering a programmable LED array to illuminate cell cultures, and using the modified LITEZ system to achieve spatiotemporal control of transgene expression in mammalian cells. PMID:24718797

  20. Regulation of Cell and Gene Therapy Medicinal Products in Taiwan.

    PubMed

    Lin, Yi-Chu; Wang, Po-Yu; Tsai, Shih-Chih; Lin, Chien-Liang; Tai, Hsuen-Yung; Lo, Chi-Fang; Wu, Shiow-Ing; Chiang, Yu-Mei; Liu, Li-Ling

    2015-01-01

    Owing to the rapid and mature development of emerging biotechnology in the fields of cell culture, cell preservation, and recombinant DNA technology, more and more cell or gene medicinal therapy products have been approved for marketing, to treat serious diseases which have been challenging to treat with current medical practice or medicine. This chapter will briefly introduce the Taiwan Food and Drug Administration (TFDA) and elaborate regulation of cell and gene therapy medicinal products in Taiwan, including regulatory history evolution, current regulatory framework, application and review procedures, and relevant jurisdictional issues. Under the promise of quality, safety, and efficacy of medicinal products, it is expected the regulation and environment will be more flexible, streamlining the process of the marketing approval of new emerging cell or gene therapy medicinal products and providing diverse treatment options for physicians and patients.

  1. Self-targeting by CRISPR: gene regulation or autoimmunity?

    PubMed Central

    Stern, Adi; Keren, Leeat; Wurtzel, Omri; Amitai, Gil; Sorek, Rotem

    2010-01-01

    CRISPR/Cas is a recently discovered prokaryotic immune system, which is based on small RNAs (“spacers”) that restrict phage and plasmid infection. It has been hypothesized that CRISPRs can also regulate self gene expression by utilizing spacers that target self genes. By analyzing CRISPRs from 330 organisms we found that one in every 250 spacers is self targeting, and that such self-targeting occurs in 18% of all CRISPR-bearing organisms. However, complete lack of conservation across species, combined with abundance of degraded repeats near self-targeting spacers, suggests that self-targeting is a consequence of autoimmunity rather than gene regulation. We propose that accidental incorporation of self nucleic-acids by CRISPR can incur an autoimmune fitness cost, which may explain the abundance of degraded CRISPR systems across prokaryotes. PMID:20598393

  2. Hypoxia-mediated regulation of gene expression in mammalian cells

    PubMed Central

    Shih, Shu-Ching; Claffey, Kevin P.

    1998-01-01

    The molecular mechanism underlying oxygen sensing in mammalian cells has been extensively investigated in the areas of glucose transport, glycolysis, erythropoiesis, angiogenesis and catecholamine metabolism. Expression of functionally operative representative proteins in these specific areas, such as the glucose transporter 1, glycolytic enzymes, erythropoietin, vascular endothelial growth factor and tyrosine hydroxylase are all induced by hypoxia. Recent studies demonstrated that both transcriptional activation and post-transcriptional mechanisms are important to the hypoxia-mediated regulation of gene expression. In this article, the cis-acting elements and trans-acting factors involved in the transcriptional activation of gene expression will be reviewed. In addition, the mechanisms of post-transcriptional mRNA stabilization will also be addressed. We will discuss whether these two processes of regulation of hypoxia-responsive genes are mechanistically linked and co-operative in nature. PMID:10319016

  3. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    PubMed Central

    2009-01-01

    Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in mycelium with primordia and a

  4. Coordinately up-regulated genes in ovarian cancer.

    PubMed

    Hough, C D; Cho, K R; Zonderman, A B; Schwartz, D R; Morin, P J

    2001-05-15

    A better understanding of the molecular circuitry in normal ovarian tissues and in ovarian cancer will likely provide new targets for diagnosis and therapy. Recently, much has been learned about the genes expressed in ovarian cancer through studies with cDNA arrays and serial analysis of gene expression. However, these methods do not allow highly quantitative analysis of gene expression on a large number of specimens. Here, we have used quantitative real-time RT-PCR in a panel of 39 microdissected ovarian carcinomas of various subtypes to systematically analyze the expression of 13 genes, many of which were previously identified as up-regulated in a subset of ovarian cancers by serial analyses of gene expression. The genes analyzed are glutathione peroxidase 3 (GPX3), apolipoprotein J/clusterin, insulin-like growth factor-binding protein 2, epithelial cell adhesion molecule/GA733-2, Kop protease inhibitor, matrix gla protein, tissue inhibitor of metalloproteinase 3, folate receptor 1, S100A2, signal transducer and activator of transcription 1, secretory leukocyte protease inhibitor, apolipoprotein E, and ceruloplasmin. All of the genes were found overexpressed, some at extremely high levels, in the vast majority of ovarian carcinomas irrespective of the subtype. Interestingly, GPX3 was found at much higher levels in tumors with clear cell histology and may represent a biomarker for this subtype. Some of the genes studied here may thus represent targets for early detection ovarian cancer. The gene expression patterns were not associated with age at diagnosis, stage, or K-ras mutation status in ovarian cancer. We find that several genes are coordinately regulated in ovarian cancer, likely representing the fact that many genes are activated as part of common signaling pathways or that extensive cross-talk exists between several pathways in ovarian cancer. A statistical analysis shows that genes commonly up-regulated in ovarian cancer may result from the aberrant

  5. The circadian Clock gene regulates acrosin activity of sperm through serine protease inhibitor A3K

    PubMed Central

    Cheng, Shuting; Liang, Xin; Wang, Yuhui; Jiang, Zhou; Liu, Yanyou; Hou, Wang; Li, Shiping; Zhang, Jing

    2015-01-01

    Our previous study found that CLOCK knockdown in the testes of male mice led to a reduced fertility, which might be associated with the lower acrosin activity. In this present study, we examined the differential expression in proteins of CLOCK knockdown sperm. Clock gene expression was knocked down in cells to confirm those differentially expressions and serine protease inhibitor SERPINA3K was identified as a potential target. The up-regulated SERPINA3K revealed an inverse relationship with Clock knockdown. Direct treatment of normal sperm with recombinant SERPINA3K protein inhibited the acrosin activity and reduced in vitro fertilization rate. The luciferase reporter gene assay showed that the down-regulated of Clock gene could activate the Serpina3k promoter, but this activation was not affected by the mutation of E-box core sequence. Co-IP demonstrated a natural interaction between SERPIAN3K and RORs (α and β). Taken together, these results demonstrated that SERPINA3K is involved in the Clock gene-mediated male fertility by regulating acrosin activity and provide the first evidence that SERPINA3K could be regulated by Clock gene via retinoic acid-related orphan receptor response elements. PMID:26264441

  6. Genes affecting heading date in cocksfoot (Dactylis glomerata)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several genes cause well known effects on heading date in cool-season forages: Vrn1, Constans, and FloweringTime. Vrn1 is a MADs box transcription factor that is induced upon vernalization and necessary for flowering. Constans genes are induced upon long days in cool-season grasses and induce exp...

  7. Factors affecting the regulation of pacing: current perspectives

    PubMed Central

    Mauger, Alexis R

    2014-01-01

    During prolonged dynamic and rhythmic exercise, muscular pain and discomfort arises as a result of an increased concentration of deleterious metabolites. Sensed by peripheral nociceptors and transmitted via afferent feedback to the brain, this provides important information regarding the physiological state of the muscle. These sensations ultimately contribute to what is termed “exercise-induced pain”. Despite being well recognized by athletes and coaches, and suggested to be integral to exercise performance, this construct has largely escaped attention in experimental work. This perspective article highlights the current understanding of pacing in endurance performance, and the causes of exercise-induced pain. A new perspective is described, which proposes how exercise-induced pain may be a contributing factor in helping individuals to regulate their work rate during exercise and thus provides an important construct in pacing. PMID:25228823

  8. Nongenic transcription, gene regulation and action at a distance.

    PubMed

    Cook, Peter R

    2003-11-15

    In eukaryotes, motifs such as silencers, enhancers and locus control regions act over thousands of base pairs to regulate adjacent genes; insulators limit such effects, and barriers confine repressive heterochromatin to particular chromosomal segments. Recent results show that many of these motifs are nongenic transcription units, and two of them directly contact their targets lying further down the chromosome to loop the intervening DNA: the barriers (scs and scs') flanking the 87A7 heat-shock locus in the fly contact each other, and a locus control region touches the beta-globin gene in the mouse. I hypothesize that the act of transcription underlies the function of these regulators; active polymerizing complexes tend to cluster into 'factories' and this facilitates molecular contact between the transcribed regulator and its distant (and transcribed) target. PMID:14576342

  9. RBM20, a gene for hereditary cardiomyopathy, regulates titin splicing

    PubMed Central

    Guo, Wei; Schafer, Sebastian; Greaser, Marion L.; Radke, Michael H.; Liss, Martin; Govindarajan, Thirupugal; Maatz, Henrike; Schulz, Herbert; Li, Shijun; Parrish, Amanda M.; Dauksaite, Vita; Vakeel, Padmanabhan; Klaassen, Sabine; Gerull, Brenda; Thierfelder, Ludwig; Regitz-Zagrosek, Vera; Hacker, Timothy A.; Saupe, Kurt W.; Dec, G. William; Ellinor, Patrick T.; MacRae, Calum A.; Spallek, Bastian; Fischer, Robert; Perrot, Andreas; Özcelik, Cemil; Saar, Kathrin; Hubner, Norbert; Gotthardt, Michael

    2013-01-01

    Alternative splicing plays a major role in the adaptation of cardiac function exemplified by the isoform switch of titin, which adjusts ventricular filling. We previously identified a rat strain deficient in titin splicing. Using genetic mapping, we found a loss-of-function mutation in RBM20 as the underlying cause for the pathological titin isoform expression. Mutations in human RBM20 have previously been shown to cause dilated cardiomyopathy. We showed that the phenotype of Rbm20 deficient rats resembles the human pathology. Deep sequencing of the human and rat cardiac transcriptome revealed an RBM20 dependent regulation of alternative splicing. Additionally to titin we identified a set of 30 genes with conserved regulation between human and rat. This network is enriched for genes previously linked to cardiomyopathy, ion-homeostasis, and sarcomere biology. Our studies emphasize the importance of posttranscriptional regulation in cardiac function and provide mechanistic insights into the pathogenesis of human heart failure. PMID:22466703

  10. Flavonoid biosynthesis-related genes in grape skin are differentially regulated by temperature and light conditions.

    PubMed

    Azuma, Akifumi; Yakushiji, Hiroshi; Koshita, Yoshiko; Kobayashi, Shozo

    2012-10-01

    Temperature and light are important environmental factors that affect flavonoid biosynthesis in grape berry skin. However, the interrelationships between temperature and light effects on flavonoid biosynthesis have not been fully elucidated at the molecular level. Here, we investigated the effects of temperature and light conditions on the biosynthesis of flavonoids (anthocyanins and flavonols) and the expression levels of related genes in an in vitro environmental experiment using detached grape berries. Sufficient anthocyanin accumulation in the grape skin was observed under a low temperature (15 °C) plus light treatment, whereas high temperature (35 °C) or dark treatment severely suppressed anthocyanin accumulation. This indicates that the accumulation of anthocyanins is dependent on both low temperature and light. qRT-PCR analysis showed that the responses of three MYB-related genes (VlMYBA1-3, VlMYBA1-2, and VlMYBA2) to temperature and light differed greatly even though the products of all three genes had the ability to regulate anthocyanin biosynthesis pathway genes. Furthermore, the expression levels of other MYB-related genes and many flavonoid biosynthesis pathway genes were regulated independently by temperature and light. We also found that temperature and light conditions affected the anthocyanin composition in the skin through the regulation of flavonoid biosynthesis pathway genes. Our results suggest that low temperature and light have a synergistic effect on the expression of genes in the flavonoid biosynthesis pathway. These findings provide new information about the relationships between environmental factors and flavonoid accumulation in grape berry skin.

  11. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    PubMed

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-01

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  12. Multiple Yeast Genes, Including Paf1 Complex Genes, Affect Telomere Length via Telomerase RNA Abundance▿ †

    PubMed Central

    Mozdy, Amy D.; Podell, Elaine R.; Cech, Thomas R.

    2008-01-01

    Twofold reductions in telomerase RNA levels cause telomere shortening in both humans and the yeast Saccharomyces cerevisiae. To test whether multiple genes that affect telomere length act by modulating telomerase RNA abundance, we used real-time reverse transcription-PCR to screen S. cerevisiae deletion strains reported to maintain shorter or longer telomeres to determine the levels of their telomerase RNA (TLC1) abundance. Of 290 strains screened, 5 had increased TLC1 levels; 4 of these maintained longer telomeres. Twenty strains had decreased TLC1 levels; 18 of these are known to maintain shorter telomeres. Four strains with decreased TLC1 RNA levels contained deletions of subunits of Paf1C (polymerase II-associated factor complex). While Paf1C had been implicated in the transcription of both polyadenylated and nonpolyadenylated RNAs, Paf1C had not been associated previously with the noncoding telomerase RNA. In Paf1C mutant strains, TLC1 overexpression partially rescues telomere length and cell growth defects, suggesting that telomerase RNA is a critical direct or indirect Paf1C target. Other factors newly identified as affecting TLC1 RNA levels include cyclin-dependent kinase, the mediator complex, protein phosphatase 2A, and ribosomal proteins L13B and S16A. This report establishes that a subset of telomere length genes act by modulating telomerase RNA abundance. PMID:18411302

  13. Living without Oxygen: Anoxia-Responsive Gene Expression and Regulation.

    PubMed

    Larade, Kevin; Storey, Kenneth B

    2009-04-01

    Many species of marine mollusks demonstrate exceptional capacities for long term survival without oxygen. Analysis of gene expression under anoxic conditions, including the subsequent translational responses, allows examination of the functional mechanisms that support and regulate natural anaerobiosis and permit noninjurious transitions between aerobic and anoxic states. Identification of stress-specific gene expression can provide important insights into the metabolic adaptations that are needed for anoxia tolerance, with potential applications to anoxia-intolerant systems. Various methods are available to do this, including high throughput microarray screening and construction and screening of cDNA libraries. Anoxia-responsive genes have been identified in mollusks; some have known functions in other organisms but were not previously linked with anoxia survival. In other cases, completely novel anoxia-responsive genes have been discovered, some that show known motifs or domains that hint at function. Selected genes are expressed at different times over an anoxia-recovery time course with their transcription and translation being actively regulated to ensure protein expression at the optimal time. An examination of transcript status over the course of anoxia exposure and subsequent aerobic recovery identifies genes, and the proteins that they encode, that enhance cell survival under oxygen-limited conditions. Analysis of data generated from non-mainstream model systems allows for insight into the response by cells to anoxia stress. PMID:19794879

  14. Inference of gene regulation functions from dynamic transcriptome data

    PubMed Central

    Hillenbrand, Patrick; Maier, Kerstin C; Cramer, Patrick; Gerland, Ulrich

    2016-01-01

    To quantify gene regulation, a function is required that relates transcription factor binding to DNA (input) to the rate of mRNA synthesis from a target gene (output). Such a ‘gene regulation function’ (GRF) generally cannot be measured because the experimental titration of inputs and simultaneous readout of outputs is difficult. Here we show that GRFs may instead be inferred from natural changes in cellular gene expression, as exemplified for the cell cycle in the yeast S. cerevisiae. We develop this inference approach based on a time series of mRNA synthesis rates from a synchronized population of cells observed over three cell cycles. We first estimate the functional form of how input transcription factors determine mRNA output and then derive GRFs for target genes in the CLB2 gene cluster that are expressed during G2/M phase. Systematic analysis of additional GRFs suggests a network architecture that rationalizes transcriptional cell cycle oscillations. We find that a transcription factor network alone can produce oscillations in mRNA expression, but that additional input from cyclin oscillations is required to arrive at the native behaviour of the cell cycle oscillator. DOI: http://dx.doi.org/10.7554/eLife.12188.001 PMID:27652904

  15. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds

    PubMed Central

    Chai, Zhenguang; Guo, Wenzhu; Chen, Rumei; Wang, Lei; Zhao, Jun; Lang, Zhihong; Fan, Yunliu; Zhao, Jiuran; Zhang, Chunyi

    2015-01-01

    Background Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it’s a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively. Results The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis. Conclusions In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs. PMID:26469520

  16. The regulation of gene expression in hair cells.

    PubMed

    Ryan, Allen F; Ikeda, Ryoukichi; Masuda, Masatsugu

    2015-11-01

    No genes have been discovered for which expression is limited only to inner ear hair cells. This is hardly surprising, since the number of mammalian genes is estimated to be 20-25,000, and each gene typically performs many tasks in various locations. Many genes are expressed in inner ear sensory cells and not in other cells of the labyrinth. However, these genes are also expressed in other locations, often in other sensory or neuronal cell types. How gene transcription is directed specifically to hair cells is unclear. Key transcription factors that act during development can specify cell phenotypes, and the hair cell is no exception. The transcription factor ATOH1 is well known for its ability to transform nonsensory cells of the developing inner ear into hair cells. And yet, ATOH1 also specifies different sensory cells at other locations, neuronal phenotypes in the brain, and epithelial cells in the gut. How it specifies hair cells in the inner ear, but alternate cell types in other locations, is not known. Studies of regulatory DNA and transcription factors are revealing mechanisms that direct gene expression to hair cells, and that determine the hair cell identity. The purpose of this review is to summarize what is known about such gene regulation in this key auditory and vestibular cell type.

  17. The extracellular protein regulator (xpr) affects exoprotein and agr mRNA levels in Staphylococcus aureus.

    PubMed Central

    Hart, M E; Smeltzer, M S; Iandolo, J J

    1993-01-01

    xpr, a regulatory element of exoprotein synthesis in Staphylococcus aureus, defined by an insertion of Tn551 into the chromosome of strain S6C, affects the expression of several exoproteins at the mRNA level. Drastic reduction in transcript levels for staphylococcal enterotoxin B (seb), lipase (geh), alpha-toxin (hla), and delta-toxin (hld) were detected, while mRNA levels for coagulase (coa) and protein A (spa) were elevated. Because the delta-toxin gene resides within the RNAIII transcript of the exoprotein regulator, agr, the reduction in hld message in the mutant strain of S6C is indicative of additional regulatory events in exoprotein gene expression. Northern (RNA) analysis of total cellular RNA hybridized with probes specific for RNAII and RNAIII (the two major transcripts of the agr operon) showed that both transcripts were reduced 16- to 32-fold at 3 h (late exponential phase) and 8- to 16-fold at 12 h (postexponential phase). These data confirm our original findings (M. S. Smeltzer, M. E. Hart, and J. J. Iandolo, Infect. Immun. 61:919-925, 1993) that two regulatory loci, agr and xpr, are interactive at the genotypic level. Images PMID:7504665

  18. How the gene-patenting race is affecting science

    SciTech Connect

    Wuethrich, B.

    1993-09-04

    Since the National Institutes of Health first filed for patents on thousand fragments of human genes in 1992, many researchers are confronting difficult problems arising at the intersection of science, private enterprise, and the law. At present scientists understand the function of fewer than 1,500 human genes. Decoding all these genes in the goal of the Human Genome Project, sponsored by NIH and DOE. This paper discusses the complex practical, political, ethical, and economic issues involved in describing portions of DNA sequences and the patenting (and ownership) of those sequences.

  19. PIAS1 Regulates Breast Tumorigenesis through Selective Epigenetic Gene Silencing

    PubMed Central

    Liu, Bin; Tahk, Samuel; Yee, Kathleen M.; Yang, Randy; Yang, Yonghui; Mackie, Ryan; Hsu, Cary; Chernishof, Vasili; O'Brien, Neil; Jin, Yusheng; Fan, Guoping; Lane, Timothy F.; Rao, Jianyu; Slamon, Dennis; Shuai, Ke

    2014-01-01

    Epigenetic gene silencing by histone modifications and DNA methylation is essential for cancer development. The molecular mechanism that promotes selective epigenetic changes during tumorigenesis is not understood. We report here that the PIAS1 SUMO ligase is involved in the progression of breast tumorigenesis. Elevated PIAS1 expression was observed in breast tumor samples. PIAS1 knockdown in breast cancer cells reduced the subpopulation of tumor-initiating cells, and inhibited breast tumor growth in vivo. PIAS1 acts by delineating histone modifications and DNA methylation to silence the expression of a subset of clinically relevant genes, including breast cancer DNA methylation signature genes such as cyclin D2 and estrogen receptor, and breast tumor suppressor WNT5A. Our studies identify a novel epigenetic mechanism that regulates breast tumorigenesis through selective gene silencing. PMID:24586797

  20. Constitutive Expressor of Pathogenesis-Related Genes5 affects cell wall biogenesis and trichome development

    PubMed Central

    Brininstool, Ginger; Kasili, Remmy; Simmons, L Alice; Kirik, Viktor; Hülskamp, Martin; Larkin, John C

    2008-01-01

    Background The Arabidopsis thaliana CONSTITUTIVE EXPRESSOR OF PATHOGENESIS-RELATED GENES5 (CPR5) gene has been previously implicated in disease resistance, cell proliferation, cell death, and sugar sensing, and encodes a putative membrane protein of unknown biochemical function. Trichome development is also affected in cpr5 plants, which have leaf trichomes that are reduced in size and branch number. Results In the work presented here, the role of CPR5 in trichome development was examined. Trichomes on cpr5 mutants had reduced birefringence, suggesting a difference in cell wall structure between cpr5 and wild-type trichomes. Consistent with this, leaf cell walls of cpr5 plants contained significantly less paracrystalline cellulose and had an altered wall carbohydrate composition. We also found that the effects of cpr5 on trichome size and endoreplication of trichome nuclear DNA were epistatic to the effects of mutations in triptychon (try) or overexpression of GLABRA3, indicating that these trichome developmental regulators are dependant on CPR5 function for their effects on trichome expansion and endoreplication. Conclusion Our results suggest that CPR5 is unlikely to be a specific regulator of pathogen response pathways or senescence, but rather functions either in cell wall biogenesis or in multiple cell signaling or transcription response pathways. PMID:18485217

  1. c-Ha-ras down regulates the alpha-fetoprotein gene but not the albumin gene in human hepatoma cells.

    PubMed Central

    Nakao, K; Lawless, D; Ohe, Y; Miyao, Y; Nakabayashi, H; Kamiya, H; Miura, K; Ohtsuka, E; Tamaoki, T

    1990-01-01

    We studied the effects of transfection of the normal c-Ha-ras gene, rasGly-12, and its oncogenic mutant, rasVal-12, on expression of the alpha-fetoprotein (AFP) and albumin genes in a human hepatoma cell line, HuH-7. The mutant and, to a lesser extent, the normal ras gene caused reduction of the AFP mRNA but not the albumin mRNA level in transfected HuH-7 cells. Cotransfection experiments with a rasVal-12 expression plasmid and a chloramphenicol acetyltransferase reporter gene fused to AFP regulatory sequences showed that rasVal-12 suppressed the activity of enhancer and promoter regions containing A + T-rich sequences (AT motif). In contrast, rasVal-12 did not affect the promoter activity of the albumin and human hepatitis B virus pre-S1 genes even though these promoters contain homologous A + T-rich elements. ras transfection appeared to induce phosphorylation of nuclear proteins that interact with the AFP AT motif, since gel mobility analysis revealed the formation of slow-moving complexes which was reversed by phosphatase treatment. However, similar changes in complex formation were observed with the albumin and hepatitis B surface antigen pre-S1 promoters. Therefore, this effect alone cannot explain the specific down regulation of the AFP promoter and enhancer activity. ras-mediated suppression of the AFP gene may reflect the process of developmental gene regulation in which AFP gene transcription is controlled by a G-protein-linked signal transduction cascade triggered by external growth stimuli. Images PMID:1690841

  2. The vigilance regulation model of affective disorders and ADHD.

    PubMed

    Hegerl, Ulrich; Hensch, Tilman

    2014-07-01

    According to the recently proposed vigilance model of affective disorders (vigilance in the sense of "brain arousal"), manic behaviour is partly interpreted as an autoregulatory attempt to stabilise vigilance by creating a stimulating environment, and the sensation avoidance and withdrawal in Major Depressive Disorder (MDD) is seen as an autoregulatory reaction to tonically increased vigilance. Indeed, using a newly developed EEG-based algorithm, hyperstable vigilance was found in MDD, and the contrary, with rapid drops to sleep stages, in mania. Furthermore, destabilising vigilance (e.g. by sleep deprivation) triggers (hypo)mania and improves depression, whereas stabilising vigilance, e.g. by prolonged sleep, improves mania. ADHD and mania have common symptoms, and the unstable vigilance might be a common pathophysiology. There is even evidence that psychostimulants might ameliorate both ADHD and mania. Hyperactivity of the noradrenergic system could explain both the high vigilance level in MDD and, as recently argued, anhedonia and behavioural inhibition. Interestingly, antidepressants and electroconvulsions decrease the firing rate of neurons in the noradrenergic locus coeruleus, whereas many antimanic drugs have opposite effects.

  3. The LexA regulated genes of the Clostridium difficile

    PubMed Central

    2014-01-01

    Background The SOS response including two main proteins LexA and RecA, maintains the integrity of bacterial genomes after DNA damage due to metabolic or environmental assaults. Additionally, derepression of LexA-regulated genes can result in mutations, genetic exchange and expression of virulence factors. Here we describe the first comprehensive description of the in silico LexA regulon in Clostridium difficile, an important human pathogen. Results We grouped thirty C. difficile strains from different ribotypes and toxinotypes into three clusters according to lexA gene/protein variability. We applied in silico analysis coupled to surface plasmon resonance spectroscopy (SPR) and determined 16 LexA binding sites in C. difficile. Our data indicate that strains within the cluster, as defined by LexA variability, harbour several specific LexA regulon genes. In addition to core SOS genes: lexA, recA, ruvCA and uvrBA, we identified a LexA binding site on the pathogenicity locus (PaLoc) and in the putative promoter region of several genes involved in housekeeping, sporulation and antibiotic resistance. Conclusions Results presented here suggest that in C. difficile LexA is not merely a regulator of the DNA damage response genes but also controls the expression of dozen genes involved in various other biological functions. Our in vitro results indicate that in C. difficile inactivation of LexA repressor depends on repressor`s dissociation from the operators. We report that the repressor`s dissociation rates from operators differentiate, thus the determined LexA-DNA dissociation constants imply on the timing of SOS gene expression in C. difficile. PMID:24713082

  4. Major psychological factors affecting acceptance of gene-recombination technology.

    PubMed

    Tanaka, Yutaka

    2004-12-01

    The purpose of this study was to verify the validity of a causal model that was made to predict the acceptance of gene-recombination technology. A structural equation model was used as a causal model. First of all, based on preceding studies, the factors of perceived risk, perceived benefit, and trust were set up as important psychological factors determining acceptance of gene-recombination technology in the structural equation model. An additional factor, "sense of bioethics," which I consider to be important for acceptance of biotechnology, was added to the model. Based on previous studies, trust was set up to have an indirect influence on the acceptance of gene-recombination technology through perceived risk and perceived benefit in the model. Participants were 231 undergraduate students in Japan who answered a questionnaire with a 5-point bipolar scale. The results indicated that the proposed model fits the data well, and showed that acceptance of gene-recombination technology is explained largely by four factors, that is, perceived risk, perceived benefit, trust, and sense of bioethics, whether the technology is applied to plants, animals, or human beings. However, the relative importance of the four factors was found to vary depending on whether the gene-recombination technology was applied to plants, animals, or human beings. Specifically, the factor of sense of bioethics is the most important factor in acceptance of plant gene-recombination technology and animal gene-recombination technology, and the factors of trust and perceived risk are the most important factors in acceptance of human being gene-recombination technology.

  5. Signal Transduction Pathways that Regulate CAB Gene Expression

    SciTech Connect

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  6. Signal Transduction Pathways that Regulate CAB Gene Expression

    SciTech Connect

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  7. Combinatorial gene regulation by modulation of relative pulse timing

    PubMed Central

    Lin, Yihan; Sohn, Chang Ho; Dalal, Chiraj K.; Cai, Long; Elowitz, Michael B.

    2015-01-01

    Studies of individual living cells have revealed that many transcription factors activate in dynamic, and often stochastic, pulses within the same cell. However, it has remained unclear whether cells might modulate the relative timing of these pulses to control gene expression. Here, using quantitative single-cell time-lapse imaging of Saccharomyces cerevisiae, we show that the pulsatile transcription factors Msn2 and Mig1 combinatorially regulate their target genes through modulation of their relative pulse timing. The activator Msn2 and repressor Mig1 pulsed in either a temporally overlapping or non-overlapping manner during their transient response to different inputs, with only the non-overlapping dynamics efficiently activating target gene expression. Similarly, under constant environmental conditions, where Msn2 and Mig1 exhibit sporadic pulsing, glucose concentration modulated the temporal overlap between pulses of the two factors. Together, these results reveal a time-based mode of combinatorial gene regulation. Regulation through relative signal timing is common in engineering and neurobiology, and these results suggest that it could also function broadly within the signaling and regulatory systems of the cell. PMID:26466562

  8. Reconstructing a network of stress-response regulators via dynamic system modeling of gene regulation.

    PubMed

    Wu, Wei-Sheng; Li, Wen-Hsiung; Chen, Bor-Sen

    2008-02-10

    Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs) that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene's expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA) to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specific stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably sufficient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.

  9. Y-chromosomal genes affecting male fertility: A review.

    PubMed

    Dhanoa, Jasdeep Kaur; Mukhopadhyay, Chandra Sekhar; Arora, Jaspreet Singh

    2016-07-01

    The mammalian sex-chromosomes (X and Y) have evolved from autosomes and are involved in sex determination and reproductive traits. The Y-chromosome is the smallest chromosome that consists of 2-3% of the haploid genome and may contain between 70 and 200 genes. The Y-chromosome plays major role in male fertility and is suitable to study the evolutionary relics, speciation, and male infertility and/or subfertility due to its unique features such as long non-recombining region, abundance of repetitive sequences, and holandric inheritance pattern. During evolution, many holandric genes were deleted. The current review discusses the mammalian holandric genes and their functions. The commonly encountered infertility and/or subfertility problems due to point or gross mutation (deletion) of the Y-chromosomal genes have also been discussed. For example, loss or microdeletion of sex-determining region, Y-linked gene results in XY males that exhibit female characteristics, deletion of RNA binding motif, Y-encoded in azoospermic factor b region results in the arrest of spermatogenesis at meiosis. The holandric genes have been covered for associating the mutations with male factor infertility. PMID:27536043

  10. Y-chromosomal genes affecting male fertility: A review

    PubMed Central

    Dhanoa, Jasdeep Kaur; Mukhopadhyay, Chandra Sekhar; Arora, Jaspreet Singh

    2016-01-01

    The mammalian sex-chromosomes (X and Y) have evolved from autosomes and are involved in sex determination and reproductive traits. The Y-chromosome is the smallest chromosome that consists of 2-3% of the haploid genome and may contain between 70 and 200 genes. The Y-chromosome plays major role in male fertility and is suitable to study the evolutionary relics, speciation, and male infertility and/or subfertility due to its unique features such as long non-recombining region, abundance of repetitive sequences, and holandric inheritance pattern. During evolution, many holandric genes were deleted. The current review discusses the mammalian holandric genes and their functions. The commonly encountered infertility and/or subfertility problems due to point or gross mutation (deletion) of the Y-chromosomal genes have also been discussed. For example, loss or microdeletion of sex-determining region, Y-linked gene results in XY males that exhibit female characteristics, deletion of RNA binding motif, Y-encoded in azoospermic factor b region results in the arrest of spermatogenesis at meiosis. The holandric genes have been covered for associating the mutations with male factor infertility. PMID:27536043

  11. Diaphanous gene mutation affects spiral cleavage and chirality in snails

    PubMed Central

    Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi

    2016-01-01

    L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420

  12. Y-chromosomal genes affecting male fertility: A review.

    PubMed

    Dhanoa, Jasdeep Kaur; Mukhopadhyay, Chandra Sekhar; Arora, Jaspreet Singh

    2016-07-01

    The mammalian sex-chromosomes (X and Y) have evolved from autosomes and are involved in sex determination and reproductive traits. The Y-chromosome is the smallest chromosome that consists of 2-3% of the haploid genome and may contain between 70 and 200 genes. The Y-chromosome plays major role in male fertility and is suitable to study the evolutionary relics, speciation, and male infertility and/or subfertility due to its unique features such as long non-recombining region, abundance of repetitive sequences, and holandric inheritance pattern. During evolution, many holandric genes were deleted. The current review discusses the mammalian holandric genes and their functions. The commonly encountered infertility and/or subfertility problems due to point or gross mutation (deletion) of the Y-chromosomal genes have also been discussed. For example, loss or microdeletion of sex-determining region, Y-linked gene results in XY males that exhibit female characteristics, deletion of RNA binding motif, Y-encoded in azoospermic factor b region results in the arrest of spermatogenesis at meiosis. The holandric genes have been covered for associating the mutations with male factor infertility.

  13. Antagonistic relationship between AtRALF1and brassinosteroid regulates cellexpansion-related genes

    PubMed Central

    Bergonci, Tábata; Silva-Filho, Marcio C; Moura, Daniel S

    2014-01-01

    Rapid alkalinization factor (RALF) is a peptide signal that plays a role in plant cell expansion. We have recently proposed that AtRALF1 negatively regulates root cell elongation and lateral root formation by opposing the effects of brassinosteroid (BR). We reported 6 AtRALF1-inducible cell wall-related genes and 2 P450 monooxygenase -encoding genes involved in the BR biosynthetic pathway. The AtRALF1-inducible genes implicated in cell wall remodeling were not downregulated by brassinolide (BL) treatment alone; their induction was only compromised following simultaneous treatment with AtRALF1 and BL. We further examined the cell wall-remodeling gene EXPANSIN A5 (AtEXPA5), which is upregulated by BL and has been shown to positively affect root cell elongation. Herein, we report that AtEXPA5 expression is downregulated by AtRALF1 in a dose-dependent manner in the roots and hypocotyls of Arabidopsis plants. AtEXPA5 is also downregulated in plants that overexpress AtRALF1, and it is upregulated in plants in which the AtRALF1 gene is partially silenced. The AtRALF1 peptide is also able to repress AtEXPA5 induction following a pre-treatment with BL. A schematic diagram showing the gene regulatory network connecting the recently reported genes with the regulation of cell expansion by AtEXPA5 is presented. PMID:25482784

  14. Expression profile of genes regulated by curcumin in Y79 retinoblastoma cells.

    PubMed

    Sreenivasan, Seethalakshmi; Thirumalai, Karthiyaini; Krishnakumar, Subramanian

    2012-01-01

    Curcumin, a well-known chemopreventive agent from turmeric, inhibits the expression of several oncogenes and cell proliferation genes in tumor cells. This study aims to understand the precise molecular mechanism by which curcumin exerts its effects on retinoblastoma cells, by performing whole genome microarray analysis to determine the gene expression profiles altered by curcumin treatment. Curcumin suppressed cell viability and altered the cell cycle of retinoblastoma cells. We identified 903 downregulated genes and 1,319 upregulated genes when compared with the control cells after treatment with 20 μM curcumin concentration for 48 h. These genes were grouped into respective functional categories according to their biological function. We found that curcumin regulated the expression of genes that are involved in the regulation of apoptosis, tumor suppressor, cell-cycle arrest, transcription factor, and angiogenesis. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to validate the results of genome array, and the results were consistent with the obtained data. In conclusion, treatment of curcumin affects the expression of genes involved in various cellular functions and plays an important role in tumor metastasis and apoptosis. Thus, curcumin might be an effective chemopreventive agent for retinoblastoma cancer. PMID:22489823

  15. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement

    PubMed Central

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-01-01

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K+ (K+in) channels and reduced K+in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K+in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K+in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  16. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement.

    PubMed

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-Ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-04-12

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K(+) (K(+) in) channels and reduced K(+) in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K(+) in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K(+) in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  17. Regulation of icaR gene expression in Staphylococcus epidermidis.

    PubMed

    Conlon, Kevin M; Humphreys, Hilary; O'Gara, James P

    2002-11-01

    LightCycler and conventional reverse transcription-polymerase chain reaction (RT-PCR) were used to examine regulation of icaR, which encodes a repressor of the Staphylococcus epidermidis ica operon. Varying concentrations of NaCl and ethanol activated ica but only high levels of both compounds repressed icaR transcription. Activation of ica by subinhibitory concentrations of tetracycline, which was strain-dependent, was also associated with icaR repression. In an ICAR::Em mutant, NaCl but not ethanol activated ica whereas both compounds repressed icaR expression indicating that environmental regulation of the icaR gene is IcaR-independent. Apparently ethanol signals exclusively through IcaR to activate ica and regulates IcaR at the transcriptional and posttranscriptional levels. NaCl also regulates icaR expression but in addition can activate ica via an icaR-independent pathway.

  18. Regulation of icaR gene expression in Staphylococcus epidermidis.

    PubMed

    Conlon, Kevin M; Humphreys, Hilary; O'Gara, James P

    2002-11-01

    LightCycler and conventional reverse transcription-polymerase chain reaction (RT-PCR) were used to examine regulation of icaR, which encodes a repressor of the Staphylococcus epidermidis ica operon. Varying concentrations of NaCl and ethanol activated ica but only high levels of both compounds repressed icaR transcription. Activation of ica by subinhibitory concentrations of tetracycline, which was strain-dependent, was also associated with icaR repression. In an ICAR::Em mutant, NaCl but not ethanol activated ica whereas both compounds repressed icaR expression indicating that environmental regulation of the icaR gene is IcaR-independent. Apparently ethanol signals exclusively through IcaR to activate ica and regulates IcaR at the transcriptional and posttranscriptional levels. NaCl also regulates icaR expression but in addition can activate ica via an icaR-independent pathway. PMID:12435499

  19. Carbon Catabolite Repression Regulates Glyoxylate Cycle Gene Expression in Cucumber.

    PubMed Central

    Graham, I. A.; Denby, K. J.; Leaver, C. J.

    1994-01-01

    We have previously proposed that metabolic status is important in the regulation of cucumber malate synthase (MS) and isocitrate lyase (ICL) gene expression during plant development. In this article, we used a cell culture system to demonstrate that intracellular metabolic status does influence expression of both of these genes. Starvation of cucumber cell cultures resulted in the coordinate induction of the expression of MS and ICL genes, and this effect was reversed when sucrose was returned to the culture media. The induction of gene expression was closely correlated with a drop in intracellular sucrose, glucose, and fructose below threshold concentrations, but it was not correlated with a decrease in respiration rate. Glucose, fructose, or raffinose in the culture media also resulted in repression of MS and ICL. Both 2-deoxyglucose and mannose, which are phosphorylated by hexokinase but not further metabolized, specifically repressed MS and ICL gene expression relative to a third glyoxylate cycle gene, malate dehydrogenase. However, the addition of 3-methylglucose, an analog of glucose that is not phosphorylated, did not result in repression of either MS or ICL. It is proposed that the signal giving rise to a change in gene expression originates from the intracellular concentration of hexose sugars or the flux of hexose sugars into glycolysis. PMID:12244257

  20. Structure and regulation of the murine gamma-casein gene.

    PubMed

    Kolb, Andreas F

    2002-12-12

    The murine casein locus consists of five genes, which are coordinately regulated during mammary development. The levels of casein-specific mRNAs in mammary epithelial cells increase during the second half of pregnancy and remain high during lactation. The murine gamma-casein gene, which corresponds to the alphaS2-casein gene in ruminants, was isolated from a mouse bacterial artificial chromosome (BAC) library (strain 129SV). The gene contains 14 exons, which are distributed over 14 kb of DNA sequence. The expression pattern of the murine gamma-casein gene mimics that of the neighbouring beta-casein gene in terms of developmental induction in vivo. In cell culture, both the beta- and gamma-casein promoter are synergistically induced by prolactin and glucocorticoids. Glucocorticoid induction is critically dependent on prolactin-mediated activation of STAT5 in both promoters. Several consensus STAT5 binding sites were identified in the gamma-casein promoter, some of which may have an additive effect on prolactin induction. mRNA levels of gamma- and beta-casein are similar in lactating mammary tissue. However, promoter segments derived from the gamma-casein gene are significantly less active in cell culture than comparable fragments of the beta-casein promoter. Promoter hybrids between the gamma- and beta-casein promoters revealed that the critical sequences which are responsible for the different in vitro activity are located in a short promoter proximal region.

  1. Complex structure and regulation of the ABP/SHBG gene.

    PubMed

    Joseph, D R; Sullivan, P M; Wang, Y M; Millhorn, D E; Bayliss, D M

    1991-01-01

    Extracellular androgen-binding proteins (ABPs) are thought to modulate the regulatory functions of androgens and the trans-acting nuclear androgen receptor. Testicular ABP and plasma sex hormone-binding globulin (SHBG), which is produced in the liver, are encoded by the same gene. We report here that the ABP/SHBG gene is also expressed in fetal rat liver and adult brain. Immunoreactive ABP was localized in the brain and fetal liver and mRNAs were identified in both tissues by northern blot hybridization. Analysis of brain and fetal liver cDNA clones revealed alternatively processed RNAs with sequence characteristics suggesting the encoded proteins could act as competitors of ABP/SHBG binding to cell surface receptors. One cDNA represented a fused transcript of the ABP/SHBG gene and the histidine decarboxylase gene that was apparently formed by a trans-splicing process. Gene sequencing experiments indicate that tissue-specific ABP/SHBG gene promoter-enhancer elements are utilized in testis, brain and fetal liver. These data demonstrate that the structure, RNA transcript processing and likely regulation of the ABP/SHBG gene are very complex. PMID:1958575

  2. Transcriptional profiling reveals regulated genes in the hippocampus during memory formation

    NASA Technical Reports Server (NTRS)

    Donahue, Christine P.; Jensen, Roderick V.; Ochiishi, Tomoyo; Eisenstein, Ingrid; Zhao, Mingrui; Shors, Tracey; Kosik, Kenneth S.

    2002-01-01

    Transcriptional profiling (TP) offers a powerful approach to identify genes activated during memory formation and, by inference, the molecular pathways involved. Trace eyeblink conditioning is well suited for the study of regional gene expression because it requires the hippocampus, whereas the highly parallel task, delay conditioning, does not. First, we determined when gene expression was most regulated during trace conditioning. Rats were exposed to 200 trials per day of paired and unpaired stimuli each day for 4 days. Changes in gene expression were most apparent 24 h after exposure to 200 trials. Therefore, we profiled gene expression in the hippocampus 24 h after 200 trials of trace eyeblink conditioning, on multiple arrays using additional animals. Of 1,186 genes on the filter array, seven genes met the statistical criteria and were also validated by real-time polymerase chain reaction. These genes were growth hormone (GH), c-kit receptor tyrosine kinase (c-kit), glutamate receptor, metabotropic 5 (mGluR5), nerve growth factor-beta (NGF-beta), Jun oncogene (c-Jun), transmembrane receptor Unc5H1 (UNC5H1), and transmembrane receptor Unc5H2 (UNC5H2). All these genes, except for GH, were downregulated in response to trace conditioning. GH was upregulated; therefore, we also validated the downregulation of the GH inhibitor, somatostatin (SST), even though it just failed to meet criteria on the arrays. By during situ hybridization, GH was expressed throughout the cell layers of the hippocampus in response to trace conditioning. None of the genes regulated in trace eyeblink conditioning were similarly affected by delay conditioning, a task that does not require the hippocampus. These findings demonstrate that transcriptional profiling can exhibit a repertoire of genes sensitive to the formation of hippocampal-dependent associative memories.

  3. Cartilage tissue engineering: recent advances and perspectives from gene regulation/therapy.

    PubMed

    Li, Kuei-Chang; Hu, Yu-Chen

    2015-05-01

    Diseases in articular cartilages affect millions of people. Despite the relatively simple biochemical and cellular composition of articular cartilages, the self-repair ability of cartilage is limited. Successful cartilage tissue engineering requires intricately coordinated interactions between matrerials, cells, biological factors, and phycial/mechanical factors, and still faces a multitude of challenges. This article presents an overview of the cartilage biology, current treatments, recent advances in the materials, biological factors, and cells used in cartilage tissue engineering/regeneration, with strong emphasis on the perspectives of gene regulation (e.g., microRNA) and gene therapy.

  4. Cytogenetic and molecular localization of tipE: A gene affecting sodium channels in Drosophila melanogaster

    SciTech Connect

    Feng, G.; Deak, P.; Hall, L.M.

    1995-04-01

    Voltage-sensitive sodium channels play a key role in nerve cells where they are responsible for the increase in sodium permeability during the rising phase of action potentials. In Drosophila melanogaster a subset of temperature-sensitive paralytic mutations affect sodium channel function. One such mutation is temperature-induced paralysis locus E (tipE), which has been shown by electrophysiology and ligand binding studies to reduce sodium channel numbers. Three new {gamma}-ray-induced tipE alleles associated with either visible deletions in 64AB or a translocation breakpoint within 64B2 provide landmarks for positional cloning of tipE. Beginning with the flanking cloned gene Ras2, a 140-kb walk across the translocation breakpoint was completed. Germline transformation using a 42-kb cosmid clone and successively smaller subclones localized the tipE gene within a 7.4-kb genomic DNA segment. Although this chromosome region is rich in transcripts, only three overlapping mRNAs (5.4, 4.4, and 1.7 kb) lie completely within the smallest rescuing construct. The small sizes of the rescuing construct and transcripts suggests that tipE does not encode a standard sodium channel {alpha}-subunit with four homologous repeats. Sequencing these transcripts will elucidate the role of the tipE gene product in sodium channel functional regulation. 55 refs., 4 figs., 2 tabs.

  5. Common genes regulate food and ethanol intake in Drosophila.

    PubMed

    Sekhon, Morgan L; Lamina, Omoteniola; Hogan, Kerry E; Kliethermes, Christopher L

    2016-06-01

    The abuse liability of alcohol (ethanol) is believed to result in part from its actions on neurobiological substrates that underlie the motivation toward food and other natural reinforcers, and a growing body of evidence indicates that these substrates are broadly conserved among animal phyla. Understanding the extent to which the substrates regulating ethanol and food intake overlap is an important step toward developing therapeutics that selectively reduce ethanol intake. In the current experiments, we measured food and ethanol intake in Recombinant Inbred (RI) lines of Drosophila melanogaster using several assays, and then calculated genetic correlations to estimate the degree to which common genes might underlie behavior in these assays. We found that food intake and ethanol intake as measured in the capillary assay are genetically correlated traits in D. melanogaster, as well as in a panel of 11 Drosophila species that we tested subsequently. RI line differences in food intake in a dyed food assay were genetically unrelated to ethanol intake in the capillary assay or to ethanol preference measured using an olfactory trap apparatus. Using publicly available gene expression data, we found that expression profiles across the RI lines of a number of genes (including the D2-like dopamine receptor, DOPA decarboxylase, and fruitless) correlated with the RI line differences in food and ethanol intake we measured, while the expression profiles of other genes, including NPF, and the NPF and 5-HT2 receptors, correlated only with ethanol intake or preference. Our results suggest that food and ethanol intake are regulated by some common genes in Drosophila, but that other genes regulate ethanol intake independently of food intake. These results have implications toward the development of therapeutics that preferentially reduce ethanol intake. PMID:27286934

  6. Cloning and regulation of the rat mdr2 gene.

    PubMed Central

    Brown, P C; Thorgeirsson, S S; Silverman, J A

    1993-01-01

    We have cloned the complete cDNA encoding the rat mdr2 gene by a combination of library screening and the polymerase chain reaction. The sequence of rat mdr2 cDNA is highly similar to other members of the mdr gene family but the initiation of transcription, tissue distribution and regulation of expression of rat mdr2 diverge from the other isoforms. Primer extension analysis showed rat mdr2 mRNA to have a major transcription start point at -277 and a minor one at approximately -518. We constructed gene specific probes for rat mdr2 and mdr1b and compared the expression patterns of these two genes. The highest expression of mdr2 mRNA was in the muscle, heart, liver and spleen. Both mdr2 and 1b mRNA levels were elevated in the livers of rats treated with CCl4 or following partial hepatectomies although the time course of induction of each gene differed. Mdr1b increased by 12 to 24 hours while mdr2 did not increase until 48 hours. Treatment of isolated hepatocytes or RC3 cells with cycloheximide did not effect mdr2 mRNA. In contrast, mdr1b expression was increased. These data suggest that rat mdr2, unlike mdr1b, is not regulated by a negative trans-acting protein factor. Images PMID:8103593

  7. Gene trap lines define domains of gene regulation in Arabidopsis petals and stamens.

    PubMed

    Nakayama, Naomi; Arroyo, Juana M; Simorowski, Joseph; May, Bruce; Martienssen, Robert; Irish, Vivian F

    2005-09-01

    To identify genes involved in Arabidopsis thaliana petal and stamen organogenesis, we used a gene trap approach to examine the patterns of reporter expression at each stage of flower development of 1765 gene trap lines. In 80 lines, the reporter gene showed petal- and/or stamen-specific expression or lack of expression, or expression in distinct patterns within the petals and/or the stamens, including distinct suborgan domains of expression, such as tissue-specific lines marking epidermis and vasculature, as well as lines demarcating the proximodistal or abaxial/adaxial axes of the organs. Interestingly, reporter gene expression was typically restricted along the proximodistal axis of petals and stamens, indicating the importance of this developmental axis in patterning of gene expression domains in these organs. We identified novel domains of gene expression along the axis marking the midregion of the petals and apical and basal parts of the anthers. Most of the genes tagged in these 80 lines were identified, and their possible functions in petal and/or stamen differentiation are discussed. We also scored the floral phenotypes of the 1765 gene trap lines and recovered two mutants affecting previously uncharacterized genes. In addition to revealing common domains of gene expression, the gene trap lines reported here provide both useful markers and valuable starting points for reverse genetic analyses of the differentiation pathways in petal and stamen development. PMID:16055634

  8. Dysfunctional chloroplasts up-regulate the expression of mitochondrial genes in Arabidopsis seedlings.

    PubMed

    Liao, Jo-Chien; Hsieh, Wei-Yu; Tseng, Ching-Chih; Hsieh, Ming-Hsiun

    2016-02-01

    Chloroplasts and mitochondria play important roles in maintaining metabolic and energy homeostasis in the plant cell. The interactions between these two organelles, especially photosynthesis and respiration, have been intensively studied. Still, little is known about the regulation of mitochondrial gene expression by chloroplasts and vice versa. The gene expression machineries in chloroplasts and mitochondria rely heavily on the nuclear genome. Thus, the interactions between nucleus and these organelles, including anterograde and retrograde regulation, have been actively investigated in the last two decades. Norflurazon (NF) and lincomycin (Lin) are two commonly used inhibitors to study chloroplast-to-nucleus retrograde signaling in plants. We used NF and Lin to block the development and functions of chloroplasts and examined their effects on mitochondrial gene expression, RNA editing and splicing. The editing of most mitochondrial transcripts was not affected, but the editing extents of nad4-107, nad6-103, and ccmFc-1172 decreased slightly in NF- and Lin-treated seedlings. While the splicing of mitochondrial transcripts was not significantly affected, steady-state mRNA levels of several mitochondrial genes increased significantly in NF- and Lin-treated seedlings. Moreover, Lin seemed to have more profound effects than NF on the expression of mitochondrial genes, indicating that signals derived from these two inhibitors might be distinct. NF and Lin also significantly induced the expression of nuclear genes encoding subunits of mitochondrial electron transport chain complexes. Thus, dysfunctional chloroplasts may coordinately up-regulate the expression of nuclear and mitochondrial genes encoding subunits of respiratory complexes.

  9. Reversible histone methylation regulates brain gene expression and behavior

    PubMed Central

    Xu, Jun; Andreassi, Megan

    2011-01-01

    Epigenetic chromatin remodeling, including reversible histone methylation, regulates gene transcription in brain development and synaptic plasticity. Aberrant chromatin modifications due to mutant chromatin enzymes or chemical exposures have been associated with neurological or psychiatric disorders such as mental retardation, schizophrenia, depression, and drug addiction. Some chromatin enzymes, such as histone demethylases JARID1C and UTX, are coded by X-linked genes which are not X-inactivated in females. The higher expression of JARID1C and UTX in females could contribute to sex differences in brain development and behavior. PMID:20816965

  10. Caesium-affected gene expression in Arabidopsis thaliana.

    PubMed

    Sahr, Tobias; Voigt, Gabriele; Paretzke, Herwig G; Schramel, Peter; Ernst, Dieter

    2005-03-01

    * Excessive caesium can be toxic to plants. Here we investigated Cs uptake and caesium-induced gene expression in Arabidopsis thaliana. * Accumulation was measured in plants grown for 5 wk on agar supplemented with nontoxic and up to toxic levels of Cs. Caesium-induced gene expression was studied by suppression-subtractive hybridization (SSH) and RT-PCR. * Caesium accumulated in leaf rosettes dependent upon the external concentration in the growth media, whereas the potassium concentration decreased in rosettes. At a concentration of 850 microM, Cs plants showed reduced development, and withered with an increase in concentration to 1 mM Cs. SSH resulted in the isolation of 73 clones that were differentially expressed at a Cs concentration of 150 microM. Most of the genes identified belong to groups of genes encoding proteins in stress defence, detoxification, transport, homeostasis and general metabolism, and proteins controlling transcription and translation. * The present study identified a number of marker genes for Cs in Arabidopsis grown under nontoxic Cs concentrations, indicating that Cs acts as an abiotic stress factor.

  11. Irx7, a Smarca4-regulated gene for retinal differentiation, regulates other genes controlled by Smarca4 in zebrafish retinas.

    PubMed

    Zhang, Yuqing; Bonilla, Sylvia; Chong, Leelyn; Leung, Yuk Fai

    2013-01-01

    The iroquois 7 (irx7) in zebrafish encodes a homeodomain transcription factor (TF) in the retinal differentiation network regulated by smarca4, a component of chromatin remodeling complex. The function of Irx7 on retinal development has recently been revealed by antisense morpholino knockdown experiments. In particular, the normal expression of irx7 in the inner nuclear layer (INL) is essential for the differentiation of cells in the INL and the outer nuclear layer (ONL), as well as the dendritic projection of GCs into the inner plexiform layer (IPL). Irx7 also exerts its effect on retinal differentiation through activating the expression of TFs that specify various retinal cell types. However, the relationship between irx7 and the other Smarca4-regulated genes for retinal differentiation was not clear. This study reports an investigation of the regulatory role of irx7 on 13 genes including aanat2, barhl2, bhlhe22, cdh11, ckmt1, gnat1, irx4a, ndrg1a, nme2l, pbx1a, rcv1, robo2 and tfap2a. These genes were originally used in a study that characterized the cellular expression pattern of Smarca4-regulated genes and had a diverse expression pattern in the retina. Their expression in the normal wild-type (WT), Irx7-knockdown and the injection control embryos was characterized by in situ hybridization at 52h post-fertilization (hpf). This is the stage when irx7's expression level is the highest in the developing retinas. The results indicate that the expression of 11 of the 13 genes was reduced and one was overexpressed in the Irx7-knockdown retinas. Consistent with a previous report, one of these 13 genes was not expressed in the retina. Among the 12 Irx7-regulated genes, 11 had an expression change in the Irx7-knockdown retinas similar to that in the smarca4 retinas, indicating that Smarca4 regulates the expression of these 11 genes at least in part through irx7. Interestingly, bhlhe22 was only over-expressed in the Irx7-knockdown but not the smarca4 retinas. These

  12. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves.

    PubMed

    Christiansen, Michael W; Gregersen, Per L

    2014-07-01

    The senescence process of plants is important for the completion of their life cycle, particularly for crop plants, it is essential for efficient nutrient remobilization during seed filling. It is a highly regulated process, and in order to address the regulatory aspect, the role of genes in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription-PCR (qRT-PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47 studied NAC genes to be important for signalling processes and for the execution of degradation processes during leaf senescence in barley. Seven models for DNA-binding motifs for NAC transcription factors were designed based on published motifs, and available promoter sequences of barley genes were screened for the motifs. Genes up-regulated during senescence showed a significant over-representation of the motifs, suggesting regulation by the NAC transcription factors. Furthermore, co-regulation studies showed that genes possessing the motifs in the promoter in general were highly co-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71 senescence-associated genes that are potential target genes for these NAC transcription factors is presented.

  13. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene

    PubMed Central

    Zhou, Jiawei

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  14. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene.

    PubMed

    Li, Yan; Wang, Lei; Zhou, Jiawei; Li, Fenge

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (-418 bp to -3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  15. Genes regulated by AoXlnR, the xylanolytic and cellulolytic transcriptional regulator, in Aspergillus oryzae.

    PubMed

    Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo

    2009-11-01

    XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.

  16. The uteroglobin gene region: hormonal regulation, repetitive elements and complete nucleotide sequence of the gene.

    PubMed Central

    Suske, G; Wenz, M; Cato, A C; Beato, M

    1983-01-01

    Differential uteroglobin induction represents an appropriate model for the molecular analysis of the mechanism by which steroid hormones control gene expression in mammals. We have analyzed the structure and hormonal regulation of a 35 Kb region of genomic DNA in which the uteroglobin gene is located. The complete sequence of 3,700 nucleotides including the uteroglobin gene and its flanking regions has been determined, and the limits of the gene established by S1 nuclease mapping. Several regions containing repeated sequences were mapped by blot hybridization, one of which is located within the large intron in the uteroglobin gene. Analysis of the RNAs extracted from endometrium, lung and liver, after treatment with estrogen and/or progesterone shows that within the 35 Kb region, the uteroglobin gene is the only DNA segment whose transcription into stable RNA is induced by progesterone. Images PMID:6304644

  17. Paralogue Interference Affects the Dynamics after Gene Duplication.

    PubMed

    Kaltenegger, Elisabeth; Ober, Dietrich

    2015-12-01

    Proteins tend to form homomeric complexes of identical subunits, which act as functional units. By definition, the subunits are encoded from a single genetic locus. When such a gene is duplicated, the gene products are suggested initially to cross-interact when coexpressed, thus resulting in the phenomenon of paralogue interference. In this opinion article, we explore how paralogue interference can shape the fate of a duplicated gene. One important outcome is a prolonged time window in which both copies remain under selection increasing the chance to accumulate mutations and to develop new properties. Thereby, paralogue interference can mediate the coevolution of duplicates and here we illustrate the potential of this phenomenon in light of recent new studies. PMID:26638775

  18. Zebrafish rest regulates developmental gene expression but not neurogenesis.

    PubMed

    Kok, Fatma O; Taibi, Andrew; Wanner, Sarah J; Xie, Xiayang; Moravec, Cara E; Love, Crystal E; Prince, Victoria E; Mumm, Jeff S; Sirotkin, Howard I

    2012-10-01

    The transcriptional repressor Rest (Nrsf) recruits chromatin-modifying complexes to RE1 'silencer elements', which are associated with hundreds of neural genes. However, the requirement for Rest-mediated transcriptional regulation of embryonic development and cell fate is poorly understood. Conflicting views of the role of Rest in controlling cell fate have emerged from recent studies. To address these controversies, we examined the developmental requirement for Rest in zebrafish using zinc-finger nuclease-mediated gene targeting. We discovered that germ layer specification progresses normally in rest mutants despite derepression of target genes during embryogenesis. This analysis provides the first evidence that maternal rest is essential for repression of target genes during blastula stages. Surprisingly, neurogenesis proceeds largely normally in rest mutants, although abnormalities are observed within the nervous system, including defects in oligodendrocyte precursor cell development and a partial loss of facial branchiomotor neuron migration. Mutants progress normally through embryogenesis but many die as larvae (after 12 days). However, some homozygotes reach adulthood and are viable. We utilized an RE1/NRSE transgenic reporter system to dynamically monitor Rest activity. This analysis revealed that Rest is required to repress gene expression in mesodermal derivatives including muscle and notochord, as well as within the nervous system. Finally, we demonstrated that Rest is required for long-term repression of target genes in non-neural tissues in adult zebrafish. Our results point to a broad role for Rest in fine-tuning neural gene expression, rather than as a widespread regulator of neurogenesis or cell fate. PMID:22951640

  19. Regulation of host gene expression by HIV-1 TAR microRNAs

    PubMed Central

    2013-01-01

    Background The transactivating response (TAR) element of human immunodeficiency virus type 1 (HIV-1) is the source of two functional microRNAs (miRNAs), miR-TAR-5p and miR-TAR-3p. The objective of this study was to characterize the post-transcriptional regulation of host messenger RNAs (mRNAs) relevant to HIV-1 pathogenesis by HIV-1 TAR miRNAs. Results We demonstrated that TAR miRNAs derived from HIV-1 can incorporate into host effector Argonaute protein complexes, which is required if these miRNAs are to regulate host mRNA expression. Bioinformatic predictions and reporter gene activity assays identified regulatory elements complementary and responsive to miR-TAR-5p and miR-TAR-3p in the 3’ untranslated region (UTR) of several candidate genes involved in apoptosis and cell survival. These include Caspase 8, Aiolos, Ikaros and Nucleophosmin (NPM)/B23. Analyses of Jurkat cells that stably expressed HIV-1 TAR or contained a full-length latent HIV provirus suggested that HIV-1 TAR miRNAs could regulate the expression of genes in T cells that affect the balance between apoptosis and cell survival. Conclusions HIV-1 TAR miRNAs may contribute to the replication cycle and pathogenesis of HIV-1, by regulating host genes involved in the intricate balance between apoptosis and infected cell, to induce conditions that promote HIV-1 propagation and survival. PMID:23938024

  20. Global identification of miR-373-regulated genes in breast cancer by quantitative proteomics.

    PubMed

    Yan, Guang-Rong; Xu, Song-Hui; Tan, Zi-Lu; Liu, Langxia; He, Qing-Yu

    2011-03-01

    Although microRNAs (miRNAs) have been reported to play an important role in carcinogenesis, their molecular mechanism remains largely unknown because of our limited understanding of miRNA target genes. miR-373 was found to be capable of promoting breast cancer invasion and metastasis, but only a target gene was experimentally identified on the basis of mRNA expression analysis. In this study, we used SILAC-based quantitative proteomics to globally identify the genes regulated by miR-373. Totally, 3666 proteins were identified, and 335 proteins were found to be regulated by miR-373. Among the 192 proteins that were downregulated by miR-373, 27 (14.1%) were predicted to have at least one potential match site at their 3'-UTR for miR-373 seed sequence. However, miR-373 did not affect the mRNA level of the five selected candidate targets, TXNIP, TRPS1, RABEP1, GRHL2 and HIP1, suggesting that the protein expressions were regulated by miR-373 via translational inhibition instead of mRNA degradation. Luciferase and mutation assays validated that TXNIP and RABEP1 were the direct target genes of miR-373. More than 30 proteins reported to be involved in cancer invasion and metastasis were found to be regulated by miR-373 in breast cancer for the first time.

  1. Early Experiences Can Alter Gene Expression and Affect Long-Term Development. Working Paper #10

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2010

    2010-01-01

    New scientific research shows that environmental influences can actually affect whether and how genes are expressed. Thus, the old ideas that genes are "set in stone" or that they alone determine development have been disproven. In fact, scientists have discovered that early experiences can determine how genes are turned on and off and even…

  2. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  3. SMARCA4 regulates gene expression and higher-order chromatin structure in proliferating mammary epithelial cells.

    PubMed

    Barutcu, A Rasim; Lajoie, Bryan R; Fritz, Andrew J; McCord, Rachel P; Nickerson, Jeffrey A; van Wijnen, Andre J; Lian, Jane B; Stein, Janet L; Dekker, Job; Stein, Gary S; Imbalzano, Anthony N

    2016-09-01

    The packaging of DNA into chromatin plays an important role in transcriptional regulation and nuclear processes. Brahma-related gene-1 SMARCA4 (also known as BRG1), the essential ATPase subunit of the mammalian SWI/SNF chromatin remodeling complex, uses the energy from ATP hydrolysis to disrupt nucleosomes at target regions. Although the transcriptional role of SMARCA4 at gene promoters is well-studied, less is known about its role in higher-order genome organization. SMARCA4 knockdown in human mammary epithelial MCF-10A cells resulted in 176 up-regulated genes, including many related to lipid and calcium metabolism, and 1292 down-regulated genes, some of which encode extracellular matrix (ECM) components that can exert mechanical forces and affect nuclear structure. ChIP-seq analysis of SMARCA4 localization and SMARCA4-bound super-enhancers demonstrated extensive binding at intergenic regions. Furthermore, Hi-C analysis showed extensive SMARCA4-mediated alterations in higher-order genome organization at multiple resolutions. First, SMARCA4 knockdown resulted in clustering of intra- and inter-subtelomeric regions, demonstrating a novel role for SMARCA4 in telomere organization. SMARCA4 binding was enriched at topologically associating domain (TAD) boundaries, and SMARCA4 knockdown resulted in weakening of TAD boundary strength. Taken together, these findings provide a dynamic view of SMARCA4-dependent changes in higher-order chromatin organization and gene expression, identifying SMARCA4 as a novel component of chromatin organization. PMID:27435934

  4. Nitrogen supply affects anthocyanin biosynthetic and regulatory genes in grapevine cv. Cabernet-Sauvignon berries.

    PubMed

    Soubeyrand, Eric; Basteau, Cyril; Hilbert, Ghislaine; van Leeuwen, Cornelis; Delrot, Serge; Gomès, Eric

    2014-07-01

    Accumulation of anthocyanins in grape berries is influenced by environmental factors (such as temperature and light) and supply of nutrients, i.e., fluxes of carbon and nitrogen feeding the berry cells. It is established that low nitrogen supply stimulates anthocyanin production in berry skin cells of red varieties. The present works aims to gain a better understanding of the molecular mechanisms involved in the response of anthocyanin accumulation to nitrogen supply in berries from field grown-plants. To this end, we developed an integrated approach combining monitoring of plant nitrogen status, metabolite measurements and transcript analysis. Grapevines (cv. Cabernet-Sauvignon) were cultivated in a vineyard with three nitrogen fertilization levels (0, 60 and 120 kg ha(-1) of nitrogen applied on the soil). Anthocyanin profiles were analyzed and compared with gene expression levels. Low nitrogen supply caused a significant increase in anthocyanin levels at two ripening stages (26 days post-véraison and maturity). Delphinidin and petunidin derivatives were the most affected compounds. Transcript levels of both structural and regulatory genes involved in anthocyanin synthesis confirmed the stimulation of the phenylpropanoid pathway. Genes encoding phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), flavonoid-3',5'-hydroxylase (F3'5'H), dihydroflavonol-4-reductase (DFR), leucoanthocyanidin dioxygenase (LDOX) exhibited higher transcript levels in berries from plant cultivated without nitrogen compared to the ones cultivated with 120 kg ha(-1) nitrogen fertilization. The results indicate that nitrogen controls a coordinated regulation of both positive (MYB transcription factors) and negative (LBD proteins) regulators of the flavonoid pathway in grapevine. PMID:24735825

  5. Attachment and affect regulation: a framework for family treatment of conduct disorder.

    PubMed

    Keiley, Margaret K

    2002-01-01

    Conduct disorder (CD), a pervasive adolescent disorder with clinically significant antisocial behaviors, has been a difficult syndrome to treat successfully. Recently, research on affect regulation and attachment has suggested that attachment and affect regulation strategies may underlie the development of conduct disorder in adolescents, implying that attention to these factors might improve family treatment for CD. In this review of the research literature, I discuss the role of attachment and affect regulation in the development and treatment of CD. In addition, I present information about the framework, intervention protocol, and preliminary evidence of effectiveness of an attachment- and affect regulation-based intervention that has been developed and implemented with multiple-family groups of parents and incarcerated adolescents.

  6. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    PubMed

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. PMID:25605389

  7. [Insect antimicrobial peptides: structures, properties and gene regulation].

    PubMed

    Wang, Yi-Peng; Lai, Ren

    2010-02-01

    Insect antimicrobial peptides (AMPs) are an important group of insect innate immunity effectors. Insect AMPs are cationic and contain less than 100 amino acid residues. According to structure, insect AMPs can be divided into a limited number of families. The diverse antimicrobial spectrum of insect AMPs may indicate different modes of action. Research on the model organism Drosophila indicate that insect AMPs gene regulation involves multiple signaling pathways and a large number of signaling molecules.

  8. Structure and regulation of the Asr gene family in banana.

    PubMed

    Henry, Isabelle M; Carpentier, Sebastien C; Pampurova, Suzana; Van Hoylandt, Anais; Panis, Bart; Swennen, Rony; Remy, Serge

    2011-10-01

    Abscisic acid, stress, ripening proteins (ASR) are a family of plant-specific small hydrophilic proteins. Studies in various plant species have highlighted their role in increased resistance to abiotic stress, including drought, but their specific function remains unknown. As a first step toward their potential use in crop improvement, we investigated the structure and regulation of the Asr gene family in Musa species (bananas and plantains). We determined that the Musa Asr gene family contained at least four members, all of which exhibited the typical two exons, one intron structure of Asr genes and the "ABA/WDS" (abscisic acid/water deficit stress) domain characteristic of Asr genes. Phylogenetic analyses determined that the Musa Asr genes were closely related to each other, probably as the product of recent duplication events. For two of the four members, two versions corresponding to the two sub-genomes of Musa, acuminata and balbisiana were identified. Gene expression and protein analyses were performed and Asr expression could be detected in meristem cultures, root, pseudostem, leaf and cormus. In meristem cultures, mAsr1 and mAsr3 were induced by osmotic stress and wounding, while mAsr3 and mAsr4 were induced by exposure to ABA. mASR3 exhibited the most variation both in terms of amino acid sequence and expression pattern, making it the most promising candidate for further functional study and use in crop improvement. PMID:21630042

  9. Tools for regulated gene expression in the chloroplast of Chlamydomonas.

    PubMed

    Rochaix, Jean-David; Surzycki, Raymond; Ramundo, Silvia

    2014-01-01

    The green unicellular alga Chlamydomonas reinhardtii has emerged as a very attractive model system for chloroplast genetic engineering. Algae can be transformed readily at the chloroplast level through bombardment of cells with a gene gun, and transformants can be selected using antibiotic resistance or phototrophic growth. An inducible chloroplast gene expression system could be very useful for several reasons. First, it could be used to elucidate the function of essential chloroplast genes required for cell growth and survival. Second, it could be very helpful for expressing proteins which are toxic to the algal cells. Third, it would allow for the reversible depletion of photosynthetic complexes thus making it possible to study their biogenesis in a controlled fashion. Fourth, it opens promising possibilities for hydrogen production in Chlamydomonas. Here we describe an inducible/repressible chloroplast gene expression system in Chlamydomonas in which the copper-regulated Cyc6 promoter drives the expression of the nuclear Nac2 gene encoding a protein which is targeted to the chloroplast where it acts specifically on the chloroplast psbD 5'-untranslated region and is required for the stable accumulation of the psbD mRNA and photosystem II. The system can be used for any chloroplast gene or transgene by placing it under the control of the psbD 5'-untranslated region. PMID:24599871

  10. Maternal regulation of child affect in externalizing and typically-developing children.

    PubMed

    Lougheed, Jessica P; Hollenstein, Tom; Lichtwarck-Aschoff, Anna; Granic, Isabela

    2015-02-01

    Temporal contingencies between children's affect and maternal behavior play a role in the development of children's externalizing problems. The goal of the current study was to use a microsocial approach to compare dyads with externalizing dysregulation (N =191) to healthy controls (N = 54) on maternal supportive regulation of children's negative and positive affect. Children were between the ages of 8 and 12 years. Mother-child dyads participated in conflict and positive discussions, and child affect and maternal supportive affect regulation were coded in real time. First, no group differences on overall levels of mother supportive regulation or child affect were found. Second, three event history analyses in a 2-level Cox hazard regression framework were used to predict the hazard rate of (a) maternal supportiveness, and of children's transitions (b) out of negative affect and (c) into positive affect. The hazard rate of maternal supportiveness, regardless of child affect, was not different between groups. However, as expected, the likelihood of mothers' supportive responses to children's negative affect was lower in externalizing than comparison dyads. In addition, children with externalizing problems were significantly less likely than typically developing children to transition out of negative affect in response to maternal supportiveness. The likelihood of both typically developing children and children with externalizing problems transitioning into positive affect were not related to specific occurrences of maternal supportiveness. Results of the current study show the importance of temporal dynamics in mother-child interactions in the emergence of children's externalizing problems.

  11. Transcriptional regulation of genes related to progesterone production.

    PubMed

    Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru

    2015-01-01

    Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production. PMID:26135521

  12. mRNA modifications: Dynamic regulators of gene expression?

    PubMed Central

    Hoernes, Thomas Philipp; Hüttenhofer, Alexander; Erlacher, Matthias David

    2016-01-01

    ABSTRACT The expression of a gene is a tightly regulated process and is exerted by a myriad of different mechanisms. Recently, RNA modifications located in coding sequences of mRNAs, have been identified as potential regulators of gene expression. N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine (Ψ) and N1-methyladenosine (m1A) have been found within open reading frames of mRNAs. The presence of these mRNA modifications has been implicated to modulate the fate of an mRNA, ranging from maturation to its translation and even degradation. However, many aspects concerning the biological functions of mRNA modifications remain elusive. Recently, systematic in vitro studies allowed a first glimpse of the direct interplay of mRNA modifications and the efficiency and fidelity of ribosomal translation. It thereby became evident that the effects of mRNA modifications were, astonishingly versatile, depending on the type, position or sequence context. The incorporation of a single modification could either prematurely terminate protein synthesis, reduce the peptide yield or alter the amino acid sequence identity. These results implicate that mRNA modifications are a powerful mechanism to post-transcriptionally regulate gene expression. PMID:27351916

  13. Inducible gene expression and environmentally regulated genes in lactic acid bacteria.

    PubMed

    Kok, J

    1996-10-01

    Relatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their transcription was studied and found to be regulatable. Examples are the lactose operon, the operon for nisin production, and genes in the proteolytic pathway of Lactococcus lactis, as well as xylose metabolism in Lactobacillus pentosus. Some other operons were specifically targetted with the aim to compare their mode of regulation with known regulatory mechanisms in other well-studied bacteria. These studies, dealing with the biosynthesis of histidine, tryptophan, and of the branched chain amino acids in L. lactis, have given new insights in gene regulation and in the occurrence of auxotrophy in these bacteria. Also, nucleotide sequence analyses of a number of lactococcal bacteriophages was recently initiated to, among other things, specifically learn more about regulation of the phage life cycle. Yet another approach in the analysis of regulated genes is the 'random' selection of genetic elements that respond to environmental stimuli and the first of such sequences from lactic acid bacteria have been identified and characterized. The potential of these regulatory elements in fundamental research and practical (industrial) applications will be discussed.

  14. Relationships between leaders' and subordinates' emotion regulation and satisfaction and affect at work.

    PubMed

    Kafetsios, Konstantinos; Nezlek, John B; Vassilakou, Thanai

    2012-01-01

    The study examined relationships between leaders' emotion regulation and leaders' and subordinates' work-related outcomes. Fifty-one school directors and 281 teachers reported on their strategies of emotion regulation (reappraisal, suppression), job satisfaction, and affect at work. For subordinates, suppression was negatively related to job satisfaction and was positively related to negative affect and emotional exhaustion, and reappraisal was positively related to job satisfaction and negatively to negativ affect. In contrast, multilevel analyses found that directors' use of reappraisal was neg atively related to subordinates' job satisfaction, and directors' use of suppression wa positively related to subordinates' positive affect. Leaders' suppression interacted wit group cohesion to predict subordinates' negative affect. This is one of the first studies to find evidence for the possible tension between leaders' emotion regulation competencie and organizational-role interests. PMID:22822684

  15. slo K+ channel gene regulation mediates rapid drug tolerance

    NASA Astrophysics Data System (ADS)

    Ghezzi, Alfredo; Al-Hasan, Yazan M.; Larios, Leo E.; Bohm, Rudolf A.; Atkinson, Nigel S.

    2004-12-01

    Changes in neural activity caused by exposure to drugs may trigger homeostatic mechanisms that attempt to restore normal neural excitability. In Drosophila, a single sedation with the anesthetic benzyl alcohol changes the expression of the slo K+ channel gene and induces rapid drug tolerance. We demonstrate linkage between these two phenomena by using a mutation and a transgene. A mutation that eliminates slo expression prevents tolerance, whereas expression from an inducible slo transgene mimics tolerance in naïve animals. The behavioral response to benzyl alcohol can be separated into an initial phase of hyperkinesis and a subsequent phase of sedation. The hyperkinetic phase causes a drop in slo gene expression and makes animals more sensitive to benzyl alcohol. It is the sedative phase that stimulates slo gene expression and induces tolerance. We demonstrate that the expression level of slo is a predictor of drug sensitivity. drug abuse | potassium channel | transcription regulation

  16. Virulence Gene Regulation by l-Arabinose in Salmonella enterica

    PubMed Central

    López-Garrido, Javier; Puerta-Fernández, Elena; Cota, Ignacio; Casadesús, Josep

    2015-01-01

    Invasion of the intestinal epithelium is a critical step in Salmonella enterica infection and requires functions encoded in the gene cluster known as Salmonella Pathogenicity Island 1 (SPI-1). Expression of SPI-1 genes is repressed by l-arabinose, and not by other pentoses. Transport of l-arabinose is necessary to repress SPI-1; however, repression is independent of l-arabinose metabolism and of the l-arabinose-responsive regulator AraC. SPI-1 repression by l-arabinose is exerted at a single target, HilD, and the mechanism appears to be post-translational. As a consequence of SPI-1 repression, l-arabinose reduces translocation of SPI-1 effectors to epithelial cells and decreases Salmonella invasion in vitro. These observations reveal a hitherto unknown role of l-arabinose in gene expression control and raise the possibility that Salmonella may use L-arabinose as an environmental signal. PMID:25991823

  17. Methods and compositions for regulating gene expression in plant cells

    NASA Technical Reports Server (NTRS)

    Beachy, Roger N. (Inventor); Luis, Maria Isabel Ordiz (Inventor); Dai, Shunhong (Inventor)

    2010-01-01

    Novel chimeric plant promoter sequences are provided, together with plant gene expression cassettes comprising such sequences. In certain preferred embodiments, the chimeric plant promoters comprise the BoxII cis element and/or derivatives thereof. In addition, novel transcription factors are provided, together with nucleic acid sequences encoding such transcription factors and plant gene expression cassettes comprising such nucleic acid sequences. In certain preferred embodiments, the novel transcription factors comprise the acidic domain, or fragments thereof, of the RF2a transcription factor. Methods for using the chimeric plant promoter sequences and novel transcription factors in regulating the expression of at least one gene of interest are provided, together with transgenic plants comprising such chimeric plant promoter sequences and novel transcription factors.

  18. Virulence Gene Regulation by L-Arabinose in Salmonella enterica.

    PubMed

    López-Garrido, Javier; Puerta-Fernández, Elena; Cota, Ignacio; Casadesús, Josep

    2015-07-01

    Invasion of the intestinal epithelium is a critical step in Salmonella enterica infection and requires functions encoded in the gene cluster known as Salmonella Pathogenicity Island 1 (SPI-1). Expression of SPI-1 genes is repressed by L-arabinose, and not by other pentoses. Transport of L-arabinose is necessary to repress SPI-1; however, repression is independent of L-arabinose metabolism and of the L-arabinose-responsive regulator AraC. SPI-1 repression by L-arabinose is exerted at a single target, HilD, and the mechanism appears to be post-translational. As a consequence of SPI-1 repression, l-arabinose reduces translocation of SPI-1 effectors to epithelial cells and decreases Salmonella invasion in vitro. These observations reveal a hitherto unknown role of L-arabinose in gene expression control and raise the possibility that Salmonella may use L-arabinose as an environmental signal.

  19. Globalisation reaches gene regulation: the case for vertebrate limb development.

    PubMed

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  20. Saccharomyces cerevisiae Yta7 regulates histone gene expression.

    PubMed

    Gradolatto, Angeline; Rogers, Richard S; Lavender, Heather; Taverna, Sean D; Allis, C David; Aitchison, John D; Tackett, Alan J

    2008-05-01

    The Saccharomyces cerevisiae Yta7 protein is a component of a nucleosome bound protein complex that maintains distinct transcriptional zones of chromatin. We previously found that one protein copurifying with Yta7 is the yFACT member Spt16. Epistasis analyses revealed a link between Yta7, Spt16, and other previously identified members of the histone regulatory pathway. In concurrence, Yta7 was found to regulate histone gene transcription in a cell-cycle-dependent manner. Association at the histone gene loci appeared to occur through binding of the bromodomain-like region of Yta7 with the N-terminal tail of histone H3. Our work suggests a mechanism in which Yta7 is localized to chromatin to establish regions of transcriptional silencing, and that one facet of this cellular mechanism is to modulate transcription of histone genes.

  1. A Redox-Responsive Regulator of Photosynthesis Gene Expression in the Cyanobacterium Synechocystis sp. Strain PCC 6803

    PubMed Central

    Li, Hong; Sherman, Louis A.

    2000-01-01

    We have identified genes in the unicellular cyanobacterium Synechocystis sp. strain PCC 6803 that are involved with redox control of photosynthesis and pigment-related genes. The genes, rppA (sll0797) and rppB (sll0798), represent a two-component regulatory system that controls the synthesis of photosystem II (PSII) and PSI genes, in addition to photopigment-related genes. rppA (regulator of photosynthesis- and photopigment-related gene expression) and rppB exhibit strong sequence similarity to prokaryotic response regulators and histidine kinases, respectively. In the wild type, the steady-state mRNA levels of PSII reaction center genes increased when the plastoquinone (PQ) pool was oxidized and decreased when the PQ pool was reduced, whereas transcription of the PSI reaction center genes was affected in an opposite fashion. Such results suggested that the redox poise of the PQ pool is critical for regulation of the photosystem reaction center genes. In ΔrppA, an insertion mutation of rppA, the PSII gene transcripts were highly up-regulated relative to the wild type under all redox conditions, whereas transcription of phycobilisome-related genes and PSI genes was decreased. The higher transcription of the psbA gene in ΔrppA was manifest by higher translation of the D1 protein and a concomitant increase in O2 evolution. The results demonstrated that RppA is a regulator of photosynthesis- and photopigment-related gene expression, is involved in the establishment of the appropriate stoichiometry between the photosystems, and can sense changes in the PQ redox poise. PMID:10894737

  2. Gene regulation networks generate diverse pigmentation patterns in plants.

    PubMed

    Albert, Nick W; Davies, Kevin M; Schwinn, Kathy E

    2014-01-01

    The diversity of pigmentation patterns observed in plants occurs due to the spatial distribution and accumulation of colored compounds, which may also be associated with structural changes to the tissue. Anthocyanins are flavonoids that provide red/purple/blue coloration to plants, often forming complex patterns such as spots, stripes, and vein-associated pigmentation, particularly in flowers. These patterns are determined by the activity of MYB-bHLH-WDR (MBW) transcription factor complexes, which activate the anthocyanin biosynthesis genes, resulting in anthocyanin pigment accumulation. Recently, we established that the MBW complex controlling anthocyanin synthesis acts within a gene regulation network that is conserved within at least the Eudicots. This network involves hierarchy, reinforcement, and feedback mechanisms that allow for stringent and responsive regulation of the anthocyanin biosynthesis genes. The gene network and mobile nature of the WDR and R3-MYB proteins provide exciting new opportunities to explore the basis of pigmentation patterning, and to investigate the evolutionary history of the MBW components in land plants.

  3. Minireview: mechanisms of growth hormone-mediated gene regulation.

    PubMed

    Chia, Dennis J

    2014-07-01

    GH exerts a diverse array of physiological actions that include prominent roles in growth and metabolism, with a major contribution via stimulating IGF-1 synthesis. GH achieves its effects by influencing gene expression profiles, and Igf1 is a key transcriptional target of GH signaling in liver and other tissues. This review examines the mechanisms of GH-mediated gene regulation that begin with signal transduction pathways activated downstream of the GH receptor and continue with chromatin events at target genes and additionally encompasses the topics of negative regulation and cross talk with other cellular inputs. The transcription factor, signal transducer and activator of transcription 5b, is regarded as the major signaling pathway by which GH achieves its physiological effects, including in stimulating Igf1 gene transcription in liver. Recent studies exploring the mechanisms of how activated signal transducer and activator of transcription 5b accomplishes this are highlighted, which begin to characterize epigenetic features at regulatory domains of the Igf1 locus. Further research in this field offers promise to better understand the GH-IGF-1 axis in normal physiology and disease and to identify strategies to manipulate the axis to improve human health.

  4. A family with a dystrophin gene mutation specifically affecting dystrophin expression in the heart

    SciTech Connect

    Muntoni, F.; Davies, K.; Dubowitz, V.

    1994-09-01

    We recently described a family with X-linked dilated cardiomyopathy where a large deletion in the muscle promoter region of the dystrophin gene was associated with a severe dilated cardiomyopathy in absence of clinical skeletal muscle involvement. The deletion removed the entire muscle promoter region, the first muscle exon and part of intron 1. The brain and Purkinje cell promoters were not affected by the deletion. Despite the lack of both the muscle promoter and the first muscle exon, dystrophin was detected immunocytochemically in relative high levels in the skeletal muscle of the affected males. We have now found that both the brain and Purkinje cell promoters were transcribed at high levels in the skeletal muscle of these individuals. This phenomenon, that does not occur in normal skeletal muscle, indicates that these two isoforms, physiologically expressed mainly in the central nervous system, can be transcribed and be functionally active in skeletal muscle under specific circumstances. Contrary to what is observed in skeletal muscle, dystrophin was not detected in the heart of one affected male using immunocytochemistry and an entire panel of anti-dystrophin antibodies. This was most likely the cause for the pronounced cardiac fibrosis observed and eventually responsible for the severe cardiac involvement invariably seen in seven affected males. In conclusion, the mutation of the muscle promoter, first muscle exon and part of intron 1 specifically affected expression of dystrophin in the heart. We believe that this deletion removes sequences involved in regulation of dystrophin expression in the heart and are at the moment characterizing other families with X-linked cardiomyopathy secondary to a dystrophinopathy.

  5. The regulatory gene VosA affects conidiogenesis and is involved in virulence of the fungal cereal pathogen Cochliobolus sativus.

    PubMed

    Wang, Rui; Leng, Yueqiang; Zhong, Shaobin

    2015-10-01

    VosA is one of the four components in the velvet complex shown to be involved in regulation of fungal development and secondary metabolism in filamentous fungi. However, the function of VosA has only been studied in a few plant pathogenic fungi. In this study, we identified the ortholog (CsVosA) of VosA in the cereal spot blotch pathogen Cochliobolus sativus and generated gene knockout mutants for functional characterization of the gene. Conidia of the CsVosA knockout mutants (ΔCsVosA) lacked trehalose, were significantly reduced in viability, had less pigmentation, and showed a dramatic reduction in tolerance to heat, oxidative, and ion stresses. However, ΔCsVosA produced more conidia than the wild type under both constant dark, and constant light conditions, suggesting that CsVosA is a negative-feedback regulator in conidiation. Interestingly, the ΔCsVosA mutants exhibited a hypermorphic conidiation phenotype with indeterminate growth of the conidial tip cells resulting in head-to-tail (acropetal) arrays of conidiogenesis, indicating that some genes involved in conidiation are also regulated by CsVosA. The ΔCsVosA mutants showed significant reduction in virulence on susceptible barley plants and the two genes for nonribosomal peptide synthetases (NRPSs) involved in virulence during host infection were down-regulated in ΔCsVosA, suggesting that CsVosA may affect virulence of the fungus by regulating the expression of the genes for NRPSs, as well as other genes directly or indirectly involved in virulence.

  6. The regulatory gene VosA affects conidiogenesis and is involved in virulence of the fungal cereal pathogen Cochliobolus sativus.

    PubMed

    Wang, Rui; Leng, Yueqiang; Zhong, Shaobin

    2015-10-01

    VosA is one of the four components in the velvet complex shown to be involved in regulation of fungal development and secondary metabolism in filamentous fungi. However, the function of VosA has only been studied in a few plant pathogenic fungi. In this study, we identified the ortholog (CsVosA) of VosA in the cereal spot blotch pathogen Cochliobolus sativus and generated gene knockout mutants for functional characterization of the gene. Conidia of the CsVosA knockout mutants (ΔCsVosA) lacked trehalose, were significantly reduced in viability, had less pigmentation, and showed a dramatic reduction in tolerance to heat, oxidative, and ion stresses. However, ΔCsVosA produced more conidia than the wild type under both constant dark, and constant light conditions, suggesting that CsVosA is a negative-feedback regulator in conidiation. Interestingly, the ΔCsVosA mutants exhibited a hypermorphic conidiation phenotype with indeterminate growth of the conidial tip cells resulting in head-to-tail (acropetal) arrays of conidiogenesis, indicating that some genes involved in conidiation are also regulated by CsVosA. The ΔCsVosA mutants showed significant reduction in virulence on susceptible barley plants and the two genes for nonribosomal peptide synthetases (NRPSs) involved in virulence during host infection were down-regulated in ΔCsVosA, suggesting that CsVosA may affect virulence of the fungus by regulating the expression of the genes for NRPSs, as well as other genes directly or indirectly involved in virulence. PMID:26399184

  7. MTA3 regulates CGB5 and Snail genes in trophoblast

    SciTech Connect

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  8. Affective Self-Regulation Trajectories During Secondary School Predict Substance Use Among Urban Minority Young Adults

    PubMed Central

    Griffin, Kenneth W.; Lowe, Sarah R.; Acevedo, Bianca P.; Botvin, Gilbert J.

    2015-01-01

    This study explored the relationship between trajectories of affective self-regulation skills during secondary school and young adult substance use in a large multi-ethnic, urban sample (N = 995). During secondary school, participants completed a measure of cognitive and behavioral skills used to control negative, unpleasant emotions or perceived stress. As young adults, participants reported on the frequency and quantity of their alcohol, cigarette, and marijuana use in a telephone interview. Controlling for demographic variables, self-regulation did not significantly change over adolescence, although there was significant variation in participants’ rates of growth and decline. Lower seventh grade self-regulation and less steep increases in self-regulation were predictive of higher young adult substance use. Male participants had significantly lower initial self-regulation and higher young adult substance use. The results suggest that interventions that build affective self-regulation skills in adolescence may decrease the risk of young adult substance use. PMID:26549966

  9. Signal transduction pathways that regulate CAB gene expression. Progress report

    SciTech Connect

    Chory, J.

    1993-12-31

    We have completed the initial genetic and phenotypic characterization of several classes of new mutants that affect CAB gene expression. The doc mutants (for dark overexpression of cab) are characterized by elevated levels of CAB gene expression in the dark; however, unlike the previously isolated de-etiolated mutants (also isolated in my lab), the doc mutants still appear etiolated. The doc alleles define 3 loci, each of which maps to a separate chromosome. The details of the mutant isolation scheme and the genetic and phenotypic description of these new mutants are described. The second class of mutants, the gun mutants (for genomes uncoupled) show accumulation of CAB mRNA in the absence of chloroplast gene expression and development. Thus, the normally tightly coordinated expression between the chloroplast and nuclear genes that encode chloroplast-destined proteins has been uncoupled. We have shown that the Arabidopsis HY3 locus encodes the type B phytochrome apoprotein gene and have characterized the phenotypes of null hy3 alleles to ascertain a role for this phytochrome in Arabidopsis development. We have also isolated and characterized a number of alleles of the phytochrome A gene.

  10. Social regulation of gene expression in human leukocytes

    PubMed Central

    Cole, Steve W; Hawkley, Louise C; Arevalo, Jesusa M; Sung, Caroline Y; Rose, Robert M; Cacioppo, John T

    2007-01-01

    Background Social environmental influences on human health are well established in the epidemiology literature, but their functional genomic mechanisms are unclear. The present study analyzed genome-wide transcriptional activity in people who chronically experienced high versus low levels of subjective social isolation (loneliness) to assess alterations in the activity of transcription control pathways that might contribute to increased adverse health outcomes in social isolates. Results DNA microarray analysis identified 209 genes that were differentially expressed in circulating leukocytes from 14 high- versus low-lonely individuals, including up-regulation of genes involved in immune activation, transcription control, and cell proliferation, and down-regulation of genes supporting mature B lymphocyte function and type I interferon response. Promoter-based bioinformatic analyses showed under-expression of genes bearing anti-inflammatory glucocorticoid response elements (GREs; p = 0.032) and over-expression of genes bearing response elements for pro-inflammatory NF-κB/Rel transcription factors (p = 0.011). This reciprocal shift in pro- and anti-inflammatory signaling was not attributable to differences in circulating cortisol levels, or to other demographic, psychological, or medical characteristics. Additional transcription control pathways showing differential activity in bioinformatic analyses included the CREB/ATF, JAK/STAT, IRF1, C/EBP, Oct, and GATA pathways. Conclusion These data provide the first indication that human genome-wide transcriptional activity is altered in association with a social epidemiological risk factor. Impaired transcription of glucocorticoid response genes and increased activity of pro-inflammatory transcription control pathways provide a functional genomic explanation for elevated risk of inflammatory disease in individuals who experience chronically high levels of subjective social isolation. PMID:17854483

  11. Global Transcriptome Analysis Reveals That Poly(ADP-Ribose) Polymerase 1 Regulates Gene Expression through EZH2

    PubMed Central

    Martin, Kayla A.; Cesaroni, Matteo; Denny, Michael F.; Lupey, Lena N.

    2015-01-01

    Posttranslational modifications, such as poly(ADP-ribosyl)ation (PARylation), regulate chromatin-modifying enzymes, ultimately affecting gene expression. This study explores the role of poly(ADP-ribose) polymerase (PARP) on global gene expression in a lymphoblastoid B cell line. We found that inhibition of PARP catalytic activity with olaparib resulted in global gene deregulation, affecting approximately 11% of the genes expressed. Gene ontology analysis revealed that PARP could exert these effects through transcription factors and chromatin-remodeling enzymes, including the polycomb repressive complex 2 (PRC2) member EZH2. EZH2 mediates the trimethylation of histone H3 at lysine 27 (H3K27me3), a modification associated with chromatin compaction and gene silencing. Both pharmacological inhibition of PARP and knockdown of PARP1 induced the expression of EZH2, which resulted in increased global H3K27me3. Chromatin immunoprecipitation confirmed that PARP1 inhibition led to H3K27me3 deposition at EZH2 target genes, which resulted in gene silencing. Moreover, increased EZH2 expression is attributed to the loss of the occupancy of the transcription repressor E2F4 at the EZH2 promoter following PARP inhibition. Together, these data show that PARP plays an important role in global gene regulation and identifies for the first time a direct role of PARP1 in regulating the expression and function of EZH2. PMID:26370511

  12. Estrogen regulation of the avian transferrin gene in transgenic mice.

    PubMed Central

    Hammer, R E; Idzerda, R L; Brinster, R L; McKnight, G S

    1986-01-01

    The intact chicken transferrin gene was microinjected into fertilized mouse eggs, and the resulting transgenic animals were used to produce lines of mice containing integrated copies of the chicken gene. The levels of expression of the chicken gene were quantitated in various tissues, and the response of the gene to estrogen stimulation was measured after chronic or acute estrogen exposure. Two of the three mouse lines studied maintained stable levels of expression in successive generations of offspring, and the third line had two- to threefold-higher levels in offspring than in the original parent. In the third line, the original transgenic parent was found to be a mosaic. The chicken transferrin gene was expressed at 10- to 20-fold-higher levels in liver than in any other tissue; however, the levels of chicken transferrin mRNA in kidney were higher than expected, indicating that the tissue specificity was only partial. In all three lines, the foreign gene was induced by estrogen administration. After 10 days of estrogen administration, there was a twofold increase in both transferrin mRNA and transcription of the chicken transferrin gene. A single injection of estradiol led to a fourfold increase in transferrin mRNA synthesis at 4h. As a control the levels of mouse albumin were measured, and both the level of albumin mRNA and its rate of transcription declined about twofold after estrogen administration. Our results indicate that the intact chicken gene with 2.2 kilobases of 5' flanking sequence contains signals for both tissue specificity and steroid regulation that can be recognized in mice. Images PMID:3785157

  13. Identification of Cilia Genes That Affect Cell-Cycle Progression Using Whole-Genome Transcriptome Analysis in Chlamydomonas reinhardtti

    PubMed Central

    Albee, Alison J.; Kwan, Alan L.; Lin, Huawen; Granas, David; Stormo, Gary D.; Dutcher, Susan K.

    2013-01-01

    Cilia are microtubule based organelles that project from cells. Cilia are found on almost every cell type of the human body and numerous diseases, collectively termed ciliopathies, are associated with defects in cilia, including respiratory infections, male infertility, situs inversus, polycystic kidney disease, retinal degeneration, and Bardet-Biedl Syndrome. Here we show that Illumina-based whole-genome transcriptome analysis in the biflagellate green alga Chlamydomonas reinhardtii identifies 1850 genes up-regulated during ciliogenesis, 4392 genes down-regulated, and 4548 genes with no change in expression during ciliogenesis. We examined four genes up-regulated and not previously known to be involved with cilia (ZMYND10, NXN, GLOD4, SPATA4) by knockdown of the human orthologs in human retinal pigment epithelial cells (hTERT-RPE1) cells to ask whether they are involved in cilia-related processes that include cilia assembly, cilia length control, basal body/centriole numbers, and the distance between basal bodies/centrioles. All of the genes have cilia-related phenotypes and, surprisingly, our data show that knockdown of GLOD4 and SPATA4 also affects the cell cycle. These results demonstrate that whole-genome transcriptome analysis during ciliogenesis is a powerful tool to gain insight into the molecular mechanism by which centrosomes and cilia are assembled. PMID:23604077

  14. Transcriptional regulation differs in affected facioscapulohumeral muscular dystrophy patients compared to asymptomatic related carriers

    PubMed Central

    Arashiro, Patricia; Eisenberg, Iris; Kho, Alvin T.; Cerqueira, Antonia M. P.; Canovas, Marta; Silva, Helga C. A.; Pavanello, Rita C. M.; Verjovski-Almeida, Sergio; Kunkel, Louis M.; Zatz, Mayana

    2009-01-01

    Facioscapulohumeral muscular dystrophy (FSHD) is a progressive muscle disorder that has been associated with a contraction of 3.3-kb repeats on chromosome 4q35. FSHD is characterized by a wide clinical inter- and intrafamilial variability, ranging from wheelchair-bound patients to asymptomatic carriers. Our study is unique in comparing the gene expression profiles from related affected, asymptomatic carrier, and control individuals. Our results suggest that the expression of genes on chromosome 4q is altered in affected and asymptomatic individuals. Remarkably, the changes seen in asymptomatic samples are largely in products of genes encoding several chemokines, whereas the changes seen in affected samples are largely in genes governing the synthesis of GPI-linked proteins and histone acetylation. Besides this, the affected patient and related asymptomatic carrier share the 4qA161 haplotype. Thus, these polymorphisms by themselves do not explain the pathogenicity of the contracted allele. Interestingly, our results also suggest that the miRNAs might mediate the regulatory network in FSHD. Together, our results support the previous evidence that FSHD may be caused by transcriptional dysregulation of multiple genes, in cis and in trans, and suggest some factors potentially important for FSHD pathogenesis. The study of the gene expression profiles from asymptomatic carriers and related affected patients is a unique approach to try to enhance our understanding of the missing link between the contraction in D4Z4 repeats and muscle disease, while minimizing the effects of differences resulting from genetic background. PMID:19339494

  15. 7 CFR 27.4 - Obligations and rights under Act: not affected by regulations.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Obligations and rights under Act: not affected by regulations. 27.4 Section 27.4 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS...

  16. Drawing versus Writing: The Role of Preference in Regulating Short-Term Affect

    ERIC Educational Resources Information Center

    Drake, Jennifer E.; Hodge, Adeline

    2015-01-01

    In a pilot study we investigated whether the most effective medium for regulating short-term affect depends on one's preference for drawing or writing, and also investigated the emotion regulation strategy (distraction versus expression) spontaneously chosen when drawing and writing. Eighty undergraduates indicated their preference for drawing or…

  17. Decorin gene expression and its regulation in human keratinocytes

    SciTech Connect

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico; Kuri-Harcuch, Walid

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  18. Three Genes Which Affect Founding of Aggregations in Polysphondylium Pallidum

    PubMed Central

    Francis, D.; Shaffer, A.; Smoyer, K.

    1991-01-01

    PN6024 is an extraordinary mutant strain of the cellular slime mold Polysphondylium pallidum, characterized by having defects in many unlinked genes. New strains with altered development appeared spontaneously as aberrant clones of PN6024. Genetic crosses using the macrocyst sexual cycle were used to show that PN6030 (a clone like PN6024 in phenotype) carries mutations at two loci, emm and hge, whereas PN6031 (a clone of altered morphology) carries in addition a mutation at a third locus, mgt. hge and possibly mgt are linked to the mating type locus mat. The relatively high frequency of recombination between mat and hge is strong evidence that meiosis precedes macrocyst germination. The mutant genes themselves are of interest. A major effect of the emm-1 mutation is to remove the requirement for light to trigger aggregation. hge-1 greatly reduces the frequency of aggregation, whereas mgt-1 greatly increases it under standard conditions. None of these mutations interrupts later development leading to stalks and spore cells. It is hypothesized that all three genes act on steps immediately preceding the differentiation of the founder cells which initiate aggregation. PMID:1874416

  19. Association, haplotype, and gene-gene interactions of the HPA axis genes with suicidal behaviour in affective disorders.

    PubMed

    Leszczyńska-Rodziewicz, Anna; Szczepankiewicz, Aleksandra; Pawlak, Joanna; Dmitrzak-Weglarz, Monika; Hauser, Joanna

    2013-01-01

    Family twin and adoption studies have noted the heritability of specific biological factors that influence suicidal behaviour. Exposure to stress is one of the factors that strongly contribute to suicide attempts. The biological response to stress involves the hypothalamic-pituitary-adrenal axis (HPA). Therefore, we found it interesting to study polymorphisms of genes involved in the HPA axis (CRHR1, NR3C1, and AVPBR1). The study was performed on 597 patients, 225 of whom had a history of suicide attempts. We did not observe any significant differences in the studied polymorphisms between the group of patients with a history of suicide attempts and the control subjects. Our haplotype analysis of the AVPR1b gene revealed an association between the GCA haplotype and suicide attempts; however, this association was not significant after correcting for multiple testing. We did not observe any other association in haplotype and MDR analysis. We report here a comprehensive analysis of the HPA axis genes and a lack of association for genetic variations regarding the risk of suicide attempts in affective disorder patients. Nonetheless, the inconsistencies with the previously published results indicate the importance of the further investigation of these polymorphisms with respect to the risk of suicide attempts.

  20. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    PubMed Central

    Chitra, M. Ananda; Jayanthy, C.; Nagarajan, B.

    2015-01-01

    Background: Staphylococcus pseudintermedius (SP) is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr) locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR) and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59%) SP isolates were obtained from 90 samples. 15 isolates (28%) were confirmed to be methicillin-resistant SP (MRSP) with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP). Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF) based on the putative AIP produced by each strain. The AIP of

  1. Sugar regulation of harvest-related genes in asparagus.

    PubMed

    Davies, K M; Seelye, J F; Irving, D E; Borst, W M; Hurst, P L; King, G A

    1996-07-01

    The signals controlling the abundance of transcripts up-regulated (pTIP27, pTIP31, and pTIP32) or down-regulated (pTIP20 and pTIP21) after harvest in asparagus (Asparagus officinalis L.) spears were examined. pTIP27 and pTIP31 are known to encode asparagine synthetase (AS) and a beta-galactosidase (beta-gal) homolog, respectively. The nucleotide sequences of pTIP20, pTIP21, and pTIP32 were determined, and they encode histone 3, histone 2B, and an unknown product, respectively. Changes in respiration, soluble sugars, and abundance of the five mRNAs were similar in the tips stored as 30-mm lengths or as part of 180-mm spears. We previously hypothesized that sugars may regulate the level of AS transcripts in asparagus tissue. Asparagus cell cultures were used to test the role of sugar status may regulate the level of AS transcripts in asparagus tissue. Asparagus cell cultures were used to test the role of sugar status in regulating gene expression. Transcript abundance for AS, beta-gal, and pTIP32 was low in cells in sugar-containing medium but increased within 12 h after transferring cells to a sugar-free medium. Histone 3 and histone 2B transcripts were, in general, abundant in cells on sugar-containing medium but declined in abundance when transferred to sugar-free medium. When cells were returned to sugar-containing medium the abundance of transcripts for histone 3 and histone 2B increased, whereas that for AS, beta-gal, and pTIP32 decreased. Soluble sugar levels are known to decline rapidly in the tips of harvested spears. Metabolic regulation by sugar status may have a major influence on gene expression in asparagus spears and other tissue after harvest. PMID:8754687

  2. Sugar regulation of harvest-related genes in asparagus.

    PubMed Central

    Davies, K M; Seelye, J F; Irving, D E; Borst, W M; Hurst, P L; King, G A

    1996-01-01

    The signals controlling the abundance of transcripts up-regulated (pTIP27, pTIP31, and pTIP32) or down-regulated (pTIP20 and pTIP21) after harvest in asparagus (Asparagus officinalis L.) spears were examined. pTIP27 and pTIP31 are known to encode asparagine synthetase (AS) and a beta-galactosidase (beta-gal) homolog, respectively. The nucleotide sequences of pTIP20, pTIP21, and pTIP32 were determined, and they encode histone 3, histone 2B, and an unknown product, respectively. Changes in respiration, soluble sugars, and abundance of the five mRNAs were similar in the tips stored as 30-mm lengths or as part of 180-mm spears. We previously hypothesized that sugars may regulate the level of AS transcripts in asparagus tissue. Asparagus cell cultures were used to test the role of sugar status may regulate the level of AS transcripts in asparagus tissue. Asparagus cell cultures were used to test the role of sugar status in regulating gene expression. Transcript abundance for AS, beta-gal, and pTIP32 was low in cells in sugar-containing medium but increased within 12 h after transferring cells to a sugar-free medium. Histone 3 and histone 2B transcripts were, in general, abundant in cells on sugar-containing medium but declined in abundance when transferred to sugar-free medium. When cells were returned to sugar-containing medium the abundance of transcripts for histone 3 and histone 2B increased, whereas that for AS, beta-gal, and pTIP32 decreased. Soluble sugar levels are known to decline rapidly in the tips of harvested spears. Metabolic regulation by sugar status may have a major influence on gene expression in asparagus spears and other tissue after harvest. PMID:8754687

  3. Safe Thinking and Affect Regulation (STAR): Human Immunodeficiency Virus Prevention in Alternative/Therapeutic Schools

    ERIC Educational Resources Information Center

    Brown, Larry K.; Nugent, Nicole R.; Houck, Christopher D.; Lescano, Celia M.; Whiteley, Laura B.; Barker, David; Viau, Lisa; Zlotnick, Caron

    2011-01-01

    Objective: To evaluate the effectiveness of Safe Thinking and Affect Regulation (STAR), a 14-session HIV-prevention program for adolescents at alternative/therapeutic schools. Because these youth frequently have difficulties with emotions and cognitions, it was designed to improve sexuality-specific affect management and cognitive monitoring, as…

  4. Toddler Emotion Regulation with Mothers and Fathers: Temporal Associations between Negative Affect and Behavioral Strategies

    ERIC Educational Resources Information Center

    Ekas, Naomi V.; Braungart-Rieker, Julia M.; Lickenbrock, Diane M.; Zentall, Shannon R.; Maxwell, Scott M.

    2011-01-01

    The present study investigated temporal associations between putative emotion regulation strategies and negative affect in 20-month-old toddlers. Toddlers' parent-focused, self-distraction, and toy-focused strategies, as well as negative affect, were rated on a second-by-second basis during laboratory parent-toddler interactions. Longitudinal…

  5. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    PubMed Central

    Kaur, Simranjeet; Pociot, Flemming

    2015-01-01

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value < 10e−16), which highlights their importance in T1D. Functional annotation of T1D genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value < 10e−6). We also identified eight T1D genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes. PMID:26184322

  6. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    PubMed

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value < 10e-16), which highlights their importance in T1D. Functional annotation of T1D genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value < 10e-6). We also identified eight T1D genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  7. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. PMID:26768363

  8. Using variability in gene expression as a tool for studying gene regulation.

    PubMed

    Padovan-Merhar, Olivia; Raj, Arjun

    2013-01-01

    With the advent of quantitative tools for measuring gene expression in single cells, researchers have made the discovery that in many contexts, messenger RNA and protein levels can vary widely from cell to cell, often because of inherently stochastic events associated with gene expression. The study of this cellular individuality has become a field of study in its own right, characterized by a blend of technological development, theoretical analysis, and, more recently, applications to biological phenomena. In this review, we focus on the use of the variability inherent to gene expression as a tool to understand gene regulation. We discuss the use of variability as a natural systems-level perturbation, its use in quantitatively characterizing the biological processes underlying transcription, and its application to the discovery of new gene regulatory interactions. We believe that use of variability can provide new biological insights into different aspects of transcriptional control and can provide a powerful complementary approach to that of existing techniques.

  9. Genome-wide gene expression analysis identifies K-ras as a regulator of alcohol intake.

    PubMed

    Repunte-Canonigo, Vez; van der Stap, Lena D; Chen, Jihuan; Sabino, Valentina; Wagner, Ulrich; Zorrilla, Eric P; Schumann, Gunter; Roberts, Amanda J; Sanna, Pietro Paolo

    2010-06-21

    Adaptations in the anterior cingulate cortex (ACC) have been implicated in alcohol and drug addiction. To identify genes that may contribute to excessive drinking, here we performed microarray analyses in laser microdissected rat ACC after a single or repeated administration of an intoxicating dose of alcohol (3 g/kg). Expression of the small G protein K-ras was differentially regulated following both single and repeated alcohol administration. We also observed that voluntary alcohol intake in K-ras heterozygous null mice (K-ras(+/-)) did not increase after withdrawal from repeated cycles of intermittent ethanol vapor exposure, unlike in their wild-type littermates. To identify K-ras regulated pathways, we then profiled gene expression in the ACC of K-ras(+/-), heterozygous null mice for the K-ras negative regulator Nf1 (Nf1(+/-)) and wild-type mice following repeated administration of an intoxicating dose of alcohol. Pathway analysis showed that alcohol differentially affected various pathways in a K-ras dependent manner - some of which previously shown to be regulated by alcohol - including the insulin/PI3K pathway, the NF-kappaB, the phosphodiesterases (PDEs) pathway, the Jak/Stat and the adipokine signaling pathways. Altogether, the data implicate K-ras-regulated pathways in the regulation of excessive alcohol drinking after a history of dependence.

  10. prrA, a putative response regulator involved in oxygen regulation of photosynthesis gene expression in Rhodobacter sphaeroides.

    PubMed Central

    Eraso, J M; Kaplan, S

    1994-01-01

    A new locus, prrA, involved in the regulation of photosynthesis gene expression in response to oxygen, has been identified in Rhodobacter sphaeroides. Inactivation of prrA results in the absence of photosynthetic spectral complexes. The prrA gene product has strong homology to response regulators associated with signal transduction in other prokaryotes. When prrA is present in multiple copies, cells produce light-harvesting complexes under aerobic growth conditions, suggesting that prrA affects photosynthesis gene expression positively in response to oxygen deprivation. Analysis of the expression of puc::lacZ fusions in wild-type and PrrA- cells revealed a substantial decrease in LacZ expression in the absence of prrA under all conditions of growth, especially when cells were grown anaerobically in the dark in the presence of dimethyl sulfoxide. Northern (RNA) and slot blot hybridizations confirmed the beta-galactoside results for puc and revealed additional positive regulation of puf, puhA, and cycA by PrrA. The effect of truncated PrrA on photosynthesis gene expression in the presence of low oxygen levels can be explained by assuming that PrrA may be effective as a multimer. PrrA was found to act on the downstream regulatory sequences (J. K. Lee and S. Kaplan, J. Bacteriol. 174:1146-1157, 1992) of the puc operon regulatory region. Finally, two spontaneous prrA mutations that abolish prrA function by changing amino acids in the amino-terminal domain of the protein were isolated. Images PMID:8282708

  11. Differentially regulated gene expression associated with hepatitis C virus clearance

    PubMed Central

    Grimes, Carolyn Z.; Hwang, Lu-Yu; Wei, Peng; Shah, Dimpy P.; Volcik, Kelly A.

    2013-01-01

    Human chronic hepatitis C virus (HCV) infections pose a significant public health threat, necessitating the development of novel treatments and vaccines. HCV infections range from spontaneous resolution to end-stage liver disease. Approximately 10–30 % of HCV infections undergo spontaneous resolution independent of treatment by yet-to-be-defined mechanisms. These individuals test positive for anti-HCV antibodies in the absence of detectable viral serum RNA. To identify genes associated with HCV clearance, this study compared gene expression profiles between current drug users chronically infected with HCV and drug users who cleared their HCV infection. This analysis identified 91 differentially regulated (up- or downregulated by twofold or more) genes potentially associated with HCV clearance. The majority of genes identified were associated with immune function, with the remaining genes categorized either as cancer related or ‘other’. Identification of factors and pathways that may influence virus clearance will be essential to the development of novel treatment strategies. PMID:23152368

  12. H-Ferritin-Regulated MicroRNAs Modulate Gene Expression in K562 Cells

    PubMed Central

    Biamonte, Flavia; Zolea, Fabiana; Bisognin, Andrea; Di Sanzo, Maddalena; Saccoman, Claudia; Scumaci, Domenica; Aversa, Ilenia; Panebianco, Mariafranca; Faniello, Maria Concetta; Bortoluzzi, Stefania; Cuda, Giovanni; Costanzo, Francesco

    2015-01-01

    In a previous study, we showed that the silencing of the heavy subunit (FHC) offerritin, the central iron storage molecule in the cell, is accompanied by a modification in global gene expression. In this work, we explored whether different FHC amounts might modulate miRNA expression levels in K562 cells and studied the impact of miRNAs in gene expression profile modifications. To this aim, we performed a miRNA-mRNA integrative analysis in K562 silenced for FHC (K562shFHC) comparing it with K562 transduced with scrambled RNA (K562shRNA). Four miRNAs, namely hsa-let-7g, hsa-let-7f, hsa-let-7i and hsa-miR-125b, were significantly up-regulated in silenced cells. The remarkable down-regulation of these miRNAs, following FHC expression rescue, supports a specific relation between FHC silencing and miRNA-modulation. The integration of target predictions with miRNA and gene expression profiles led to the identification of a regulatory network which includes the miRNAs up-regulated by FHC silencing, as well as91 down-regulated putative target genes. These genes were further classified in 9 networks; the highest scoring network, “Cell Death and Survival, Hematological System Development and Function, Hematopoiesis”, is composed by 18 focus molecules including RAF1 and ERK1/2. We confirmed that, following FHC silencing, ERK1/2 phosphorylation is severely impaired and that RAF1 mRNA is significantly down-regulated. Taken all together, our data indicate that, in our experimental model, FHC silencing may affect RAF1/pERK1/2 levels through the modulation of a specific set of miRNAs and add new insights in to the relationship among iron homeostasis and miRNAs. PMID:25815883

  13. Retroviral vectors containing Tet-controlled bidirectional transcription units for simultaneous regulation of two gene activities

    PubMed Central

    Loew, Rainer; Vigna, Elisa; Lindemann, Dirk; Naldini, Luigi; Bujard, Herman

    2006-01-01

    In this study retroviral self-inactivating (SIN)-vectors were constructed, that allow simultaneous regulation of two genes by integration of bidirectional Tet controlled transcription units. Marker genes (luciferase and eGFP) were expressed under the control of various bidirectional promoters Ptetbis, in order to determine (i) the fraction of HtTA-1 cells exhibiting tight doxycycline (Dox) dependent control; (ii) possible effects of the vector backbone on the regulation of gene transcription; (iii) the possibility for crosstalk between different minimal promoters within Ptetbi. When HtTA-1 cells, constitutively expressing the Tet-Transactivator (tTA), were transduced by S2f-lMCg retroviral vector, a high percentage (40) of the cell population displayed tight regulation (5000 fold) of Ptetbi activity over a wide range of Dox concentrations. As a result of our comparative study on the activity of virus derived minimal promoters (from MMTV, HIV and CMV), a clear hierarchy of activity as well as a different sensitivity to external influences among the various promoters studied was observed. Furthermore, our results strongly support the idea, that viral elements such as part of the MuLV pol/env region significantly affect the regulation capacity of an integrate. Taking into account our observations as outlined above, we succeeded in generating significantly optimized Tet regulated retroviral vectors. The application of such a one-step transfer system for Ptet controlled genes would be of particular relevance to applications where cellular systems do not allow prolonged selection procedures as it is the case with primary cells considered for ex vivo gene therapy. PMID:19565004

  14. Neuregulin-regulated gene expression in mammary carcinoma cells.

    PubMed

    Amin, Dhara N; Tuck, David; Stern, David F

    2005-09-10

    Recent studies have suggested that autocrine production of Neuregulin (NRG), a growth factor that activates members of the Epidermal Growth Factor Receptor/ErbB family of proto-oncogenes, is sufficient for breast tumor initiation and progression. To elucidate the molecular mechanisms regulating these events, we undertook a global analysis of genes regulated by NRG in luminal mammary epithelial cell lines. Gene expression profiling of estrogen receptor-positive T47D cells exposed to NRG-1 revealed both previously identified and novel targets of NRG activation. Profiling of other estrogen receptor-positive breast cancer cell lines, MCF7 and SUM44, yielded a group of twenty-one genes whose transcripts are upregulated by NRG in all three lines tested. The NRG targets are FBJ murine osteosarcoma viral oncogene homolog B, Early growth response 1, v-jun avian sarcoma virus 17 oncogene homolog, Activating transcription factor 3, Homo sapiens cDNA FLJ31636 fis, Jun B proto-oncogene, Forkhead box C1, Platelet/endothelial cell adhesion molecule 1, NADPH-dependent retinol dehydrogenase/reductase, Dual specificity phosphatase 5, NGF inducible protein TIS21, Connective tissue growth factor, Jun D proto-oncogene, Serum response factor, Cullin 1, v-myc avian myelocytomatosis viral oncogene, Transient receptor potential channel 1, Low density lipoprotein receptor, Transforming growth factor beta 1, Nucleoporin 88 kDa, and Pleckstrin homology-like domain A1. Since NRG activation of these cells induces resistance to anti-hormonal therapy, the identified genes may provide clues to molecular events regulating mammary tumor progression and hormone independence.

  15. Structural Mechanisms of Peptide Recognition and Allosteric Modulation of Gene Regulation by the RRNPP Family of Quorum-Sensing Regulators.

    PubMed

    Do, Hackwon; Kumaraswami, Muthiah

    2016-07-17

    The members of RRNPP family of bacterial regulators sense population density-specific secreted oligopeptides and modulate the expression of genes involved in cellular processes, such as sporulation, competence, virulence, biofilm formation, conjugative plasmid transfer and antibiotic resistance. Signaling by RRNPP regulators include several steps: generation and secretion of the signaling oligopeptides, re-internalization of the signaling molecules into the cytoplasm, signal sensing by the cytosolic RRNPP regulators, signal-specific allosteric structural changes in the regulators, and interaction of the regulators with their respective regulatory target and gene regulation. The recently determined structures of the RRNPP regulators provide insight into the mechanistic aspects for several steps in this signaling circuit. In this review, we discuss the structural principles underlying peptide specificity, regulatory target recognition, and ligand-induced allostery in RRNPP regulators and its impact on gene regulation. Despite the conserved tertiary structure of these regulators, structural analyses revealed unexpected diversity in the mechanism of activation and molecular strategies that couple the peptide-induced allostery to gene regulation. Although these structural studies provide a sophisticated understanding of gene regulation by RRNPP regulators, much needs to be learned regarding the target DNA binding by yet-to-be characterized RNPP regulators and the several aspects of signaling by Rgg regulators. PMID:27283781

  16. Regulation of iron transport related genes by boron in the marine bacterium Marinobacter algicola DG893.

    PubMed

    Romano, Ariel; Trimble, Lyndsay; Hobusch, Ashtian R; Schroeder, Kristine J; Amin, Shady A; Hartnett, Andrej D; Barker, Ryan A; Crumbliss, Alvin L; Carrano, Carl J

    2013-08-01

    While there has been extensive interest in the use of boron isotope ratios as a surrogate of pH in paleoclimate studies in the context of climate change-related questions, the high (0.4 mM) concentration and the depth-independent (conservative or non-nutrient-like) concentration profile of this element have led to boron being neglected as a potentially biologically relevant element in the modern ocean. Here we report that boron affects the expression of a number of protein and genes in the "algal-associated" Gram-negative marine bacterium Marinobacter algicola DG893. Most intriguingly, a number of these proteins and genes are related to iron uptake. In a recent separate publication we have shown that boron regulates one such iron transport related protein, i.e. the periplasmic iron binding protein FbpA via a direct interaction of the metalloid with this protein. Here we show that a number of other iron uptake related genes are also affected by boron but in the opposite way i.e. they are up-regulated. We propose that the differential effect of boron on FbpA expression relative to other iron transport related genes is a result of an interaction between boron and the global iron regulatory protein Fur.

  17. A plant gene up-regulated at rust infection sites.

    PubMed

    Ayliffe, Michael A; Roberts, James K; Mitchell, Heidi J; Zhang, Ren; Lawrence, Gregory J; Ellis, Jeffrey G; Pryor, Tony J

    2002-05-01

    Expression of the fis1 gene from flax (Linum usitatissimum) is induced by a compatible rust (Melampsora lini) infection. Infection of transgenic plants containing a beta-glucuronidase (GUS) reporter gene under the control of the fis1 promoter showed that induction is highly localized to those leaf mesophyll cells within and immediately surrounding rust infection sites. The level of induction reflects the extent of fungal growth. In a strong resistance reaction, such as the hypersensitive fleck mediated by the L6 resistance gene, there is very little fungal growth and a microscopic level of GUS expression. Partially resistant flax leaves show levels of GUS expression that were intermediate to the level observed in the fully susceptible infection. Sequence and deletion analysis using both transient Agrobacterium tumefaciens expression and stable transformation assays have shown that the rust-inducible fis1 promoter is contained within a 580-bp fragment. Homologs of fis1 were identified in expressed sequence tag databases of a range of plant species including dicots, monocots, and a gymnosperm. Homologous genes isolated from maize (Zea mays; mis1), barley (Hordeum vulgare; bis1), wheat (Triticum aestivum; wis1), and Arabidopsis encode proteins that are highly similar (76%-82%) to the FIS1 protein. The Arabidopsis homologue has been reported to encode a delta1-pyrroline-5-carboxylate dehydrogenase that is involved in the catabolism of proline to glutamate. RNA-blot analysis showed that mis1 in maize and the bis1 homolog in barley are both up-regulated by a compatible infection with the corresponding species-specific rust. The rust-induced genes homologous to fis1 are present in many plants. The promoters of these genes have potential roles for the engineering of synthetic rust resistance genes by targeting transgene expression to the sites of rust infection.

  18. Expression of Selenoprotein Genes Is Affected by Obesity of Pigs Fed a High-Fat Diet123

    PubMed Central

    Zhao, Hua; Li, Ke; Tang, Jia-Yong; Zhou, Ji-Chang; Wang, Kang-Ning; Xia, Xin-Jie; Lei, Xin Gen

    2015-01-01

    Background: Relations of the 25 mammalian selenoprotein genes with obesity and the associated inflammation remain unclear. Objective: This study explored impacts of high-fat diet-induced obesity on inflammation and expressions of selenoprotein and obesity-related genes in 10 tissues of pigs. Methods: Plasma and 10 tissues were collected from pigs (n = 10) fed a corn-soy–based control diet or that diet containing 3–7% lard from weanling to finishing (180 d). Plasma concentrations (n = 8) of cytokines and thyroid hormones and tissue mRNA abundance (n = 4) of 25 selenoprotein genes and 16 obesity-related genes were compared between the pigs fed the control and high-fat diets. Stepwise regression was applied to analyze correlations among all these measures, including the previously reported body physical and plasma biochemical variables. Results: The high-fat diet elevated (P < 0.05) plasma concentrations of tumor necrosis factor α, interleukin-6, leptin, and leptin receptor by 29–42% and affected (P < 0.05–0.1) tissue mRNA levels of the selenoprotein and obesity-related genes in 3 patterns. Specifically, the high-fat diet up-regulated 12 selenoprotein genes in 6 tissues, down-regulated 13 selenoprotein genes in 7 tissues, and exerted no effect on 5 genes in any tissue. Body weights and plasma triglyceride concentrations of pigs showed the strongest regressions to tissue mRNA abundances of selenoprotein and obesity-related genes. Among the selenoprotein genes, selenoprotein V and I were ranked as the strongest independent variables for the regression of phenotypic and plasma measures. Meanwhile, agouti signaling protein, adiponectin, and resistin genes represented the strongest independent variables of the obesity-related genes for the regression of tissue selenoprotein mRNA. Conclusions: The high-fat diet induced inflammation in pigs and affected their gene expression of selenoproteins associated with thioredoxin and oxidoreductase systems, local tissue

  19. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-01

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming.

  20. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-01

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming. PMID:25384038

  1. Epigenetic mechanisms of gene expression regulation in neurological diseases.

    PubMed

    Gos, Monika

    2013-01-01

    Neurological diseases are a heterogenous group of disorders that are related to alterations in nervous system function. The genetic background of neurological diseases is heterogenous and may include chromosomal aberrations, specific gene mutations and epigenetic defects. This review is aimed at presenting of selected diseases that are associated with different epigenetic alterations. The imprinting defects on chromosome 15 are the cause of Prader-Willi and Angelman syndromes that both are characterized by intellectual disability, developmental delay and specific behavioral phenotype. Besides the imprinting defect, these diseases can also be caused by deletion of chromosome 15 or uniparental disomy. Aberrant epigenetic regulation is also specific for Fragile X syndrome that is caused by expansion of CGG repeats in the FMR1 gene that leads to global methylation of the promoter region and repression of FMR1 transcription. A number of neurological diseases, mainly associated with intellectual impairment, may be caused by mutations in genes encoding proteins involved in epigenetic regulation. The number of such diseases is rapidly growing thanks to the implementation of genomic sequencing for the identification of their molecular causes. One of the best known diseases linked to defects in epigenetic modifiers is Rett syndrome caused by a mutation in the MECP2 gene or its variant - Rett-like syndrome caused by a mutation in CDKL5 or FOXG1 genes. As the epigenetic signature is potentially reversible, much attention is focused on possible therapies with drugs that influence DNA or histone modifications. This is especially important in the case of neurological disorders in which epigenetic changes are observed as the effect of the disease.

  2. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  3. Computational Design of Artificial RNA Molecules for Gene Regulation

    PubMed Central

    Laganà, Alessandro; Veneziano, Dario; Russo, Francesco; Pulvirenti, Alfredo; Giugno, Rosalba; Croce, Carlo Maria; Ferro, Alfredo

    2015-01-01

    RNA interference (RNAi) is a powerful tool for the regulation of gene expression. Small exogenous noncoding RNAs (ncRNAs) such as siRNA and shRNA are the active silencing agents, intended to target and cleave complementary mRNAs in a specific way. They are widely and successfully employed in functional studies, and several ongoing and already completed siRNA-based clinical trials suggest encouraging results in the regulation of overexpressed genes in disease. siRNAs share many aspects of their biogenesis and function with miRNAs, small ncRNA molecules transcribed from endogenous genes which are able to repress the expression of target mRNAs by either inhibiting their translation or promoting their degradation. Although siRNA and artificial miRNA molecules can significantly reduce the expression of overexpressed target genes, cancer and other diseases can also be triggered or sustained by upregulated miRNAs. Thus, in the past recent years, molecular tools for miRNA silencing, such as antagomiRs and miRNA sponges, have been developed. These molecules have shown their efficacy in the derepression of genes downregulated by overexpressed miRNAs. In particular, while a single antagomiR is able to inhibit a single complementary miRNA, an artificial sponge construct usually contains one or more binding sites for one or more miRNAs and functions by competing with the natural targets of these miRNAs. As a consequence, natural miRNA targets are reexpressed at their physiological level. In this chapter we review the most successful methods for the computational design of siRNAs, antagomiRs, and miRNA sponges and describe the most popular tools that implement them. PMID:25577393

  4. Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans

    PubMed Central

    Honda, Yoko; Higashibata, Akira; Matsunaga, Yohei; Yonezawa, Yukiko; Kawano, Tsuyoshi; Higashitani, Atsushi; Kuriyama, Kana; Shimazu, Toru; Tanaka, Masashi; Szewczyk, Nathaniel J.; Ishioka, Noriaki; Honda, Shuji

    2012-01-01

    How microgravitational space environments affect aging is not well understood. We observed that, in Caenorhabditis elegans, spaceflight suppressed the formation of transgenically expressed polyglutamine aggregates, which normally accumulate with increasing age. Moreover, the inactivation of each of seven genes that were down-regulated in space extended lifespan on the ground. These genes encode proteins that are likely related to neuronal or endocrine signaling: acetylcholine receptor, acetylcholine transporter, choline acetyltransferase, rhodopsin-like receptor, glutamate-gated chloride channel, shaker family of potassium channel, and insulin-like peptide. Most of them mediated lifespan control through the key longevity-regulating transcription factors DAF-16 or SKN-1 or through dietary-restriction signaling, singly or in combination. These results suggest that aging in C. elegans is slowed through neuronal and endocrine response to space environmental cues. PMID:22768380

  5. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway.

  6. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway. PMID:27491940

  7. Do circadian genes and ambient temperature affect substrate-borne signalling during Drosophila courtship?

    PubMed

    Medina, Izarne; Casal, José; Fabre, Caroline C G

    2015-01-01

    Courtship vibratory signals can be air-borne or substrate-borne. They convey distinct and species-specific information from one individual to its prospective partner. Here, we study the substrate-borne vibratory signals generated by the abdominal quivers of the Drosophila male during courtship; these vibrations travel through the ground towards courted females and coincide with female immobility. It is not known which physical parameters of the vibrations encode the information that is received by the females and induces them to pause. We examined the intervals between each vibratory pulse, a feature that was reported to carry information for animal communication. We were unable to find evidence of periodic variations in the lengths of these intervals, as has been reported for fly acoustical signals. Because it was suggested that the genes involved in the circadian clock may also regulate shorter rhythms, we search for effects of period on the interval lengths. Males that are mutant for the period gene produced vibrations with significantly altered interpulse intervals; also, treating wild type males with constant light results in similar alterations to the interpulse intervals. Our results suggest that both the clock and light/dark cycles have input into the interpulse intervals of these vibrations. We wondered if we could alter the interpulse intervals by other means, and found that ambient temperature also had a strong effect. However, behavioural analysis suggests that only extreme ambient temperatures can affect the strong correlation between female immobility and substrate-borne vibrations. PMID:26519517

  8. Do circadian genes and ambient temperature affect substrate-borne signalling during Drosophila courtship?

    PubMed Central

    Medina, Izarne; Casal, José; Fabre, Caroline C. G.

    2015-01-01

    ABSTRACT Courtship vibratory signals can be air-borne or substrate-borne. They convey distinct and species-specific information from one individual to its prospective partner. Here, we study the substrate-borne vibratory signals generated by the abdominal quivers of the Drosophila male during courtship; these vibrations travel through the ground towards courted females and coincide with female immobility. It is not known which physical parameters of the vibrations encode the information that is received by the females and induces them to pause. We examined the intervals between each vibratory pulse, a feature that was reported to carry information for animal communication. We were unable to find evidence of periodic variations in the lengths of these intervals, as has been reported for fly acoustical signals. Because it was suggested that the genes involved in the circadian clock may also regulate shorter rhythms, we search for effects of period on the interval lengths. Males that are mutant for the period gene produced vibrations with significantly altered interpulse intervals; also, treating wild type males with constant light results in similar alterations to the interpulse intervals. Our results suggest that both the clock and light/dark cycles have input into the interpulse intervals of these vibrations. We wondered if we could alter the interpulse intervals by other means, and found that ambient temperature also had a strong effect. However, behavioural analysis suggests that only extreme ambient temperatures can affect the strong correlation between female immobility and substrate-borne vibrations. PMID:26519517

  9. Do circadian genes and ambient temperature affect substrate-borne signalling during Drosophila courtship?

    PubMed

    Medina, Izarne; Casal, José; Fabre, Caroline C G

    2015-01-01

    Courtship vibratory signals can be air-borne or substrate-borne. They convey distinct and species-specific information from one individual to its prospective partner. Here, we study the substrate-borne vibratory signals generated by the abdominal quivers of the Drosophila male during courtship; these vibrations travel through the ground towards courted females and coincide with female immobility. It is not known which physical parameters of the vibrations encode the information that is received by the females and induces them to pause. We examined the intervals between each vibratory pulse, a feature that was reported to carry information for animal communication. We were unable to find evidence of periodic variations in the lengths of these intervals, as has been reported for fly acoustical signals. Because it was suggested that the genes involved in the circadian clock may also regulate shorter rhythms, we search for effects of period on the interval lengths. Males that are mutant for the period gene produced vibrations with significantly altered interpulse intervals; also, treating wild type males with constant light results in similar alterations to the interpulse intervals. Our results suggest that both the clock and light/dark cycles have input into the interpulse intervals of these vibrations. We wondered if we could alter the interpulse intervals by other means, and found that ambient temperature also had a strong effect. However, behavioural analysis suggests that only extreme ambient temperatures can affect the strong correlation between female immobility and substrate-borne vibrations.

  10. Identification of REST-regulated genes and pathways using a REST-targeted antisense approach.

    PubMed

    Sedaghat, Yalda; Bui, Huynh-Hoa; Mazur, Curt; Monia, Brett P

    2013-12-01

    The repressor element-1 silencing transcription factor/neuron-restrictive silencer factor (REST/NRSF) is one of the first negative-acting transcriptional regulators implicated in vertebrate development thought to regulate hundreds of neuron-specific genes. However, its function in the adult system remains elusive. Here we employ second-generation antisense oligonucleotides (ASOs) to study the impact of rest-mediated suppression on gene expression. We demonstrate specific reductions in REST levels in vitro, and in vivo in mouse liver following treatment with ASOs, and we show that ASO mediated-REST suppression results in the elevation in expression of many neuronal genes including brain-derived neurotrophic factor, Synapsin1 (syn1) and β3-tubulin in BALB/c liver. Furthermore, we show the elevation of the affected proteins in plasma following ASO treatment. Finally, microarray analysis was applied to identify a broad range of genes modulated by REST suppression in mouse liver. Our findings suggest that REST may be an important target for neurodegenerative diseases like Huntington's disease, is also involved in the regulation of a broad range of additional cellular pathways, and that the antisense approach is a viable strategy for selectively modulating REST activity in vivo. PMID:24329414

  11. Sox2 cooperates with Chd7 to regulate genes that are mutated in human syndromes.

    PubMed

    Engelen, Erik; Akinci, Umut; Bryne, Jan Christian; Hou, Jun; Gontan, Cristina; Moen, Maaike; Szumska, Dorota; Kockx, Christel; van Ijcken, Wilfred; Dekkers, Dick H W; Demmers, Jeroen; Rijkers, Erik-Jan; Bhattacharya, Shoumo; Philipsen, Sjaak; Pevny, Larysa H; Grosveld, Frank G; Rottier, Robbert J; Lenhard, Boris; Poot, Raymond A

    2011-06-01

    The HMG-box transcription factor Sox2 plays a role throughout neurogenesis and also acts at other stages of development, as illustrated by the multiple organs affected in the anophthalmia syndrome caused by SOX2 mutations. Here we combined proteomic and genomic approaches to characterize gene regulation by Sox2 in neural stem cells. Chd7, a chromatin remodeling ATPase associated with CHARGE syndrome, was identified as a Sox2 transcriptional cofactor. Sox2 and Chd7 physically interact, have overlapping genome-wide binding sites and regulate a set of common target genes including Jag1, Gli3 and Mycn, genes mutated in Alagille, Pallister-Hall and Feingold syndromes, which show malformations also associated with SOX2 anophthalmia syndrome or CHARGE syndrome. Regulation of disease-associated genes by a Sox2-Chd7 complex provides a plausible explanation for several malformations associated with SOX2 anophthalmia syndrome or CHARGE syndrome. Indeed, we found that Chd7-haploinsufficient embryos showed severely reduced expression of Jag1 in the developing inner ear. PMID:21532573

  12. Gaze fixations predict brain activation during the voluntary regulation of picture-induced negative affect.

    PubMed

    van Reekum, Carien M; Johnstone, Tom; Urry, Heather L; Thurow, Marchell E; Schaefer, Hillary S; Alexander, Andrew L; Davidson, Richard J

    2007-07-01

    Recent studies have identified a distributed network of brain regions thought to support cognitive reappraisal processes underlying emotion regulation in response to affective images, including parieto-temporal regions and lateral/medial regions of prefrontal cortex (PFC). A number of these commonly activated regions are also known to underlie visuospatial attention and oculomotor control, which raises the possibility that people use attentional redeployment rather than, or in addition to, reappraisal as a strategy to regulate emotion. We predicted that a significant portion of the observed variance in brain activation during emotion regulation tasks would be associated with differences in how participants visually scan the images while regulating their emotions. We recorded brain activation using fMRI and quantified patterns of gaze fixation while participants increased or decreased their affective response to a set of affective images. fMRI results replicated previous findings on emotion regulation with regulation differences reflected in regions of PFC and the amygdala. In addition, our gaze fixation data revealed that when regulating, individuals changed their gaze patterns relative to a control condition. Furthermore, this variation in gaze fixation accounted for substantial amounts of variance in brain activation. These data point to the importance of controlling for gaze fixation in studies of emotion regulation that use visual stimuli.

  13. Expression and regulation of CCN genes in murine osteoblasts.

    PubMed

    Parisi, Muriel S; Gazzerro, Elizabetta; Rydziel, Sheila; Canalis, Ernesto

    2006-05-01

    Members of the CCN family of genes include cysteine-rich 61 (CYR61), connective tissue growth factor (CTGF), nephroblastoma overexpressed (NOV), and Wnt-induced secreted proteins (WISP) 1, 2 and 3. CCN proteins play a role in cell differentiation and function, but their expression and function in skeletal tissue is partially understood. We examined the expression and regulation of CCN genes in primary cultures of murine osteoblasts treated with transforming growth factor beta (TGFbeta), bone morphogenetic protein (BMP)-2, or cortisol. Northern blot analysis revealed the presence of CYR61, CTGF, NOV, and WISP 1 and 2 transcripts in murine osteoblasts, but not WISP 3 transcripts. Northern and Western blot analyses revealed that TGF beta, BMP-2, and cortisol increased CYR61 and CTGF mRNA and protein levels. TGF beta decreased NOV and increased WISP 2 mRNA and protein levels, and TGF beta and BMP-2 increased, whereas cortisol decreased WISP 1 mRNA and protein levels. Nuclear run-on assays revealed that TGF beta, BMP-2 and cortisol enhanced CYR61 and CTGF transcription, TGF beta and BMP-2 induced and cortisol suppressed WISP 1, and TGF beta induced WISP 2 transcription. Suppression of NOV transcription could not be detected due to low control levels. In conclusion, five of the six known CCN genes are expressed by osteoblasts and their transcription is regulated by TGF beta, BMP-2 and cortisol.

  14. Regulation of virulence gene expression in pathogenic Listeria.

    PubMed

    Brehm, K; Kreft, J; Ripio, M T; Vázquez-Boland, J A

    1996-06-01

    Dynamic interactions between host and pathogen are characteristic of infections caused by intracellular bacteria. This has favoured the evolution of highly effective control systems by which these pathogens regulate the expression of different virulence factors during sequential steps of the infection process. In the case of the facultative intracellular bacterium Listeria monocytogenes, these steps involve internalization by eukaryotic cells, lysis of the resulting phagosome, replication as well as movement within the host cytoplasm, direct cell-to-cell spread, and subsequent lysis of a double-membrane vacuole when entering neighbouring cells. Virulence factors which are involved in each of these steps have been identified and the expression of these factors is subject to a co-ordinate and differential control exerted by the major listerial virulence regulator PrfA. This protein belongs to the Crp/Fnr-family of transcriptional activators and recognizes specific target sequences in promoter regions of several listerial virulence genes. Differential expression of these genes during sequential steps of the infection seems to be at least partially mediated by different binding affinities of PrfA to its target sequences. Activity of PrfA-dependent genes and of prfA itself is under the control of several environmental variables which are used by the pathogen to recognize its transition from the free environment into a eukaryotic host.

  15. Neighboring Gene Regulation by Antisense Long Non-Coding RNAs

    PubMed Central

    Villegas, Victoria E.; Zaphiropoulos, Peter G.

    2015-01-01

    Antisense transcription, considered until recently as transcriptional noise, is a very common phenomenon in human and eukaryotic transcriptomes, operating in two ways based on whether the antisense RNA acts in cis or in trans. This process can generate long non-coding RNAs (lncRNAs), one of the most diverse classes of cellular transcripts, which have demonstrated multifunctional roles in fundamental biological processes, including embryonic pluripotency, differentiation and development. Antisense lncRNAs have been shown to control nearly every level of gene regulation—pretranscriptional, transcriptional and posttranscriptional—through DNA–RNA, RNA–RNA or protein–RNA interactions. This review is centered on functional studies of antisense lncRNA-mediated regulation of neighboring gene expression. Specifically, it addresses how these transcripts interact with other biological molecules, nucleic acids and proteins, to regulate gene expression through chromatin remodeling at the pretranscriptional level and modulation of transcriptional and post-transcriptional processes by altering the sense mRNA structure or the cellular compartmental distribution, either in the nucleus or the cytoplasm. PMID:25654223

  16. Regulation of the Saccharomyces cerevisiae DNA repair gene RAD16.

    PubMed Central

    Bang, D D; Timmermans, V; Verhage, R; Zeeman, A M; van de Putte, P; Brouwer, J

    1995-01-01

    The RAD16 gene product has been shown to be essential for the repair of the silenced mating type loci [Bang et al. (1992) Nucleic Acids Res. 20, 3925-3931]. More recently we demonstrated that the RAD16 and RAD7 proteins are also required for repair of non-transcribed strands of active genes in Saccharomyces cerevisiae [Waters et al. (1993) Mol. Gen. Genet. 239, 28-32]. We have studied the regulation of the RAD16 gene and found that the RAD16 transcript levels increased up to 7-fold upon UV irradiation. Heat shock at 42 degrees C also results in elevated levels of RAD16 mRNA. In sporulating MAT alpha/MATa diploid cells RAD16 mRNA is also induced. The basal level of the RAD16 transcript is constant during the mitotic cell cycle. G1-arrested cells show normal induction of RAD16 mRNA upon UV irradiation demonstrating that the induction is not a secondary consequence of G2 cell cycle arrest following UV irradiation. However, in cells arrested in G1 the induction of RAD16 mRNA after UV irradiation is not followed by a rapid decline as occurs in normal growing cells suggesting that the down regulation of RAD16 transcription is dependent on progression into the cell cycle. Images PMID:7784171

  17. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    PubMed Central

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches. PMID:25566532

  18. Regulation of the Saccharomyces cerevisiae DNA repair gene RAD16.

    PubMed

    Bang, D D; Timmermans, V; Verhage, R; Zeeman, A M; van de Putte, P; Brouwer, J

    1995-05-25

    The RAD16 gene product has been shown to be essential for the repair of the silenced mating type loci [Bang et al. (1992) Nucleic Acids Res. 20, 3925-3931]. More recently we demonstrated that the RAD16 and RAD7 proteins are also required for repair of non-transcribed strands of active genes in Saccharomyces cerevisiae [Waters et al. (1993) Mol. Gen. Genet. 239, 28-32]. We have studied the regulation of the RAD16 gene and found that the RAD16 transcript levels increased up to 7-fold upon UV irradiation. Heat shock at 42 degrees C also results in elevated levels of RAD16 mRNA. In sporulating MAT alpha/MATa diploid cells RAD16 mRNA is also induced. The basal level of the RAD16 transcript is constant during the mitotic cell cycle. G1-arrested cells show normal induction of RAD16 mRNA upon UV irradiation demonstrating that the induction is not a secondary consequence of G2 cell cycle arrest following UV irradiation. However, in cells arrested in G1 the induction of RAD16 mRNA after UV irradiation is not followed by a rapid decline as occurs in normal growing cells suggesting that the down regulation of RAD16 transcription is dependent on progression into the cell cycle.

  19. The heterozygous abp1/ABP1 insertional mutant has defects in functions requiring polar auxin transport and in regulation of early auxin-regulated genes.

    PubMed

    Effendi, Yunus; Rietz, Steffen; Fischer, Urs; Scherer, Günther F E

    2011-01-01

    AUXIN-BINDING PROTEIN 1 (ABP1) is not easily accessible for molecular studies because the homozygous T-DNA insertion mutant is embryo-lethal. We found that the heterozygous abp1/ABP1 insertion mutant has defects in auxin physiology-related responses: higher root slanting angles, longer hypocotyls, agravitropic roots and hypocotyls, aphototropic hypocotyls, and decreased apical dominance. Heterozygous plants flowered earlier than wild-type plants under short-day conditions. The length of the main root, the lateral root density and the hypocotyl length were little altered in the mutant in response to auxin. Compared to wild-type plants, transcription of early auxin-regulated genes (IAA2, IAA11, IAA13, IAA14, IAA19, IAA20, SAUR9, SAUR15, SAUR23, GH3.5 and ABP1) was less strongly up-regulated in the mutant by 0.1, 1 and 10 μm IAA. Surprisingly, ABP1 was itself an early auxin-up-regulated gene. IAA uptake into the mutant seedlings during auxin treatments was indistinguishable from wild-type. Basipetal auxin transport in young roots was slower in the mutant, indicating a PIN2/EIR1 defect, while acropetal transport was indistinguishable from wild-type. In the eir1 background, three of the early auxin-regulated genes tested (IAA2, IAA13 and ABP1) were more strongly induced by 1 μm IAA in comparison to wild-type, but eight of them were less up-regulated in comparison to wild-type. Similar but not identical disturbances in regulation of early auxin-regulated genes indicate tight functional linkage of ABP1 and auxin transport regulation. We hypothesize that ABP1 is involved in the regulation of polar auxin transport, and thus affects local auxin concentration and early auxin gene regulation. In turn, ABP1 itself is under the transcriptional control of auxin.

  20. Endosymbiotic gene transfer and transcriptional regulation of transferred genes in Paulinella chromatophora.

    PubMed

    Nowack, Eva C M; Vogel, Heiko; Groth, Marco; Grossman, Arthur R; Melkonian, Michael; Glöckner, Gernot

    2011-01-01

    Paulinella chromatophora is a cercozoan amoeba that contains "chromatophores," which are photosynthetic inclusions of cyanobacterial origin. The recent discovery that chromatophores evolved independently of plastids, underwent major genome reduction, and transferred at least two genes to the host nucleus has highlighted P. chromatophora as a model to infer early steps in the evolution of photosynthetic organelles. However, owing to the paucity of nuclear genome sequence data, the extent of endosymbiotic gene transfer (EGT) and host symbiont regulation are currently unknown. A combination of 454 and Illumina next generation sequencing enabled us to generate a comprehensive reference transcriptome data set for P. chromatophora on which we mapped short Illumina cDNA reads generated from cultures from the dark and light phases of a diel cycle. Combined with extensive phylogenetic analyses of the deduced protein sequences, these data revealed that 1) about 0.3-0.8% of the nuclear genes were obtained by EGT compared with 11-14% in the Plantae, 2) transferred genes show a distinct bias in that many encode small proteins involved in photosynthesis and photoacclimation, 3) host cells established control over expression of transferred genes, and 4) not only EGT, but to a minor extent also horizontal gene transfer from organisms that presumably served as food sources, helped to shape the nuclear genome of P. chromatophora. The identification of a significant number of transferred genes involved in photosynthesis and photoacclimation of thylakoid membranes as well as the observed transcriptional regulation of these genes strongly implies import of the encoded gene products into chromatophores, a feature previously thought to be restricted to canonical organelles. Thus, a possible mechanism by which P. chromatophora exerts control over the performance of its newly acquired photosynthetic organelle may involve controlling the expression of nuclear-encoded chromatophore

  1. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    PubMed Central

    Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired. PMID:25961030

  2. Genome-wide transcriptomic analysis of cotton under drought stress reveal significant down-regulation of genes and pathways involved in fibre elongation and up-regulation of defense responsive genes.

    PubMed

    Padmalatha, Kethireddy Venkata; Dhandapani, Gurusamy; Kanakachari, Mogilicherla; Kumar, Saravanan; Dass, Abhishek; Patil, Deepak Prabhakar; Rajamani, Vijayalakshmi; Kumar, Krishan; Pathak, Ranjana; Rawat, Bhupendra; Leelavathi, Sadhu; Reddy, Palakolanu Sudhakar; Jain, Neha; Powar, Kasu N; Hiremath, Vamadevaiah; Katageri, Ishwarappa S; Reddy, Malireddy K; Solanke, Amolkumar U; Reddy, Vanga Siva; Kumar, Polumetla Ananda

    2012-02-01

    Cotton is an important source of natural fibre used in the textile industry and the productivity of the crop is adversely affected by drought stress. High throughput transcriptomic analyses were used to identify genes involved in fibre development. However, not much information is available on cotton genome response in developing fibres under drought stress. In the present study a genome wide transcriptome analysis was carried out to identify differentially expressed genes at various stages of fibre growth under drought stress. Our study identified a number of genes differentially expressed during fibre elongation as compared to other stages. High level up-regulation of genes encoding for enzymes involved in pectin modification and cytoskeleton proteins was observed at fibre initiation stage. While a large number of genes encoding transcription factors (AP2-EREBP, WRKY, NAC and C2H2), osmoprotectants, ion transporters and heat shock proteins and pathways involved in hormone (ABA, ethylene and JA) biosynthesis and signal transduction were up-regulated and genes involved in phenylpropanoid and flavonoid biosynthesis, pentose and glucuronate interconversions and starch and sucrose metabolism pathways were down-regulated during fibre elongation. This study showed that drought has relatively less impact on fibre initiation but has profound effect on fibre elongation by down-regulating important genes involved in cell wall loosening and expansion process. The comprehensive transcriptome analysis under drought stress has provided valuable information on differentially expressed genes and pathways during fibre development that will be useful in developing drought tolerant cotton cultivars without compromising fibre quality.

  3. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs.

  4. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  5. Thyroid hormone status affects expression of daily torpor and gene transcription in Djungarian hamsters (Phodopus sungorus).

    PubMed

    Bank, Jonathan H H; Kemmling, Julia; Rijntjes, Eddy; Wirth, Eva K; Herwig, Annika

    2015-09-01

    Thyroid hormones (TH) play a key role in regulation of seasonal as well as acute changes in metabolism. Djungarian hamsters (Phodopus sungorus) adapt to winter by multiple changes in behaviour and physiology including spontaneous daily torpor, a state of hypometabolism and hypothermia. We investigated effects of systemic TH administration and ablation on the torpor behaviour in Djungarian hamsters adapted to short photoperiod. Hyperthyroidism was induced by giving T4 or T3 and hypothyroidism by giving methimazole (MMI) and sodium perchlorate via drinking water. T3 treatment increased water, food intake and body mass, whereas MMI had the opposite effect. Continuous recording of body temperature revealed that low T3 serum concentrations increased torpor incidence, lowered Tb and duration, whereas high T3 serum concentrations inhibited torpor expression. Gene expression of deiodinases (dio) and uncoupling proteins (ucp) were analysed by qPCR in hypothalamus, brown adipose tissue (BAT) and skeletal muscle. Expression of dio2, the enzyme generating T3 by deiodination of T4, and ucps, involved in thermoregulation, indicated a tissue specific response to treatment. Torpor per se decreased dio2 expression irrespective of treatment or tissue, suggesting low intracellular T3 concentrations during torpor. Down regulation of ucp1 and ucp3 during torpor might be a factor for the inhibition of BAT thermogenesis. Hypothalamic gene expression of neuropeptide Y, propopiomelanocortin and somatostatin, involved in feeding behaviour and energy balance, were not affected by treatment. Taken together our data indicate a strong effect of thyroid hormones on torpor, suggesting that lowered intracellular T3 concentrations in peripheral tissues promote torpor.

  6. Misexpression of BRE gene in the developing chick neural tube affects neurulation and somitogenesis

    PubMed Central

    Wang, Guang; Li, Yan; Wang, Xiao-Yu; Chuai, Manli; Yeuk-Hon Chan, John; Lei, Jian; Münsterberg, Andrea; Lee, Kenneth Ka Ho; Yang, Xuesong

    2015-01-01

    The brain and reproductive expression (BRE) gene is expressed in numerous adult tissues and especially in the nervous and reproductive systems. However, little is known about BRE expression in the developing embryo or about its role in embryonic development. In this study, we used in situ hybridization to reveal the spatiotemporal expression pattern for BRE in chick embryo during development. To determine the importance of BRE in neurogenesis, we overexpressed BRE and also silenced BRE expression specifically in the neural tube. We established that overexpressing BRE in the neural tube indirectly accelerated Pax7+ somite development and directly increased HNK-1+ neural crest cell (NCC) migration and TuJ-1+ neurite outgrowth. These altered morphogenetic processes were associated with changes in the cell cycle of NCCs and neural tube cells. The inverse effect was obtained when BRE expression was silenced in the neural tube. We also determined that BMP4 and Shh expression in the neural tube was affected by misexpression of BRE. This provides a possible mechanism for how altering BRE expression was able to affect somitogenesis, neurogenesis, and NCC migration. In summary, our results demonstrate that BRE plays an important role in regulating neurogenesis and indirectly somite differentiation during early chick embryo development. PMID:25568339

  7. Single-taxon field measurements of bacterial gene regulation controlling DMSP fate

    PubMed Central

    Varaljay, Vanessa A; Robidart, Julie; Preston, Christina M; Gifford, Scott M; Durham, Bryndan P; Burns, Andrew S; Ryan, John P; Marin III, Roman; Kiene, Ronald P; Zehr, Jonathan P; Scholin, Christopher A; Ann Moran, Mary

    2015-01-01

    The ‘bacterial switch' is a proposed regulatory point in the global sulfur cycle that routes dimethylsulfoniopropionate (DMSP) to two fundamentally different fates in seawater through genes encoding either the cleavage or demethylation pathway, and affects the flux of volatile sulfur from ocean surface waters to the atmosphere. Yet which ecological or physiological factors might control the bacterial switch remains a topic of considerable debate. Here we report the first field observations of dynamic changes in expression of DMSP pathway genes by a single marine bacterial species in its natural environment. Detection of taxon-specific gene expression in Roseobacter species HTCC2255 during a month-long deployment of an autonomous ocean sensor in Monterey Bay, CA captured in situ regulation of the first gene in each DMSP pathway (dddP and dmdA) that corresponded with shifts in the taxonomy of the phytoplankton community. Expression of the cleavage pathway was relatively greater during a high-DMSP-producing dinoflagellate bloom, and expression of the demethylation pathway was greater in the presence of a mixed diatom and dinoflagellate community. These field data fit the prevailing hypothesis for bacterial DMSP gene regulation based on bacterial sulfur demand, but also suggest a modification involving oxidative stress response, evidenced as upregulation of catalase via katG, when DMSP is demethylated. PMID:25700338

  8. Gene Expression in Gut Symbiotic Organ of Stinkbug Affected by Extracellular Bacterial Symbiont

    PubMed Central

    Futahashi, Ryo; Tanaka, Kohjiro; Tanahashi, Masahiko; Nikoh, Naruo; Kikuchi, Yoshitomo; Lee, Bok Luel; Fukatsu, Takema

    2013-01-01

    The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations. PMID:23691247

  9. Gene expression in gut symbiotic organ of stinkbug affected by extracellular bacterial symbiont.

    PubMed

    Futahashi, Ryo; Tanaka, Kohjiro; Tanahashi, Masahiko; Nikoh, Naruo; Kikuchi, Yoshitomo; Lee, Bok Luel; Fukatsu, Takema

    2013-01-01

    The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations.

  10. Non-DBS DNA Repair Genes Regulate Radiation-induced Cytogenetic Damage Repair and Cell Cycle Progression

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Casey, Rachael; Wu, Honglu

    2008-01-01

    Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in DSB repair, and its impact on cytogenetic responses has not been systematically studied. In the present study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by transfection with small interfering RNA in human fibroblast cells. The purpose of this study is to identify new roles of these selected genes on regulating DSB repair and cell cycle progression , as measured in the micronuclei formation and chromosome aberration. In response to IR, the formation of MN was significantly increased by suppressed expression of 5 genes: Ku70 in the DSB repair pathway, XPA in the NER pathway, RPA1 in the MMR pathway, and RAD17 and RBBP8 in cell cycle control. Knocked-down expression of 4 genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Furthermore, loss of XPA, P21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Most of the 11 genes that affected cytogenetic responses are not known to have clear roles influencing DBS repair. Nine of these 11 genes were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate the biological consequences after IR.

  11. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  12. Affect intensity and negative mood regulation (NMR) expectancies: a preliminary Indian study.

    PubMed

    Mehrotra, Seema; Tripathi, Ravikesh

    2012-06-01

    Individuals differ in the intensity with which they typically experience affect as well as in their beliefs regarding their ability to alleviate negative mood states. These variables have been implicated in a range of clinical problems. Most studies utilize a single index of affect intensity. The differential correlates of positive and negative affect intensity, their association with negative mood regulation expectancy and their role as predictors of psychological outcomes have been insufficiently explored. This study aimed at exploring the relationship of affect intensity variables with negative mood regulation (NMR) expectancy, their association with age and gender and examining the role of affect intensity and NMR expectancy as predictors of stress and well being in a community sample of Indian adults. The sample consisted of 206 participants aged between 20 and 60 years. Higher age was associated with higher NMR expectancy but lower positive affect intensity. Positive and negative affect intensity showed differential patterns of association with NMR expectancy. Higher negative affect intensity was associated with lower NMR expectancy whereas higher positive affect intensity was associated with higher NMR expectancy. Affect intensity and NMR expectancy variables jointly predicted 30-39% of variance in perceived stress and well being. Implications for further research are discussed.

  13. MTA3 regulates CGB5 and Snail genes in trophoblast.

    PubMed

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-04-19

    Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3 occupied the proximal promoter regions of both Snail and hCG within BeWo cells. Furthermore, we examined MTA3 expression in placental trophoblast by immunohistochemistry and found that MTA3 expression was higher in villous cytotrophoblasts versus

  14. Developmental, genetic and environmental factors affect the expression of flavonoid genes, enzymes and metabolites in strawberry fruits.

    PubMed

    Carbone, Fabrizio; Preuss, Anja; De Vos, Ric C H; D'Amico, Eleonora; Perrotta, Gaetano; Bovy, Arnaud G; Martens, Stefan; Rosati, Carlo

    2009-08-01

    The influence of internal (genetic and developmental) and external (environmental) factors on levels of flavonoid gene transcripts, enzyme activity and metabolites was studied in fruit of six cultivated strawberry (Fragaria x ananassa Duch.) genotypes grown at two Italian locations. Gene expression and enzyme activity showed development- and genotype-associated patterns, revealing gene coordination. Analysis clarified the regulation mechanism of the hydroxylation status of the B-ring of the major flavonoid pools and pointed out examples of genotype-specific post-transcriptional regulation mechanisms and key steps of pathway regulation in strawberry fruits. Metabolite profiles were strongly affected by development and genotype. Flavan-3-ols, their proanthocyanidin (PA) derivatives and anthocyanins were the most abundant metabolites. Flavonol levels and PA-associated traits (epicatechin/catechin ratio and mean degree of polymerization) showed significant environmental effects. Multivariate and correlation analyses determined the relationships among genes, enzymes and metabolites. The combined molecular and biochemical information elucidated more in depth the role of genetic and environmental factors on flavonoid metabolism during strawberry fruit development, highlighting the major impact of developmental processes, and revealing genotype-dependent differences and environmental effects on PA-related traits.

  15. Coherent organization in gene regulation: a study on six networks

    NASA Astrophysics Data System (ADS)

    Aral, Neşe; Kabakçıoğlu, Alkan

    2016-04-01

    Structural and dynamical fingerprints of evolutionary optimization in biological networks are still unclear. Here we analyze the dynamics of genetic regulatory networks responsible for the regulation of cell cycle and cell differentiation in three organisms or cell types each, and show that they follow a version of Hebb's rule which we have termed coherence. More precisely, we find that simultaneously expressed genes with a common target are less likely to act antagonistically at the attractors of the regulatory dynamics. We then investigate the dependence of coherence on structural parameters, such as the mean number of inputs per node and the activatory/repressory interaction ratio, as well as on dynamically determined quantities, such as the basin size and the number of expressed genes.

  16. Amino acid recognition and gene regulation by riboswitches

    PubMed Central

    Serganov, Alexander; Patel, Dinshaw J.

    2012-01-01

    Riboswitches specifically control expression of genes predominantly involved in biosynthesis, catabolism and transport of various cellular metabolites in organisms from all three kingdoms of life. Amongst many classes of identified riboswitches, two riboswitches respond to amino acids lysine and glycine to date. Though these riboswitches recognize small compounds, they both belong to the largest riboswitches and have unique structural and functional characteristics. In this review, we attempt to characterize molecular recognition principles employed by amino acid-responsive riboswitches to selectively bind their cognate ligands and to effectively perform a gene regulation function. We summarize up-to-date biochemical and genetic data available for the lysine and glycine riboswitches and correlate these results with recent high-resolution structural information obtained for the lysine riboswitch. We also discuss the contribution of lysine riboswitches to antibiotic resistance and outline potential applications of riboswitches in biotechnology and medicine. PMID:19619684

  17. Ribozymes, riboswitches and beyond: regulation of gene expression without proteins

    PubMed Central

    Serganov, Alexander; Patel, Dinshaw J.

    2015-01-01

    Although various functions of RNA are carried out in conjunction with proteins, some catalytic RNAs, or ribozymes, which contribute to a range of cellular processes, require little or no assistance from proteins. Furthermore, the discovery of metabolite-sensing riboswitches and other types of RNA sensors has revealed RNA-based mechanisms that cells use to regulate gene expression in response to internal and external changes. Structural studies have shown how these RNAs can carry out a range of functions. In addition, the contribution of ribozymes and riboswitches to gene expression is being revealed as far more widespread than was previously appreciated. These findings have implications for understanding how cellular functions might have evolved from RNA-based origins. PMID:17846637

  18. Molecular immunology--gene regulation and signal transduction.

    PubMed

    Hopkins, John

    2002-09-10

    Research on 'molecular immunology-gene regulation and signal transduction' in veterinary species is relatively new. The reason for its novelty is that until recently there have been very few tools with which we can work. Over the last 10 years the veterinary immunology community has succeeded in generating panels of defined monoclonal antibodies (mAb) and cloned genes that has enabled such work to be started. More recently, quantitative, high-resolution analytical tools for veterinary species have begun to be developed; some of these are specific for veterinary species and others have been adapted from human or rodent systems. Of the species-specific tools that have recently been developed perhaps the most widely used are the immunoassays for cytokines, RNAase protection assays (RPAs) and in the near future oligonucleotide and EST-based microarrays. This presentation will describe some of these assays and discuss their relative advantages and disadvantages.

  19. Genes Regulating Epithelial Polarity Are Critical Suppressors of Esophageal Oncogenesis

    PubMed Central

    Li, Xiu-Min; Wang, Hui; Zhu, Li-Li; Zhao, Run-Zhen; Ji, Hong-Long

    2015-01-01

    Esophageal cancer is an aggressive disease featured by early lymphatic and hematogenous dissemination, and is the sixth lead