Science.gov

Sample records for affect gene regulation

  1. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    SciTech Connect

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-04-23

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic {beta}-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  2. TERE1, a novel gene affecting growth regulation in prostate carcinoma.

    PubMed

    McGarvey, Terence W; Nguyen, Trang; Puthiyaveettil, Raghunath; Tomaszewski, John E; Malkowicz, S Bruce

    2003-02-01

    Recently, we isolated a ubiquitously expressed gene designated TERE1, which has a significant effect on the growth regulation in bladder cancer. The TERE1 gene maps to chromosome 1p36.11-1p36.33 between the micro-satellite markers D1S2667 and D1S434, a chromosome locus that has been identified by loss of heterozygosity studies as a site of a putative tumor suppressor gene or genes for multiple tumor types including prostate carcinoma. The expression of the TERE1 transcript and protein was examined in a series of thirty microdissected prostate tumors by semi-quantitative RT/PCR and immunohistochemistry. There was a significant 61% decrease in the TERE1 transcript in prostate carcinoma (CaP) and a distinct loss of the TERE1 protein in metstatic prostate. Though a loss of heterozygosity at chromosome 1p36 was found in 25% of these prostate tumors, there appeared to be no TERE1 mutations present in these tumor samples. Induced TERE1 expression after transduction or transfection of TERE1 constructs into two prostate carcinoma (LNCaP and PC-3) cell lines significantly decreased proliferation up to 80% with a significant increase in the number of cells in G1. Serum factors but not DHT (dihydrotestosterone) appear to regulate the amount of TERE1 protein in the androgen responsive LNCaP cell line. Additionally, we have identified by microarray analysis various growth regulatory genes that are down-regulated or up-regulated in TERE1-transduced PC-3 cells. Altogether, these data suggest that TERE1 maybe significant in prostate cancer growth regulation and the down regulation or absence of TERE1 may be an important component of the phenotype of advanced disease.

  3. Schizophrenia-Associated MIR204 Regulates Noncoding RNAs and Affects Neurotransmitter and Ion Channel Gene Sets

    PubMed Central

    Cammaerts, Sophia; Strazisar, Mojca; Smets, Bart; Weckhuysen, Sarah; Nordin, Annelie; De Jonghe, Peter; Adolfsson, Rolf; De Rijk, Peter; Del Favero, Jurgen

    2015-01-01

    As regulators of gene expression, microRNAs (miRNAs) are likely to play an important role in the development of disease. In this study we present a large-scale strategy to identify miRNAs with a role in the regulation of neuronal processes. Thereby we found variant rs7861254 located near the MIR204 gene to be significantly associated with schizophrenia. This variant resulted in reduced expression of miR-204 in neuronal-like SH-SY5Y cells. Analysis of the consequences of the altered miR-204 expression on the transcriptome of these cells uncovered a new mode of action for miR-204, being the regulation of noncoding RNAs (ncRNAs), including several miRNAs, such as MIR296. Furthermore, pathway analysis showed downstream effects of miR-204 on neurotransmitter and ion channel related gene sets, potentially mediated by miRNAs regulated through miR-204. PMID:26714269

  4. The Magea gene cluster regulates male germ cell apoptosis without affecting the fertility in mice

    PubMed Central

    Hou, Siyuan; Xian, Li; Shi, Peiliang; Li, Chaojun; Lin, Zhaoyu; Gao, Xiang

    2016-01-01

    While apoptosis is essential for male germ cell development, improper activation of apoptosis in the testis can affect spermatogenesis and cause reproduction defects. Members of the MAGE-A (melanoma antigen family A) gene family are frequently clustered in mammalian genomes and are exclusively expressed in the testes of normal animals but abnormally activated in a wide variety of cancers. We investigated the potential roles of these genes in spermatogenesis by generating a mouse model with a 210-kb genomic deletion encompassing six members of the Magea gene cluster (Magea1, Magea2, Magea3, Magea5, Magea6 and Magea8). Male mice carrying the deletion displayed smaller testes from 2 months old with a marked increase in apoptotic germ cells in the first wave of spermatogenesis. Furthermore, we found that Magea genes prevented stress-induced spermatogenic apoptosis after N-ethyl-N-nitrosourea (ENU) treatment during the adult stage. Mechanistically, deletion of the Magea gene cluster resulted in a dramatic increase in apoptotic germ cells, predominantly spermatocytes, with activation of p53 and induction of Bax in the testes. These observations demonstrate that the Magea genes are crucial in maintaining normal testicular size and protecting germ cells from excessive apoptosis under genotoxic stress. PMID:27226137

  5. Down-regulation of GhADF1 gene expression affects cotton fibre properties.

    PubMed

    Wang, Hai-Yun; Wang, Juan; Gao, Peng; Jiao, Gai-Li; Zhao, Pi-Ming; Li, Yan; Wang, Gui-Ling; Xia, Gui-Xian

    2009-01-01

    Cotton fibre is the most important natural fibres for textile industry. To date, the mechanism that governs the development of fibre traits is largely unknown. In this study, we have characterized the function of a member of the actin depolymerizing factor (ADF) family in Gossypium hirsutum by down-regulation of the gene (designated as GhADF1) expression in the transgenic cotton plants. We observed that both the fibre length and strength of the GhADF1-underexpressing plants increased as compared to the wild-type fibre, and transgenic fibres contained more abundant F-actin filaments in the cortical region of the cells. Moreover, the secondary cell wall of the transgenic fibre appeared thicker and the cellulose content was higher than that of the control fibre. Our results suggest that organization of actin cytoskeleton regulated by actin-associated proteins such as GhADF1 plays a critical role in the processes of elongation and secondary cell wall formation during fibre development. Additionally, our study provided a candidate intrinsic gene for the improvement of fibre traits via genetic engineering.

  6. Power training and postmenopausal hormone therapy affect transcriptional control of specific co-regulated gene clusters in skeletal muscle

    PubMed Central

    Fey, Vidal; Törmäkangas, Timo; Ronkainen, Paula H. A.; Taaffe, Dennis R.; Takala, Timo; Koskinen, Satu; Cheng, Sulin; Puolakka, Jukka; Kujala, Urho M.; Suominen, Harri; Sipilä, Sarianna; Kovanen, Vuokko

    2010-01-01

    At the moment, there is no clear molecular explanation for the steeper decline in muscle performance after menopause or the mechanisms of counteractive treatments. The goal of this genome-wide study was to identify the genes and gene clusters through which power training (PT) comprising jumping activities or estrogen containing hormone replacement therapy (HRT) may affect skeletal muscle properties after menopause. We used musculus vastus lateralis samples from early stage postmenopausal (50–57 years old) women participating in a yearlong randomized double-blind placebo-controlled trial with PT and HRT interventions. Using microarray platform with over 24,000 probes, we identified 665 differentially expressed genes. The hierarchical clustering method was used to assort the genes. Additionally, enrichment analysis of gene ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was carried out to clarify whether assorted gene clusters are enriched with particular functional categories. The analysis revealed transcriptional regulation of 49 GO/KEGG categories. PT upregulated transcription in “response to contraction”—category revealing novel candidate genes for contraction-related regulation of muscle function while HRT upregulated gene expression related to functionality of mitochondria. Moreover, several functional categories tightly related to muscle energy metabolism, development, and function were affected regardless of the treatment. Our results emphasize that during the early stages of the postmenopause, muscle properties are under transcriptional modulation, which both PT and HRT partially counteract leading to preservation of muscle power and potentially reducing the risk for aging-related muscle weakness. More specifically, PT and HRT may function through improving energy metabolism, response to contraction as well as by preserving functionality of the mitochondria. Electronic supplementary material The online version of this

  7. SNHG16 is regulated by the Wnt pathway in colorectal cancer and affects genes involved in lipid metabolism.

    PubMed

    Christensen, Lise Lotte; True, Kirsten; Hamilton, Mark P; Nielsen, Morten M; Damas, Nkerorema D; Damgaard, Christian K; Ongen, Halit; Dermitzakis, Emmanouil; Bramsen, Jesper B; Pedersen, Jakob S; Lund, Anders H; Vang, Søren; Stribolt, Katrine; Madsen, Mogens R; Laurberg, Søren; McGuire, Sean E; Ørntoft, Torben F; Andersen, Claus L

    2016-10-01

    It is well established that lncRNAs are aberrantly expressed in cancer where they have been shown to act as oncogenes or tumor suppressors. RNA profiling of 314 colorectal adenomas/adenocarcinomas and 292 adjacent normal colon mucosa samples using RNA-sequencing demonstrated that the snoRNA host gene 16 (SNHG16) is significantly up-regulated in adenomas and all stages of CRC. SNHG16 expression was positively correlated to the expression of Wnt-regulated transcription factors, including ASCL2, ETS2, and c-Myc. In vitro abrogation of Wnt signaling in CRC cells reduced the expression of SNHG16 indicating that SNHG16 is regulated by the Wnt pathway. Silencing of SNHG16 resulted in reduced viability, increased apoptotic cell death and impaired cell migration. The SNHG16 silencing particularly affected expression of genes involved in lipid metabolism. A connection between SNHG16 and genes involved in lipid metabolism was also observed in clinical tumors. Argonaute CrossLinking and ImmunoPrecipitation (AGO-CLIP) demonstrated that SNHG16 heavily binds AGO and has 27 AGO/miRNA target sites along its length, indicating that SNHG16 may act as a competing endogenous RNA (ceRNA) "sponging" miRNAs off their cognate targets. Most interestingly, half of the miRNA families with high confidence targets on SNHG16 also target the 3'UTR of Stearoyl-CoA Desaturase (SCD). SCD is involved in lipid metabolism and is down-regulated upon SNHG16 silencing. In conclusion, up-regulation of SNHG16 is a frequent event in CRC, likely caused by deregulated Wnt signaling. In vitro analyses demonstrate that SNHG16 may play an oncogenic role in CRC and that it affects genes involved in lipid metabolism, possible through ceRNA related mechanisms.

  8. Sphingolipids regulate telomere clustering by affecting the transcription of genes involved in telomere homeostasis.

    PubMed

    Ikeda, Atsuko; Muneoka, Tetsuya; Murakami, Suguru; Hirota, Ayaka; Yabuki, Yukari; Karashima, Takefumi; Nakazono, Kota; Tsuruno, Masahiro; Pichler, Harald; Shirahige, Katsuhiko; Kodama, Yukiko; Shimamoto, Toshi; Mizuta, Keiko; Funato, Kouichi

    2015-07-15

    In eukaryotic organisms, including mammals, nematodes and yeasts, the ends of chromosomes, telomeres are clustered at the nuclear periphery. Telomere clustering is assumed to be functionally important because proper organization of chromosomes is necessary for proper genome function and stability. However, the mechanisms and physiological roles of telomere clustering remain poorly understood. In this study, we demonstrate a role for sphingolipids in telomere clustering in the budding yeast Saccharomyces cerevisiae. Because abnormal sphingolipid metabolism causes downregulation of expression levels of genes involved in telomere organization, sphingolipids appear to control telomere clustering at the transcriptional level. In addition, the data presented here provide evidence that telomere clustering is required to protect chromosome ends from DNA-damage checkpoint signaling. As sphingolipids are found in all eukaryotes, we speculate that sphingolipid-based regulation of telomere clustering and the protective role of telomere clusters in maintaining genome stability might be conserved in eukaryotes.

  9. Stiff Mutant Genes of Phycomyces Affect Turgor Pressure and Wall Mechanical Properties to Regulate Elongation Growth Rate

    PubMed Central

    Ortega, Joseph K. E.; Munoz, Cindy M.; Blakley, Scott E.; Truong, Jason T.; Ortega, Elena L.

    2012-01-01

    Regulation of cell growth is paramount to all living organisms. In plants, algae and fungi, regulation of expansive growth of cells is required for development and morphogenesis. Also, many sensory responses of stage IVb sporangiophores of Phycomyces blakesleeanus are produced by regulating elongation growth rate (growth responses) and differential elongation growth rate (tropic responses). “Stiff” mutant sporangiophores exhibit diminished tropic responses and are found to be defective in at least five genes; madD, E, F, G, and J. Prior experimental research suggests that the defective genes affect growth regulation, but this was not verified. All the growth of the single-celled stalk of the stage IVb sporangiophore occurs in a short region termed the “growth zone.” Prior experimental and theoretical research indicates that elongation growth rate of the stage IVb sporangiophore can be regulated by controlling the cell wall mechanical properties within the growth zone and the magnitude of the turgor pressure. A quantitative biophysical model for elongation growth rate is required to elucidate the relationship between wall mechanical properties and turgor pressure during growth regulation. In this study, it is hypothesized that the mechanical properties of the wall within the growth zone of stiff mutant sporangiophores are different compared to wild type (WT). A biophysical equation for elongation growth rate is derived for fungal and plant cells with a growth zone. Two strains of stiff mutants are studied, C149 madD120 (−) and C216 geo- (−). Experimental results demonstrate that turgor pressure is larger but irreversible wall deformation rates within the growth zone and growth zone length are smaller for stiff mutant sporangiophores compared to WT. These findings can explain the diminished tropic responses of the stiff mutant sporangiophores. It is speculated that the defective genes affect the amount of wall-building material delivered to the inner cell

  10. Stiff mutant genes of phycomyces affect turgor pressure and wall mechanical properties to regulate elongation growth rate.

    PubMed

    Ortega, Joseph K E; Munoz, Cindy M; Blakley, Scott E; Truong, Jason T; Ortega, Elena L

    2012-01-01

    Regulation of cell growth is paramount to all living organisms. In plants, algae and fungi, regulation of expansive growth of cells is required for development and morphogenesis. Also, many sensory responses of stage IVb sporangiophores of Phycomyces blakesleeanus are produced by regulating elongation growth rate (growth responses) and differential elongation growth rate (tropic responses). "Stiff" mutant sporangiophores exhibit diminished tropic responses and are found to be defective in at least five genes; madD, E, F, G, and J. Prior experimental research suggests that the defective genes affect growth regulation, but this was not verified. All the growth of the single-celled stalk of the stage IVb sporangiophore occurs in a short region termed the "growth zone." Prior experimental and theoretical research indicates that elongation growth rate of the stage IVb sporangiophore can be regulated by controlling the cell wall mechanical properties within the growth zone and the magnitude of the turgor pressure. A quantitative biophysical model for elongation growth rate is required to elucidate the relationship between wall mechanical properties and turgor pressure during growth regulation. In this study, it is hypothesized that the mechanical properties of the wall within the growth zone of stiff mutant sporangiophores are different compared to wild type (WT). A biophysical equation for elongation growth rate is derived for fungal and plant cells with a growth zone. Two strains of stiff mutants are studied, C149 madD120 (-) and C216 geo- (-). Experimental results demonstrate that turgor pressure is larger but irreversible wall deformation rates within the growth zone and growth zone length are smaller for stiff mutant sporangiophores compared to WT. These findings can explain the diminished tropic responses of the stiff mutant sporangiophores. It is speculated that the defective genes affect the amount of wall-building material delivered to the inner cell wall.

  11. Autism Associated Haplotype Affects the Regulation of the Homeobox Gene, ENGRAILED 2

    PubMed Central

    Benayed, Rym; Choi, Jiyeon; Matteson, Paul G; Gharani, Neda; Kamdar, Silky; Brzustowicz, Linda M; Millonig, James H

    2009-01-01

    Background Association analysis identified the homeobox transcription factor, ENGRAILED 2 (EN2), as a possible Autism Spectrum Disorder (ASD) susceptibility gene (ASD [MIM 608636]; EN2 [MIM 131310]). The common alleles (underlined) of two intronic SNPs, rs1861972 (A/G) and rs1861973 (C/T), are over-transmitted to affected individuals both singly and as a haplotype in three separate datasets (518 families total, haplotype P=0.00000035). Methods: Further support that EN2 is a possible ASD susceptibility gene requires the identification of a risk allele, a DNA variant that is consistently associated with ASD but is also functional. To identify possible risk alleles, additional association analysis and LD mapping were performed. Candidate polymorphisms were then tested for functional differences by luciferase (luc) reporter transfections and Electrophoretic Mobility Shift Assays (EMSAs). Results: Association analysis of additional EN2 polymorphisms and LD mapping with Hapmap SNPs identified the rs1861972-rs1861973 haplotype as the most appropriate candidate to test for functional differences. Luc reporters for the two common rs1861972-rs1861973 haplotypes (A-C and G-T) were then transfected into human and rat cell lines as well as primary mouse neuronal cultures. In all cases the A-C haplotype resulted in a significant increase in luc levels (P<.005). EMSAs were then performed and nuclear factors bound specifically to the A and C alleles of both SNPs. Conclusions: These data indicate the AC haplotype is functional and together with the association and LD mapping results support EN2 as a likely ASD susceptibility gene and the A-C haplotype as a possible risk allele. PMID:19615670

  12. JMJD2A attenuation affects cell cycle and tumourigenic inflammatory gene regulation in lipopolysaccharide stimulated neuroectodermal stem cells

    SciTech Connect

    Das, Amitabh; Chai, Jin Choul; Jung, Kyoung Hwa; Das, Nando Dulal; Kang, Sung Chul; Lee, Young Seek; Seo, Hyemyung; Chai, Young Gyu

    2014-11-01

    JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuation significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup

  13. In Ovo injection of betaine affects hepatic cholesterol metabolism through epigenetic gene regulation in newly hatched chicks.

    PubMed

    Hu, Yun; Sun, Qinwei; Li, Xiaoliang; Wang, Min; Cai, Demin; Li, Xi; Zhao, Ruqian

    2015-01-01

    Betaine is reported to regulate hepatic cholesterol metabolism in mammals. Chicken eggs contain considerable amount of betaine, yet it remains unknown whether and how betaine in the egg affects hepatic cholesterol metabolism in chicks. In this study, eggs were injected with betaine at 2.5 mg/egg and the hepatic cholesterol metabolism was investigated in newly hatched chicks. Betaine did not affect body weight or liver weight, but significantly increased the serum concentration (P < 0.05) and the hepatic content (P < 0.01) of cholesterol. Accordingly, the cholesterol biosynthetic enzyme HMGCR was up-regulated (P < 0.05 for both mRNA and protein), while CYP7A1 which converts cholesterol to bile acids was down-regulated (P < 0.05 for mRNA and P = 0.07 for protein). Moreover, hepatic protein content of the sterol-regulatory element binding protein 1 which regulates cholesterol and lipid biosynthesis, and the mRNA abundance of ATP binding cassette sub-family A member 1 (ABCA1) which mediates cholesterol counter transport were significantly (P < 0.05) increased in betaine-treated chicks. Meanwhile, hepatic protein contents of DNA methyltransferases 1 and adenosylhomocysteinase-like 1 were increased (P < 0.05), which was associated with global genomic DNA hypermethylation (P < 0.05) and diminished gene repression mark histone H3 lysine 27 trimethylation (P < 0.05). Furthermore, CpG methylation level on gene promoters was found to be increased (P < 0.05) for CYP7A1 yet decreased (P < 0.05) for ABCA1. These results indicate that in ovo betaine injection regulates hepatic cholesterol metabolism in chicks through epigenetic mechanisms including DNA and histone methylations.

  14. Expression of the Saccharomyces cerevisiae inositol-1-phosphate synthase (INO1) gene is regulated by factors that affect phospholipid synthesis.

    PubMed Central

    Hirsch, J P; Henry, S A

    1986-01-01

    The INO1 gene of Saccharomyces cerevisiae encodes the regulated enzyme inositol-1-phosphate synthase, which catalyzes the first committed step in the synthesis of inositol-containing phospholipids. The expression of this gene was analyzed under conditions known to regulate phospholipid synthesis. RNA blot hybridization with a genomic clone for INO1 detected two RNA species of 1.8 and 0.6 kb. The abundance of the 1.8-kb RNA was greatly decreased when the cells were grown in the presence of the phospholipid precursor inositol, as was the enzyme activity of the synthase. Complementation analysis showed that this transcript encoded the INO1 gene product. The level of INO1 RNA was repressed 12-fold when the cells were grown in medium containing inositol, and it was repressed 33-fold when the cells were grown in the presence of inositol and choline together. The INO1 transcript was present at a very low level in cells containing mutations (ino2 and ino4) in regulatory genes unlinked to INO1 that result in inositol auxotrophy. The transcript was constitutively overproduced in cells containing a mutation (opi1) that causes constitutive expression of inositol-1-phosphate synthase and results in excretion of inositol. The expression of INO1 RNA was also examined in cells containing a mutation (cho2) affecting the synthesis of phosphatidylcholine. In contrast to what was observed in wild-type cells, growth of cho2 cells in medium containing inositol did not result in a significant decrease in INO1 RNA abundance. Inositol and choline together were required for repression of the INO1 transcript in these cells, providing evidence for a regulatory link between the synthesis of inositol- and choline-containing lipids. The level of the 0.6-kb RNA was affected, although to a lesser degree, by many of the same factors that influence INO1 expression. Images PMID:3025587

  15. G0/G1 switch gene-2 regulates human adipocyte lipolysis by affecting activity and localization of adipose triglyceride lipase.

    PubMed

    Schweiger, Martina; Paar, Margret; Eder, Christina; Brandis, Janina; Moser, Elena; Gorkiewicz, Gregor; Grond, Susanne; Radner, Franz P W; Cerk, Ines; Cornaciu, Irina; Oberer, Monika; Kersten, Sander; Zechner, Rudolf; Zimmermann, Robert; Lass, Achim

    2012-11-01

    The hydrolysis of triglycerides in adipocytes, termed lipolysis, provides free fatty acids as energy fuel. Murine lipolysis largely depends on the activity of adipose triglyceride lipase (ATGL), which is regulated by two proteins annotated as comparative gene identification-58 (CGI-58) and G0/G1 switch gene-2 (G0S2). CGI-58 activates and G0S2 inhibits ATGL activity. In contrast to mice, the functional role of G0S2 in human adipocyte lipolysis is poorly characterized. Here we show that overexpression or silencing of G0S2 in human SGBS adipocytes decreases and increases lipolysis, respectively. Human G0S2 is upregulated during adipocyte differentiation and inhibits ATGL activity in a dose-dependent manner. Interestingly, C-terminally truncated ATGL mutants, which fail to localize to lipid droplets, translocate to the lipid droplet upon coexpression with G0S2, suggesting that G0S2 anchors ATGL to lipid droplets independent of ATGL's C-terminal lipid binding domain. Taken together, our results indicate that G0S2 also regulates human lipolysis by affecting enzyme activity and intracellular localization of ATGL. Increased lipolysis is known to contribute to the pathogenesis of insulin resistance, and G0S2 expression has been shown to be reduced in poorly controlled type 2 diabetic patients. Our data indicate that downregulation of G0S2 in adipose tissue could represent one of the underlying causes leading to increased lipolysis in the insulin-resistant state.

  16. Natural mixtures of POPs affected body weight gain and induced transcription of genes involved in weight regulation and insulin signaling.

    PubMed

    Lyche, Jan L; Nourizadeh-Lillabadi, Rasoul; Karlsson, Camilla; Stavik, Benedicte; Berg, Vidar; Skåre, Janneche Utne; Alestrøm, Peter; Ropstad, Erik

    2011-04-01

    Obesity is reaching epidemic proportions worldwide, and is associated with chronic illnesses such as diabetes, cardiovascular disease, hypertension and dyslipidemias (metabolic syndrome). Commonly held causes of obesity are overeating coupled with a sedentary lifestyle. However, it has also been postulated that exposure to endocrine disrupting chemicals (EDCs) may be related to the significant increase in the prevalence of obesity and associated diseases. In the present study, developmental and reproductive effects of lifelong exposure to environmentally relevant concentrations of two natural mixtures of persistent organic pollutants (POPs) were investigated using classical and molecular methods in a controlled zebrafish model. The mixtures used were extracted from burbot (Lota lota) liver originating from freshwater systems in Norway (Lake Mjøsa and Lake Losna). The concentration of POPs in the zebrafish ranged from levels detected in wild fish (Lake Mjøsa and Lake Losna), to concentrations reported in human and wildlife populations. Phenotypic effects observed in both exposure groups included (1) earlier onset of puberty, (2) elevated male/female sex ratio, and (3) increased body weight at 5 months of age. Interestingly, genome-wide transcription profiling identified functional networks of genes, in which key regulators of weight homeostasis (PPARs, glucocoricoids, CEBPs, estradiol), steroid hormone functions (glucocoricoids, estradiol, NCOA3) and insulin signaling (HNF4A, CEBPs, PPARG) occupied central positions. The increased weight and the regulation of genes associated with weight homeostasis and insulin signaling observed in the present study suggest that environmental pollution may affect the endocrine regulation of the metabolism, possibly leading to increased weight gain and obesity.

  17. The Role of Genetic Sex in Affect Regulation and Expression of GABA-Related Genes Across Species

    PubMed Central

    Seney, Marianne L.; Chang, Lun-Ching; Oh, Hyunjung; Wang, Xingbin; Tseng, George C.; Lewis, David A.; Sibille, Etienne

    2013-01-01

    Although circulating hormones and inhibitory gamma-aminobutyric acid (GABA)-related factors are known to affect mood, considerable knowledge gaps persist for biological mechanisms underlying the female bias in mood disorders. Here, we combine human and mouse studies to investigate sexual dimorphism in the GABA system in the context of major depressive disorder (MDD) and then use a genetic model to dissect the role of sex-related factors in GABA-related gene expression and anxiety-/depressive-like behaviors in mice. First, using meta-analysis of gene array data in human postmortem brain (N = 51 MDD subjects, 50 controls), we show that the previously reported down-regulation in MDD of somatostatin (SST), a marker of a GABA neuron subtype, is significantly greater in women with MDD. Second, using gene co-expression network analysis in control human subjects (N = 214; two frontal cortex regions) and expression quantitative trait loci mapping (N = 170 subjects), we show that expression of SST and the GABA-synthesizing enzymes glutamate decarboxylase 67 (GAD67) and GAD65 are tightly co-regulated and influenced by X-chromosome genetic polymorphisms. Third, using a rodent genetic model [Four Core Genotypes (FCG) mice], in which genetic and gonadal sex are artificially dissociated (N ≥ 12/group), we show that genetic sex (i.e., X/Y-chromosome) influences both gene expression (lower Sst, Gad67, Gad65 in XY mice) and anxiety-like behaviors (higher in XY mice). This suggests that in an intact male animal, the observed behavior represents the outcomes of male genetic sex increasing and male-like testosterone decreasing anxiety-like behaviors. Gonadal sex was the only factor influencing depressive-like behavior (gonadal males < gonadal females). Collectively, these combined human and mouse studies provide mechanistic insight into sexual dimorphism in mood disorders, and specifically demonstrate an unexpected role of male-like factors (XY genetic sex) on

  18. bHLH142 regulates various metabolic pathway-related genes to affect pollen development and anther dehiscence in rice.

    PubMed

    Ranjan, Rajeev; Khurana, Reema; Malik, Naveen; Badoni, Saurabh; Parida, Swarup K; Kapoor, Sanjay; Tyagi, Akhilesh K

    2017-03-06

    Apposite development of anther and its dehiscence are important for the reproductive success of the flowering plants. Recently, bHLH142, a bHLH transcription factor encoding gene of rice has been found to show anther-specific expression and mutant analyses suggest its functions in regulating tapetum differentiation and degeneration during anther development. However, our study on protein level expression and gain-of-function phenotype revealed novel aspects of its regulation and function during anther development. Temporally dissimilar pattern of bHLH142 transcript and polypeptide accumulation suggested regulation of its expression beyond transcriptional level. Overexpression of bHLH142 in transgenic rice resulted in indehiscent anthers and aborted pollen grains. Defects in septum and stomium rupture caused anther indehiscence while pollen abortion phenotype attributed to abnormal degeneration of the tapetum. Furthermore, RNA-Seq-based transcriptome analysis of tetrad and mature pollen stage anthers of wild type and bHLH142(OE)plants suggested that it might regulate carbohydrate and lipid metabolism, cell wall modification, reactive oxygen species (ROS) homeostasis and cell death-related genes during rice anther development. Thus, bHLH142 is an anther-specific gene whose expression is regulated at transcriptional and post-transcriptional/translational levels. It plays a role in pollen maturation and anther dehiscence by regulating expression of various metabolic pathways-related genes.

  19. bHLH142 regulates various metabolic pathway-related genes to affect pollen development and anther dehiscence in rice

    PubMed Central

    Ranjan, Rajeev; Khurana, Reema; Malik, Naveen; Badoni, Saurabh; Parida, Swarup K.; Kapoor, Sanjay; Tyagi, Akhilesh K.

    2017-01-01

    Apposite development of anther and its dehiscence are important for the reproductive success of the flowering plants. Recently, bHLH142, a bHLH transcription factor encoding gene of rice has been found to show anther-specific expression and mutant analyses suggest its functions in regulating tapetum differentiation and degeneration during anther development. However, our study on protein level expression and gain-of-function phenotype revealed novel aspects of its regulation and function during anther development. Temporally dissimilar pattern of bHLH142 transcript and polypeptide accumulation suggested regulation of its expression beyond transcriptional level. Overexpression of bHLH142 in transgenic rice resulted in indehiscent anthers and aborted pollen grains. Defects in septum and stomium rupture caused anther indehiscence while pollen abortion phenotype attributed to abnormal degeneration of the tapetum. Furthermore, RNA-Seq-based transcriptome analysis of tetrad and mature pollen stage anthers of wild type and bHLH142OEplants suggested that it might regulate carbohydrate and lipid metabolism, cell wall modification, reactive oxygen species (ROS) homeostasis and cell death-related genes during rice anther development. Thus, bHLH142 is an anther-specific gene whose expression is regulated at transcriptional and post-transcriptional/translational levels. It plays a role in pollen maturation and anther dehiscence by regulating expression of various metabolic pathways-related genes. PMID:28262713

  20. CcpA and LacD.1 Affect Temporal Regulation of Streptococcus pyogenes Virulence Genes ▿ †

    PubMed Central

    Kietzman, Colin C.; Caparon, Michael G.

    2010-01-01

    Production of H2O2 follows a growth phase-dependent pattern that mimics that of many virulence factors of Streptococcus pyogenes. To gain greater insight into mechanisms coupling virulence factor expression to growth phase, we investigated the molecular basis for H2O2 generation and its regulation. Deletion of the gene encoding lactate oxidase (lctO) or culture in the presence of glucose eliminated H2O2 production, implicating carbohydrate regulation of lctO as a key element of growth phase control. In examining known carbohydrate-responsive regulators, deletion of the gene encoding CcpA but not that encoding LacD.1 resulted in both derepression and an uncoupling of lctO transcription from its growth phase pattern. Expanding this analysis to additional virulence factors demonstrated both negative (cfa, encoding CAMP factor) and positive (speB, encoding a cysteine protease) regulation by CcpA and that CcpA mutants were highly cytotoxic for cultured macrophages. This latter property resulted from enhanced transcription of the streptolysin S biogenesis operon. Examination of CcpA-promoter interactions using a DNA pull-down assay mimicking physiological conditions showed direct binding to the promoters of lctO and speB but not those of sagA. CcpA but not LacD.1 mutants were attenuated in a murine model of soft-tissue infection, and analysis of gene expression in infected tissue indicated that CcpA mutants had altered expression of lctO, cfa, and speB but not the indirectly regulated sagA gene. Taken together, these data show that CcpA regulates virulence genes via at least three distinct mechanisms and that disruption of growth phase regulation alters transcriptional patterns in infected tissues. PMID:19841076

  1. Affect and Self-Regulation

    ERIC Educational Resources Information Center

    Malmivuori, Marja-Liisa

    2006-01-01

    This paper presents affect as an essential aspect of students' self-reflection and self-regulation. The introduced concepts of self-system and self-system process stress the importance of self-appraisals of personal competence and agency in affective responses and self-regulation in problem solving. Students are viewed as agents who constantly…

  2. The diageotropica mutation and synthetic auxins differentially affect the expression of auxin-regulated genes in tomato.

    PubMed Central

    Mito, N; Bennett, A B

    1995-01-01

    The effect of a tomato (Lycopersicon esculentum) mutation, diageotropica (dgt), on the accumulation of mRNA corresponding to tomato homologs of three auxin-regulated genes, LeAux, LeSAUR, and Lepar, was examined. The dgt mutation inhibited the induction of LeAux and LeSAUR mRNA accumulation by naphthalene acetic acid (NAA) but had no effect on NAA-induced Lepar mRNA accumulation. The effect of two synthetic auxins, NAA and 3,7-dichloro-8-quinoline carboxylic acid (quinclorac), on the accumulation of LeAux, LeSAUR, and Lepar mRNA was also examined. Quinclorac induced the expression of each of the auxin-regulated genes, confirming its proposed mode of herbicidal action as an auxin-type herbicide. Concentrations of quinclorac at least 100-fold higher than NAA were required to induce LeAux and LeSAUR mRNA accumulation to similar levels, whereas Lepar mRNA accumulation was induced by similar concentrations of NAA and quinclorac. Collectively, these data suggest the presence of two auxin-dependent signal transduction pathways: one that regulates LeSAUR and LeAux mRNA accumulation and is interrupted by the dgt mutation and a second that regulates Lepar mRNA accumulation and is not defective in dgt tomato hypocotyls. These two auxin-regulated signal transduction pathways can be further discriminated by the action of two synthetic auxins, NAA and quinclorac. PMID:7480327

  3. The dyadic regulation of affect.

    PubMed

    Fosha, D

    2001-02-01

    Accelerated Experiential-Dynamic Psychotherapy integrates experiential, relational, and psychodynamic elements. Deep authentic affective experience and its regulation through coordinated emotional interchanges between patient and therapist are viewed as key transformational agents. When maintaining attachment with caregivers necessitates excluding particular affects, a patient's capacity to regulate emotion becomes compromised. Being in an emotionally alive therapeutic relationship enables patients to better tolerate and communicate affective states; doing so, in turn, fosters security, openness, and intimacy in their other relationships. A clinical vignette will illustrate how using the therapist's affect, and focusing on the patient's experience of it, contributes to the repair of affect regulatory difficulties.

  4. Expression-based GWAS identifies variants, gene interactions and key regulators affecting intramuscular fatty acid content and composition in porcine meat

    PubMed Central

    Puig-Oliveras, Anna; Revilla, Manuel; Castelló, Anna; Fernández, Ana I.; Folch, Josep M.; Ballester, Maria

    2016-01-01

    The aim of this work is to better understand the genetic mechanisms determining two complex traits affecting porcine meat quality: intramuscular fat (IMF) content and its fatty acid (FA) composition. With this purpose, expression Genome-Wide Association Study (eGWAS) of 45 lipid-related genes associated with meat quality traits in swine muscle (Longissimus dorsi) of 114 Iberian × Landrace backcross animals was performed. The eGWAS identified 241 SNPs associated with 11 genes: ACSM5, CROT, FABP3, FOS, HIF1AN, IGF2, MGLL, NCOA1, PIK3R1, PLA2G12A and PPARA. Three expression Quantitative Trait Loci (eQTLs) for IGF2, ACSM5 and MGLL were identified, showing cis-acting effects, whereas 16 eQTLs had trans regulatory effects. A polymorphism in the ACSM5 promoter region associated with its expression was identified. In addition, strong candidate genes regulating ACSM5, FOS, PPARA, PIK3R1, PLA2G12A and HIF1AN gene expression were also seen. Notably, the analysis highlighted the NR3C1 transcription factor as a strong candidate gene involved in the regulation of the 45 genes analysed. Finally, the IGF2, MGLL, MC2R, ARHGAP6, and NR3C1 genes were identified as potential regulators co-localizing within QTLs for fatness and growth traits in the IBMAP population. The results obtained increase our knowledge in the functional regulatory mechanisms involved in these complex traits. PMID:27666082

  5. Peach ( Prunus persica L. Batsch) allergen-encoding genes are developmentally regulated and affected by fruit load and light radiation.

    PubMed

    Botton, Alessandro; Andreotti, Carlo; Costa, Guglielmo; Ramina, Angelo

    2009-01-28

    The fruits of Rosaceae species may frequently induce allergic reactions in both adults and children, especially in the Mediterranean area. In peach, true allergens and cross-reactive proteins may cause hypersensitive reactions involving a wide diversity of symptoms. Three known classes of allergenic proteins, namely, Pru p 1, Pru p 3, and Pru p 4, have been reported to be mostly involved, but an exhaustive survey of the proteins determining the overall allergenic potential, their biological functions, and the factors affecting the expression of the related genes is still missing. In the present study, the expression profiles of some selected genes encoding peach allergen isoforms were studied during fruit growth and development and upon different fruit load and light radiation regimens. The results indicate that the majority of allergen-encoding genes are expressed at their maximum during the ripening stage, therefore representing a potential risk for peach consumers. Nevertheless, enhancing the light radiation and decreasing the fruit load achieved a reduction of the transcription rate of most genes and a possible decrease of the overall allergenic potential at harvest. According to these data, new growing practices could be set up to obtain hypoallergenic peach fruits and eventually combined with the cultivation of hypoallergenic genotypes to obtain a significant reduction of the allergenic potential.

  6. Does inbreeding affect gene expression in birds?

    PubMed

    Hansson, Bengt; Naurin, Sara; Hasselquist, Dennis

    2014-09-01

    Inbreeding increases homozygosity, exposes genome-wide recessive deleterious alleles and often reduces fitness. The physiological and reproductive consequences of inbreeding may be manifested already during gene regulation, but the degree to which inbreeding influences gene expression is unknown in most organisms, including in birds. To evaluate the pattern of inbreeding-affected gene expression over the genome and in relation to sex, we performed a transcriptome-wide gene expression (10 695 genes) study of brain tissue of 10-day-old inbred and outbred, male and female zebra finches. We found significantly lower gene expression in females compared with males at Z-linked genes, confirming that dosage compensation is incomplete in female birds. However, inbreeding did not affect gene expression at autosomal or sex-linked genes, neither in males nor in females. Analyses of single genes again found a clear sex-biased expression at Z-linked genes, whereas only a single gene was significantly affected by inbreeding. The weak effect of inbreeding on gene expression in zebra finches contrasts to the situation, for example, in Drosophila where inbreeding has been found to influence gene expression more generally and at stress-related genes in particular.

  7. Regulated Gene Therapy.

    PubMed

    Breger, Ludivine; Wettergren, Erika Elgstrand; Quintino, Luis; Lundberg, Cecilia

    2016-01-01

    Gene therapy represents a promising approach for the treatment of monogenic and multifactorial neurological disorders. It can be used to replace a missing gene and mutated gene or downregulate a causal gene. Despite the versatility of gene therapy, one of the main limitations lies in the irreversibility of the process: once delivered to target cells, the gene of interest is constitutively expressed and cannot be removed. Therefore, efficient, safe and long-term gene modification requires a system allowing fine control of transgene expression.Different systems have been developed over the past decades to regulate transgene expression after in vivo delivery, either at transcriptional or post-translational levels. The purpose of this chapter is to give an overview on current regulatory system used in the context of gene therapy for neurological disorders. Systems using external regulation of transgenes using antibiotics are commonly used to control either gene expression using tetracycline-controlled transcription or protein levels using destabilizing domain technology. Alternatively, specific promoters of genes that are regulated by disease mechanisms, increasing expression as the disease progresses or decreasing expression as disease regresses, are also examined. Overall, this chapter discusses advantages and drawbacks of current molecular methods for regulated gene therapy in the central nervous system.

  8. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

    PubMed Central

    De la Cruz, Miguel A.; Pérez-Morales, Deyanira; Palacios, Irene J.; Fernández-Mora, Marcos; Calva, Edmundo; Bustamante, Víctor H.

    2015-01-01

    Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella. PMID:26300871

  9. TET1 modulates H4K16 acetylation by controlling auto-acetylation of hMOF to affect gene regulation and DNA repair function

    PubMed Central

    Zhong, Jianing; Li, Xianfeng; Cai, Wanshi; Wang, Yan; Dong, Shanshan; Yang, Jie; Zhang, Jian'an; Wu, Nana; Li, Yuanyuan; Mao, Fengbiao; Zeng, Cheng; Wu, Jinyu; Xu, Xingzhi; Sun, Zhong Sheng

    2017-01-01

    The Ten Eleven Translocation 1 (TET1) protein is a DNA demethylase that regulates gene expression through altering statue of DNA methylation. However, recent studies have demonstrated that TET1 could modulate transcriptional expression independent of its DNA demethylation activity; yet, the detailed mechanisms underlying TET1's role in such transcriptional regulation remain not well understood. Here, we uncovered that Tet1 formed a chromatin complex with histone acetyltransferase Mof and scaffold protein Sin3a in mouse embryonic stem cells by integrative genomic analysis using publicly available ChIP-seq data sets and a series of in vitro biochemical studies in human cell lines. Mechanistically, the TET1 facilitated chromatin affinity and enzymatic activity of hMOF against acetylation of histone H4 at lysine 16 via preventing auto-acetylation of hMOF, to regulate expression of the downstream genes, including DNA repair genes. We found that Tet1 knockout MEF cells exhibited an accumulation of DNA damage and genomic instability and Tet1 deficient mice were more sensitive to x-ray exposure. Taken together, our findings reveal that TET1 forms a complex with hMOF to modulate its function and the level of H4K16Ac ultimately affect gene expression and DNA repair. PMID:27733505

  10. SOX2 gene regulates the transcriptional network of oncogenes and affects tumorigenesis of human lung cancer cells.

    PubMed

    Chen, Si; Xu, Yingxi; Chen, Yanan; Li, Xuefei; Mou, Wenjun; Wang, Lina; Liu, Yanhua; Reisfeld, Ralph A; Xiang, Rong; Lv, Dan; Li, Na

    2012-01-01

    Recent studies demonstrated that cancer stem cells (CSCs) have higher tumorigenesis properties than those of differentiated cancer cells and that transcriptional factor-SOX2 plays a vital role in maintaining the unique properties of CSCs; however, the function and underlying mechanism of SOX2 in carcinogenesis of lung cancer are still elusive. This study applied immunohistochemistry to analyze the expression of SOX2 in human lung tissues of normal individuals as well as patients with adenocarcinoma, squamous cell carcinoma, and large cell and small cell carcinoma and demonstrated specific overexpression of SOX2 in all types of lung cancer tissues. This finding supports the notion that SOX2 contributes to the tumorigenesis of lung cancer cells and can be used as a diagnostic probe. In addition, obviously higher expression of oncogenes c-MYC, WNT1, WNT2, and NOTCH1 was detected in side population (SP) cells than in non-side population (NSP) cells of human lung adenocarcinoma cell line-A549, revealing a possible mechanism for the tenacious tumorigenic potential of CSCs. To further elucidate the function of SOX2 in tumorigenesis of cancer cells, A549 cells were established with expression of luciferase and doxycycline-inducible shRNA targeting SOX2. We found silencing of SOX2 gene reduces the tumorigenic property of A549 cells with attenuated expression of c-MYC, WNT1, WNT2, and NOTCH1 in xenografted NOD/SCID mice. By using the RNA-Seq method, an additional 246 target cancer genes of SOX2 were revealed. These results present evidence that SOX2 may regulate the expression of oncogenes in CSCs to promote the development of human lung cancer.

  11. Musical affect regulation in infancy.

    PubMed

    Trehub, Sandra E; Ghazban, Niusha; Corbeil, Mariève

    2015-03-01

    Adolescents and adults commonly use music for various forms of affect regulation, including relaxation, revitalization, distraction, and elicitation of pleasant memories. Mothers throughout the world also sing to their infants, with affect regulation as the principal goal. To date, the study of maternal singing has focused largely on its acoustic features and its consequences for infant attention. We describe recent laboratory research that explores the consequences of singing for infant affect regulation. Such work reveals that listening to recordings of play songs can maintain 6- to 9-month-old infants in a relatively contented or neutral state considerably longer than recordings of infant-directed or adult-directed speech. When 10-month-old infants fuss or cry and are highly aroused, mothers' multimodal singing is more effective than maternal speech at inducing recovery from such distress. Moreover, play songs are more effective than lullabies at reducing arousal in Western infants. We explore the implications of these findings along with possible practical applications.

  12. Down-regulation of muscarinic acetylcholine receptor M2 adversely affects the expression of Alzheimer's disease-relevant genes and proteins.

    PubMed

    Zuchner, Thole; Schliebs, Reinhard; Perez-Polo, J Regino

    2005-10-01

    Beta-amyloid peptides play a major role in the pathogenesis of Alzheimer's disease (AD). Therefore, preventing beta-amyloid formation by inhibition of the beta site amyloid precursor protein-cleaving enzyme (BACE) 1 is considered as a potential strategy to treat AD. Cholinergic mechanisms have been shown to control amyloid precursor protein processing and the number of muscarinic M2-acetylcholine receptors is decreased in brain regions of patients with AD enriched with senile plaques. Therefore, the present study investigates the effect of this M2 muscarinic receptor down-regulation by siRNA on total gene expression and on regulation of BACE1 in particular in SK-SH-SY5Y cells. This model system was used for microarray analysis after carbachol stimulation of siRNA-treated cells compared with carbachol stimulated, non-siRNA-treated cells. The same model system was used to elucidate changes at the protein level by using two-dimensional gels followed by Matrix Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF) analysis. Taken together, the results indicate that the M2 acetylcholine receptor down-regulation in brains of patients with AD has important effects on the expression of several genes and proteins with major functions in the pathology of AD. This includes beta-secretase BACE1 as well as several modulators of the tau protein and other AD-relevant genes and proteins. Moreover, most of these genes and proteins are adversely affected against the background of AD.

  13. Characterization of a disease-associated mutation affecting a putative splicing regulatory element in intron 6b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.

    PubMed

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M Cristina

    2009-10-30

    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as "splicing mutations," but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002-1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5'- and 3'-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002-1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75.

  14. Identification of the genes affecting the regulation of riboflavin synthesis in the flavinogenic yeast Pichia guilliermondii using insertion mutagenesis

    PubMed Central

    Boretsky, Yuriy R.; Pynyaha, Yuriy V.; Boretsky, Volodymyr Y.; Fedorovych, Dariya V.; Fayura, Lyubov R.; Protchenko, Olha; Philpott, Caroline C.; Sibirny, Andriy A.

    2012-01-01

    Pichia guilliermondii is a representative of a group of so-called flavinogenic yeast species that overproduce riboflavin (vitamin B2) in response to iron limitation. Using insertion mutagenesis, we isolated P. guilliermondii mutants overproducing riboflavin. Analysis of nucleotide sequence of recombination sites revealed that insertion cassettes integrated into the genome disrupting P. guilliermondii genes similar to the VMA1 gene of Ashbya gossypii and Saccharomyces cerevisiae and FES1 and FRA1 genes of S. cerevisiae. The constructed P. guilliermondii Δvma1–17 mutant possessed five- to sevenfold elevated riboflavin production and twofold decreased iron cell content as compared with the parental strain. Pichia guilliermondii Δfra1–45 mutant accumulated 1.8–2.2-fold more iron in the cells and produced five- to sevenfold more riboflavin as compared with the parental strain. Both Δvma1–17 and Δfes1–77 knockout strains could not grow at 37 °C in contrast to the wild-type strain and the Δfra1–45 mutant. Increased riboflavin production by the wild-type strain was observed at 37 °C. Although the Δfes1–77 mutant did not overproduce riboflavin, it showed partial complementation when crossed with previously isolated P. guilliermondii riboflavin-overproducing mutant rib80–22. Complementation analysis revealed that Δvma1–17 and Δfra1–45 mutants are distinct from previously reported riboflavin-producing mutants hit1-1, rib80-22 and rib81-31 of this yeast. PMID:21261808

  15. Implication of nifA in regulation of genes located on a Rhizobium meliloti cryptic plasmid that affect nodulation efficiency.

    PubMed Central

    Sanjuan, J; Olivares, J

    1989-01-01

    We examined the contribution of a cryptic plasmid, pRmeGR4b, to the nodulation of Medicago sativa by strain GR4 of Rhizobium meliloti. A 905-base-pair PstI DNA fragment in pRmeGR4b was found to hybridize DNA of the R. meliloti fixA promoter region as a probe. Sequence analysis of the PstI fragment showed a 206-base-pair region displaying high homology with the DNA upstream of the RNA start points of the P1 and P2 symbiotic promoters. Putative nif promoter consensus sequences were conserved in this DNA segment. Expression of DNA downstream of the nif promoterlike sequence, monitored by beta-galactosidase activity of different lacZ fusions, was demonstrated to depend on a functional nifA gene, both in microaerobically free-living cells and in nodules. Individual transposon Tn3-HoHo1 insertions in this DNA region caused a reduced nodulation competitiveness. This new symbiotic region, occupying approximately 5 kilobases of pRmeGR4b DNA, was called nfe (nodule formation efficiency). Images PMID:2546913

  16. Maternal dietary protein affects transcriptional regulation of myostatin gene distinctively at weaning and finishing stages in skeletal muscle of Meishan pigs.

    PubMed

    Liu, Xiujuan; Wang, Jinquan; Li, Runsheng; Yang, Xiaojing; Sun, Qinwei; Albrecht, Elke; Zhao, Ruqian

    2011-07-01

    Myostatin (MSTN) is suggested to mediate the effect of maternal nutrition on offspring phenotype, yet the mechanisms underlying such adaptive gene regulation is elusive. In this study, we determined the effects of maternal dietary protein on transcriptional regulation of MSTN in skeletal muscle of pig offspring. Fourteen Meishan sows were fed either low-protein (LP) or standard-protein (SP) diets throughout gestation and lactation. MSTN expression in the longissimus dorsi muscle was determined both at weaning and finishing stages. Myostatin mRNA abundance was downregulated at weaning, but upregulated at finishing in LP pigs, indicating stage-specific transcriptional regulation. At weaning, CCAAT/enhancer-binding protein beta (C/EBPβ) in muscle nuclear lysate was decreased in LP piglets, associated with diminished binding of C/EBPβ to all the 3 putative binding sites in MSTN promoter. None of the four histone modification marks investigated showed differences between SP and LP piglets. Among 12 microRNAs predicted to target MSTN, none was differently expressed. At finishing stage, C/EBPβ content remained unchanged, but the binding of C/EBPβ to two of the 3 putative binding sites increased in LP pigs. Histone H3 acetylation and histone H3 lysine 27 trimethylation on MSTN promoter were increased, while histone H3 lysine 9 monomethylation was decreased in LP pigs. Moreover, expression of ssc-miR-136 and ssc-miR-500 was significantly reduced. These results indicate that maternal dietary protein affects MSTN expression through distinct regulatory mechanisms at different stages. The immediate effect at weaning is mediated by C/EBPβ binding without epigenetic modifications, whereas the long-term effect at finishing stage involves both C/EBPβ binding and epigenetic regulations, including histone modification and microRNA expression.

  17. Trace concentrations of imazethapyr (IM) affect floral organs development and reproduction in Arabidopsis thaliana: IM-induced inhibition of key genes regulating anther and pollen biosynthesis.

    PubMed

    Qian, Haifeng; Li, Yali; Sun, Chongchong; Lavoie, Michel; Xie, Jun; Bai, Xiaocui; Fu, Zhengwei

    2015-01-01

    Understanding how herbicides affect plant reproduction and growth is critical to develop herbicide toxicity model and refine herbicide risk assessment. Although our knowledge of herbicides toxicity mechanisms at the physiological and molecular level in plant vegetative phase has increased substantially in the last decades, few studies have addressed the herbicide toxicity problematic on plant reproduction. Here, we determined the long-term (4-8 weeks) effect of a chiral herbicide, imazethapyr (IM), which has been increasingly used in plant crops, on floral organ development and reproduction in the model plant Arabidopsis thaliana. More specifically, we followed the effect of two IM enantiomers (R- and S-IM) on floral organ structure, seed production, pollen viability and the transcription of key genes involved in anther and pollen development. The results showed that IM strongly inhibited the transcripts of genes regulating A. thaliana tapetum development (DYT1: DYSFUNCTIONAL TAPETUM 1), tapetal differentiation and function (TDF1: TAPETAL DEVELOPMENT AND FUNCTION1), and pollen wall formation and developments (AMS: ABORTED MICROSPORES, MYB103: MYB DOMAIN PROTEIN 103, MS1: MALE STERILITY 1, MS2: MALE STERILITY 2). Since DYT1 positively regulates 33 genes involved in cell-wall modification (such as, TDF1, AMS, MYB103, MS1, MS2) that can catalyze the breakdown of polysaccharides to facilitate anther dehiscence, the consistent decrease in the transcription of these genes after IM exposure should hamper anther opening as observed under scanning electron microscopy. The toxicity of IM on anther opening further lead to a decrease in pollen production and pollen viability. Furthermore, long-term IM exposure increased the number of apurinic/apyrimidinic sites (AP sites) in the DNA of A. thaliana and also altered the DNA of A. thaliana offspring grown in IM-free soils. Toxicity of IM on floral organs development and reproduction was generally higher in the presence of the R

  18. Expression pattern of cellulolytic and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1 are affected by carbon source in Trichoderma reesei.

    PubMed

    Castro, Lilian dos Santos; Antoniêto, Amanda Cristina Campos; Pedersoli, Wellington Ramos; Silva-Rocha, Rafael; Persinoti, Gabriela F; Silva, Roberto Nascimento

    2014-03-01

    Trichoderma reesei is the most important fungus for the industrial production of enzymes to biomass deconstruction. Most of the genes encoding cellulases and hemicellulases are regulated by the transcription factors CRE1 and XYR1. In this work, the regulation of 22 genes of cellulases and xylanases by these transcription factors was investigated under three different carbon sources. Analysis of gene expression and enzymatic profiles of CMCase, β-glucosidase, and xylanases showed different regulation that was depended of the carbon source in both Δxyr1 and Δcre1 mutants. In the presence of glucose, the majority of genes evaluated (82%) showed increased expression levels in the Δcre1 mutant compared to the parental QM9414 strain. In the Δxyr1 mutant, it was observed that expression of cellulase and xylanase genes was reduced compared to the parental QM9414 strain, when cultured in the presence of cellulose or sophorose. Interesting, in the presence of glucose, approximately 60% of the analyzed genes had increased expression in the Δxyr1 mutant compared to parental strain. Furthermore, no correlation between gene expression and the number of putative binding sites of XYR1 and CRE1 to promoter region of cellulolytic and xylanolytic studied genes was observed. Therefore, these results demonstrated that the regulation of cellulase and xylanase by the transcription factors CRE1 and XYR1 is influenced by different carbon sources.

  19. RNA-Seq Analysis Identifies New Genes Regulated by the Histone-Like Nucleoid Structuring Protein (H-NS) Affecting Vibrio cholerae Virulence, Stress Response and Chemotaxis

    PubMed Central

    Wang, Hongxia; Ayala, Julio C.; Benitez, Jorge A.; Silva, Anisia J.

    2015-01-01

    The histone-like nucleoid structuring protein (H-NS) functions as a transcriptional silencer by binding to AT-rich sequences at bacterial promoters. However, H-NS repression can be counteracted by other transcription factors in response to environmental changes. The identification of potential toxic factors, the expression of which is prevented by H-NS could facilitate the discovery of new regulatory proteins that may contribute to the emergence of new pathogenic variants by anti-silencing. Vibrio cholerae hns mutants of the El Tor biotype exhibit altered virulence, motility and environmental stress response phenotypes compared to wild type. We used an RNA-seq analysis approach to determine the basis of the above hns phenotypes and identify new targets of H-NS transcriptional silencing. H-NS affected the expression of 18% of all predicted genes in a growth phase-dependent manner. Loss of H-NS resulted in diminished expression of numerous genes encoding methyl-accepting chemotaxis proteins as well as chemotaxis toward the attractants glycine and serine. Deletion of hns also induced an endogenous envelope stress response resulting in elevated expression of rpoE encoding the extracytoplamic sigma factor E (σE). The RNA-seq analysis identified new genes directly repressed by H-NS that can affect virulence and biofilm development in the El Tor biotype cholera bacterium. We show that H-NS and the quorum sensing regulator HapR silence the transcription of the vieSAB three-component regulatory system in El Tor biotype V. cholerae. We also demonstrate that H-NS directly represses the transcription of hlyA (hemolysin), rtxCA (the repeat in toxin or RTX), rtxBDE (RTX transport) and the biosynthesis of indole. Of these genes, H-NS occupancy at the hlyA promoter was diminished by overexpression of the transcription activator HlyU. We discuss the role of H-NS transcriptional silencing in phenotypic differences exhibited by V. cholerae biotypes. PMID:25679988

  20. Gene regulation by mechanical forces

    NASA Technical Reports Server (NTRS)

    Oluwole, B. O.; Du, W.; Mills, I.; Sumpio, B. E.

    1997-01-01

    Endothelial cells are subjected to various mechanical forces in vivo from the flow of blood across the luminal surface of the blood vessel. The purpose of this review was to examine the data available on how these mechanical forces, in particular cyclic strain, affect the expression and regulation of endothelial cell function. Studies from various investigators using models of cyclic strain in vitro have shown that various vasoactive mediators such as nitric oxide and prostacyclin are induced by the effect of mechanical deformation, and that the expression of these mediators may be regulated at the transcription level by mechanical forces. There also seems to be emerging evidence that endothelial cells may also act as mechanotransducers, whereby the transmission of external forces induces various cytoskeletal changes and second messenger cascades. Furthermore, it seems these forces may act on specific response elements of promoter genes.

  1. Understanding regulations affecting pet foods.

    PubMed

    Dzanis, David A

    2008-08-01

    In the United States, pet foods are subject to regulation at both the federal and the state levels. The US Food and Drug Administration has jurisdiction over all animal feeds (including pet foods, treats, chews, supplements, and ingredients) in interstate commerce, which includes imported products. Many states adopt and enforce at least in part the Association of American Feed Control Officials Model Bill and Model Regulations for Pet Food and Specialty Pet Food. Thus, all pet foods in multi-state distribution are subject to a host of labeling requirements covering aspects such as product names, ingredient lists, nutrient content guarantees, and nutritional adequacy statements. Ingredients must be GRAS (generally recognized as safe) substances, approved food additives, or defined by Association of American Feed Control Officials for their intended use. Pet food labels may not bear claims that are false or misleading or that state or imply use for the treatment or prevention of disease. Pet foods that are found to be adulterated or misbranded may be subject to seizure or other enforcement actions.

  2. The Affective Regulation of Cognitive Priming

    PubMed Central

    Storbeck, Justin; Clore, Gerald L.

    2008-01-01

    Semantic and affective priming are classic effects observed in cognitive and social psychology, respectively. We discovered that affect regulates such priming effects. In Experiment 1, positive and negative moods were induced prior to one of three priming tasks; evaluation, categorization, or lexical decision. As predicted, positive affect led to both affective priming (evaluation task) and semantic priming (category and lexical decision tasks). However, negative affect inhibited such effects. In Experiment 2, participants in their natural affective state completed the same priming tasks as in Experiment 1. As expected, affective priming (evaluation task) and category priming (categorization and lexical decision tasks) were observed in such resting affective states. Hence, we conclude that negative affect inhibits semantic and affective priming. These results support recent theoretical models, which suggest that positive affect promotes associations among strong and weak concepts, and that negative affect impairs such associations (Kuhl, 2000; Clore & Storbeck, 2006). PMID:18410195

  3. Gene regulation in cancer gene therapy strategies.

    PubMed

    Scanlon, Ian; Lehouritis, Panos; Niculescu-Duvaz, Ion; Marais, Richard; Springer, Caroline J

    2003-10-01

    Regulation of expression in gene therapy is considered to be a very desirable goal, preventing toxic effects and improving biological efficacy. A variety of systems have been reported in an ever widening range of applications, this paper describes these systems with specific reference to cancer gene therapy.

  4. A polymorphism of the GTP-cyclohydrolase I feedback regulator gene alters transcriptional activity and may affect response to SSRI antidepressants.

    PubMed

    McHugh, P C; Joyce, P R; Deng, X; Kennedy, M A

    2011-06-01

    Tetrahydrobiopterin (BH(4)) is an essential cofactor for synthesis of many neurotransmitters including serotonin. In serotonergic neurons, BH(4) is tightly regulated by GTP-cyclohydrolase I feedback regulator (GFRP). Given the pivotal role of the serotonergic system in mood disorders and selective serotonin reuptake inhibitors (SSRIs) antidepressant function, we tested the hypothesis that GFRP gene (GCHFR) variants would modify response to antidepressants in subjects with major depression. Two single nucleotide polymorphisms (rs7164342 and rs7163862) in the GCHFR promoter were identified and occurred as two haplotypes (GA or TT). A multiple regression analysis revealed that homozygous individuals for the TT haplotype were less likely to respond to the SSRI fluoxetine than to the tricyclic antidepressant nortriptyline (P = 0.037). Moreover, the TT haplotype showed a reduced transcription rate in luciferase reporter gene assays, which may impact on BH(4)-mediated neurotransmitter production, thus suggesting a biological process through which GCHFR promoter variants might influence antidepressant response.

  5. Affect regulation: holding, containing and mirroring.

    PubMed

    Pedersen, Signe Holm; Poulsen, Stig; Lunn, Susanne

    2014-10-01

    Gergely and colleagues' state that their "Social Biofeedback Theory of Parental Affect Mirroring" can be seen as a kind of operationalization of the classical psychoanalytic concepts of holding, containing and mirroring. This article examines to what extent the social biofeedback theory of parental affect mirroring may be understood as a specification of these concepts. It is argued that despite similarities at a descriptive level the concepts are embedded in theories with different ideas of subjectivity. Hence an understanding of the concept of affect regulation as a concretization and specification of the classical concepts dilutes the complexity of both the concept of affect regulation and of the classical concepts.

  6. Different mating-type-regulated genes affect the DNA repair defects of Saccharomyces RAD51, RAD52 and RAD55 mutants.

    PubMed

    Valencia-Burton, Maria; Oki, Masaya; Johnson, Jean; Seier, Tracey A; Kamakaka, Rohinton; Haber, James E

    2006-09-01

    Saccharomyces cerevisiae cells expressing both a- and alpha-mating-type (MAT) genes (termed mating-type heterozygosity) exhibit higher rates of spontaneous recombination and greater radiation resistance than cells expressing only MATa or MATalpha. MAT heterozygosity suppresses recombination defects of four mutations involved in homologous recombination: complete deletions of RAD55 or RAD57, an ATPase-defective Rad51 mutation (rad51-K191R), and a C-terminal truncation of Rad52, rad52-Delta327. We investigated the genetic basis of MAT-dependent suppression of these mutants by deleting genes whose expression is controlled by the Mata1-Matalpha2 repressor and scoring resistance to both campothecin (CPT) and phleomycin. Haploid rad55Delta strains became more damage resistant after deleting genes required for nonhomologous end-joining (NHEJ), a process that is repressed in MATa/MATalpha cells. Surprisingly, NHEJ mutations do not suppress CPT sensitivity of rad51-K191R or rad52-Delta327. However, rad51-K191R is uniquely suppressed by deleting the RME1 gene encoding a repressor of meiosis or its coregulator SIN4; this effect is independent of the meiosis-specific homolog, Dmc1. Sensitivity of rad52-Delta327 to CPT was unexpectedly increased by the MATa/MATalpha-repressed gene YGL193C, emphasizing the complex ways in which MAT regulates homologous recombination. The rad52-Delta327 mutation is suppressed by deleting the prolyl isomerase Fpr3, which is not MAT regulated. rad55Delta is also suppressed by deletion of PST2 and/or YBR052C (RFS1, rad55 suppressor), two members of a three-gene family of flavodoxin-fold proteins that associate in a nonrandom fashion with chromatin. All three recombination-defective mutations are made more sensitive by deletions of Rad6 and of the histone deacetylases Rpd3 and Ume6, although these mutations are not themselves CPT or phleomycin sensitive.

  7. The Shwachman-Bodian-Diamond syndrome associated protein interacts with HsNip7 and its down-regulation affects gene expression at the transcriptional and translational levels

    SciTech Connect

    Hesling, Cedric; Oliveira, Carla C.; Castilho, Beatriz A.; Zanchin, Nilson I.T.

    2007-12-10

    The Shwachman-Bodian-Diamond syndrome (SDS) is an autosomal disorder with pleiotropic phenotypes including pancreatic, skeletal and bone marrow deficiencies and predisposition to hematological dysfunctions. SDS has been associated to mutations in the SBDS gene, encoding a highly conserved protein that was shown to function in ribosome biogenesis in yeast. In this work, we show that SBDS is found in complexes containing the human Nip7 ortholog. Analysis of pre-rRNA processing in a stable SBDS knock-down HEK293-derivative cell line revealed accumulation of a small RNA which is a further indication of SBDS involvement in rRNA biosynthesis. Global transcription and polysome-bound mRNA profiling revealed that SBDS knock-down affects expression of critical genes involved in brain development and function, bone morphogenesis, blood cell proliferation and differentiation, and cell adhesion. Expression of a group of growth and signal transduction factors and of DNA damage response genes is also affected. In SBDS knock-down cells, 34 mRNAs showed decreased and 55 mRNAs showed increased association to polysomes, among which is a group encoding proteins involved in alternative splicing and RNA modification. These results indicate that SBDS is required for accurate expression of genes important for proper brain, skeletal, and blood cell development.

  8. [Measurement of Affect Regulation Styles (MARS) expanded].

    PubMed

    Rovira, Darío Páez; Martínez Sánchez, Francisco; Sevillano Triguero, Verónica; Mendiburo Seguel, Andrés; Campos, Miriam

    2012-05-01

    An expanded Spanish version of the Measure of Affect Regulation Styles (MARS), was applied to episodes of anger and sadness, in a sample of 355 graduate students from Chile, Spain, and Mexico. The study examines the association between affective regulation, adaptation to episodes and dispositional coping and emotional regulation, and psychological well-being. With regard to perceived improvement of adaptive goals, the following adaptive affect regulation strategies were confirmed: Instrumental coping, seeking social support, positive reappraisal, distraction, rumination, self-comfort, self-control, and emotional expression were functional; whereas inhibition and suppression were dysfunctional. Adaptive strategies were positively associated with psychological well-being, reappraisal and humor as a coping strategy. Negative associations were found between adaptive strategies and suppression and alexithymia. Maladaptive strategies show the opposite profile. Confrontation, instrumental coping, social support as well as social isolation were more frequently found in anger, an approach emotion.

  9. Phytochrome B Negatively Affects Cold Tolerance by Regulating OsDREB1 Gene Expression through Phytochrome Interacting Factor-Like Protein OsPIL16 in Rice

    PubMed Central

    He, Yanan; Li, Yaping; Cui, Lixin; Xie, Lixia; Zheng, Chongke; Zhou, Guanhua; Zhou, Jinjun; Xie, Xianzhi

    2016-01-01

    Cross talk between light signaling and cold signaling has been elucidated in the model plant Arabidopsis and tomato, but little is known about their relationship in rice. Here, we report that phytochrome B (phyB) mutants exhibit improved cold tolerance compared with wild type (WT) rice (Oryza sativa L. cv. Nipponbare). The phyB mutants had a lower electrolyte leakage index and malondialdehyde concentration than the WT, suggesting that they had greater cell membrane integrity and less lipid peroxidation. Real-time PCR analysis revealed that the expression levels of dehydration-responsive element binding protein 1 (OsDREB1) family genes, which functions in the cold stress response in rice, were increased in the phyB mutant under normal and cold stress conditions. PIFs are central players in phytochrome-mediated light signaling networks. To explore the relationship between rice PIFs and OsDREB1 gene expression, we produced overexpression lines of rice PIF genes. OsDREB1 family genes were up-regulated in OsPIL16-overexpression lines, which had improved cold tolerance relative to the WT. Chromatin immunoprecipitation (ChIP)-qPCR assay revealed that OsPIL16 can bind to the N-box region of OsDREB1B promoter. Expression pattern analyses revealed that OsPIL16 transcripts were induced by cold stress and was significantly higher in the phyB mutant than in the WT. Moreover, yeast two-hybrid assay showed that OsPIL16 can bind to rice PHYB. Based on these results, we propose that phyB deficiency positively regulates OsDREB1 expression through OsPIL16 to enhance cell membrane integrity and to reduce the malondialdehyde concentration, resulting in the improved cold tolerance of the phyB mutants. PMID:28083003

  10. Exporting licensing regulations affecting US geothermal firms

    SciTech Connect

    Not Available

    1988-08-01

    This document presents a brief introduction and overview of the Department of Commerce's Export Administration Regulations which might affect potential US geothermal goods exporters. It is intended to make US geothermal firms officials aware of the existence of such regulations and to provide them with references, contacts and phone numbers where they can obtain specific and detailed information and assistance. It must be stressed however, that the ultimate responsibility for complying with the above mentioned regulations lies with the exporter who must consult the complete version of the regulations.

  11. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  12. Transcription factor CecR (YbiH) regulates a set of genes affecting the sensitivity of Escherichia coli against cefoperazone and chloramphenicol.

    PubMed

    Yamanaka, Yuki; Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2016-07-01

    Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening was performed for identification of the binding site of YbiH, an as yet uncharacterized TetR-family transcription factor, on the Escherichia coli genome. YbiH was found to be a unique single-target regulator that binds in vitro within the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses indicated one clear binding site of YbiH, including a complete palindromic sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of the ybiH operon and activation of the rhlE operon by YbiH. After phenotype microarray screening, YbiH was indicated to confer resistance to chloramphenicol and cefazoline (a first-generation cephalosporin). A systematic survey of the participation of each of the predicted YbiH-regulated genes in the antibiotic sensitivity indicated involvement of the YbhFSR ABC-type transporter in the sensitivity to cefoperazone (a third-generation cephalosporin) and of the membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken together with the growth test in the presence of these two antibiotics and in vitro transcription assay, it was concluded that the hitherto uncharacterized YbiH regulates transcription of both the bidirectional transcription units, the ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the control of sensitivity to cefoperazone and chloramphenicol. We thus propose to rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity).

  13. The Affective Regulation of Social Interaction*

    PubMed Central

    Clore, Gerald L.; Pappas, Jesse

    2008-01-01

    The recent publication of David Heise’s Expressive Order (2007) provides an occasion for discussing some of the key ideas in Affect Control Theory. The theory proposes that a few dimensions of affective meaning provide a common basis for interrelating personal identities and social actions. It holds that during interpersonal interactions, social behavior is continually regulated to maintain an affective tone compatible with whatever social roles or identities define the situation. We outline the intellectual history of the proposed dimensions and of the idea that each social action invites an action from the other that has a particular location along these dimensions. We also relate these ideas to the Affect-as-Information hypothesis, an approach that often guides research in psychology on the role of affect in regulating judgment and thought. PMID:18461152

  14. Cloning of the major histocompatibility complex class II promoter binding protein affected in a hereditary defect in class II gene regulation.

    PubMed Central

    Reith, W; Barras, E; Satola, S; Kobr, M; Reinhart, D; Sanchez, C H; Mach, B

    1989-01-01

    The regulation of major histocompatibility complex class II gene expression is directly involved in the control of normal and abnormal immune responses. In humans, HLA-DR, -DQ, and -DP class II heterodimers are encoded by a family of alpha- and beta-chain genes clustered in the major histocompatibility complex. Their expression is developmentally controlled and normally restricted to certain cell types. This control is mediated by cis-acting sequences in class II promoters and by trans-acting regulatory factors. Several nuclear proteins bind to class II promoter sequences. In a form of hereditary immunodeficiency characterized by a defect in a trans-acting regulatory factor controlling class II gene transcription, we have observed that one of these nuclear factors (RF-X) does not bind to its target sequence (the class II X box). A cDNA encoding RF-X was isolated by screening a phage expression library with an X-box binding-site probe. The recombinant protein has the binding specificity of RF-X, including a characteristic gradient of affinity for the X boxes of HLA-DR, -DP, and -DQ promoters. RF-X mRNA is present in the regulatory mutants, indicating a defect in the synthesis of a functional form of the RF-X protein. Images PMID:2498880

  15. Silencing of molt-regulating transcription factor gene, CiHR3, affects growth and development of sugarcane stem borer, Chilo infuscatellus.

    PubMed

    Zhang, Yu-liang; Zhang, Shu-zhen; Kulye, Mahesh; Wu, Su-ran; Yu, Nai-tong; Wang, Jian-hua; Zeng, Hong-mei; Liu, Zhi-xin

    2012-01-01

    RNA interference (RNAi) is a technology for conducting functional genomic studies and a potential tool for crop protection against insect pests. Development of reliable methods for production and delivery of double-stranded RNA (dsRNA) is the major challenge for efficient pest control. In this study, Chilo infuscatellus Snellen (Crambidae: Lepidoptera) was fed with CiHR3 dsRNA expressed in bacteria or synthesized in vitro. The dsRNA ingested by C. infuscatellus successfully triggered silencing of the molt-regulating transcription factor CiHR3, an important gene for insect growth and development, and caused significant abnormalities and weight loss in insects within seven days of treatment. This study is an ideal example of feeding-based RNAi mediated by dsRNA expressed in bacteria or synthesized in vitro. The results also suggested that feeding-based RNA interference is a potential method for the management of C. infuscatellus.

  16. New Regulations Affect School Debt Financing.

    ERIC Educational Resources Information Center

    Olson, Carol Duane

    1993-01-01

    Provides an overview of changes in Treasury Regulations as they affect school debt financing, including bond and note construction and acquisition issues, other types of equipment and property financing, as well as tax and revenue anticipation notes for working capital needs. (MLF)

  17. Marker gene tethering by nucleoporins affects gene expression in plants.

    PubMed

    Smith, Sarah; Galinha, Carla; Desset, Sophie; Tolmie, Frances; Evans, David; Tatout, Christophe; Graumann, Katja

    2015-01-01

    In non-plant systems, chromatin association with the nuclear periphery affects gene expression, where interactions with nuclear envelope proteins can repress and interactions with nucleoporins can enhance transcription. In plants, both hetero- and euchromatin can localize at the nuclear periphery, but the effect of proximity to the nuclear periphery on gene expression remains largely unknown. This study explores the putative function of Seh1 and Nup50a nucleoporins on gene expression by using the Lac Operator / Lac Repressor (LacI-LacO) system adapted to Arabidopsis thaliana. We used LacO fused to the luciferase reporter gene (LacO:Luc) to investigate whether binding of the LacO:Luc transgene to nucleoporin:LacI protein fusions alters luciferase expression. Two separate nucleoporin-LacI-YFP fusions were introduced into single insert, homozygous LacO:Luc Arabidopsis plants. Homozygous plants carrying LacO:Luc and a single insert of either Seh1-LacI-YFP or Nup50a-LacI-YFP were tested for luciferase activity and compared to plants containing LacO:Luc only. Seh1-LacI-YFP increased, while Nup50a-LacI-YFP decreased luciferase activity. Seh1-LacI-YFP accumulated at the nuclear periphery as expected, while Nup50a-LacI-YFP was nucleoplasmic and was not selected for further study. Protein and RNA levels of luciferase were quantified by western blotting and RT-qPCR, respectively. Increased luciferase activity in LacO:Luc+Seh1-LacI-YFP plants was correlated with increased luciferase protein and RNA levels. This change of luciferase expression was abolished by disruption of LacI-LacO binding by treating with IPTG in young seedlings, rosette leaves and inflorescences. This study suggests that association with the nuclear periphery is involved in the regulation of gene expression in plants.

  18. Synaptic regulation of affective behaviors; role of BDNF

    PubMed Central

    Ninan, Ipe

    2013-01-01

    Brain derived neurotrophic factor (BDNF), a neurotrophin essential for nervous system development and synaptic plasticity, has been found to have a significant influence on affective behaviors. The notion that an impairment in BDNF signaling might be involved in affective disorders is originated primarily from the opposing effects of antidepressants and stress on BDNF signaling. Antidepressants enhance BDNF signaling and synaptic plasticity. On the other hand, negative environmental factors such as severe stress suppress BDNF signaling, impair synaptic activity and increase susceptibility to affective disorders. Postmortem studies provided strong support for decreased BDNF signaling in depressive disorders. Remarkably, studies in humans with a single nucleotide polymorphism in the BDNF gene, the BDNF Val66Met which affects regulated release of BDNF, showed profound deficits in hippocampal and prefrontal cortical (PFC) plasticity and cognitive behaviors. BDNF regulates synaptic mechanisms responsible for various cognitive processes including attenuation of aversive memories, a key process in the regulation of affective behaviors. The unique role of BDNF in cognitive and affective behaviors suggests that cognitive deficits due to altered BDNF signaling might underlie affective disorders. Understanding how BDNF modulates synapses in neural circuits relevant to affective behaviors, particularly the medial prefrontal cortical (mPFC)-hippocampus-amygdala pathway, and its interaction with development, sex, and environmental risk factors might shed light on potential therapeutic targets for affective disorders. PMID:23747574

  19. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C

    2000-01-01

    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  20. Osmotic regulation of gene action.

    PubMed Central

    Douzou, P

    1994-01-01

    Most reactions involved in gene translation systems are ionic-dependent and may be explained in electrostatic terms. However, a number of observations of equilibria and rate processes making up the overall reactions clearly indicate that there is still an enormous gap between the rough picture of the mechanism of ionic regulation and the detailed behavior of reactions at the molecular level that hold the key to specific mechanisms. The present paper deals with possible osmotic contributions arising from the gel state of gene systems that are complementary to, and interdependent of, electrostatic contributions. This treatment, although still oversimplified, explains many previous observations by relating them to a general osmotic mechanism and suggests experimental approaches to studying the mechanisms of gene regulation in organelle-free and intact systems. PMID:8127862

  1. Epigenetic regulation of gene responsiveness in Arabidopsis

    PubMed Central

    To, Taiko K.; Kim, Jong Myong

    2014-01-01

    The regulation of chromatin structure is inevitable for proper transcriptional response in eukaryotes. Recent reports in Arabidopsis have suggested that gene responsiveness is modulated by particular chromatin status. One such feature is H2A.Z, a histone variant conserved among eukaryotes. In Arabidopsis, H2A.Z is enriched within gene bodies of transcriptionally variable genes, which is in contrast to genic DNA methylation found within constitutive genes. In the absence of H2A.Z, the genes normally harboring H2A.Z within gene bodies are transcriptionally misregulated, while DNA methylation is unaffected. Therefore, H2A.Z may promote variability of gene expression without affecting genic DNA methylation. Another epigenetic information that could be important for gene responsiveness is trimethylation of histone H3 lysine 4 (H3K4me3). The level of H3K4me3 increases when stress responsive genes are transcriptionally activated, and it decreases after recovery from the stress. Even after the recovery, however, H3K4me3 is kept at some atypical levels, suggesting possible role of H3K4me3 for a stress memory. In this review, we summarize and discuss the growing evidences connecting chromatin features and gene responsiveness. PMID:24432027

  2. Hox genes regulation in vertebrates.

    PubMed

    Soshnikova, Natalia

    2014-01-01

    Hox genes encode transcription factors defining cellular identities along the major and secondary body axes. Their coordinated expression in both space and time is critical for embryonic patterning. Accordingly, Hox genes transcription is tightly controlled at multiple levels, and involves an intricate combination of local and long-range cis-regulatory elements. Recent studies revealed that in addition to transcription factors, dynamic patterns of histone marks and higher-order chromatin structure are important determinants of Hox gene regulation. Furthermore, the emerging picture suggests an involvement of various species of non-coding RNA in targeting activating and repressive complexes to Hox clusters. I review these recent developments and discuss their relevance to the control of Hox gene expression in vivo, as well as to our understanding of transcriptional regulatory mechanisms.

  3. Regulation of ABO gene expression.

    PubMed

    Kominato, Yoshihiko; Hata, Yukiko; Matsui, Kazuhiro; Takizawa, Hisao

    2005-07-01

    The ABO blood group system is important in blood transfusions and in identifying individuals during criminal investigations. Two carbohydrate antigens, the A and B antigens, and their antibodies constitute this system. Although biochemical and molecular genetic studies have demonstrated the molecular basis of the histo-blood group ABO system, some aspects remain to be elucidated. To explain the molecular basis of how the ABO genes are controlled in cell type-specific expression, during normal cell differentiation, and in cancer cells with invasive and metastatic potential that lack A/B antigens, it is essential to understand the regulatory mechanism of ABO gene transcription. We review the transcriptional regulation of the ABO gene, including positive and negative elements in the upstream region of the gene, and draw some inferences that help to explain the phenomena described above.

  4. Characterization of disease-associated mutations affecting an exonic splicing enhancer and two cryptic splice sites in exon 13 of the cystic fibrosis transmembrane conductance regulator gene.

    PubMed

    Aznarez, Isabel; Chan, Elayne M; Zielenski, Julian; Blencowe, Benjamin J; Tsui, Lap-Chee

    2003-08-15

    Sequences in exons can play an important role in constitutive and regulated pre-mRNA splicing. Since exonic splicing regulatory sequences are generally poorly conserved and their mechanism of action is not well understood, the consequence of exonic mutations on splicing can only be determined empirically. In this study, we have investigated the consequence of two cystic fibrosis (CF) disease-causing mutations, E656X and 2108delA, on the function of a putative exonic splicing enhancer (ESE) in exon 13 of the CFTR gene. We have also determined whether five other CF mutations D648V, D651N, G654S, E664X and T665S located near this putative ESE could lead to aberrant splicing of exon 13. Using minigene constructs, we have demonstrated that the E656X and 2108delA mutations could indeed cause aberrant splicing in a predicted manner, supporting a role for the putative ESE sequence in pre-mRNA splicing. In addition, we have shown that D648V, E664X and T665S mutations could cause aberrant splicing of exon 13 by improving the polypyrimidine tracts of two cryptic 3' splice sites. We also provide evidence that the relative levels of two splicing factors, hTra2alpha and SF2/ASF, could alter the effect on splicing of some of the exon 13 disease mutations. Taken together, our results suggest that the severity of CF disease could be modulated by changes in the fidelity of CFTR pre-mRNA splicing.

  5. Stochastic Fluctuations in Gene Regulation

    DTIC Science & Technology

    2005-04-01

    AFRL-IF- RS -TR-2005-126 Final Technical Report April 2005 STOCHASTIC FLUCTUATIONS IN GENE REGULATION Boston University...be releasable to the general public, including foreign nations. AFRL-IF- RS -TR-2005-126 has been reviewed and is approved for publication...AGENCY REPORT NUMBER AFRL-IF- RS -TR-2005-126 11. SUPPLEMENTARY NOTES AFRL Project Engineer: Peter J. Costianes/IFED/(315) 330-4030

  6. Vibrio Fischeri Symbiosis Gene Regulation

    DTIC Science & Technology

    1988-08-12

    bacterium. PROGRESS (Year 1): 1. Regulation of V. fischeri lux gene expression in E . coli . A . Transcriptional control of luxR expression by cAMP-CRP and...comparable to cya and crp mutants of E . coli and Salmonella typhimuriwn, including a pleiotropic carbohydrate negative phenotype and a decreased...availability of appropriate mutants. Conditions for iron restriction of growth of E . coli that result in a stimulation of luminescence and luciferase

  7. IBD Candidate Genes and Intestinal Barrier Regulation

    PubMed Central

    McCole, Declan F.

    2015-01-01

    Technological advances in the large scale analysis of human genetics have generated profound insights into possible genetic contributions to chronic diseases including the inflammatory bowel diseases (IBDs), Crohn’s disease and ulcerative colitis. To date, 163 distinct genetic risk loci have been associated with either Crohn’s disease or ulcerative colitis, with a substantial degree of genetic overlap between these 2 conditions. Although many risk variants show a reproducible correlation with disease, individual gene associations only affect a subset of patients, and the functional contribution(s) of these risk variants to the onset of IBD is largely undetermined. Although studies in twins have demonstrated that the development of IBD is not mediated solely by genetic risk, it is nevertheless important to elucidate the functional consequences of risk variants for gene function in relevant cell types known to regulate key physiological processes that are compromised in IBD. This article will discuss IBD candidate genes that are known to be, or are suspected of being, involved in regulating the intestinal epithelial barrier and several of the physiological processes presided over by this dynamic and versatile layer of cells. This will include assembly and regulation of tight junctions, cell adhesion and polarity, mucus and glycoprotein regulation, bacterial sensing, membrane transport, epithelial differentiation, and restitution. PMID:25215613

  8. How Europe regulates its genes

    SciTech Connect

    Balter, M.

    1991-06-07

    As Europe moves toward unification in 1992, more than two dozen regulations and directives that will affect biotech are working their way through the complex European legislative system. The result could mean tough scrutiny for genetically engineered products. One reason is that the European Community (EC) has chosen to examine genetically engineered products as a special category - an approach the FDA has rejected. Another is that the EC is considering enacting regulations that would mandate consideration of the socioeconomic effects of biotech products in addition to their safety. In addition, some - particularly in industry - fear a nightmare of overlapping and contradictory regulations. It's too soon to tell how well the European system will work, or how stifling the regulations might be. In all likelihood the regulations emerging in Europe won't be demonstrably superior - or inferior - to the American ones, just different, with different strengths and weaknesses. But since many US biotech companies are looking to the huge market that a unified Europe represents, the specifics of those strengths and weaknesses will ultimately be of more than passing interest.

  9. Linker histones in hormonal gene regulation.

    PubMed

    Vicent, G P; Wright, R H G; Beato, M

    2016-03-01

    In the present review, we summarize advances in our knowledge on the role of the histone H1 family of proteins in breast cancer cells, focusing on their response to progestins. Histone H1 plays a dual role in gene regulation by hormones, both as a structural component of chromatin and as a dynamic modulator of transcription. It contributes to hormonal regulation of the MMTV promoter by stabilizing a homogeneous nucleosome positioning, which reduces basal transcription whereas at the same time promoting progesterone receptor binding and nucleosome remodeling. These combined effects enhance hormone dependent gene transcription, which eventually requires H1 phosphorylation and displacement. Various isoforms of histone H1 have specific functions in differentiated breast cancer cells and compact nucleosomal arrays to different extents in vitro. Genome-wide studies show that histone H1 has a key role in chromatin dynamics of hormone regulated genes. A complex sequence of enzymatic events, including phosphorylation by CDK2, PARylation by PARP1 and the ATP-dependent activity of NURF, are required for H1 displacement and gene de-repression, as a prerequisite for further nucleosome remodeling. Similarly, during hormone-dependent gene repression a dedicated enzymatic mechanism controls H1 deposition at promoters by a complex containing HP1γ, LSD1 and BRG1, the ATPase of the BAF complex. Thus, a broader vision of the histone code should include histone H1, as the linker histone variants actively participate in the regulation of the chromatin structure. How modifications of the core histones tails affect H1 modifications and vice versa is one of the many questions that remains to be addressed to provide a more comprehensive view of the histone cross-talk mechanisms.

  10. Mathematical Models of Gene Regulation

    NASA Astrophysics Data System (ADS)

    Mackey, Michael C.

    2004-03-01

    This talk will focus on examples of mathematical models for the regulation of repressible operons (e.g. the tryptophan operon), inducible operons (e.g. the lactose operon), and the lysis/lysogeny switch in phage λ. These ``simple" gene regulatory elements can display characteristics experimentally of rapid response to perturbations and bistability, and biologically accurate mathematical models capture these aspects of the dynamics. The models, if realistic, are always nonlinear and contain significant time delays due to transcriptional and translational delays that pose substantial problems for the analysis of the possible ranges of dynamics.

  11. QB1 - Stochastic Gene Regulation

    SciTech Connect

    Munsky, Brian

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  12. Down-regulation of MHC Class I by the Marek's Disease Virus (MDV) UL49.5 Gene Product Mildly Affects Virulence in a Haplotype-specific Fashion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marek’s disease is a devastating neoplastic disease of chickens caused by gallid herpesvirus 2 or Marek’s disease virus (MDV), which is characterized by massive visceral tumors, immune suppression, neurologic syndromes, and peracute deaths. It has been reported that MDV down-regulates surface expre...

  13. Affect-regulation expectancies among Gamblers.

    PubMed

    Will Shead, N; Hodgins, David C

    2009-09-01

    Factor scores on a gambling expectancy questionnaire (GEQ) were used to subtype 132 university students who gamble regularly (37.9% male; M age = 22.6 years, SD = 6.04) as: Reward Expectancy Gamblers (Reward EGs)-have strong expectations that gambling augments positive mood, Relief Expectancy Gamblers (Relief EGs)-have strong expectations that gambling relieves negative affect, and Non-Expectancy Gamblers (Non-EGs)-have neither strong expectation. Gambling on a high-low card game was compared across subtypes following priming for either "relief" or "reward" affect-regulation expectancies with the Scrambled Sentence Test (SST). The hypothesized Prime type x GEQ subtype interaction was not significant. When a more stringent set of criteria for GEQ subtyping was imposed, the "purified" sub-sample (n = 54) resulted in the hypothesized statistically significant Prime type x GEQ subtype interaction. Relief EGs gambled more after being primed with the construct "relief of negative emotions" compared to after being primed with the construct "augmentation of positive emotion." Planned orthogonal contrasts showed a significant linear increase in number of bets made across GEQ subtypes when prime type corresponded to GEQ subtype. The results suggest a need for components in gambling treatment programs that address clients' expectancies that gambling can provide a specific desirable emotional outcome.

  14. Legislation: Legislation and Regulations Affecting Libraries in 2002; Legislation and Regulations Affecting Publishing in 2002.

    ERIC Educational Resources Information Center

    Sheketoff, Emily; Costabile, Mary R.; Adler, Allan

    2003-01-01

    Reviews legislation and regulations affecting libraries and the publishing industry, including the Museum and Library Services Act; Office of Educational Research and Improvement (OERI); copyright; access to electronic government information; telecommunications and technology; electronic surveillance and privacy, including the USA Patriot Act;…

  15. Regulation of UDP glucuronosyltransferase genes.

    PubMed

    Mackenzie, P I; Gregory, P A; Gardner-Stephen, D A; Lewinsky, R H; Jorgensen, B R; Nishiyama, T; Xie, Wen; Radominska-Pandya, A

    2003-06-01

    The UDP glucuronosyltransferase (UGT) content of cells and tissues is a major determinant of our response to those chemicals that are primarily eliminated by conjugation with glucuronic acid. There are marked interindividual differences in the content of UGTs in the liver and other organs. The mechanisms that lead to these differences are unknown but are most likely the result of differential UGT gene expression. Several transcription factors involved in the regulation of UGT genes have been identified. These include factors such as Hepatocyte Nuclear Factor 1, CAAT-Enhancer Binding Protein, Octamer transcription Factor 1 and Pbx2, which appear to control the constitutive levels of UGTs in tissues and organs. In addition, UGT gene expression is also modulated by hormones, drugs and other foreign chemicals through the action of proteins that bind and/or sense the presence of these chemicals. These proteins include the Ah receptor, members of the nuclear receptor superfamily, such as CAR and PXR and transcription factors that respond to stress.

  16. TMEM106B, the risk gene for frontotemporal dementia, is regulated by the microRNA-132/212 cluster and affects progranulin pathways.

    PubMed

    Chen-Plotkin, Alice S; Unger, Travis L; Gallagher, Michael D; Bill, Emily; Kwong, Linda K; Volpicelli-Daley, Laura; Busch, Johanna I; Akle, Sebastian; Grossman, Murray; Van Deerlin, Vivianna; Trojanowski, John Q; Lee, Virginia M-Y

    2012-08-15

    Frontotemporal lobar degeneration with TDP-43 inclusions (FTLD-TDP) is a fatal neurodegenerative disease with no available treatments. Mutations in the progranulin gene (GRN) causing impaired production or secretion of progranulin are a common Mendelian cause of FTLD-TDP; additionally, common variants at chromosome 7p21 in the uncharacterized gene TMEM106B were recently linked by genome-wide association to FTLD-TDP with and without GRN mutations. Here we show that TMEM106B is neuronally expressed in postmortem human brain tissue, and that expression levels are increased in FTLD-TDP brain. Furthermore, using an unbiased, microarray-based screen of >800 microRNAs (miRs), we identify microRNA-132 as the top microRNA differentiating FTLD-TDP and control brains, with <50% normal expression levels of three members of the microRNA-132 cluster (microRNA-132, microRNA-132*, and microRNA-212) in disease. Computational analyses, corroborated empirically, demonstrate that the top mRNA target of both microRNA-132 and microRNA-212 is TMEM106B; both microRNAs repress TMEM106B expression through shared microRNA-132/212 binding sites in the TMEM106B 3'UTR. Increasing TMEM106B expression to model disease results in enlargement and poor acidification of endo-lysosomes, as well as impairment of mannose-6-phosphate-receptor trafficking. Finally, endogenous neuronal TMEM106B colocalizes with progranulin in late endo-lysosomes, and TMEM106B overexpression increases intracellular levels of progranulin. Thus, TMEM106B is an FTLD-TDP risk gene, with microRNA-132/212 depression as an event which can lead to aberrant overexpression of TMEM106B, which in turn alters progranulin pathways. Evidence for this pathogenic cascade includes the striking convergence of two independent, genomic-scale screens on a microRNA:mRNA regulatory pair. Our findings open novel directions for elucidating miR-based therapies in FTLD-TDP.

  17. Dynamics of bacterial gene regulation

    NASA Astrophysics Data System (ADS)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  18. Gene regulation by noncoding RNAs

    PubMed Central

    Patil, Veena S.; Zhou, Rui; Rana, Tariq M.

    2015-01-01

    The past two decades have seen an explosion in research on noncoding RNAs and their physiological and pathological functions. Several classes of small (20–30 nucleotides) and long (>200 nucleotides) noncoding RNAs have been firmly established as key regulators of gene expression in myriad processes ranging from embryonic development to innate immunity. In this review, we focus on our current understanding of the molecular mechanisms underlying the biogenesis and function of small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). In addition, we briefly review the relevance of small and long noncoding RNAs to human physiology and pathology and their potential to be exploited as therapeutic agents. PMID:24164576

  19. Retrotransposons as regulators of gene expression.

    PubMed

    Elbarbary, Reyad A; Lucas, Bronwyn A; Maquat, Lynne E

    2016-02-12

    Transposable elements (TEs) are both a boon and a bane to eukaryotic organisms, depending on where they integrate into the genome and how their sequences function once integrated. We focus on two types of TEs: long interspersed elements (LINEs) and short interspersed elements (SINEs). LINEs and SINEs are retrotransposons; that is, they transpose via an RNA intermediate. We discuss how LINEs and SINEs have expanded in eukaryotic genomes and contribute to genome evolution. An emerging body of evidence indicates that LINEs and SINEs function to regulate gene expression by affecting chromatin structure, gene transcription, pre-mRNA processing, or aspects of mRNA metabolism. We also describe how adenosine-to-inosine editing influences SINE function and how ongoing retrotransposition is countered by the body's defense mechanisms.

  20. Methylation Affects Transposition and Splicing of a Large CACTA Transposon from a MYB Transcription Factor Regulating Anthocyanin Synthase Genes in Soybean Seed Coats

    PubMed Central

    Zabala, Gracia; Vodkin, Lila O.

    2014-01-01

    We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-rm is homozygous for a mutable allele (rm) that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-rm line had a 13 kb CACTA subfamily transposon insertion (designated TgmR*) at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3) to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-rm progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element. PMID:25369033

  1. Regulation of the genes involved in nitrification.

    SciTech Connect

    Arp, D.J.; Sayavedra-Soto, L.A.

    2003-08-14

    OAK-B135 This project focuses on the characterization of the regulation of the genes involved in nitrification in the bacterium Nitrosomonas europaea. The key genes in the nitrification pathway, amo and hao, are present in multiple copies in the genome. The promoters for these genes were identified and characterized. It was shown that there were some differences in the transcriptional regulation of the copies of these genes.

  2. Social regulation of cortisol receptor gene expression

    PubMed Central

    Korzan, Wayne J.; Grone, Brian P.; Fernald, Russell D.

    2014-01-01

    In many social species, individuals influence the reproductive capacity of conspecifics. In a well-studied African cichlid fish species, Astatotilapia burtoni, males are either dominant (D) and reproductively competent or non-dominant (ND) and reproductively suppressed as evidenced by reduced gonadotropin releasing hormone (GnRH1) release, regressed gonads, lower levels of androgens and elevated levels of cortisol. Here, we asked whether androgen and cortisol levels might regulate this reproductive suppression. Astatotilapia burtoni has four glucocorticoid receptors (GR1a, GR1b, GR2 and MR), encoded by three genes, and two androgen receptors (ARα and ARβ), encoded by two genes. We previously showed that ARα and ARβ are expressed in GnRH1 neurons in the preoptic area (POA), which regulates reproduction, and that the mRNA levels of these receptors are regulated by social status. Here, we show that GR1, GR2 and MR mRNAs are also expressed in GnRH1 neurons in the POA, revealing potential mechanisms for both androgens and cortisol to influence reproductive capacity. We measured AR, MR and GR mRNA expression levels in a microdissected region of the POA containing GnRH1 neurons, comparing D and ND males. Using quantitative PCR (qPCR), we found D males had higher mRNA levels of ARα, MR, total GR1a and GR2 in the POA compared with ND males. In contrast, ND males had significantly higher levels of GR1b mRNA, a receptor subtype with a reduced transcriptional response to cortisol. Through this novel regulation of receptor type, neurons in the POA of an ND male will be less affected by the higher levels of cortisol typical of low status, suggesting GR receptor type change as a potential adaptive mechanism to mediate high cortisol levels during social suppression. PMID:25013108

  3. Regulation of male fertility by X-linked genes.

    PubMed

    Zheng, Ke; Yang, Fang; Wang, Peijing Jeremy

    2010-01-01

    Infertility is a worldwide reproductive health problem, affecting men and women about equally. Mouse genetic studies demonstrate that more than 200 genes specifically or predominantly regulate fertility. However, few genetic causes of infertility in humans have been identified. Here, we focus on the regulation of male fertility by X-linked, germ cell-specific genes. Previous genomic studies reveal that the mammalian X chromosome is enriched for genes expressed in early spermatogenesis. Recent genetic studies in mice show that X-linked, germ cell-specific genes, such as A-kinase anchor protein 4 (Akap4), nuclear RNA export factor 2 (Nxf2), TBP-associated factor 7l (Taf7l), and testis-expressed gene 11 (Tex11), indeed play important roles in the regulation of male fertility. Moreover, we find that the Taf7l Tex11 double-mutant males exhibit much more severe defects in meiosis than either single mutant, suggesting that these 2 X-linked genes regulate male meiosis synergistically. The X-linked, germ cell-specific genes are particularly attractive in the study of male infertility in humans. Because males are hemizygous for X-linked genes, loss-of-function mutations in the single-copy X-linked genes, unlike in autosomal genes, would not be masked by a normal allele. The genetic studies of X-linked, germ cell-specific genes in mice have laid a foundation for mutational analysis of their human orthologues in infertile men.

  4. Implicit emotion regulation affects outcome evaluation.

    PubMed

    Yang, Qiwei; Tang, Ping; Gu, Ruolei; Luo, Wenbo; Luo, Yue-jia

    2015-06-01

    Efficient implicit emotion regulation processes, which run without awareness, are important for human well-being. In this study, to investigate the influence of implicit emotion regulation on psychological and electrophysiological responses to gains and losses, participants were required to select between two Chinese four-character idioms to match the meaning of the third one before they performed a monetary gambling task. According to whether their meanings were related to emotion regulation, the idioms fell into two categories. Event-related potentials and self-rating emotional experiences to outcome feedback were recorded during the task. Priming emotion regulation reduced subjective emotional experience to both gains and losses and the amplitudes of the feedback-related negativity, while the P3 component was not influenced. According to these results, we suggest that the application of implicit emotion regulation effectively modulated the subjective emotional experience and the motivational salience of current outcomes without the cost of cognitive resources. This study implicates the potential significance of implicit emotion regulation in decision-making processes.

  5. Gasoline Composition Regulations Affecting LUST Sites

    EPA Science Inventory

    Passage of the Clean Air Act Amendments in 1990 imposed requirements on gasoline composition in the United States. Impacts to ground water are affected by the provisions that required oxygenated additives and limited benzene concentration. Reformulated and oxygenated gasoline w...

  6. [Emotional intelligence, social support and affect regulation].

    PubMed

    Verissimo, Ramiro

    2005-01-01

    The aim of the present study was to gain additional information about the relationship between emotional intelligence, social support, and affectivity. The subjects were 64 university students who completed the short form of the Trait Meta-Mood Scale (TMMS-30), the Social Support Questionnaire, and the Multiple Affect Adjective Check List (MAACL). The results show that Social Support is high and significantly related with both Mood Repair, on one hand, and more Positive Affects and Sensation Seeking, on the other. These findings are consistent with the hypothesis that social support can be considered, somehow, as a way of mood repair; and thus not surprisingly is also associated with more Positive Affects and Sensation Seeking.

  7. Self-regulation and Beyond: Affect Regulation and the Infant-Caregiver Dyad.

    PubMed

    Taipale, Joona

    2016-01-01

    In the available psychological literature, affect regulation is fundamentally considered in terms of self-regulation, and according to this standard picture, the contribution of other people in our affect regulation has been viewed in terms of socially assisted self-regulation. The present article challenges this standard picture. By focusing on affect regulation as it unfolds in early infancy, it will be argued that instead of being something original and fundamental, self-regulation developmentally emerges from the basis of a further type of affect regulation. While infants' capacities in recognizing, understanding, and modifying their own affective states are initially immature and undeveloped, affect regulation is initially managed by the other: it is initially the self, and not the other, that plays the role of an assistant in affect regulation. To capture this phenomenon, the concepts of "auto-matic," "hetero-matic," and "altero-matic" affect regulation will be introduced and their interrelations elaborated. By showing how the capacity of affective self-regulation, which is characteristic to maturity, is developmentally achieved by internalizing regulative functions that, at the outset of development, are managed by the caregiver, it will be argued that altero-matic affect regulation is an autonomous type of affect regulation and the developmental basis for self-regulation.

  8. Self-regulation and Beyond: Affect Regulation and the Infant–Caregiver Dyad

    PubMed Central

    Taipale, Joona

    2016-01-01

    In the available psychological literature, affect regulation is fundamentally considered in terms of self-regulation, and according to this standard picture, the contribution of other people in our affect regulation has been viewed in terms of socially assisted self-regulation. The present article challenges this standard picture. By focusing on affect regulation as it unfolds in early infancy, it will be argued that instead of being something original and fundamental, self-regulation developmentally emerges from the basis of a further type of affect regulation. While infants’ capacities in recognizing, understanding, and modifying their own affective states are initially immature and undeveloped, affect regulation is initially managed by the other: it is initially the self, and not the other, that plays the role of an assistant in affect regulation. To capture this phenomenon, the concepts of “auto-matic,” “hetero-matic,” and “altero-matic” affect regulation will be introduced and their interrelations elaborated. By showing how the capacity of affective self-regulation, which is characteristic to maturity, is developmentally achieved by internalizing regulative functions that, at the outset of development, are managed by the caregiver, it will be argued that altero-matic affect regulation is an autonomous type of affect regulation and the developmental basis for self-regulation. PMID:27378984

  9. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes.

    PubMed

    Zhao, Huayan; Lü, Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P; Xiong, Liming

    2015-11-01

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  10. Affect regulation and HIV risk among youth in therapeutic schools

    PubMed Central

    Brown, Larry K.; Houck, Christopher; Lescano, Celia; Donenberg, Geri; Tolou-Shams, Marina; Mello, Justin

    2012-01-01

    The acquisition of affect regulation skills is often impaired or delayed in youth with mental health problems but the relationship between affect dysregulation and risk behaviors has not been well studied. Baseline data from adolescents (N =418; ages 13–19) recruited from therapeutic school settings examined the relationship between affect dysregulation, substance use, self-cutting, and sexual risk behavior. Analyses of covariance demonstrated that adolescents who did not use condoms at last sex, ever self-cut, attempted suicide, used alcohol and other drugs and reported less condom use self-efficacy when emotionally aroused were significantly more likely (p < .01) to report greater difficulty with affect regulation than peers who did not exhibit these behaviors. General patterns of difficulty with affect regulation may be linked to HIV risk behavior, including condom use at last sex. HIV prevention strategies for youth in mental health treatment should target affect regulation in relation to multiple risk behaviors. PMID:22669595

  11. Gene Regulation Networks for Modeling Drosophila Development

    NASA Technical Reports Server (NTRS)

    Mjolsness, E.

    1999-01-01

    This chapter will very briefly introduce and review some computational experiments in using trainable gene regulation network models to simulate and understand selected episodes in the development of the fruit fly, Drosophila Melanogaster.

  12. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-01-01

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  13. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.

    PubMed

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-02-15

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  14. ADP1 Affects Plant Architecture by Regulating Local Auxin Biosynthesis

    PubMed Central

    Li, Shibai; Qin, Genji; Novák, Ondřej; Pěnčík, Aleš; Ljung, Karin; Aoyama, Takashi; Liu, Jingjing; Murphy, Angus; Gu, Hongya; Tsuge, Tomohiko; Qu, Li-Jia

    2014-01-01

    Plant architecture is one of the key factors that affect plant survival and productivity. Plant body structure is established through the iterative initiation and outgrowth of lateral organs, which are derived from the shoot apical meristem and root apical meristem, after embryogenesis. Here we report that ADP1, a putative MATE (multidrug and toxic compound extrusion) transporter, plays an essential role in regulating lateral organ outgrowth, and thus in maintaining normal architecture of Arabidopsis. Elevated expression levels of ADP1 resulted in accelerated plant growth rate, and increased the numbers of axillary branches and flowers. Our molecular and genetic evidence demonstrated that the phenotypes of plants over-expressing ADP1 were caused by reduction of local auxin levels in the meristematic regions. We further discovered that this reduction was probably due to decreased levels of auxin biosynthesis in the local meristematic regions based on the measured reduction in IAA levels and the gene expression data. Simultaneous inactivation of ADP1 and its three closest homologs led to growth retardation, relative reduction of lateral organ number and slightly elevated auxin level. Our results indicated that ADP1-mediated regulation of the local auxin level in meristematic regions is an essential determinant for plant architecture maintenance by restraining the outgrowth of lateral organs. PMID:24391508

  15. ADP1 affects plant architecture by regulating local auxin biosynthesis.

    PubMed

    Li, Ruixi; Li, Jieru; Li, Shibai; Qin, Genji; Novák, Ondřej; Pěnčík, Aleš; Ljung, Karin; Aoyama, Takashi; Liu, Jingjing; Murphy, Angus; Gu, Hongya; Tsuge, Tomohiko; Qu, Li-Jia

    2014-01-01

    Plant architecture is one of the key factors that affect plant survival and productivity. Plant body structure is established through the iterative initiation and outgrowth of lateral organs, which are derived from the shoot apical meristem and root apical meristem, after embryogenesis. Here we report that ADP1, a putative MATE (multidrug and toxic compound extrusion) transporter, plays an essential role in regulating lateral organ outgrowth, and thus in maintaining normal architecture of Arabidopsis. Elevated expression levels of ADP1 resulted in accelerated plant growth rate, and increased the numbers of axillary branches and flowers. Our molecular and genetic evidence demonstrated that the phenotypes of plants over-expressing ADP1 were caused by reduction of local auxin levels in the meristematic regions. We further discovered that this reduction was probably due to decreased levels of auxin biosynthesis in the local meristematic regions based on the measured reduction in IAA levels and the gene expression data. Simultaneous inactivation of ADP1 and its three closest homologs led to growth retardation, relative reduction of lateral organ number and slightly elevated auxin level. Our results indicated that ADP1-mediated regulation of the local auxin level in meristematic regions is an essential determinant for plant architecture maintenance by restraining the outgrowth of lateral organs.

  16. Gene Regulation by Cytokinin in Arabidopsis

    PubMed Central

    Brenner, Wolfram G.; Ramireddy, Eswar; Heyl, Alexander; Schmülling, Thomas

    2011-01-01

    The plant hormone cytokinin realizes at least part of its signaling output through the regulation of gene expression. A great part of the early transcriptional regulation is mediated by type-B response regulators, which are transcription factors of the MYB family. Other transcription factors, such as the cytokinin response factors of the AP2/ERF family, have also been shown to be involved in this process. Additional transcription factors mediate distinct parts of the cytokinin response through tissue- and cell-specific downstream transcriptional cascades. In Arabidopsis, only a single cytokinin response element, to which type-B response regulators bind, has been clearly proven so far, which has 5′-GAT(T/C)-3′ as a core sequence. This motif has served to construct a synthetic cytokinin-sensitive two-component system response element, which is useful for monitoring the cellular cytokinin status. Insight into the extent of transcriptional regulation has been gained by genome-wide gene expression analyses following cytokinin treatment and from plants having an altered cytokinin content or signaling. This review presents a meta analysis of such microarray data resulting in a core list of cytokinin response genes. Genes encoding type-A response regulators displayed the most stable response to cytokinin, but a number of cytokinin metabolism genes (CKX4, CKX5, CYP735A2, UGT76C2) also belong to them, indicating homeostatic mechanisms operating at the transcriptional level. The cytokinin core response genes are also the target of other hormones as well as biotic and abiotic stresses, documenting crosstalk of the cytokinin system with other hormonal and environmental signaling pathways. The multiple links of cytokinin to diverse functions, ranging from control of meristem activity, hormonal crosstalk, nutrient acquisition, and various stress responses, are also corroborated by a compilation of genes that have been repeatedly found by independent gene expression profiling

  17. Major genes affecting ovulation rate in sheep

    PubMed Central

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection. PMID:15601592

  18. Major genes affecting ovulation rate in sheep.

    PubMed

    Davis, George Henry

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection.

  19. Regulation of gene expression by Goodwin's loop with many genes

    NASA Astrophysics Data System (ADS)

    Sielewiesiuk, Jan; Łopaciuk, Agata

    2012-01-01

    The paper presents a simple analysis of a long Goodwin's loop containing many genes. The genes form a closed series. The rate of transcription of any gene is up or down regulated by theprotein product of the preceding gene. We describe the loop with a system of ordinary differential equations of order s. Oscillatory solutions of the system are possible at the odd number of repressions and any number of inductions if the product of all Hill's coefficients, related to both repressions and inductions, is larger than:

  20. Let there be light: Regulation of gene expression in plants

    PubMed Central

    Petrillo, Ezequiel; Godoy Herz, Micaela A; Barta, Andrea; Kalyna, Maria; Kornblihtt, Alberto R

    2014-01-01

    Gene expression regulation relies on a variety of molecular mechanisms affecting different steps of a messenger RNA (mRNA) life: transcription, processing, splicing, alternative splicing, transport, translation, storage and decay. Light induces massive reprogramming of gene expression in plants. Differences in alternative splicing patterns in response to environmental stimuli suggest that alternative splicing plays an important role in plant adaptation to changing life conditions. In a recent publication, our laboratories showed that light regulates alternative splicing of a subset of Arabidopsis genes encoding proteins involved in RNA processing by chloroplast retrograde signals. The light effect on alternative splicing is also observed in roots when the communication with the photosynthetic tissues is not interrupted, suggesting that a signaling molecule travels through the plant. These results point at alternative splicing regulation by retrograde signals as an important mechanism for plant adaptation to their environment. PMID:25590224

  1. Polyamine analogues targeting epigenetic gene regulation.

    PubMed

    Huang, Yi; Marton, Laurence J; Woster, Patrick M; Casero, Robert A

    2009-11-04

    Over the past three decades the metabolism and functions of the polyamines have been actively pursued as targets for antineoplastic therapy. Interactions between cationic polyamines and negatively charged nucleic acids play a pivotal role in DNA stabilization and RNA processing that may affect gene expression, translation and protein activity. Our growing understanding of the unique roles that the polyamines play in chromatin regulation, and the discovery of novel proteins homologous with specific regulatory enzymes in polyamine metabolism, have led to our interest in exploring chromatin remodelling enzymes as potential therapeutic targets for specific polyamine analogues. One of our initial efforts focused on utilizing the strong affinity that the polyamines have for chromatin to create a backbone structure, which could be combined with active-site-directed inhibitor moieties of HDACs (histone deacetylases). Specific PAHAs (polyaminohydroxamic acids) and PABAs (polyaminobenzamides) polyamine analogues have demonstrated potent inhibition of the HDACs, re-expression of p21 and significant inhibition of tumour growth. A second means of targeting the chromatin-remodelling enzymes with polyamine analogues was facilitated by the recent identification of flavin-dependent LSD1 (lysine-specific demethylase 1). The existence of this enzyme demonstrated that histone lysine methylation is a dynamic process similar to other histone post-translational modifications. LSD1 specifically catalyses demethylation of mono- and di-methyl Lys4 of histone 3, key positive chromatin marks associated with transcriptional activation. Structural and catalytic similarities between LSD1 and polyamine oxidases facilitated the identification of biguanide, bisguanidine and oligoamine polyamine analogues that are potent inhibitors of LSD1. Cellular inhibition of LSD1 by these unique compounds led to the re-activation of multiple epigenetically silenced genes important in tumorigenesis. The use of

  2. Developmental regulation of embryonic genes in plants

    SciTech Connect

    Borkird, C.; Choi, Jung, H.; Jin, Zhenghua; Franz, G.; Hatzopoulos, P.; Chorneaus, R.; Bonas, U.; Pelegri, F.; Sung, Z.R.

    1988-09-01

    Somatic embryogenesis from cultured carrot cells progresses through successive morphogenetic stages termed globular, heart, and torpedo. To understand the molecular mechanisms underlying plant embryogenesis, the authors isolated two genes differentially expressed during embryo development. The expression of these two genes is associated with heart-stage embryogenesis. By altering the culture conditions and examining their expressions in a developmental variant cell line, they found that these genes were controlled by the developmental program of embryogenesis and were not directly regulated by 2,4-dichlorophenoxyacetic acid, the growth regulator that promotes unorganized growth of cultured cells and suppresses embryo morphogenesis. These genes are also expressed in carrot zygotic embryos but not in seedlings or mature plants.

  3. Following the affect: learning to observe emotional regulation.

    PubMed

    Delaney, Kathleen R

    2006-11-01

    On inpatient psychiatric units, staff deal with children and adolescents whose affect escalates quickly and intensely. These same children experience strong emotions that they can neither understand nor explain. To intervene effectively, inpatient staff must understand the regulation issues underneath the escalated behaviors. Emotion Regulation theory and the developmental line of emotional understanding are useful concepts in assessing and intervening with these children and adolescents. Presented here are criteria to guide inpatient staff's assessment of children and adolescents with emotion regulation difficulties. The assessment cues are based in concepts of Emotion Regulation and emotional understanding and are accompanied by suggested intervention strategies.

  4. The TRANSFAC system on gene expression regulation.

    PubMed

    Wingender, E; Chen, X; Fricke, E; Geffers, R; Hehl, R; Liebich, I; Krull, M; Matys, V; Michael, H; Ohnhäuser, R; Prüss, M; Schacherer, F; Thiele, S; Urbach, S

    2001-01-01

    The TRANSFAC database on transcription factors and their DNA-binding sites and profiles (http://www.gene-regulation.de/) has been quantitatively extended and supplemented by a number of modules. These modules give information about pathologically relevant mutations in regulatory regions and transcription factor genes (PathoDB), scaffold/matrix attached regions (S/MARt DB), signal transduction (TRANSPATH) and gene expression sources (CYTOMER). Altogether, these distinct database modules constitute the TRANSFAC system. They are accompanied by a number of program routines for identifying potential transcription factor binding sites or for localizing individual components in the regulatory network of a cell.

  5. Flexible parasympathetic responses to sadness facilitate spontaneous affect regulation.

    PubMed

    Stange, Jonathan P; Hamilton, Jessica L; Fresco, David M; Alloy, Lauren B

    2017-03-23

    The ability of the parasympathetic nervous system to flexibly adapt to changes in environmental context is thought to serve as a physiological indicator of self-regulatory capacity, and deficits in parasympathetic flexibility appear to characterize affective disorders such as depression. However, whether parasympathetic flexibility (vagal withdrawal to emotional or environmental challenges such as sadness, and vagal augmentation during recovery from sadness) could facilitate the effectiveness of adaptive affect regulation strategies is not known. In a study of 178 undergraduate students, we evaluated whether parasympathetic flexibility in response to a sad film involving loss would enhance the effectiveness of regulatory strategies (reappraisal, distraction, and suppression) spontaneously employed to reduce negative affect during a 2-min uninstructed recovery period following the induction. Parasympathetic reactivity and recovery were indexed by fluctuations in respiratory sinus arrhythmia and high-frequency heart rate variability. Cognitive reappraisal and distraction were more effective in attenuating negative affect among individuals with more parasympathetic flexibility, particularly greater vagal augmentation during recovery, relative to individuals with less parasympathetic flexibility. In contrast, suppression was associated with less attenuation of negative affect, but only among individuals who also had less vagal withdrawal during the sad film. Alternative models provided partial support for reversed directionality, with reappraisal predicting greater parasympathetic recovery, but only when individuals also experienced greater reductions in negative affect. These results suggest that contextually appropriate parasympathetic reactivity and recovery may facilitate the success of affect regulation. Impairments in parasympathetic flexibility could confer risk for affective disorders due to attenuated capacity for effective self-regulation.

  6. [Gene networks that regulate secondary metabolism in actinomycetes: pleiotropic regulators].

    PubMed

    Rabyk, M V; Ostash, B O; Fedorenko, V O

    2014-01-01

    Current advances in the research and practical applications of pleiotropic regulatory genes for antibiotic production in actinomycetes are reviewed. The basic regulatory mechanisms found in these bacteria are outlined. Examples described in the review show the importance of the manipulation of regulatory systems that affect the synthesis of antibiotics for the metabolic engineering of the actinomycetes. Also, the study of these genes is the basis for the development of genetic engineering approaches towards the induction of "cryptic" part of the actinomycetes secondary metabolome, which capacity for production of biologically active compounds is much bigger than the diversity of antibiotics underpinned by traditional microbiological screening. Besides the practical problems, the study of regulatory genes for antibiotic biosynthesis will provide insights into the process of evolution of complex regulatory systems that coordinate the expression of gene operons, clusters and regulons, involved in the control of secondary metabolism and morphogenesis of actinomycetes.

  7. Regulation of erythroid cell-specific gene expression during erythropoiesis.

    PubMed Central

    Harrison, P. R.; Plumb, M.; Frampton, J.; Llewellyn, D.; Chester, J.; Chambers, I.; MacLeod, K.; Fleming, J.; O'Prey, J.; Walker, M.

    1988-01-01

    The aim of our group's work over the past few years has been to investigate the molecular mechanisms regulating erythroid cell-specific gene expression during erythroid cell differentiation. In addition to the alpha-globin gene, we have focussed on two non-globin genes of interest encoding the rabbit red cell-specific lipoxygenase (LOX) and the mouse glutathione peroxidase (GSHPX), an important seleno-enzyme responsible for protection against peroxide-damage. Characterisation of the GSHPX gene showed that the seleno-cysteine residue in the active site of the enzyme is encoded by UGA, which usually functions as a translation-termination codon. This novel finding has important implications regarding mRNA sequence context effects affecting codon recognition. The regulation of the GSHPX and red cell LOX genes has been investigated by functional transfection experiments. The 700 bp upstream of the GSHPX promoter seems to function equally well when linked to the bacterial chloramphenicol acetyl transferase (CAT) gene and transfected into mouse erythroid or fibroblast cell lines. However, the presence of tissue-specific DNase I hypersensitive sites (DHSS) in the 3' flanking region of the GSHPX gene suggests that such sites may be important in its regulation in the various cell types in which it is highly expressed, i.e., erythroid cells, liver and kidney. The transcription unit of the RBC LOX gene has also been defined and 5' and 3' flanking regions are being investigated for erythroid-specific regulatory elements: a region upstream of the LOX gene gives increased expression of a linked CAT gene when transfected into mouse erythroid cell lines compared to non-erythroid cell lines.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3151147

  8. Methods of Combinatorial Optimization to Reveal Factors Affecting Gene Length

    PubMed Central

    Bolshoy, Alexander; Tatarinova, Tatiana

    2012-01-01

    In this paper we present a novel method for genome ranking according to gene lengths. The main outcomes described in this paper are the following: the formulation of the genome ranking problem, presentation of relevant approaches to solve it, and the demonstration of preliminary results from prokaryotic genomes ordering. Using a subset of prokaryotic genomes, we attempted to uncover factors affecting gene length. We have demonstrated that hyperthermophilic species have shorter genes as compared with mesophilic organisms, which probably means that environmental factors affect gene length. Moreover, these preliminary results show that environmental factors group together in ranking evolutionary distant species. PMID:23300345

  9. Methods of combinatorial optimization to reveal factors affecting gene length.

    PubMed

    Bolshoy, Alexander; Tatarinova, Tatiana

    2012-01-01

    In this paper we present a novel method for genome ranking according to gene lengths. The main outcomes described in this paper are the following: the formulation of the genome ranking problem, presentation of relevant approaches to solve it, and the demonstration of preliminary results from prokaryotic genomes ordering. Using a subset of prokaryotic genomes, we attempted to uncover factors affecting gene length. We have demonstrated that hyperthermophilic species have shorter genes as compared with mesophilic organisms, which probably means that environmental factors affect gene length. Moreover, these preliminary results show that environmental factors group together in ranking evolutionary distant species.

  10. Chemically regulated gene expression in plants.

    PubMed

    Padidam, Malla

    2003-04-01

    Chemically inducible systems that activate or inactivate gene expression have many potential applications in the determination of gene function and in plant biotechnology. The precise timing and control of gene expression are important aspects of chemically inducible systems. Several systems have been developed and used to analyze gene function, marker-free plant transformation, site-specific DNA excision, activation tagging, conditional genetic complementation, and restoration of male fertility. Chemicals that are used to regulate transgene expression include the antibiotic tetracycline, the steroids dexamethasone and estradiol, copper, ethanol, the inducer of pathogen-related proteins benzothiadiazol, herbicide safeners, and the insecticide methoxyfenozide. Systems that are suitable for field application are particularly useful for experimental systems and have potential applications in biotechnology.

  11. Regulation of Gene Expression in Protozoa Parasites

    PubMed Central

    Gomez, Consuelo; Esther Ramirez, M.; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A.

    2010-01-01

    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis. PMID:20204171

  12. GENE REGULATION BY MAPK SUBSTRATE COMPETITION

    PubMed Central

    Kim, Yoosik; Andreu, María José; Lim, Bomyi; Chung, Kwanghun; Terayama, Mark; Jiménez, Gerardo; Berg, Celeste A.; Lu, Hang; Shvartsman, Stanislav Y.

    2011-01-01

    SUMMARY Developing tissues are patterned by coordinated activities of signaling systems, which can be integrated by a regulatory region of a gene that binds multiple transcription factors or by a transcription factor that is modified by multiple enzymes. Based on a combination of genetic and imaging experiments in the early Drosophila embryo, we describe a signal integration mechanism that cannot be reduced to a single gene regulatory element or a single transcription factor. This mechanism relies on an enzymatic network formed by Mitogen Activated Protein Kinase (MAPK) and its substrates. Specifically, anteriorly localized MAPK substrates, such as Bicoid, antagonize MAPK-dependent downregulation of Capicua, a repressor which is involved in gene regulation along the dorsoventral axis of the embryo. MAPK substrate competition provides a basis for ternary interaction of the anterior, dorsoventral, and terminal patterning systems. A mathematical model of this interaction can explain gene expression patterns with both anteroposterior and dorsoventral polarities. PMID:21664584

  13. Early postnatal feed restriction reduces liver connective tissue levels and affects H3K9 acetylation state of regulated genes associated with protein metabolism in low birth weight pigs.

    PubMed

    Nebendahl, Constance; Görs, Solvig; Albrecht, Elke; Krüger, Ricarda; Martens, Karen; Giller, Katrin; Hammon, Harald M; Rimbach, Gerald; Metges, Cornelia C

    2016-03-01

    Intrauterine growth retardation is associated with metabolic consequences in adulthood. Since our previous data indicate birth weight-dependent effects of feed restriction (R) on protein degradation processes in the liver, it should be investigated whether effects on connective tissue turnover are obvious and could be explained by global changes of histone H3K9me3 and H3K9ac states in regulated genes. For this purpose, female littermate pigs with low (U) or normal (N) birth weight were subjected to 3-week R (60% of ad libitum fed controls) with subsequent refeeding (REF) for further 5 weeks. The 3-week R-period induced a significant reduction of connective tissue area by 43% in the liver of U animals at 98 d of age, which was not found in age-matched N animals. Of note, after REF at 131 d of age, in previously feed-restricted U animals (UR), the percentage of mean connective tissue was only 53% of ad libitum fed controls (UK), indicating a persistent effect. In U animals, R induced H3K9 acetylation of regulated genes (e.g. XBP1, ERLEC1, GALNT2, PTRH2), which were inter alia associated with protein metabolism. In contrast, REF was mostly accompanied by deacetylation in U and N animals. Thus, our epigenetic data may give a first explanation for the observed birth weight-dependent differences in this connective tissue phenotype.

  14. Gene expression regulation in roots under drought.

    PubMed

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona

    2016-02-01

    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots.

  15. Regulation of Airway Mucin Gene Expression

    PubMed Central

    Thai, Philip; Loukoianov, Artem; Wachi, Shinichiro; Wu, Reen

    2015-01-01

    Mucins are important components that exert a variety of functions in cell-cell interaction, epidermal growth factor receptor signaling, and airways protection. In the conducting airways of the lungs, mucins are the major contributor to the viscoelastic property of mucous secretion, which is the major barrier to trapping inhaled microbial organism, particulates, and oxidative pollutants. The homeostasis of mucin production is an important feature in conducting airways for the maintenance of mucociliary function. Aberrant mucin secretion and accumulation in airway lumen are clinical hallmarks associated with various lung diseases, such as asthma, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, and lung cancer. Among 20 known mucin genes identified, 11 of them have been verified at either the mRNA and/or protein level in airways. The regulation of mucin genes is complicated, as are the mediators and signaling pathways. This review summarizes the current view on the mediators, the signaling pathways, and the transcriptional units that are involved in the regulation of airway mucin gene expression. In addition, we also point out essential features of epigenetic mechanisms for the regulation of these genes. PMID:17961085

  16. Transposable element origins of epigenetic gene regulation.

    PubMed

    Lisch, Damon; Bennetzen, Jeffrey L

    2011-04-01

    Transposable elements (TEs) are massively abundant and unstable in all plant genomes, but are mostly silent because of epigenetic suppression. Because all known epigenetic pathways act on all TEs, it is likely that the specialized epigenetic regulation of regular host genes (RHGs) was co-opted from this ubiquitous need for the silencing of TEs and viruses. With their internally repetitive and rearranging structures, and the acquisition of fragments of RHGs, the expression of TEs commonly makes antisense RNAs for both TE genes and RHGs. These antisense RNAs, particularly from heterochromatic reservoirs of 'zombie' TEs that are rearranged to form variously internally repetitive structures, may be advantageous because their induction will help rapidly suppress active TEs of the same family. RHG fragments within rapidly rearranging TEs may also provide the raw material for the ongoing generation of miRNA genes. TE gene expression is regulated by both environmental and developmental signals, and insertions can place nearby RHGs under the regulation (both standard and epigenetic) of the TE. The ubiquity of TEs, their frequent preferential association with RHGs, and their ability to be programmed by epigenetic signals all indicate that RGHs have nearly unlimited access to novel regulatory cassettes to assist plant adaptation.

  17. How the Neanderthal in Your Genes Affects Your Health

    MedlinePlus

    ... medlineplus.gov/news/fullstory_163749.html How the Neanderthal in Your Genes Affects Your Health The DNA ... 23, 2017 THURSDAY, Feb. 23, 2017 (HealthDay News) -- Neanderthals were wiped out about 40,000 years ago, ...

  18. Gene regulation and speciation in house mice

    PubMed Central

    Mack, Katya L.; Campbell, Polly; Nachman, Michael W.

    2016-01-01

    One approach to understanding the process of speciation is to characterize the genetic architecture of post-zygotic isolation. As gene regulation requires interactions between loci, negative epistatic interactions between divergent regulatory elements might underlie hybrid incompatibilities and contribute to reproductive isolation. Here, we take advantage of a cross between house mouse subspecies, where hybrid dysfunction is largely unidirectional, to test several key predictions about regulatory divergence and reproductive isolation. Regulatory divergence between Mus musculus musculus and M. m. domesticus was characterized by studying allele-specific expression in fertile hybrid males using mRNA-sequencing of whole testes. We found extensive regulatory divergence between M. m. musculus and M. m. domesticus, largely attributable to cis-regulatory changes. When both cis and trans changes occurred, they were observed in opposition much more often than expected under a neutral model, providing strong evidence of widespread compensatory evolution. We also found evidence for lineage-specific positive selection on a subset of genes related to transcriptional regulation. Comparisons of fertile and sterile hybrid males identified a set of genes that were uniquely misexpressed in sterile individuals. Lastly, we discovered a nonrandom association between these genes and genes showing evidence of compensatory evolution, consistent with the idea that regulatory interactions might contribute to Dobzhansky-Muller incompatibilities and be important in speciation. PMID:26833790

  19. Metabolic regulation and gene expression during aestivation.

    PubMed

    Storey, Kenneth B; Storey, Janet M

    2010-01-01

    The biochemical regulation of aestivation, a state of aerobic hypometabolism, achieves actions including strong overall suppression of metabolic rate, reprioritization of energy use by diverse cell functions, and enhancement of defenses such as protein chaperones and antioxidants that aid long-term life extension. This is accomplished by mechanisms that include differential action of intracellular signaling cascades, reversible protein phosphorylation to alter the activity states of multiple enzymes and functional proteins, global suppression of transcription and translation, and selective gene upregulation. Recent advances in understanding the regulation of aestivation are discussed with a particular emphasis on land snail and anuran models.

  20. Darkness affects differentially the expression of plastid-encoded genes and delays the senescence-induced down-regulation of chloroplast transcription in cotyledons of Cucurbita pepo L. (Zucchini).

    PubMed

    Mishev, Kiril; Dimitrova, Anna; Ananiev, Evguéni D

    2011-01-01

    In contrast to differentiated leaves, the regulatory mechanisms of chloroplast gene expression in darkened cotyledons have not been elucidated. Although some results have been reported indicating accelerated senescence in Arabidopsis upon reillumination, the capacity of cotyledons to recover after dark stress remains unclear. We analysed the effect of two-days dark stress, applied locally or at the whole-plant level, on plastid gene expression in zucchini cotyledons. Our results showed that in the dark the overall chloroplast transcription rate was much more inhibited than the nuclear run-on transcription. While the activities of the plastid-encoded RNA polymerase (PEP) and nuclear RNA polymerase II were strongly reduced, the activities of the nuclear-encoded plastid RNA polymerase (NEP) and nuclear RNA polymerase I were less affected. During recovery upon reillumination, chloroplast transcription in the cotyledons was strongly stimulated (3-fold) compared with the naturally senescing controls, suggesting delayed senescence. Northern blot and dot blot analyses of the expression of key chloroplast-encoded photosynthetic genes showed that in contrast to psbA, which remained almost unaffected, both the transcription rate and mRNA content of psaB and rbcL were substantially decreased.

  1. Regulatory network controlling extracellular proteins in Erwinia carotovora subsp. carotovora: FlhDC, the master regulator of flagellar genes, activates rsmB regulatory RNA production by affecting gacA and hexA (lrhA) expression.

    PubMed

    Cui, Yaya; Chatterjee, Asita; Yang, Hailian; Chatterjee, Arun K

    2008-07-01

    Erwinia carotovora subsp. carotovora produces an array of extracellular proteins (i.e., exoproteins), including plant cell wall-degrading enzymes and Harpin, an effector responsible for eliciting hypersensitive reaction. Exoprotein genes are coregulated by the quorum-sensing signal, N-acyl homoserine lactone, plant signals, an assortment of transcriptional factors/regulators (GacS/A, ExpR1, ExpR2, KdgR, RpoS, HexA, and RsmC) and posttranscriptional regulators (RsmA, rsmB RNA). rsmB RNA production is positively regulated by GacS/A, a two-component system, and negatively regulated by HexA (PecT in Erwinia chrysanthemi; LrhA [LysR homolog A] in Escherichia coli) and RsmC, a putative transcriptional adaptor. While free RsmA, an RNA-binding protein, promotes decay of mRNAs of exoprotein genes, binding of RsmA with rsmB RNA neutralizes the RsmA effect. In the course of studies of GacA regulation, we discovered that a locus bearing strong homology to the flhDC operon of E. coli also controls extracellular enzyme production. A transposon insertion FlhDC(-) mutant produces very low levels of pectate lyase, polygalacturonase, cellulase, protease, and E. carotovora subsp. carotovora Harpin (Harpin(Ecc)) and is severely attenuated in its plant virulence. The production of these exoproteins is restored in the mutant carrying an FlhDC(+) plasmid. Sequence analysis and transcript assays disclosed that the flhD operon of E. carotovora subsp. carotovora, like those of other enterobacteria, consists of flhD and flhC. Complementation analysis revealed that the regulatory effect requires functions of both flhD and flhC products. The data presented here show that FlhDC positively regulates gacA, rsmC, and fliA and negatively regulates hexA (lrhA). Evidence shows that FlhDC controls extracellular protein production through cumulative effects on hexA and gacA. Reduced levels of GacA and elevated levels of HexA in the FlhDC(-) mutant are responsible for the inhibition of rsmB RNA

  2. Pathway-specific regulation revisited: cross-regulation of multiple disparate gene clusters by PAS-LuxR transcriptional regulators.

    PubMed

    Vicente, Cláudia M; Payero, Tamara D; Santos-Aberturas, Javier; Barreales, Eva G; de Pedro, Antonio; Aparicio, Jesús F

    2015-06-01

    PAS-LuxR regulators are highly conserved proteins devoted to the control of antifungal production by binding to operators located in given promoters of polyene biosynthetic genes. The canonical operator of PimM, archetype of this class of regulators, has been used here to search for putative targets of orthologous protein PteF in the genome of Streptomyces avermitilis, finding 97 putative operators outside the pentaene filipin gene cluster (pte). The processes putatively affected included genetic information processing; energy, carbohydrate, and lipid metabolism; DNA replication and repair; morphological differentiation; secondary metabolite biosynthesis; and transcriptional regulation, among others. Seventeen of these operators were selected, and their binding to PimM DNA-binding domain was assessed by electrophoretic mobility shift assays. Strikingly, the protein bound all predicted operators suggesting a direct control over targeted processes. As a proof of concept, we studied the biosynthesis of the ATP-synthase inhibitor oligomycin whose gene cluster included two operators. Regulator mutants showed a severe loss of oligomycin production, whereas gene complementation of the mutant restored phenotype, and gene duplication in the wild-type strain boosted oligomycin production. Comparative gene expression analyses in parental and mutant strains by reverse transcription-quantitative polymerase chain reaction of selected olm genes corroborated production results. These results demonstrate that PteF is able to cross-regulate the biosynthesis of two related secondary metabolites, filipin and oligomycin, but might be extended to all the processes indicated above. This study highlights the complexity of the network of interactions in which PAS-LuxR regulators are involved and opens new possibilities for the manipulation of metabolite production in Streptomycetes.

  3. Gravity-regulated gene expression in Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  4. Gene regulation by dietary microRNAs1

    PubMed Central

    Zempleni, Janos; Baier, Scott R.; Howard, Katherine M.; Cui, Juan

    2016-01-01

    MicroRNAs (miRNAs) silence genes through destabilizing mRNA or preventing translation of mRNA, thereby playing an essential role in gene silencing. Traditionally, miRNAs have been considered endogenous regulators of genes, i.e., miRNAs synthesized by an organism regulate the genes in that organism. Recently, that dogma has been challenged in studies suggesting that food-borne miRNAs are bioavailable and affect gene expression in mice and humans. While the evidence in support of this theory may be considered weak for miRNAs that originate in plants, there is compelling evidence to suggest that humans use bovine miRNAs in cow’s milk and avian miRNAs in chicken eggs for gene regulation. Importantly, evidence also suggests that mice fed a miRNA-depleted diet cannot compensate for dietary depletion by increased endogenous synthesis. Bioinformatics predictions implicate bovine miRNAs in the regulation of genes that play roles in human health and development. Current challenges in this area of research include that some miRNAs are unable to establish a cause-and-effect between miRNA depletion and disease in miRNA knockout mice, and sequence similarities and identities for bovine and human miRNAs render it difficult to distinguish between exogenous and endogenous miRNAs. Based on what is currently known about dietary miRNAs, the body of evidence appears to be sufficient to consider milk miRNA bioactive compounds in foods, and to increase research activities in this field. PMID:26222444

  5. Regulation of methane genes and genome expression

    SciTech Connect

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  6. Gene regulation by phosphate in enteric bacteria.

    PubMed

    Wanner, B L

    1993-01-01

    The Escherichia coli phosphate (PHO) regulon includes 31 (or more) genes arranged in eight separate operons. All are coregulated by environmental (extra-cellular) phosphate and are probably involved in phosphorus assimilation. Pi control of these genes requires the sensor PhoR, the response regulator PhoB, the binding protein-dependent Pi-specific transporter Pst, and the accessory protein PhoU. During Pi limitation, PhoR turns on genes of the PHO regulon by phosphorylating PhoB that in turn activates transcription by binding to promoters that share an 18-base consensus PHO Box. When Pi is in excess, PhoR, Pst, and PhoU together turn off the PHO regulon, presumably by dephosphorylating PhoB. In addition, two Pi-independent controls that may be forms of cross regulation turn on the PHO regulon in the absence of PhoR. The sensor CreC, formerly called PhoM, phosphorylates PhoB in response to some (unknown) catabolite, while acetyl phosphate may directly phosphorylate PhoB. Cross regulation of the PHO regulon by CreC and acetyl phosphate may be examples of underlying control mechanisms important for the general (global) control of cell growth and metabolism.

  7. Identification of novel TCDD-regulated genes by microarray analysis

    SciTech Connect

    Hanlon, Paul R.; Zheng, Wenchao; Ko, Alex Y.; Jefcoate, Colin R. . E-mail: jefcoate@facstaff.wisc.edu

    2005-02-01

    TCDD exposure of multipotential C3H10T1/2 fibroblasts for 72 h altered the expression of over 1000 genes, including coordinated changes across large functionally similar gene clusters. TCDD coordinately induced 23 cell cycle-related genes similar to epidermal growth factor (EGF)-induced levels but without any affect on the major mitogenic signaling pathway (extracellular signal-regulated kinase, ERK). TCDD treatment also decreased glycolytic and ribosomal clusters. Most of these TCDD-induced changes were attenuated by the presence of EGF or an adipogenic stimulus, each added during the final 24 h. TCDD prevented 10% of EGF-induced gene responses and 40% of adipogenic responses. Over 100 other genes responded to TCDD during adipogenesis. This group of responses included complete suppression of three proliferins and stimulations of several cytokine receptors. Despite these varied secondary effects of TCDD, direct AhR activation measured by integrated AhR-responsive luciferase reporters was similar under quiescent, EGF-stimulated or adipogenic conditions. Only 23 genes were similarly induced by TCDD regardless of conditions and 10 were suppressed. These 23 genes include: 4 genes previously recognized to contain AhR response elements (cytochrome P450 (CYP) 1B1, CYP1A1, NAD(P)H quinone reductase 1 (NQO1), and aldehyde dehydrogenase 3A1); two novel oxidative genes (alcohol dehydrogenase 3 and superoxide dismutase 3); and glypican 1, a plasma membrane proteoglycan that affects cell signaling. Further experiments demonstrated that TCDD maximally induced NQO1, glypican 1 and alcohol dehydrogenase 3 by 6 h. Glypican 1 activates the actions of many growth factors and therefore may contribute to secondary effects on gene expression.

  8. Compassion-based emotion regulation up-regulates experienced positive affect and associated neural networks

    PubMed Central

    Singer, Tania

    2015-01-01

    Emotion regulation research has primarily focused on techniques that attenuate or modulate the impact of emotional stimuli. Recent evidence suggests that this mode regulation can be problematic in the context of regulation of emotion elicited by the suffering of others, resulting in reduced emotional connectedness. Here, we investigated the effects of an alternative emotion regulation technique based on the up-regulation of positive affect via Compassion-meditation on experiential and neural affective responses to depictions of individuals in distress, and compared these with the established emotion regulation strategy of Reappraisal. Using fMRI, we scanned 15 expert practitioners of Compassion-meditation either passively viewing, or using Compassion-meditation or Reappraisal to modulate their emotional reactions to film clips depicting people in distress. Both strategies effectively, but differentially regulated experienced affect, with Compassion primarily increasing positive and Reappraisal primarily decreasing negative affect. Imaging results showed that Compassion, relative to both passive-viewing and Reappraisal increased activation in regions involved in affiliation, positive affect and reward processing including ventral striatum and medial orbitfrontal cortex. This network was shown to be active prior to stimulus presentation, suggesting that the regulatory mechanism of Compassion is the stimulus-independent endogenous generation of positive affect. PMID:25698699

  9. Compassion-based emotion regulation up-regulates experienced positive affect and associated neural networks.

    PubMed

    Engen, Haakon G; Singer, Tania

    2015-09-01

    Emotion regulation research has primarily focused on techniques that attenuate or modulate the impact of emotional stimuli. Recent evidence suggests that this mode regulation can be problematic in the context of regulation of emotion elicited by the suffering of others, resulting in reduced emotional connectedness. Here, we investigated the effects of an alternative emotion regulation technique based on the up-regulation of positive affect via Compassion-meditation on experiential and neural affective responses to depictions of individuals in distress, and compared these with the established emotion regulation strategy of Reappraisal. Using fMRI, we scanned 15 expert practitioners of Compassion-meditation either passively viewing, or using Compassion-meditation or Reappraisal to modulate their emotional reactions to film clips depicting people in distress. Both strategies effectively, but differentially regulated experienced affect, with Compassion primarily increasing positive and Reappraisal primarily decreasing negative affect. Imaging results showed that Compassion, relative to both passive-viewing and Reappraisal increased activation in regions involved in affiliation, positive affect and reward processing including ventral striatum and medial orbitfrontal cortex. This network was shown to be active prior to stimulus presentation, suggesting that the regulatory mechanism of Compassion is the stimulus-independent endogenous generation of positive affect.

  10. Gene therapy on demand: site specific regulation of gene therapy.

    PubMed

    Jazwa, Agnieszka; Florczyk, Urszula; Jozkowicz, Alicja; Dulak, Jozef

    2013-08-10

    Since 1990 when the first clinical gene therapy trial was conducted, much attention and considerable promise have been given to this form of treatment. Gene therapy has been used with success in patients suffering from severe combined immunodeficiency syndromes (X-SCID and ADA-deficiency), Leber's congenital amaurosis, hemophilia, β-thalassemia and adrenoleukodystrophy. Last year, the first therapeutic vector (Glybera) for treatment of lipoprotein lipase deficiency has been registered in the European Union. Nevertheless, there are still several numerous issues that need to be improved to make this technique more safe, effective and easily accessible for patients. Introduction of the therapeutic gene to the given cells should provide the level of expression which will restore the production of therapeutic protein to normal values or will provide therapeutic efficacy despite not fully physiological expression. However, in numerous diseases the expression of therapeutic genes has to be kept at certain level for some time, and then might be required to be switched off to be activated again when worsening of the symptoms may aggravate the risk of disease relapse. In such cases the promoters which are regulated by local conditions may be more required. In this article the special emphasis is to discuss the strategies of regulation of gene expression by endogenous stimuli. Particularly, the hypoxia- or miRNA-regulated vectors offer the possibilities of tight but, at the same time, condition-dependent and cell-specific expression. Such means have been already tested in certain pathophysiological conditions. This creates the chance for the translational approaches required for development of effective treatments of so far incurable diseases.

  11. Genes regulating touch cell development in Caenorhabditis elegans.

    PubMed Central

    Du, H; Chalfie, M

    2001-01-01

    To identify genes regulating the development of the six touch receptor neurons, we screened the F(2) progeny of mutated animals expressing an integrated mec-2::gfp transgene that is expressed mainly in these touch cells. From 2638 mutated haploid genomes, we obtained 11 mutations representing 11 genes that affected the production, migration, or outgrowth of the touch cells. Eight of these mutations were in known genes, and 2 defined new genes (mig-21 and vab-15). The mig-21 mutation is the first known to affect the asymmetry of the migrations of Q neuroblasts, the cells that give rise to two of the six touch cells. vab-15 is a msh-like homeobox gene that appears to be needed for the proper production of touch cell precursors, since vab-15 animals lacked the four more posterior touch cells. The remaining touch cells (the ALM cells) were present but mispositioned. A similar touch cell phenotype is produced by mutations in lin-32. A more severe phenotype; i.e., animals often lacked ALM cells, was seen in lin-32 vab-15 double mutants, suggesting that these genes acted redundantly in ALM differentiation. In addition to the touch cell abnormalities, vab-15 animals variably exhibit embryonic or larval lethality, cell degenerations, malformation of the posterior body, uncoordinated movement, and defective egg laying. PMID:11333230

  12. Gene and genon concept: coding versus regulation

    PubMed Central

    2007-01-01

    We analyse here the definition of the gene in order to distinguish, on the basis of modern insight in molecular biology, what the gene is coding for, namely a specific polypeptide, and how its expression is realized and controlled. Before the coding role of the DNA was discovered, a gene was identified with a specific phenotypic trait, from Mendel through Morgan up to Benzer. Subsequently, however, molecular biologists ventured to define a gene at the level of the DNA sequence in terms of coding. As is becoming ever more evident, the relations between information stored at DNA level and functional products are very intricate, and the regulatory aspects are as important and essential as the information coding for products. This approach led, thus, to a conceptual hybrid that confused coding, regulation and functional aspects. In this essay, we develop a definition of the gene that once again starts from the functional aspect. A cellular function can be represented by a polypeptide or an RNA. In the case of the polypeptide, its biochemical identity is determined by the mRNA prior to translation, and that is where we locate the gene. The steps from specific, but possibly separated sequence fragments at DNA level to that final mRNA then can be analysed in terms of regulation. For that purpose, we coin the new term “genon”. In that manner, we can clearly separate product and regulative information while keeping the fundamental relation between coding and function without the need to introduce a conceptual hybrid. In mRNA, the program regulating the expression of a gene is superimposed onto and added to the coding sequence in cis - we call it the genon. The complementary external control of a given mRNA by trans-acting factors is incorporated in its transgenon. A consequence of this definition is that, in eukaryotes, the gene is, in most cases, not yet present at DNA level. Rather, it is assembled by RNA processing, including differential splicing, from various

  13. A parasitic selfish gene that affects host promiscuity.

    PubMed

    Giraldo-Perez, Paulina; Goddard, Matthew R

    2013-11-07

    Selfish genes demonstrate transmission bias and invade sexual populations despite conferring no benefit to their hosts. While the molecular genetics and evolutionary dynamics of selfish genes are reasonably well characterized, their effects on hosts are not. Homing endonuclease genes (HEGs) are one well-studied family of selfish genes that are assumed to be benign. However, we show that carrying HEGs is costly for Saccharomyces cerevisiae, demonstrating that these genetic elements are not necessarily benign but maybe parasitic. We estimate a selective load of approximately 1-2% in 'natural' niches. The second aspect we examine is the ability of HEGs to affect hosts' sexual behaviour. As all selfish genes critically rely on sex for spread, then any selfish gene correlated with increased host sexuality will enjoy a transmission advantage. While classic parasites are known to manipulate host behaviour, we are not aware of any evidence showing a selfish gene is capable of affecting host promiscuity. The data presented here show a selfish element may increase the propensity of its eukaryote host to undergo sex and along with increased rates of non-Mendelian inheritance, this may counterbalance mitotic selective load and promote spread. Demonstration that selfish genes are correlated with increased promiscuity in eukaryotes connects with ideas suggesting that selfish genes promoted the evolution of sex initially.

  14. Intron retention-dependent gene regulation in Cryptococcus neoformans

    PubMed Central

    Gonzalez-Hilarion, Sara; Paulet, Damien; Lee, Kyung-Tae; Hon, Chung-Chau; Lechat, Pierre; Mogensen, Estelle; Moyrand, Frédérique; Proux, Caroline; Barboux, Rony; Bussotti, Giovanni; Hwang, Jungwook; Coppée, Jean-Yves; Bahn, Yong-Sun; Janbon, Guilhem

    2016-01-01

    The biological impact of alternative splicing is poorly understood in fungi, although recent studies have shown that these microorganisms are usually intron-rich. In this study, we re-annotated the genome of C. neoformans var. neoformans using RNA-Seq data. Comparison with C. neoformans var. grubii revealed that more than 99% of ORF-introns are in the same exact position in the two varieties whereas UTR-introns are much less evolutionary conserved. We also confirmed that alternative splicing is very common in C. neoformans, affecting nearly all expressed genes. We also observed specific regulation of alternative splicing by environmental cues in this yeast. However, alternative splicing does not appear to be an efficient method to diversify the C. neoformans proteome. Instead, our data suggest the existence of an intron retention-dependent mechanism of gene expression regulation that is not dependent on NMD. This regulatory process represents an additional layer of gene expression regulation in fungi and provides a mechanism to tune gene expression levels in response to any environmental modification. PMID:27577684

  15. Quantitative characterization of gene regulation by Rho dependent transcription termination.

    PubMed

    Hussein, Razika; Lee, Tiffany Y; Lim, Han N

    2015-08-01

    Rho factor dependent transcription termination (RTT) is common within the coding sequences of bacterial genes and it acts to couple transcription and translation levels. Despite the importance of RTT for gene regulation, its effects on mRNA and protein concentrations have not been quantitatively characterized. Here we demonstrate that the exogenous cfp gene encoding the cyan fluorescent protein can serve as a model for gene regulation by RTT. This was confirmed by showing that Psu and bicyclomycin decrease RTT and increase full length cfp mRNAs (but remarkably they have little effect on protein production). We then use cfp to characterize the relationship between its protein and full length mRNA concentrations when the translation initiation rate is varied by sequence modifications of the translation initiation region (TIR). These experiments reveal that the fold change in protein concentration (RP) and the fold change in full length mRNA concentration (Rm) have the relationship RP≈Rm(b), where b is a constant. The average value of b was determined from three separate data sets to be ~3.6. We demonstrate that the above power law function can predict how altering the translation initiation rate of a gene in an operon will affect the mRNA concentrations of downstream genes and specify a lower bound for the associated changes in protein concentrations. In summary, this study defines a simple phenomenological model to help program expression from single genes and operons that are regulated by RTT, and to guide molecular models of RTT.

  16. Goal regulation across time: the effects of feedback and affect.

    PubMed

    Ilies, Remus; Judge, Timothy A

    2005-05-01

    This research focused on the processes individuals use to regulate their goals across time. Two studies examined goal regulation following task performance with 6 samples of participants in a series of 8-trial task performance experiments. The experiments involved: (a) 3 task types, (b) 2 goal types, and (c) actual or manipulated performance feedback referring to the focal participant's own performance or to the participant's performance compared with others' performance. Applying multilevel methods, the authors examined (a) how performance feedback influences subsequent goals within individuals across both negative and positive performance feedback ranges, and (b) the mediating role of affect in explaining the relationship between feedback and subsequent goal setting. Results showed that participants adjusted their goals downwardly following negative feedback and created positive goal-performance discrepancies by raising their goals following positive feedback. In each sample, affect mediated substantial proportions of the feedback-goals relationship within individuals.

  17. Regulation of Calreticulin Gene Expression by Calcium

    PubMed Central

    Waser, Mathilde; Mesaeli, Nasrin; Spencer, Charlotte; Michalak, Marek

    1997-01-01

    We have isolated and characterized a 12-kb mouse genomic DNA fragment containing the entire calreticulin gene and 2.14 kb of the promoter region. The mouse calreticulin gene consists of nine exons and eight introns, and it spans 4.2 kb of genomic DNA. A 1.8-kb fragment of the calreticulin promoter was subcloned into a reporter gene plasmid containing chloramphenicol acetyltransferase. This construct was then used in transient and stable transfection of NIH/ 3T3 cells. Treatment of transfected cells either with the Ca2+ ionophore A23187, or with the ER Ca2+-ATPase inhibitor thapsigargin, resulted in a five- to sevenfold increase of the expression of chloramphenicol acetyltransferase protein. Transactivation of the calreticulin promoter was also increased by fourfold in NIH/3T3 cells treated with bradykinin, a hormone that induces Ca2+ release from the intracellular Ca2+ stores. Analysis of the promoter deletion constructs revealed that A23187- and thapsigargin-responsive regions are confined to two regions (−115 to −260 and −685 to −1,763) in the calreticulin promoter that contain the CCAAT nucleotide sequences. Northern blot analysis of cells treated with A23187, or with thapsigargin, revealed a fivefold increase in calreticulin mRNA levels. Thapsigargin also induced a fourfold increase in calreticulun protein levels. Importantly, we show by nuclear run-on transcription analysis that calreticulin gene transcription is increased in NIH/3T3 cells treated with A23187 and thapsigargin in vivo. This increase in gene expression required over 4 h of continuous incubation with the drugs and was also sensitive to treatment with cycloheximide, suggesting that it is dependent on protein synthesis. Changes in the concentration of extracellular and cytoplasmic Ca2+ did not affect the increased expression of the calreticulin gene. These studies suggest that stress response to the depletion of intracellular Ca2+ stores induces expression of the calreticulin gene in vitro

  18. Leucine metabolism regulates TRI6 expression and affects deoxynivalenol production and virulence in Fusarium graminearum.

    PubMed

    Subramaniam, Rajagopal; Narayanan, Swara; Walkowiak, Sean; Wang, Li; Joshi, Manisha; Rocheleau, Hélène; Ouellet, Thérèse; Harris, Linda J

    2015-11-01

    TRI6 is a positive regulator of the trichothecene gene cluster and the production of trichothecene mycotoxins [deoxynivalenol (DON)] and acetylated forms such as 15-Acetyl-DON) in the cereal pathogen Fusarium graminearum. As a global transcriptional regulator, TRI6 expression is modulated by nitrogen-limiting conditions, sources of nitrogen and carbon, pH and light. However, the mechanism by which these diverse environmental factors affect TRI6 expression remains underexplored. In our effort to understand how nutrients affect TRI6 regulation, comparative digital expression profiling was performed with a wild-type F. graminearum and a Δtri6 mutant strain, grown in nutrient-rich conditions. Analysis showed that TRI6 negatively regulates genes of the branched-chain amino acid (BCAA) metabolic pathway. Feeding studies with deletion mutants of MCC, encoding methylcrotonyl-CoA-carboxylase, one of the key enzymes of leucine metabolism, showed that addition of leucine specifically down-regulated TRI6 expression and reduced 15-ADON accumulation. Constitutive expression of TRI6 in the Δmcc mutant strain restored 15-ADON production. A combination of cellophane breach assays and pathogenicity experiments on wheat demonstrated that disrupting the leucine metabolic pathway significantly reduced disease. These findings suggest a complex interaction between one of the primary metabolic pathways with a global regulator of mycotoxin biosynthesis and virulence in F. graminearum.

  19. Iron nanoparticles significantly affect the in vitro and in vivo expression of Id genes.

    PubMed

    Zou, Jinglu; Wang, Xin; Zhang, Ling; Wang, Jinke

    2015-03-16

    In recent DNA microarray studies, we found that the transcription of the Id3 gene was significantly down-regulated in five cell lines (RAW264.7, Hepa1-6, THP-1, HepG2, and HL7702) treated with two doses (50 and 100 μg/mL) of a DMSA-coated magnetite nanoparticle. Given the regulatory roles of Id genes in the cell cycle, growth, and differentiation, we wanted to do more investigations on the effect of the nanoparticle upon the Id genes. This study detected the expression of Id genes in six cell lines (the above cell lines plus HeLa) treated with the nanoparticle at the same doses using quantitative PCR. The results revealed that the expression of Id genes was significantly affected by the nanoparticle in these cell lines. Under each treatment, the Id3 gene was significantly (p < 0.01) down-regulated in all cell lines, the Id1 gene was significantly down-regulated in all cell lines except the RAW264.7 cells, and the Id2 gene was significantly down-regulated in the HepG2, HL7702, and HeLa cells. Because the Id1, Id2, and Id3 genes were significantly down-regulated in three liver-derived cell lines (Hepa1-6, HepG2, and HL7702) in both microarray and PCR detections, this study then detected the expression of Id genes in the liver tissues of mice that were intravenously injected with the nanoparticle at two doses (2 and 5 mg/kg body weight). The results revealed that the expression of Id1, Id2, and Id3 genes was also significantly down-regulated in the liver tissues under each treatment. Another Id gene, Id4, was also significantly regulated in some cells or liver tissues treated with the nanoparticle. These results reveal that the nanoparticle exerts a significant effect on the in vitro and in vivo expression of Id genes. This study thus provides new insights into the Id-related nanotoxicity of the nanoparticle and the close relationship between the regulation of Id genes and iron.

  20. FAK and HAS Inhibition Synergistically Decrease Colon Cancer Cell Viability and Affect Expression of Critical Genes

    PubMed Central

    Heffler, Melissa; Golubovskaya, Vita; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William; Dunn, Kelli B.

    2013-01-01

    Focal adhesion kinase (FAK), hyaluronan (HA), and hyaluronan synthase-3 (HAS3) have been implicated in cancer growth and progression. FAK inhibition with the small molecule inhibitor Y15 decreases colon cancer cell growth in vitro and in vivo. HAS3 inhibition in colon cancer cells decreases FAK expression and activation, and exogenous HA increases FAK activation. We sought to determine the genes affected by HAS and FAK inhibition and hypothesized that dual inhibition would synergistically inhibit viability. Y15 (FAK inhibitor) and the HAS inhibitor 4-methylumbelliferone (4-MU) decreased viability in a dose dependent manner; viability was further inhibited by treatment with Y15 and 4-MU in colon cancer cells. HAS inhibited cells treated with 2μM of Y15 showed significantly decreased viability compared to HAS scrambled cells treated with the same dose (p<0.05) demonstrating synergistic inhibition of viability with dual FAK/HAS inhibition. Microarray analysis showed more than 2-fold up- or down-regulation of 121 genes by HAS inhibition, and 696 genes by FAK inhibition (p<0.05) and revealed 29 common genes affected by both signaling. Among the genes affected by FAK or HAS3 inhibition were genes, playing role in apoptosis, cell cycle regulation, adhesion, transcription, heat-shock and WNT pathways. Thus, FAK or HAS inhibition decreases SW620 viability and affects several similar genes, which are involved in the regulation of tumor survival. Dual inhibition of FAK and HAS3 decreases viability to a greater degree than with either agent alone, and suggests that synergistic inhibition of colon cancer cell growth can result from affecting similar genetic pathways. PMID:22934709

  1. FAK and HAS inhibition synergistically decrease colon cancer cell viability and affect expression of critical genes.

    PubMed

    Heffler, Melissa; Golubovskaya, Vita M; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G; Dunn, Kelli B

    2013-05-01

    Focal adhesion kinase (FAK), hyaluronan (HA), and hyaluronan synthase-3 (HAS3) have been implicated in cancer growth and progression. FAK inhibition with the small molecule inhibitor Y15 decreases colon cancer cell growth in vitro and in vivo. HAS3 inhibition in colon cancer cells decreases FAK expression and activation, and exogenous HA increases FAK activation. We sought to determine the genes affected by HAS and FAK inhibition and hypothesized that dual inhibition would synergistically inhibit viability. Y15 (FAK inhibitor) and the HAS inhibitor 4-methylumbelliferone (4-MU) decreased viability in a dose dependent manner; viability was further inhibited by treatment with Y15 and 4-MU in colon cancer cells. HAS inhibited cells treated with 2 μM of Y15 showed significantly decreased viability compared to HAS scrambled cells treated with the same dose (p < 0.05) demonstrating synergistic inhibition of viability with dual FAK/HAS inhibition. Microarray analysis showed more than 2-fold up- or down-regulation of 121 genes by HAS inhibition, and 696 genes by FAK inhibition (p < 0.05) and revealed 29 common genes affected by both signaling. Among the genes affected by FAK or HAS3 inhibition were genes, playing role in apoptosis, cell cycle regulation, adhesion, transcription, heatshock and WNT pathways. Thus, FAK or HAS inhibition decreases SW620 viability and affects several similar genes, which are involved in the regulation of tumor survival. Dual inhibition of FAK and HAS3 decreases viability to a greater degree than with either agent alone, and suggests that synergistic inhibition of colon cancer cell growth can result from affecting similar genetic pathways.

  2. Dietary Methanol Regulates Human Gene Activity

    PubMed Central

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  3. Hox gene Ultrabithorax regulates distinct sets of target genes at successive stages of Drosophila haltere morphogenesis.

    PubMed

    Pavlopoulos, Anastasios; Akam, Michael

    2011-02-15

    Hox genes encode highly conserved transcription factors that regionalize the animal body axis by controlling complex developmental processes. Although they are known to operate in multiple cell types and at different stages, we are still missing the batteries of genes targeted by any one Hox gene over the course of a single developmental process to achieve a particular cell and organ morphology. The transformation of wings into halteres by the Hox gene Ultrabithorax (Ubx) in Drosophila melanogaster presents an excellent model system to study the Hox control of transcriptional networks during successive stages of appendage morphogenesis and cell differentiation. We have used an inducible misexpression system to switch on Ubx in the wing epithelium at successive stages during metamorphosis--in the larva, prepupa, and pupa. We have then used extensive microarray expression profiling and quantitative RT-PCR to identify the primary transcriptional responses to Ubx. We find that Ubx targets range from regulatory genes like transcription factors and signaling components to terminal differentiation genes affecting a broad repertoire of cell behaviors and metabolic reactions. Ubx up- and down-regulates hundreds of downstream genes at each stage, mostly in a subtle manner. Strikingly, our analysis reveals that Ubx target genes are largely distinct at different stages of appendage morphogenesis, suggesting extensive interactions between Hox genes and hormone-controlled regulatory networks to orchestrate complex genetic programs during metamorphosis.

  4. Evaluating Posttranscriptional Regulation of Cytokine Genes

    PubMed Central

    Rattenbacher, Bernd; Bohjanen, Paul R.

    2014-01-01

    A wide variety of cytokines are necessary for cell–cell communication in multicellular organisms, and cytokine dysregulation has detrimental effects, leading to disease states. Thus, it is a necessity that the expression of cytokines is tightly controlled. Regulation of cytokine gene expression takes place at different levels, including transcriptional and posttranscriptional levels. Ultimately, the steady-state levels of cytokine transcripts are determined by the equilibrium of transcription and degradation of this mRNA. Degradation rates of cytokine mRNAs can be measured in cells by blocking transcription with actinomycin D, harvesting RNA after different time points, and evaluating mRNA levels over time by northern blot. Cis-acting elements that mediate the rapid decay of numerous cytokine transcripts, including AU-rich elements (AREs), are found in the 3′ untranslated region (UTR) of these transcripts. Putative regulatory cis-elements can be cloned into the 3′ UTR of a reporter transcript in order to assess their function in regulating mRNA decay. Cis-elements, such as AREs, regulate cytokine mRNA decay by binding to trans-acting proteins, such as tristetraprolin or HuR. These RNA-binding proteins can be visualized using electromobility shift assays or UV crosslinking assays based on their binding to radioactively labeled RNA sequences. RNA-binding proteins that regulate cytokine mRNA decay can be purified using an RNA affinity method, using their target RNA sequence as the bait. In this chapter, we review the methods for measuring cytokine mRNA decay and methods for characterizing the cis-acting elements and trans-acting factors that regulate cytokine mRNA decay. PMID:22131026

  5. Tet1 controls meiosis by regulating meiotic gene expression.

    PubMed

    Yamaguchi, Shinpei; Hong, Kwonho; Liu, Rui; Shen, Li; Inoue, Azusa; Diep, Dinh; Zhang, Kun; Zhang, Yi

    2012-12-20

    Meiosis is a germ-cell-specific cell division process through which haploid gametes are produced for sexual reproduction. Before the initiation of meiosis, mouse primordial germ cells undergo a series of epigenetic reprogramming steps, including the global erasure of DNA methylation at the 5-position of cytosine (5mC) in CpG-rich DNA. Although several epigenetic regulators, such as Dnmt3l and the histone methyltransferases G9a and Prdm9, have been reported to be crucial for meiosis, little is known about how the expression of meiotic genes is regulated and how their expression contributes to normal meiosis. Using a loss-of-function approach in mice, here we show that the 5mC-specific dioxygenase Tet1 has an important role in regulating meiosis in mouse oocytes. Tet1 deficiency significantly reduces female germ-cell numbers and fertility. Univalent chromosomes and unresolved DNA double-strand breaks are also observed in Tet1-deficient oocytes. Tet1 deficiency does not greatly affect the genome-wide demethylation that takes place in primordial germ cells, but leads to defective DNA demethylation and decreased expression of a subset of meiotic genes. Our study thus establishes a function for Tet1 in meiosis and meiotic gene activation in female germ cells.

  6. Tet1 controls meiosis by regulating meiotic gene expression

    PubMed Central

    Yamaguchi, Shinpei; Hong, Kwonho; Liu, Rui; Shen, Li; Inoue, Azusa; Diep, Dinh; Zhang, Kun; Zhang, Yi

    2012-01-01

    Meiosis is a germ cell-specific cell division process through which haploid gametes are produced for sexual reproduction1. Prior to initiation of meiosis, mouse primordial germ cells (PGCs) undergo a series of epigenetic reprogramming steps2,3, including global erasure of DNA methylation on the 5-position of cytosine (5mC) at CpG4,5. Although several epigenetic regulators, such as Dnmt3l, histone methyltransferases G9a and Prdm9, have been reported to be critical for meiosis6, little is known about how the expression of meiotic genes is regulated and how their expression contributes to normal meiosis. Using a loss of function approach, here we demonstrate that the 5mC-specific dioxygenase Tet1 plays an important role in regulating meiosis in mouse oocytes. Tet1 deficiency significantly reduces female germ cell numbers and fertility. Univalent chromosomes and unresolved DNA double strand breaks are also observed in Tet1-deficient oocytes. Tet1 deficiency does not greatly affect the genome-wide demethylation that takes place in PGCs but leads to defective DNA demethylation and decreased expression of a subset of meiotic genes. Our study thus establishes a function for Tet1 in meiosis and meiotic gene activation in female germ cells. PMID:23151479

  7. In silico analysis of polymorphisms in microRNAs that target genes affecting aerobic glycolysis

    PubMed Central

    Venkatesh, Thejaswini; Tsutsumi, Rie

    2016-01-01

    Background Cancer cells preferentially metabolize glucose through aerobic glycolysis, an observation known as the Warburg effect. Recently, studies have deciphered the role of oncogenes and tumor suppressor genes in regulating the Warburg effect. Furthermore, mutations in glycolytic enzymes identified in various cancers highlight the importance of the Warburg effect at the molecular and cellular level. MicroRNAs (miRNAs) are non-coding RNAs that posttranscriptionally regulate gene expression and are dysregulated in the pathogenesis of various types of human cancers. Single nucleotide polymorphisms (SNPs) in miRNA genes may affect miRNA biogenesis, processing, function, and stability and provide additional complexity in the pathogenesis of cancer. Moreover, mutations in miRNA target sequences in target mRNAs can affect expression. Methods In silico analysis and cataloguing polymorphisms in miRNA genes that target genes directly or indirectly controlling aerobic glycolysis was carried out using different publically available databases. Results miRNA SNP2.0 database revealed several SNPs in miR-126 and miR-25 in the upstream and downstream pre-miRNA flanking regions respectively should be inserted after flanking regions and miR-504 and miR-451 had the fewest. These miRNAs target genes that control aerobic glycolysis indirectly. SNPs in premiRNA genes were found in miR-96, miR-155, miR-25 and miR34a by miRNASNP. Dragon database of polymorphic regulation of miRNA genes (dPORE-miRNA) database revealed several SNPs that modify transcription factor binding sites (TFBS) or creating new TFBS in promoter regions of selected miRNA genes as analyzed by dPORE-miRNA. Conclusions Our results raise the possibility that integration of SNP analysis in miRNA genes with studies of metabolic adaptations in cancer cells could provide greater understanding of oncogenic mechanisms. PMID:27004216

  8. Plant defense genes are regulated by ethylene

    SciTech Connect

    Ecker, J.R.; Davis, R.W.

    1987-08-01

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase (4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12), enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes.

  9. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway.

  10. Identification of sites subjected to serine/threonine phosphorylation by SGK1 affecting N-myc downstream-regulated gene 1 (NDRG1)/Cap43-dependent suppression of angiogenic CXC chemokine expression in human pancreatic cancer cells.

    PubMed

    Murakami, Yuichi; Hosoi, Fumihito; Izumi, Hiroto; Maruyama, Yuichiro; Ureshino, Hiroki; Watari, Kosuke; Kohno, Kimitoshi; Kuwano, Michihiko; Ono, Mayumi

    2010-05-28

    We have recently reported that N-myc downstream-regulated gene 1 (NDRG1)/Ca(2+)-associated protein with a molecular mass of 43kDa (Cap43) suppresses angiogenesis and tumor growth of pancreatic cancer through marked decreases in both the expression of CXC chemokines and phosphorylation of a NF-kappaB signaling molecule, inhibitor of kappaB kinase (IkappaBalpha). NDRG1/Cap43 is phosphorylated at serine/threonine sites in its C-terminal domain by serum- and glucocorticoid-regulated kinase 1 (SGK1). In this study, we attempted to clarify the domain or site of NDRG1/Cap43 responsible for its suppression of CXC chemokine expression in pancreatic cancer cells. Expression of the deletion constructs CapDelta2 [deletion of amino acids (AA) 130-142] and CapDelta4 [deletion of AA 180-294] as well as the wild-type full sequence of NDRG1/Cap43 (F-Cap), suppressed the production of CXC chemokines such as Groalpha/CXCL1 and ENA-78/CXCL5, whereas no or low suppression was observed in cell expressing the CapDelta5 mutant [deletion of AA 326-350] and CapDelta6 mutant [deletion of AA 326-394]. We further introduced mutations at the serine and threonine sites at 328 [T328A], 330 [S330A] and 346 [T346A], which are susceptible to phosphorylation by SGK1, and also constructed double mutants [T328A, S330A], [T328A, T346A] and [S330A, T346A]. Expression of all these mutants, with the exception of [S330A, T346A], suppressed the production of CXC chemokine to similar levels as their wild-type counterpart. IkappaBalpha was found to be specifically phosphorylated by this double mutant [S330A, T346A] and the CapDelta5 mutant at levels comparable to that induced in their wild-type counterpart. Phosphorylation of NDRG1/Cap43 at both serine330 and threonine346 is required for its suppressive action on the NF-kappaB signaling pathway and CXC chemokine expression in pancreatic cancer cells.

  11. Interspecies systems biology uncovers metabolites affecting C. elegans gene expression and life history traits.

    PubMed

    Watson, Emma; MacNeil, Lesley T; Ritter, Ashlyn D; Yilmaz, L Safak; Rosebrock, Adam P; Caudy, Amy A; Walhout, Albertha J M

    2014-02-13

    Diet greatly influences gene expression and physiology. In mammals, elucidating the effects and mechanisms of individual nutrients is challenging due to the complexity of both the animal and its diet. Here, we used an interspecies systems biology approach with Caenorhabditis elegans and two of its bacterial diets, Escherichia coli and Comamonas aquatica, to identify metabolites that affect the animal's gene expression and physiology. We identify vitamin B12 as the major dilutable metabolite provided by Comamonas aq. that regulates gene expression, accelerates development, and reduces fertility but does not affect lifespan. We find that vitamin B12 has a dual role in the animal: it affects development and fertility via the methionine/S-Adenosylmethionine (SAM) cycle and breaks down the short-chain fatty acid propionic acid, preventing its toxic buildup. Our interspecies systems biology approach provides a paradigm for understanding complex interactions between diet and physiology.

  12. Bone mineral density-affecting genes in Africans.

    PubMed Central

    Gong, Gordon; Haynatzki, Gleb; Haynatzka, Vera; Howell, Ryan; Kosoko-Lasaki, Sade; Fu, Yun-Xin; Yu, Fei; Gallagher, John C.; Wilson, M. Roy

    2006-01-01

    BACKGROUND: We have recently reported the role of environmental exposure in the ethnic diversity of bone mineral density (BMD). Potential genetic difference has not been adequately assessed. PURPOSE: To determine allele frequencies of BMD-affecting genes and their association with BMD in Africans. METHODS: Allele frequencies at 18 polymorphic sites in 13 genes that affect BMD in Asians and/or Caucasians were determined in 143 recent immigrants (55 men and 88 women, 18-51 years of age) from sub-Saharan Sudan to the United States. Genetic association studies were performed. RESULTS: Among the 14 single-nucleotide polymorphisms (SNPs), 10 were significantly different in allele frequency between Sudanese and Asians, and 10 between Sudanese and Caucasians. Only the osteocalcin gene was not significantly different in allele frequency among Sudanese, Asians and Caucasians. Allele frequencies in the TGFB, COL1A1 and CSR genes were extremely low (<0.04) in the Sudanese. Frequencies of microsatellite alleles in four genes were significantly different among Sudanese, Asians and Caucasians. SNPs in the VDR and ERalpha genes were associated with BMD and/or BMC (bone mineral content) at several bone sites. CONCLUSIONS: Genetic difference may play a role in the ethnic diversity in BMD and/or BMC. PMID:16895279

  13. Rice open beak is a negative regulator of class 1 knox genes and a positive regulator of class B floral homeotic gene.

    PubMed

    Horigome, Ayako; Nagasawa, Nobuhiro; Ikeda, Kyoko; Ito, Momoyo; Itoh, Jun-Ichi; Nagato, Yasuo

    2009-06-01

    Numerous genes are involved in the regulation of plant development, including those that regulate floral homeotic genes, We identified two recessive allelic rice mutants, open beak-1 (opb-1) and opb-2, which exhibited pleiotropic defects in leaf morphogenesis, inflorescence architecture, and floral organ identity. Abnormal cell proliferation was observed in the leaves and spikelets, and ectopic or overexpression of several class 1 knox genes was detected; thus, the abnormal cell proliferation in opb mutants is probably caused by ectopic class 1 knox gene expression. The opb mutants also had defects in floral organ identity, resulting in the development of mosaic organs, including gluminous lodicules, staminoid lodicules, and pistiloid stamens. These results, together with the reduced expression of a class B gene, indicate that OPB positively regulates the expression of class B genes. Map-based cloning revealed that OPB encodes a transcription factor that is orthologous to the Arabidopsis JAGGED gene and is expressed in leaf primordia, inflorescence meristem, rachis branch meristems, floral meristem, and floral organ primordia. Taken together, our data suggest that the OPB gene affects cellular proliferation and floral organ identity through the regulation of class 1 knox genes and floral homeotic genes.

  14. Identification of Yeast Genes Involved in K+ Homeostasis: Loss of Membrane Traffic Genes Affects K+ Uptake

    PubMed Central

    Fell, Gillian L.; Munson, Amanda M.; Croston, Merriah A.; Rosenwald, Anne G.

    2011-01-01

    Using the homozygous diploid Saccharomyces deletion collection, we searched for strains with defects in K+ homeostasis. We identified 156 (of 4653 total) strains unable to grow in the presence of hygromycin B, a phenotype previously shown to be indicative of ion defects. The most abundant group was that with deletions of genes known to encode membrane traffic regulators. Nearly 80% of these membrane traffic defective strains showed defects in uptake of the K+ homolog, 86Rb+. Since Trk1, a plasma membrane protein localized to lipid microdomains, is the major K+ influx transporter, we examined the subcellular localization and Triton-X 100 insolubility of Trk1 in 29 of the traffic mutants. However, few of these showed defects in the steady state levels of Trk1, the localization of Trk1 to the plasma membrane, or the localization of Trk1 to lipid microdomains, and most defects were mild compared to wild-type. Three inositol kinase mutants were also identified, and in contrast, loss of these genes negatively affected Trk1 protein levels. In summary, this work reveals a nexus between K+ homeostasis and membrane traffic, which does not involve traffic of the major influx transporter, Trk1. PMID:22384317

  15. Identification of yeast genes involved in k homeostasis: loss of membrane traffic genes affects k uptake.

    PubMed

    Fell, Gillian L; Munson, Amanda M; Croston, Merriah A; Rosenwald, Anne G

    2011-06-01

    Using the homozygous diploid Saccharomyces deletion collection, we searched for strains with defects in K(+) homeostasis. We identified 156 (of 4653 total) strains unable to grow in the presence of hygromycin B, a phenotype previously shown to be indicative of ion defects. The most abundant group was that with deletions of genes known to encode membrane traffic regulators. Nearly 80% of these membrane traffic defective strains showed defects in uptake of the K(+) homolog, (86)Rb(+). Since Trk1, a plasma membrane protein localized to lipid microdomains, is the major K(+) influx transporter, we examined the subcellular localization and Triton-X 100 insolubility of Trk1 in 29 of the traffic mutants. However, few of these showed defects in the steady state levels of Trk1, the localization of Trk1 to the plasma membrane, or the localization of Trk1 to lipid microdomains, and most defects were mild compared to wild-type. Three inositol kinase mutants were also identified, and in contrast, loss of these genes negatively affected Trk1 protein levels. In summary, this work reveals a nexus between K(+) homeostasis and membrane traffic, which does not involve traffic of the major influx transporter, Trk1.

  16. Pharmacological and Genetic Modulation of REV-ERB Activity and Expression Affects Orexigenic Gene Expression

    PubMed Central

    Amador, Ariadna; Wang, Yongjun; Banerjee, Subhashis; Kameneka, Theodore M.; Solt, Laura A.; Burris, Thomas P.

    2016-01-01

    The nuclear receptors REV-ERBα and REV-ERBβ are transcription factors that play pivotal roles in the regulation of the circadian rhythm and various metabolic processes. The circadian rhythm is an endogenous mechanism, which generates entrainable biological changes that follow a 24-hour period. It regulates a number of physiological processes, including sleep/wakeful cycles and feeding behaviors. We recently demonstrated that REV-ERB-specific small molecules affect sleep and anxiety. The orexinergic system also plays a significant role in mammalian physiology and behavior, including the regulation of sleep and food intake. Importantly, orexin genes are expressed in a circadian manner. Given these overlaps in function and circadian expression, we wanted to determine whether the REV-ERBs might regulate orexin. We found that acute in vivo modulation of REV-ERB activity, with the REV-ERB-specific synthetic ligand SR9009, affects the circadian expression of orexinergic genes in mice. Long term dosing with SR9009 also suppresses orexinergic gene expression in mice. Finally, REV-ERBβ-deficient mice present with increased orexinergic transcripts. These data suggest that the REV-ERBs may be involved in the repression of orexinergic gene expression. PMID:26963516

  17. Gene expression profiles in rice gametes and zygotes: identification of gamete-enriched genes and up- or down-regulated genes in zygotes after fertilization

    PubMed Central

    Abiko, Mafumi; Maeda, Hiroki; Tamura, Kentaro; Hara-Nishimura, Ikuko; Okamoto, Takashi

    2013-01-01

    In angiosperms, fertilization and subsequent zygotic development occur in embryo sacs deeply embedded in the ovaries; therefore, these processes are poorly elucidated. In this study, microarray-based transcriptome analyses were conducted on rice sperm cells, egg cells, and zygotes isolated from flowers to identify candidate genes involved in gametic and/or early zygotic development. Cell type-specific transcriptomes were obtained, and up- or down-regulated genes in zygotes after fertilization were identified, in addition to genes enriched in male and female gametes. A total of 325 putatively up-regulated and 94 putatively down-regulated genes in zygotes were obtained. Interestingly, several genes encoding homeobox proteins or transcription factors were identified as highly up-regulated genes after fertilization, and the gene ontology for up-regulated genes was highly enriched in functions related to chromatin/DNA organization and assembly. Because a gene encoding methyltransferase 1 was identified as a highly up-regulated gene in zygotes after fertilization, the effect of an inhibitor of this enzyme on zygote development was monitored. The inhibitor appeared partially to affect polarity or division asymmetry in rice zygotes, but it did not block normal embryo generation. PMID:23570690

  18. Gene expression profiles in rice gametes and zygotes: identification of gamete-enriched genes and up- or down-regulated genes in zygotes after fertilization.

    PubMed

    Abiko, Mafumi; Maeda, Hiroki; Tamura, Kentaro; Hara-Nishimura, Ikuko; Okamoto, Takashi

    2013-04-01

    In angiosperms, fertilization and subsequent zygotic development occur in embryo sacs deeply embedded in the ovaries; therefore, these processes are poorly elucidated. In this study, microarray-based transcriptome analyses were conducted on rice sperm cells, egg cells, and zygotes isolated from flowers to identify candidate genes involved in gametic and/or early zygotic development. Cell type-specific transcriptomes were obtained, and up- or down-regulated genes in zygotes after fertilization were identified, in addition to genes enriched in male and female gametes. A total of 325 putatively up-regulated and 94 putatively down-regulated genes in zygotes were obtained. Interestingly, several genes encoding homeobox proteins or transcription factors were identified as highly up-regulated genes after fertilization, and the gene ontology for up-regulated genes was highly enriched in functions related to chromatin/DNA organization and assembly. Because a gene encoding methyltransferase 1 was identified as a highly up-regulated gene in zygotes after fertilization, the effect of an inhibitor of this enzyme on zygote development was monitored. The inhibitor appeared partially to affect polarity or division asymmetry in rice zygotes, but it did not block normal embryo generation.

  19. European Regulation Affecting Nanomaterials - Review of Limitations and Future Recommendations

    PubMed Central

    Hansen, Steffen Foss; Baun, Anders

    2012-01-01

    After learning about the potential risks associated with various specific nanomaterials, concerns have been raised about adequacy of existing regulation in Europe and what should be done to address any potential regulatory gaps related to nanomaterials. Understanding the limitations of the current regulation in regard to nanomaterials is a starting point in a democratic and transparent process towards adapting existing laws and facilitating an informed discussion about which kind of regulatory options best address the identified limitations. In the following we will introduce key pieces of European legislation affecting nanomaterials, analyze their limitations, and provide a number of recommendations on how these can be overcome. We find that, although nanomaterials are in principle covered by the scope of many of the existing legislative frameworks, it is often unclear, if current regulations are actually applicable when it comes to specific nanomaterials and their diverse applications. Main limitations seem to be: that requirements to do safety evaluations are triggered by production volumes by tonnage not tailored to the nanoscale, the profound lack of (eco)toxicological data, and that thresholds values and occupational exposure limits cannot be established with existing methodologies. PMID:22942870

  20. European regulation affecting nanomaterials - review of limitations and future recommendations.

    PubMed

    Hansen, Steffen Foss; Baun, Anders

    2012-01-01

    After learning about the potential risks associated with various specific nanomaterials, concerns have been raised about adequacy of existing regulation in Europe and what should be done to address any potential regulatory gaps related to nanomaterials. Understanding the limitations of the current regulation in regard to nanomaterials is a starting point in a democratic and transparent process towards adapting existing laws and facilitating an informed discussion about which kind of regulatory options best address the identified limitations. In the following we will introduce key pieces of European legislation affecting nanomaterials, analyze their limitations, and provide a number of recommendations on how these can be overcome. We find that, although nanomaterials are in principle covered by the scope of many of the existing legislative frameworks, it is often unclear, if current regulations are actually applicable when it comes to specific nanomaterials and their diverse applications. Main limitations seem to be: that requirements to do safety evaluations are triggered by production volumes by tonnage not tailored to the nanoscale, the profound lack of (eco)toxicological data, and that thresholds values and occupational exposure limits cannot be established with existing methodologies.

  1. The microarray gene profiling analysis of glioblastoma cancer cells reveals genes affected by FAK inhibitor Y15 and combination of Y15 and temozolomide.

    PubMed

    Huang, Grace; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Qiang, Hu; Golubovskaya, Vita

    2014-01-01

    Focal adhesion is known to be highly expressed and activated in glioma cells. Recently, we demonstrated that FAK autophosphorylation inhibitor, Y15 significantly decreased tumor growth of DBTRG and U87 cells, especially in combination with temozolomide. In the present report, we performed gene expression analysis in these cells to reveal genes affected by Y15, temozolomide and combination of Y15 and temozolomide. We tested the effect of Y15 on gene expression by Illumina Human HT12v4 microarray assay and detected 8087 and 6555 genes, which were significantly either up- or down-regulated by Y15-treatment in DBTRG and U87 cells, respectively (p<0.05). Moreover, DBTRG and U87 cells treated with Y15 changed expression of 1332 and 462 genes more than 1.5 fold, p<0.05, respectively and had 237 common genes affected by Y15. The common genes up-regulated by Y15 included GADD45A, HSPA6 (heat-shock 70); DUSP1, DUSP 5 (dual-phosphatase 5); CDKN1A (p21) and common down-regulated genes included kinesins, such as KIF11, 14, 20A, 20B; topoisomerase II, TOP2A; cyclin F; cell cycle protein: BUB1; PARP1, POLA1. In addition, we detected genes affected by temozolomide and by combination of Y15 and temozolomide treatment in U87 cells. Among genes up-regulated by Y15 and temozolomide more significantly than by each agent alone were: COX7B; interferon, gamma-inducible transcript: IFI16; DDIT4; GADD45G and down-regulated: KIF3A, AKT1; ABL; JAK1, GLI3 and ALDH1A3. Thus, microarray gene expression analysis can be effective in establishing genes affected in response to FAK inhibitor alone and in response to combination of Y15 with temozolomide that is important for glioblastoma therapy.

  2. Conditional gene vectors regulated in cis.

    PubMed

    Pich, Dagmar; Humme, Sibille; Spindler, Mark-Peter; Schepers, Aloys; Hammerschmidt, Wolfgang

    2008-08-01

    Non-integrating gene vectors, which are stably and extrachromosomally maintained in transduced cells would be perfect tools to support long-term expression of therapeutic genes but preserve the genomic integrity of the cellular host. Small extrachromosomal plasmids share some of these ideal characteristics but are primarily based on virus blueprints. These plasmids are dependent on viral trans-acting factors but they can replicate their DNA molecules in synchrony with the chromosome of the cellular host and segregate to daughter cells in an autonomous fashion. On the basis of the concept of the latent origin of DNA replication of Epstein-Barr virus, oriP, we devised novel derivatives, which exclusively rely on an artificial replication factor for both nuclear retention and replication of plasmid DNA. In addition, an allosteric switch regulates the fate of the plasmid molecules, which are rapidly lost upon addition of doxycycline. Conditional maintenance of these novel plasmid vectors allows the reversible transfer of genetic information into target cells for the first time.

  3. Toxic Diatom Aldehydes Affect Defence Gene Networks in Sea Urchins

    PubMed Central

    Varrella, Stefano; Ruocco, Nadia; Ianora, Adrianna; Bentley, Matt G.; Costantini, Maria

    2016-01-01

    Marine organisms possess a series of cellular strategies to counteract the negative effects of toxic compounds, including the massive reorganization of gene expression networks. Here we report the modulated dose-dependent response of activated genes by diatom polyunsaturated aldehydes (PUAs) in the sea urchin Paracentrotus lividus. PUAs are secondary metabolites deriving from the oxidation of fatty acids, inducing deleterious effects on the reproduction and development of planktonic and benthic organisms that feed on these unicellular algae and with anti-cancer activity. Our previous results showed that PUAs target several genes, implicated in different functional processes in this sea urchin. Using interactomic Ingenuity Pathway Analysis we now show that the genes targeted by PUAs are correlated with four HUB genes, NF-κB, p53, δ-2-catenin and HIF1A, which have not been previously reported for P. lividus. We propose a working model describing hypothetical pathways potentially involved in toxic aldehyde stress response in sea urchins. This represents the first report on gene networks affected by PUAs, opening new perspectives in understanding the cellular mechanisms underlying the response of benthic organisms to diatom exposure. PMID:26914213

  4. Regulation of collagen I gene expression by ras.

    PubMed Central

    Slack, J L; Parker, M I; Robinson, V R; Bornstein, P

    1992-01-01

    Although transformation of rodent fibroblasts can lead to dramatic changes in expression of extracellular matrix genes, the molecular basis and physiological significance of these changes remain poorly understood. In this study, we have investigated the mechanism(s) by which ras affects expression of the genes encoding type I collagen. Levels of both alpha 1(I) and alpha 2(I) collagen mRNAs were markedly reduced in Rat 1 fibroblasts overexpressing either the N-rasLys-61 or the Ha-rasVal-12 oncogene. In fibroblasts conditionally transformed with N-rasLys-61, alpha 1(I) transcript levels began to decline within 8 h of ras induction and reached 1 to 5% of control levels after 96 h. In contrast, overexpression of normal ras p21 had no effect on alpha 1(I) or alpha 2(I) mRNA levels. Nuclear run-on experiments demonstrated that the transcription rates of both the alpha 1(I) and alpha 2(I) genes were significantly reduced in ras-transformed cells compared with those in parental cells. In addition, the alpha 1(I) transcript was less stable in transformed cells. Chimeric plasmids containing up to 3.6 kb of alpha 1(I) 5'-flanking DNA and up to 2.3 kb of the 3'-flanking region were expressed at equivalent levels in both normal and ras-transformed fibroblasts. However, a cosmid clone containing the entire mouse alpha 1(I) gene, including 3.7 kb of 5'- and 4 kb of 3'-flanking DNA, was expressed at reduced levels in fibroblasts overexpressing oncogenic ras. We conclude that oncogenic ras regulates the type I collagen genes at both transcriptional and posttranscriptional levels and that this effect, at least for the alpha 1(I) gene, may be mediated by sequences located either within the body of the gene itself or in the distal 3'-flanking region. Images PMID:1406656

  5. Interactions among Genes Regulating Ovule Development in Arabidopsis Thaliana

    PubMed Central

    Baker, S. C.; Robinson-Beers, K.; Villanueva, J. M.; Gaiser, J. C.; Gasser, C. S.

    1997-01-01

    The INNER NO OUTER (INO) and AINTEGUMENTA (ANT) genes are essential for ovule integument development in Arabidopsis thaliana. Ovules of ino mutants initiate two integument primordia, but the outer integument primordium forms on the opposite side of the ovule from the normal location and undergoes no further development. The inner integument appears to develop normally, resulting in erect, unitegmic ovules that resemble those of gymnosperms. ino plants are partially fertile and produce seeds with altered surface topography, demonstrating a lineage dependence in development of the testa. ant mutations affect initiation of both integuments. The strongest of five new ant alleles we have isolated produces ovules that lack integuments and fail to complete megasporogenesis. ant mutations also affect flower development, resulting in narrow petals and the absence of one or both lateral stamens. Characterization of double mutants between ant, ino and other mutations affecting ovule development has enabled the construction of a model for genetic control of ovule development. This model proposes parallel independent regulatory pathways for a number of aspects of this process, a dependence on the presence of an inner integument for development of the embryo sac, and the existence of additional genes regulating ovule development. PMID:9093862

  6. Quantitative expression of candidate genes affecting eggshell color.

    PubMed

    Zheng, Chuanwei; Li, Zesheng; Yang, Ning; Ning, Zhonghua

    2014-05-01

    There are three pigments that affect the color of an eggshell: protoporphyrin, biliverdin and biliverdin-zinc chelate. Protoporphyrin is the main pigment in brown and light-brown eggshells, whereas very little protoporphyrin is found in white eggshells. Eggshell protoporphyrin is derived from the heme formation in birds. Coproporphyrinogen III oxidase (CPOX) and ferrochelatase (FECH) represent rate-limiting enzymes for the heme-biosynthetic pathway. Breast cancer resistance protein (BCRP), feline leukemia virus receptor (FLVCR), and heme-responsive gene-1 (HRG1) serve as primary transporters for both protoporphyrinogen and heme. Finally, four organic anion transporting polypeptide family members (including solute carrier organic anion transporter family, SLCO1C1, SLCO1A2, SLCO1B3 and LOC418189) may affect pigment transport within eggshells. Here we measured gene expression levels in key tissues of egg-producing hens. We analyzed three different types of hens that generated distinct eggshell colors: white, pink or brown. Our data revealed three ways in which eggshell color was genetically influenced. First, high-level expression of CPOX generated more protoporphyrinogen and a brown eggshell color. In contrast, high expression of FECH likely converted more protoporphyrinogen into heme, reduced protoporphyrinogen levels within the eggshell and generated a light color. Second, heme transporters also affected eggshell color. High-level expression of BCRP, HRG1 and FLVCR were associated with brown, white and generally lighter eggshell colors, respectively. Finally, protoporphyrin precipitation also affected eggshell color, as high expression of both SLCO1A2 and SLCO1C1 were associated with brown eggshell color. As such, we have identified seven genes in which expression levels in different tissues were associated with eggshell color.

  7. FOXO1A differentially regulates genes of decidualization.

    PubMed

    Buzzio, Oscar L; Lu, Zhenxiao; Miller, Curt D; Unterman, Terry G; Kim, J Julie

    2006-08-01

    The forkhead box O1A (FOXO1A) has been identified as one gene that is up-regulated early in the decidualization process. To further investigate the role of FOXO1A during this process, six genes, IGFBP1, PRL, TIMP3, LAMB1, CNR1, and DCN, shown to be up-regulated during decidualization, were chosen as potential targets of FOXO1A action. Treatment of human endometrial stromal cells with hormones (estradiol and medroxyprogesterone acetate) plus dibutyryl cAMP (H+dbcAMP) for 48 h increased expression of IGFBP1, PRL, TIMP3, CNR1, and DCN but not LAMB1, as measured by real-time PCR. Silencing of FOXO1A using small interfering RNA oligonucleotides decreased IGFBP1 and DCN levels and increased CNR1, TIMP3, and PRL levels. LAMB1 was not affected. When FOXO1A was overexpressed in human endometrial stromal cells, expression of IGFBP1, DCN, and PRL increased, whereas levels of TIMP3 and CNR1 decreased. Addition of H+dbcAMP caused an increased expression of IGFBP1, PRL, and DCN beyond that of FOXO1A alone. TIMP3 and CNR1 levels decreased even further in response to H+dbcAMP compared with FOXO1A alone. LAMB1, which was unresponsive to FOXO1A, decreased when H+dbcAMP was added. Overexpressing FOXO1A also caused a change in cell shape, in that the stromal fibroblasts acquired a rounded, epithelioid appearance. Finally, reporter studies showed that cotransfection of FOXO1A significantly increased PRL promoter activity but not TIMP3 promoter activity. Addition of H+dbcAMP resulted in a significant increase in PRL promoter activity and a significant decrease in TIMP3 promoter activity. In summary, this study demonstrates the versatile nature of FOXO1A in the regulation of a number of decidualization-specific genes.

  8. Genes from Lycopersicon chmielewskii affecting tomato quality during fruit ripening.

    PubMed

    Azanza, F; Kim, D; Tanksley, S D; Juvik, J A

    1995-08-01

    Three chromosomal segments from the wild tomato, L. chmielewskii, introgressed into the L. esculentum genome have been previously mapped to the middle and terminal regions of chromosome 7 (7M, 7T respectively), and to the terminal region of chromosome 10 (10T). The present study was designed to investigate the physiological mechanisms controlled by the 7M and 7T segments on tomato soluble solids (SS) and pH, and their genetic regulation during fruit development. The effects of 7M and 7T were studied in 64 BC2F5 backcross inbred lines (BILs) developed from a cross between LA 1501 (an L. esculentum line containing the 7M and 7T fragments from L. chmielewskii), and VF145B-7879 (a processing cultivar). BILs were classified into four homozygous genotypes with respect to the introgressed segments based on RFLP analysis, and evaluated for fruit chemical characteristics at different harvest stages. Gene(s) in the 7M fragment reduce fruit water uptake during ripening increasing pH, sugars, and SS concentration. Gene(s) in the 7T fragment were found to be associated with higher mature green fruit starch concentration and red ripe fruit weight. Comparisons between tomatoes ripened on or off the vine suggest that the physiological mechanisms influenced by the L. chmielewskii alleles are dependent on the translocation of photosynthates and water during fruit ripening.

  9. Pluralistic and stochastic gene regulation: examples, models and consistent theory

    PubMed Central

    Salas, Elisa N.; Shu, Jiang; Cserhati, Matyas F.; Weeks, Donald P.; Ladunga, Istvan

    2016-01-01

    We present a theory of pluralistic and stochastic gene regulation. To bridge the gap between empirical studies and mathematical models, we integrate pre-existing observations with our meta-analyses of the ENCODE ChIP-Seq experiments. Earlier evidence includes fluctuations in levels, location, activity, and binding of transcription factors, variable DNA motifs, and bursts in gene expression. Stochastic regulation is also indicated by frequently subdued effects of knockout mutants of regulators, their evolutionary losses/gains and massive rewiring of regulatory sites. We report wide-spread pluralistic regulation in ≈800 000 tightly co-expressed pairs of diverse human genes. Typically, half of ≈50 observed regulators bind to both genes reproducibly, twice more than in independently expressed gene pairs. We also examine the largest set of co-expressed genes, which code for cytoplasmic ribosomal proteins. Numerous regulatory complexes are highly significant enriched in ribosomal genes compared to highly expressed non-ribosomal genes. We could not find any DNA-associated, strict sense master regulator. Despite major fluctuations in transcription factor binding, our machine learning model accurately predicted transcript levels using binding sites of 20+ regulators. Our pluralistic and stochastic theory is consistent with partially random binding patterns, redundancy, stochastic regulator binding, burst-like expression, degeneracy of binding motifs and massive regulatory rewiring during evolution. PMID:26823500

  10. Gene-specific regulation by general translation factors.

    PubMed

    Dever, Thomas E

    2002-02-22

    Protein synthesis is the ultimate step of gene expression and a key control point for regulation. In particular, it enables cells to rapidly manipulate protein production without new mRNA synthesis, processing, or export. Recent studies have enhanced our understanding of the translation initiation process and helped elucidate how modifications of the general translational machinery regulate gene-specific protein production.

  11. Transcriptional regulation of the uncoupling protein-1 gene.

    PubMed

    Villarroya, Francesc; Peyrou, Marion; Giralt, Marta

    2017-03-01

    Regulated transcription of the uncoupling protein-1 (UCP1) gene, and subsequent UCP1 protein synthesis, is a hallmark of the acquisition of the differentiated, thermogenically competent status of brown and beige/brite adipocytes, as well as of the responsiveness of brown and beige/brite adipocytes to adaptive regulation of thermogenic activity. The 5' non-coding region of the UCP1 gene contains regulatory elements that confer tissue specificity, differentiation dependence, and neuro-hormonal regulation to UCP1 gene transcription. Two main regions-a distal enhancer and a proximal promoter region-mediate transcriptional regulation through interactions with a plethora of transcription factors, including nuclear hormone receptors and cAMP-responsive transcription factors. Co-regulators, such as PGC-1α, play a pivotal role in the concerted regulation of UCP1 gene transcription. Multiple interactions of transcription factors and co-regulators at the promoter region of the UCP1 gene result in local chromatin remodeling, leading to activation and increased accessibility of RNA polymerase II and subsequent gene transcription. Moreover, a commonly occurring A-to-G polymorphism in close proximity to the UCP1 gene enhancer influences the extent of UCP1 gene transcription. Notably, it has been reported that specific aspects of obesity and associated metabolic diseases are associated with human population variability at this site. On another front, the unique properties of the UCP1 promoter region have been exploited to develop brown adipose tissue-specific gene delivery tools for experimental purposes.

  12. Cj1199 Affect the Development of Erythromycin Resistance in Campylobacter jejuni through Regulation of Leucine Biosynthesis

    PubMed Central

    Hao, Haihong; Li, Fei; Han, Jing; Foley, Steven L.; Dai, Menghong; Wang, Xu; Wang, Yulian; Huang, Lingli; Sun, Yawei; Liu, Zhenli; Yuan, Zonghui

    2017-01-01

    The aim of this study was to reveal the biological function of Cj1199 which was overexpressed in the laboratory induced erythromycin resistant strains. The Cj1199 deletion mutant (ΦCj1199) was constructed via insertional inactivation from its parent strain Campylobacter jejuni NCTC11168. The ΦCj1199 and NCTC11168 were then subjected to microarray and real-time PCR to find gene pathway of Cj1199. The antimicrobial susceptibility, antimicrobial resistance development, growth characteristics and leucine metabolism were examined to confirm the biological function of Cj1199. Our result showed that a total of 20 genes were down-regulated in ΦCj1199. These genes were mainly involved in leucine biosynthesis, amino acid transport and periplasmic/membrane structure. Compared to NCTC11168, ΦCj1199 was difficult to acquire higher-level erythromycin resistance during the in vitro step-wise selection. The competition growth and leucine-dependent growth assays demonstrated that ΦCj1199 imposed a growth disadvantage under pressure of erythromycin and in the leucine-free medium. In conclusion, Cj1199 gene may directly regulate the leucine biosynthesis and transport and indirectly affect the development of erythromycin resistance in C. jejuni. PMID:28144238

  13. Necdin, a negative growth regulator, is a novel STAT3 target gene down-regulated in human cancer.

    PubMed

    Haviland, Rachel; Eschrich, Steven; Bloom, Gregory; Ma, Yihong; Minton, Susan; Jove, Richard; Cress, W Douglas

    2011-01-01

    Cytokine and growth factor signaling pathways involving STAT3 are frequently constitutively activated in many human primary tumors, and are known for the transcriptional role they play in controlling cell growth and cell cycle progression. However, the extent of STAT3's reach on transcriptional control of the genome as a whole remains an important question. We predicted that this persistent STAT3 signaling affects a wide variety of cellular functions, many of which still remain to be characterized. We took a broad approach to identify novel STAT3 regulated genes by examining changes in the genome-wide gene expression profile by microarray, using cells expressing constitutively-activated STAT3. Using computational analysis, we were able to define the gene expression profiles of cells containing activated STAT3 and identify candidate target genes with a wide range of biological functions. Among these genes we identified Necdin, a negative growth regulator, as a novel STAT3 target gene, whose expression is down-regulated at the mRNA and protein levels when STAT3 is constitutively active. This repression is STAT3 dependent, since inhibition of STAT3 using siRNA restores Necdin expression. A STAT3 DNA-binding site was identified in the Necdin promoter and both EMSA and chromatin immunoprecipitation confirm binding of STAT3 to this region. Necdin expression has previously been shown to be down-regulated in a melanoma and a drug-resistant ovarian cancer cell line. Further analysis of Necdin expression demonstrated repression in a STAT3-dependent manner in human melanoma, prostate and breast cancer cell lines. These results suggest that STAT3 coordinates expression of genes involved in multiple metabolic and biosynthetic pathways, integrating signals that lead to global transcriptional changes and oncogenesis. STAT3 may exert its oncogenic effect by up-regulating transcription of genes involved in promoting growth and proliferation, but also by down-regulating expression

  14. ALPK1 affects testosterone mediated regulation of proinflammatory cytokines production.

    PubMed

    Kuo, Tzer-Min; Yeh, Kun-Tu; Hsu, Hui-Ting; Chiang, Shang-Lun; Chang, Jan-Gowth; Huang, Chung-Ming; Tu, Hung-Pin; Liu, Chiu-Shong; Ko, Ying-Chin

    2015-11-01

    Alpha-protein kinase 1, also known as alpha-kinase 1 (ALPK1), is associated with chronic kidney disease (CKD), myocardial infarction, gout and type 2 diabetes mellitus (DM). In addition to having an inductive effect on the proinflammatory cytokines in monocytic THP1 cells, ALPK1 is expressed abundantly in the mouse testes. Low testosterone levels are commonly associated with arthritis, CKD, type 2 DM, cardiovascular disease and inflammation. The testosterone's anti-inflammatory effect has been demonstrated to reduce proinflammatory cytokines and adhesion molecules. In this study, we found that ALPK1 transgenic mice showed lower levels of testosterone in both the testes and the serum. Decreasing endogenous ALPK1 enhanced testosterone levels and transcripts of testosterone-regulated genes (P450scc, 3beta-HSD, P450C17, 17beta-HSD, StAR, and INSL3) in TM3 Leydig cells. In contrast, increasing testosterone decreased ALPK1 in both TM3 and monocytic THP1 cells. This decrease was accompanied by a reduction of the proinflammatory cytokines. Increased ALPK1 levels attenuated the testosterone effects in THP1 cells. Finally, we also found that ALPK1 increased the release of TNF-alpha and TGF-beta1 in the human embryonic kidney 293 cells, while testosterone inhibited ALPK1 in the primary kidney cells. Taken together, this data suggests that the balance between ALPK1 and testosterone plays a critical role in the testosterone-mediated inhibition of proinflammatory cytokines.

  15. Gene regulation: ancient microRNA target sequences in plants.

    PubMed

    Floyd, Sandra K; Bowman, John L

    2004-04-01

    MicroRNAs are an abundant class of small RNAs that are thought to regulate the expression of protein-coding genes in plants and animals. Here we show that the target sequence of two microRNAs, known to regulate genes in the class-III homeodomain-leucine zipper (HD-Zip) gene family of the flowering plant Arabidopsis, is conserved in homologous sequences from all lineages of land plants, including bryophytes, lycopods, ferns and seed plants. We also find that the messenger RNAs from these genes are cleaved within the same microRNA-binding site in representatives of each land-plant group, as they are in Arabidopsis. Our results indicate not only that microRNAs mediate gene regulation in non-flowering as well as flowering plants, but also that the regulation of this class of plant genes dates back more than 400 million years.

  16. Common risk genes for affective and schizophrenic psychoses.

    PubMed

    Maier, Wolfgang

    2008-06-01

    The familial-genetic relationship between affective and schizophrenic disorders is receiving a re-emergence of interest. The reasons are a series of cross-diagnostic molecular-genetic discoveries: specific alleles in the genes for dysbindin (DTNBP1), neuregulin (NRG1) and DAOA (G72/G30) reveal associations for each of both groups of disorders in the same direction in some but not all reported studies. These findings cannot just be false positives because of confirming metaanalyses. Furthermore there is some pathophysiological support: the mentioned genes are involved in biochemical pathways, which are contributing to both disorders partly in a similar and partly in a different manner. The new levels of evidence enrich the classical continuity/discontinuity debate on the relationship between both groups of disorders.

  17. Daytime sleepiness affects prefrontal regulation of food intake.

    PubMed

    Killgore, William D S; Schwab, Zachary J; Weber, Mareen; Kipman, Maia; Deldonno, Sophie R; Weiner, Melissa R; Rauch, Scott L

    2013-05-01

    The recent epidemic of obesity corresponds closely with the decline in the average number of hours of sleep obtained nightly. While growing research suggests that sleep loss may affect hormonal and other physiological systems related to food intake, no studies have yet explored the role that sleepiness may play in reducing prefrontal inhibitory control over food intake. Because evidence suggests that women may be more prone to obesity and eating disorders, as well as more likely to suffer from sleep problems, we examined the relation between general daytime sleepiness, brain responses to food stimuli, and self-reported overeating separately for men and women. Thirty-eight healthy adults (16 women; 22 men) aged 18 to 45 underwent functional magnetic resonance imaging (fMRI) while viewing pictures of high- and low-calorie foods. Subjects completed the Epworth Sleepiness Scale (ESS) and provided a rating to the query "how often do you eat more than you intend to." Contrast images comparing brain activation derived from the high- versus low-calorie conditions were correlated voxel-wise with scores from the ESS in a second-level regression model, the output of which was used to predict self-reported overeating. As hypothesized, daytime sleepiness correlated with reduced activation in the ventromedial prefrontal cortex during perception of high- versus low-calorie food images. Moreover, activation within this cluster predicted overeating, but only for women. Findings suggest that normal fluctuations in sleepiness may be sufficient to affect brain regions important for regulating food intake, but that these effects may differ between men and women.

  18. Trainable Gene Regulation Networks with Applications to Drosophila Pattern Formation

    NASA Technical Reports Server (NTRS)

    Mjolsness, Eric

    2000-01-01

    This chapter will very briefly introduce and review some computational experiments in using trainable gene regulation network models to simulate and understand selected episodes in the development of the fruit fly, Drosophila melanogaster. For details the reader is referred to the papers introduced below. It will then introduce a new gene regulation network model which can describe promoter-level substructure in gene regulation. As described in chapter 2, gene regulation may be thought of as a combination of cis-acting regulation by the extended promoter of a gene (including all regulatory sequences) by way of the transcription complex, and of trans-acting regulation by the transcription factor products of other genes. If we simplify the cis-action by using a phenomenological model which can be tuned to data, such as a unit or other small portion of an artificial neural network, then the full transacting interaction between multiple genes during development can be modelled as a larger network which can again be tuned or trained to data. The larger network will in general need to have recurrent (feedback) connections since at least some real gene regulation networks do. This is the basic modeling approach taken, which describes how a set of recurrent neural networks can be used as a modeling language for multiple developmental processes including gene regulation within a single cell, cell-cell communication, and cell division. Such network models have been called "gene circuits", "gene regulation networks", or "genetic regulatory networks", sometimes without distinguishing the models from the actual modeled systems.

  19. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection.

    PubMed

    Katsarou, Konstantina; Wu, Yun; Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E; Bryan, Glenn J; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection.

  20. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection

    PubMed Central

    Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E.; Bryan, Glenn J.; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection. PMID:26937634

  1. Deletion of PLCB1 gene in schizophrenia-affected patients.

    PubMed

    Lo Vasco, Vincenza Rita; Cardinale, Giuseppina; Polonia, Patrizia

    2012-04-01

    A prevalence of 1% in the general population and approximately 50% concordance rate in monozygotic twins was reported for schizophrenia, suggesting that genetic predisposition affecting neurodevelopmental processes might combine with environmental risk factors. A multitude of pathways seems to be involved in the aetiology and/or pathogenesis of schizophrenia, including dopaminergic, serotoninergic, muscarinic and glutamatergic signalling. The phosphoinositide signal transduction system and related phosphoinositide-specific phospholipase C (PI-PLC) enzymes seem to represent a point of convergence in these networking pathways during the development of selected brain regions. The existence of a susceptibility locus on the short arm of chromosome 20 moved us to analyse PLCB1, the gene codifying for PI-PLC β1 enzyme, which maps on 20p12. By using interphase fluorescent in situ hybridization methodology, we found deletions of PLCB1 in orbito-frontal cortex samples of schizophrenia-affected patients.

  2. Deletion of PLCB1 gene in schizophrenia-affected patients

    PubMed Central

    Vasco, Vincenza Rita Lo; Cardinale, Giuseppina; Polonia, Patrizia

    2012-01-01

    Abstract A prevalence of 1% in the general population and approximately 50% concordance rate in monozygotic twins was reported for schizophrenia, suggesting that genetic predisposition affecting neurodevelopmental processes might combine with environmental risk factors. A multitude of pathways seems to be involved in the aetiology and/or pathogenesis of schizophrenia, including dopaminergic, serotoninergic, muscarinic and glutamatergic signalling. The phosphoinositide signal transduction system and related phosphoinositide-specific phospholipase C (PI-PLC) enzymes seem to represent a point of convergence in these networking pathways during the development of selected brain regions. The existence of a susceptibility locus on the short arm of chromosome 20 moved us to analyse PLCB1, the gene codifying for PI-PLC β1 enzyme, which maps on 20p12. By using interphase fluorescent in situ hybridization methodology, we found deletions of PLCB1 in orbito-frontal cortex samples of schizophrenia-affected patients. PMID:22507702

  3. Adult Antisocial Behavior and Affect Regulation among Primary Crack/Cocaine-Using Women

    ERIC Educational Resources Information Center

    Litt, Lisa Caren; Hien, Denise A.; Levin, Deborah

    2003-01-01

    The relationship between deficits in affect regulation and Adult Antisocial Behavior (ASB) in primary crack/cocaine-using women was explored in a sample of 80 inner-city women. Narrative early memories were coded for two components of affect regulation, Affect Tolerance and Affect Expression, using the Epigenetic Assessment Rating Scale (EARS;…

  4. Glyphosate-based pesticides affect cell cycle regulation.

    PubMed

    Marc, Julie; Mulner-Lorillon, Odile; Bellé, Robert

    2004-04-01

    Cell-cycle dysregulation is a hallmark of tumor cells and human cancers. Failure in the cell-cycle checkpoints leads to genomic instability and subsequent development of cancers from the initial affected cell. A worldwide used product Roundup 3plus, based on glyphosate as the active herbicide, was suggested to be of human health concern since it induced cell cycle dysfunction as judged from analysis of the first cell division of sea urchin embryos, a recognized model for cell cycle studies. Several glyphosate-based pesticides from different manufacturers were assayed in comparison with Roundup 3plus for their ability to interfere with the cell cycle regulation. All the tested products, Amega, Cargly, Cosmic, and Roundup Biovert induced cell cycle dysfunction. The threshold concentration for induction of cell cycle dysfunction was evaluated for each product and suggests high risk by inhalation for people in the vicinity of the pesticide handling sprayed at 500 to 4000 times higher dose than the cell-cycle adverse concentration.

  5. Studying Gene Expression: Database Searches and Promoter Fusions to Investigate Transcriptional Regulation in Bacteria†

    PubMed Central

    Martinez-Vaz, Betsy M.; Makarevitch, Irina; Stensland, Shane

    2010-01-01

    A laboratory project was designed to illustrate how to search biological databases and utilize the information provided by these resources to investigate transcriptional regulation in Escherichia coli. The students searched several databases (NCBI Genomes, RegulonDB and EcoCyc) to learn about gene function, regulation, and the organization of transcriptional units. A fluorometer and GFP promoter fusions were used to obtain fluorescence data and measure changes in transcriptional activity. The class designed and performed experiments to investigate the regulation of genes necessary for biosynthesis of amino acids and how expression is affected by environmental signals and transcriptional regulators. Assessment data showed that this activity enhanced students’ knowledge of databases, reporter genes and transcriptional regulation. PMID:23653697

  6. Natural variation in ARF18 gene simultaneously affects seed weight and silique length in polyploid rapeseed

    PubMed Central

    Liu, Jing; Hua, Wei; Hu, Zhiyong; Yang, Hongli; Zhang, Liang; Li, Rongjun; Deng, Linbin; Sun, Xingchao; Wang, Xinfa; Wang, Hanzhong

    2015-01-01

    Seed weight (SW), which is one of the three major factors influencing grain yield, has been widely accepted as a complex trait that is controlled by polygenes, particularly in polyploid crops. Brassica napus L., which is the second leading crop source for vegetable oil around the world, is a tetraploid (4×) species. In the present study, we identified a major quantitative trait locus (QTL) on chromosome A9 of rapeseed in which the genes for SW and silique length (SL) were colocated. By fine mapping and association analysis, we uncovered a 165-bp deletion in the auxin-response factor 18 (ARF18) gene associated with increased SW and SL. ARF18 encodes an auxin-response factor and shows inhibitory activity on downstream auxin genes. This 55-aa deletion prevents ARF18 from forming homodimers, in turn resulting in the loss of binding activity. Furthermore, reciprocal crossing has shown that this QTL affects SW by maternal effects. Transcription analysis has shown that ARF18 regulates cell growth in the silique wall by acting via an auxin-response pathway. Together, our results suggest that ARF18 regulates silique wall development and determines SW via maternal regulation. In addition, our study reveals the first (to our knowledge) QTL in rapeseed and may provide insights into gene cloning involving polyploid crops. PMID:26324896

  7. Akt1 as a putative regulator of Hox genes.

    PubMed

    Kong, Kyoung-Ah; Yoon, Heejei; Kim, Myoung Hee

    2013-01-25

    In mammals, precise spatiotemporal expressions of Hox genes control the main body axis during embryogenesis. However, the mechanism by which Hox genes are regulated is poorly understood. To discover the putative regulator of Hox genes, in silico analyses were performed using GEO profiles, and Akt1 emerged as a candidate regulator of Hox genes in E13.5 MEFs. The results of the RT-PCR showed that 5' Hoxc genes, including ncRNA were upregulated in Akt1 null MEF. Combined bisulfite restriction analysis (COBRA) and bisulfite sequencing showed that the CpG island of a 5' Hoxc gene was hypomethylated in Akt1 null cells. These results indicate that Hox expression could be controlled by the function of Akt1 through epigenetic modification such as DNA methylation.

  8. Does regulating others' feelings influence people's own affective well-being?

    PubMed

    Niven, Karen; Totterdell, Peter; Holman, David; Headley, Tara

    2012-01-01

    Individuals in a variety of social contexts try to regulate other people's feelings, but how does this process affect the regulators themselves? This research aimed to establish a relationship between people's use of interpersonal affect regulation and their own affective well-being. In a field study, self- and other-reported data were collected from prisoners and staff members in a therapeutic prison using two surveys separated in time. In a laboratory study, a student sample reported their affect before and after attempting to influence the feelings of talent show contestants in a role-play task. The results of both studies indicated congruent associations between the use of affect-improving and affect-worsening interpersonal affect regulation and strategy agents' affective well-being. Our findings highlight that, when performing interpersonal affect regulation, people may not be immune from the effects of their own actions.

  9. Light-independent developmental regulation of cab gene expression in Arabidopsis thaliana seedlings.

    PubMed Central

    Brusslan, J A; Tobin, E M

    1992-01-01

    We found a transient increase in the amount of mRNA for four nuclear genes encoding chloroplast proteins during early development of Arabidopsis thaliana. This increase began soon after germination as cotyledons emerged from the seed coat; it occurred in total darkness and was not affected by external factors, such as gibberellins or light treatments used to stimulate germination. Three members of the cab gene family and the rbcS-1A gene exhibited this expression pattern. Because timing of the increase coincided with cotyledon emergence and because it occurred independently of external stimuli, we suggest that this increase represents developmental regulation of these genes. Further, 1.34 kilobases of the cab1 promoter was sufficient to confer this expression pattern on a reporter gene in transgenic Arabidopsis seedlings. The ability of the cab genes to respond to phytochrome preceded this developmental increase, showing that these two types of regulation are independent. Images PMID:1380166

  10. Mutation of AREA affects growth, sporulation, nitrogen regulation, and pathogenicity in Colletotrichum gloeosporioides.

    PubMed

    Bi, Fangcheng; Ment, Dana; Luria, Neta; Meng, Xiangchun; Prusky, Dov

    2017-02-01

    The GATA transcription factor AreA is a global nitrogen regulator that restricts the utilization of complex and poor nitrogen sources in the presence of good nitrogen sources in microorganisms. In this study, we report the biological function of an AreA homolog (the CgareA gene) in the fruit postharvest pathogen Colletotrichum gloeosporioides. Targeted gene deletion mutants of areA exhibited significant reductions in vegetative growth, increases in conidia production, and slight decreases in conidial germination rates. Quantitative RT-PCR (qRT-PCR) analysis revealed that the expression of AreA was highly induced under nitrogen-limiting conditions. Moreover, compared to wild-type and complemented strains, nitrogen metabolism-related genes were misregulated in ΔareA mutant strains. Pathogenicity assays indicated that the virulence of ΔareA mutant strains were affected by the nitrogen content, but not the carbon content, of fruit hosts. Taken together, our results indicate that CgareA plays a critical role in fungal development, conidia production, regulation of nitrogen metabolism and virulence in Colletotrichum gloeosporioides.

  11. Prediction of epigenetically regulated genes in breast cancer cell lines

    SciTech Connect

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  12. Predicting cell cycle regulated genes by causal interactions.

    PubMed

    Emmert-Streib, Frank; Dehmer, Matthias

    2009-08-18

    The fundamental difference between classic and modern biology is that technological innovations allow to generate high-throughput data to get insights into molecular interactions on a genomic scale. These high-throughput data can be used to infer gene networks, e.g., the transcriptional regulatory or signaling network, representing a blue print of the current dynamical state of the cellular system. However, gene networks do not provide direct answers to biological questions, instead, they need to be analyzed to reveal functional information of molecular working mechanisms. In this paper we propose a new approach to analyze the transcriptional regulatory network of yeast to predict cell cycle regulated genes. The novelty of our approach is that, in contrast to all other approaches aiming to predict cell cycle regulated genes, we do not use time series data but base our analysis on the prior information of causal interactions among genes. The major purpose of the present paper is to predict cell cycle regulated genes in S. cerevisiae. Our analysis is based on the transcriptional regulatory network, representing causal interactions between genes, and a list of known periodic genes. No further data are used. Our approach utilizes the causal membership of genes and the hierarchical organization of the transcriptional regulatory network leading to two groups of periodic genes with a well defined direction of information flow. We predict genes as periodic if they appear on unique shortest paths connecting two periodic genes from different hierarchy levels. Our results demonstrate that a classical problem as the prediction of cell cycle regulated genes can be seen in a new light if the concept of a causal membership of a gene is applied consequently. This also shows that there is a wealth of information buried in the transcriptional regulatory network whose unraveling may require more elaborate concepts than it might seem at first.

  13. Detection of differentially expressed genes in broiler pectoralis major muscle affected by White Striping - Wooden Breast myopathies.

    PubMed

    Zambonelli, Paolo; Zappaterra, Martina; Soglia, Francesca; Petracci, Massimiliano; Sirri, Federico; Cavani, Claudio; Davoli, Roberta

    2016-12-01

    White Striping and Wooden Breast (WS/WB) are abnormalities increasingly occurring in the fillets of high breast yield and growth rate chicken hybrids. These defects lead to consistent economic losses for poultry meat industry, as affected broiler fillets present an impaired visual appearance that negatively affects consumers' acceptability. Previous studies have highlighted in affected fillets a severely damaged muscle, showing profound inflammation, fibrosis, and lipidosis. The present study investigated the differentially expressed genes and pathways linked to the compositional changes observed in WS/WB breast muscles, in order to outline a more complete framework of the gene networks related to the occurrence of this complex pathological picture. The biochemical composition was performed on 20 pectoralis major samples obtained from high breast yield and growth rate broilers (10 affected vs. 10 normal) and 12 out of the 20 samples were used for the microarray gene expression profiling (6 affected vs. 6 normal). The obtained results indicate strong changes in muscle mineral composition, coupled to an increased deposition of fat. In addition, 204 differentially expressed genes (DEG) were found: 102 up-regulated and 102 down-regulated in affected breasts. The gene expression pathways found more altered in WS/WB muscles are those related to muscle development, polysaccharide metabolic processes, proteoglycans synthesis, inflammation, and calcium signaling pathway. On the whole, the findings suggest that a multifactorial and complex etiology is associated with the occurrence of WS/WB muscle abnormalities, contributing to further defining the transcription patterns associated with these myopathies.

  14. A Discovery Lab for Studying Gene Regulation.

    ERIC Educational Resources Information Center

    Moss, Robert

    1997-01-01

    Presents a laboratory in which students are provided with cultures of three bacterial strains. Using the results, students will determine which of the strains corresponds to a mutant lacking a particular functional gene. (DDR)

  15. Regulation of gene expression in the nervous system

    SciTech Connect

    Stella, A.M.G. ); de Vellis, J. ); Perez-Polo, J.R. 62230.

    1990-01-01

    This book covers subjects under the following topics: Plenary Lecture; Growth factors; Regulation of gene expression in neurons; Cell adhesion molecules and development; Nervous tissue reaction to injury-aging; and Poster presentation.

  16. Tbx16 regulates hox gene activation in mesodermal progenitor cells

    PubMed Central

    Payumo, Alexander Y.; McQuade, Lindsey E.; Walker, Whitney J.; Yamazoe, Sayumi; Chen, James K.

    2016-01-01

    The transcription factor T-box 16 (Tbx16/Spadetail) is an essential regulator of paraxial mesoderm development in zebrafish (Danio rerio). Mesodermal progenitor cells (MPCs) fail to differentiate into trunk somites in tbx16 mutants and instead accumulate within the tailbud in an immature state. The mechanisms by which Tbx16 controls mesoderm patterning have remained enigmatic, and we describe here the application of photoactivatable morpholino oligonucleotides to determine the Tbx16 transcriptome in MPCs. We identify 124 Tbx16-regulated genes that are expressed in zebrafish gastrulae, including several developmental signaling proteins and regulators of gastrulation, myogenesis, and somitogenesis. Unexpectedly, we observe that loss of Tbx16 function precociously activates posterior hox genes in MPCs, and overexpression of a single posterior hox gene is sufficient to disrupt MPC migration. Our studies support a model in which Tbx16 regulates the timing of collinear hox gene activation to coordinate the anterior-posterior fates and positions of paraxial MPCs. PMID:27376691

  17. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  18. Retrograde regulation of nuclear gene expression in CW-CMS of rice.

    PubMed

    Fujii, Sota; Komatsu, Setsuko; Toriyama, Kinya

    2007-02-01

    The CW-cytoplasmic male sterility (CMS) line has the cytoplasm of Oryza rufipogon Griff, and mature pollen is morphologically normal under an optical microscope but lacks the ability to germinate; restorer gene Rf17 has been identified as restoring this ability. The difference between nuclear gene expression in mature anthers was compared for the CW-CMS line, [cms-CW] rf17rf17, and a maintainer line with normal cytoplasm of Oryza sativa L., [normal] rf17rf17. Using a 22-k rice oligoarray we detected 58 genes that were up-regulated more than threefold in the CW-CMS line. Expression in other organs was further investigated for 20 genes using RT-PCR. Five genes, including genes for alternative oxidase, were found to be preferentially expressed in [cms-CW] rf17rf17 but not in [normal] rf17rf17 or [cms-CW] Rf17Rf17. Such [cms-CW] rf17rf17-specific gene expression was only observed in mature anthers but not in leaves, stems, or roots, indicating the presence of anther-specific mitochondrial retrograde regulation of nuclear gene expression, and that Rf17 has a role in restoring the ectopic gene expression. We also used a proteomic approach to discover the retrograde regulated proteins and identified six proteins that were accumulated differently. These results reveal organ-specific induced mitochondrial retrograde pathways affecting nuclear gene expression possibly related to CMS.

  19. Light affects ascorbate content and ascorbate-related gene expression in tomato leaves more than in fruits.

    PubMed

    Massot, Capucine; Stevens, Rebecca; Génard, Michel; Longuenesse, Jean-Jacques; Gautier, Hélène

    2012-01-01

    Little is known about the light regulation of vitamin C synthesis in fruits. In contrast, previous studies in leaves revealed that VTC2 (coding for GDP-L: -galactose phosphorylase) was one of the key genes up-regulated by light in leaves. Our objective was to determine how the expression of ascorbate (AsA) synthesis genes in tomato (Solanum lycopersicum) was modified according to light irradiance in both leaves and fruits. Seven days of shading strongly decreased total ascorbate (reduced and oxidized form) content in leaves (50%) and to a lesser extent in fruits (10%). Among the last six steps of AsA biosynthesis, only two genes, VTC2 and GPP1 (one of the two unigenes coding for L: -galactose-1-P phosphatase in tomato), were down-regulated by long-term shading in red ripe fruits, compared to seven genes regulated in leaves. This underlines that light affects AsA-related gene expression more in leaves than in ripening fruits. Moreover, this study reveals strong daily changes in transcript levels of enzymes of the AsA biosynthetic pathway in leaves (11 of the 12 studied genes showed significant changes in their expression pattern). Among those genes, we found that diurnal variation in transcript levels of VTC2 and GME1 correlated to leaf AsA content measured 8 h later. This study provides a new hypothesis on the role of GME1 in addition to VTC2 in light-regulated AsA biosynthesis.

  20. l-Ornithine affects peripheral clock gene expression in mice

    PubMed Central

    Fukuda, Takafumi; Haraguchi, Atsushi; Kuwahara, Mari; Nakamura, Kaai; Hamaguchi, Yutaro; Ikeda, Yuko; Ishida, Yuko; Wang, Guanying; Shirakawa, Chise; Tanihata, Yoko; Ohara, Kazuaki; Shibata, Shigenobu

    2016-01-01

    The peripheral circadian clock is entrained by factors in the external environment such as scheduled feeding, exercise, and mental and physical stresses. In addition, recent studies in mice demonstrated that some food components have the potential to control the peripheral circadian clock during scheduled feeding, although information about these components remains limited. l-Ornithine is a type of non-protein amino acid that is present in foods and has been reported to have various physiological functions. In human trials, for example, l-ornithine intake improved a subjective index of sleep quality. Here we demonstrate, using an in vivo monitoring system, that repeated oral administration of l-ornithine at an early inactive period in mice induced a phase advance in the rhythm of PER2 expression. By contrast, l-ornithine administration to mouse embryonic fibroblasts did not affect the expression of PER2, indicating that l-ornithine indirectly alters the phase of PER2. l-Ornithine also increased plasma levels of insulin, glucose and glucagon-like peptide-1 alongside mPer2 expression, suggesting that it exerts its effects probably via insulin secretion. Collectively, these findings demonstrate that l-ornithine affects peripheral clock gene expression and may expand the possibilities of L-ornithine as a health food. PMID:27703199

  1. l-Ornithine affects peripheral clock gene expression in mice.

    PubMed

    Fukuda, Takafumi; Haraguchi, Atsushi; Kuwahara, Mari; Nakamura, Kaai; Hamaguchi, Yutaro; Ikeda, Yuko; Ishida, Yuko; Wang, Guanying; Shirakawa, Chise; Tanihata, Yoko; Ohara, Kazuaki; Shibata, Shigenobu

    2016-10-05

    The peripheral circadian clock is entrained by factors in the external environment such as scheduled feeding, exercise, and mental and physical stresses. In addition, recent studies in mice demonstrated that some food components have the potential to control the peripheral circadian clock during scheduled feeding, although information about these components remains limited. l-Ornithine is a type of non-protein amino acid that is present in foods and has been reported to have various physiological functions. In human trials, for example, l-ornithine intake improved a subjective index of sleep quality. Here we demonstrate, using an in vivo monitoring system, that repeated oral administration of l-ornithine at an early inactive period in mice induced a phase advance in the rhythm of PER2 expression. By contrast, l-ornithine administration to mouse embryonic fibroblasts did not affect the expression of PER2, indicating that l-ornithine indirectly alters the phase of PER2. l-Ornithine also increased plasma levels of insulin, glucose and glucagon-like peptide-1 alongside mPer2 expression, suggesting that it exerts its effects probably via insulin secretion. Collectively, these findings demonstrate that l-ornithine affects peripheral clock gene expression and may expand the possibilities of L-ornithine as a health food.

  2. Biotic Stress Globally Down-Regulates Photosynthesis Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Upon herbivore and pathogen attacks, plants switch from processes supporting growth and reproduction to defense by inducing a set of defense genes and down-regulating most of the nuclear encoded photosynthetic genes. To determine if this transcriptional response is universal we used transcriptome da...

  3. Gene regulation: hacking the network on a sugar high.

    PubMed

    Ellis, Tom; Wang, Xiao; Collins, James J

    2008-04-11

    In a recent issue of Molecular Cell, Kaplan et al. (2008) determine the input functions for 19 E. coli sugar-utilization genes by using a two-dimensional high-throughput approach. The resulting input-function map reveals that gene network regulation follows non-Boolean, and often nonmonotonic, logic.

  4. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    DTIC Science & Technology

    2005-08-01

    14 . ABSTRACT Neurofibromatosis type 2 (NF2) is associated with a homozygous inactivation of the neurofibromatosis 2 (NF2) gene. Despite intense...direct β-galactosidase (β-gal) reporter expression as early as embryonic day 5.5 (E5.5). NF2 promoter activity was first detected in the embryonic...8 carrying a 2.4-kb NF2 promoter-driven the lacZ gene with a nuclear localization signal. Whole- mount X-gal staining of embryos at various days

  5. IGF-Regulated Genes in Prostate Cancer

    DTIC Science & Technology

    2006-02-01

    Burgess, A.W., and Ward, C.W. (2002) Cell 110(6), 763-773 53. Sambrook, J., Maniatis , T., and Fritsch, E.F. (1989) Molecular cloning : a laboratory...triplicate arrays that each contain >12,000 sequence-verified, non-redundant human cDNA clones . Data were analyzed by accepted means of normalization...this award. Review of the field-published in Genes, Chromosomes, and Cancer 36: 113-120 (2003) The IGFI Receptor Gene: A Molecular Target for

  6. Stochastic model of transcription factor-regulated gene expression

    NASA Astrophysics Data System (ADS)

    Karmakar, Rajesh; Bose, Indrani

    2006-09-01

    We consider a stochastic model of transcription factor (TF)-regulated gene expression. The model describes two genes, gene A and gene B, which synthesize the TFs and the target gene proteins, respectively. We show through analytic calculations that the TF fluctuations have a significant effect on the distribution of the target gene protein levels when the mean TF level falls in the highest sensitive region of the dose-response curve. We further study the effect of reducing the copy number of gene A from two to one. The enhanced TF fluctuations yield results different from those in the deterministic case. The probability that the target gene protein level exceeds a threshold value is calculated with the knowledge of the probability density functions associated with the TF and target gene protein levels. Numerical simulation results for a more detailed stochastic model are shown to be in agreement with those obtained through analytic calculations. The relevance of these results in the context of the genetic disorder haploinsufficiency is pointed out. Some experimental observations on the haploinsufficiency of the tumour suppressor gene, Nkx 3.1, are explained with the help of the stochastic model of TF-regulated gene expression.

  7. Mutations in two regions upstream of the A gamma globin gene canonical promoter affect gene expression.

    PubMed Central

    Lloyd, J A; Lee, R F; Lingrel, J B

    1989-01-01

    Two regions upstream of the human fetal (A gamma) globin gene, which interact with protein factors from K562 and HeLa nuclear extracts, have functional significance in gene expression. One binding site (site I) is at a position -290 to -267 bp upstream of the transcription initiation site, the other (site II) is at -182 to -168 bp. Site II includes the octamer sequence (ATGCAAAT) found in an immunoglobulin enhancer and the histone H2b gene promoter. A point mutation (T----C) at -175, within the octamer sequence, is characteristic of a naturally occurring HPFH (hereditary persistence of fetal hemoglobin), and decreases factor binding to an oligonucleotide containing the octamer motif. Expression assays using a A gamma globin promoter-CAT (chloramphenicol acetyl transferase) fusion gene show that the point mutation at -175 increases expression in erythroid, but not non-erythroid cells when compared to a wild-type construct. This correlates with the actual effect of the HPFH mutation in humans. This higher expression may result from a mechanism more complex than reduced binding of a negative regulator. A site I clustered-base substitution gives gamma-CAT activity well below wild-type, suggesting that this factor is a positive regulator. Images PMID:2472607

  8. Nuclear pore complexes and regulation of gene expression.

    PubMed

    Raices, Marcela; D'Angelo, Maximiliano A

    2017-01-11

    Nuclear pore complexes (NPCs), are large multiprotein channels that penetrate the nuclear envelope connecting the nucleus to the cytoplasm. Accumulating evidence shows that besides their main role in regulating the exchange of molecules between these two compartments, NPCs and their components also play important transport-independent roles, including gene expression regulation, chromatin organization, DNA repair, RNA processing and quality control, and cell cycle control. Here, we will describe the recent findings about the role of these structures in the regulation of gene expression.

  9. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    DTIC Science & Technology

    2006-07-01

    0.1% Tween) three times, placed in 100% methanol, and then bleached at room temperature for 5 hr by adding hydrogen peroxide to 6%. After rinsing with...Mukhopadhyay A, Banerjee S, Stafford LJ, et al. Curcumin - induced suppression of cell proliferation correlates with down-regulation of cyclin D1 expression

  10. Y Chromosome Regulation of Autism Susceptibility Genes

    DTIC Science & Technology

    2009-06-01

    Garcia- Barcelo , M., et al., TTF-1 and RET promoter SNPs: regulation of RET transcription in Hirschsprung’s disease. Hum Mol Genet, 2005. 14(2): p. 191...204. 50. Tam, P.K. and M. Garcia- Barcelo , Molecular genetics of Hirschsprung’s disease. Semin Pediatr Surg, 2004. 13(4): p. 236-48. 51. Amiel, J., et

  11. Cost benefit theory and optimal design of gene regulation functions

    NASA Astrophysics Data System (ADS)

    Kalisky, Tomer; Dekel, Erez; Alon, Uri

    2007-12-01

    Cells respond to the environment by regulating the expression of genes according to environmental signals. The relation between the input signal level and the expression of the gene is called the gene regulation function. It is of interest to understand the shape of a gene regulation function in terms of the environment in which it has evolved and the basic constraints of biological systems. Here we address this by presenting a cost-benefit theory for gene regulation functions that takes into account temporally varying inputs in the environment and stochastic noise in the biological components. We apply this theory to the well-studied lac operon of E. coli. The present theory explains the shape of this regulation function in terms of temporal variation of the input signals, and of minimizing the deleterious effect of cell-cell variability in regulatory protein levels. We also apply the theory to understand the evolutionary tradeoffs in setting the number of regulatory proteins and for selection of feed-forward loops in genetic circuits. The present cost-benefit theory can be used to understand the shape of other gene regulatory functions in terms of environment and noise constraints.

  12. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    SciTech Connect

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  13. Thyroid hormone regulated genes in cerebral cortex development.

    PubMed

    Bernal, Juan

    2017-02-01

    The physiological and developmental effects of thyroid hormones are mainly due to the control of gene expression after interaction of T3 with the nuclear receptors. To understand the role of thyroid hormones on cerebral cortex development, knowledge of the genes regulated by T3 during specific stages of development is required. In our laboratory, we previously identified genes regulated by T3 in primary cerebrocortical cells in culture. By comparing these data with transcriptomics of purified cell types from the developing cortex, the cellular targets of T3 can be identified. In addition, many of the genes regulated transcriptionally by T3 have defined roles in cortex development, from which the role of T3 can be derived. This review analyzes the specific roles of T3-regulated genes in the different stages of cortex development within the physiological frame of the developmental changes of thyroid hormones and receptor concentrations in the human cerebral cortex during fetal development. These data indicate an increase in the sensitivity to T3 during the second trimester of fetal development. The main cellular targets of T3 appear to be the Cajal-Retzius and the subplate neurons. On the other hand, T3 regulates transcriptionally genes encoding extracellular matrix proteins, involved in cell migration and the control of diverse signaling pathways.

  14. Intrinsic limits to gene regulation by global crosstalk

    PubMed Central

    Friedlander, Tamar; Prizak, Roshan; Guet, Călin C.; Barton, Nicholas H.; Tkačik, Gašper

    2016-01-01

    Gene regulation relies on the specificity of transcription factor (TF)–DNA interactions. Limited specificity may lead to crosstalk: a regulatory state in which a gene is either incorrectly activated due to noncognate TF–DNA interactions or remains erroneously inactive. As each TF can have numerous interactions with noncognate cis-regulatory elements, crosstalk is inherently a global problem, yet has previously not been studied as such. We construct a theoretical framework to analyse the effects of global crosstalk on gene regulation. We find that crosstalk presents a significant challenge for organisms with low-specificity TFs, such as metazoans. Crosstalk is not easily mitigated by known regulatory schemes acting at equilibrium, including variants of cooperativity and combinatorial regulation. Our results suggest that crosstalk imposes a previously unexplored global constraint on the functioning and evolution of regulatory networks, which is qualitatively distinct from the known constraints that act at the level of individual gene regulatory elements. PMID:27489144

  15. Antidepressant actions of the exercise-regulated gene VGF.

    PubMed

    Hunsberger, Joshua G; Newton, Samuel S; Bennett, Alicia H; Duman, Catharine H; Russell, David S; Salton, Stephen R; Duman, Ronald S

    2007-12-01

    Exercise has many health benefits, including antidepressant actions in depressed human subjects, but the mechanisms underlying these effects have not been elucidated. We used a custom microarray to identify a previously undescribed profile of exercise-regulated genes in the mouse hippocampus, a brain region implicated in mood and antidepressant response. Pathway analysis of the regulated genes shows that exercise upregulates a neurotrophic factor signaling cascade that has been implicated in the actions of antidepressants. One of the most highly regulated target genes of exercise and of the growth factor pathway is the gene encoding the VGF nerve growth factor, a peptide precursor previously shown to influence synaptic plasticity and metabolism. We show that administration of a synthetic VGF-derived peptide produces a robust antidepressant response in mice and, conversely, that mutation of VGF in mice produces the opposite effects. The results suggest a new role for VGF and identify VGF signaling as a potential therapeutic target for antidepressant drug development.

  16. A genomics approach identifies senescence-specific gene expression regulation

    PubMed Central

    Lackner, Daniel H; Hayashi, Makoto T; Cesare, Anthony J; Karlseder, Jan

    2014-01-01

    Replicative senescence is a fundamental tumor-suppressive mechanism triggered by telomere erosion that results in a permanent cell cycle arrest. To understand the impact of telomere shortening on gene expression, we analyzed the transcriptome of diploid human fibroblasts as they progressed toward and entered into senescence. We distinguished novel transcription regulation due to replicative senescence by comparing senescence-specific expression profiles to profiles from cells arrested by DNA damage or serum starvation. Only a small specific subset of genes was identified that was truly senescence-regulated and changes in gene expression were exacerbated from presenescent to senescent cells. The majority of gene expression regulation in replicative senescence was shown to occur due to telomere shortening, as exogenous telomerase activity reverted most of these changes. PMID:24863242

  17. A genomics approach identifies senescence-specific gene expression regulation.

    PubMed

    Lackner, Daniel H; Hayashi, Makoto T; Cesare, Anthony J; Karlseder, Jan

    2014-10-01

    Replicative senescence is a fundamental tumor-suppressive mechanism triggered by telomere erosion that results in a permanent cell cycle arrest. To understand the impact of telomere shortening on gene expression, we analyzed the transcriptome of diploid human fibroblasts as they progressed toward and entered into senescence. We distinguished novel transcription regulation due to replicative senescence by comparing senescence-specific expression profiles to profiles from cells arrested by DNA damage or serum starvation. Only a small specific subset of genes was identified that was truly senescence-regulated and changes in gene expression were exacerbated from presenescent to senescent cells. The majority of gene expression regulation in replicative senescence was shown to occur due to telomere shortening, as exogenous telomerase activity reverted most of these changes.

  18. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  19. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  20. Pleiotropic Genes Affecting Carcass Traits in Bos indicus (Nellore) Cattle Are Modulators of Growth

    PubMed Central

    Milanesi, Marco; Torrecilha, Rafaela B. P.; Carmo, Adriana S.; Neves, Haroldo H. R.; Carvalheiro, Roberto; Ajmone-Marsan, Paolo; Sonstegard, Tad S.; Sölkner, Johann; Contreras-Castillo, Carmen J.; Garcia, José F.

    2016-01-01

    Two complementary methods, namely Multi-Trait Meta-Analysis and Versatile Gene-Based Test for Genome-wide Association Studies (VEGAS), were used to identify putative pleiotropic genes affecting carcass traits in Bos indicus (Nellore) cattle. The genotypic data comprised over 777,000 single-nucleotide polymorphism markers scored in 995 bulls, and the phenotypic data included deregressed breeding values (dEBV) for weight measurements at birth, weaning and yearling, as well visual scores taken at weaning and yearling for carcass finishing precocity, conformation and muscling. Both analyses pointed to the pleomorphic adenoma gene 1 (PLAG1) as a major pleiotropic gene. VEGAS analysis revealed 224 additional candidates. From these, 57 participated, together with PLAG1, in a network involved in the modulation of the function and expression of IGF1 (insulin like growth factor 1), IGF2 (insulin like growth factor 2), GH1 (growth hormone 1), IGF1R (insulin like growth factor 1 receptor) and GHR (growth hormone receptor), suggesting that those pleiotropic genes operate as satellite regulators of the growth pathway. PMID:27410030

  1. Pleiotropic Genes Affecting Carcass Traits in Bos indicus (Nellore) Cattle Are Modulators of Growth.

    PubMed

    G T Pereira, Anirene; Utsunomiya, Yuri T; Milanesi, Marco; Torrecilha, Rafaela B P; Carmo, Adriana S; Neves, Haroldo H R; Carvalheiro, Roberto; Ajmone-Marsan, Paolo; Sonstegard, Tad S; Sölkner, Johann; Contreras-Castillo, Carmen J; Garcia, José F

    2016-01-01

    Two complementary methods, namely Multi-Trait Meta-Analysis and Versatile Gene-Based Test for Genome-wide Association Studies (VEGAS), were used to identify putative pleiotropic genes affecting carcass traits in Bos indicus (Nellore) cattle. The genotypic data comprised over 777,000 single-nucleotide polymorphism markers scored in 995 bulls, and the phenotypic data included deregressed breeding values (dEBV) for weight measurements at birth, weaning and yearling, as well visual scores taken at weaning and yearling for carcass finishing precocity, conformation and muscling. Both analyses pointed to the pleomorphic adenoma gene 1 (PLAG1) as a major pleiotropic gene. VEGAS analysis revealed 224 additional candidates. From these, 57 participated, together with PLAG1, in a network involved in the modulation of the function and expression of IGF1 (insulin like growth factor 1), IGF2 (insulin like growth factor 2), GH1 (growth hormone 1), IGF1R (insulin like growth factor 1 receptor) and GHR (growth hormone receptor), suggesting that those pleiotropic genes operate as satellite regulators of the growth pathway.

  2. Identification of NDRG1-regulated genes associated with invasive potential in cervical and ovarian cancer cells

    SciTech Connect

    Zhao, Gang; Chen, Jiawei; Deng, Yanqiu; Gao, Feng; Zhu, Jiwei; Feng, Zhenzhong; Lv, Xiuhong; Zhao, Zheng

    2011-04-29

    Highlights: {yields} NDRG1 was knockdown in cervical and ovarian cancer cell lines by shRNA technology. {yields} NDRG1 knockdown resulted in increased cell invasion activities. {yields} Ninety-six common deregulated genes in both cell lines were identified by cDNA microarray. {yields} Eleven common NDRG1-regulated genes might enhance cell invasive activity. {yields} Regulation of invasion by NDRG1 is an indirect and complicated process. -- Abstract: N-myc downstream regulated gene 1 (NDRG1) is an important gene regulating tumor invasion. In this study, shRNA technology was used to suppress NDRG1 expression in CaSki (a cervical cancer cell line) and HO-8910PM (an ovarian cancer cell line). In vitro assays showed that NDRG1 knockdown enhanced tumor cell adhesion, migration and invasion activities without affecting cell proliferation. cDNA microarray analysis revealed 96 deregulated genes with more than 2-fold changes in both cell lines after NDRG1 knockdown. Ten common upregulated genes (LPXN, DDR2, COL6A1, IL6, IL8, FYN, PTP4A3, PAPPA, ETV5 and CYGB) and one common downregulated gene (CLCA2) were considered to enhance tumor cell invasive activity. BisoGenet network analysis indicated that NDRG1 regulated these invasion effector genes/proteins in an indirect manner. Moreover, NDRG1 knockdown also reduced pro-invasion genes expression such as MMP7, TMPRSS4 and CTSK. These results suggest that regulation of invasion and metastasis by NDRG1 is a highly complicated process.

  3. Gravity regulated genes in Arabidopsis thaliana (GENARA experiment)

    NASA Astrophysics Data System (ADS)

    Boucheron-Dubuisson, Elodie; Carnero-D&íaz, Eugénie; Medina, Francisco Javier; Gasset, Gilbert; Pereda-Loth, Veronica; Graziana, Annick; Mazars, Christian; Le Disquet, Isabelle; Eche, Brigitte; Grat, Sabine; Gauquelin-Koch, Guillemette

    2012-07-01

    In higher plants, post-embryonic development is possible through the expression of a set of genes constituting the morphogenetic program that contribute to the production of tissues and organs during the whole plant life cycle. Plant development is mainly controlled by internal factors such as phytohormones, as well as by environmental factors, among which gravity plays a key role (gravi-morphogenetic program). The GENARA space experiment has been designed with the goal of contributing to a better understanding of this gravi-morphogenetic program through the identification and characterization of some gravity regulated proteins (GR proteins) by using quantitative proteomic methods, and through the study of the impact of plant hormones on the expression of this program. Among plant hormones, auxin is the major regulator of organogenesis. In fact, it affects numerous plant developmental processes, e.g. cell division and elongation, autumnal loss of leaves, and the formation of buds, roots, flowers and fruits. Furthermore, it also plays a key role in the mechanisms of different tropisms (including gravitropism) that modulate fundamental features of plant growth. The expression of significant genes involved in auxin transport and in auxin signal perception in root cells is being studied in space-grown seedlings and compared with the corresponding ground controls. This experiment was scheduled to be performed in The European Modular Cultivation System (EMCS), a new facility for plant cultivation and Plant Molecular Biology studies, at ISS. However only one aspect of this experiment was flown and concerns the qualitative and quantitative changes in membrane proteins supposed to be mainly associated with cell signaling and has been called GENARA A. The second part dealing with the function of auxin in the gravi-morphogenetic program and the alterations induced by microgravity will be studied through mutants affected on biosynthesis, transport or perception of auxin in a

  4. Identification of NDRG1-regulated genes associated with invasive potential in cervical and ovarian cancer cells.

    PubMed

    Zhao, Gang; Chen, Jiawei; Deng, Yanqiu; Gao, Feng; Zhu, Jiwei; Feng, Zhenzhong; Lv, Xiuhong; Zhao, Zheng

    2011-04-29

    N-myc downstream regulated gene 1 (NDRG1) is an important gene regulating tumor invasion. In this study, shRNA technology was used to suppress NDRG1 expression in CaSki (a cervical cancer cell line) and HO-8910PM (an ovarian cancer cell line). In vitro assays showed that NDRG1 knockdown enhanced tumor cell adhesion, migration and invasion activities without affecting cell proliferation. cDNA microarray analysis revealed 96 deregulated genes with more than 2-fold changes in both cell lines after NDRG1 knockdown. Ten common upregulated genes (LPXN, DDR2, COL6A1, IL6, IL8, FYN, PTP4A3, PAPPA, ETV5 and CYGB) and one common downregulated gene (CLCA2) were considered to enhance tumor cell invasive activity. BisoGenet network analysis indicated that NDRG1 regulated these invasion effector genes/proteins in an indirect manner. Moreover, NDRG1 knockdown also reduced pro-invasion genes expression such as MMP7, TMPRSS4 and CTSK. These results suggest that regulation of invasion and metastasis by NDRG1 is a highly complicated process.

  5. Spatial regulation of the Antennapedia and Ultrabithorax homeotic genes during Drosophila early development.

    PubMed Central

    Irish, V F; Martinez-Arias, A; Akam, M

    1989-01-01

    Both maternally supplied products and zygotically acting segmentation genes are required to establish the segment pattern of the Drosophila embryo. These genes are thought to act in part by regulating the expression of the homeotic genes. Products of the maternal and zygotic gap genes are present in the egg prior to blastoderm formation, when the homeotic genes are initially expressed within precisely bounded domains. In order to assess the first regulatory interactions between some of these gap gene products and the homeotic genes, we have examined the spatial distribution of transcripts arising from the homeotic Antp and Ubx genes during early embryogenesis in various mutant backgrounds. Here we show that mutations in both maternally and zygotically acting gap genes differentially affect the initial spatial domains of transcripts arising from each of these homeotic gene promoters. Later in embryogenesis, the patterns of homeotic gene expression change in both the wild-type and mutant cases, suggesting that other regulatory activities come into play. We propose a model in which the initial activation of each homeotic gene promoter depends on a unique combination of gap and pair-rule gene activities. Images PMID:2569971

  6. DNA Methylation is Developmentally Regulated for Genes Essential for Cardiogenesis

    PubMed Central

    Chamberlain, Alyssa A.; Lin, Mingyan; Lister, Rolanda L.; Maslov, Alex A.; Wang, Yidong; Suzuki, Masako; Wu, Bingruo; Greally, John M.; Zheng, Deyou; Zhou, Bin

    2014-01-01

    Background DNA methylation is a major epigenetic mechanism altering gene expression in development and disease. However, its role in the regulation of gene expression during heart development is incompletely understood. The aim of this study is to reveal DNA methylation in mouse embryonic hearts and its role in regulating gene expression during heart development. Methods and Results We performed the genome‐wide DNA methylation profiling of mouse embryonic hearts using methyl‐sensitive, tiny fragment enrichment/massively parallel sequencing to determine methylation levels at ACGT sites. The results showed that while global methylation of 1.64 million ACGT sites in developing hearts remains stable between embryonic day (E) 11.5 and E14.5, a small fraction (2901) of them exhibit differential methylation. Gene Ontology analysis revealed that these sites are enriched at genes involved in heart development. Quantitative real‐time PCR analysis of 350 genes with differential DNA methylation showed that the expression of 181 genes is developmentally regulated, and 79 genes have correlative changes between methylation and expression, including hyaluronan synthase 2 (Has2). Required for heart valve formation, Has2 expression in the developing heart valves is downregulated at E14.5, accompanied with increased DNA methylation in its enhancer. Genetic knockout further showed that the downregulation of Has2 expression is dependent on DNA methyltransferase 3b, which is co‐expressed with Has2 in the forming heart valve region, indicating that the DNA methylation change may contribute to the Has2 enhancer's regulating function. Conclusions DNA methylation is developmentally regulated for genes essential to heart development, and abnormal DNA methylation may contribute to congenital heart disease. PMID:24947998

  7. Affect Regulation Training (ART) for Alcohol Use Disorders: Development of a Novel Intervention for Negative Affect Drinkers

    PubMed Central

    Stasiewicz, Paul R.; Bradizza, Clara M.; Schlauch, Robert C.; Coffey, Scott F.; Gulliver, Suzy B.; Gudleski, Gregory; Bole, Christopher W.

    2013-01-01

    Although negative affect is a common precipitant of alcohol relapse, there are few interventions for alcohol dependence that specifically target negative affect. In this Stage 1a/1b treatment development study, several affect regulation strategies (e.g., mindfulness, prolonged exposure, distress tolerance) were combined to create a new treatment supplement called Affect Regulation Training (ART), which could be added to enhance Cognitive-Behavioral Therapy (CBT) for alcohol dependence. A draft therapy manual was given to therapists and treatment experts before being administered to several patients who also provided input. After two rounds of manual development (Stage 1a), a pilot randomized clinical trial (N = 77) of alcohol-dependent outpatients who reported drinking often in negative affect situations was conducted (Stage 1b). Participants received 12-weekly, 90-minute sessions of either CBT for alcohol dependence plus ART (CBT + ART) or CBT plus a healthy lifestyles control condition (CBT + HLS). Baseline, end-of-treatment, and 3- and 6-month posttreatment interviews were conducted. For both treatment conditions, participant ratings of treatment satisfaction were high, with CBT + ART rated significantly higher. Drinking outcome results indicated greater reductions in alcohol use for CBT + ART when compared to CBT + HLS, with moderate effect sizes for percent days abstinent, drinks per day, drinks per drinking day, and percent heavy drinking days. Overall, findings support further research on affect regulation interventions for negative affect drinkers. PMID:23876455

  8. Economic Approaches to Estimating Benefits of Regulations Affecting Addictive Goods.

    PubMed

    Cutler, David M; Jessup, Amber I; Kenkel, Donald S; Starr, Martha A

    2016-05-01

    The question of how to evaluate lost consumer surplus in benefit-cost analyses has been contentious. There are clear health benefits of regulations that curb consumption of goods with health risks, such as tobacco products and foods high in fats, calories, sugar, and sodium. Yet, if regulations cause consumers to give up goods they like, the health benefits they experience may be offset by some utility loss, which benefit-cost analyses of regulations need to take into account. This paper lays out the complications of measuring benefits of regulations aiming to curb consumption of addictive and habitual goods, rooted in the fact that consumers' observed demand for such goods may not be in line with their true preferences. Focusing on the important case of tobacco products, the paper describes four possible approaches for estimating benefits when consumers' preferences may not be aligned with their behavior, and identifies one as having the best feasibility for use in applied benefit-cost analyses in the near term.

  9. Identification of human HK genes and gene expression regulation study in cancer from transcriptomics data analysis.

    PubMed

    Chen, Meili; Xiao, Jingfa; Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer.

  10. Evolution of Brain Active Gene Promoters in Human Lineage Towards the Increased Plasticity of Gene Regulation.

    PubMed

    Gunbin, Konstantin V; Ponomarenko, Mikhail P; Suslov, Valentin V; Gusev, Fedor; Fedonin, Gennady G; Rogaev, Evgeny I

    2017-02-24

    Adaptability to a variety of environmental conditions is a prominent feature of Homo sapiens. We hypothesize that this feature can be explained by evolutionary changes in gene promoters active in the brain prefrontal cortex leading to a more flexible gene regulation network. The genotype-dependent range of gene expression can be broader in humans than in other higher primates. Thus, we searched for specific signatures of evolutionary changes in promoter architectures of multiple hominid genes, including the genes active in human cortical neurons that may indicate an increase of variability of gene expression rather than just changes in the level of expression, such as downregulation or upregulation of the genes. We performed a whole-genome search for genetic-based alterations that may impact gene regulation "flexibility" in a process of hominids evolution, such as (i) CpG dinucleotide content, (ii) predicted nucleosome-DNA dissociation constant, and (iii) predicted affinities for TATA-binding protein (TBP) in gene promoters. We tested all putative promoter regions across the human genome and especially gene promoters in active chromatin state in neurons of prefrontal cortex, the brain region critical for abstract thinking and social and behavioral adaptation. Our data imply that the origin of modern man has been associated with an increase of flexibility of promoter-driven gene regulation in brain. In contrast, after splitting from the ancestral lineages of H. sapiens, the evolution of ape species is characterized by reduced flexibility of gene promoter functioning, underlying reduced variability of the gene expression.

  11. TAM receptors affect adult brain neurogenesis by negative regulation of microglial cell activation.

    PubMed

    Ji, Rui; Tian, Shifu; Lu, Helen J; Lu, Qingjun; Zheng, Yan; Wang, Xiaomin; Ding, Jixiang; Li, Qiutang; Lu, Qingxian

    2013-12-15

    TAM tyrosine kinases play multiple functional roles, including regulation of the target genes important in homeostatic regulation of cytokine receptors or TLR-mediated signal transduction pathways. In this study, we show that TAM receptors affect adult hippocampal neurogenesis and loss of TAM receptors impairs hippocampal neurogenesis, largely attributed to exaggerated inflammatory responses by microglia characterized by increased MAPK and NF-κB activation and elevated production of proinflammatory cytokines that are detrimental to neuron stem cell proliferation and neuronal differentiation. Injection of LPS causes even more severe inhibition of BrdU incorporation in the Tyro3(-/-)Axl(-/-)Mertk(-/-) triple-knockout (TKO) brains, consistent with the LPS-elicited enhanced expression of proinflammatory mediators, for example, IL-1β, IL-6, TNF-α, and inducible NO synthase, and this effect is antagonized by coinjection of the anti-inflammatory drug indomethacin in wild-type but not TKO brains. Conditioned medium from TKO microglia cultures inhibits neuron stem cell proliferation and neuronal differentiation. IL-6 knockout in Axl(-/-)Mertk(-/-) double-knockout mice overcomes the inflammatory inhibition of neurogenesis, suggesting that IL-6 is a major downstream neurotoxic mediator under homeostatic regulation by TAM receptors in microglia. Additionally, autonomous trophic function of the TAM receptors on the proliferating neuronal progenitors may also promote progenitor differentiation into immature neurons.

  12. Mutations in TSPEAR, Encoding a Regulator of Notch Signaling, Affect Tooth and Hair Follicle Morphogenesis

    PubMed Central

    Samuelov, Liat; Bertolini, Marta; Weissglas-Volkov, Daphna; Eskin-Schwartz, Marina; Malchin, Natalia; Bochner, Ron; Fainberg, Gilad; Goldberg, Ilan; Sugawara, Koji; Tsuruta, Daisuke; Morasso, Maria; Shalev, Stavit; Gallo, Richard L.; Shomron, Noam; Paus, Ralf; Sprecher, Eli

    2016-01-01

    Despite recent advances in our understanding of the pathogenesis of ectodermal dysplasias (EDs), the molecular basis of many of these disorders remains unknown. In the present study, we aimed at elucidating the genetic basis of a new form of ED featuring facial dysmorphism, scalp hypotrichosis and hypodontia. Using whole exome sequencing, we identified 2 frameshift and 2 missense mutations in TSPEAR segregating with the disease phenotype in 3 families. TSPEAR encodes the thrombospondin-type laminin G domain and EAR repeats (TSPEAR) protein, whose function is poorly understood. TSPEAR knock-down resulted in altered expression of genes known to be regulated by NOTCH and to be involved in murine hair and tooth development. Pathway analysis confirmed that down-regulation of TSPEAR in keratinocytes is likely to affect Notch signaling. Accordingly, using a luciferase-based reporter assay, we showed that TSPEAR knock-down is associated with decreased Notch signaling. In addition, NOTCH1 protein expression was reduced in patient scalp skin. Moreover, TSPEAR silencing in mouse hair follicle organ cultures was found to induce apoptosis in follicular epithelial cells, resulting in decreased hair bulb diameter. Collectively, these observations indicate that TSPEAR plays a critical, previously unrecognized role in human tooth and hair follicle morphogenesis through regulation of the Notch signaling pathway. PMID:27736875

  13. Gene duplication and divergence affecting drug content in Cannabis sativa.

    PubMed

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency.

  14. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene.

    PubMed

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-12-12

    Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd(2+) uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  15. [Mentalisation and affect regulation--how the infantile self develops].

    PubMed

    Kalisch, Konrad

    2012-01-01

    The text comprises the different elements of the psychoanalytic mentalization theory of Peter Fonagy et al. and tries to explain them. Part of this theory are above all the affect mirroring as well as the affect reciprocity theory and the two modes of the "as if" character and the psychic equivalence (playing with reality). You can find clear examples for each of these theoretical components. Moreover there are many correlations to other authors and their respective development theories: that is to Wilfred Bion, Donald Winnicott and John Bowlby. The text is based above all on Martin Dornes' approaches on this topic (2004, 2006).

  16. Linking gene regulation to mRNA production and export.

    PubMed

    Rodríguez-Navarro, Susana; Hurt, Ed

    2011-06-01

    Regulation of gene expression can occur at many different levels. One important step in the gene expression process is the transport of mRNA from the nucleus to the cytoplasm. In recent years, studies have described how nuclear mRNA export depends on the steps preceding and following transport through nuclear pore complexes. These include gene activation, transcription, mRNA processing and mRNP assembly and disassembly. In this review, we summarise recent insights into the links between these steps in the gene expression cascade.

  17. Target genes of the Streptomyces tsukubaensis FkbN regulator include most of the tacrolimus biosynthesis genes, a phosphopantetheinyl transferase and other PKS genes.

    PubMed

    Ordóñez-Robles, María; Rodríguez-García, Antonio; Martín, Juan F

    2016-09-01

    Tacrolimus (FK506) is a 23-membered macrolide immunosuppressant used in current clinics. Understanding how the tacrolimus biosynthetic gene cluster is regulated is important to increase its industrial production. Here, we analysed the effect of the disruption of fkbN (encoding a LAL-type positive transcriptional regulator) on the whole transcriptome of the tacrolimus producer Streptomyces tsukubaensis using microarray technology. Transcription of fkbN in the wild type strain increases from 70 h of cultivation reaching a maximum at 89 h, prior to the onset of tacrolimus biosynthesis. Disruption of fkbN in S. tsukubaensis does not affect growth but prevents tacrolimus biosynthesis. Inactivation of fkbN reduces the transcription of most of the fkb cluster genes, including some all (for allylmalonyl-CoA biosynthesis) genes but does not affect expression of allMNPOS or fkbR (encoding a LysR-type regulator). Disruption of fkbN does not suppress transcription of the cistron tcs6-fkbQ-fkbN; thus, FkbN self-regulates only weakly its own expression. Interestingly, inactivation of FkbN downregulates the transcription of a 4'-phosphopantetheinyl transferase coding gene, which product is involved in tacrolimus biosynthesis, and upregulates the transcription of a gene cluster containing a cpkA orthologous gene, which encodes a PKS involved in coelimycin P1 biosynthesis in Streptomyces coelicolor. We propose an information theory-based model for FkbN binding sequences. The consensus FkbN binding sequence consists of 14 nucleotides with dyad symmetry containing two conserved inverted repeats of 7 nt each. This FkbN target sequence is present in the promoters of FkbN-regulated genes.

  18. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  19. Pancreatic regeneration: basic research and gene regulation.

    PubMed

    Okita, Kenji; Mizuguchi, Toru; Shigenori, Ota; Ishii, Masayuki; Nishidate, Toshihiko; Ueki, Tomomi; Meguro, Makoto; Kimura, Yasutoshi; Tanimizu, Naoki; Ichinohe, Norihisa; Torigoe, Toshihiko; Kojima, Takashi; Mitaka, Toshihiro; Sato, Noriyuki; Sawada, Norimasa; Hirata, Koichi

    2016-06-01

    Pancreatic regeneration (PR) is an interesting phenomenon that could provide clues as to how the control of diabetes mellitus might be achieved. Due to the different regenerative abilities of the pancreas and liver, the molecular mechanism responsible for PR is largely unknown. In this review, we describe five representative murine models of PR and thirteen humoral mitogens that stimulate β-cell proliferation. We also describe pancreatic ontogenesis, including the molecular transcriptional differences between α-cells and β-cells. Furthermore, we review 14 murine models which carry defects in genes related to key transcription factors for pancreatic ontogenesis to gain further insight into pancreatic development.

  20. Automatic goals and conscious regulation in social cognitive affective neuroscience.

    PubMed

    Sripada, Chandra; Swain, John D; Ho, S Shaun; Swain, James E

    2014-04-01

    The Selfish Goal model challenges traditional agentic models that place conscious systems at the helm of motivation. We highlight the need for ongoing supervision and intervention of automatic goals by higher-order conscious systems with examples from social cognitive affective neuroscience. We contend that interplay between automatic and supervisory systems is required for adaptive human behavior.

  1. 93rd Congress: Federal Laws and Regulations Affecting the Handicapped.

    ERIC Educational Resources Information Center

    Gettings, Robert M.

    Provided is a summary of 1973 and 1974 legislative and administrative developments affecting handicapped persons. The report is divided into five major sections: an outline of some overriding issues faced by the 93rd Congress; a detailed analysis of the implications for the handicapped of bills enacted by the past session of Congress; a brief…

  2. Ezrin Inhibition Up-regulates Stress Response Gene Expression.

    PubMed

    Çelik, Haydar; Bulut, Gülay; Han, Jenny; Graham, Garrett T; Minas, Tsion Z; Conn, Erin J; Hong, Sung-Hyeok; Pauly, Gary T; Hayran, Mutlu; Li, Xin; Özdemirli, Metin; Ayhan, Ayşe; Rudek, Michelle A; Toretsky, Jeffrey A; Üren, Aykut

    2016-06-17

    Ezrin is a member of the ERM (ezrin/radixin/moesin) family of proteins that links cortical cytoskeleton to the plasma membrane. High expression of ezrin correlates with poor prognosis and metastasis in osteosarcoma. In this study, to uncover specific cellular responses evoked by ezrin inhibition that can be used as a specific pharmacodynamic marker(s), we profiled global gene expression in osteosarcoma cells after treatment with small molecule ezrin inhibitors, NSC305787 and NSC668394. We identified and validated several up-regulated integrated stress response genes including PTGS2, ATF3, DDIT3, DDIT4, TRIB3, and ATF4 as novel ezrin-regulated transcripts. Analysis of transcriptional response in skin and peripheral blood mononuclear cells from NSC305787-treated mice compared with a control group revealed that, among those genes, the stress gene DDIT4/REDD1 may be used as a surrogate pharmacodynamic marker of ezrin inhibitor compound activity. In addition, we validated the anti-metastatic effects of NSC305787 in reducing the incidence of lung metastasis in a genetically engineered mouse model of osteosarcoma and evaluated the pharmacokinetics of NSC305787 and NSC668394 in mice. In conclusion, our findings suggest that cytoplasmic ezrin, previously considered a dormant and inactive protein, has important functions in regulating gene expression that may result in down-regulation of stress response genes.

  3. Variability of Gene Expression Identifies Transcriptional Regulators of Early Human Embryonic Development

    PubMed Central

    Hasegawa, Yu; Taylor, Deanne; Ovchinnikov, Dmitry A.; Wolvetang, Ernst J.; de Torrenté, Laurence; Mar, Jessica C.

    2015-01-01

    An analysis of gene expression variability can provide an insightful window into how regulatory control is distributed across the transcriptome. In a single cell analysis, the inter-cellular variability of gene expression measures the consistency of transcript copy numbers observed between cells in the same population. Application of these ideas to the study of early human embryonic development may reveal important insights into the transcriptional programs controlling this process, based on which components are most tightly regulated. Using a published single cell RNA-seq data set of human embryos collected at four-cell, eight-cell, morula and blastocyst stages, we identified genes with the most stable, invariant expression across all four developmental stages. Stably-expressed genes were found to be enriched for those sharing indispensable features, including essentiality, haploinsufficiency, and ubiquitous expression. The stable genes were less likely to be associated with loss-of-function variant genes or human recessive disease genes affected by a DNA copy number variant deletion, suggesting that stable genes have a functional impact on the regulation of some of the basic cellular processes. Genes with low expression variability at early stages of development are involved in regulation of DNA methylation, responses to hypoxia and telomerase activity, whereas by the blastocyst stage, low-variability genes are enriched for metabolic processes as well as telomerase signaling. Based on changes in expression variability, we identified a putative set of gene expression markers of morulae and blastocyst stages. Experimental validation of a blastocyst-expressed variability marker demonstrated that HDDC2 plays a role in the maintenance of pluripotency in human ES and iPS cells. Collectively our analyses identified new regulators involved in human embryonic development that would have otherwise been missed using methods that focus on assessment of the average expression

  4. 75 FR 33501 - Definitions for Regulations Affecting All Savings Associations; Money Market Deposit Accounts

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-14

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF THE TREASURY Office of Thrift Supervision 12 CFR Part 561 RIN 1550-AC40 Definitions for Regulations Affecting All... REGULATIONS AFFECTING ALL SAVINGS ASSOCIATIONS 0 1. The authority citation for part 509 continues to read...

  5. 25 CFR 542.5 - How do these regulations affect state jurisdiction?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false How do these regulations affect state jurisdiction? 542.5 Section 542.5 Indians NATIONAL INDIAN GAMING COMMISSION, DEPARTMENT OF THE INTERIOR HUMAN SERVICES MINIMUM INTERNAL CONTROL STANDARDS § 542.5 How do these regulations affect state jurisdiction? Nothing in this...

  6. 32 CFR 701.67 - Petitions for issuance, revision, or cancellation of regulations affecting the public.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... cancellation of regulations affecting the public. 701.67 Section 701.67 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY UNITED STATES NAVY REGULATIONS AND OFFICIAL RECORDS AVAILABILITY OF DEPARTMENT OF THE NAVY RECORDS AND PUBLICATION OF DEPARTMENT OF THE NAVY DOCUMENTS AFFECTING THE...

  7. Interactions of Metacognition with Motivation and Affect in Self-Regulated Learning: The MASRL Model

    ERIC Educational Resources Information Center

    Efklides, Anastasia

    2011-01-01

    Metacognition, motivation, and affect are components of self-regulated learning (SRL) that interact. The "metacognitive and affective model of self-regulated learning" (the MASRL model) distinguishes two levels of functioning in SRL, namely, the Person level and the Task x Person level. At the Person level interactions between trait-like…

  8. Affect Regulation as a Mediator of Attachment and Deliberate Self-Harm

    ERIC Educational Resources Information Center

    Kimball, Joan S.; Diddams, Margaret

    2007-01-01

    The authors used structural equation modeling to test the mediational role of affect regulation on attachment and deliberate self-harm in 216 undergraduates. Results suggest that affect regulation mediates the relationship between attachment and deliberate self-harm, providing support for the theoretical importance of attachment and affect…

  9. Accuracy and Generalizability in Summaries of Affect Regulation Strategies: Comment on Webb, Miles, and Sheeran (2012)

    ERIC Educational Resources Information Center

    Augustine, Adam A.; Hemenover, Scott H.

    2013-01-01

    In their examination of the effectiveness of affect regulation strategies, Webb, Miles, and Sheeran (2012) offered the results of a broad meta-analysis of studies on regulatory interventions. Their analysis provides an alternative to our earlier, more focused meta-analysis of the affect regulation literature (Augustine & Hemenover, 2009).…

  10. Deletion of pH Regulator pac-3 Affects Cellulase and Xylanase Activity during Sugarcane Bagasse Degradation by Neurospora crassa

    PubMed Central

    Campos Antoniêto, Amanda Cristina; Ramos Pedersoli, Wellington; dos Santos Castro, Lílian; da Silva Santos, Rodrigo; Cruz, Aline Helena da Silva; Nogueira, Karoline Maria Vieira; Silva-Rocha, Rafael; Rossi, Antonio

    2017-01-01

    Microorganisms play a vital role in bioethanol production whose usage as fuel energy is increasing worldwide. The filamentous fungus Neurospora crassa synthesize and secrete the major enzymes involved in plant cell wall deconstruction. The production of cellulases and hemicellulases is known to be affected by the environmental pH; however, the regulatory mechanisms of this process are still poorly understood. In this study, we investigated the role of the pH regulator PAC-3 in N. crassa during their growth on sugarcane bagasse at different pH conditions. Our data indicate that secretion of cellulolytic enzymes is reduced in the mutant Δpac-3 at alkaline pH, whereas xylanases are positively regulated by PAC-3 in acidic (pH 5.0), neutral (pH 7.0), and alkaline (pH 10.0) medium. Gene expression profiles, evaluated by real-time qPCR, revealed that genes encoding cellulases and hemicellulases are also subject to PAC-3 control. Moreover, deletion of pac-3 affects the expression of transcription factor-encoding genes. Together, the results suggest that the regulation of holocellulase genes by PAC-3 can occur as directly as in indirect manner. Our study helps improve the understanding of holocellulolytic performance in response to PAC-3 and should thereby contribute to the better use of N. crassa in the biotechnology industry. PMID:28107376

  11. Deletion of pH Regulator pac-3 Affects Cellulase and Xylanase Activity during Sugarcane Bagasse Degradation by Neurospora crassa.

    PubMed

    Campos Antoniêto, Amanda Cristina; Ramos Pedersoli, Wellington; Dos Santos Castro, Lílian; da Silva Santos, Rodrigo; Cruz, Aline Helena da Silva; Nogueira, Karoline Maria Vieira; Silva-Rocha, Rafael; Rossi, Antonio; Silva, Roberto Nascimento

    2017-01-01

    Microorganisms play a vital role in bioethanol production whose usage as fuel energy is increasing worldwide. The filamentous fungus Neurospora crassa synthesize and secrete the major enzymes involved in plant cell wall deconstruction. The production of cellulases and hemicellulases is known to be affected by the environmental pH; however, the regulatory mechanisms of this process are still poorly understood. In this study, we investigated the role of the pH regulator PAC-3 in N. crassa during their growth on sugarcane bagasse at different pH conditions. Our data indicate that secretion of cellulolytic enzymes is reduced in the mutant Δpac-3 at alkaline pH, whereas xylanases are positively regulated by PAC-3 in acidic (pH 5.0), neutral (pH 7.0), and alkaline (pH 10.0) medium. Gene expression profiles, evaluated by real-time qPCR, revealed that genes encoding cellulases and hemicellulases are also subject to PAC-3 control. Moreover, deletion of pac-3 affects the expression of transcription factor-encoding genes. Together, the results suggest that the regulation of holocellulase genes by PAC-3 can occur as directly as in indirect manner. Our study helps improve the understanding of holocellulolytic performance in response to PAC-3 and should thereby contribute to the better use of N. crassa in the biotechnology industry.

  12. DAG1, no gene for RNA regulation?

    PubMed

    Brancaccio, Andrea

    2012-04-10

    DAG1 encodes for a precursor protein that liberates the two subunits featured by the dystroglycan (DG) adhesion complex that are involved in an increasing number of cellular functions in a wide variety of cells and tissues. Aside from the proteolytic events producing the α and β subunits, especially the former undergoes extensive "post-production" modifications taking place within the ER/Golgi where its core protein is both N- and O-decorated with sugars. These post-translational events, that are mainly orchestrated by a plethora of certified, or putative, glycosyltransferases, prelude to the excocytosis-mediated trafficking and targeting of the DG complex to the plasma membrane. Extensive genetic and biochemical evidences have been accumulated so far on α-DG glycosylation, while little is know on possible regulatory events underlying the chromatine activation, transcription or post-transcription (splicing and escape from the nucleus) of DAG1 or of its mRNA. A scenario is envisaged in which cells would use a sort of preferential, and scarcely regulated, route for DAG1 activation, that would imply fast mRNA transcription, maturation and export to the cytosol, and would prelude to the multiple time-consuming enzymatic post-translational activities needed for its glycosylation. Such a provocative view might be helpful to trigger future work aiming at disclosing the complete molecular mechanisms underlying DAG1 activation and at improving our knowledge of any pre-translational step that is involved in dystroglycan regulation.

  13. All-optical regulation of gene expression in targeted cells

    NASA Astrophysics Data System (ADS)

    Wang, Yisen; He, Hao; Li, Shiyang; Liu, Dayong; Lan, Bei; Hu, Minglie; Cao, Youjia; Wang, Chingyue

    2014-06-01

    Controllable gene expression is always a challenge and of great significance to biomedical research and clinical applications. Recently, various approaches based on extra-engineered light-sensitive proteins have been developed to provide optogenetic actuators for gene expression. Complicated biomedical techniques including exogenous genes engineering, transfection, and material delivery are needed. Here we present an all-optical method to regulate gene expression in targeted cells. Intrinsic or exogenous genes can be activated by a Ca2+-sensitive transcription factor nuclear factor of activated T cells (NFAT) driven by a short flash of femtosecond-laser irradiation. When applied to mesenchymal stem cells, expression of a differentiation regulator Osterix can be activated by this method to potentially induce differentiation of them. A laser-induced ``Ca2+-comb'' (LiCCo) by multi-time laser exposure is further developed to enhance gene expression efficiency. This noninvasive method hence provides an encouraging advance of gene expression regulation, with promising potential of applying in cell biology and stem-cell science.

  14. Acetylation of RNA polymerase II regulates growth-factor-induced gene transcription in mammalian cells.

    PubMed

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S; Capra, John A; Schnölzer, Martina; Cole, Philip A; Geyer, Matthias; Bruneau, Benoit G; Adelman, Karen; Ott, Melanie

    2013-11-07

    Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes.

  15. Gene expression and regulation in adrenocortical tumorigenesis.

    PubMed

    Fonseca, Annabelle L; Healy, James; Kunstman, John W; Korah, Reju; Carling, Tobias

    2012-12-27

    Adrenocortical tumors are frequently found in the general population, and may be benign adrenocortical adenomas or malignant adrenocortical carcinomas. Unfortunately the clinical, biochemical and histopathological distinction between benign and malignant adrenocortical tumors may be difficult in the absence of widely invasive or metastatic disease, and hence attention has turned towards a search for molecular markers. The study of rare genetic diseases that are associated with the development of adrenocortical carcinomas has contributed to our understanding of adrenocortical tumorigenesis. In addition, comprehensive genomic hybridization, methylation profiling, and genome wide mRNA and miRNA profiling have led to improvements in our understanding, as well as demonstrated several genes and pathways that may serve as diagnostic or prognostic markers.

  16. Social Regulation of Gene Expression in Threespine Sticklebacks

    PubMed Central

    Greenwood, Anna K.; Peichel, Catherine L.

    2015-01-01

    Identifying genes that are differentially expressed in response to social interactions is informative for understanding the molecular basis of social behavior. To address this question, we described changes in gene expression as a result of differences in the extent of social interactions. We housed threespine stickleback (Gasterosteus aculeatus) females in either group conditions or individually for one week, then measured levels of gene expression in three brain regions using RNA-sequencing. We found that numerous genes in the hindbrain/cerebellum had altered expression in response to group or individual housing. However, relatively few genes were differentially expressed in either the diencephalon or telencephalon. The list of genes upregulated in fish from social groups included many genes related to neural development and cell adhesion as well as genes with functions in sensory signaling, stress, and social and reproductive behavior. The list of genes expressed at higher levels in individually-housed fish included several genes previously identified as regulated by social interactions in other animals. The identified genes are interesting targets for future research on the molecular mechanisms of normal social interactions. PMID:26367311

  17. Transcriptional Regulation of Gene Expression in C. elegans

    PubMed Central

    Reinke, Valerie; Krause, Michael; Okkema, Peter

    2013-01-01

    Protein coding gene sequences are converted to mRNA by the highly regulated process of transcription. The precise temporal and spatial control of transcription for many genes is an essential part of development in metazoans. Thus, understanding the molecular mechanisms underlying transcriptional control is essential to understanding cell fate determination during embryogenesis, post-embryonic development, many environmental interactions, and disease-related processes. Studies of transcriptional regulation in C. elegans exploit its genomic simplicity and physical characteristics to define regulatory events with single cell and minute time scale resolution. When combined with the genetics of the system, C. elegans offers a unique and powerful vantage point from which to study how chromatin-associated protein and their modifications interact with transcription factors and their binding sites to yield precise control of gene expression through transcriptional regulation. PMID:23801596

  18. Absence of canonical active chromatin marks in developmentally regulated genes

    PubMed Central

    Ruiz-Romero, Marina; Corominas, Montserrat; Guigó, Roderic

    2015-01-01

    The interplay of active and repressive histone modifications is assumed to play a key role in the regulation of gene expression. In contrast to this generally accepted view, we show that transcription of genes temporally regulated during fly and worm development occurs in the absence of canonically active histone modifications. Conversely, strong chromatin marking is related to transcriptional and post-transcriptional stability, an association that we also observe in mammals. Our results support a model in which chromatin marking is associated to stable production of RNA, while unmarked chromatin would permit rapid gene activation and de-activation during development. In this case, regulation by transcription factors would play a comparatively more important regulatory role. PMID:26280901

  19. Toehold Switches: De-Novo-Designed Regulators of Gene Expression

    PubMed Central

    Green, Alexander A.; Silver, Pamela A.; Collins, James J.; Yin, Peng

    2014-01-01

    SUMMARY Efforts to construct synthetic networks in living cells have been hindered by the limited number of regulatory components that provide wide dynamic range and low crosstalk. Here, we report a new class of de-novo-designed prokaryotic riboregulators called toehold switches that activate gene expression in response to cognate RNAs with arbitrary sequences. Toehold switches provide a high level of orthogonality and can be forward-engineered to provide average dynamic range above 400. We show that switches can be integrated into the genome to regulate endogenous genes and use them as sensors that respond to endogenous RNAs. We exploit the orthogonality of toehold switches to regulate 12 genes independently and to construct a genetic circuit that evaluates 4-input AND logic. Toehold switches, with their wide dynamic range, orthogonality, and programmability, represent a versatile and powerful platform for regulation of translation, offering diverse applications in molecular biology, synthetic biology, and biotechnology. PMID:25417166

  20. Different Polycomb group complexes regulate common target genes in Arabidopsis.

    PubMed

    Makarevich, Grigory; Leroy, Olivier; Akinci, Umut; Schubert, Daniel; Clarenz, Oliver; Goodrich, Justin; Grossniklaus, Ueli; Köhler, Claudia

    2006-09-01

    Polycomb group (PcG) proteins convey epigenetic inheritance of repressed transcriptional states. Although the mechanism of the action of PcG is not completely understood, methylation of histone H3 lysine 27 (H3K27) is important in establishing PcG-mediated transcriptional repression. We show that the plant PcG target gene PHERES1 is regulated by histone trimethylation on H3K27 residues mediated by at least two different PcG complexes in plants, containing the SET domain proteins MEDEA or CURLY LEAF/SWINGER. Furthermore, we identify FUSCA3 as a potential PcG target gene and show that FUSCA3 is regulated by MEDEA and CURLY LEAF/SWINGER. We propose that different PcG complexes regulate a common set of target genes during the different stages of plant development.

  1. Information Integration and Energy Expenditure in Gene Regulation.

    PubMed

    Estrada, Javier; Wong, Felix; DePace, Angela; Gunawardena, Jeremy

    2016-06-30

    The quantitative concepts used to reason about gene regulation largely derive from bacterial studies. We show that this bacterial paradigm cannot explain the sharp expression of a canonical developmental gene in response to a regulating transcription factor (TF). In the absence of energy expenditure, with regulatory DNA at thermodynamic equilibrium, information integration across multiple TF binding sites can generate the required sharpness, but with strong constraints on the resultant "higher-order cooperativities." Even with such integration, there is a "Hopfield barrier" to sharpness; for n TF binding sites, this barrier is represented by the Hill function with the Hill coefficient n. If, however, energy is expended to maintain regulatory DNA away from thermodynamic equilibrium, as in kinetic proofreading, this barrier can be breached and greater sharpness achieved. Our approach is grounded in fundamental physics, leads to testable experimental predictions, and suggests how a quantitative paradigm for eukaryotic gene regulation can be formulated.

  2. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  3. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer’s Disease Affected Brain Regions

    PubMed Central

    Berretta, Regina; Moscato, Pablo

    2016-01-01

    Background Alzheimer’s disease (AD) is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation. Methods The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD) from the Entorhinal Cortex (EC), Hippocampus (HIP), Middle temporal gyrus (MTG), Posterior cingulate cortex (PC), Superior frontal gyrus (SFG) and visual cortex (VCX) brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets. Results We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD

  4. Nutrient and hormonal regulation of pyruvate kinase gene expression.

    PubMed

    Yamada, K; Noguchi, T

    1999-01-01

    Mammalian pyruvate kinase (PK), a key glycolytic enzyme, has two genes named PKL and PKM, which produce the L- and R-type isoenzymes by means of alternative promoters, and the M1-and M2-types by mutually exclusive alternative splicing respectively. The expression of these genes is tissue-specific and under developmental, dietary and hormonal control. The L-type isoenzyme (L-PK) gene contains multiple regulatory elements necessary for regulation in the 5' flanking region, up to position -170. Both L-II and L-III elements are required for stimulation of L-PK gene transcription by carbohydrates such as glucose and fructose, although the L-III element is itself responsive to carbohydrates. The L-II element is also responsible for the gene regulation by polyunsaturated fatty acids. Nuclear factor-1 proteins and hepatocyte nuclear factor 4, which bind to the L-II element, may also be involved in carbohydrate and polyunsaturated fatty acid regulation of the L-PK gene respectively. However, the L-III-element-binding protein that is involved in carbohydrate regulation remains to be clarified, although involvement by an upstream stimulating factor has been proposed. Available evidence suggests that the carbohydrate signalling pathway to the L-PK gene includes a glucose metabolite, possibly glucose 6-phosphate or xylulose 5-phosphate, as well as phosphorylation and dephosphorylation mechanisms. In addition, at least five regulatory elements have been identified in the 5' flanking region of the PKM gene up to position -279. Sp1-family proteins bind to two proximal elements, but the binding of proteins to other elements have not yet been clarified. Glucose may stimulate the transcription of the PKM gene via hexosamine derivatives. Sp1 may be involved in this regulation via its dephosphorylation, although the carbohydrate response element has not been determined precisely in the PKM gene. Thus glucose stimulates transcription of the PKM gene by the mechanism which is probably

  5. [An iron regulator hepcidin is affected by EPO].

    PubMed

    Sun, Xue-Feng; Zhou, Dao-Bin; Zhao, Yong-Qiang

    2006-08-01

    To investigate the effect of EPO on hepcidin mRNA expression in normal mice, acute inflammatory mice and ACD mice, the acute phase model and ACD model of mouse was produced by subcutaneous injection of turpentine oil. Hepatic hepcidin mRNA expression levels of normal mice, acute inflammatory mice and ACD mice were detected by semi-quantitative retro-transcriptase polymerase chain reaction (RT-PCR) after intra-peritoneal injection of EPO. The results showed that prolonged chronic inflammation did not significantly increase mouse hepatic hepcidin mRNA expression, but a single injection of turpentine oil increased mouse hepatic hepcidin mRNA expression transiently. Intra-peritoneal injection of EPO down-regulated hepatic hepcidin mRNA expression in normal mice, ACD mice and acute inflammatory mice. Hb levels had a negative correlation with hepatic hepcidin mRNA expression levels in ACD mice treated with EPO. It is concluded that the ACD model can be produced by repeated subcutaneous injection of turpentine oil. Hepatic hepcidin mRNA expression increased during the early period of ACD process and then fall to normal level. EPO down-regulate hepcidin mRNA expression under the normal, acute inflammation and chronic inflammation conditions.

  6. Does close temperature regulation affect surgical site infection rates?

    PubMed

    Leeds, Ira L; Wick, Elizabeth C; Melton, Genevieve B

    2014-01-01

    The argument for close temperature control, to which regulatory bodies have held health systems in an effort to reduce the burden of hospital-acquired infections, is not fully supported by current evidence. The literature is complex on the topic, and overinterpretation of historical data supporting close temperature regulation does not preclude an important recognition of these early works' contribution to high-quality surgical care. Avoidance of hypothermia through the regular use of active rewarming should be a routine part of safe surgical care. The biochemical basis of emphasizing temperature regulation is sound, and ample evidence shows the frank physiologic derangements seen when biological processes occur at suboptimal temperature. It is also recognized that patients tend to do better when warmed during the perioperative period, suggesting that warming devices are an important and essential adjunct to good perioperative care. Clinicians, researchers, and policymakers must be careful in how they apply these well-supported findings to process metrics in an era of limited resources with increasingly stringent quality guidelines and outcomes measures. Discrete temperature targets in current measures are not supported by the existing literature. Not only do these targets artificially anchor clinicians to temperature values with an inadequate scientific basis but they demand intensive resources from health institutions that could potentially be better used on quality requirements with stronger evidence of their ultimate effect on patient care.

  7. Coordinate regulation of HOX genes in human hematopoietic cells

    SciTech Connect

    Magli, M.C.; Barba, P.; Celetti, A.; De Vita, G.; Cillo, C.; Boncinelli, E. )

    1991-07-15

    Hematopoiesis is a continuous process in which precursor cells proliferate and differentiate throughout life. However, the molecular mechanisms that govern this process are not clearly defined. Homeobox-containing genes, encoding DNA-binding homeodomains. are a network of genes highly conserved throughout evolution. They are organized in clusters expressed in the developing embryo with a positional hierarchy. The authors have analyzed expression of the four human HOX loci in erythroleukemic, promyelocytic, and monocytic cell lines to investigate whether the physical organization of human HOX genes reflects a regulatory hierarchy involved in the differentiation process of hematopoietic cells. The results demonstrate that cells representing various stages of hematopoietic differentiation display differential patterns of HOX gene expression and that HOX genes are coordinately switched on or off in blocks that may include entire loci. The entire HOX4 locus is silent in all lines analyzed and almost all the HOX2 genes are active in erythroleukemic cells and turned off in myeloid-restricted cells. The observations provide information about the regulation of HOX genes and suggest that the coordinate regulation of these genes may play an important role in lineage determination during early steps of hematopoiesis.

  8. Regulation of mitochondrial gene expression, the epigenetic enigma.

    PubMed

    Mposhi, Archibold; Van der Wijst, Monique Gp; Faber, Klaas Nico; Rots, Marianne G

    2017-03-01

    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether mitochondrial DNA (mtDNA) undergoes similar epigenetic changes to regulate mitochondrial gene expression. Recently, it has been shown that mtDNA is differentially methylated in various diseases such as diabetes and colorectal cancer. Interestingly, this differential methylation was often associated with altered mitochondrial gene expression. However, the direct role of mtDNA methylation on gene expression remains elusive. Alternatively, the activity of the mitochondrial transcription factor A (TFAM), a protein involved in mtDNA packaging, might also influence gene expression. This review discusses the role of mtDNA methylation and potential epigenetic-like modifications of TFAM with respect to mtDNA transcription and replication. We suggest three mechanisms: (1) methylation within the non-coding D-loop, (2) methylation at gene start sites (GSS) and (3) post-translational modifications (PTMs) of TFAM. Unraveling mitochondrial gene expression regulation could open new therapeutic avenues for mitochondrial diseases.

  9. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    SciTech Connect

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  10. Methylation of microRNA genes regulates gene expression in bisexual flower development in andromonoecious poplar.

    PubMed

    Song, Yuepeng; Tian, Min; Ci, Dong; Zhang, Deqiang

    2015-04-01

    Previous studies showed sex-specific DNA methylation and expression of candidate genes in bisexual flowers of andromonoecious poplar, but the regulatory relationship between methylation and microRNAs (miRNAs) remains unclear. To investigate whether the methylation of miRNA genes regulates gene expression in bisexual flower development, the methylome, microRNA, and transcriptome were examined in female and male flowers of andromonoecious poplar. 27 636 methylated coding genes and 113 methylated miRNA genes were identified. In the coding genes, 64.5% of the methylated reads mapped to the gene body region; by contrast, 60.7% of methylated reads in miRNA genes mainly mapped in the 5' and 3' flanking regions. CHH methylation showed the highest methylation levels and CHG showed the lowest methylation levels. Correlation analysis showed a significant, negative, strand-specific correlation of methylation and miRNA gene expression (r=0.79, P <0.05). The methylated miRNA genes included eight long miRNAs (lmiRNAs) of 24 nucleotides and 11 miRNAs related to flower development. miRNA172b might play an important role in the regulation of bisexual flower development-related gene expression in andromonoecious poplar, via modification of methylation. Gynomonoecious, female, and male poplars were used to validate the methylation patterns of the miRNA172b gene, implying that hyper-methylation in andromonoecious and gynomonoecious poplar might function as an important regulator in bisexual flower development. Our data provide a useful resource for the study of flower development in poplar and improve our understanding of the effect of epigenetic regulation on genes other than protein-coding genes.

  11. A recent evolutionary change affects a regulatory element in the human FOXP2 gene.

    PubMed

    Maricic, Tomislav; Günther, Viola; Georgiev, Oleg; Gehre, Sabine; Curlin, Marija; Schreiweis, Christiane; Naumann, Ronald; Burbano, Hernán A; Meyer, Matthias; Lalueza-Fox, Carles; de la Rasilla, Marco; Rosas, Antonio; Gajovic, Srecko; Kelso, Janet; Enard, Wolfgang; Schaffner, Walter; Pääbo, Svante

    2013-04-01

    The FOXP2 gene is required for normal development of speech and language. By isolating and sequencing FOXP2 genomic DNA fragments from a 49,000-year-old Iberian Neandertal and 50 present-day humans, we have identified substitutions in the gene shared by all or nearly all present-day humans but absent or polymorphic in Neandertals. One such substitution is localized in intron 8 and affects a binding site for the transcription factor POU3F2, which is highly conserved among vertebrates. We find that the derived allele of this site is less efficient than the ancestral allele in activating transcription from a reporter construct. The derived allele also binds less POU3F2 dimers than POU3F2 monomers compared with the ancestral allele. Because the substitution in the POU3F2 binding site is likely to alter the regulation of FOXP2 expression, and because it is localized in a region of the gene associated with a previously described signal of positive selection, it is a plausible candidate for having caused a recent selective sweep in the FOXP2 gene.

  12. Epigenetic Regulation of BDNF Gene during Development and Diseases

    PubMed Central

    Chen, Kuan-Wei; Chen, Linyi

    2017-01-01

    Brain-derived neurotrophic factor (BDNF) is required for the development of the nervous system, proper cognitive function and memory formation. While aberrant expression of BDNF has been implicated in neurological disorders, the transcriptional regulation of BDNF remains to be elucidated. In response to different stimuli, BDNF expression can be initiated from different promoters. Several studies have suggested that the expression of BDNF is regulated by promoter methylation. An emerging theme points to the possibility that histone modifications at the BDNF promoters may link to the neurological pathology. Thus, understanding the epigenetic regulation at the BDNF promoters will shed light on future therapies for neurological disorders. The present review summarizes the current knowledge of histone modifications of the BDNF gene in neuronal diseases, as well as the developmental regulation of the BDNF gene based on data from the Encyclopedia of DNA Elements (ENCODE). PMID:28272318

  13. Regulation of cytochrome P450 (CYP) genes by nuclear receptors.

    PubMed Central

    Honkakoski, P; Negishi, M

    2000-01-01

    Members of the nuclear-receptor superfamily mediate crucial physiological functions by regulating the synthesis of their target genes. Nuclear receptors are usually activated by ligand binding. Cytochrome P450 (CYP) isoforms often catalyse both formation and degradation of these ligands. CYPs also metabolize many exogenous compounds, some of which may act as activators of nuclear receptors and disruptors of endocrine and cellular homoeostasis. This review summarizes recent findings that indicate that major classes of CYP genes are selectively regulated by certain ligand-activated nuclear receptors, thus creating tightly controlled networks. PMID:10749660

  14. Every which way – nanos gene regulation in echinoderms

    PubMed Central

    Oulhen, Nathalie; Wessel, Gary M.

    2014-01-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio, binds to and changes the fate of several known transcripts. We summarize here the documented functions of nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way. PMID:24376110

  15. Every which way--nanos gene regulation in echinoderms.

    PubMed

    Oulhen, Nathalie; Wessel, Gary M

    2014-03-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio binds to and changes the fate of several known transcripts. We summarize here the documented functions of Nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way.

  16. Regulation of Gene Expression Patterns in Mosquito Reproduction.

    PubMed

    Roy, Sourav; Saha, Tusar T; Johnson, Lisa; Zhao, Bo; Ha, Jisu; White, Kevin P; Girke, Thomas; Zou, Zhen; Raikhel, Alexander S

    2015-08-01

    In multicellular organisms, development, growth and reproduction require coordinated expression of numerous functional and regulatory genes. Insects, in addition to being the most speciose animal group with enormous biological and economical significance, represent outstanding model organisms for studying regulation of synchronized gene expression due to their rapid development and reproduction. Disease-transmitting female mosquitoes have adapted uniquely for ingestion and utilization of the huge blood meal required for swift reproductive events to complete egg development within a 72-h period. We investigated the network of regulatory factors mediating sequential gene expression in the fat body, a multifunctional organ analogous to the vertebrate liver and adipose tissue, of the female Aedes aegypti mosquito. Transcriptomic and bioinformatics analyses revealed that ~7500 transcripts are differentially expressed in four sequential waves during the 72-h reproductive period. A combination of RNA-interference gene-silencing and in-vitro organ culture identified the major regulators for each of these waves. Amino acids (AAs) regulate the first wave of gene activation between 3 h and 12 h post-blood meal (PBM). During the second wave, between 12 h and 36 h, most genes are highly upregulated by a synergistic action of AAs, 20-hydroxyecdysone (20E) and the Ecdysone-Receptor (EcR). Between 36 h and 48 h, the third wave of gene activation-regulated mainly by HR3-occurs. Juvenile Hormone (JH) and its receptor Methoprene-Tolerant (Met) are major regulators for the final wave between 48 h and 72 h. Each of these key regulators also has repressive effects on one or more gene sets. Our study provides a better understanding of the complexity of the regulatory mechanisms related to temporal coordination of gene expression during reproduction. We have detected the novel function of 20E/EcR responsible for transcriptional repression. This study also reveals the previously

  17. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  18. URC Fuzzy Modeling and Simulation of Gene Regulation

    DTIC Science & Technology

    2007-11-02

    URC FUZZY MODELING AND SIMULATION OF GENE REGULATION B. A. Sokhansanj1,2 and J. P. Fitch1 1Biology and Biotechnology Research Program, Lawrence...engineering, pharmaceuticals , gene therapy). Diverse modeling approaches have been proposed, in two general categories: modeling a biological pathway as (a) a...systems, we propose that fuzzy logic is a natural language for modeling biology. The Union Rule Configuration (URC) avoids combinatorial explosion in the

  19. Factors affecting the regulation of pacing: current perspectives

    PubMed Central

    Mauger, Alexis R

    2014-01-01

    During prolonged dynamic and rhythmic exercise, muscular pain and discomfort arises as a result of an increased concentration of deleterious metabolites. Sensed by peripheral nociceptors and transmitted via afferent feedback to the brain, this provides important information regarding the physiological state of the muscle. These sensations ultimately contribute to what is termed “exercise-induced pain”. Despite being well recognized by athletes and coaches, and suggested to be integral to exercise performance, this construct has largely escaped attention in experimental work. This perspective article highlights the current understanding of pacing in endurance performance, and the causes of exercise-induced pain. A new perspective is described, which proposes how exercise-induced pain may be a contributing factor in helping individuals to regulate their work rate during exercise and thus provides an important construct in pacing. PMID:25228823

  20. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  1. GLK gene pairs regulate chloroplast development in diverse plant species.

    PubMed

    Fitter, David W; Martin, David J; Copley, Martin J; Scotland, Robert W; Langdale, Jane A

    2002-09-01

    Chloroplast biogenesis is a complex process that requires close co-ordination between two genomes. Many of the proteins that accumulate in the chloroplast are encoded by the nuclear genome, and the developmental transition from proplastid to chloroplast is regulated by nuclear genes. Here we show that a pair of Golden 2-like (GLK) genes regulates chloroplast development in Arabidopsis. The GLK proteins are members of the GARP superfamily of transcription factors, and phylogenetic analysis demonstrates that the maize, rice and Arabidopsis GLK gene pairs comprise a distinct group within the GARP superfamily. Further phylogenetic analysis suggests that the gene pairs arose through separate duplication events in the monocot and dicot lineages. As in rice, AtGLK1 and AtGLK2 are expressed in partially overlapping domains in photosynthetic tissue. Insertion mutants demonstrate that this expression pattern reflects a degree of functional redundancy as single mutants display normal phenotypes in most photosynthetic tissues. However, double mutants are pale green in all photosynthetic tissues and chloroplasts exhibit a reduction in granal thylakoids. Products of several genes involved in light harvesting also accumulate at reduced levels in double mutant chloroplasts. GLK genes therefore regulate chloroplast development in diverse plant species.

  2. Sub-toxic nicotine concentrations affect extracellular matrix and growth factor signaling gene expressions in human osteoblasts.

    PubMed

    Marinucci, Lorella; Bodo, Maria; Balloni, Stefania; Locci, Paola; Baroni, Tiziano

    2014-12-01

    Exposure to nicotine and other compounds contained in cigarette smoking affects human health. This study examined the effects of exposure to a single or multiple sub-toxic nicotine concentrations on human osteoblasts. Cell growth and expression of genes involved in bone differentiation, extracellular matrix (ECM) metabolism, and growth factor signaling pathways were investigated in nicotine-treated cells compared to untreated cells. Depending on osteoblast concentration and maturation stages, nicotine differently regulated cell growth. Real-time PCR showed regulated expressions of genes expressed by nicotine-treated osteoblasts compared to untreated cells. Among ECM genes, type I collagen was down-regulated and osteonectin was up-regulated in nicotine-treated osteoblasts; similarly, fibroblast growth factor-1 (FGF1) and fibroblast growth factor-2 (FGF2), two members of FGF signaling system, were discordantly modulated; genes involved in osteoblast maturation and differentiation such as alkaline phosphatase (ALP), runt-related transcription factor-2 (RUNX2), and bone sialoprotein (BSP) were over-expressed after drug treatment. Our results show a positive association between nicotine exposure and osteoblast phenotype and illustrate for the first time a mechanism whereby acute or chronic exposure to sub-toxic nicotine concentrations may affect bone formation through the impairment of growth factor signaling system and ECM metabolism.

  3. Gene regulation and the origin of cancer: a new model.

    PubMed

    Shah, A

    1995-10-01

    The genome is a dynamical system in which regulation is achieved by the algebraic logic of Boolean functions. A model of a webbed genetic network is presented. In this, all genes lie on interconnected loops, within which each can influence the others, forming the basis of a regulatory network. The normal proto-oncogenes and tumor suppressor genes serve as gateways or switch points in the genetic circuitry, controlling the transition between different cell states. The model explains why multiple genes must be perturbed for the formation of a cancer.

  4. Visual experience regulates gene expression in the developing striate cortex.

    PubMed

    Neve, R L; Bear, M F

    1989-06-01

    We have examined the regulation of expression of the genes for the neuronal growth-associated protein GAP43, the type II calcium/calmodulin-dependent protein kinase, and glutamic acid decarboxylase in the kitten visual cortex during normal postnatal development and after a period of visual deprivation. We find that the mRNA transcripts of these genes display very different patterns of normal development but are all increased in the visual cortex of animals reared in the dark. Upon exposure to light, the transcript of the GAP43 gene drops to near-normal levels within 12 hr.

  5. The Slx5-Slx8 complex affects sumoylation of DNA repair proteins and negatively regulates recombination.

    PubMed

    Burgess, Rebecca C; Rahman, Sadia; Lisby, Michael; Rothstein, Rodney; Zhao, Xiaolan

    2007-09-01

    Recombination is important for repairing DNA lesions, yet it can also lead to genomic rearrangements. This process must be regulated, and recently, sumoylation-mediated mechanisms were found to inhibit Rad51-dependent recombination. Here, we report that the absence of the Slx5-Slx8 complex, a newly identified player in the SUMO (small ubiquitin-like modifier) pathway, led to increased Rad51-dependent and Rad51-independent recombination. The increases were most striking during S phase, suggesting an accumulation of DNA lesions during replication. Consistent with this view, Slx8 protein localized to replication centers. In addition, like SUMO E2 mutants, slx8Delta mutants exhibited clonal lethality, which was due to the overamplification of 2 microm, an extrachromosomal plasmid. Interestingly, in both SUMO E2 and slx8Delta mutants, clonal lethality was rescued by deleting genes required for Rad51-independent recombination but not those involved in Rad51-dependent events. These results suggest that sumoylation negatively regulates Rad51-independent recombination, and indeed, the Slx5-Slx8 complex affected the sumoylation of several enzymes involved in early steps of Rad51-independent recombination. We propose that, during replication, the Slx5-Slx8 complex helps prevent DNA lesions that are acted upon by recombination. In addition, the complex inhibits Rad51-independent recombination via modulating the sumoylation of DNA repair proteins.

  6. Epigenetic regulation of cardiac myofibril gene expression during heart development.

    PubMed

    Zhao, Weian; Liu, Lingjuan; Pan, Bo; Xu, Yang; Zhu, Jing; Nan, Changlong; Huang, Xupei; Tian, Jie

    2015-07-01

    Cardiac gene expression regulation is controlled not only by genetic factors but also by environmental, i.e., epigenetic factors. Several environmental toxic effects such as oxidative stress and ischemia can result in abnormal myofibril gene expression during heart development. Troponin, one of the regulatory myofibril proteins in the heart, is a well-known model in study of cardiac gene regulation during the development. In our previous studies, we have demonstrated that fetal form troponin I (ssTnI) expression in the heart is partially regulated by hormones, such as thyroid hormone. In the present study, we have explored the epigenetic role of histone modification in the regulation of ssTnI expression. Mouse hearts were collected at different time of heart development, i.e., embryonic day 15.5, postnatal day 1, day 7, day 14 and day 21. Levels of histone H3 acetylation (acH3) and histone H3 lysine 9 trimethylation (H3K9me(3)) were detected using chromatin immunoprecipitation assays in slow upstream regulatory element (SURE) domain (TnI slow upstream regulatory element), 300-bp proximal upstream domain and the first intron of ssTnI gene, which are recognized as critical regions for ssTnI regulation. We found that the levels of acH3 on the SURE region were gradually decreased, corresponding to a similar decrease of ssTnI expression in the heart, whereas the levels of H3K9me(3) in the first intron of ssTnI gene were gradually increased. Our results indicate that both histone acetylation and methylation are involved in the epigenetic regulation of ssTnI expression in the heart during the development, which are the targets for environmental factors.

  7. Sequences affecting the regulation of solvent production in Clostridium acetobutylicum.

    PubMed

    Scotcher, Miles C; Huang, Ke-xue; Harrison, Mary L; Rudolph, Frederick B; Bennett, George N

    2003-07-01

    The high solvent phenotype of Clostridium acetobutylicum mutants B and H was complemented by the introduction of a plasmid that contains either an intact or partially-deleted copy of solR, restoring acetone and butanol production to wild-type levels. This demonstrates that the solR open reading frame on pSOLThi is not required to restore solvent levels. The promoter region upstream of alcohol dehydrogense E (adhE) was examined in efforts to identify sites that play major roles in the control of expression. A series of adhE promoter fragments was constructed and the expression of each in acid- and solvent-phases of growth was analyzed using a chloramphenicol acetyl-transferase reporter system. Our results show that a region beyond the 0A box is needed for full induction of the promoter. Additionally, we show that the presence of sequences around a possible processing site designated S2 may have a negative role in the regulation of adhE expression.

  8. Genes affecting heading date in cocksfoot (Dactylis glomerata)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several genes cause well known effects on heading date in cool-season forages: Vrn1, Constans, and FloweringTime. Vrn1 is a MADs box transcription factor that is induced upon vernalization and necessary for flowering. Constans genes are induced upon long days in cool-season grasses and induce exp...

  9. TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes.

    PubMed

    Matys, V; Kel-Margoulis, O V; Fricke, E; Liebich, I; Land, S; Barre-Dirrie, A; Reuter, I; Chekmenev, D; Krull, M; Hornischer, K; Voss, N; Stegmaier, P; Lewicki-Potapov, B; Saxel, H; Kel, A E; Wingender, E

    2006-01-01

    The TRANSFAC database on transcription factors, their binding sites, nucleotide distribution matrices and regulated genes as well as the complementing database TRANSCompel on composite elements have been further enhanced on various levels. A new web interface with different search options and integrated versions of Match and Patch provides increased functionality for TRANSFAC. The list of databases which are linked to the common GENE table of TRANSFAC and TRANSCompel has been extended by: Ensembl, UniGene, EntrezGene, HumanPSD and TRANSPRO. Standard gene names from HGNC, MGI and RGD, are included for human, mouse and rat genes, respectively. With the help of InterProScan, Pfam, SMART and PROSITE domains are assigned automatically to the protein sequences of the transcription factors. TRANSCompel contains now, in addition to the COMPEL table, a separate table for detailed information on the experimental EVIDENCE on which the composite elements are based. Finally, for TRANSFAC, in respect of data growth, in particular the gain of Drosophila transcription factor binding sites (by courtesy of the Drosophila DNase I footprint database) and of Arabidopsis factors (by courtesy of DATF, Database of Arabidopsis Transcription Factors) has to be stressed. The here described public releases, TRANSFAC 7.0 and TRANSCompel 7.0, are accessible under http://www.gene-regulation.com/pub/databases.html.

  10. Epigenetic regulation of inducible gene expression in the immune system.

    PubMed

    Lim, Pek Siew; Li, Jasmine; Holloway, Adele F; Rao, Sudha

    2013-07-01

    T cells are exquisitely poised to respond rapidly to pathogens and have proved an instructive model for exploring the regulation of inducible genes. Individual genes respond to antigenic stimulation in different ways, and it has become clear that the interplay between transcription factors and the chromatin platform of individual genes governs these responses. Our understanding of the complexity of the chromatin platform and the epigenetic mechanisms that contribute to transcriptional control has expanded dramatically in recent years. These mechanisms include the presence/absence of histone modification marks, which form an epigenetic signature to mark active or inactive genes. These signatures are dynamically added or removed by epigenetic enzymes, comprising an array of histone-modifying enzymes, including the more recently recognized chromatin-associated signalling kinases. In addition, chromatin-remodelling complexes physically alter the chromatin structure to regulate chromatin accessibility to transcriptional regulatory factors. The advent of genome-wide technologies has enabled characterization of the chromatin landscape of T cells in terms of histone occupancy, histone modification patterns and transcription factor association with specific genomic regulatory regions, generating a picture of the T-cell epigenome. Here, we discuss the multi-layered regulation of inducible gene expression in the immune system, focusing on the interplay between transcription factors, and the T-cell epigenome, including the role played by chromatin remodellers and epigenetic enzymes. We will also use IL2, a key inducible cytokine gene in T cells, as an example of how the different layers of epigenetic mechanisms regulate immune responsive genes during T-cell activation.

  11. The fur transcription regulator and fur-regulated genes in Clostridium botulinum A ATCC 3502.

    PubMed

    Zhang, Weibin; Ma, Junhua; Zang, Chengyuan; Song, Yingying; Liu, Peipei

    2011-01-01

    Clostridium botulinum is a spore-forming bacterium that can produce a very powerful neurotoxin that causes botulism. In this study, we have investigated the Fur transcription regulators in Clostridium botulinum and Fur-regulated genes in Clostridium botulinum A ATCC 3502. We found that gene loss may be the main cause leading to the different numbers of Fur transcription regulators in different Clostridium botulinum strains. Meanwhile, 46 operons were found to be regulated by the Fur transcription regulator in Clostridium botulinum A ATCC 3502, involved in several functional classifications, including iron acquisition, iron utilization, iron transport, and transcription regulator. Under an iron-restricted medium, we experimentally found that a Fur transcription regulator (CBO1372) and two operons (DedA, CBO2610-CBO2614 and ABC transporter, CBO0845-CBO0847) are shown to be differentially expressed in Clostridium botulinum A ATCC 3502. This study has provided-us novel insights into the diversity of Fur transcription regulators in different Clostridium botulinum strains and diversity of Fur-targeted genes, as well as a better understanding of the dynamic changes in iron restriction occurring in response to this stress.

  12. Querying Co-regulated Genes on Diverse Gene Expression Datasets Via Biclustering.

    PubMed

    Deveci, Mehmet; Küçüktunç, Onur; Eren, Kemal; Bozdağ, Doruk; Kaya, Kamer; Çatalyürek, Ümit V

    2016-01-01

    Rapid development and increasing popularity of gene expression microarrays have resulted in a number of studies on the discovery of co-regulated genes. One important way of discovering such co-regulations is the query-based search since gene co-expressions may indicate a shared role in a biological process. Although there exist promising query-driven search methods adapting clustering, they fail to capture many genes that function in the same biological pathway because microarray datasets are fraught with spurious samples or samples of diverse origin, or the pathways might be regulated under only a subset of samples. On the other hand, a class of clustering algorithms known as biclustering algorithms which simultaneously cluster both the items and their features are useful while analyzing gene expression data, or any data in which items are related in only a subset of their samples. This means that genes need not be related in all samples to be clustered together. Because many genes only interact under specific circumstances, biclustering may recover the relationships that traditional clustering algorithms can easily miss. In this chapter, we briefly summarize the literature using biclustering for querying co-regulated genes. Then we present a novel biclustering approach and evaluate its performance by a thorough experimental analysis.

  13. The Role of Nucleosome Positioning in the Evolution of Gene Regulation

    PubMed Central

    Tsankov, Alexander M.; Thompson, Dawn Anne; Socha, Amanda

    2010-01-01

    Chromatin organization plays a major role in gene regulation and can affect the function and evolution of new transcriptional programs. However, it can be difficult to decipher the basis of changes in chromatin organization and their functional effect on gene expression. Here, we present a large-scale comparative genomic analysis of the relationship between chromatin organization and gene expression, by measuring mRNA abundance and nucleosome positions genome-wide in 12 Hemiascomycota yeast species. We found substantial conservation of global and functional chromatin organization in all species, including prominent nucleosome-free regions (NFRs) at gene promoters, and distinct chromatin architecture in growth and stress genes. Chromatin organization has also substantially diverged in both global quantitative features, such as spacing between adjacent nucleosomes, and in functional groups of genes. Expression levels, intrinsic anti-nucleosomal sequences, and trans-acting chromatin modifiers all play important, complementary, and evolvable roles in determining NFRs. We identify five mechanisms that couple chromatin organization to evolution of gene regulation and have contributed to the evolution of respiro-fermentation and other key systems, including (1) compensatory evolution of alternative modifiers associated with conserved chromatin organization, (2) a gradual transition from constitutive to trans-regulated NFRs, (3) a loss of intrinsic anti-nucleosomal sequences accompanying changes in chromatin organization and gene expression, (4) re-positioning of motifs from NFRs to nucleosome-occluded regions, and (5) the expanded use of NFRs by paralogous activator-repressor pairs. Our study sheds light on the molecular basis of chromatin organization, and on the role of chromatin organization in the evolution of gene regulation. PMID:20625544

  14. RpoS regulation of gene expression during exponential growth of Escherichia coli K12.

    PubMed

    Dong, Tao; Kirchhof, Mark G; Schellhorn, Herb E

    2008-03-01

    RpoS is a major regulator of genes required for adaptation to stationary phase in E. coli. However, the exponential phase expression of some genes is affected by rpoS mutation, suggesting RpoS may also have an important physiological role in growing cells. To test this hypothesis, we examined the regulatory role of RpoS in exponential phase using both genomic and biochemical approaches. Microarray expression data revealed that, in the rpoS mutant, the expression of 268 genes was attenuated while the expression of 24 genes was enhanced. Genes responsible for carbon source transport (the mal operon for maltose), protein folding (dnaK and mopAB), and iron acquisition (fepBD, entCBA, fecI, and exbBD) were positively controlled by RpoS. The importance of RpoS-mediated control of iron acquisition was confirmed by cellular metal analysis which revealed that the intracellular iron content of wild type cells was two-fold higher than in rpoS mutant cells. Surprisingly, many previously identified RpoS stationary-phase dependent genes were not controlled by RpoS in exponential phase and several genes were RpoS-regulated only in exponential phase, suggesting the involvement of other regulators. The expression of RpoS-dependent genes osmY, tnaA and malK was controlled by Crl, a transcriptional regulator that modulates RpoS activity. In summary, the identification of a group of exponential phase genes controlled by RpoS reveals a novel aspect of RpoS function.

  15. Bioinformatics-Based Identification of MicroRNA-Regulated and Rheumatoid Arthritis-Associated Genes

    PubMed Central

    Song, Yi-Jiang; Li, Guiling; He, Jian-Hua; Guo, Yao; Yang, Li

    2015-01-01

    MicroRNAs (miRNAs) act as epigenetic markers and regulate the expression of their target genes, including those characterized as regulators in autoimmune diseases. Rheumatoid arthritis (RA) is one of the most common autoimmune diseases. The potential roles of miRNA-regulated genes in RA pathogenesis have greatly aroused the interest of clinicians and researchers in recent years. In the current study, RA-related miRNAs records were obtained from PubMed through conditional literature retrieval. After analyzing the selected records, miRNA targeted genes were predicted. We identified 14 RA-associated miRNAs, and their sub-analysis in 5 microarray or RNA sequencing (RNA-seq) datasets was performed. The microarray and RNA-seq data of RA were also downloaded from NCBI Gene Expression Omnibus (GEO) and Sequence Read Archive (SRA), analyzed, and annotated. Using a bioinformatics approach, we identified a series of differentially expressed genes (DEGs) by comparing studies on RA and the controls. The RA-related gene expression profile was thus obtained and the expression of miRNA-regulated genes was analyzed. After functional annotation analysis, we found GO molecular function (MF) terms significantly enriched in calcium ion binding (GO: 0005509). Moreover, some novel dysregulated target genes were identified in RA through integrated analysis of miRNA/mRNA expression. The result revealed that the expression of a number of genes, including ROR2, ABI3BP, SMOC2, etc., was not only affected by dysregulated miRNAs, but also altered in RA. Our findings indicate that there is a close association between negatively correlated mRNA/miRNA pairs and RA. These findings may be applied to identify genetic markers for RA diagnosis and treatment in the future. PMID:26359667

  16. Ethylene could influence ferric reductase, iron transporter, and H+-ATPase gene expression by affecting FER (or FER-like) gene activity.

    PubMed

    Lucena, Carlos; Waters, Brian M; Romera, F Javier; García, María José; Morales, María; Alcántara, Esteban; Pérez-Vicente, Rafael

    2006-01-01

    In previous works, it has been shown, by using ethylene inhibitors and precursors, that ethylene could participate in the regulation of the enhanced ferric reductase activity of Fe-deficient Strategy I plants. However, it was not known whether ethylene regulates the ferric reductase gene expression or other aspects related to this activity. This paper is a study of the effects of ethylene inhibitors and precursors on the expression of the genes encoding the ferric reductases and iron transporters of Arabidopsis thaliana (FRO2 and IRT1) and Lycopersicon esculentum (=Solanum lycopersicum) (FRO1 and IRT1) plants. The effects of ethylene inhibitors and precursors on the activity of the iron reductase and the iron transporter have been examined in parallel. Also studied were the effects of ethylene inhibitors and precursors on the expression of the H(+)-ATPase genes of cucumber (CsHA1 and CsHA2) and the transcription factor genes of tomato (LeFER) and Arabidopsis (AtFRU or AtFIT1, an LeFER homologue) that regulate ferric reductase, iron transporter, and H(+)-ATPse activity. The results obtained suggest that ethylene participates in the regulation of ferric reductase, the iron transporter, and H(+)-ATPase gene expression by affecting the FER (or FER-like) levels.

  17. Regulation of SET Gene Expression by NFkB.

    PubMed

    Feng, Yi; Li, Xiaoyong; Zhou, Weitao; Lou, Dandan; Huang, Daochao; Li, Yanhua; Kang, Yu; Xiang, Yan; Li, Tingyu; Zhou, Weihui; Song, Weihong

    2016-06-28

    SET is elevated and mislocalized in the neuronal cytoplasm in brains of Alzheimer's disease (AD) and Down syndrome (DS) patients. Cytoplasm SET leads to inhibition of protein phosphatase 2A and is involved in the tau pathology. However, the regulation of SET gene expression remains elusive. In the present study, we cloned a 1399-bp segment of the 5' flanking region of the human SET gene and identified that the transcription start site (TSS) of SET transcript 1 is located at 123 bp upstream of the translation start site ATG in exon 1. Sequence analysis reveals several putative regulatory elements including NFkB, Sp1, and HSE. Luciferase assay and electrophoretic mobility shift assay (EMSA) identified a functional cis-acting NFkB-responsive element in the SET gene promoter. Overexpression and activation of NFkB upregulate transcription of SET isoform 1 but not isoform 2, indicating that the expression of these two isoforms is differentially regulated. The results demonstrate that NFkB plays an important role in regulation of the human SET gene expression. Our findings suggest that oxidative stress and inflammatory responses could result in abnormal SET gene expression, contributing to the tauopathy in AD pathogenesis.

  18. RNA editing regulates transposon-mediated heterochromatic gene silencing.

    PubMed

    Savva, Yiannis A; Jepson, James E C; Chang, Yao-Jen; Whitaker, Rachel; Jones, Brian C; St Laurent, Georges; Tackett, Michael R; Kapranov, Philipp; Jiang, Nan; Du, Guyu; Helfand, Stephen L; Reenan, Robert A

    2013-01-01

    Heterochromatin formation drives epigenetic mechanisms associated with silenced gene expression. Repressive heterochromatin is established through the RNA interference pathway, triggered by double-stranded RNAs (dsRNAs) that can be modified via RNA editing. However, the biological consequences of such modifications remain enigmatic. Here we show that RNA editing regulates heterochromatic gene silencing in Drosophila. We utilize the binding activity of an RNA-editing enzyme to visualize the in vivo production of a long dsRNA trigger mediated by Hoppel transposable elements. Using homologous recombination, we delete this trigger, dramatically altering heterochromatic gene silencing and chromatin architecture. Furthermore, we show that the trigger RNA is edited and that dADAR serves as a key regulator of chromatin state. Additionally, dADAR auto-editing generates a natural suppressor of gene silencing. Lastly, systemic differences in RNA editing activity generates interindividual variation in silencing state within a population. Our data reveal a global role for RNA editing in regulating gene expression.

  19. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  20. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement

    PubMed Central

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-01-01

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K+ (K+in) channels and reduced K+in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K+in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K+in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  1. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement.

    PubMed

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-Ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-04-12

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K(+) (K(+) in) channels and reduced K(+) in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K(+) in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K(+) in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants.

  2. How the gene-patenting race is affecting science

    SciTech Connect

    Wuethrich, B.

    1993-09-04

    Since the National Institutes of Health first filed for patents on thousand fragments of human genes in 1992, many researchers are confronting difficult problems arising at the intersection of science, private enterprise, and the law. At present scientists understand the function of fewer than 1,500 human genes. Decoding all these genes in the goal of the Human Genome Project, sponsored by NIH and DOE. This paper discusses the complex practical, political, ethical, and economic issues involved in describing portions of DNA sequences and the patenting (and ownership) of those sequences.

  3. The circadian Clock gene regulates acrosin activity of sperm through serine protease inhibitor A3K

    PubMed Central

    Cheng, Shuting; Liang, Xin; Wang, Yuhui; Jiang, Zhou; Liu, Yanyou; Hou, Wang; Li, Shiping; Zhang, Jing

    2015-01-01

    Our previous study found that CLOCK knockdown in the testes of male mice led to a reduced fertility, which might be associated with the lower acrosin activity. In this present study, we examined the differential expression in proteins of CLOCK knockdown sperm. Clock gene expression was knocked down in cells to confirm those differentially expressions and serine protease inhibitor SERPINA3K was identified as a potential target. The up-regulated SERPINA3K revealed an inverse relationship with Clock knockdown. Direct treatment of normal sperm with recombinant SERPINA3K protein inhibited the acrosin activity and reduced in vitro fertilization rate. The luciferase reporter gene assay showed that the down-regulated of Clock gene could activate the Serpina3k promoter, but this activation was not affected by the mutation of E-box core sequence. Co-IP demonstrated a natural interaction between SERPIAN3K and RORs (α and β). Taken together, these results demonstrated that SERPINA3K is involved in the Clock gene-mediated male fertility by regulating acrosin activity and provide the first evidence that SERPINA3K could be regulated by Clock gene via retinoic acid-related orphan receptor response elements. PMID:26264441

  4. Deletion of the homeobox gene PRX-2 affects fetal but not adult fibroblast wound healing responses.

    PubMed

    White, Philip; Thomas, David W; Fong, Steven; Stelnicki, Eric; Meijlink, Fritz; Largman, Corey; Stephens, Phil

    2003-01-01

    The phenotype of fibroblasts repopulating experimental wounds in vivo has been shown to influence both wound healing responses and clinical outcome. Recent studies have demonstrated that the human homeobox gene PRX-2 is strongly upregulated in fibroblasts within fetal, but not adult, mesenchymal tissues during healing. Differential homeobox gene expression by fibroblasts may therefore be important in mediating the scarless healing exhibited in early fetal wounds. RNase protection analysis demonstrated that murine Prx-2 expression was involved in fetal but not adult wound healing responses in vitro. Using fibroblasts established from homozygous mutant (Prx-2-/-) and wild-type (Prx-2+/+) murine skin tissues it was demonstrated that Prx-2 affected a number of fetal fibroblastic responses believed to be important in mediating scarless healing in vivo; namely cellular proliferation, extracellular matrix reorganization, and matrix metalloproteinase 2 and hyaluronic acid production. These data demonstrate how Prx-2 may contribute to the regulation of fetal, but not adult, fibroblasts and ultimately the wound healing phenotype. This study provides further evidence for the importance of homeobox transcription factors in the regulation of scarless wound healing. A further understanding of these processes will, it is hoped, enable the targeting of specific therapies in wound healing, both to effect scarless healing and to stimulate healing in chronic, nonhealing wounds such as venous leg ulcers.

  5. The dynamic mechanism of noisy signal decoding in gene regulation

    PubMed Central

    Liu, Peijiang; Wang, Haohua; Huang, Lifang; Zhou, Tianshou

    2017-01-01

    Experimental evidence supports that signaling pathways can induce different dynamics of transcription factor (TF) activation, but how an input signal is encoded by such a dynamic, noisy TF and further decoded by downstream genes remains largely unclear. Here, using a system of stochastic transcription with signal regulation, we show that (1) keeping the intensity of the signal noise invariant but prolonging the signal duration can both enhance the mutual information (MI) and reduce the energetic cost (EC); (2) if the signal duration is fixed, the larger MI needs the larger EC, but if the signal period is fixed, there is an optimal time that the signal spends at one lower branch, such that MI reaches the maximum; (3) if both the period and the duration are simultaneously fixed, increasing the input noise can always enhance MI in the case of transcription regulation rather than in the case of degradation regulation. In addition, we find that the input noise can induce stochastic focusing in a regulation-dependent manner. These results reveal not only the dynamic mechanism of noisy signal decoding in gene regulation but also the essential role of external noise in controlling gene expression levels. PMID:28176840

  6. Dissecting the regulation of yeast genes by the osmotin receptor

    PubMed Central

    Kupchak, Brian R.; Villa, Nancy Y.; Kulemina, Lidia; Lyons, Thomas J.

    2008-01-01

    The Izh2p protein from Saccharomyces cerevisiae is a receptor for the plant antifungal protein, osmotin. Since Izh2p is conserved in fungi, understanding its biochemical function could inspire novel strategies for the prevention of fungal growth. However, it has been difficult to determine the exact role of Izh2p because it has pleiotropic effects on cellular biochemistry. Herein, we demonstrate that Izh2p negatively regulates functionally divergent genes through a CCCTC promoter motif. Moreover, we show that Izh2p-dependent promoters containing this motif are regulated by the Nrg1p/Nrg2p and Msn2p/Msn4p transcription factors. The fact that Izh2p can regulate gene expression through this widely dispersed element presents a reasonable explanation of its pleiotropy. The involvement of Nrg1p/Nrgp2 in Izh2p-dependent gene regulation also suggests a role for this receptor in regulating fungal differentiation in response to stimuli produced by plants. PMID:18625204

  7. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    PubMed

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-02

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  8. REST regulation of gene networks in adult neural stem cells

    PubMed Central

    Mukherjee, Shradha; Brulet, Rebecca; Zhang, Ling; Hsieh, Jenny

    2016-01-01

    Adult hippocampal neural stem cells generate newborn neurons throughout life due to their ability to self-renew and exist as quiescent neural progenitors (QNPs) before differentiating into transit-amplifying progenitors (TAPs) and newborn neurons. The mechanisms that control adult neural stem cell self-renewal are still largely unknown. Conditional knockout of REST (repressor element 1-silencing transcription factor) results in precocious activation of QNPs and reduced neurogenesis over time. To gain insight into the molecular mechanisms by which REST regulates adult neural stem cells, we perform chromatin immunoprecipitation sequencing and RNA-sequencing to identify direct REST target genes. We find REST regulates both QNPs and TAPs, and importantly, ribosome biogenesis, cell cycle and neuronal genes in the process. Furthermore, overexpression of individual REST target ribosome biogenesis or cell cycle genes is sufficient to induce activation of QNPs. Our data define novel REST targets to maintain the quiescent neural stem cell state. PMID:27819263

  9. Regulation of methanol utilisation pathway genes in yeasts

    PubMed Central

    Hartner, Franz S; Glieder, Anton

    2006-01-01

    Methylotrophic yeasts such as Candida boidinii, Hansenula polymorpha, Pichia methanolica and Pichia pastoris are an emerging group of eukaryotic hosts for recombinant protein production with an ever increasing number of applications during the last 30 years. Their applications are linked to the use of strong methanol-inducible promoters derived from genes of the methanol utilisation pathway. These promoters are tightly regulated, highly repressed in presence of non-limiting concentrations of glucose in the medium and strongly induced if methanol is used as carbon source. Several factors involved in this tight control and their regulatory effects have been described so far. This review summarises available data about the regulation of promoters from methanol utilisation pathway genes. Furthermore, the role of cis and trans acting factors (e.g. transcription factors, glucose processing enzymes) in the expression of methanol utilisation pathway genes is reviewed both in the context of the native cell environment as well as in heterologous hosts. PMID:17169150

  10. Regulation of Cell and Gene Therapy Medicinal Products in Taiwan.

    PubMed

    Lin, Yi-Chu; Wang, Po-Yu; Tsai, Shih-Chih; Lin, Chien-Liang; Tai, Hsuen-Yung; Lo, Chi-Fang; Wu, Shiow-Ing; Chiang, Yu-Mei; Liu, Li-Ling

    2015-01-01

    Owing to the rapid and mature development of emerging biotechnology in the fields of cell culture, cell preservation, and recombinant DNA technology, more and more cell or gene medicinal therapy products have been approved for marketing, to treat serious diseases which have been challenging to treat with current medical practice or medicine. This chapter will briefly introduce the Taiwan Food and Drug Administration (TFDA) and elaborate regulation of cell and gene therapy medicinal products in Taiwan, including regulatory history evolution, current regulatory framework, application and review procedures, and relevant jurisdictional issues. Under the promise of quality, safety, and efficacy of medicinal products, it is expected the regulation and environment will be more flexible, streamlining the process of the marketing approval of new emerging cell or gene therapy medicinal products and providing diverse treatment options for physicians and patients.

  11. REST regulation of gene networks in adult neural stem cells.

    PubMed

    Mukherjee, Shradha; Brulet, Rebecca; Zhang, Ling; Hsieh, Jenny

    2016-11-07

    Adult hippocampal neural stem cells generate newborn neurons throughout life due to their ability to self-renew and exist as quiescent neural progenitors (QNPs) before differentiating into transit-amplifying progenitors (TAPs) and newborn neurons. The mechanisms that control adult neural stem cell self-renewal are still largely unknown. Conditional knockout of REST (repressor element 1-silencing transcription factor) results in precocious activation of QNPs and reduced neurogenesis over time. To gain insight into the molecular mechanisms by which REST regulates adult neural stem cells, we perform chromatin immunoprecipitation sequencing and RNA-sequencing to identify direct REST target genes. We find REST regulates both QNPs and TAPs, and importantly, ribosome biogenesis, cell cycle and neuronal genes in the process. Furthermore, overexpression of individual REST target ribosome biogenesis or cell cycle genes is sufficient to induce activation of QNPs. Our data define novel REST targets to maintain the quiescent neural stem cell state.

  12. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    PubMed Central

    2009-01-01

    Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in mycelium with primordia and a

  13. Major psychological factors affecting acceptance of gene-recombination technology.

    PubMed

    Tanaka, Yutaka

    2004-12-01

    The purpose of this study was to verify the validity of a causal model that was made to predict the acceptance of gene-recombination technology. A structural equation model was used as a causal model. First of all, based on preceding studies, the factors of perceived risk, perceived benefit, and trust were set up as important psychological factors determining acceptance of gene-recombination technology in the structural equation model. An additional factor, "sense of bioethics," which I consider to be important for acceptance of biotechnology, was added to the model. Based on previous studies, trust was set up to have an indirect influence on the acceptance of gene-recombination technology through perceived risk and perceived benefit in the model. Participants were 231 undergraduate students in Japan who answered a questionnaire with a 5-point bipolar scale. The results indicated that the proposed model fits the data well, and showed that acceptance of gene-recombination technology is explained largely by four factors, that is, perceived risk, perceived benefit, trust, and sense of bioethics, whether the technology is applied to plants, animals, or human beings. However, the relative importance of the four factors was found to vary depending on whether the gene-recombination technology was applied to plants, animals, or human beings. Specifically, the factor of sense of bioethics is the most important factor in acceptance of plant gene-recombination technology and animal gene-recombination technology, and the factors of trust and perceived risk are the most important factors in acceptance of human being gene-recombination technology.

  14. Genome-wide gene expression regulation as a function of genotype and age in C. elegans

    PubMed Central

    Viñuela, Ana; Snoek, L. Basten; Riksen, Joost A.G.; Kammenga, Jan E.

    2010-01-01

    Gene expression becomes more variable with age, and it is widely assumed that this is due to a decrease in expression regulation. But currently there is no understanding how gene expression regulatory patterns progress with age. Here we explored genome-wide gene expression variation and regulatory loci (eQTL) in a population of developing and aging C. elegans recombinant inbred worms. We found almost 900 genes with an eQTL, of which almost half were found to have a genotype-by-age effect (gxaeQTL). The total number of eQTL decreased with age, whereas the variation in expression increased. In developing worms, the number of genes with increased expression variation (1282) was similar to the ones with decreased expression variation (1328). In aging worms, the number of genes with increased variation (1772) was nearly five times higher than the number of genes with a decreased expression variation (373). The number of cis-acting eQTL in juveniles decreased by almost 50% in old worms, whereas the number of trans-acting loci decreased by ∼27%, indicating that cis-regulation becomes relatively less frequent than trans-regulation in aging worms. Of the 373 genes with decreased expression level variation in aging worms, ∼39% had an eQTL compared with ∼14% in developing worms. gxaeQTL were found for ∼21% of these genes in aging worms compared with only ∼6% in developing worms. We highlight three examples of linkages: in young worms (pgp-6), in old worms (daf-16), and throughout life (lips-16). Our findings demonstrate that eQTL patterns are strongly affected by age, and suggest that gene network integrity declines with age. PMID:20488933

  15. Y-chromosomal genes affecting male fertility: A review

    PubMed Central

    Dhanoa, Jasdeep Kaur; Mukhopadhyay, Chandra Sekhar; Arora, Jaspreet Singh

    2016-01-01

    The mammalian sex-chromosomes (X and Y) have evolved from autosomes and are involved in sex determination and reproductive traits. The Y-chromosome is the smallest chromosome that consists of 2-3% of the haploid genome and may contain between 70 and 200 genes. The Y-chromosome plays major role in male fertility and is suitable to study the evolutionary relics, speciation, and male infertility and/or subfertility due to its unique features such as long non-recombining region, abundance of repetitive sequences, and holandric inheritance pattern. During evolution, many holandric genes were deleted. The current review discusses the mammalian holandric genes and their functions. The commonly encountered infertility and/or subfertility problems due to point or gross mutation (deletion) of the Y-chromosomal genes have also been discussed. For example, loss or microdeletion of sex-determining region, Y-linked gene results in XY males that exhibit female characteristics, deletion of RNA binding motif, Y-encoded in azoospermic factor b region results in the arrest of spermatogenesis at meiosis. The holandric genes have been covered for associating the mutations with male factor infertility. PMID:27536043

  16. Diaphanous gene mutation affects spiral cleavage and chirality in snails

    PubMed Central

    Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi

    2016-01-01

    L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420

  17. Dopamine Transporter Gene Variant Affecting Expression in Human Brain is Associated with Bipolar Disorder

    PubMed Central

    Pinsonneault, Julia K; Han, Dawn D; Burdick, Katherine E; Kataki, Maria; Bertolino, Alessandro; Malhotra, Anil K; Gu, Howard H; Sadee, Wolfgang

    2011-01-01

    The gene encoding the dopamine transporter (DAT) has been implicated in CNS disorders, but the responsible polymorphisms remain uncertain. To search for regulatory polymorphisms, we measured allelic DAT mRNA expression in substantia nigra of human autopsy brain tissues, using two marker SNPs (rs6347 in exon 9 and rs27072 in the 3′-UTR). Allelic mRNA expression imbalance (AEI), an indicator of cis-acting regulatory polymorphisms, was observed in all tissues heterozygous for either of the two marker SNPs. SNP scanning of the DAT locus with AEI ratios as the phenotype, followed by in vitro molecular genetics studies, demonstrated that rs27072 C>T affects mRNA expression and translation. Expression of the minor T allele was dynamically regulated in transfected cell cultures, possibly involving microRNA interactions. Both rs6347 and rs3836790 (intron8 5/6 VNTR) also seemed to affect DAT expression, but not the commonly tested 9/10 VNTR in the 3′UTR (rs28363170). All four polymorphisms (rs6347, intron8 5/6 VNTR, rs27072 and 3′UTR 9/10 VNTR) were genotyped in clinical cohorts, representing schizophrenia, bipolar disorder, depression, and controls. Only rs27072 was significantly associated with bipolar disorder (OR=2.1, p=0.03). This result was replicated in a second bipolar/control population (OR=1.65, p=0.01), supporting a critical role for DAT regulation in bipolar disorder. PMID:21525861

  18. Inference of gene regulation functions from dynamic transcriptome data

    PubMed Central

    Hillenbrand, Patrick; Maier, Kerstin C; Cramer, Patrick; Gerland, Ulrich

    2016-01-01

    To quantify gene regulation, a function is required that relates transcription factor binding to DNA (input) to the rate of mRNA synthesis from a target gene (output). Such a ‘gene regulation function’ (GRF) generally cannot be measured because the experimental titration of inputs and simultaneous readout of outputs is difficult. Here we show that GRFs may instead be inferred from natural changes in cellular gene expression, as exemplified for the cell cycle in the yeast S. cerevisiae. We develop this inference approach based on a time series of mRNA synthesis rates from a synchronized population of cells observed over three cell cycles. We first estimate the functional form of how input transcription factors determine mRNA output and then derive GRFs for target genes in the CLB2 gene cluster that are expressed during G2/M phase. Systematic analysis of additional GRFs suggests a network architecture that rationalizes transcriptional cell cycle oscillations. We find that a transcription factor network alone can produce oscillations in mRNA expression, but that additional input from cyclin oscillations is required to arrive at the native behaviour of the cell cycle oscillator. DOI: http://dx.doi.org/10.7554/eLife.12188.001 PMID:27652904

  19. Canalization of gene expression in the Drosophila blastoderm by gap gene cross regulation.

    PubMed

    Manu; Surkova, Svetlana; Spirov, Alexander V; Gursky, Vitaly V; Janssens, Hilde; Kim, Ah-Ram; Radulescu, Ovidiu; Vanario-Alonso, Carlos E; Sharp, David H; Samsonova, Maria; Reinitz, John

    2009-03-01

    Developing embryos exhibit a robust capability to reduce phenotypic variations that occur naturally or as a result of experimental manipulation. This reduction in variation occurs by an epigenetic mechanism called canalization, a phenomenon which has resisted understanding because of a lack of necessary molecular data and of appropriate gene regulation models. In recent years, quantitative gene expression data have become available for the segment determination process in the Drosophila blastoderm, revealing a specific instance of canalization. These data show that the variation of the zygotic segmentation gene expression patterns is markedly reduced compared to earlier levels by the time gastrulation begins, and this variation is significantly lower than the variation of the maternal protein gradient Bicoid. We used a predictive dynamical model of gene regulation to study the effect of Bicoid variation on the downstream gap genes. The model correctly predicts the reduced variation of the gap gene expression patterns and allows the characterization of the canalizing mechanism. We show that the canalization is the result of specific regulatory interactions among the zygotic gap genes. We demonstrate the validity of this explanation by showing that variation is increased in embryos mutant for two gap genes, Krüppel and knirps, disproving competing proposals that canalization is due to an undiscovered morphogen, or that it does not take place at all. In an accompanying article in PLoS Computational Biology (doi:10.1371/journal.pcbi.1000303), we show that cross regulation between the gap genes causes their expression to approach dynamical attractors, reducing initial variation and providing a robust output. These results demonstrate that the Bicoid gradient is not sufficient to produce gap gene borders having the low variance observed, and instead this low variance is generated by gap gene cross regulation. More generally, we show that the complex multigenic

  20. Aspergillus nidulans mutants defective in stc gene cluster regulation.

    PubMed Central

    Butchko, R A; Adams, T H; Keller, N P

    1999-01-01

    The genes involved in the biosynthesis of sterigmatocystin (ST), a toxic secondary metabolite produced by Aspergillus nidulans and an aflatoxin (AF) precursor in other Aspergillus spp., are clustered on chromosome IV of A. nidulans. The sterigmatocystin gene cluster (stc gene cluster) is regulated by the pathway-specific transcription factor aflR. The function of aflR appears to be conserved between ST- and AF-producing aspergilli, as are most of the other genes in the cluster. We describe a novel screen for detecting mutants defective in stc gene cluster activity by use of a genetic block early in the ST biosynthetic pathway that results in the accumulation of the first stable intermediate, norsolorinic acid (NOR), an orange-colored compound visible with the unaided eye. We have mutagenized this NOR-accumulating strain and have isolated 176 Nor(-) mutants, 83 of which appear to be wild type in growth and development. Sixty of these 83 mutations are linked to the stc gene cluster and are likely defects in aflR or known stc biosynthetic genes. Of the 23 mutations not linked to the stc gene cluster, 3 prevent accumulation of NOR due to the loss of aflR expression. PMID:10511551

  1. Conditioned taste aversion dependent regulation of amygdala gene expression.

    PubMed

    Panguluri, Siva K; Kuwabara, Nobuyuki; Kang, Yi; Cooper, Nigel; Lundy, Robert F

    2012-02-28

    The present experiments investigated gene expression in the amygdala following contingent taste/LiCl treatment that supports development of conditioned taste aversion (CTA). The use of whole genome chips and stringent data set filtering led to the identification of 168 genes regulated by CTA compared to non-contingent LiCl treatment that does not support CTA learning. Seventy-six of these genes were eligible for network analysis. Such analysis identified "behavior" as the top biological function, which was represented by 15 of the 76 genes. These genes included several neuropeptides, G protein-coupled receptors, ion channels, kinases, and phosphatases. Subsequent qRT-PCR analyses confirmed changes in mRNA expression for 5 of 7 selected genes. We were able to demonstrate directionally consistent changes in protein level for 3 of these genes; insulin 1, oxytocin, and major histocompatibility complex class I-C. Behavioral analyses demonstrated that blockade of central insulin receptors produced a weaker CTA that was less resistant to extinction. Together, these results support the notion that we have identified downstream genes in the amygdala that contribute to CTA learning.

  2. Role of mga in growth phase regulation of virulence genes of the group A streptococcus.

    PubMed Central

    McIver, K S; Scott, J R

    1997-01-01

    To determine whether growth phase affects the expression of mga and other virulence-associated genes in the group A streptococcus (GAS), total RNA was isolated from the serotype M6 GAS strain JRS4 at different phases of growth and transcript levels were quantitated by hybridization with radiolabeled DNA probes. Expression of mga (which encodes a multiple gene regulator) and the Mga-regulated genes emm (which encodes M protein) and scpA (which encodes a complement C5a peptidase) was found to be maximal in exponential phase and shut off as the bacteria entered stationary phase, while the housekeeping genes recA and rpsL showed constant transcript levels over the same period of growth. Expression of mga from a foreign phage promoter in a mga-deleted GAS strain (JRS519) altered the wild-type growth phase-dependent transcription profile seen for emm and scpA, as well as for mga. Therefore, the temporal control of mga expression requires its upstream promoter region, and the subsequent growth phase regulation of emm and scpA is Mga dependent. A number of putative virulence genes in JRS4 were shown not to require Mga for their expression, although several exhibited growth phase-dependent regulation that was similar to mga, i.e., slo (which encodes streptolysin O) and plr (encoding the plasmin receptor/glyceraldehyde-3-phosphate dehydrogenase). Still others showed a markedly different pattern of expression (the genes for the superantigen toxins MF and SpeC). These results suggest the existence of complex levels of global regulation sensitive to growth phase that directly control the expression of virulence genes and mga in GAS. PMID:9260962

  3. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  4. A 57-bp deletion in the ovine KAP6-1 gene affects wool fibre diameter.

    PubMed

    Zhou, H; Gong, H; Li, S; Luo, Y; Hickford, J G H

    2015-08-01

    High glycine-tyrosine keratin-associated proteins (HGT-KAPs) are predominantly present in the orthocortex of wool fibres. They vary in abundance in different wools and have been implicated in regulating wool fibre properties, but little is known about the functional roles of these proteins in the fibre matrix. In this study, we used polymerase chain reaction--single-strand conformational polymorphism (PCR-SSCP) analysis to screen for variation in a gene encoding the ovine HGT-KAP6-1 protein. We identified three gene variants (A, B and C). Variants A and B were similar to each other, with only three nucleotide differences occurring downstream of the coding sequence. However, variant C had a 57-bp deletion that would notionally result in a loss of 19 amino acids in the protein. The presence of C was found to be associated with an increase in mean fibre diameter (MFD), fibre diameter standard deviation (FDSD), coefficient of variation of fibre diameter (CVFD) and prickle factor (percentage of fibres over 30 microns; PF). Sheep of genotype BC produced wool of greater MFD, FDSD and PF than sheep of genotypes AA, AB and BB. The CVFD was greater in the BC sheep than the AB sheep. The results suggest that variation in ovine KRTAP6-1 affects wool fibre diameter-associated traits and that the 57-bp deletion in this gene would lead to coarser wool with greater FDSD, CVFD and PF.

  5. Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations.

    PubMed

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M A; Bramley, Peter M; Fraser, Paul D

    2013-11-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed.

  6. Cytogenetic and molecular localization of tipE: A gene affecting sodium channels in Drosophila melanogaster

    SciTech Connect

    Feng, G.; Deak, P.; Hall, L.M.

    1995-04-01

    Voltage-sensitive sodium channels play a key role in nerve cells where they are responsible for the increase in sodium permeability during the rising phase of action potentials. In Drosophila melanogaster a subset of temperature-sensitive paralytic mutations affect sodium channel function. One such mutation is temperature-induced paralysis locus E (tipE), which has been shown by electrophysiology and ligand binding studies to reduce sodium channel numbers. Three new {gamma}-ray-induced tipE alleles associated with either visible deletions in 64AB or a translocation breakpoint within 64B2 provide landmarks for positional cloning of tipE. Beginning with the flanking cloned gene Ras2, a 140-kb walk across the translocation breakpoint was completed. Germline transformation using a 42-kb cosmid clone and successively smaller subclones localized the tipE gene within a 7.4-kb genomic DNA segment. Although this chromosome region is rich in transcripts, only three overlapping mRNAs (5.4, 4.4, and 1.7 kb) lie completely within the smallest rescuing construct. The small sizes of the rescuing construct and transcripts suggests that tipE does not encode a standard sodium channel {alpha}-subunit with four homologous repeats. Sequencing these transcripts will elucidate the role of the tipE gene product in sodium channel functional regulation. 55 refs., 4 figs., 2 tabs.

  7. Cytogenetic and molecular localization of tipE: a gene affecting sodium channels in Drosophila melanogaster.

    PubMed

    Feng, G; Deák, P; Kasbekar, D P; Gil, D W; Hall, L M

    1995-04-01

    Voltage-sensitive sodium channels play a key role in nerve cells where they are responsible for the increase in sodium permeability during the rising phase of action potentials. In Drosophila melanogaster a subset of temperature-sensitive paralytic mutations affect sodium channel function. One such mutation is temperature-induced paralysis locus E (tipE), which has been shown by electrophysiology and ligand binding studies to reduce sodium channel numbers. Three new gamma-ray-induced tipE alleles associated with either visible deletions in 64AB or a translocation breakpoint within 64B2 provide landmarks for positional cloning of tipE. Beginning with the flanking cloned gene Ras2, a 140-kb walk across the translocation breakpoint was completed. Germline transformation using a 42-kb cosmid clone and successively smaller subclones localized the tipE gene within a 7.4-kb genomic DNA segment. Although this chromosome region is rich in transcripts, only three overlapping mRNAs (5.4, 4.4, and 1.7 kb) lie completely within the smallest rescuing construct. The small sizes of the rescuing construct and transcripts suggest that tipE does not encode a standard sodium channel alpha-subunit with four homologous repeats. Sequencing these transcripts will elucidate the role of the tipE gene product in sodium channel functional regulation.

  8. Downregulation of RWA genes in hybrid aspen affects xylan acetylation and wood saccharification.

    PubMed

    Pawar, Prashant Mohan-Anupama; Ratke, Christine; Balasubramanian, Vimal K; Chong, Sun-Li; Gandla, Madhavi Latha; Adriasola, Mathilda; Sparrman, Tobias; Hedenström, Mattias; Szwaj, Klaudia; Derba-Maceluch, Marta; Gaertner, Cyril; Mouille, Gregory; Ezcurra, Ines; Tenkanen, Maija; Jönsson, Leif J; Mellerowicz, Ewa J

    2017-03-03

    High acetylation of angiosperm wood hinders its conversion to sugars by glycoside hydrolases, subsequent ethanol fermentation and (hence) its use for biofuel production. We studied the REDUCED WALL ACETYLATION (RWA) gene family of the hardwood model Populus to evaluate its potential for improving saccharification. The family has two clades, AB and CD, containing two genes each. All four genes are expressed in developing wood but only RWA-A and -B are activated by master switches of the secondary cell wall PtNST1 and PtMYB21. Histochemical analysis of promoter::GUS lines in hybrid aspen (Populus tremula × tremuloides) showed activation of RWA-A and -B promoters in the secondary wall formation zone, while RWA-C and -D promoter activity was diffuse. Ectopic downregulation of either clade reduced wood xylan and xyloglucan acetylation. Suppressing both clades simultaneously using the wood-specific promoter reduced wood acetylation by 25% and decreased acetylation at position 2 of Xylp in the dimethyl sulfoxide-extracted xylan. This did not affect plant growth but decreased xylose and increased glucose contents in the noncellulosic monosaccharide fraction, and increased glucose and xylose yields of wood enzymatic hydrolysis without pretreatment. Both RWA clades regulate wood xylan acetylation in aspen and are promising targets to improve wood saccharification.

  9. 77 FR 467 - Notice of Tribal Consultation Meetings Regarding How the Current SACWIS Regulations Affect Tribes...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-05

    ... Meetings Regarding How the Current SACWIS Regulations Affect Tribes Administering a Title IV-E Program... CONTACT: If you have questions about this process, or want further information about current...

  10. Accuracy and generalizability in summaries of affect regulation strategies: comment on Webb, Miles, and Sheeran (2012).

    PubMed

    Augustine, Adam A; Hemenover, Scott H

    2013-05-01

    In their examination of the effectiveness of affect regulation strategies, Webb, Miles, and Sheeran (2012) offered the results of a broad meta-analysis of studies on regulatory interventions. Their analysis provides an alternative to our earlier, more focused meta-analysis of the affect regulation literature (Augustine & Hemenover, 2009). Unfortunately, there are a number of errors and omissions in this new meta-analysis that could lead to misconceptions regarding both our previous work and the state of the affect regulation literature. In this comment, we examine the impact of methodological issues, inconsistent inclusion criteria, variance in manipulations, and what we perceive to be a subjective and inconsistent selection of effect sizes on the accuracy and generalizability of Webb and colleagues' estimates of affect regulation strategy effectiveness.

  11. Regulation of gene expression in bovine blastocysts in response to oxygen and the iron chelator desferrioxamine.

    PubMed

    Harvey, A J; Kind, K L; Thompson, J G

    2007-07-01

    Low (2%) oxygen conditions during postcompaction culture of bovine blastocysts improve embryo quality and are associated with small increases in the expression of glucose transporter 1 (SLC2A1), anaphase promoting complex (ANAPC1), and myotrophin (MTPN), suggesting a role for oxygen in the regulation of embryo development, mediated through oxygen-sensitive gene expression. However, bovine embryos, to at least the blastocyst stage, lack detectable levels of the key regulator of oxygen-sensitive gene expression, hypoxia-inducible 1 alpha (HIF1A), while the less well-characterized HIF2 alpha protein is readily detectable. Here we report that other key HIF1 regulated genes are not significantly altered in their expression pattern in bovine blastocysts in response to reduced oxygen concentrations postcompaction-with the exception of lactate dehydrogenase A (LDHA), which was significantly increased following 2% oxygen culture. Antioxidant enzymes have been suggested as potential HIF2 target genes, but their expression was not altered following low-oxygen culture in the bovine blastocyst. The addition of desferrioxamine (an iron chelator and inducer of HIF-regulated gene expression) during postcompaction stages significantly increased SLC2A1, LDHA, inducible nitric oxide synthase (NOS2A), and MTPN gene expression in bovine blastocysts, although development to the blastocyst stage was not significantly affected. These results further suggest that expression of genes, known to be regulated by oxygen via HIF-1 in somatic cells, is not influenced by oxygen during preimplantation postcompaction bovine embryo development. Oxygen-regulated expression of LDHA and SLC2A1 in bovine blastocysts suggests that regulation of these genes may be mediated by HIF2. Furthermore, the effect of a reduced-oxygen environment on gene expression can be mimicked in vitro through the use of desferrioxamine. These results further support our data that the bovine blastocyst stage embryo is unique in

  12. Maternal regulation of child affect in externalizing and typically-developing children.

    PubMed

    Lougheed, Jessica P; Hollenstein, Tom; Lichtwarck-Aschoff, Anna; Granic, Isabela

    2015-02-01

    Temporal contingencies between children's affect and maternal behavior play a role in the development of children's externalizing problems. The goal of the current study was to use a microsocial approach to compare dyads with externalizing dysregulation (N =191) to healthy controls (N = 54) on maternal supportive regulation of children's negative and positive affect. Children were between the ages of 8 and 12 years. Mother-child dyads participated in conflict and positive discussions, and child affect and maternal supportive affect regulation were coded in real time. First, no group differences on overall levels of mother supportive regulation or child affect were found. Second, three event history analyses in a 2-level Cox hazard regression framework were used to predict the hazard rate of (a) maternal supportiveness, and of children's transitions (b) out of negative affect and (c) into positive affect. The hazard rate of maternal supportiveness, regardless of child affect, was not different between groups. However, as expected, the likelihood of mothers' supportive responses to children's negative affect was lower in externalizing than comparison dyads. In addition, children with externalizing problems were significantly less likely than typically developing children to transition out of negative affect in response to maternal supportiveness. The likelihood of both typically developing children and children with externalizing problems transitioning into positive affect were not related to specific occurrences of maternal supportiveness. Results of the current study show the importance of temporal dynamics in mother-child interactions in the emergence of children's externalizing problems.

  13. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene

    PubMed Central

    Zhou, Jiawei

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  14. Functional Enhancers As Master Regulators of Tissue-Specific Gene Regulation and Cancer Development

    PubMed Central

    Ko, Je Yeong; Oh, Sumin; Yoo, Kyung Hyun

    2017-01-01

    Tissue-specific transcription is critical for normal development, and abnormalities causing undesirable gene expression may lead to diseases such as cancer. Such highly organized transcription is controlled by enhancers with specific DNA sequences recognized by transcription factors. Enhancers are associated with chromatin modifications that are distinct epigenetic features in a tissue-specific manner. Recently, super-enhancers comprising enhancer clusters co-occupied by lineage-specific factors have been identified in diverse cell types such as adipocytes, hair follicle stem cells, and mammary epithelial cells. In addition, noncoding RNAs, named eRNAs, are synthesized at super-enhancer regions before their target genes are transcribed. Many functional studies revealed that super-enhancers and eRNAs are essential for the regulation of tissue-specific gene expression. In this review, we summarize recent findings concerning enhancer function in tissue-specific gene regulation and cancer development. PMID:28359147

  15. Role of AINTEGUMENTA-like gene NtANTL in the regulation of tobacco organ growth.

    PubMed

    Kuluev, Bulat; Avalbaev, Azamat; Nurgaleeva, Elina; Knyazev, Alexey; Nikonorov, Yuriy; Chemeris, Alexey

    2015-09-15

    The Nicotiana tabacum AINTEGUMENTA-like gene (NtANTL), encoding one of AP2/ERF transcription factors, is a putative ortholog of the AtANT gene from Arabidopsis thaliana. In wild-type tobacco plants, the NtANTL gene was expressed in the actively dividing young flowers, shoot apices, and calluses, while the level of its mRNA increased considerably after treatment with exogenous 6-benzylaminopurine, indoleacetic acid and 24-epibrassinolide. We found a positive correlation among the expression levels of NtANTL, cyclin NtCYCD3;1 and cyclin-dependent kinase NtCDKB1-1 genes, suggesting possible molecular links between AINTEGUMENTA and cell cycle regulators in tobacco plants. However, no correlation was observed between NtANTL, NtCYCD3;1 and NtCDKB1-1 expression levels in response to NaCl and ABA. These observations indicate that the transcription factor NtANTL was not involved in the regulation of the cellular response to salinity nor did it affect the expression of NtCYCD3;1 and NtCDKB1-1 when tobacco plants were exposed to salt stress and ABA. In addition, we generated transgenic tobacco plants with both up-regulated and down-regulated expression of the NtANTL gene. Constitutive expression of the NtANTL gene contributed to an increase in the size of leaves and corolla of transgenic plants. Transgenic plants with reduced expression of the NtANTL gene had smaller leaves, flowers and stems, but showed a compensatory increase in the cell size of leaves and flowers. The results show the significance of the NtANTL gene for the control of organ growth by both cell division and expansion in tobacco plants.

  16. Caesium-affected gene expression in Arabidopsis thaliana.

    PubMed

    Sahr, Tobias; Voigt, Gabriele; Paretzke, Herwig G; Schramel, Peter; Ernst, Dieter

    2005-03-01

    * Excessive caesium can be toxic to plants. Here we investigated Cs uptake and caesium-induced gene expression in Arabidopsis thaliana. * Accumulation was measured in plants grown for 5 wk on agar supplemented with nontoxic and up to toxic levels of Cs. Caesium-induced gene expression was studied by suppression-subtractive hybridization (SSH) and RT-PCR. * Caesium accumulated in leaf rosettes dependent upon the external concentration in the growth media, whereas the potassium concentration decreased in rosettes. At a concentration of 850 microM, Cs plants showed reduced development, and withered with an increase in concentration to 1 mM Cs. SSH resulted in the isolation of 73 clones that were differentially expressed at a Cs concentration of 150 microM. Most of the genes identified belong to groups of genes encoding proteins in stress defence, detoxification, transport, homeostasis and general metabolism, and proteins controlling transcription and translation. * The present study identified a number of marker genes for Cs in Arabidopsis grown under nontoxic Cs concentrations, indicating that Cs acts as an abiotic stress factor.

  17. groE genes affect SOS repair in Escherichia coli

    SciTech Connect

    Liu, S.K.; Tessman, I. )

    1990-10-01

    Repair of UV-irradiated bacteriophage in Escherichia coli by Weigle reactivation requires functional recA+ and umuD+C+ genes. When the cells were UV irradiated, the groE heat shock gene products, GroES and GroEL, were needed for at least 50% of the Weigle reactivation of the single-stranded DNA phage S13. Because of repression of the umuDC and recA genes, Weigle reactivation is normally blocked by the lexA3(Ind-) mutation (which creates a noncleavable LexA protein), but it was restored by a combination of a high-copy-number umuD+C+ plasmid and a UV dose that increases groE expression. Maximal reactivation was achieved by elevated amounts of the Umu proteins, which was accomplished in part by UV-induced expression of the groE genes. By increasing the number of copies of the umuD+C+ genes, up to 50% of the normal amount of reactivation of S13 was achieved in an unirradiated recA+ host.

  18. RNA-based gene circuits for cell regulation

    PubMed Central

    KARAGIANNIS, Peter; FUJITA, Yoshihiko; SAITO, Hirohide

    2016-01-01

    A major goal of synthetic biology is to control cell behavior. RNA-mediated genetic switches (RNA switches) are devices that serve this purpose, as they can control gene expressions in response to input signals. In general, RNA switches consist of two domains: an aptamer domain, which binds to an input molecule, and an actuator domain, which controls the gene expression. An input binding to the aptamer can cause the actuator to alter the RNA structure, thus changing access to translation machinery. The assembly of multiple RNA switches has led to complex gene circuits for cell therapies, including the selective killing of pathological cells and purification of cell populations. The inclusion of RNA binding proteins, such as L7Ae, increases the repertoire and precision of the circuit. In this short review, we discuss synthetic RNA switches for gene regulation and their potential therapeutic applications. PMID:27840389

  19. Complex roles of Stat1 in regulating gene expression.

    PubMed

    Ramana, C V; Chatterjee-Kishore, M; Nguyen, H; Stark, G R

    2000-05-15

    Stat1 is a fascinating and complex protein with multiple, yet contrasting transcriptional functions. Upon activation, it drives the expression of many genes but also suppresses the transcription of others. These opposing characteristics also apply to its role in facilitating crosstalk between signal transduction pathways, as it participates in both synergistic activation and inhibition of gene expression. Stat1 is a functional transcription factor even in the absence of inducer-mediated activation, participating in the constitutive expression of some genes. This review summarizes the well studied involvement of Stat1 in IFN-dependent and growth factor-dependent signaling and then describes the roles of Stat1 in positive, negative and constitutive regulation of gene expression as well as its participation in crosstalk between signal transduction pathways. Oncogene (2000).

  20. Achieving HIV-1 Control through RNA-Directed Gene Regulation

    PubMed Central

    Klemm, Vera; Mitchell, Jye; Cortez-Jugo, Christina; Cavalieri, Francesca; Symonds, Geoff; Caruso, Frank; Kelleher, Anthony Dominic; Ahlenstiel, Chantelle

    2016-01-01

    HIV-1 infection has been transformed by combined anti-retroviral therapy (ART), changing a universally fatal infection into a controllable infection. However, major obstacles for an HIV-1 cure exist. The HIV latent reservoir, which exists in resting CD4+ T cells, is not impacted by ART, and can reactivate when ART is interrupted or ceased. Additionally, multi-drug resistance can arise. One alternate approach to conventional HIV-1 drug treatment that is being explored involves gene therapies utilizing RNA-directed gene regulation. Commonly known as RNA interference (RNAi), short interfering RNA (siRNA) induce gene silencing in conserved biological pathways, which require a high degree of sequence specificity. This review will provide an overview of the silencing pathways, the current RNAi technologies being developed for HIV-1 gene therapy, current clinical trials, and the challenges faced in progressing these treatments into clinical trials. PMID:27941595

  1. Cis-Acting Polymorphisms Affect Complex Traits through Modifications of MicroRNA Regulation Pathways

    PubMed Central

    Hartsperger, Mara L.; Pfeufer, Arne; Stümpflen, Volker

    2012-01-01

    Genome-wide association studies (GWAS) have become an effective tool to map genes and regions contributing to multifactorial human diseases and traits. A comparably small number of variants identified by GWAS are known to have a direct effect on protein structure whereas the majority of variants is thought to exert their moderate influences on the phenotype through regulatory changes in mRNA expression. MicroRNAs (miRNAs) have been identified as powerful posttranscriptional regulators of mRNAs. Binding to their target sites, which are mostly located within the 3′-untranslated region (3′-UTR) of mRNA transcripts, they modulate mRNA expression and stability. Until today almost all human mRNA transcripts are known to harbor at least one miRNA target site with an average of over 20 miRNA target sites per transcript. Among 5,101 GWAS-identified sentinel single nucleotide polymorphisms (SNPs) that correspond to 18,884 SNPs in linkage disequilibrium (LD) with the sentinels () we identified a significant overrepresentation of SNPs that affect the 3′-UTR of genes (OR = 2.33, 95% CI = 2.12–2.57, ). This effect was even stronger considering all SNPs in one LD bin a single signal (OR = 4.27, 95% CI = 3.84–4.74, ). Based on crosslinking immunoprecipitation data we identified four mechanisms affecting miRNA regulation by 3′-UTR mutations: (i) deletion or (ii) creation of miRNA recognition elements within validated RNA-induced silencing complex binding sites, (iii) alteration of 3′-UTR splicing leading to a loss of binding sites, and (iv) change of binding affinity due to modifications of 3′-UTR folding. We annotated 53 SNPs of a total of 288 trait-associated 3′-UTR SNPs as mediating at least one of these mechanisms. Using a qualitative systems biology approach, we demonstrate how our findings can be used to support biological interpretation of GWAS results as well as to provide new experimentally testable hypotheses. PMID:22606281

  2. Paralogue Interference Affects the Dynamics after Gene Duplication.

    PubMed

    Kaltenegger, Elisabeth; Ober, Dietrich

    2015-12-01

    Proteins tend to form homomeric complexes of identical subunits, which act as functional units. By definition, the subunits are encoded from a single genetic locus. When such a gene is duplicated, the gene products are suggested initially to cross-interact when coexpressed, thus resulting in the phenomenon of paralogue interference. In this opinion article, we explore how paralogue interference can shape the fate of a duplicated gene. One important outcome is a prolonged time window in which both copies remain under selection increasing the chance to accumulate mutations and to develop new properties. Thereby, paralogue interference can mediate the coevolution of duplicates and here we illustrate the potential of this phenomenon in light of recent new studies.

  3. Combinatorial gene regulation by modulation of relative pulse timing

    PubMed Central

    Lin, Yihan; Sohn, Chang Ho; Dalal, Chiraj K.; Cai, Long; Elowitz, Michael B.

    2015-01-01

    Studies of individual living cells have revealed that many transcription factors activate in dynamic, and often stochastic, pulses within the same cell. However, it has remained unclear whether cells might modulate the relative timing of these pulses to control gene expression. Here, using quantitative single-cell time-lapse imaging of Saccharomyces cerevisiae, we show that the pulsatile transcription factors Msn2 and Mig1 combinatorially regulate their target genes through modulation of their relative pulse timing. The activator Msn2 and repressor Mig1 pulsed in either a temporally overlapping or non-overlapping manner during their transient response to different inputs, with only the non-overlapping dynamics efficiently activating target gene expression. Similarly, under constant environmental conditions, where Msn2 and Mig1 exhibit sporadic pulsing, glucose concentration modulated the temporal overlap between pulses of the two factors. Together, these results reveal a time-based mode of combinatorial gene regulation. Regulation through relative signal timing is common in engineering and neurobiology, and these results suggest that it could also function broadly within the signaling and regulatory systems of the cell. PMID:26466562

  4. Signal Transduction Pathways that Regulate CAB Gene Expression

    SciTech Connect

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  5. Signal Transduction Pathways that Regulate CAB Gene Expression

    SciTech Connect

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  6. Antagonistic relationship between AtRALF1 and brassinosteroid regulates cell expansion-related genes.

    PubMed

    Bergonci, Tábata; Silva-Filho, Marcio C; Moura, Daniel S

    2014-01-01

    Rapid alkalinization factor (RALF) is a peptide signal that plays a role in plant cell expansion. We have recently proposed that AtRALF1 negatively regulates root cell elongation and lateral root formation by opposing the effects of brassinosteroid (BR). We reported 6 AtRALF1-inducible cell wall-related genes and 2 P450 monooxygenase -encoding genes involved in the BR biosynthetic pathway. The AtRALF1-inducible genes implicated in cell wall remodeling were not downregulated by brassinolide (BL) treatment alone; their induction was only compromised following simultaneous treatment with AtRALF1 and BL. We further examined the cell wall-remodeling gene EXPANSIN A5 (AtEXPA5), which is upregulated by BL and has been shown to positively affect root cell elongation. Herein, we report that AtEXPA5 expression is downregulated by AtRALF1 in a dose-dependent manner in the roots and hypocotyls of Arabidopsis plants. AtEXPA5 is also downregulated in plants that overexpress AtRALF1, and it is upregulated in plants in which the AtRALF1 gene is partially silenced. The AtRALF1 peptide is also able to repress AtEXPA5 induction following a pre-treatment with BL. A schematic diagram showing the gene regulatory network connecting the recently reported genes with the regulation of cell expansion by AtEXPA5 is presented.

  7. Antagonistic relationship between AtRALF1and brassinosteroid regulates cellexpansion-related genes

    PubMed Central

    Bergonci, Tábata; Silva-Filho, Marcio C; Moura, Daniel S

    2014-01-01

    Rapid alkalinization factor (RALF) is a peptide signal that plays a role in plant cell expansion. We have recently proposed that AtRALF1 negatively regulates root cell elongation and lateral root formation by opposing the effects of brassinosteroid (BR). We reported 6 AtRALF1-inducible cell wall-related genes and 2 P450 monooxygenase -encoding genes involved in the BR biosynthetic pathway. The AtRALF1-inducible genes implicated in cell wall remodeling were not downregulated by brassinolide (BL) treatment alone; their induction was only compromised following simultaneous treatment with AtRALF1 and BL. We further examined the cell wall-remodeling gene EXPANSIN A5 (AtEXPA5), which is upregulated by BL and has been shown to positively affect root cell elongation. Herein, we report that AtEXPA5 expression is downregulated by AtRALF1 in a dose-dependent manner in the roots and hypocotyls of Arabidopsis plants. AtEXPA5 is also downregulated in plants that overexpress AtRALF1, and it is upregulated in plants in which the AtRALF1 gene is partially silenced. The AtRALF1 peptide is also able to repress AtEXPA5 induction following a pre-treatment with BL. A schematic diagram showing the gene regulatory network connecting the recently reported genes with the regulation of cell expansion by AtEXPA5 is presented. PMID:25482784

  8. Cartilage tissue engineering: recent advances and perspectives from gene regulation/therapy.

    PubMed

    Li, Kuei-Chang; Hu, Yu-Chen

    2015-05-01

    Diseases in articular cartilages affect millions of people. Despite the relatively simple biochemical and cellular composition of articular cartilages, the self-repair ability of cartilage is limited. Successful cartilage tissue engineering requires intricately coordinated interactions between matrerials, cells, biological factors, and phycial/mechanical factors, and still faces a multitude of challenges. This article presents an overview of the cartilage biology, current treatments, recent advances in the materials, biological factors, and cells used in cartilage tissue engineering/regeneration, with strong emphasis on the perspectives of gene regulation (e.g., microRNA) and gene therapy.

  9. Affective Self-Regulation Trajectories During Secondary School Predict Substance Use Among Urban Minority Young Adults

    PubMed Central

    Griffin, Kenneth W.; Lowe, Sarah R.; Acevedo, Bianca P.; Botvin, Gilbert J.

    2015-01-01

    This study explored the relationship between trajectories of affective self-regulation skills during secondary school and young adult substance use in a large multi-ethnic, urban sample (N = 995). During secondary school, participants completed a measure of cognitive and behavioral skills used to control negative, unpleasant emotions or perceived stress. As young adults, participants reported on the frequency and quantity of their alcohol, cigarette, and marijuana use in a telephone interview. Controlling for demographic variables, self-regulation did not significantly change over adolescence, although there was significant variation in participants’ rates of growth and decline. Lower seventh grade self-regulation and less steep increases in self-regulation were predictive of higher young adult substance use. Male participants had significantly lower initial self-regulation and higher young adult substance use. The results suggest that interventions that build affective self-regulation skills in adolescence may decrease the risk of young adult substance use. PMID:26549966

  10. Carbon dioxide as a regulator of gene expression in microorganisms.

    PubMed

    Stretton, S; Goodman, A E

    1998-01-01

    CO2 regulates gene expression across a diverse group of microorganisms including fungi, and both photosynthetic and non photosynthetic bacteria. The processes that CO2 regulates are diverse. Several CO2-responsive random promoter lacZ fusions of unknown function have been isolated from a marine Synechococcus and a Pseudoalteromonas sp., highlighting the wide effect of CO2 control in these organisms. Regulatory proteins have been described that mediate the CO2 response at transcription level in Bacillus anthracis, the group A streptococci and two Rhodobacter spp. These regulatory proteins include: AcpA and AtxA that are involved in CO2 control of B. anthracis capsule and toxin production; Mga that regulates surface associated virulence factors in the group A streptococci; and RegB/A, a two component signal transduction system that responds to environmental stimuli including CO2, to regulate photosynthetic apparatus and CO2 fixation enzyme synthesis in Rhodobacter spp.

  11. BRCA1 transcriptionally regulates genes involved in breast tumorigenesis

    PubMed Central

    Welcsh, Piri L.; Lee, Ming K.; Gonzalez-Hernandez, Rachel M.; Black, Daniel J.; Mahadevappa, Mamatha; Swisher, Elizabeth M.; Warrington, Janet A.; King, Mary-Claire

    2002-01-01

    Loss of function of BRCA1 caused by inherited mutation and tissue-specific somatic mutation leads to breast and ovarian cancer. Nearly all BRCA1 germ-line mutations involve truncation or loss of the C-terminal BRCT transcriptional activation domain, suggesting that transcriptional regulation is a critical function of the wild-type gene. The purpose of this project was to determine whether there is a link between the role of BRCA1 in transcriptional regulation and its role in tumor suppression. We developed a cell line (in which BRCA1 can be induced) and used microarray analysis to compare transcription profiles of epithelial cells with low endogenous levels of BRCA1 vs. transcription profiles of cells with 2–4-fold higher induced levels of expression of BRCA1. At these levels of expression, BRCA1 did not induce apoptosis. Undirected cluster analysis of six paired experiments revealed 373 genes, the expression of which was altered significantly and consistently by BRCA1 induction. Expression of 62 genes was altered more than 2-fold. BRCA1-regulated genes associated with breast tumorigenesis included the estrogen-responsive genes MYC and cyclin D1, which are overexpressed in many breast tumors; STAT1 and JAK1, key components of the cytokine signal transduction pathway; the extracellular matrix protein laminin 3A; ID4, an inhibitor of DNA-binding transcriptional activators, which in turn negatively regulates BRCA1 expression; and the prohormone stanniocalcin, expression of which is lost in breast tumor cells. Coordinated expression of BRCA1 with ID4 and with stanniocalcin was confirmed in primary breast and ovarian tumors. PMID:12032322

  12. Drawing versus Writing: The Role of Preference in Regulating Short-Term Affect

    ERIC Educational Resources Information Center

    Drake, Jennifer E.; Hodge, Adeline

    2015-01-01

    In a pilot study we investigated whether the most effective medium for regulating short-term affect depends on one's preference for drawing or writing, and also investigated the emotion regulation strategy (distraction versus expression) spontaneously chosen when drawing and writing. Eighty undergraduates indicated their preference for drawing or…

  13. Early Experiences Can Alter Gene Expression and Affect Long-Term Development. Working Paper #10

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2010

    2010-01-01

    New scientific research shows that environmental influences can actually affect whether and how genes are expressed. Thus, the old ideas that genes are "set in stone" or that they alone determine development have been disproven. In fact, scientists have discovered that early experiences can determine how genes are turned on and off and even…

  14. Transcriptional profiling reveals regulated genes in the hippocampus during memory formation

    NASA Technical Reports Server (NTRS)

    Donahue, Christine P.; Jensen, Roderick V.; Ochiishi, Tomoyo; Eisenstein, Ingrid; Zhao, Mingrui; Shors, Tracey; Kosik, Kenneth S.

    2002-01-01

    Transcriptional profiling (TP) offers a powerful approach to identify genes activated during memory formation and, by inference, the molecular pathways involved. Trace eyeblink conditioning is well suited for the study of regional gene expression because it requires the hippocampus, whereas the highly parallel task, delay conditioning, does not. First, we determined when gene expression was most regulated during trace conditioning. Rats were exposed to 200 trials per day of paired and unpaired stimuli each day for 4 days. Changes in gene expression were most apparent 24 h after exposure to 200 trials. Therefore, we profiled gene expression in the hippocampus 24 h after 200 trials of trace eyeblink conditioning, on multiple arrays using additional animals. Of 1,186 genes on the filter array, seven genes met the statistical criteria and were also validated by real-time polymerase chain reaction. These genes were growth hormone (GH), c-kit receptor tyrosine kinase (c-kit), glutamate receptor, metabotropic 5 (mGluR5), nerve growth factor-beta (NGF-beta), Jun oncogene (c-Jun), transmembrane receptor Unc5H1 (UNC5H1), and transmembrane receptor Unc5H2 (UNC5H2). All these genes, except for GH, were downregulated in response to trace conditioning. GH was upregulated; therefore, we also validated the downregulation of the GH inhibitor, somatostatin (SST), even though it just failed to meet criteria on the arrays. By during situ hybridization, GH was expressed throughout the cell layers of the hippocampus in response to trace conditioning. None of the genes regulated in trace eyeblink conditioning were similarly affected by delay conditioning, a task that does not require the hippocampus. These findings demonstrate that transcriptional profiling can exhibit a repertoire of genes sensitive to the formation of hippocampal-dependent associative memories.

  15. The PSORS1 locus gene CCHCR1 affects keratinocyte proliferation in transgenic mice.

    PubMed

    Tiala, Inkeri; Wakkinen, Janica; Suomela, Sari; Puolakkainen, Pauli; Tammi, Raija; Forsberg, Sofi; Rollman, Ola; Kainu, Kati; Rozell, Björn; Kere, Juha; Saarialho-Kere, Ulpu; Elomaa, Outi

    2008-04-01

    The CCHCR1 gene (Coiled-Coil alpha-Helical Rod protein 1) within the major psoriasis susceptibility locus PSORS1 is a plausible candidate gene for the risk effect. We have previously generated transgenic mice overexpressing either the psoriasis-associated risk allele CCHCR1*WWCC or the normal allele of CCHCR1. All transgenic CCHCR1 mice appeared phenotypically normal, but exhibited altered expression of genes relevant to the pathogenesis of psoriasis, including upregulation of hyperproliferation markers keratins 6, 16 and 17. Here, we challenged the skin of CCHCR1 transgenic mice with wounding or 12-O-tetradecanoyl-13-acetate (TPA), treatments able to induce epidermal hyperplasia and proliferation that both are hallmarks of psoriasis. These experiments revealed that CCHCR1 regulates keratinocyte proliferation. Early wound healing on days 1 and 4 was delayed, and TPA-induced epidermal hyperproliferation was less pronounced in mice with the CCHCR1*WWCC risk allele than in mice with the normal allele or in wild-type animals. Finally, we demonstrated that overexpression of CCHCR1 affects basal keratinocyte proliferation in mice; CCHCR1*WWCC mice had less proliferating keratinocytes than the non-risk allele mice. Similarly, keratinocytes isolated from risk allele mice proliferated more slowly in culture than wild-type cells when measured by BrdU labeling and ELISA. Our data show that CCHCR1 may function as a negative regulator of keratinocyte proliferation. Thus, aberrant function of CCHCR1 may lead to abnormal keratinocyte proliferation which is a key feature of psoriatic epidermis.

  16. Angiotensin II-regulated transcription regulatory genes in adrenal steroidogenesis.

    PubMed

    Romero, Damian G; Gomez-Sanchez, Elise P; Gomez-Sanchez, Celso E

    2010-11-29

    Transcription regulatory genes are crucial modulators of cell physiology and metabolism whose intracellular levels are tightly controlled in response to extracellular stimuli. We previously reported a set of 29 transcription regulatory genes modulated by angiotensin II in H295R human adrenocortical cells and their roles in regulating the expression of the last and unique enzymes of the glucocorticoid and mineralocorticoid biosynthetic pathways, 11β-hydroxylase and aldosterone synthase, respectively, using gene expression reporter assays. To study the effect of this set of transcription regulatory genes on adrenal steroidogenesis, H295R cells were transfected by high-efficiency nucleofection and aldosterone and cortisol were measured in cell culture supernatants under basal and angiotensin II-stimulated conditions. BCL11B, BHLHB2, CITED2, ELL2, HMGA1, MAFF, NFIL3, PER1, SERTAD1, and VDR significantly stimulated aldosterone secretion, while EGR1, FOSB, and ZFP295 decreased aldosterone secretion. BTG2, HMGA1, MITF, NR4A1, and ZFP295 significantly increased cortisol secretion, while BCL11B, NFIL3, PER1, and SIX2 decreased cortisol secretion. We also report the effect of some of these regulators on the expression of endogenous aldosterone synthase and 11β-hydroxylase under basal and angiotensin II-stimulated conditions. In summary, this study reports for the first time the effects of a set of angiotensin II-modulated transcription regulatory genes on aldosterone and cortisol secretion and the expression levels of the last and unique enzymes of the mineralocorticoid and glucocorticoid biosynthetic pathways. Abnormal regulation of mineralocorticoid or glucocorticoid secretion is involved in several pathophysiological conditions. These transcription regulatory genes may be involved in adrenal steroidogenesis pathologies; thus they merit additional study as potential candidates for therapeutic intervention.

  17. Information theory, gene expression, and combinatorial regulation: a quantitative analysis.

    PubMed

    Jost, Jürgen; Scherrer, Klaus

    2014-03-01

    According to a functional definition of the term "gene", a protein-coding gene corresponds to a polypeptide and, hence, a coding sequence. It is therefore as such not yet present at the DNA level, but assembled from possibly heterogeneous pieces in the course of RNA processing. Assembly and regulation of genes require, thus, information about when and in which quantity specific polypeptides are to be produced. To assess this, we draw upon precise biochemical data. On the basis of our conceptual framework, we also develop formal models for the coordinated expression of specific sets of genes through the interaction of transcripts and mRNAs and with proteins via a precise putative regulatory code. Thus, the nucleotides in transcripts and mRNA are not only arranged into amino acid-coding triplets, but at the same time may participate in regulatory oligomotifs that provide binding sites for specific proteins. We can then quantify and compare product and regulatory information involved in gene expression and regulation.

  18. Enrichment of cells exhibiting tetracycline regulated gene expression.

    PubMed

    Nahreini, Piruz; Hanson, Amy J; Prasad, Kedar N

    2003-05-01

    Tetracycline controlled gene expression varies significantly among cells within a cell line. Chromosomal integration sites of the tetracycline transactivator (tTA) gene and/or the test gene presumably account for the variable efficacy of this system. We hypothesized that the efficacy of tetracycline regulated gene expression is more dependent on the level of tTA inside cells and less dependent on the integration sites of the tetracycline transcription units. To test this hypothesis, we established a TetOff regulatied expression of a short-lived enhanced GFP (d2EGFP) via retroviral vectors in a neuroblastoma cell line (NBP2). We then enriched for two populations of NBP2 cells; one expressing high levels of d2EGFP (HG) and the other expressing low levels of d2EGFP (LG) in the absence of doxycycline. We show that the tTA is more abundant in HG cells than in LG cells; the cAMP-mediated transactivation of tTA's promoter further increases the efficacy of the tetracycline system; and the efficient doxycycline regulated expression of a test gene (i.e., VP16CREB) is achieved in HG cells. Therefore, we have developed a simple method to enrich for a population of tetracycline-responsive cells with no need for screening for tetracycline-responsive clonal cell lines.

  19. The novel C. elegans gene sop-3 modulates Wnt signaling to regulate Hox gene expression.

    PubMed

    Zhang, H; Emmons, S W

    2001-03-01

    We describe the properties of a new gene, sop-3, that is required for the regulated expression of a C. elegans Hox gene, egl-5, in a postembryonic neuroectodermal cell lineage. Regulated expression of egl-5 in this cell lineage is necessary for development of the sensory rays of the male tail. sop-3 encodes a predicted novel protein of 1475 amino acids without clear homologs in other organisms. However, the sequence contains motifs consisting of homopolymeric runs of amino acids found in several other transcriptional regulators, some of which also act in Hox gene regulatory pathways. The genetic properties of sop-3 are very similar to those of sop-1, which encodes a component of the transcriptional Mediator complex, and mutations in the two genes are synthetic lethal. This suggests that SOP-3 may act at the level of the Mediator complex in regulating transcription initiation. In a sop-3 loss-of-function background, egl-5 is expressed ectopically in lineage branches that normally do not express this gene. Such expression is dependent on the Hox gene mab-5, as it is in branches where egl-5 is normally expressed. Ectopic egl-5 expression is also dependent on the Wnt pathway. Thus, sop-3 contributes to the combinatorial control of egl-5 by blocking egl-5 activation by MAB-5 and the Wnt pathway in inappropriate lineage branches.

  20. New ideas in epilepsy genetics: novel epilepsy genes, copy number alterations, and gene regulation.

    PubMed

    Gurnett, Christina A; Hedera, Peter

    2007-03-01

    The majority of genes associated with epilepsy syndromes to date are ion channel genes. Selection bias may have allowed us to establish their role in epilepsy based on a priori knowledge of the significance of these proteins in regulating neuronal excitability. There are, however, more than 3000 genes expressed at the synapse, as well as many other genes expressed nearby in supporting cells and glia that can likewise regulate excitability. Identification of new genes involved in epilepsy may arise from studying the targets of anticonvulsant medications, ascertainment of an epileptic phenotype in mice, or as a result of positional cloning efforts. There are several loci for idiopathic focal and generalized epilepsies that lie in chromosomal regions that are devoid of known ion channels; therefore, the number of novel genes involved in epilepsy is likely to increase. Establishing the role of these novel genes in the pathogenesis of epilepsy has not been an easy task compared with the relative ease with which ion channel mutations can be studied. This review will describe several novel epilepsy genes and will then discuss other genetic causes of epilepsy, including alterations of chromosomal copy number and gene regulatory elements.

  1. Reversible histone methylation regulates brain gene expression and behavior

    PubMed Central

    Xu, Jun; Andreassi, Megan

    2011-01-01

    Epigenetic chromatin remodeling, including reversible histone methylation, regulates gene transcription in brain development and synaptic plasticity. Aberrant chromatin modifications due to mutant chromatin enzymes or chemical exposures have been associated with neurological or psychiatric disorders such as mental retardation, schizophrenia, depression, and drug addiction. Some chromatin enzymes, such as histone demethylases JARID1C and UTX, are coded by X-linked genes which are not X-inactivated in females. The higher expression of JARID1C and UTX in females could contribute to sex differences in brain development and behavior. PMID:20816965

  2. Safe Thinking and Affect Regulation (STAR): Human Immunodeficiency Virus Prevention in Alternative/Therapeutic Schools

    ERIC Educational Resources Information Center

    Brown, Larry K.; Nugent, Nicole R.; Houck, Christopher D.; Lescano, Celia M.; Whiteley, Laura B.; Barker, David; Viau, Lisa; Zlotnick, Caron

    2011-01-01

    Objective: To evaluate the effectiveness of Safe Thinking and Affect Regulation (STAR), a 14-session HIV-prevention program for adolescents at alternative/therapeutic schools. Because these youth frequently have difficulties with emotions and cognitions, it was designed to improve sexuality-specific affect management and cognitive monitoring, as…

  3. Toddler Emotion Regulation with Mothers and Fathers: Temporal Associations between Negative Affect and Behavioral Strategies

    ERIC Educational Resources Information Center

    Ekas, Naomi V.; Braungart-Rieker, Julia M.; Lickenbrock, Diane M.; Zentall, Shannon R.; Maxwell, Scott M.

    2011-01-01

    The present study investigated temporal associations between putative emotion regulation strategies and negative affect in 20-month-old toddlers. Toddlers' parent-focused, self-distraction, and toy-focused strategies, as well as negative affect, were rated on a second-by-second basis during laboratory parent-toddler interactions. Longitudinal…

  4. A family with a dystrophin gene mutation specifically affecting dystrophin expression in the heart

    SciTech Connect

    Muntoni, F.; Davies, K.; Dubowitz, V.

    1994-09-01

    We recently described a family with X-linked dilated cardiomyopathy where a large deletion in the muscle promoter region of the dystrophin gene was associated with a severe dilated cardiomyopathy in absence of clinical skeletal muscle involvement. The deletion removed the entire muscle promoter region, the first muscle exon and part of intron 1. The brain and Purkinje cell promoters were not affected by the deletion. Despite the lack of both the muscle promoter and the first muscle exon, dystrophin was detected immunocytochemically in relative high levels in the skeletal muscle of the affected males. We have now found that both the brain and Purkinje cell promoters were transcribed at high levels in the skeletal muscle of these individuals. This phenomenon, that does not occur in normal skeletal muscle, indicates that these two isoforms, physiologically expressed mainly in the central nervous system, can be transcribed and be functionally active in skeletal muscle under specific circumstances. Contrary to what is observed in skeletal muscle, dystrophin was not detected in the heart of one affected male using immunocytochemistry and an entire panel of anti-dystrophin antibodies. This was most likely the cause for the pronounced cardiac fibrosis observed and eventually responsible for the severe cardiac involvement invariably seen in seven affected males. In conclusion, the mutation of the muscle promoter, first muscle exon and part of intron 1 specifically affected expression of dystrophin in the heart. We believe that this deletion removes sequences involved in regulation of dystrophin expression in the heart and are at the moment characterizing other families with X-linked cardiomyopathy secondary to a dystrophinopathy.

  5. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves.

    PubMed

    Christiansen, Michael W; Gregersen, Per L

    2014-07-01

    The senescence process of plants is important for the completion of their life cycle, particularly for crop plants, it is essential for efficient nutrient remobilization during seed filling. It is a highly regulated process, and in order to address the regulatory aspect, the role of genes in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription-PCR (qRT-PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47 studied NAC genes to be important for signalling processes and for the execution of degradation processes during leaf senescence in barley. Seven models for DNA-binding motifs for NAC transcription factors were designed based on published motifs, and available promoter sequences of barley genes were screened for the motifs. Genes up-regulated during senescence showed a significant over-representation of the motifs, suggesting regulation by the NAC transcription factors. Furthermore, co-regulation studies showed that genes possessing the motifs in the promoter in general were highly co-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71 senescence-associated genes that are potential target genes for these NAC transcription factors is presented.

  6. The Nuclear Pore-Associated TREX-2 Complex Employs Mediator to Regulate Gene Expression

    PubMed Central

    Schneider, Maren; Hellerschmied, Doris; Schubert, Tobias; Amlacher, Stefan; Vinayachandran, Vinesh; Reja, Rohit; Pugh, B. Franklin; Clausen, Tim; Köhler, Alwin

    2015-01-01

    Summary Nuclear pore complexes (NPCs) influence gene expression besides their established function in nuclear transport. The TREX-2 complex localizes to the NPC basket and affects gene-NPC interactions, transcription, and mRNA export. How TREX-2 regulates the gene expression machinery is unknown. Here, we show that TREX-2 interacts with the Mediator complex, an essential regulator of RNA Polymerase (Pol) II. Structural and biochemical studies identify a conserved region on TREX-2, which directly binds the Mediator Med31/Med7N submodule. TREX-2 regulates assembly of Mediator with the Cdk8 kinase and is required for recruitment and site-specific phosphorylation of Pol II. Transcriptome and phenotypic profiling confirm that TREX-2 and Med31 are functionally interdependent at specific genes. TREX-2 additionally uses its Mediator-interacting surface to regulate mRNA export suggesting a mechanism for coupling transcription initiation and early steps of mRNA processing. Our data provide mechanistic insight into how an NPC-associated adaptor complex accesses the core transcription machinery. PMID:26317468

  7. Signal-dependent regulation of the sea urchin skeletogenic gene regulatory network.

    PubMed

    Sun, Zhongling; Ettensohn, Charles A

    2014-11-01

    The endoskeleton of the sea urchin embryo is produced by primary mesenchyme cells (PMCs). Maternal inputs activate a complex gene regulatory network (GRN) in the PMC lineage in a cell-autonomous fashion during early development, initially creating a uniform population of prospective skeleton-forming cells. Previous studies showed that at post-blastula stages of development, several effector genes in the network exhibit non-uniform patterns of expression, suggesting that their regulation becomes subject to local, extrinsic cues. Other studies have identified the VEGF and MAPK pathways as regulators of PMC migration, gene expression, and biomineralization. In this study, we used whole mount in situ hybridization (WMISH) to examine the spatial expression patterns of 39 PMC-specific/enriched mRNAs in Strongylocentrotus purpuratus embryos at the late gastrula, early prism and pluteus stages. We found that all 39 mRNAs (including several regulatory genes) showed non-uniform patterns of expression within the PMC syncytium, revealing a global shift in the regulation of the skeletogenic GRN from a cell-autonomous to a signal-dependent mode. In general, localized regions of elevated gene expression corresponded to sites of rapid biomineral deposition. We used a VEGFR inhibitor (axitinib) and a MEK inhibitor (U0126) to show that VEGF signaling and the MAPK pathway are essential for maintaining high levels of gene expression in PMCs at the tips of rods that extend from the ventral region of the embryo. These inhibitors affected gene expression in the PMCs in similar ways, suggesting that VEGF acts via the MAPK pathway. In contrast, axitinib and U0126 did not affect the localized expression of genes in PMCs at the tips of the body rods, which form on the dorsal side of the embryo. Our results therefore indicate that multiple signaling pathways regulate the skeletogenic GRN during late stages of embryogenesis-VEGF/MAPK signaling on the ventral side and a separate, unidentified

  8. Expression profiling identifies novel Hh/Gli-regulated genes in developing zebrafish embryos.

    PubMed

    Bergeron, Sadie A; Milla, Luis A; Villegas, Rosario; Shen, Meng-Chieh; Burgess, Shawn M; Allende, Miguel L; Karlstrom, Rolf O; Palma, Verónica

    2008-02-01

    The Hedgehog (Hh) signaling pathway plays critical instructional roles during embryonic development. Misregulation of Hh/Gli signaling is a major causative factor in human congenital disorders and in a variety of cancers. The zebrafish is a powerful genetic model for the study of Hh signaling during embryogenesis, as a large number of mutants that affect different components of the Hh/Gli signaling system have been identified. By performing global profiling of gene expression in different Hh/Gli gain- and loss-of-function scenarios we identified known (e.g., ptc1 and nkx2.2a) and novel Hh-regulated genes that are differentially expressed in embryos with altered Hh/Gli signaling function. By uncovering changes in tissue-specific gene expression, we revealed new embryological processes that are influenced by Hh signaling. We thus provide a comprehensive survey of Hh/Gli-regulated genes during embryogenesis and we identify new Hh-regulated genes that may be targets of misregulation during tumorigenesis.

  9. SMARCA4 regulates gene expression and higher-order chromatin structure in proliferating mammary epithelial cells

    PubMed Central

    Barutcu, A. Rasim; Lajoie, Bryan R.; Fritz, Andrew J.; McCord, Rachel P.; Nickerson, Jeffrey A.; van Wijnen, Andre J.; Lian, Jane B.; Stein, Janet L.; Dekker, Job; Stein, Gary S.; Imbalzano, Anthony N.

    2016-01-01

    The packaging of DNA into chromatin plays an important role in transcriptional regulation and nuclear processes. Brahma-related gene-1 SMARCA4 (also known as BRG1), the essential ATPase subunit of the mammalian SWI/SNF chromatin remodeling complex, uses the energy from ATP hydrolysis to disrupt nucleosomes at target regions. Although the transcriptional role of SMARCA4 at gene promoters is well-studied, less is known about its role in higher-order genome organization. SMARCA4 knockdown in human mammary epithelial MCF-10A cells resulted in 176 up-regulated genes, including many related to lipid and calcium metabolism, and 1292 down-regulated genes, some of which encode extracellular matrix (ECM) components that can exert mechanical forces and affect nuclear structure. ChIP-seq analysis of SMARCA4 localization and SMARCA4-bound super-enhancers demonstrated extensive binding at intergenic regions. Furthermore, Hi-C analysis showed extensive SMARCA4-mediated alterations in higher-order genome organization at multiple resolutions. First, SMARCA4 knockdown resulted in clustering of intra- and inter-subtelomeric regions, demonstrating a novel role for SMARCA4 in telomere organization. SMARCA4 binding was enriched at topologically associating domain (TAD) boundaries, and SMARCA4 knockdown resulted in weakening of TAD boundary strength. Taken together, these findings provide a dynamic view of SMARCA4-dependent changes in higher-order chromatin organization and gene expression, identifying SMARCA4 as a novel component of chromatin organization. PMID:27435934

  10. Expression of foreign genes in lamprey embryos: an approach to study evolutionary changes in gene regulation.

    PubMed

    Kusakabe, Rie; Tochinai, Shin; Kuratani, Shigeru

    2003-04-15

    Evolution in development can be viewed as a sequence of changes in gene regulation. To investigate the cross-species compatibility of 5' upstream regulatory regions, we introduced exogenous gene constructs derived from a gnathostome genome into fertilized eggs of the Japanese lamprey, Lampetra japonica, a sister group of the gnathostomes. Eggs were injected with gene constructs in which a sequence encoding the green fluorescent protein (GFP) had been located downstream of either a virus promoter or 5' regulatory regions of medaka actin genes. Reporter gene expression was recorded for more than a month starting two days after injection. Although the expression patterns were highly mosaic and differed among individuals, GFP was expressed predominantly in the striated muscles of lamprey embryos when driven by the 5' upstream regions of the medaka muscle actin genes. This implies that a pan-vertebrate muscle-specific gene regulatory mechanism may have evolved before the agnathan/gnathostome divergence. This gene-transfer technique potentially facilitates the visualization of cells in various differentiating tissues throughout development. The introduction of developmental genes of the lamprey or other animals into lamprey embryos is another potentially important application, one that could provide us with information on the evolutionary changes in functions of genes or gene cascades.

  11. A Subset of Autism-Associated Genes Regulate the Structural Stability of Neurons

    PubMed Central

    Lin, Yu-Chih; Frei, Jeannine A.; Kilander, Michaela B. C.; Shen, Wenjuan; Blatt, Gene J.

    2016-01-01

    Autism spectrum disorder (ASD) comprises a range of neurological conditions that affect individuals’ ability to communicate and interact with others. People with ASD often exhibit marked qualitative difficulties in social interaction, communication, and behavior. Alterations in neurite arborization and dendritic spine morphology, including size, shape, and number, are hallmarks of almost all neurological conditions, including ASD. As experimental evidence emerges in recent years, it becomes clear that although there is broad heterogeneity of identified autism risk genes, many of them converge into similar cellular pathways, including those regulating neurite outgrowth, synapse formation and spine stability, and synaptic plasticity. These mechanisms together regulate the structural stability of neurons and are vulnerable targets in ASD. In this review, we discuss the current understanding of those autism risk genes that affect the structural connectivity of neurons. We sub-categorize them into (1) cytoskeletal regulators, e.g., motors and small RhoGTPase regulators; (2) adhesion molecules, e.g., cadherins, NCAM, and neurexin superfamily; (3) cell surface receptors, e.g., glutamatergic receptors and receptor tyrosine kinases; (4) signaling molecules, e.g., protein kinases and phosphatases; and (5) synaptic proteins, e.g., vesicle and scaffolding proteins. Although the roles of some of these genes in maintaining neuronal structural stability are well studied, how mutations contribute to the autism phenotype is still largely unknown. Investigating whether and how the neuronal structure and function are affected when these genes are mutated will provide insights toward developing effective interventions aimed at improving the lives of people with autism and their families. PMID:27909399

  12. Land use type significantly affects microbial gene transcription in soil.

    PubMed

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

  13. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  14. Escherichia coli tol and rcs genes participate in the complex network affecting curli synthesis.

    PubMed

    Vianney, Anne; Jubelin, Grégory; Renault, Sophie; Dorel, Corine; Lejeune, Philippe; Lazzaroni, Jean Claude

    2005-07-01

    Curli are necessary for the adherence of Escherichia coli to surfaces, and to each other, during biofilm formation, and the csgBA and csgDEFG operons are both required for their synthesis. A recent survey of gene expression in Pseudomonas aeruginosa biofilms has identified tolA as a gene activated in biofilms. The tol genes play a fundamental role in maintaining the outer-membrane integrity of Gram-negative bacteria. RcsC, the sensor of the RcsBCD phosphorelay, is involved, together with RcsA, in colanic acid capsule synthesis, and also modulates the expression of tolQRA and csgDEFG. In addition, the RcsBCD phosphorelay is activated in tol mutants or when Tol proteins are overexpressed. These results led the authors to investigate the role of the tol genes in biofilm formation in laboratory and clinical isolates of E. coli. It was shown that the adherence of cells was lowered in the tol mutants. This could be the result of a drastic decrease in the expression of the csgBA operon, even though the expression of csgDEFG was slightly increased under such conditions. It was also shown that the Rcs system negatively controls the expression of the two csg operons in an RcsA-dependent manner. In the tol mutants, activation of csgDEFG occurred via OmpR and was dominant upon repression by RcsB and RcsA, while these two regulatory proteins repressed csgBA through a dominant effect on the activator protein CsgD, thus affecting curli synthesis. The results demonstrate that the Rcs system, previously known to control the synthesis of the capsule and the flagella, is an additional component involved in the regulation of curli. Furthermore, it is shown that the defect in cell motility observed in the tol mutants depends on RcsB and RcsA.

  15. Oxygen regulated gene expression in facultatively anaerobic bacteria.

    PubMed

    Unden, G; Becker, S; Bongaerts, J; Schirawski, J; Six, S

    1994-01-01

    In facultatively anaerobic bacteria such as Escherichia coli, oxygen and other electron acceptors fundamentally influence catabolic and anabolic pathways. E. coli is able to grow aerobically by respiration and in the absence of O2 by anaerobic respiration with nitrate, nitrite, fumarate, dimethylsulfoxide and trimethylamine N-oxide as acceptors or by fermentation. The expression of the various catabolic pathways occurs according to a hierarchy with 3 or 4 levels. Aerobic respiration at the highest level is followed by nitrate respiration (level 2), anaerobic respiration with the other acceptors (level 3) and fermentation. In other bacteria, different regulatory cascades with other underlying principles can be observed. Regulation of anabolism in response to O2 availability is important, too. It is caused by different requirements of cofactors or coenzymes in aerobic and anaerobic metabolism and by the requirement for different O2-independent biosynthetic routes under anoxia. The regulation mainly occurs at the transcriptional level. In E. coli, 4 global regulatory systems are known to be essential for the aerobic/anaerobic switch and the described hierarchy. A two-component sensor/regulator system comprising ArcB (sensor) and ArcA (transcriptional regulator) is responsible for regulation of aerobic metabolism. The FNR protein is a transcriptional sensor-regulator protein which regulates anaerobic respiratory genes in response to O2 availability. The gene activator FhlA regulates fermentative formate and hydrogen metabolism with formate as the inductor. ArcA/B and FNR directly respond to O2, FhlA indirectly by decreased levels of formate in the presence of O2. Regulation of nitrate/nitrite catabolism is effected by two 2-component sensor/regulator systems NarX(Q)/NarL(P) in response to nitrate/nitrite. Co-operation of the different regulatory systems at the target promoters which are in part under dual (or manifold) transcriptional control causes the expression

  16. Cognitive analysis of schizophrenia risk genes that function as epigenetic regulators of gene expression.

    PubMed

    Whitton, Laura; Cosgrove, Donna; Clarkson, Christopher; Harold, Denise; Kendall, Kimberley; Richards, Alex; Mantripragada, Kiran; Owen, Michael J; O'Donovan, Michael C; Walters, James; Hartmann, Annette; Konte, Betina; Rujescu, Dan; Gill, Michael; Corvin, Aiden; Rea, Stephen; Donohoe, Gary; Morris, Derek W

    2016-12-01

    Epigenetic mechanisms are an important heritable and dynamic means of regulating various genomic functions, including gene expression, to orchestrate brain development, adult neurogenesis, and synaptic plasticity. These processes when perturbed are thought to contribute to schizophrenia pathophysiology. A core feature of schizophrenia is cognitive dysfunction. For genetic disorders where cognitive impairment is more severe such as intellectual disability, there are a disproportionally high number of genes involved in the epigenetic regulation of gene transcription. Evidence now supports some shared genetic aetiology between schizophrenia and intellectual disability. GWAS have identified 108 chromosomal regions associated with schizophrenia risk that span 350 genes. This study identified genes mapping to those loci that have epigenetic functions, and tested the risk alleles defining those loci for association with cognitive deficits. We developed a list of 350 genes with epigenetic functions and cross-referenced this with the GWAS loci. This identified eight candidate genes: BCL11B, CHD7, EP300, EPC2, GATAD2A, KDM3B, RERE, SATB2. Using a dataset of Irish psychosis cases and controls (n = 1235), the schizophrenia risk SNPs at these loci were tested for effects on IQ, working memory, episodic memory, and attention. Strongest associations were for rs6984242 with both measures of IQ (P = 0.001) and episodic memory (P = 0.007). We link rs6984242 to CHD7 via a long range eQTL. These associations were not replicated in independent samples. Our study highlights that a number of genes mapping to risk loci for schizophrenia may function as epigenetic regulators of gene expression but further studies are required to establish a role for these genes in cognition. © 2016 Wiley Periodicals, Inc.

  17. From biophysics to evolutionary genetics: statistical aspects of gene regulation

    PubMed Central

    Lässig, Michael

    2007-01-01

    This is an introductory review on how genes interact to produce biological functions. Transcriptional interactions involve the binding of proteins to regulatory DNA. Specific binding sites can be identified by genomic analysis, and these undergo a stochastic evolution process governed by selection, mutations, and genetic drift. We focus on the links between the biophysical function and the evolution of regulatory elements. In particular, we infer fitness landscapes of binding sites from genomic data, leading to a quantitative evolutionary picture of regulation. PMID:17903288

  18. Regulation of cry Gene Expression in Bacillus thuringiensis

    PubMed Central

    Deng, Chao; Peng, Qi; Song, Fuping; Lereclus, Didier

    2014-01-01

    Bacillus thuringiensis differs from the closely related Bacillus cereus group species by its ability to produce crystalline inclusions. The production of these crystals mainly results from the expression of the cry genes, from the stability of their transcripts and from the synthesis, accumulation and crystallization of large amounts of insecticidal Cry proteins. This process normally coincides with sporulation and is regulated by various factors operating at the transcriptional, post-transcriptional, metabolic and post-translational levels. PMID:25055802

  19. Cyclic mononucleotide- and Clr-dependent gene regulation in Sinorhizobium meliloti.

    PubMed

    Krol, Elizaveta; Klaner, Christina; Gnau, Petra; Kaever, Volkhard; Essen, Lars-Oliver; Becker, Anke

    2016-10-01

    To identify physiological processes affected by cAMP in the plant-symbiotic nitrogen-fixing α-proteobacterium Sinorhizobium meliloti Rm2011, cAMP levels were artificially increased by overexpression of its cognate adenylate/guanylate cyclase gene cyaJ. This resulted in high accumulation of cAMP in the culture supernatant, decreased swimming motility and increased production of succinoglycan, an exopolysaccharide involved in host invasion. Weaker, similar phenotypic changes were induced by overexpression of cyaB and cyaG1. Effects on swimming motility and succinoglycan production were partially dependent on clr encoding a cyclic AMP receptor-like protein. Transcriptome profiling of an cyaJ-overexpressing strain identified 72 upregulated and 82 downregulated genes. A considerable number of upregulated genes are related to polysaccharide biosynthesis and osmotic stress response. These included succinoglycan biosynthesis genes, genes of the putative polysaccharide synthesis nodP2-exoF3 cluster and feuN, the first gene of the operon encoding the FeuNPQ regulatory system. Downregulated genes were mostly related to respiration, central metabolism and swimming motility. Promoter-probe studies in the presence of externally added cAMP revealed 18 novel Clr-cAMP-regulated genes. Moreover, the addition of cGMP into the growth medium also promoted clr-dependent gene regulation. In vitro binding of Clr-cAMP and Clr-cGMP to the promoter regions of SMc02178, SMb20906,SMc04190, SMc00925, SMc01136 and cyaF2 required the DNA motif (A/C/T)GT(T/C)(T/C/A)C (N4) G(G/A)(T/A)ACA. Furthermore, SMc02178, SMb20906,SMc04190and SMc00653 promoters were activated by Clr-cAMP/cGMP in Escherichia coli as heterologous host. These findings suggest direct activation of these 7 genes by Clr-cAMP/cGMP.

  20. Using a suppression subtractive library-based approach to identify tobacco genes regulated in response to short-term sulphur deficit.

    PubMed

    Wawrzyńska, Anna; Lewandowska, Małgorzata; Hawkesford, Malcolm J; Sirko, Agnieszka

    2005-06-01

    Monitoring expression at the transcriptional level is an essential first step for the functional analysis of plant genes. Genes encoding proteins directly involved in sulphur metabolism constitute only a small fraction of all the genes affected by sulphur deficiency stress. Transcriptional responses to various periods of sulphur deprivation have been extensively studied in Arabidopsis thaliana; however, no corresponding data are available for Solanaceae sp. To address this problem, a subtractive library-based approach to search for tobacco genes regulated by a short-term sulphur starvation has been adopted. In this work, 38 genes were identified, of which 22 were regulated positively and 16 were regulated negatively. The transcript levels of the representative genes were monitored in four parts of the plants (mature and immature leaves, stems, and roots), which exhibited differential sulphur deficiency. Interestingly, some genes exhibit different regulation of expression in different parts of the plants. Database analysis allowed assignment of the potential function for many of the identified genes; however, the functions of a small number of genes strongly regulated by sulphur starvation remain unknown. The genes were grouped into nine functional categories, each including both up- and down-regulated genes. The possible links between the identified regulated genes and sulphur metabolism are considered, and compared where possible with expression patterns in Arabidopsis thaliana. Although no obvious regulatory genes were identified, the genes encoding proteins of unknown function remain as potential components of the regulatory processes.

  1. Early life adversity and serotonin transporter gene variation interact to affect DNA methylation of the corticotropin-releasing factor gene promoter region in the adult rat brain.

    PubMed

    van der Doelen, Rick H A; Arnoldussen, Ilse A; Ghareh, Hussein; van Och, Liselot; Homberg, Judith R; Kozicz, Tamás

    2015-02-01

    The interaction between childhood maltreatment and the serotonin transporter (5-HTT) gene linked polymorphic region has been associated with increased risk to develop major depression. This Gene × Environment interaction has furthermore been linked with increased levels of anxiety and glucocorticoid release upon exposure to stress. Both endophenotypes are regulated by the neuropeptide corticotropin-releasing factor (CRF) or hormone, which is expressed by the paraventricular nucleus of the hypothalamus, the bed nucleus of the stria terminalis, and the central amygdala (CeA). Therefore, we hypothesized that altered regulation of the expression of CRF in these areas represents a major neurobiological mechanism underlying the interaction of early life stress and 5-HTT gene variation. The programming of gene transcription by Gene × Environment interactions has been proposed to involve epigenetic mechanisms such as DNA methylation. In this study, we report that early life stress and 5-HTT genotype interact to affect DNA methylation of the Crf gene promoter in the CeA of adult male rats. Furthermore, we found that DNA methylation of a specific site in the Crf promoter significantly correlated with CRF mRNA levels in the CeA. Moreover, CeA CRF mRNA levels correlated with stress coping behavior in a learned helplessness paradigm. Together, our findings warrant further investigation of the link of Crf promoter methylation and CRF expression in the CeA with behavioral changes that are relevant for psychopathology.

  2. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-02

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming.

  3. REGULATION OF MULTIPLE RENIN-ANGIOTENSIN SYSTEM GENES BY SRY

    PubMed Central

    Milsted, Amy; Underwood, Adam C.; Dunmire, Jeff; DelPuerto, Helen L.; Martins, Almir S.; Ely, Daniel L.; Turner, Monte E.

    2010-01-01

    We demonstrated that the Sry gene complex on the SHR Y chromosome is a candidate locus for hypertension that accounts for the SHR Y chromosome blood pressure effect. All rat strains examined to date share 6 Sry loci, and a seventh Sry locus (Sry3) appears to be unique to SHR males. Previously, we showed that Sry1 increased activity of the tyrosine hydroxylase promoter in transfected PC12 cells, and Sry1 delivered to adrenal gland of WKY rats increased blood pressure and sympathetic nervous system activity. The objective of this study was to determine whether renin-angiotensin system genes participate in Sry-mediated effects. Sry expression vectors were co-transfected into CHO cells with luciferase reporter constructs containing promoters of angiotensinogen (Agt −1430/+22), renin (Ren −1050/−1), ACE (ACE −1677/+21) and ACE2 (ACE2 −1091/+83). Sry1, Sry2 and Sry3 differentially up-regulated activity of the promoters of angiotensinogen, renin and ACE genes, and down-regulated ACE2 promoter activity. The largest effect was seen with Sry3, which increased activity of angiotensinogen promoter by 1.7 fold, renin promoter by 1.3 fold, ACE promoter by 2.6 fold, and decreased activity of ACE2 promoter by 0.5 fold. The effect of Sry1 on promoter activity was significantly less than Sry3. Sry2 activated promoters at a significantly lower level than Sry1. The result of either an additive effect of Sry regulation of multiple genes in the renin-angiotensin system or alterations in expression of a single gene could favor increased levels of Ang II and decreased levels of Ang-(1-7). These actions of Sry could result in increased blood pressure in males and contribute to gender differences in blood pressure. PMID:19809364

  4. Pheromone-regulated genes required for yeast mating differentiation.

    PubMed

    Erdman, S; Lin, L; Malczynski, M; Snyder, M

    1998-02-09

    Yeast cells mate by an inducible pathway that involves agglutination, mating projection formation, cell fusion, and nuclear fusion. To obtain insight into the mating differentiation of Saccharomyces cerevisiae, we carried out a large-scale transposon tagging screen to identify genes whose expression is regulated by mating pheromone. 91,200 transformants containing random lacZ insertions were screened for beta-galactosidase (beta-gal) expression in the presence and absence of alpha factor, and 189 strains containing pheromone-regulated lacZ insertions were identified. Transposon insertion alleles corresponding to 20 genes that are novel or had not previously been known to be pheromone regulated were examined for effects on the mating process. Mutations in four novel genes, FIG1, FIG2, KAR5/ FIG3, and FIG4 were found to cause mating defects. Three of the proteins encoded by these genes, Fig1p, Fig2p, and Fig4p, are dispensible for cell polarization in uniform concentrations of mating pheromone, but are required for normal cell polarization in mating mixtures, conditions that involve cell-cell communication. Fig1p and Fig2p are also important for cell fusion and conjugation bridge shape, respectively. The fourth protein, Kar5p/Fig3p, is required for nuclear fusion. Fig1p and Fig2p are likely to act at the cell surface as Fig1:: beta-gal and Fig2::beta-gal fusion proteins localize to the periphery of mating cells. Fig4p is a member of a family of eukaryotic proteins that contain a domain homologous to the yeast Sac1p. Our results indicate that a variety of novel genes are expressed specifically during mating differentiation to mediate proper cell morphogenesis, cell fusion, and other steps of the mating process.

  5. Structure and regulation of the Asr gene family in banana.

    PubMed

    Henry, Isabelle M; Carpentier, Sebastien C; Pampurova, Suzana; Van Hoylandt, Anais; Panis, Bart; Swennen, Rony; Remy, Serge

    2011-10-01

    Abscisic acid, stress, ripening proteins (ASR) are a family of plant-specific small hydrophilic proteins. Studies in various plant species have highlighted their role in increased resistance to abiotic stress, including drought, but their specific function remains unknown. As a first step toward their potential use in crop improvement, we investigated the structure and regulation of the Asr gene family in Musa species (bananas and plantains). We determined that the Musa Asr gene family contained at least four members, all of which exhibited the typical two exons, one intron structure of Asr genes and the "ABA/WDS" (abscisic acid/water deficit stress) domain characteristic of Asr genes. Phylogenetic analyses determined that the Musa Asr genes were closely related to each other, probably as the product of recent duplication events. For two of the four members, two versions corresponding to the two sub-genomes of Musa, acuminata and balbisiana were identified. Gene expression and protein analyses were performed and Asr expression could be detected in meristem cultures, root, pseudostem, leaf and cormus. In meristem cultures, mAsr1 and mAsr3 were induced by osmotic stress and wounding, while mAsr3 and mAsr4 were induced by exposure to ABA. mASR3 exhibited the most variation both in terms of amino acid sequence and expression pattern, making it the most promising candidate for further functional study and use in crop improvement.

  6. Bradyoxetin, a unique chemical signal involved in symbiotic gene regulation

    PubMed Central

    Loh, John; Carlson, Russell W.; York, William S.; Stacey, Gary

    2002-01-01

    Bradyrhizobium japonicum is a symbiotic bacterium that nodulates soybean. Critical for the infection and establishment of this symbiosis are the bacterial nodulation genes (nod, nol, noe), which are induced in the presence of plant produced isoflavones. Transcription of the nodulation genes is also controlled in a population density-dependent fashion. Expression of the nod genes is maximal at low population densities, and decreases significantly at higher culture densities. Population density control of the nodulation genes involves NolA and NodD2, both of which function in tandem to repress nod gene expression. An extracellular secreted factor (CDF) is known to mediate this repression. Here, we report that CDF is a novel signaling molecule, designated bradyoxetin, different from other Gram-negative quorum signals. The proposed structure of bradyoxetin is 2-{4-[[4-(3-aminooxetan-2-yl)phenyl](imino)methyl]phenyl}oxetan-3-ylamine. Interestingly, expression of bradyoxetin is iron-regulated, and is maximally produced under iron-starved conditions. Consistent with this, expression of the nodulation genes occurred in an iron-dependent fashion. Addition of iron to B. japonicum cultures at high optical densities resulted in decreased bradyoxetin production, and a concomitant reduction in nolA expression. A corresponding increase in nodY–lacZ expression was observed with iron treatment. PMID:12393811

  7. Core promoter functions in the regulation of gene expression of Drosophila dorsal target genes.

    PubMed

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-04-25

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes.

  8. Simplified mechanistic models of gene regulation for analysis and design

    PubMed Central

    Hancock, Edward J.; Stan, Guy-Bart; Arpino, James A. J.; Papachristodoulou, Antonis

    2015-01-01

    Simplified mechanistic models of gene regulation are fundamental to systems biology and essential for synthetic biology. However, conventional simplified models typically have outputs that are not directly measurable and are based on assumptions that do not often hold under experimental conditions. To resolve these issues, we propose a ‘model reduction’ methodology and simplified kinetic models of total mRNA and total protein concentration, which link measurements, models and biochemical mechanisms. The proposed approach is based on assumptions that hold generally and include typical cases in systems and synthetic biology where conventional models do not hold. We use novel assumptions regarding the ‘speed of reactions’, which are required for the methodology to be consistent with experimental data. We also apply the methodology to propose simplified models of gene regulation in the presence of multiple protein binding sites, providing both biological insights and an illustration of the generality of the methodology. Lastly, we show that modelling total protein concentration allows us to address key questions on gene regulation, such as efficiency, burden, competition and modularity. PMID:26063825

  9. Global regulation of gene expression in Escherichia coli.

    PubMed Central

    Chuang, S E; Daniels, D L; Blattner, F R

    1993-01-01

    Global transcription responses of Escherichia coli to various stimuli or genetic defects were studied by measuring mRNA levels in about 400 segments of the genome. Measuring mRNA levels was done by analyzing hybridization to DNA dot blots made with overlapping lambda clones spanning the genome of E. coli K-12. Conditions examined included isopropyl-beta-D-thiogalactopyranoside (IPTG) induction, heat shock, osmotic shock, starvation for various nutrients, entrance of cells into the stationary phase of growth, anaerobic growth in a tube, growth in the gnotobiotic mouse gut, and effects of pleiotropic mutations rpoH, himA, topA, and crp. Most mapped genes known to be regulated by a particular situation were successfully detected. In addition, many chromosomal regions containing no previously known regulated genes were discovered that responded to various stimuli. This new method for studying globally regulated genetic systems in E. coli combines detection, cloning, and physical mapping of a battery of coregulated genes in one step. Images PMID:8458845

  10. Mechanisms of post-transcriptional gene regulation in bacterial biofilms

    PubMed Central

    Martínez, Luary C.; Vadyvaloo, Viveka

    2014-01-01

    Biofilms are characterized by a dense multicellular community of microorganisms that can be formed by the attachment of bacteria to an inert surface and to each other. The development of biofilm involves the initial attachment of planktonic bacteria to a surface, followed by replication, cell-to-cell adhesion to form microcolonies, maturation, and detachment. Mature biofilms are embedded in a self-produced extracellular polymeric matrix composed primarily of bacterial-derived exopolysaccharides, specialized proteins, adhesins, and occasionally DNA. Because the synthesis and assembly of biofilm matrix components is an exceptionally complex process, the transition between its different phases requires the coordinate expression and simultaneous regulation of many genes by complex genetic networks involving all levels of gene regulation. The finely controlled intracellular level of the chemical second messenger molecule, cyclic-di-GMP is central to the post-transcriptional mechanisms governing the switch between the motile planktonic lifestyle and the sessile biofilm forming state in many bacteria. Several other post-transcriptional regulatory mechanisms are known to dictate biofilm development and assembly and these include RNA-binding proteins, small non-coding RNAs, toxin-antitoxin systems, riboswitches, and RNases. Post-transcriptional regulation is therefore a powerful molecular mechanism employed by bacteria to rapidly adjust to the changing environment and to fine tune gene expression to the developmental needs of the cell. In this review, we discuss post-transcriptional mechanisms that influence the biofilm developmental cycle in a variety of pathogenic bacteria. PMID:24724055

  11. Neighboring gene regulation by antisense long non-coding RNAs.

    PubMed

    Villegas, Victoria E; Zaphiropoulos, Peter G

    2015-02-03

    Antisense transcription, considered until recently as transcriptional noise, is a very common phenomenon in human and eukaryotic transcriptomes, operating in two ways based on whether the antisense RNA acts in cis or in trans. This process can generate long non-coding RNAs (lncRNAs), one of the most diverse classes of cellular transcripts, which have demonstrated multifunctional roles in fundamental biological processes, including embryonic pluripotency, differentiation and development. Antisense lncRNAs have been shown to control nearly every level of gene regulation--pretranscriptional, transcriptional and posttranscriptional--through DNA-RNA, RNA-RNA or protein-RNA interactions. This review is centered on functional studies of antisense lncRNA-mediated regulation of neighboring gene expression. Specifically, it addresses how these transcripts interact with other biological molecules, nucleic acids and proteins, to regulate gene expression through chromatin remodeling at the pretranscriptional level and modulation of transcriptional and post-transcriptional processes by altering the sense mRNA structure or the cellular compartmental distribution, either in the nucleus or the cytoplasm.

  12. Association, haplotype, and gene-gene interactions of the HPA axis genes with suicidal behaviour in affective disorders.

    PubMed

    Leszczyńska-Rodziewicz, Anna; Szczepankiewicz, Aleksandra; Pawlak, Joanna; Dmitrzak-Weglarz, Monika; Hauser, Joanna

    2013-01-01

    Family twin and adoption studies have noted the heritability of specific biological factors that influence suicidal behaviour. Exposure to stress is one of the factors that strongly contribute to suicide attempts. The biological response to stress involves the hypothalamic-pituitary-adrenal axis (HPA). Therefore, we found it interesting to study polymorphisms of genes involved in the HPA axis (CRHR1, NR3C1, and AVPBR1). The study was performed on 597 patients, 225 of whom had a history of suicide attempts. We did not observe any significant differences in the studied polymorphisms between the group of patients with a history of suicide attempts and the control subjects. Our haplotype analysis of the AVPR1b gene revealed an association between the GCA haplotype and suicide attempts; however, this association was not significant after correcting for multiple testing. We did not observe any other association in haplotype and MDR analysis. We report here a comprehensive analysis of the HPA axis genes and a lack of association for genetic variations regarding the risk of suicide attempts in affective disorder patients. Nonetheless, the inconsistencies with the previously published results indicate the importance of the further investigation of these polymorphisms with respect to the risk of suicide attempts.

  13. Saccharomyces cerevisiae Yta7 Regulates Histone Gene Expression

    PubMed Central

    Gradolatto, Angeline; Rogers, Richard S.; Lavender, Heather; Taverna, Sean D.; Allis, C. David; Aitchison, John D.; Tackett, Alan J.

    2008-01-01

    The Saccharomyces cerevisiae Yta7 protein is a component of a nucleosome bound protein complex that maintains distinct transcriptional zones of chromatin. We previously found that one protein copurifying with Yta7 is the yFACT member Spt16. Epistasis analyses revealed a link between Yta7, Spt16, and other previously identified members of the histone regulatory pathway. In concurrence, Yta7 was found to regulate histone gene transcription in a cell-cycle-dependent manner. Association at the histone gene loci appeared to occur through binding of the bromodomain-like region of Yta7 with the N-terminal tail of histone H3. Our work suggests a mechanism in which Yta7 is localized to chromatin to establish regions of transcriptional silencing, and that one facet of this cellular mechanism is to modulate transcription of histone genes. PMID:18493054

  14. Virulence Gene Regulation by L-Arabinose in Salmonella enterica.

    PubMed

    López-Garrido, Javier; Puerta-Fernández, Elena; Cota, Ignacio; Casadesús, Josep

    2015-07-01

    Invasion of the intestinal epithelium is a critical step in Salmonella enterica infection and requires functions encoded in the gene cluster known as Salmonella Pathogenicity Island 1 (SPI-1). Expression of SPI-1 genes is repressed by L-arabinose, and not by other pentoses. Transport of L-arabinose is necessary to repress SPI-1; however, repression is independent of L-arabinose metabolism and of the L-arabinose-responsive regulator AraC. SPI-1 repression by L-arabinose is exerted at a single target, HilD, and the mechanism appears to be post-translational. As a consequence of SPI-1 repression, l-arabinose reduces translocation of SPI-1 effectors to epithelial cells and decreases Salmonella invasion in vitro. These observations reveal a hitherto unknown role of L-arabinose in gene expression control and raise the possibility that Salmonella may use L-arabinose as an environmental signal.

  15. Globalisation reaches gene regulation: the case for vertebrate limb development.

    PubMed

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  16. Mechanical regulation of osteoclastic genes in human osteoblasts

    SciTech Connect

    Kreja, Ludwika Liedert, Astrid; Hasni, Sofia; Claes, Lutz; Ignatius, Anita

    2008-04-11

    Bone adaptation to mechanical load is accompanied by changes in gene expression of bone-forming cells. Less is known about mechanical effects on factors controlling bone resorption by osteoclasts. Therefore, we studied the influence of mechanical loading on several key genes modulating osteoclastogenesis. Human osteoblasts were subjected to various cell stretching protocols. Quantitative RT-PCR was used to evaluate gene expression. Cell stretching resulted in a significant up-regulation of receptor activator of nuclear factor-{kappa}B ligand (RANKL) immediate after intermittent loading (3 x 3 h, 3 x 6 h, magnitude 1%). Continuous loading, however, had no effect on RANKL expression. The expression of osteoprotegerin (OPG), macrophage-colony stimulating factor (M-CSF), and osteoclast inhibitory lectin (OCIL) was not significantly altered. The data suggested that mechanical loading could influence osteoclasts recruitment by modulating RANKL expression in human osteoblasts and that the effects might be strictly dependent on the quality of loading.

  17. Frequency-modulated nuclear localization bursts coordinate gene regulation

    PubMed Central

    Cai, Long; Dalal, Chiraj K.; Elowitz, Michael B.

    2008-01-01

    In yeast, the transcription factor Crz1 is dephosphorylated and translocates into the nucleus in response to extracellular calcium. Using time-lapse microscopy, we found that Crz1 exhibited short bursts of nuclear localization (∼2 minutes) that occurred stochastically in individual cells and propagated to the expression of downstream genes. Strikingly, calcium concentration controlled the frequency, but not duration, of localization bursts. Using an analytic model, we found that this frequency modulation (FM) of bursts ensures proportional expression of multiple target genes across a wide dynamic range of expression levels, independent of promoter characteristics. We experimentally confirmed this theory with natural and synthetic Crz1 target promoters. Another stress response transcription factor, Msn2, exhibits similar, but largely uncorrelated, localization bursts under calcium stress. These results suggest that FM regulation of localization bursts may be a general control strategy utilized by the cell to coordinate multi-gene responses to external signals. PMID:18818649

  18. slo K+ channel gene regulation mediates rapid drug tolerance

    NASA Astrophysics Data System (ADS)

    Ghezzi, Alfredo; Al-Hasan, Yazan M.; Larios, Leo E.; Bohm, Rudolf A.; Atkinson, Nigel S.

    2004-12-01

    Changes in neural activity caused by exposure to drugs may trigger homeostatic mechanisms that attempt to restore normal neural excitability. In Drosophila, a single sedation with the anesthetic benzyl alcohol changes the expression of the slo K+ channel gene and induces rapid drug tolerance. We demonstrate linkage between these two phenomena by using a mutation and a transgene. A mutation that eliminates slo expression prevents tolerance, whereas expression from an inducible slo transgene mimics tolerance in naïve animals. The behavioral response to benzyl alcohol can be separated into an initial phase of hyperkinesis and a subsequent phase of sedation. The hyperkinetic phase causes a drop in slo gene expression and makes animals more sensitive to benzyl alcohol. It is the sedative phase that stimulates slo gene expression and induces tolerance. We demonstrate that the expression level of slo is a predictor of drug sensitivity. drug abuse | potassium channel | transcription regulation

  19. Virulence Gene Regulation by l-Arabinose in Salmonella enterica

    PubMed Central

    López-Garrido, Javier; Puerta-Fernández, Elena; Cota, Ignacio; Casadesús, Josep

    2015-01-01

    Invasion of the intestinal epithelium is a critical step in Salmonella enterica infection and requires functions encoded in the gene cluster known as Salmonella Pathogenicity Island 1 (SPI-1). Expression of SPI-1 genes is repressed by l-arabinose, and not by other pentoses. Transport of l-arabinose is necessary to repress SPI-1; however, repression is independent of l-arabinose metabolism and of the l-arabinose-responsive regulator AraC. SPI-1 repression by l-arabinose is exerted at a single target, HilD, and the mechanism appears to be post-translational. As a consequence of SPI-1 repression, l-arabinose reduces translocation of SPI-1 effectors to epithelial cells and decreases Salmonella invasion in vitro. These observations reveal a hitherto unknown role of l-arabinose in gene expression control and raise the possibility that Salmonella may use L-arabinose as an environmental signal. PMID:25991823

  20. Methods and compositions for regulating gene expression in plant cells

    NASA Technical Reports Server (NTRS)

    Beachy, Roger N. (Inventor); Luis, Maria Isabel Ordiz (Inventor); Dai, Shunhong (Inventor)

    2010-01-01

    Novel chimeric plant promoter sequences are provided, together with plant gene expression cassettes comprising such sequences. In certain preferred embodiments, the chimeric plant promoters comprise the BoxII cis element and/or derivatives thereof. In addition, novel transcription factors are provided, together with nucleic acid sequences encoding such transcription factors and plant gene expression cassettes comprising such nucleic acid sequences. In certain preferred embodiments, the novel transcription factors comprise the acidic domain, or fragments thereof, of the RF2a transcription factor. Methods for using the chimeric plant promoter sequences and novel transcription factors in regulating the expression of at least one gene of interest are provided, together with transgenic plants comprising such chimeric plant promoter sequences and novel transcription factors.

  1. Protocadherin 19 (PCDH19) interacts with paraspeckle protein NONO to co-regulate gene expression with estrogen receptor alpha (ERα).

    PubMed

    Pham, Duyen H; Tan, Chuan; Homan, Claire C; Kolc, Kristy; Corbett, Mark; McAninch, Dale; Fox, Archa; Thomas, Paul; Kumar, Raman; Gecz, Jozef

    2017-03-17

    De novo and inherited mutations of X-chromosome cell adhesion molecule protocadherin 19 (PCDH19) cause frequent, highly variable epilepsy, autism, cognitive decline and behavioural problems syndrome. Intriguingly, hemizygous null males are not affected while heterozygous females are, contradicting established X-chromosome inheritance. The disease mechanism is not known. Cellular mosaicism is the likely driver. We have identified p54nrb/NONO, a multifunctional nuclear paraspeckle protein with known roles in nuclear hormone receptor gene regulation, as a PCDH19 protein interacting partner. Using breast cancer cells we show that PCDH19-NONO complex is a positive co-regulator of ERα-mediated gene expression. Expression of mutant PCDH19 affects at least a subset of known ERα-regulated genes. These data are consistent with our findings that genes regulated by nuclear hormone receptors and those involved in the metabolism of neurosteroids in particular are dysregulated in PCDH19-epilepsy girls and affected mosaic males. Overall we define and characterize a novel mechanism of gene regulation driven by PCDH19, which is mediated by paraspeckle constituent NONO and is ERα-dependent. This PCDH19-NONO-ERα axis is of relevance not only to PCDH19-epilepsy and its comorbidities but likely also to ERα and generally nuclear hormone receptor-associated cancers.

  2. Gene regulation networks generate diverse pigmentation patterns in plants.

    PubMed

    Albert, Nick W; Davies, Kevin M; Schwinn, Kathy E

    2014-01-01

    The diversity of pigmentation patterns observed in plants occurs due to the spatial distribution and accumulation of colored compounds, which may also be associated with structural changes to the tissue. Anthocyanins are flavonoids that provide red/purple/blue coloration to plants, often forming complex patterns such as spots, stripes, and vein-associated pigmentation, particularly in flowers. These patterns are determined by the activity of MYB-bHLH-WDR (MBW) transcription factor complexes, which activate the anthocyanin biosynthesis genes, resulting in anthocyanin pigment accumulation. Recently, we established that the MBW complex controlling anthocyanin synthesis acts within a gene regulation network that is conserved within at least the Eudicots. This network involves hierarchy, reinforcement, and feedback mechanisms that allow for stringent and responsive regulation of the anthocyanin biosynthesis genes. The gene network and mobile nature of the WDR and R3-MYB proteins provide exciting new opportunities to explore the basis of pigmentation patterning, and to investigate the evolutionary history of the MBW components in land plants.

  3. MTA3 regulates CGB5 and Snail genes in trophoblast

    SciTech Connect

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  4. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    NASA Astrophysics Data System (ADS)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  5. Regulated expression of the human gastrin gene in mice.

    PubMed

    Mensah-Osman, Edith; Labut, Ed; Zavros, Yana; El-Zaatari, Mohamad; Law, David J; Merchant, Juanita L

    2008-11-29

    Gastrin is secreted from neuroendocrine cells residing in the adult antrum called G cells, but constitutively low levels are also expressed in the duodenum and fetal pancreas. Gastrin normally regulates gastric acid secretion by stimulating the proliferation of enterochromaffin-like cells and the release of histamine. Gastrin and progastrin forms are expressed in a number of pathological conditions and malignancies. However, the DNA regulatory elements in the human versus the mouse gastrin promoters differ suggesting differences in their transcriptional control. Thus, we describe here the expression of the human gastrin gene using a bacterial artificial chromosome (BAC) in the antral and duodenal cells of gastrin null mice. All 5 founder lines expressed the 253 kb human gastrin BAC. hGasBAC transgenic mice were bred onto a gastrin null background so that the levels of human gastrin peptide could be analyzed by immunohistochemistry and radioimmunoassay without detecting endogenous mouse gastrin. We have shown previously that chronically elevated gastrin levels suppress somatostatin. Indeed, infusion of amidated rat gastrin depressed somatostatin levels, stimulated gastric acid secretion and an increase in the numbers of G cells in the antrum and duodenum. In conclusion, human gastrin was expressed in mouse enteroendocrine cells and was regulated by somatostatin. This mouse model provides a unique opportunity to study regulation of the human gastrin promoter in vivo by somatostatin and possibly other extracellular regulators contributing to our understanding of the mechanisms involved in transcriptional control of the human gene.

  6. Social regulation of gene expression in human leukocytes

    PubMed Central

    Cole, Steve W; Hawkley, Louise C; Arevalo, Jesusa M; Sung, Caroline Y; Rose, Robert M; Cacioppo, John T

    2007-01-01

    Background Social environmental influences on human health are well established in the epidemiology literature, but their functional genomic mechanisms are unclear. The present study analyzed genome-wide transcriptional activity in people who chronically experienced high versus low levels of subjective social isolation (loneliness) to assess alterations in the activity of transcription control pathways that might contribute to increased adverse health outcomes in social isolates. Results DNA microarray analysis identified 209 genes that were differentially expressed in circulating leukocytes from 14 high- versus low-lonely individuals, including up-regulation of genes involved in immune activation, transcription control, and cell proliferation, and down-regulation of genes supporting mature B lymphocyte function and type I interferon response. Promoter-based bioinformatic analyses showed under-expression of genes bearing anti-inflammatory glucocorticoid response elements (GREs; p = 0.032) and over-expression of genes bearing response elements for pro-inflammatory NF-κB/Rel transcription factors (p = 0.011). This reciprocal shift in pro- and anti-inflammatory signaling was not attributable to differences in circulating cortisol levels, or to other demographic, psychological, or medical characteristics. Additional transcription control pathways showing differential activity in bioinformatic analyses included the CREB/ATF, JAK/STAT, IRF1, C/EBP, Oct, and GATA pathways. Conclusion These data provide the first indication that human genome-wide transcriptional activity is altered in association with a social epidemiological risk factor. Impaired transcription of glucocorticoid response genes and increased activity of pro-inflammatory transcription control pathways provide a functional genomic explanation for elevated risk of inflammatory disease in individuals who experience chronically high levels of subjective social isolation. PMID:17854483

  7. A Role of Polycomb Group Genes in the Regulation of Gap Gene Expression in Drosophila

    PubMed Central

    Pelegri, F.; Lehmann, R.

    1994-01-01

    Anteroposterior polarity of the Drosophila embryo is initiated by the localized activities of the maternal genes, bicoid and nanos, which establish a gradient of the hunchback (hb) morphogen. nanos determines the distribution of the maternal Hb protein by regulating its translation. To identify further components of this pathway we isolated suppressors of nanos. In the absence of nanos high levels of Hb protein repress the abdomen-specific genes knirps and giant. In suppressor-of-nanos mutants, knirps and giant are expressed in spite of high Hb levels. The suppressors are alleles of Enhancer of zeste (E(z)) a member of the Polycomb group (Pc-G) of genes. We show that E(z), and likely other Pc-G genes, are required for maintaining the expression domains of knirps and giant initiated by the maternal Hb protein gradient. We have identified a small region of the knirps promoter that mediates the regulation by E(z) and hb. Because Pc-G genes are thought to control gene expression by regulating chromatin, we propose that imprinting at the chromatin level underlies the determination of anteroposterior polarity in the early embryo. PMID:8013911

  8. O2-sensing and O2-dependent gene regulation in facultatively anaerobic bacteria.

    PubMed

    Unden, G; Becker, S; Bongaerts, J; Holighaus, G; Schirawski, J; Six, S

    1995-08-01

    Availability of O2 is one of the most important regulatory signals in facultatively anaerobic bacteria. Various two- or one-component sensor/regulator systems control the expression of aerobic and anaerobic metabolism in response to O2. Most of the sensor proteins contain heme or Fe as cofactors that interact with O2 either by binding or by a redox reaction. The ArcA/ArcB regulator of aerobic metabolism in Escherichia coli may use a different sensory mechanism. In two-component regulators, the sensor is located in the cytoplasmic membrane, whereas one-component regulators are located in the cytoplasm. Under most conditions, O2 can readily reach the cytoplasm and could provide the signal in the cytoplasm. The transcriptional regulator FNR of E. Coli controls the expression of many genes required for anaerobic metabolism in response to O2. Functional homologs of FNR are present in facultatively anaerobic Proteobacteria and presumably also in gram-positive bacteria. The target genes of FNR are mostly under multiple regulation by FNR and other regulators that respond to O2, nitrate, or glucose. FNR represents a 'one-component' sensor/regulator and contains Fe for signal perception. In response to O2 availability, FNR is converted reversibly from the aerobic (inactive) state to the anaerobic (active) state. Experiments suggest that the Fe cofactor is bound by four essential cysteine residues. The O2-triggered transformation between active and inactive FNR presumably is due to a redox reaction at the Fe cofactor, but other modes of interaction cannot be excluded. O2 seems to affect the site-specific DNA binding of FNR at target genes or the formation of an active transcriptional complex with RNA polymerase.

  9. Effects of bidirectional regulation on noises in gene networks.

    PubMed

    Zheng, Xiudeng; Tao, Yi

    2010-03-14

    To investigate the effects of bidirectional regulation on the noise in protein concentration, a theoretical and simple three-gene network model is considered. The basic idea behind this model is from Paulsson's proposition (J. Paulsson, Phys. Life Rev. 2005, 2, 157-175), where the synthesis and degradation of a mRNA species corresponding to a target protein are regulated directly and indirectly by a certain sigma-factor, and a random increase in the concentration of the sigma-factor should increase both the synthesis and degradation rates of the mRNA species (bidirectional regulation). Using the standard Omega-expansion technique (linear noise approximation) and Monte Carlo simulation, our main results show clearly that for the steady-state statistics the effects of the noise of the sigma-factor on the stochastic fluctuation of the target protein could partially cancel out.

  10. Decorin gene expression and its regulation in human keratinocytes

    SciTech Connect

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico; Kuri-Harcuch, Walid

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  11. Mechanisms of Hypoxic Up-Regulation of Versican Gene Expression in Macrophages

    PubMed Central

    Sotoodehnejadnematalahi, Fattah; Staples, Karl J.; Chrysanthou, Elvina; Pearson, Helen; Ziegler-Heitbrock, Loems; Burke, Bernard

    2015-01-01

    Hypoxia is a hallmark of many pathological tissues. Macrophages accumulate in hypoxic sites and up-regulate a range of hypoxia-inducible genes. The matrix proteoglycan versican has been identified as one such gene, but the mechanisms responsible for hypoxic induction are not fully characterised. Here we investigate the up-regulation of versican by hypoxia in primary human monocyte-derived macrophages (HMDM), and, intriguingly, show that versican mRNA is up-regulated much more highly (>600 fold) by long term hypoxia (5 days) than by 1 day of hypoxia (48 fold). We report that versican mRNA decay rates are not affected by hypoxia, demonstrating that hypoxic induction of versican mRNA is mediated by increased transcription. Deletion analysis of the promoter identified two regions required for high level promoter activity of luciferase reporter constructs in human macrophages. The hypoxia-inducible transcription factor HIF-1 has previously been implicated as a key potential regulator of versican expression in hypoxia, however our data suggest that HIF-1 up-regulation is unlikely to be principally responsible for the high levels of induction observed in HMDM. Treatment of HMDM with two distinct specific inhibitors of Phosphoinositide 3-kinase (PI3K), LY290042 and wortmannin, significantly reduced induction of versican mRNA by hypoxia and provides evidence of a role for PI3K in hypoxic up-regulation of versican expression. PMID:26057378

  12. Do circadian genes and ambient temperature affect substrate-borne signalling during Drosophila courtship?

    PubMed Central

    Medina, Izarne; Casal, José; Fabre, Caroline C. G.

    2015-01-01

    ABSTRACT Courtship vibratory signals can be air-borne or substrate-borne. They convey distinct and species-specific information from one individual to its prospective partner. Here, we study the substrate-borne vibratory signals generated by the abdominal quivers of the Drosophila male during courtship; these vibrations travel through the ground towards courted females and coincide with female immobility. It is not known which physical parameters of the vibrations encode the information that is received by the females and induces them to pause. We examined the intervals between each vibratory pulse, a feature that was reported to carry information for animal communication. We were unable to find evidence of periodic variations in the lengths of these intervals, as has been reported for fly acoustical signals. Because it was suggested that the genes involved in the circadian clock may also regulate shorter rhythms, we search for effects of period on the interval lengths. Males that are mutant for the period gene produced vibrations with significantly altered interpulse intervals; also, treating wild type males with constant light results in similar alterations to the interpulse intervals. Our results suggest that both the clock and light/dark cycles have input into the interpulse intervals of these vibrations. We wondered if we could alter the interpulse intervals by other means, and found that ambient temperature also had a strong effect. However, behavioural analysis suggests that only extreme ambient temperatures can affect the strong correlation between female immobility and substrate-borne vibrations. PMID:26519517

  13. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    PubMed Central

    Chitra, M. Ananda; Jayanthy, C.; Nagarajan, B.

    2015-01-01

    Background: Staphylococcus pseudintermedius (SP) is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr) locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR) and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59%) SP isolates were obtained from 90 samples. 15 isolates (28%) were confirmed to be methicillin-resistant SP (MRSP) with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP). Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF) based on the putative AIP produced by each strain. The AIP of

  14. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

  15. Genome-scale study of the importance of binding site context for transcription factor binding and gene regulation

    PubMed Central

    Westholm, Jakub Orzechowski; Xu, Feifei; Ronne, Hans; Komorowski, Jan

    2008-01-01

    Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence) is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context. PMID:19014636

  16. Addiction-Related Gene Regulation: Risks of Exposure to Cognitive Enhancers vs. Other Psychostimulants

    PubMed Central

    Steiner, Heinz; Van Waes, Vincent

    2012-01-01

    The psychostimulants methylphenidate (Ritalin, Concerta), amphetamine (Adderall), and modafinil (Provigil) are widely used in the treatment of medical conditions such as attention-deficit hyperactivity disorder and narcolepsy and, increasingly, as “cognitive enhancers” by healthy people. The long-term neuronal effects of these drugs, however, are poorly understood. A substantial amount of research over the past 2 decades has investigated the effects of psychostimulants such as cocaine and amphetamines on gene regulation in the brain because these molecular changes are considered critical for psychostimulant addiction. This work has determined in some detail the neurochemical and cellular mechanisms that mediate psychostimulant-induced gene regulation and has also identified the neuronal systems altered by these drugs. Among the most affected brain systems are corticostriatal circuits, which are part of cortico-basal ganglia-cortical loops that mediate motivated behavior. The neurotransmitters critical for such gene regulation are dopamine in interaction with glutamate, while other neurotransmitters (e.g., serotonin) play modulatory roles. This review presents (1) an overview of the main findings on cocaine- and amphetamine-induced gene regulation in corticostriatal circuits in an effort to provide a cellular framework for (2) an assessment of the molecular changes produced by methylphenidate, medical amphetamine (Adderall), and modafinil. The findings lead to the conclusion that protracted exposure to these cognitive enhancers can induce gene regulation effects in corticostriatal circuits that are qualitatively similar to those of cocaine and other amphetamines. These neuronal changes may contribute to the addiction liability of the psychostimulant cognitive enhancers. PMID:23085425

  17. Regulation of iron transport related genes by boron in the marine bacterium Marinobacter algicola DG893.

    PubMed

    Romano, Ariel; Trimble, Lyndsay; Hobusch, Ashtian R; Schroeder, Kristine J; Amin, Shady A; Hartnett, Andrej D; Barker, Ryan A; Crumbliss, Alvin L; Carrano, Carl J

    2013-08-01

    While there has been extensive interest in the use of boron isotope ratios as a surrogate of pH in paleoclimate studies in the context of climate change-related questions, the high (0.4 mM) concentration and the depth-independent (conservative or non-nutrient-like) concentration profile of this element have led to boron being neglected as a potentially biologically relevant element in the modern ocean. Here we report that boron affects the expression of a number of protein and genes in the "algal-associated" Gram-negative marine bacterium Marinobacter algicola DG893. Most intriguingly, a number of these proteins and genes are related to iron uptake. In a recent separate publication we have shown that boron regulates one such iron transport related protein, i.e. the periplasmic iron binding protein FbpA via a direct interaction of the metalloid with this protein. Here we show that a number of other iron uptake related genes are also affected by boron but in the opposite way i.e. they are up-regulated. We propose that the differential effect of boron on FbpA expression relative to other iron transport related genes is a result of an interaction between boron and the global iron regulatory protein Fur.

  18. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs.

  19. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    PubMed

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value < 10e-16), which highlights their importance in T1D. Functional annotation of T1D genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value < 10e-6). We also identified eight T1D genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  20. Misexpression of BRE gene in the developing chick neural tube affects neurulation and somitogenesis.

    PubMed

    Wang, Guang; Li, Yan; Wang, Xiao-Yu; Chuai, Manli; Yeuk-Hon Chan, John; Lei, Jian; Münsterberg, Andrea; Lee, Kenneth Ka Ho; Yang, Xuesong

    2015-03-01

    The brain and reproductive expression (BRE) gene is expressed in numerous adult tissues and especially in the nervous and reproductive systems. However, little is known about BRE expression in the developing embryo or about its role in embryonic development. In this study, we used in situ hybridization to reveal the spatiotemporal expression pattern for BRE in chick embryo during development. To determine the importance of BRE in neurogenesis, we overexpressed BRE and also silenced BRE expression specifically in the neural tube. We established that overexpressing BRE in the neural tube indirectly accelerated Pax7(+) somite development and directly increased HNK-1(+) neural crest cell (NCC) migration and TuJ-1(+) neurite outgrowth. These altered morphogenetic processes were associated with changes in the cell cycle of NCCs and neural tube cells. The inverse effect was obtained when BRE expression was silenced in the neural tube. We also determined that BMP4 and Shh expression in the neural tube was affected by misexpression of BRE. This provides a possible mechanism for how altering BRE expression was able to affect somitogenesis, neurogenesis, and NCC migration. In summary, our results demonstrate that BRE plays an important role in regulating neurogenesis and indirectly somite differentiation during early chick embryo development.

  1. Identification of genes affecting production of the adhesion organelle of Caulobacter crescentus CB2.

    PubMed Central

    Mitchell, D; Smit, J

    1990-01-01

    Transposon (Tn5) mutagenesis was used to identify regions in the genome involved with production, regulation, or attachment to the cell surface of the adhesive holdfast of the freshwater bacterium Caulobacter crescentus CB2. A total of 12,000 independently selected transposon insertion mutants were screened for defects in adhesion to cellulose acetate; 77 mutants were detected and examined by Southern blot hybridization mapping methods and pulsed-field gel electrophoresis. Ten unique sites of Tn5 insertion affecting holdfast function were identified that were clustered in four regions of the genome. Representative mutants of the 10 Tn5 insertion sites were examined by a variety of methods for differences in their phenotype leading to the loss of adhesiveness. Four phenotypes were identified: no holdfast production, production of a smaller or an altered holdfast, production of a holdfast that was unable to remain attached to the cell, and a fourth category in which a possible alteration of the stalk was related to impaired adhesion of the cell. With the possible exception of the last class, no pleiotropic mutants (those with multiple defects in the polar region of the cell) were detected among the adhesion-defective mutants. This was unexpected, since holdfast deficiency is often a characteristic of pleiotropic mutants obtained when selecting for loss of other polar structures. Overall, the evidence suggests that we have identified regions containing structural genes for the holdfast, genes involved with proper attachment or positioning on the caulobacter surface, and possibly regions that regulate the levels of holdfast production. Images PMID:2168382

  2. Endospanin1 affects oppositely body weight regulation and glucose homeostasis by differentially regulating central leptin signaling.

    PubMed

    Vauthier, Virginie; Roujeau, Clara; Chen, Patty; Sarkis, Chamsy; Migrenne, Stéphanie; Hosoi, Toru; Ozawa, Koichiro; Rouillé, Yves; Foretz, Marc; Mallet, Jacques; Launay, Jean-Marie; Magnan, Christophe; Jockers, Ralf; Dam, Julie

    2017-01-01

    The hypothalamic arcuate nucleus (ARC) is a major integration center for energy and glucose homeostasis that responds to leptin. Resistance to leptin in the ARC is an important component of the development of obesity and type 2 diabetes. Recently, we showed that Endospanin1 (Endo1) is a negative regulator of the leptin receptor (OBR) that interacts with OBR and retains the receptor inside the cell, leading to a decreased activation of the anorectic STAT3 pathway. Endo1 is up-regulated in the ARC of high fat diet (HFD)-fed mice, and its silencing in the ARC of lean and obese mice prevents and reverses the development of obesity.

  3. Oxygen-regulated gene expression in murine cumulus cells.

    PubMed

    Kind, Karen L; Tam, Kimberley K Y; Banwell, Kelly M; Gauld, Ashley D; Russell, Darryl L; Macpherson, Anne M; Brown, Hannah M; Frank, Laura A; Peet, Daniel J; Thompson, Jeremy G

    2015-01-01

    Oxygen is an important component of the environment of the cumulus-oocyte complex (COC), both in vivo within the ovarian follicle and during in vitro oocyte maturation (IVM). Cumulus cells have a key role in supporting oocyte development, and cumulus cell function and gene expression are known to be altered when the environment of the COC is perturbed. Oxygen-regulated gene expression is mediated through the actions of the transcription factors, the hypoxia-inducible factors (HIFs). In the present study, the effect of oxygen on cumulus cell gene expression was examined following in vitro maturation of the murine COC at 2%, 5% or 20% oxygen. Increased expression of HIF-responsive genes, including glucose transporter-1, lactate dehydrogenase A and BCL2/adenovirus E1B interacting protein 3, was observed in cumulus cells matured at 2% or 5%, compared with 20% oxygen. Stabilisation of HIF1α protein in cumulus cells exposed to low oxygen was confirmed by western blot and HIF-mediated transcriptional activity was demonstrated using a transgenic mouse expressing green fluorescent protein under the control of a promoter containing hypoxia response elements. These results indicate that oxygen concentration influences cumulus cell gene expression and support a role for HIF1α in mediating the cumulus cell response to varying oxygen.

  4. Regulation of fibronectin gene expression in cardiac fibroblasts by scleraxis.

    PubMed

    Bagchi, Rushita A; Lin, Justin; Wang, Ryan; Czubryt, Michael P

    2016-11-01

    The glycoprotein fibronectin is a key component of the extracellular matrix. By interacting with numerous matrix and cell surface proteins, fibronectin plays important roles in cell adhesion, migration and intracellular signaling. Up-regulation of fibronectin occurs in tissue fibrosis, and previous studies have identified the pro-fibrotic factor TGFβ as an inducer of fibronectin expression, although the mechanism responsible remains unknown. We have previously shown that a key downstream effector of TGFβ signaling in cardiac fibroblasts is the transcription factor scleraxis, which in turn regulates the expression of a wide variety of extracellular matrix genes. We noted that fibronectin expression tracked closely with scleraxis expression, but it was unclear whether scleraxis directly regulated the fibronectin gene. Here, we report that scleraxis acts via two E-box binding sites in the proximal human fibronectin promoter to govern fibronectin expression, with the second E-box being both sufficient and necessary for scleraxis-mediated fibronectin expression to occur. A combination of electrophoretic mobility shift and chromatin immunoprecipitation assays indicated that scleraxis interacted to a greater degree with the second E-box. Over-expression or knockdown of scleraxis resulted in increased or decreased fibronectin expression, respectively, and scleraxis null mice presented with dramatically decreased immunolabeling for fibronectin in cardiac tissue sections compared to wild-type controls. Furthermore, scleraxis was required for TGFβ-induced fibronectin expression: TGFβ lost its ability to induce fibronectin expression following scleraxis knockdown. Together, these results demonstrate a novel and required role for scleraxis in the regulation of cardiac fibroblast fibronectin gene expression basally or in response to TGFβ.

  5. Landscape of post-transcriptional gene regulation during hepatitis C virus infection

    PubMed Central

    Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram

    2015-01-01

    Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065

  6. Gene Expression in Gut Symbiotic Organ of Stinkbug Affected by Extracellular Bacterial Symbiont

    PubMed Central

    Futahashi, Ryo; Tanaka, Kohjiro; Tanahashi, Masahiko; Nikoh, Naruo; Kikuchi, Yoshitomo; Lee, Bok Luel; Fukatsu, Takema

    2013-01-01

    The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations. PMID:23691247

  7. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway.

  8. The heterozygous abp1/ABP1 insertional mutant has defects in functions requiring polar auxin transport and in regulation of early auxin-regulated genes.

    PubMed

    Effendi, Yunus; Rietz, Steffen; Fischer, Urs; Scherer, Günther F E

    2011-01-01

    AUXIN-BINDING PROTEIN 1 (ABP1) is not easily accessible for molecular studies because the homozygous T-DNA insertion mutant is embryo-lethal. We found that the heterozygous abp1/ABP1 insertion mutant has defects in auxin physiology-related responses: higher root slanting angles, longer hypocotyls, agravitropic roots and hypocotyls, aphototropic hypocotyls, and decreased apical dominance. Heterozygous plants flowered earlier than wild-type plants under short-day conditions. The length of the main root, the lateral root density and the hypocotyl length were little altered in the mutant in response to auxin. Compared to wild-type plants, transcription of early auxin-regulated genes (IAA2, IAA11, IAA13, IAA14, IAA19, IAA20, SAUR9, SAUR15, SAUR23, GH3.5 and ABP1) was less strongly up-regulated in the mutant by 0.1, 1 and 10 μm IAA. Surprisingly, ABP1 was itself an early auxin-up-regulated gene. IAA uptake into the mutant seedlings during auxin treatments was indistinguishable from wild-type. Basipetal auxin transport in young roots was slower in the mutant, indicating a PIN2/EIR1 defect, while acropetal transport was indistinguishable from wild-type. In the eir1 background, three of the early auxin-regulated genes tested (IAA2, IAA13 and ABP1) were more strongly induced by 1 μm IAA in comparison to wild-type, but eight of them were less up-regulated in comparison to wild-type. Similar but not identical disturbances in regulation of early auxin-regulated genes indicate tight functional linkage of ABP1 and auxin transport regulation. We hypothesize that ABP1 is involved in the regulation of polar auxin transport, and thus affects local auxin concentration and early auxin gene regulation. In turn, ABP1 itself is under the transcriptional control of auxin.

  9. Acute exercise regulates adipogenic gene expression in white adipose tissue.

    PubMed

    Shen, Y; Zhou, H; Jin, W; Lee, H J

    2016-12-01

    White adipose tissue expansion is associated with both hypertrophy and hyperplasia of adipocytes. Exercise training results in adipocyte hypotrophy by activating lipolysis, but it is poorly understood whether exercise regulates adipogenesis by altering adipogenic gene expression. The purpose of this study was to evaluate the effect of a single bout of swimming exercise on adipogenic gene expression in white adipose tissue (WAT). Male C57BL/6J mice were divided into two groups: a sedentary control group and a 120-minute swimming exercise group. Immediately after acute exercise, adipogenic gene expression in WAT was analysed by RT-PCR, and tdTomato positive cells in WAT from UCP1-cre-tdTomato mice were observed under a confocal microscope. In epididymal white adipose tissue (eWAT), PPARγ2 and C/EBPα expression at the mRNA level was significantly decreased with high induction of Wnt10b and KLFs (KLF2, KLF3, KLF7, KLF6, KLF9 and KLF15), whereas PPARγ2, not C/EBPα, was decreased with high induction of Wnt6 and KLFs (KLF2, KLF3, KLF7, KLF6 and KLF9) in inguinal white adipose tissue (iWAT) after acute exercise. The expression of C/EBPβ and C/EBPδ was upregulated in both WATs with a high level of PGC-1α expression. Expression level of UCP1 was increased only in adipocytes of eWAT, while beige cell specific gene expression was comparable between groups and tdTomato positive cells were not found in WAT of UCP1-cre-tdTomato reporter mouse immediately after acute exercise. These results suggest that acute exercise suppresses adipogenic gene expression and may regulate thermogenesis by activating C/EBPβ, PGC-1α and UCP1 in WAT.

  10. ARID3B Directly Regulates Ovarian Cancer Promoting Genes

    PubMed Central

    Bobbs, Alexander; Gellerman, Katrina; Hallas, William Morgan; Joseph, Stancy; Yang, Chao; Kurkewich, Jeffrey; Cowden Dahl, Karen D.

    2015-01-01

    The DNA-binding protein AT-Rich Interactive Domain 3B (ARID3B) is elevated in ovarian cancer and increases tumor growth in a xenograft model of ovarian cancer. However, relatively little is known about ARID3B's function. In this study we perform the first genome wide screen for ARID3B direct target genes and ARID3B regulated pathways. We identified and confirmed numerous ARID3B target genes by chromatin immunoprecipitation (ChIP) followed by microarray and quantitative RT-PCR. Using motif-finding algorithms, we characterized a binding site for ARID3B, which is similar to the previously known site for the ARID3B paralogue ARID3A. Functionality of this predicted site was demonstrated by ChIP analysis. We next demonstrated that ARID3B induces expression of its targets in ovarian cancer cell lines. We validated that ARID3B binds to an epidermal growth factor receptor (EGFR) enhancer and increases mRNA expression. ARID3B also binds to the promoter of Wnt5A and its receptor FZD5. FZD5 is highly expressed in ovarian cancer cell lines, and is upregulated by exogenous ARID3B. Both ARID3B and FZD5 expression increase adhesion to extracellular matrix (ECM) components including collagen IV, fibronectin and vitronectin. ARID3B-increased adhesion to collagens II and IV require FZD5. This study directly demonstrates that ARID3B binds target genes in a sequence-specific manner, resulting in increased gene expression. Furthermore, our data indicate that ARID3B regulation of direct target genes in the Wnt pathway promotes adhesion of ovarian cancer cells. PMID:26121572

  11. Cell Number Regulator1 affects plant and organ size in maize: implications for crop yield enhancement and heterosis.

    PubMed

    Guo, Mei; Rupe, Mary A; Dieter, Jo Ann; Zou, Jijun; Spielbauer, Daniel; Duncan, Keith E; Howard, Richard J; Hou, Zhenglin; Simmons, Carl R

    2010-04-01

    Genes involved in cell number regulation may affect plant growth and organ size and, ultimately, crop yield. The tomato (genus Solanum) fruit weight gene fw2.2, for instance, governs a quantitative trait locus that accounts for 30% of fruit size variation, with increased fruit size chiefly due to increased carpel ovary cell number. To expand investigation of how related genes may impact other crop plant or organ sizes, we identified the maize (Zea mays) gene family of putative fw2.2 orthologs, naming them Cell Number Regulator (CNR) genes. This family represents an ancient eukaryotic family of Cys-rich proteins containing the PLAC8 or DUF614 conserved motif. We focused on native expression and transgene analysis of the two maize members closest to Le-fw2.2, namely, CNR1 and CNR2. We show that CNR1 reduced overall plant size when ectopically overexpressed and that plant and organ size increased when its expression was cosuppressed or silenced. Leaf epidermal cell counts showed that the increased or decreased transgenic plant and organ size was due to changes in cell number, not cell size. CNR2 expression was found to be negatively correlated with tissue growth activity and hybrid seedling vigor. The effects of CNR1 on plant size and cell number are reminiscent of heterosis, which also increases plant size primarily through increased cell number. Regardless of whether CNRs and other cell number-influencing genes directly contribute to, or merely mimic, heterosis, they may aid generation of more vigorous and productive crop plants.

  12. Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens

    PubMed Central

    Ederli, Luisa; Dawe, Adam; Pasqualini, Stefania; Quaglia, Mara; Xiong, Liming; Gehring, Chris

    2015-01-01

    We investigated whether the Arabidopsis flower evolved protective measures to increase reproductive success. Firstly, analyses of available transcriptome data show that the most highly expressed transcripts in the closed sepal (stage 12) are enriched in genes with roles in responses to chemical stimuli and cellular metabolic processes. At stage 15, there is enrichment in transcripts with a role in responses to biotic stimuli. Comparative analyses between the sepal and petal in the open flower mark an over-representation of transcripts with a role in responses to stress and catalytic activity. Secondly, the content of the biotic defense-associated phytohormone salicylic acid (SA) in sepals and petals is significantly higher than in leaves. To understand whether the high levels of stress responsive transcripts and the higher SA content affect defense, wild-type plants (Col-0) and transgenic plants defective in SA accumulation (nahG) were challenged with the biotrophic fungus Golovinomyces cichoracearum, the causal agent of powdery mildew, and the necrotrophic fungus Botrytis cinerea. NahG leaves were more sensitive than those of Col-0, suggesting that in leaves SA has a role in the defense against biotrophs. In contrast, sepals and petals of both genotypes were resistant to G. cichoracearum, indicating that in the flower, resistance to the biotrophic pathogen is not critically dependent on SA, but likely dependent on the up-regulation of stress-responsive genes. Since sepals and petals of both genotypes are equally susceptible to B. cinerea, we conclude that neither stress-response genes nor increased SA accumulation offers protection against the necrotrophic pathogen. These results are interpreted in the light of the distinctive role of the flower and we propose that in the early stages, the sepal may act as a chemical defense barrier of the developing reproductive structures against biotrophic pathogens. PMID:25750645

  13. Diurnal regulation of plastid genes in Populus deltoides.

    PubMed

    Reddy, M S; Naithani, S; Tuli, R; Sane, P V

    2000-12-01

    Light regulates leaf and chloroplast development, together with overall chloroplast gene expression at various levels. Plants respond to diurnal and seasonal changes in light by changing expression of photosynthesis genes and metabolism. In Populus deltoides, a deciduous tree species, leaf development begins in the month of March and leaf maturation is attained by summer, which is subsequently followed by autumnal senescence and fall. In the present study, diurnal changes in the steady state transcript levels of plastid genes were examined in the fully developed leaves during summer season. Our results show that steady state level of the psaA/B, psbA, psbEFLJ and petA transcripts showed differential accumulation during diurnal cycle in summer. However, there was no significant change in the pigment composition during the day/night cycle. Our studies suggest that the diurnal regulation of steady state mRNA accumulation may play a crucial role during daily adjustments in plants life with rapidly changing light irradiance and temperature.

  14. Regulation of virulence gene expression in pathogenic Listeria.

    PubMed

    Brehm, K; Kreft, J; Ripio, M T; Vázquez-Boland, J A

    1996-06-01

    Dynamic interactions between host and pathogen are characteristic of infections caused by intracellular bacteria. This has favoured the evolution of highly effective control systems by which these pathogens regulate the expression of different virulence factors during sequential steps of the infection process. In the case of the facultative intracellular bacterium Listeria monocytogenes, these steps involve internalization by eukaryotic cells, lysis of the resulting phagosome, replication as well as movement within the host cytoplasm, direct cell-to-cell spread, and subsequent lysis of a double-membrane vacuole when entering neighbouring cells. Virulence factors which are involved in each of these steps have been identified and the expression of these factors is subject to a co-ordinate and differential control exerted by the major listerial virulence regulator PrfA. This protein belongs to the Crp/Fnr-family of transcriptional activators and recognizes specific target sequences in promoter regions of several listerial virulence genes. Differential expression of these genes during sequential steps of the infection seems to be at least partially mediated by different binding affinities of PrfA to its target sequences. Activity of PrfA-dependent genes and of prfA itself is under the control of several environmental variables which are used by the pathogen to recognize its transition from the free environment into a eukaryotic host.

  15. Identification and Characterization of Clostridium sordellii Toxin Gene Regulator

    PubMed Central

    Sirigi Reddy, Apoorva Reddy; Girinathan, Brintha Parasumanna; Zapotocny, Ryan

    2013-01-01

    Toxigenic Clostridium sordellii causes uncommon but highly lethal infections in humans and animals. Recently, an increased incidence of C. sordellii infections has been reported in women undergoing obstetric interventions. Pathogenic strains of C. sordellii produce numerous virulence factors, including sordellilysin, phospholipase, neuraminidase, and two large clostridial glucosylating toxins, TcsL and TcsH. Recent studies have demonstrated that TcsL toxin is an essential virulence factor for the pathogenicity of C. sordellii. In this study, we identified and characterized TcsR as the toxin gene (tcsL) regulator in C. sordellii. High-throughput sequencing of two C. sordellii strains revealed that tcsR lies within a genomic region that encodes TcsL, TcsH, and TcsE, a putative holin. By using ClosTron technology, we inactivated the tcsR gene in strain ATCC 9714. Toxin production and tcsL transcription were decreased in the tcsR mutant strain. However, the complemented tcsR mutant produced large amounts of toxins, similar to the parental strain. Expression of the Clostridium difficile toxin gene regulator tcdR also restored toxin production to the C. sordellii tcsR mutant, showing that these sigma factors are functionally interchangeable. PMID:23873908

  16. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    PubMed Central

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  17. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    PubMed Central

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches. PMID:25566532

  18. Activity-Regulated Genes as Mediators of Neural Circuit Plasticity

    PubMed Central

    Leslie, Jennifer H.; Nedivi, Elly

    2011-01-01

    Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Many electrophysiological and molecular mechanisms are common to the seemingly diverse types of activity-dependent functional adaptation that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. They fine-tune brain circuits by strengthening or weakening synaptic connections or by altering synapse numbers. Their effects are further modulated by posttranscriptional regulatory mechanisms, often also dependent on activity, that control activity-regulated gene transcript and protein function. Thus, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. PMID:21601615

  19. TRANSCRIPTIONAL REGULATION OF THE HUMAN KiSS1 GENE

    PubMed Central

    Mueller, Johanna K.; Dietzel, Anja; Lomniczi, Alejandro; Loche, Alberto; Tefs, Katrin; Kiess, Wieland; Danne, Thomas; Ojeda, Sergio R.; Heger, Sabine

    2011-01-01

    Kisspeptin, the product of the KiSS1 gene, has emerged as a key component of the mechanism by which the hypothalamus controls puberty and reproductive development. It does so by stimulating the secretion of gonadotropin releasing hormone (GnRH). Little is known about the transcriptional control of the KiSS1 gene. Here we show that a set of proteins postulated to be upstream components of a hypothalamic network involved in controlling female puberty regulates KiSS1 transcriptional activity. Using RACE-PCR we determined that transcription of KiSS1 mRNA is initiated at a single transcription start site (TSS) located 153–156 bp upstream of the ATG translation initiation codon. Promoter assays performed using 293 MSR cells showed that the KiSS1 promoter is activated by TTF1 and CUX1-p200, and repressed by EAP1, YY1, and CUX1-p110. EAP1 and CUX-110 were also repressive in GT1-7 cells. All four TFs are recruited in vivo to the KiSS1 promoter and are expressed in kisspeptin neurons. These results suggest that expression of the KiSS1 gene is regulated by trans-activators and repressors involved in the system-wide control of mammalian puberty. PMID:21672609

  20. Intron retention as a component of regulated gene expression programs.

    PubMed

    Jacob, Aishwarya G; Smith, Christopher W J

    2017-04-08

    Intron retention has long been an exemplar of regulated splicing with case studies of individual events serving as models that provided key mechanistic insights into the process of splicing control. In organisms such as plants and budding yeast, intron retention is well understood as a major mechanism of gene expression regulation. In contrast, in mammalian systems, the extent and functional significance of intron retention have, until recently, remained greatly underappreciated. Technical challenges to the global detection and quantitation of transcripts with retained introns have often led to intron retention being overlooked or dismissed as "noise". Now, however, with the wealth of information available from high-throughput deep sequencing, combined with focused computational and statistical analyses, we are able to distinguish clear intron retention patterns in various physiological and pathological contexts. Several recent studies have demonstrated intron retention as a central component of gene expression programs during normal development as well as in response to stress and disease. Furthermore, these studies revealed various ways in which intron retention regulates protein isoform production, RNA stability and translation efficiency, and rapid induction of expression via post-transcriptional splicing of retained introns. In this review, we highlight critical findings from these transcriptomic studies and discuss commonalties in the patterns prevalent in intron retention networks at the functional and regulatory levels.

  1. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    PubMed Central

    Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired. PMID:25961030

  2. Everyday music listening and affect regulation: the role of MP3 players.

    PubMed

    Skånland, Marie Strand

    2013-08-07

    The use of digital portable music devices such as MP3 players has rapidly increased during the last decade, and the sheer availability of music offered by such players raises questions about their impact on listeners' mental and physical health and well-being. This article explores MP3 player use as an everyday tactic for affect regulation, here understood as an individual's efforts to maintain or change the intensity or duration of a given affect. The ability to understand and regulate affects has significant health implications, and among the tactics relevant to such regulation, engagement with music has proven to be particularly successful. The material presented in this article is based on a qualitative interview study focused on MP3 player use as a medium for musical self-care. Because MP3 users can listen to whatever they want, whenever they want, and target their music in the interests of managing and regulating moods and emotions, the MP3 player represents a valuable and convenient technology of affect regulation.

  3. Everyday music listening and affect regulation: The role of MP3 players.

    PubMed

    Skånland, Marie Strand

    2013-01-01

    The use of digital portable music devices such as MP3 players has rapidly increased during the last decade, and the sheer availability of music offered by such players raises questions about their impact on listeners' mental and physical health and well-being. This article explores MP3 player use as an everyday tactic for affect regulation, here understood as an individual's efforts to maintain or change the intensity or duration of a given affect. The ability to understand and regulate affects has significant health implications, and among the tactics relevant to such regulation, engagement with music has proven to be particularly successful. The material presented in this article is based on a qualitative interview study focused on MP3 player use as a medium for musical self-care. Because MP3 users can listen to whatever they want, whenever they want, and target their music in the interests of managing and regulating moods and emotions, the MP3 player represents a valuable and convenient technology of affect regulation.

  4. Genetic perturbation of key central metabolic genes extends lifespan in Drosophila and affects response to dietary restriction

    PubMed Central

    Talbert, Matthew E.; Barnett, Brittany; Hoff, Robert; Amella, Maria; Kuczynski, Kate; Lavington, Erik; Koury, Spencer; Brud, Evgeny; Eanes, Walter F.

    2015-01-01

    There is a connection between nutrient inputs, energy-sensing pathways, lifespan variation and aging. Despite the role of metabolic enzymes in energy homeostasis and their metabolites as nutrient signals, little is known about how their gene expression impacts lifespan. In this report, we use P-element mutagenesis in Drosophila to study the effect on lifespan of reductions in expression of seven central metabolic enzymes, and contrast the effects on normal diet and dietary restriction. The major observation is that for five of seven genes, the reduction of gene expression extends lifespan on one or both diets. Two genes are involved in redox balance, and we observe that lower activity genotypes significantly extend lifespan. The hexokinases also show extension of lifespan with reduced gene activity. Since both affect the ATP/ADP ratio, this connects with the role of AMP-activated protein kinase as an energy sensor in regulating lifespan and mediating caloric restriction. These genes possess significant expression variation in natural populations, and our experimental genotypes span this level of natural activity variation. Our studies link the readout of energy state with the perturbation of the genes of central metabolism and demonstrate their effect on lifespan. PMID:26378219

  5. [Study of the regulation of crp gene expression in Escherichia coli K12].

    PubMed

    Lisenkov, A F; Smirnov, Iu V

    1990-03-01

    The regulation of crp gene expression by CRP-cAMP complex was studied in E. coli strain by the crp-lac operon fusion. F'141 crp+ episome decreased 5-7 fold the high level of crp-lac expression in crp strains while F'141 crp episome had no effect. The hybrid plasmid pCAP2 crp+ with the intact crp gene did not affect the crp gene expression level in crp mutants, though they had acquired the Crp+ phenotype just as they did in F'141 crp+ presence. The F'141 crp+ and pCAP2 crp+ combination in crp mutants also resulted in decrease of the crp gene expression comparable to the registered in the presence of the F'141 crp+ plasmid. Similar repression occurred only in cya+ strains but not in cya strains. The crp gene is supposed to possess negative regulation by CRP-cAMP complex with a complementary factor also necessary. The latter is evidently located in an E. coli chromosome site overlapped by F'141 episome.

  6. Single-taxon field measurements of bacterial gene regulation controlling DMSP fate.

    PubMed

    Varaljay, Vanessa A; Robidart, Julie; Preston, Christina M; Gifford, Scott M; Durham, Bryndan P; Burns, Andrew S; Ryan, John P; Marin, Roman; Kiene, Ronald P; Zehr, Jonathan P; Scholin, Christopher A; Moran, Mary Ann

    2015-07-01

    The 'bacterial switch' is a proposed regulatory point in the global sulfur cycle that routes dimethylsulfoniopropionate (DMSP) to two fundamentally different fates in seawater through genes encoding either the cleavage or demethylation pathway, and affects the flux of volatile sulfur from ocean surface waters to the atmosphere. Yet which ecological or physiological factors might control the bacterial switch remains a topic of considerable debate. Here we report the first field observations of dynamic changes in expression of DMSP pathway genes by a single marine bacterial species in its natural environment. Detection of taxon-specific gene expression in Roseobacter species HTCC2255 during a month-long deployment of an autonomous ocean sensor in Monterey Bay, CA captured in situ regulation of the first gene in each DMSP pathway (dddP and dmdA) that corresponded with shifts in the taxonomy of the phytoplankton community. Expression of the demethylation pathway was relatively greater during a high-DMSP-producing dinoflagellate bloom, and expression of the cleavage pathway was greater in the presence of a mixed diatom and dinoflagellate community [corrected].These field data fit the prevailing hypothesis for bacterial DMSP gene regulation based on bacterial sulfur demand, but also suggest a modification involving oxidative stress response, evidenced as upregulation of catalase via katG, when DMSP is demethylated.

  7. Single-taxon field measurements of bacterial gene regulation controlling DMSP fate

    PubMed Central

    Varaljay, Vanessa A; Robidart, Julie; Preston, Christina M; Gifford, Scott M; Durham, Bryndan P; Burns, Andrew S; Ryan, John P; Marin III, Roman; Kiene, Ronald P; Zehr, Jonathan P; Scholin, Christopher A; Ann Moran, Mary

    2015-01-01

    The ‘bacterial switch' is a proposed regulatory point in the global sulfur cycle that routes dimethylsulfoniopropionate (DMSP) to two fundamentally different fates in seawater through genes encoding either the cleavage or demethylation pathway, and affects the flux of volatile sulfur from ocean surface waters to the atmosphere. Yet which ecological or physiological factors might control the bacterial switch remains a topic of considerable debate. Here we report the first field observations of dynamic changes in expression of DMSP pathway genes by a single marine bacterial species in its natural environment. Detection of taxon-specific gene expression in Roseobacter species HTCC2255 during a month-long deployment of an autonomous ocean sensor in Monterey Bay, CA captured in situ regulation of the first gene in each DMSP pathway (dddP and dmdA) that corresponded with shifts in the taxonomy of the phytoplankton community. Expression of the cleavage pathway was relatively greater during a high-DMSP-producing dinoflagellate bloom, and expression of the demethylation pathway was greater in the presence of a mixed diatom and dinoflagellate community. These field data fit the prevailing hypothesis for bacterial DMSP gene regulation based on bacterial sulfur demand, but also suggest a modification involving oxidative stress response, evidenced as upregulation of catalase via katG, when DMSP is demethylated. PMID:25700338

  8. Menaquinone-7 regulates gene expression in osteoblastic MC3T3E1 cells.

    PubMed

    Katsuyama, Hironobu; Saijoh, Kiyofumi; Otsuki, Takemi; Tomita, Masafumi; Fukunaga, Masao; Sunami, Shigeo

    2007-02-01

    Previous study has shown that the vitamin K2 analog menaquinone-7 (MK-7) induces expression of the osteoblast-specific genes osteocalcin, osteoprotegerin, receptor activator of NFkappaB, and its ligand. Since MK-7 may also regulate osteoblast cell function, we examined the expression of osteoblast genes regulated by MK-7 administration. Differences between gene expression in control and MK-7-administered MC3T3E1 cells were analyzed using the suppression subtractive hybridization method. After 24 h of MK-7 administration, genes upregulated by MK-7 included tenascin C and BMP2. Genes downregulated by MK-7 administration included biglycan and butyrophilin. Real-time PCR showed a marked increase in tenascin C. When the protein level was examined using Western blot analysis, tenascin C was higher in MK-7-administered cells than in control cells. These results indicated that MK-7 affected the cellular function of osteoblastic MC3T3E1 cells. Considering BMP2 mRNA expression was higher in MK-7-administered cells than in control cells, the effect of MK-7 administration on the signal transduction system was examined. Western blot analysis showed that cells administered MK-7 displayed a higher phosphorylated Smad1 level than control cells. Because MC3T3E1 cells have a nuclear binding receptor for MK-7, this result might indicate an indirect effect of MK-7 through BMP2 production.

  9. Non-DBS DNA Repair Genes Regulate Radiation-induced Cytogenetic Damage Repair and Cell Cycle Progression

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Casey, Rachael; Wu, Honglu

    2008-01-01

    Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in DSB repair, and its impact on cytogenetic responses has not been systematically studied. In the present study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by transfection with small interfering RNA in human fibroblast cells. The purpose of this study is to identify new roles of these selected genes on regulating DSB repair and cell cycle progression , as measured in the micronuclei formation and chromosome aberration. In response to IR, the formation of MN was significantly increased by suppressed expression of 5 genes: Ku70 in the DSB repair pathway, XPA in the NER pathway, RPA1 in the MMR pathway, and RAD17 and RBBP8 in cell cycle control. Knocked-down expression of 4 genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Furthermore, loss of XPA, P21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Most of the 11 genes that affected cytogenetic responses are not known to have clear roles influencing DBS repair. Nine of these 11 genes were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate the biological consequences after IR.

  10. Identification of nonviable genes affecting touch sensitivity in Caenorhabditis elegans using neuronally enhanced feeding RNA interference.

    PubMed

    Chen, Xiaoyin; Cuadros, Margarete Diaz; Chalfie, Martin

    2015-01-09

    Caenorhabditis elegans senses gentle touch along the body via six touch receptor neurons. Although genetic screens and microarray analyses have identified several genes needed for touch sensitivity, these methods miss pleiotropic genes that are essential for the viability, movement, or fertility of the animals. We used neuronally enhanced feeding RNA interference to screen genes that cause lethality or paralysis when mutated, and we identified 61 such genes affecting touch sensitivity, including five positive controls. We confirmed 18 genes by using available alleles, and further studied one of them, tag-170, now renamed txdc-9. txdc-9 preferentially affects anterior touch response but is needed for tubulin acetylation and microtubule formation in both the anterior and posterior touch receptor neurons. Our results indicate that neuronally enhanced feeding RNA interference screens complement traditional mutageneses by identifying additional nonviable genes needed for specific neuronal functions.

  11. Regulation of cel genes of C. cellulolyticum: identification of GlyR2, a transcriptional regulator regulating cel5D gene expression.

    PubMed

    Fendri, Imen; Abdou, Laetitia; Trotter, Valentine; Dedieu, Luc; Maamar, Hédia; Minton, Nigel P; Tardif, Chantal

    2013-01-01

    Transcription and expression regulation of some individual cel genes (cel5A, cel5I, cel5D and cel44O) of Clostridium cellulolyticum were investigated. Unlike the cip-cel operon, these genes are transcribed as monocistronic units of transcription, except cel5D. The location of the transcription initiation sites was determined using RT-PCR and the mRNA 5'-end extremities were detected using primer extension experiments. Similarly to the cip-cel operon, cel5A and cel5I expressions are regulated by a carbon catabolite repression mechanism, whereas cel44O and cel5D expressions do not seem to be submitted to this regulation. The role of the putative transcriptional regulator GlyR2 in the regulation of cel5D expression was investigated. The recombinant protein GlyR2 was produced and was shown to bind in vitro to the cel5D and glyR2 promoter regions, suggesting that besides regulating its own expression, GlyR2 may regulate cel5D expression. To test this hypothesis in vivo, an insertional glyR2 mutant was generated and the effect of this disruption on cel5D expression was evaluated. Levels of cel5D mRNAs in the mutant were 16 fold lower than that of the wild-type strain suggesting that GlyR2 acts as an activator of cel5D expression.

  12. Identifying Molecular Regulators of Neuronal Functions Affected in the Movement Disorder Dystonia

    DTIC Science & Technology

    2015-08-01

    AD______________ AWARD NUMBER: W81XWH-14-1-0301 TITLE: Identifying Molecular Regulators of Neuronal Functions Affected in the Movement Disorder...Affected in the Movement Disorder Dystonia 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-14-1-0301 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S...SUPPLEMENTARY NOTES 14. ABSTRACT The movement disorder dystonia is characterized by involuntary muscle contractions in the limbs, hands, feet or neck. The aim

  13. Unmasking Upstream Gene Expression Regulators with miRNA-corrected mRNA Data

    PubMed Central

    Bollmann, Stephanie; Bu, Dengpan; Wang, Jiaqi; Bionaz, Massimo

    2015-01-01

    Expressed micro-RNA (miRNA) affects messenger RNA (mRNA) abundance, hindering the accuracy of upstream regulator analysis. Our objective was to provide an algorithm to correct such bias. Large mRNA and miRNA analyses were performed on RNA extracted from bovine liver and mammary tissue. Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%). Using four levels of target scores from TargetScan (all miRNA:mRNA target gene pairs or only the top 25%, 50%, or 75%) and four levels of the magnitude of miRNA effect (ME) on mRNA expression (30%, 50%, 75%, and 83% mRNA reduction), we generated 17 different datasets (including the original dataset). For each dataset, we performed upstream regulator analysis using two bioinformatics tools. We detected an increased effect on the upstream regulator analysis with larger miRNA:mRNA pair bins and higher ME. The miRNA correction allowed identification of several upstream regulators not present in the analysis of the original dataset. Thus, the proposed algorithm improved the prediction of upstream regulators. PMID:27279737

  14. The transcriptional regulation of the human CYP2C genes

    PubMed Central

    Chen, Yuping; Goldstein, Joyce A.

    2010-01-01

    In humans, four members of the CYP2C subfamily (CYP2C8, CYP2C9, CYP2C18, and CYP2C19) metabolize more than 20% of all therapeutic drugs as well as a number of endogenous compounds. The CYP2C enzymes are found predominantly in the liver, where they comprise ∼20% of the total cytochrome P450. A variety of xenobiotics such as phenobarbital, rifampicin, and hyperforin have been shown to induce the transcriptional expression of CYP2C genes in primary human hepatocytes and to increase the metabolism of CYP2C substrates in vivo in man. This induction can result in drug-drug interactions, drug tolerance, and therapeutic failure. Several drug-activated nuclear receptors including CAR, PXR, VDR, and GR recognize drug responsive elements within the 5′ flanking promoter region of CYP2C genes to mediate the transcriptional upregulation of these genes in response to xenobiotics and steroids. Other nuclear receptors and transcriptional factors including HNF4α, HNF3γ, C/EBPα and more recently RORs, have been reported to regulate the constitutive expression of CYP2C genes in liver. The maximum transcriptional induction of CYP2C genes appears to be achieved through a coordinative cross-talk between drug responsive nuclear receptors, hepatic factors, and coactivators. The transcriptional regulatory mechanisms of the expression of CYP2C genes in extrahepatic tissues has received less study, but these may be altered by perturbations from pathological conditions such as ischemia as well as some of the receptors mentioned above. PMID:19702536

  15. Moderately lower temperatures greatly extend the lifespan of Brachionus manjavacas (Rotifera): Thermodynamics or gene regulation?

    PubMed

    Johnston, Rachel K; Snell, Terry W

    2016-06-01

    Environmental temperature greatly affects lifespan in a wide variety of animals, but the exact mechanisms underlying this effect are still largely unknown. A moderate temperature decrease from 22°C to 16°C extends the lifespan of the monogonont rotifer Brachionus manjavacas by up to 163%. Thermodynamic effects on metabolism contribute to this increase in longevity, but are not the only cause. When rotifers are exposed to 16°C for four days and then transfered to 22°C, they survive until day 13 at nearly identical rates as rotifers maintained at 16°C continuously. This persistence of the higher survival for nine days after transfer to 22°C suggests that low temperature exposure alters the expression of genes that affect the rate of aging. The relative persistence of the gene regulation effect suggests that it may play an even larger role in slowing aging than the thermodynamic effects. The life extending effects of these short-term low temperature treatments are largest when the exposure happens early in the life cycle, demonstrating the importance of early development. There is no advantage to lowering the temperature below 16°C to 11° or 5°C. Rotifers exposed to 16°C also displayed increased resistance to heat, starvation, oxidative and osmotic stress. Reproductive rates at 16°C were lower than those at 22°C, but because they reproduce longer, there is no significant change in the lifetime fecundity of females. To investigate which genes contribute to these effects, the expression of specific temperature sensing genes was knocked down using RNAi. Of 12 genes tested, RNAi knockdown of four eliminated the survival enhancing effects of the four-day cold treatment: TRP7, forkhead box C, Y-box factor, and ribosomal protein S6. This demonstrates that active gene regulation is an important factor in temperature mediated life extension, and that these particular genes play an integral role in these pathways. As a thermoresponsive sensor, TRP7 may be

  16. Epigenetic Gene Regulation in Stem Cells and Correlation to Cancer

    PubMed Central

    Mathews, Lesley A.; Crea, Francesco; Farrar, W. L.

    2009-01-01

    Through the classic study of genetics, much has been learned about the regulation and progression of human disease. Specifically, cancer has been defined as a disease driven by genetic alterations, including mutations in tumor-suppressor genes and oncogenes, as well as chromosomal abnormalities. However, the study of normal human development has identified that in addition to classical genetics, regulation of gene expression is also modified by ‘epigenetic’ alterations including chromatin remodeling and histone variants, DNA methylation, the regulation of polycomb group proteins and the epigenetic function of non-coding RNA. These changes are modifications inherited both during meiosis and mitosis, yet they do not result in alterations of the actual DNA sequence. A number of biological questions are directly influenced by epigenetics, such as how does a cell know when to divide, differentiate or remain quiescent, and more importantly, what happens when these pathways become altered? Do these alterations lead to the development and/or progression of cancer? This review will focus on summarizing the limited current literature involving epigenetic alterations in the context of human cancer stems cells (CSCs). The extent to which epigenetic changes define cell fate, identity, and phenotype are still under intense investigation, and many questions remain largely unanswered. Before discussing epigenetic gene silencing in CSCs, the different classifications of stem cells and their properties will be introduced. This will be followed by an introduction to the different epigenetic mechanisms Finally, there will be a discussion of the current knowledge of epigenetic modifications in stem cells, specifically what is known from rodent systems and established cancer cell lines, and how they are leading us to understand human stem cells. PMID:19443100

  17. Regulation of mammalian gene expression by exogenous microRNAs.