Science.gov

Sample records for affect gene transcription

  1. Land use type significantly affects microbial gene transcription in soil.

    PubMed

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

  2. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-01-01

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  3. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.

    PubMed

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-02-15

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  4. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway.

  5. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    SciTech Connect

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-04-23

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic {beta}-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  6. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs.

  7. Co-stimulatory CD28 and transcription factor NFKB1 gene variants affect idiopathic recurrent miscarriages.

    PubMed

    Misra, Maneesh Kumar; Singh, Bharti; Mishra, Aditi; Agrawal, Suraksha

    2016-12-01

    Co-stimulatory CD28 and transcription factor NFKB1 genes are considered as a crucial player in the determination of inflammatory responses; genetic variability in these may modulate the risk for idiopathic recurrent miscarriages (IRM). We investigated the association of functional variants of CD28 (rs3116496 T/C) and NFKB1 (rs28362491 ins/del and rs696 A/G) with IRM cases. We recruited 200 IRM women with a history of at least three consecutive pregnancy losses before 20th week of pregnancy and 300 fertile control women. Determination of CD28 (rs3116496 T/C) and NFKB1 (rs28362491 ins/del and rs696 A/G) gene variants were based on the polymerase chain reaction pursued by restriction fragment length polymorphism analysis and validated with Sanger sequencing. Single marker analysis and multifactor dimensionality reduction (MDR) model used to predict the IRM risk. We observed nearly three- to twofold increased risk in single marker analysis for minor homozygous genotypes of rs3116496 T/C, rs28362491 ins/del and rs696 A/G tag-SNPs in IRM cases, suggesting the risk association. In MDR analysis, we observed 10.5-fold augmented risk among IRM women in three-SNP model (rs3116496 T/C, rs28362491 ins/del and rs696 A/G). The eQTL mapping analyses was performed to strengthen the results of our study. The eQTL mapping analysis revealed that the variations in CD28 and NFKB1 gene content might affect the abundance of transcripts of CD28 and Family with sequence similarity 177 member A1 (FAM177A1) genes, respectively. These results suggest that CD28 and NFKB1 gene variants may be associated with increased risks to IRM.

  8. Transcription factor co-localization patterns affect human cell type-specific gene expression

    PubMed Central

    2012-01-01

    Background Cellular development requires the precise control of gene expression states. Transcription factors are involved in this regulatory process through their combinatorial binding with DNA. Information about transcription factor binding sites can help determine which combinations of factors work together to regulate a gene, but it is unclear how far the binding data from one cell type can inform about regulation in other cell types. Results By integrating data on co-localized transcription factor binding sites in the K562 cell line with expression data across 38 distinct hematopoietic cell types, we developed regression models to describe the relationship between the expression of target genes and the transcription factors that co-localize nearby. With K562 binding sites identifying the predictors, the proportion of expression explained by the models is statistically significant only for monocytic cells (p-value< 0.001), which are closely related to K562. That is, cell type specific binding patterns are crucial for choosing the correct transcription factors for the model. Comparison of predictors obtained from binding sites in the GM12878 cell line with those from K562 shows that the amount of difference between binding patterns is directly related to the quality of the prediction. By identifying individual genes whose expression is predicted accurately by the binding sites, we are able to link transcription factors FOS, TAF1 and YY1 to a sparsely studied gene LRIG2. We also find that the activity of a transcription factor may be different depending on the cell type and the identity of other co-localized factors. Conclusion Our approach shows that gene expression can be explained by a modest number of co-localized transcription factors, however, information on cell-type specific binding is crucial for understanding combinatorial gene regulation. PMID:22721266

  9. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    PubMed

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer.

  10. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene

    PubMed Central

    Zhou, Jiawei

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  11. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes

    PubMed Central

    Leśniewska, Ewa

    2017-01-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency. PMID:28228471

  12. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes.

    PubMed

    Leśniewska, Ewa; Boguta, Magdalena

    2017-02-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency.

  13. Genome duplication and gene loss affect the evolution of heat shock transcription factor genes in legumes.

    PubMed

    Lin, Yongxiang; Cheng, Ying; Jin, Jing; Jin, Xiaolei; Jiang, Haiyang; Yan, Hanwei; Cheng, Beijiu

    2014-01-01

    Whole-genome duplication events (polyploidy events) and gene loss events have played important roles in the evolution of legumes. Here we show that the vast majority of Hsf gene duplications resulted from whole genome duplication events rather than tandem duplication, and significant differences in gene retention exist between species. By searching for intraspecies gene colinearity (microsynteny) and dating the age distributions of duplicated genes, we found that genome duplications accounted for 42 of 46 Hsf-containing segments in Glycine max, while paired segments were rarely identified in Lotus japonicas, Medicago truncatula and Cajanus cajan. However, by comparing interspecies microsynteny, we determined that the great majority of Hsf-containing segments in Lotus japonicas, Medicago truncatula and Cajanus cajan show extensive conservation with the duplicated regions of Glycine max. These segments formed 17 groups of orthologous segments. These results suggest that these regions shared ancient genome duplication with Hsf genes in Glycine max, but more than half of the copies of these genes were lost. On the other hand, the Glycine max Hsf gene family retained approximately 75% and 84% of duplicated genes produced from the ancient genome duplication and recent Glycine-specific genome duplication, respectively. Continuous purifying selection has played a key role in the maintenance of Hsf genes in Glycine max. Expression analysis of the Hsf genes in Lotus japonicus revealed their putative involvement in multiple tissue-/developmental stages and responses to various abiotic stimuli. This study traces the evolution of Hsf genes in legume species and demonstrates that the rates of gene gain and loss are far from equilibrium in different species.

  14. Low-temperature affected LC-PUFA conversion and associated gene transcript level in Nannochloropsis oculata CS-179

    NASA Astrophysics Data System (ADS)

    Ma, Xiaolei; Zhang, Lin; Zhu, Baohua; Pan, Kehou; Li, Si; Yang, Guanpin

    2011-09-01

    Nannochloropsis oculata CS-179, a marine eukaryotic unicellular microalga, is rich in long-chain polyunsaturated fatty acids (LC-PUFAs). Culture temperature affected cell growth and the composition of LC-PUFAs. At an initial cell density of 1.5 × 106 cell mL-1, the highest growth was observed at 25°C and the cell density reached 3 × 107 cell mL-1 at the beginning of logarithmic phase. The content of LC-PUFAs varied with culture temperature. The highest content of LC-PUFAs (43.96%) and EPA (36.6%) was gained at 20°C. Real-time PCR showed that the abundance of Δ6-desaturase gene transcripts was significantly different among 5 culture temperatures and the highest transcript level (15°C) of Nanoc-D6D took off at cycle 21.45. The gene transcript of C20-elongase gene was higher at lower temperatures (10, 15, and 20°C), and the highest transcript level (20°C) of Nanoc-E took off at cycle 21.18. The highest conversion rate (39.3%) of Δ6-desaturase was also gained at 20°C. But the conversion rate of Nanoc-E was not detected. The higher content of LC-PUFAs was a result of higher gene transcript level and higher enzyme activity. Compared with C20-elongase gene, Δ6-desaturase gene transcript and enzyme activity varied significantly with temperature. It will be useful to study the mechanism of how the content of LC-PUFAs is affected by temperature.

  15. Power training and postmenopausal hormone therapy affect transcriptional control of specific co-regulated gene clusters in skeletal muscle

    PubMed Central

    Fey, Vidal; Törmäkangas, Timo; Ronkainen, Paula H. A.; Taaffe, Dennis R.; Takala, Timo; Koskinen, Satu; Cheng, Sulin; Puolakka, Jukka; Kujala, Urho M.; Suominen, Harri; Sipilä, Sarianna; Kovanen, Vuokko

    2010-01-01

    At the moment, there is no clear molecular explanation for the steeper decline in muscle performance after menopause or the mechanisms of counteractive treatments. The goal of this genome-wide study was to identify the genes and gene clusters through which power training (PT) comprising jumping activities or estrogen containing hormone replacement therapy (HRT) may affect skeletal muscle properties after menopause. We used musculus vastus lateralis samples from early stage postmenopausal (50–57 years old) women participating in a yearlong randomized double-blind placebo-controlled trial with PT and HRT interventions. Using microarray platform with over 24,000 probes, we identified 665 differentially expressed genes. The hierarchical clustering method was used to assort the genes. Additionally, enrichment analysis of gene ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was carried out to clarify whether assorted gene clusters are enriched with particular functional categories. The analysis revealed transcriptional regulation of 49 GO/KEGG categories. PT upregulated transcription in “response to contraction”—category revealing novel candidate genes for contraction-related regulation of muscle function while HRT upregulated gene expression related to functionality of mitochondria. Moreover, several functional categories tightly related to muscle energy metabolism, development, and function were affected regardless of the treatment. Our results emphasize that during the early stages of the postmenopause, muscle properties are under transcriptional modulation, which both PT and HRT partially counteract leading to preservation of muscle power and potentially reducing the risk for aging-related muscle weakness. More specifically, PT and HRT may function through improving energy metabolism, response to contraction as well as by preserving functionality of the mitochondria. Electronic supplementary material The online version of this

  16. Sphingolipids regulate telomere clustering by affecting the transcription of genes involved in telomere homeostasis.

    PubMed

    Ikeda, Atsuko; Muneoka, Tetsuya; Murakami, Suguru; Hirota, Ayaka; Yabuki, Yukari; Karashima, Takefumi; Nakazono, Kota; Tsuruno, Masahiro; Pichler, Harald; Shirahige, Katsuhiko; Kodama, Yukiko; Shimamoto, Toshi; Mizuta, Keiko; Funato, Kouichi

    2015-07-15

    In eukaryotic organisms, including mammals, nematodes and yeasts, the ends of chromosomes, telomeres are clustered at the nuclear periphery. Telomere clustering is assumed to be functionally important because proper organization of chromosomes is necessary for proper genome function and stability. However, the mechanisms and physiological roles of telomere clustering remain poorly understood. In this study, we demonstrate a role for sphingolipids in telomere clustering in the budding yeast Saccharomyces cerevisiae. Because abnormal sphingolipid metabolism causes downregulation of expression levels of genes involved in telomere organization, sphingolipids appear to control telomere clustering at the transcriptional level. In addition, the data presented here provide evidence that telomere clustering is required to protect chromosome ends from DNA-damage checkpoint signaling. As sphingolipids are found in all eukaryotes, we speculate that sphingolipid-based regulation of telomere clustering and the protective role of telomere clusters in maintaining genome stability might be conserved in eukaryotes.

  17. Parent-of-origin genetic background affects the transcriptional levels of circadian and neuronal plasticity genes following sleep loss

    PubMed Central

    Tinarelli, Federico; Garcia-Garcia, Celina; Nicassio, Francesco; Tucci, Valter

    2014-01-01

    Sleep homoeostasis refers to a process in which the propensity to sleep increases as wakefulness progresses and decreases as sleep progresses. Sleep is tightly organized around the circadian clock and is regulated by genetic and epigenetic mechanisms. The homoeostatic response of sleep, which is classically triggered by sleep deprivation, is generally measured as a rebound effect of electrophysiological measures, for example delta sleep. However, more recently, gene expression changes following sleep loss have been investigated as biomarkers of sleep homoeostasis. The genetic background of an individual may affect this sleep-dependent gene expression phenotype. In this study, we investigated whether parental genetic background differentially modulates the expression of genes following sleep loss. We tested the progeny of reciprocal crosses of AKR/J and DBA/2J mouse strains and we show a parent-of-origin effect on the expression of circadian, sleep and neuronal plasticity genes following sleep deprivation. Thus, we further explored, by in silico, specific functions or upstream mechanisms of regulation and we observed that several upstream mechanisms involving signalling pathways (i.e. DICER1, PKA), growth factors (CSF3 and BDNF) and transcriptional regulators (EGR2 and ELK4) may be differentially modulated by parental effects. This is the first report showing that a behavioural manipulation (e.g. sleep deprivation) in adult animals triggers specific gene expression responses according to parent-of-origin genomic mechanisms. Our study suggests that the same mechanism may be extended to other behavioural domains and that the investigation of gene expression following experimental manipulations should take seriously into account parent-of-origin effects. PMID:24446504

  18. Parent-of-origin genetic background affects the transcriptional levels of circadian and neuronal plasticity genes following sleep loss.

    PubMed

    Tinarelli, Federico; Garcia-Garcia, Celina; Nicassio, Francesco; Tucci, Valter

    2014-03-05

    Sleep homoeostasis refers to a process in which the propensity to sleep increases as wakefulness progresses and decreases as sleep progresses. Sleep is tightly organized around the circadian clock and is regulated by genetic and epigenetic mechanisms. The homoeostatic response of sleep, which is classically triggered by sleep deprivation, is generally measured as a rebound effect of electrophysiological measures, for example delta sleep. However, more recently, gene expression changes following sleep loss have been investigated as biomarkers of sleep homoeostasis. The genetic background of an individual may affect this sleep-dependent gene expression phenotype. In this study, we investigated whether parental genetic background differentially modulates the expression of genes following sleep loss. We tested the progeny of reciprocal crosses of AKR/J and DBA/2J mouse strains and we show a parent-of-origin effect on the expression of circadian, sleep and neuronal plasticity genes following sleep deprivation. Thus, we further explored, by in silico, specific functions or upstream mechanisms of regulation and we observed that several upstream mechanisms involving signalling pathways (i.e. DICER1, PKA), growth factors (CSF3 and BDNF) and transcriptional regulators (EGR2 and ELK4) may be differentially modulated by parental effects. This is the first report showing that a behavioural manipulation (e.g. sleep deprivation) in adult animals triggers specific gene expression responses according to parent-of-origin genomic mechanisms. Our study suggests that the same mechanism may be extended to other behavioural domains and that the investigation of gene expression following experimental manipulations should take seriously into account parent-of-origin effects.

  19. Post-entrapment genome engineering: first exon size does not affect the expression of fusion transcripts generated by gene entrapment.

    PubMed

    Osipovich, Anna B; Singh, Aparna; Ruley, H Earl

    2005-03-01

    Gene trap mutagenesis in mouse embryonic stem cells has been widely used for genome-wide studies of mammalian gene function. However, while large numbers of genes can be disrupted, individual mutations may suffer from limitations due to the structure and/or placement of targeting vector. To extend the utility of gene trap mutagenesis, replaceable 3' [or poly(A)] gene trap vectors were developed that permit sequences inserted in individual entrapment clones to be engineered by Cre-mediated recombination. 3' traps incorporating different drug resistance genes could be readily exchanged, simply by selecting for the drug-resistance gene of the replacement vector. By substituting different 3' traps, we show that otherwise identical fusion genes containing a large first exon (804 nt) are not expressed at appreciably lower levels than genes expressing small first exons (384 and 151 nt). Thus, size appears to have less effect on the expression and processing of first exons than has been reported for internal exons. Finally, a retroviral poly(A) trap (consisting of a RNA polymerase II promoter, a neomycin-resistance gene, and 5'-splice site) typically produced mutagenized clones in which vector sequences spliced to the 3'-terminal exons of cellular transcription units, suggesting strong selection for fusion transcripts that evade nonsense-mediated decay. The efficient exchange of poly(A) traps should greatly extend the utility of mutant libraries generated by gene entrapment and provides new strategies to study the rules that govern the expression of exons inserted throughout the genome.

  20. Natural mixtures of POPs affected body weight gain and induced transcription of genes involved in weight regulation and insulin signaling.

    PubMed

    Lyche, Jan L; Nourizadeh-Lillabadi, Rasoul; Karlsson, Camilla; Stavik, Benedicte; Berg, Vidar; Skåre, Janneche Utne; Alestrøm, Peter; Ropstad, Erik

    2011-04-01

    Obesity is reaching epidemic proportions worldwide, and is associated with chronic illnesses such as diabetes, cardiovascular disease, hypertension and dyslipidemias (metabolic syndrome). Commonly held causes of obesity are overeating coupled with a sedentary lifestyle. However, it has also been postulated that exposure to endocrine disrupting chemicals (EDCs) may be related to the significant increase in the prevalence of obesity and associated diseases. In the present study, developmental and reproductive effects of lifelong exposure to environmentally relevant concentrations of two natural mixtures of persistent organic pollutants (POPs) were investigated using classical and molecular methods in a controlled zebrafish model. The mixtures used were extracted from burbot (Lota lota) liver originating from freshwater systems in Norway (Lake Mjøsa and Lake Losna). The concentration of POPs in the zebrafish ranged from levels detected in wild fish (Lake Mjøsa and Lake Losna), to concentrations reported in human and wildlife populations. Phenotypic effects observed in both exposure groups included (1) earlier onset of puberty, (2) elevated male/female sex ratio, and (3) increased body weight at 5 months of age. Interestingly, genome-wide transcription profiling identified functional networks of genes, in which key regulators of weight homeostasis (PPARs, glucocoricoids, CEBPs, estradiol), steroid hormone functions (glucocoricoids, estradiol, NCOA3) and insulin signaling (HNF4A, CEBPs, PPARG) occupied central positions. The increased weight and the regulation of genes associated with weight homeostasis and insulin signaling observed in the present study suggest that environmental pollution may affect the endocrine regulation of the metabolism, possibly leading to increased weight gain and obesity.

  1. Post-entrapment genome engineering: First exon size does not affect the expression of fusion transcripts generated by gene entrapment

    PubMed Central

    Osipovich, Anna B.; Singh, Aparna; Ruley, H. Earl

    2005-01-01

    Gene trap mutagenesis in mouse embryonic stem cells has been widely used for genome-wide studies of mammalian gene function. However, while large numbers of genes can be disrupted, individual mutations may suffer from limitations due to the structure and/or placement of targeting vector. To extend the utility of gene trap mutagenesis, replaceable 3′ [or poly(A)] gene trap vectors were developed that permit sequences inserted in individual entrapment clones to be engineered by Cre-mediated recombination. 3′ traps incorporating different drug resistance genes could be readily exchanged, simply by selecting for the drug-resistance gene of the replacement vector. By substituting different 3′ traps, we show that otherwise identical fusion genes containing a large first exon (804 nt) are not expressed at appreciably lower levels than genes expressing small first exons (384 and 151 nt). Thus, size appears to have less effect on the expression and processing of first exons than has been reported for internal exons. Finally, a retroviral poly(A) trap (consisting of a RNA polymerase II promoter, a neomycin-resistance gene, and 5′-splice site) typically produced mutagenized clones in which vector sequences spliced to the 3′-terminal exons of cellular transcription units, suggesting strong selection for fusion transcripts that evade nonsense-mediated decay. The efficient exchange of poly(A) traps should greatly extend the utility of mutant libraries generated by gene entrapment and provides new strategies to study the rules that govern the expression of exons inserted throughout the genome. PMID:15741512

  2. Transcript levels of phytoene desaturase gene in Dunaliella salina Teod. as affected by PbS nanoparticles and light intensity

    PubMed Central

    Zamani, Hajar; Moradshahi, Ali

    2016-01-01

    Phytoene synthase (Psy) and Phytoene desaturase (Pds) are the first two regulatory enzymes in the carotenoids biosynthetic pathway. The genes Psy and Pds are under transcriptional control in many photosynthetic organisms. In the present study, using quantitative real time- PCR (qRT-PCR), the effects of uncoated and gum-Arabic coated PbS nanoparticles (GA-coated PbS NPs) and light intensity on the mRNA levels of Pds were investigated. Relative to mRNA level of Pds at 100 µmol photon m-2 s-1 light intensity (control culture), 2.2-fold increase in transcript levels occurred after 12 h of exposure to higher light intensity, which is significantly (P<0.05) different compared to control. After 48 h of exposure, the mRNA level of Pds was reduced to that in control. This indicates that light intensity regulates Pds at the mRNA level. In the presence of uncoated and GA-coated PbS NPs, the transcript levels of Pds were decreased over time, with uncoated PbS NPs having more inhibitory effects on mRNA levels compared to GA- coated PbS NPs. This shows that PbS NPs have adverse effects on transcription or post transcriptional processing and coating nanoparticles with biopolymers reduces their toxicity to organisms. Being under control, it seems that genetic manipulation of Pds may result in increased biotechnological production of carotenoids by D. salina. PMID:28097172

  3. Source of metabolizable energy affects gene transcription in metabolic pathways in adipose and liver tissue of nonlactating, pregnant dairy cows.

    PubMed

    Crookenden, M A; Mandok, K S; Grala, T M; Phyn, C V C; Kay, J K; Greenwood, S L; Roche, J R

    2015-02-01

    The objective of this experiment was to determine if transcript abundance of genes involved in metabolic pathways in adipose and liver tissue could provide some explanation for the low efficiency with which ME in autumn pasture is used for BW gain. Nonlactating, pregnant (208 ± 19 d of gestation or approximately 75 d precalving) dairy cows (n = 90) were randomly allocated to either a control diet (i.e., offered fresh autumn pasture to maintenance requirements: 0.55 MJ ME/kg of measured metabolic BW [BW0.75] per day) or, in addition to the control diet, 1 of 2 supplement amounts (2.5 and 5.0 kg DM/d) of autumn pasture or 1 of 4 supplementary feeds (i.e., a control and 2 levels of feeding for each of 5 feeds: 11 groups of cows). Along with autumn pasture, evaluated feeds included spring pasture silage, maize silage, maize grain, and palm kernel expeller. Adipose and liver tissues were biopsied in wk 4 of the experiment and transcript abundance of genes involved in metabolic pathways associated with energy metabolism, lipolysis, and lipogenesis was determined. Additional feed, irrespective of type, increased BW gain (P < 0.01) and this effect was reflected in the expression of genes in adipose and liver tissue. However, autumn pasture had lower energy-use efficiency than the other feeds. Genes involved in both lipogenesis (ACACA, THRSP, GPAM, GPD1, and LPL) and lipolysis (PNPLA2) were upregulated (P < 0.05) in adipose tissue in response to increased ME intake/kilogram BW0.75. Hepatic expression of APOA1 decreased and that of APOB increased (P < 0.05) in cows offered maize grain and maize silage (i.e., starch-containing feeds). In comparison, pasture-fed cows demonstrated a degree of uncoupling of the somatotropic axis, with lower hepatic transcript abundance of both GHR1A and IGF-1 compared with cows offered any of the other 4 feeds. Changes to gene transcription indicate a possible molecular mechanism for the poor BW gain evident in ruminants consuming autumn

  4. Phosphorylation of CREB affects its binding to high and low affinity sites: implications for cAMP induced gene transcription.

    PubMed Central

    Nichols, M; Weih, F; Schmid, W; DeVack, C; Kowenz-Leutz, E; Luckow, B; Boshart, M; Schütz, G

    1992-01-01

    Cyclic AMP treatment of hepatoma cells leads to increased protein binding at the cyclic AMP response element (CRE) of the tyrosine aminotransferase (TAT) gene in vivo, as revealed by genomic footprinting, whereas no increase is observed at the CRE of the phosphoenolpyruvate carboxykinase (PEPCK) gene. Several criteria establish that the 43 kDa CREB protein is interacting with both of these sites. Two classes of CRE with different affinity for CREB are described. One class, including the TATCRE, is characterized by asymmetric and weak binding sites (CGTCA), whereas the second class containing symmetrical TGACGTCA sites shows a much higher binding affinity for CREB. Both classes show an increase in binding after phosphorylation of CREB by protein kinase A (PKA). An in vivo phosphorylation-dependent change in binding of CREB increases the occupancy of weak binding sites used for transactivation, such as the TATCRE, while high affinity sites may have constitutive binding of transcriptionally active and inactive CREB dimers, as demonstrated by in vivo footprinting at the PEPCK CRE. Thus, lower basal level and higher relative stimulation of transcription by cyclic AMP through low affinity CREs should result, allowing finely tuned control of gene activation. Images PMID:1354612

  5. The SNF5 protein of Saccharomyces cerevisiae is a glutamine- and proline-rich transcriptional activator that affects expression of a broad spectrum of genes.

    PubMed Central

    Laurent, B C; Treitel, M A; Carlson, M

    1990-01-01

    The Saccharomyces cerevisiae SNF5 gene affects expression of both glucose- and phosphate-regulated genes and appears to function in transcription. We report the nucleotide sequence, which predicts that SNF5 encodes a 102,536-dalton protein. The N-terminal third of the protein is extremely rich in glutamine and proline. Mutants carrying a deletion of the coding sequence were viable but grew slowly, indicating that the SNF5 gene is important but not essential. Evidence that SNF5 affects expression of the cell type-specific genes MF alpha 1 and BAR1 at the RNA level extends the known range of SNF5 function. SNF5 is apparently required for expression of a wide variety of differently regulated genes. A bifunctional SNF5-beta-galactosidase fusion protein was localized in the nucleus by immunofluorescence. No DNA-binding activity was detected for SNF5. A LexA-SNF5 fusion protein, when bound to a lexA operator, functioned as a transcriptional activator. Images PMID:2233708

  6. Erwinia carotovora DsbA mutants: evidence for a periplasmic-stress signal transduction system affecting transcription of genes encoding secreted proteins.

    PubMed

    Vincent-Sealy, L V; Thomas, J D; Commander, P; Salmond, G P

    1999-08-01

    The dsbA genes, which encode major periplasmic disulfide-bond-forming proteins, were isolated from Erwinia carotovora subsp. carotovora (Ecc) and Erwinia carotovora subsp. atroseptica (Eca), and the dsbC gene, encoding another periplasmic disulfide oxidoreductase was isolated from Ecc. All three genes were sequenced and mutants deficient in these genes were created by marker exchange mutagenesis. The Ecc mutants were severely affected in activity and secretion of pectate lyase, probably due to the absence of functional PelC, which is predicted to require disulfide bond formation to achieve its correct conformation prior to secretion across the outer membrane. Similarly, endopolygalacturonase, also predicted to possess disulfide bonds, displayed reduced activity. The major Ecc cellulase (CelV) does not contain cysteine residues and was still secreted in dsbA-deficient strains. This observation demonstrated unequivocally that the localization and activity of the individual components of the Out apparatus are independent of disulfide bond formation. Surprisingly, cellulase activity was shown to be increased approximately two- to threefold in the DsbA mutant. This phenomenon resulted from transcriptional up-regulation of celV gene expression. In contrast, transcription of both pelC and peh were down-regulated in dsbA-deficient strains when compared to the wild-type. Protease (Prt) activity and secretion were unaffected in the Ecc dsbA mutant. Prt activity was considerably reduced in the double dsbA dsbC mutant. However Prt was secreted normally in this strain. The Eca dsbA mutant was found to be non-motile, suggesting that disulfide bond formation is essential for motility in this strain. All of the dsb mutants showed reduced tissue maceration in planta. These results suggest that a feedback regulation system operates in Ecc. In this system, defects in periplasmic disulfide bond formation act as a signal which is relayed to the transcription machinery regulating gene

  7. SOX2 gene regulates the transcriptional network of oncogenes and affects tumorigenesis of human lung cancer cells.

    PubMed

    Chen, Si; Xu, Yingxi; Chen, Yanan; Li, Xuefei; Mou, Wenjun; Wang, Lina; Liu, Yanhua; Reisfeld, Ralph A; Xiang, Rong; Lv, Dan; Li, Na

    2012-01-01

    Recent studies demonstrated that cancer stem cells (CSCs) have higher tumorigenesis properties than those of differentiated cancer cells and that transcriptional factor-SOX2 plays a vital role in maintaining the unique properties of CSCs; however, the function and underlying mechanism of SOX2 in carcinogenesis of lung cancer are still elusive. This study applied immunohistochemistry to analyze the expression of SOX2 in human lung tissues of normal individuals as well as patients with adenocarcinoma, squamous cell carcinoma, and large cell and small cell carcinoma and demonstrated specific overexpression of SOX2 in all types of lung cancer tissues. This finding supports the notion that SOX2 contributes to the tumorigenesis of lung cancer cells and can be used as a diagnostic probe. In addition, obviously higher expression of oncogenes c-MYC, WNT1, WNT2, and NOTCH1 was detected in side population (SP) cells than in non-side population (NSP) cells of human lung adenocarcinoma cell line-A549, revealing a possible mechanism for the tenacious tumorigenic potential of CSCs. To further elucidate the function of SOX2 in tumorigenesis of cancer cells, A549 cells were established with expression of luciferase and doxycycline-inducible shRNA targeting SOX2. We found silencing of SOX2 gene reduces the tumorigenic property of A549 cells with attenuated expression of c-MYC, WNT1, WNT2, and NOTCH1 in xenografted NOD/SCID mice. By using the RNA-Seq method, an additional 246 target cancer genes of SOX2 were revealed. These results present evidence that SOX2 may regulate the expression of oncogenes in CSCs to promote the development of human lung cancer.

  8. Gene dosage of the transcription factor Fingerin (bHLHA9) affects digit development and links syndactyly to ectrodactyly.

    PubMed

    Schatz, Omri; Langer, Erez; Ben-Arie, Nissim

    2014-10-15

    Distal limb deformities are congenital malformations with phenotypic variability, genetic heterogeneity and complex inheritance. Among these, split-hand/foot malformation is an ectrodactyly with missing central fingers, yielding a lobster claw-like hand, which when combined with long-bone deficiency is defined as split-hand/foot malformation and long-bone deficiency (SHFLD) that is genetically heterogeneous. Copy number variation (CNV) consisting of 17p13.3 duplication was identified in unrelated pedigrees, underlying SHFLD3 (OMIM 612576). Although the transcription factor Fingerin (bHLHA9) is the only complete gene in the critical region, its biological role is not yet known and there are no data supporting its involvement in mammalian limb development. We have generated knockout mice in which only the entire coding region of Fingerin was deleted, and indeed found that most null mice display some limb defects. These include various levels of simple asymmetrical syndactyly, characterized by webbed fingers, generated by incomplete separation of soft, but not skeletal, tissues between forelimb digits 2 and 3. As expected, hand pads of Fingerin null embryos exhibited reduced apoptosis between digital rays 2 and 3. This defect was shown to cause syndactyly when the same limbs were grown ex vivo following the apoptosis assay. Extrapolating from mouse data, we suggest that Fingerin loss-of-function in humans may underlie MSSD syndactyly (OMIM 609432), which was mapped to the same locus. Taken together, Fingerin gene dosage links two different congenital limb malformations, syndactyly and ectrodactyly, which were previously postulated to share a common etiology. These results add limb disorders to the growing list of diseases resulting from CNV.

  9. Expression of the MYB transcription factor gene BplMYB46 affects abiotic stress tolerance and secondary cell wall deposition in Betula platyphylla.

    PubMed

    Guo, Huiyan; Wang, Yucheng; Wang, Liuqiang; Hu, Ping; Wang, Yanmin; Jia, Yuanyuan; Zhang, Chunrui; Zhang, Yu; Zhang, Yiming; Wang, Chao; Yang, Chuanping

    2017-01-01

    Plant MYB transcription factors control diverse biological processes, such as differentiation, development and abiotic stress responses. In this study, we characterized BplMYB46, an MYB gene from Betula platyphylla (birch) that is involved in both abiotic stress tolerance and secondary wall biosynthesis. BplMYB46 can act as a transcriptional activator in yeast and tobacco. We generated transgenic birch plants with overexpressing or silencing of BplMYB46 and subjected them to gain- or loss-of-function analysis. The results suggest that BplMYB46 improves salt and osmotic tolerance by affecting the expression of genes including SOD, POD and P5CS to increase both reactive oxygen species scavenging and proline levels. In addition, BplMYB46 appears to be involved in controlling stomatal aperture to reduce water loss. Overexpression of BplMYB46 increases lignin deposition, secondary cell wall thickness and the expression of genes in secondary cell wall formation. Further analysis indicated that BplMYB46 binds to MYBCORE and AC-box motifs and may directly activate the expression of genes involved in abiotic stress responses and secondary cell wall biosynthesis whose promoters contain these motifs. The transgenic BplMYB46-overexpressing birch plants, which have improved salt and osmotic stress tolerance, higher lignin and cellulose content and lower hemicellulose content than the control, have potential applications in the forestry industry.

  10. Overexpression of a cotton gene that encodes a putative transcription factor of AP2/EREBP family in Arabidopsis affects growth and development of transgenic plants.

    PubMed

    Zhou, Ying; Xia, Hui; Li, Xiao-Jie; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2013-01-01

    In the study, a gene encoding a putative ethylene response factor of AP2/EREBP family was isolated from cotton (Gossypium hirsutum) and designated as GhERF12. Sequence alignment showed that GhERF12 protein contains a central AP2/ERF domain (58 amino acids) with two functional conserved amino acid residues (ala14 and asp19). Transactivation assay indicated that GhERF12 displayed strong transcription activation activity in yeast cells, suggesting that this protein may be a transcriptional activator in cotton. Quantitative RT-PCR analysis showed that GhERF12 expression in cotton was induced by ACC and IAA. Overexpression of GhERF12 in Arabidopsis affected seedling growth and development. The GhERF12 transgenic plants grew slowly, and displayed a dwarf phenotype. The mean bolting time of the transgenic plants was delayed for about 10 days, compared with that of wild type. Further study revealed that some ethylene-related and auxin-related genes were dramatically up-regulated in the transgenic plants, compared with those of wild type. Collectively, we speculated that GhERF12, as a transcription factor, may be involved in regulation of plant growth and development by activating the constitutive ethylene response likely related to auxin biosynthesis and/or signaling.

  11. Depletion of Arabidopsis SC35 and SC35-like serine/arginine-rich proteins affects the transcription and splicing of a subset of genes

    PubMed Central

    Xia, Xi; Sun, Zhenfei

    2017-01-01

    Serine/arginine-rich (SR) proteins are important splicing factors which play significant roles in spliceosome assembly and splicing regulation. However, little is known regarding their biological functions in plants. Here, we analyzed the phenotypes of mutants upon depleting different subfamilies of Arabidopsis SR proteins. We found that loss of the functions of SC35 and SC35-like (SCL) proteins cause pleiotropic changes in plant morphology and development, including serrated leaves, late flowering, shorter roots and abnormal silique phyllotaxy. Using RNA-seq, we found that SC35 and SCL proteins play roles in the pre-mRNA splicing. Motif analysis revealed that SC35 and SCL proteins preferentially bind to a specific RNA sequence containing the AGAAGA motif. In addition, the transcriptions of a subset of genes are affected by the deletion of SC35 and SCL proteins which interact with NRPB4, a specific subunit of RNA polymerase II. The splicing of FLOWERING LOCUS C (FLC) intron1 and transcription of FLC were significantly regulated by SC35 and SCL proteins to control Arabidopsis flowering. Therefore, our findings provide mechanistic insight into the functions of plant SC35 and SCL proteins in the regulation of splicing and transcription in a direct or indirect manner to maintain the proper expression of genes and development. PMID:28273088

  12. The Shwachman-Bodian-Diamond syndrome associated protein interacts with HsNip7 and its down-regulation affects gene expression at the transcriptional and translational levels

    SciTech Connect

    Hesling, Cedric; Oliveira, Carla C.; Castilho, Beatriz A.; Zanchin, Nilson I.T.

    2007-12-10

    The Shwachman-Bodian-Diamond syndrome (SDS) is an autosomal disorder with pleiotropic phenotypes including pancreatic, skeletal and bone marrow deficiencies and predisposition to hematological dysfunctions. SDS has been associated to mutations in the SBDS gene, encoding a highly conserved protein that was shown to function in ribosome biogenesis in yeast. In this work, we show that SBDS is found in complexes containing the human Nip7 ortholog. Analysis of pre-rRNA processing in a stable SBDS knock-down HEK293-derivative cell line revealed accumulation of a small RNA which is a further indication of SBDS involvement in rRNA biosynthesis. Global transcription and polysome-bound mRNA profiling revealed that SBDS knock-down affects expression of critical genes involved in brain development and function, bone morphogenesis, blood cell proliferation and differentiation, and cell adhesion. Expression of a group of growth and signal transduction factors and of DNA damage response genes is also affected. In SBDS knock-down cells, 34 mRNAs showed decreased and 55 mRNAs showed increased association to polysomes, among which is a group encoding proteins involved in alternative splicing and RNA modification. These results indicate that SBDS is required for accurate expression of genes important for proper brain, skeletal, and blood cell development.

  13. Transcriptional gene silencing in humans

    PubMed Central

    Weinberg, Marc S.; Morris, Kevin V.

    2016-01-01

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  14. The gene transcription factor cyclic AMP-responsive element binding protein: role in positive and negative affective states of alcohol addiction.

    PubMed

    Pandey, Subhash C

    2004-10-01

    The gene transcription factor cyclic adenosine monophosphate (cAMP)-responsive element binding (CREB) protein is a nuclear protein that regulates synaptic plasticity via modulating the expression of several (cAMP)-inducible genes. Alcohol addiction is a complex psychiatric disorder and is characterized by a compulsive and uncontrolled pattern of alcohol drinking by an individual in spite of the adverse consequences of its abuse. Ethanol produces both euphoric (reward and reinforcing) and dysphoric (negative withdrawal reactions) effects and these are most likely involved in the initiation and maintenance of alcohol use and abuse. Several neurotransmitter systems in the brain might be involved in the effects of alcohol but the exact molecular mechanisms of both the positive and negative affective states of alcohol abuse are still unclear. Recent research in molecular neurosciences using animal models have identified the role of extended amygdaloid (shell structures of nucleus accumbens [NAc] and central and medial amygdaloid nuclei) CREB signaling in positive and negative affective states of alcohol drinking behaviors. This review article highlights the current findings on the role of nucleus accumbal and amygdaloid CREB signaling in behavioral consequences of alcohol use and abuse.

  15. Transposon insertions in the promoter of the Zea mays a1 gene differentially affect transcription by the Myb factors P and C1.

    PubMed Central

    Pooma, Wilailak; Gersos, Christos; Grotewold, Erich

    2002-01-01

    The understanding of control of gene regulation in higher eukaryotes relies heavily on results derived from non-in vivo studies, but rarely can the significance of these approximations be established in vivo. Here, we investigated the effect of Mutator and Spm insertions on the expression of the flavonoid biosynthetic gene a1, independently regulated by the transcription factors C1 and P. The a1-mum2 and a1-m2 alleles carry Mu1 and Spm insertions, respectively, in a cis-element (ARE) of unknown function located between the P- and C1-binding sites. We show that the insertions of Mu1 and Spm similarly influence the expression of a1 controlled by C1 or P. The P-controlled a1 expression in a1-m2 is Spm dependent, and the mutant phenotype of a1-mum2 is suppressed in the pericarp in the absence of the autonomous MuDR element. Footprints within the ARE affect the regulation of a1 by C1 and P differently, providing evidence that these factors control a1 expression using distinct cis-acting regulatory elements. Together, our findings contribute significantly to one of the best-described plant regulatory systems, while stressing the need to complement with in vivo experiments current approaches used for the study of control of gene expression. PMID:12072474

  16. Nascent transcription affected by RNA polymerase IV in Zea mays.

    PubMed

    Erhard, Karl F; Talbot, Joy-El R B; Deans, Natalie C; McClish, Allison E; Hollick, Jay B

    2015-04-01

    All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3'-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance.

  17. Expression pattern of cellulolytic and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1 are affected by carbon source in Trichoderma reesei.

    PubMed

    Castro, Lilian dos Santos; Antoniêto, Amanda Cristina Campos; Pedersoli, Wellington Ramos; Silva-Rocha, Rafael; Persinoti, Gabriela F; Silva, Roberto Nascimento

    2014-03-01

    Trichoderma reesei is the most important fungus for the industrial production of enzymes to biomass deconstruction. Most of the genes encoding cellulases and hemicellulases are regulated by the transcription factors CRE1 and XYR1. In this work, the regulation of 22 genes of cellulases and xylanases by these transcription factors was investigated under three different carbon sources. Analysis of gene expression and enzymatic profiles of CMCase, β-glucosidase, and xylanases showed different regulation that was depended of the carbon source in both Δxyr1 and Δcre1 mutants. In the presence of glucose, the majority of genes evaluated (82%) showed increased expression levels in the Δcre1 mutant compared to the parental QM9414 strain. In the Δxyr1 mutant, it was observed that expression of cellulase and xylanase genes was reduced compared to the parental QM9414 strain, when cultured in the presence of cellulose or sophorose. Interesting, in the presence of glucose, approximately 60% of the analyzed genes had increased expression in the Δxyr1 mutant compared to parental strain. Furthermore, no correlation between gene expression and the number of putative binding sites of XYR1 and CRE1 to promoter region of cellulolytic and xylanolytic studied genes was observed. Therefore, these results demonstrated that the regulation of cellulase and xylanase by the transcription factors CRE1 and XYR1 is influenced by different carbon sources.

  18. Maternal dietary protein affects transcriptional regulation of myostatin gene distinctively at weaning and finishing stages in skeletal muscle of Meishan pigs.

    PubMed

    Liu, Xiujuan; Wang, Jinquan; Li, Runsheng; Yang, Xiaojing; Sun, Qinwei; Albrecht, Elke; Zhao, Ruqian

    2011-07-01

    Myostatin (MSTN) is suggested to mediate the effect of maternal nutrition on offspring phenotype, yet the mechanisms underlying such adaptive gene regulation is elusive. In this study, we determined the effects of maternal dietary protein on transcriptional regulation of MSTN in skeletal muscle of pig offspring. Fourteen Meishan sows were fed either low-protein (LP) or standard-protein (SP) diets throughout gestation and lactation. MSTN expression in the longissimus dorsi muscle was determined both at weaning and finishing stages. Myostatin mRNA abundance was downregulated at weaning, but upregulated at finishing in LP pigs, indicating stage-specific transcriptional regulation. At weaning, CCAAT/enhancer-binding protein beta (C/EBPβ) in muscle nuclear lysate was decreased in LP piglets, associated with diminished binding of C/EBPβ to all the 3 putative binding sites in MSTN promoter. None of the four histone modification marks investigated showed differences between SP and LP piglets. Among 12 microRNAs predicted to target MSTN, none was differently expressed. At finishing stage, C/EBPβ content remained unchanged, but the binding of C/EBPβ to two of the 3 putative binding sites increased in LP pigs. Histone H3 acetylation and histone H3 lysine 27 trimethylation on MSTN promoter were increased, while histone H3 lysine 9 monomethylation was decreased in LP pigs. Moreover, expression of ssc-miR-136 and ssc-miR-500 was significantly reduced. These results indicate that maternal dietary protein affects MSTN expression through distinct regulatory mechanisms at different stages. The immediate effect at weaning is mediated by C/EBPβ binding without epigenetic modifications, whereas the long-term effect at finishing stage involves both C/EBPβ binding and epigenetic regulations, including histone modification and microRNA expression.

  19. Short-term treatment of adult male zebrafish (Danio Rerio) with 17α-ethinyl estradiol affects the transcription of genes involved in development and male sex differentiation.

    PubMed

    Reyhanian Caspillo, Nasim; Volkova, Kristina; Hallgren, Stefan; Olsson, Per-Erik; Porsch-Hällström, Inger

    2014-08-01

    The synthetic estrogen 17α-ethinyl estradiol (EE2) disturbs reproduction and causes gonadal malformation in fish. Effects on the transcription of genes involved in gonad development and function that could serve as sensitive biomarkers of reproductive effects in the field is, however, not well known. We have studied mRNA expression in testes and liver of adult zebrafish (Danio rerio) males treated with 0, 5 or 25 ng/L EE2for 14 days. qPCR analysis showed that the mRNA expression of four genes linked to zebrafish male sex determination and differentiation, Anti-Mullerian Hormone, Double sex and mab-related protein, Sry-related HMG box-9a and Nuclear receptor subfamily 5 group number 1b were significantly decreased by 25 ng/L, but not 5 ng/L EE2 compared with the levels in untreated fish. The decreased transcription was correlated with a previously shown spawning failure in these males (Reyhanian et al., 2011. Aquat Toxicol 105, 41-48), suggesting that decreased mRNA expression of genes regulating male sexual function could be involved in the functional sterility. The mRNA level of Cytochrome P-45019a, involved in female reproductive development, was unaffected by hormone treatment. The transcription of the female-specific Vitellogenin was significantly induced in testes. While testicular Androgen Receptor and the Estrogen Receptor-alpha mRNA levels were unchanged, Estrogen receptor-beta was significantly decreased by 25 ng/L EE2. Hepatic Estrogen Receptor-alpha mRNA was significantly increased by both exposure concentrations, while Estrogen Receptor-beta transcription was unaltered. The decreased transcription of male-predominant genes supports a demasculinization of testes by EE2 and might reflect reproductive disturbances in the environment.

  20. Thyroid active agents T3 and PTU differentially affect immune gene transcripts in the head kidney of rainbow trout (Oncorynchus mykiss).

    PubMed

    Quesada-García, Alba; Encinas, Paloma; Valdehita, Ana; Baumann, Lisa; Segner, Helmut; Coll, Julio M; Navas, José M

    2016-05-01

    In mammals, numerous reports describe an immunomodulating effect of thyroid-active compounds. In contrast, only few reports have been published on this subject in fish. We previously demonstrated that immune cells of rainbow trout (Oncorhynchus mykiss) possess thyroid hormone receptors (THRs) and that exposure of trout to the thyroid hormone 3,3',5-triiodo-l-thyronine (T3) or the antithyroid drug propylthiouracil (PTU) alters immune cell transcript levels of THR and several immune genes. The present study aims to further characterize the immunomodulating action of thyroid-active compounds in trout immune cells. We report here the use of a custom-designed 60-mer oligo immune-targeted microarray for rainbow trout to analyze the gene expression profiles induced in the head kidney by T3 and PTU. Morphometric analyses of the thyroid showed that PTU exposure increased the size of the epithelial cells, whereas T3 induced no significant effects. Both T3 and PTU had diverse and partly contrasting effects on immune transcript profiles. The strongest differential effects of T3 and PTU on gene expressions were those targeting the Mitogen Associated Protein Kinase (MAPK), NFkB, Natural Killer (NK) and Toll-Like Receptor (TLR) pathways, a number of multipath genes (MPG) such as those encoding pleiotropic transcription factors (atf1, junb, myc), as well as important pro-inflammatory genes (tnfa, tnf6, il1b) and interferon-related genes (ifng, irf10). With these results we show for the first time in a fish species that the in vivo thyroidal status modulates a diversity of immune genes and pathways. This knowledge provides the basis to investigate both mechanisms and consequences of thyroid hormone- and thyroid disruptor-mediated immunomodulation for the immunocompetence of fish.

  1. Transfection of human prostate cancer CA-HPV-10 cells with cytosolic sulfotransferase SULT1E1 affects estrogen signaling and gene transcription.

    PubMed

    Kapoor, Ruchita; Sheng, Jonathan J

    2008-02-01

    Human cytosolic sulfotransferase SULT1E1 catalyzes the sulfation of estrogens and estrogenic drugs in human reproductive tissues. Logically, this estrogen-preferring sulfotransferase isoform could play a regulatory role in estrogen signaling activities in human reproductive cells, including the prostate cells. This hypothesis was tested using DNA microarray and real-time reverse transcription-polymerase chain reaction methods in the present work. Potential changes in the transcriptional expression of selected signal transduction-related genes in human prostate cancer CA-HPV-10 cell line after SULT1E1 transfection were examined by DNA microarray methods. Notable changes were observed in the mRNA expression levels of TFRC, a cell membrane transferrin receptor gene, and TMEPAI, a gene encoding a steroid-dependent mRNA product. Expression of TFRC was down-regulated, whereas expression of TMEPAI was up-regulated by SULT1E1 transfection in CA-HPV-10 cells. Data from the current studies also showed that the estrogen-induced estrogen response element activation in CA-HPV-10 cells was repressed after the cells were transfected with SULT1E1. These results indicate that SULT1E1 may function as a transcriptional mediator in human prostate cancer CA-HPV-10 cells.

  2. Denitrification gene pools, transcription and kinetics of NO, N2O and N2 production as affected by soil pH.

    PubMed

    Liu, Binbin; Mørkved, Pål Tore; Frostegård, Asa; Bakken, Lars Reier

    2010-06-01

    The N(2)O : N(2) product ratio of denitrification is negatively correlated with soil pH, but the mechanisms involved are not clear. We compared soils from field experiments where the pH had been maintained at different levels (pH 4.0-8.0) by liming (> or = 20 years), and quantified functional gene pools (nirS, nirK and nosZ), their transcription and gas kinetics (NO, N(2)O and N(2)) of denitrification as induced by anoxic incubation with and without a carbon substrate (glutamate). Denitrification in unamended soil appeared to be based largely on the activation of a pre-existing denitrification proteome, because constant rates of N(2) and N(2)O production were observed, and the transcription of functional genes was below the detection level. In contrast, glutamate-amended soils showed sharp peaks in the transcripts of nirS and nosZ, increasing the rates of denitrification and pH-dependent transient accumulation of N(2)O. The results indicate that the high N(2)O : N(2) product ratio at low pH is a post-transcriptional phenomenon, because the transcription rate of nosZ relative to that of nirS was higher at pH 6.1 than at pH 8.0. The most plausible explanation is that the translation/assembly of N(2)O reductase is more sensitive to low pH than that of the other reductases involved in denitrification.

  3. Effect of selenium deficiency on gene transcription

    SciTech Connect

    Christensen, M.J.; Burgener, K.W. )

    1991-03-11

    To investigate the general effects of dietary selenium (Se) deficiency on gene transcription, weanling male Sprague-Dawley rats were fed a basal Se-deficient Torula yeast-based diet or the same diet supplemented with 0.5 ppm Se as sodium selenite for 40 days. At that time three rats in each dietary group were sacrificed. Livers were excised and divided into two portions for isolation of nuclei and for assay of cytosolic Se-glutathione peroxidase (Se-GPX) activity. Se-GPX activity was 279 {plus minus} 4 (mean {plus minus} SEM) mUnits/mg protein in Se-adequate livers, and 10 {plus minus} 2 mUnits/mg protein in Se-deficient livers. One aliquot of nuclei from each dietary group was used in a run-on transcription assay, employing {alpha}-{sup 32}P-UTP to label nascent transcripts. Equal quantities of radioactivity from these nuclei were hybridized with cDNA probes bound to nitrocellulose. Message bound to each probe was quantitated by laser densitometry of autoradiographs, and by scintillation counting of dot blotted nitrocellulose. Transcription of most genes tested, including Se-GPX, was not significantly affected by dietary Se intake. However, the amount of hybridization to a murine oncogene probe (v-fos) was increased in Se deficiency.

  4. Transcription factor CecR (YbiH) regulates a set of genes affecting the sensitivity of Escherichia coli against cefoperazone and chloramphenicol.

    PubMed

    Yamanaka, Yuki; Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2016-07-01

    Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening was performed for identification of the binding site of YbiH, an as yet uncharacterized TetR-family transcription factor, on the Escherichia coli genome. YbiH was found to be a unique single-target regulator that binds in vitro within the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses indicated one clear binding site of YbiH, including a complete palindromic sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of the ybiH operon and activation of the rhlE operon by YbiH. After phenotype microarray screening, YbiH was indicated to confer resistance to chloramphenicol and cefazoline (a first-generation cephalosporin). A systematic survey of the participation of each of the predicted YbiH-regulated genes in the antibiotic sensitivity indicated involvement of the YbhFSR ABC-type transporter in the sensitivity to cefoperazone (a third-generation cephalosporin) and of the membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken together with the growth test in the presence of these two antibiotics and in vitro transcription assay, it was concluded that the hitherto uncharacterized YbiH regulates transcription of both the bidirectional transcription units, the ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the control of sensitivity to cefoperazone and chloramphenicol. We thus propose to rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity).

  5. The poplar basic helix-loop-helix transcription factor BEE3 – Like gene affects biomass production by enhancing proliferation of xylem cells in poplar

    SciTech Connect

    Noh, Seol Ah Choi, Young-Im Cho, Jin-Seong Lee, Hyoshin

    2015-06-19

    Brassinosteroids (BRs) play important roles in many aspects of plant growth and development, including regulation of vascular cambium activities and cell elongation. BR-induced BEE3 (brassinosteroid enhanced expression 3) is required for a proper BR response. Here, we identified a poplar (Populus alba × Populus glandulosa) BEE3-like gene, PagBEE3L, encoding a putative basic helix-loop-helix (bHLH)-type transcription factor. Expression of PagBEE3L was induced by brassinolide (BL). Transcripts of PagBEE3L were mainly detected in stems, with the internode having a low level of transcription and the node having a relatively higher level. The function of the PagBEE3L gene was investigated through phenotypic analyses with PagBEE3L-overexpressing (ox) transgenic lines. This work particularly focused on a potential role of PagBEE3L in stem growth and development of polar. The PagBEE3L-ox poplar showed thicker and longer stems than wild-type plants. The xylem cells from the stems of PagBEE3L-ox plants revealed remarkably enhanced proliferation, resulting in an earlier thickening growth than wild-type plants. Therefore, this work suggests that xylem development of poplar is accelerated in PagBEE3L-ox plants and PagBEE3L plays a role in stem growth by increasing the proliferation of xylem cells to promote the initial thickening growth of poplar stems. - Highlights: • We identify the BEE3-like gene form hybrid poplar (Populus alba × Populus glandulosa). • We examine effects of overexpression of PagBEE3L on growth in poplar. • We found that 35S:BEE3L transgenic plants showed more rapid growth than wild-type plants. • BEE3L protein plays an important role in the development of plant stem.

  6. The peptide semax affects the expression of genes related to the immune and vascular systems in rat brain focal ischemia: genome-wide transcriptional analysis

    PubMed Central

    2014-01-01

    Background The nootropic neuroprotective peptide Semax (Met-Glu-His-Phe-Pro-Gly-Pro) has proved efficient in the therapy of brain stroke; however, the molecular mechanisms underlying its action remain obscure. Our genome-wide study was designed to investigate the response of the transcriptome of ischemized rat brain cortex tissues to the action of Semax in vivo. Results The gene-expression alteration caused by the action of the peptide Semax was compared with the gene expression of the “ischemia” group animals at 3 and 24 h after permanent middle cerebral artery occlusion (pMCAO). The peptide predominantly enhanced the expression of genes related to the immune system. Three hours after pMCAO, Semax influenced the expression of some genes that affect the activity of immune cells, and, 24 h after pMCAO, the action of Semax on the immune response increased considerably. The genes implicated in this response represented over 50% of the total number of genes that exhibited Semax-induced altered expression. Among the immune-response genes, the expression of which was modulated by Semax, genes that encode immunoglobulins and chemokines formed the most notable groups. In response to Semax administration, 24 genes related to the vascular system exhibited altered expression 3 h after pMCAO, whereas 12 genes were changed 24 h after pMCAO. These genes are associated with such processes as the development and migration of endothelial tissue, the migration of smooth muscle cells, hematopoiesis, and vasculogenesis. Conclusions Semax affects several biological processes involved in the function of various systems. The immune response is the process most markedly affected by the drug. Semax altered the expression of genes that modulate the amount and mobility of immune cells and enhanced the expression of genes that encode chemokines and immunoglobulins. In conditions of rat brain focal ischemia, Semax influenced the expression of genes that promote the formation and

  7. The "fourth dimension" of gene transcription.

    PubMed

    O'Malley, Bert W

    2009-05-01

    The three dimensions of space provide our relationship to position on the earth, but the fourth dimension of time has an equally profound influence on our lives. Everything from light and sound to weather and biology operate on the principle of measurable temporal periodicity. Consequently, a wide variety of time clocks affect all aspects of our existence. The annual (and biannual) cycles of activity, metabolism, and mating, the monthly physiological clocks of women and men, and the 24-h diurnal rhythms of humans are prime examples. Should it be surprising to us that the fourth dimension also impinges upon gene expression and that the genome itself is regulated by the fastest running of all biological clocks? Recent evidence substantiates the existence of such a ubiquitin-dependent transcriptional clock that is based upon the activation and destruction of transcriptional coactivators.

  8. Gene transcription and electromagnetic fields

    SciTech Connect

    Henderson, A.S.

    1992-01-01

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  9. A polymorphism of the GTP-cyclohydrolase I feedback regulator gene alters transcriptional activity and may affect response to SSRI antidepressants.

    PubMed

    McHugh, P C; Joyce, P R; Deng, X; Kennedy, M A

    2011-06-01

    Tetrahydrobiopterin (BH(4)) is an essential cofactor for synthesis of many neurotransmitters including serotonin. In serotonergic neurons, BH(4) is tightly regulated by GTP-cyclohydrolase I feedback regulator (GFRP). Given the pivotal role of the serotonergic system in mood disorders and selective serotonin reuptake inhibitors (SSRIs) antidepressant function, we tested the hypothesis that GFRP gene (GCHFR) variants would modify response to antidepressants in subjects with major depression. Two single nucleotide polymorphisms (rs7164342 and rs7163862) in the GCHFR promoter were identified and occurred as two haplotypes (GA or TT). A multiple regression analysis revealed that homozygous individuals for the TT haplotype were less likely to respond to the SSRI fluoxetine than to the tricyclic antidepressant nortriptyline (P = 0.037). Moreover, the TT haplotype showed a reduced transcription rate in luciferase reporter gene assays, which may impact on BH(4)-mediated neurotransmitter production, thus suggesting a biological process through which GCHFR promoter variants might influence antidepressant response.

  10. The poplar basic helix-loop-helix transcription factor BEE3 - Like gene affects biomass production by enhancing proliferation of xylem cells in poplar.

    PubMed

    Noh, Seol Ah; Choi, Young-Im; Cho, Jin-Seong; Lee, Hyoshin

    2015-06-19

    Brassinosteroids (BRs) play important roles in many aspects of plant growth and development, including regulation of vascular cambium activities and cell elongation. BR-induced BEE3 (brassinosteroid enhanced expression 3) is required for a proper BR response. Here, we identified a poplar (Populus alba × Populus glandulosa) BEE3-like gene, PagBEE3L, encoding a putative basic helix-loop-helix (bHLH)-type transcription factor. Expression of PagBEE3L was induced by brassinolide (BL). Transcripts of PagBEE3L were mainly detected in stems, with the internode having a low level of transcription and the node having a relatively higher level. The function of the PagBEE3L gene was investigated through phenotypic analyses with PagBEE3L-overexpressing (ox) transgenic lines. This work particularly focused on a potential role of PagBEE3L in stem growth and development of polar. The PagBEE3L-ox poplar showed thicker and longer stems than wild-type plants. The xylem cells from the stems of PagBEE3L-ox plants revealed remarkably enhanced proliferation, resulting in an earlier thickening growth than wild-type plants. Therefore, this work suggests that xylem development of poplar is accelerated in PagBEE3L-ox plants and PagBEE3L plays a role in stem growth by increasing the proliferation of xylem cells to promote the initial thickening growth of poplar stems.

  11. Darkness affects differentially the expression of plastid-encoded genes and delays the senescence-induced down-regulation of chloroplast transcription in cotyledons of Cucurbita pepo L. (Zucchini).

    PubMed

    Mishev, Kiril; Dimitrova, Anna; Ananiev, Evguéni D

    2011-01-01

    In contrast to differentiated leaves, the regulatory mechanisms of chloroplast gene expression in darkened cotyledons have not been elucidated. Although some results have been reported indicating accelerated senescence in Arabidopsis upon reillumination, the capacity of cotyledons to recover after dark stress remains unclear. We analysed the effect of two-days dark stress, applied locally or at the whole-plant level, on plastid gene expression in zucchini cotyledons. Our results showed that in the dark the overall chloroplast transcription rate was much more inhibited than the nuclear run-on transcription. While the activities of the plastid-encoded RNA polymerase (PEP) and nuclear RNA polymerase II were strongly reduced, the activities of the nuclear-encoded plastid RNA polymerase (NEP) and nuclear RNA polymerase I were less affected. During recovery upon reillumination, chloroplast transcription in the cotyledons was strongly stimulated (3-fold) compared with the naturally senescing controls, suggesting delayed senescence. Northern blot and dot blot analyses of the expression of key chloroplast-encoded photosynthetic genes showed that in contrast to psbA, which remained almost unaffected, both the transcription rate and mRNA content of psaB and rbcL were substantially decreased.

  12. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  13. Silencing of molt-regulating transcription factor gene, CiHR3, affects growth and development of sugarcane stem borer, Chilo infuscatellus.

    PubMed

    Zhang, Yu-liang; Zhang, Shu-zhen; Kulye, Mahesh; Wu, Su-ran; Yu, Nai-tong; Wang, Jian-hua; Zeng, Hong-mei; Liu, Zhi-xin

    2012-01-01

    RNA interference (RNAi) is a technology for conducting functional genomic studies and a potential tool for crop protection against insect pests. Development of reliable methods for production and delivery of double-stranded RNA (dsRNA) is the major challenge for efficient pest control. In this study, Chilo infuscatellus Snellen (Crambidae: Lepidoptera) was fed with CiHR3 dsRNA expressed in bacteria or synthesized in vitro. The dsRNA ingested by C. infuscatellus successfully triggered silencing of the molt-regulating transcription factor CiHR3, an important gene for insect growth and development, and caused significant abnormalities and weight loss in insects within seven days of treatment. This study is an ideal example of feeding-based RNAi mediated by dsRNA expressed in bacteria or synthesized in vitro. The results also suggested that feeding-based RNA interference is a potential method for the management of C. infuscatellus.

  14. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

    PubMed Central

    De la Cruz, Miguel A.; Pérez-Morales, Deyanira; Palacios, Irene J.; Fernández-Mora, Marcos; Calva, Edmundo; Bustamante, Víctor H.

    2015-01-01

    Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella. PMID:26300871

  15. Thyrotropin controls transcription of the thyroglobulin gene.

    PubMed

    Van Heuverswyn, B; Streydio, C; Brocas, H; Refetoff, S; Dumont, J; Vassart, G

    1984-10-01

    The availability of rat thyroglobulin cDNA clones was exploited to study the regulation of thyroglobulin gene transcription by thyrotropin (TSH). Groups of rats were subjected to treatments leading to reduction or increase in the rat serum TSH (rTSH) levels. Thyroid gland nuclei were isolated, incubated in vitro in the presence of 32P-labeled uridine triphosphate, and thyroglobulin transcripts were quantitated by hybridization to immobilized rat thyroglobulin cDNA clones. Transcription of the thyroglobulin gene was found to be very active in thyroid nuclei from control animals. It represented about 10% of total RNA polymerase II activity. Chronic hyperstimulation of the thyroid glands with endogenous rTSH was achieved in rats treated with the goitrogen propylthiouracil. No significant increase of thyroglobulin gene transcription could be measured in thyroid nuclei from these animals. On the contrary, a dramatic decrease in thyroglobulin gene transcription was observed in those animals in which endogenous rTSH levels had been suppressed by hypophysectomy or by the administration of triiodothyronine. Injection of exogenous bovine TSH in such animals readily restored transcriptional activity of the gene. Our results identify transcription as an important regulatory step involved in TSH action. They suggest that normal TSH levels induce close to maximal expression of the thyroglobulin gene but that continuous presence of TSH is required in order to maintain the gene in an activated state.

  16. Widespread Inducible Transcription Downstream of Human Genes

    PubMed Central

    Vilborg, Anna; Passarelli, Maria C.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.

    2015-01-01

    Summary Pervasive transcription of the human genome generates RNAs whose mode of formation and functions are largely uncharacterized. Here, we combine RNA-Seq with detailed mechanistic studies to describe a transcript type derived from protein-coding genes. The resulting RNAs, which we call DoGs for downstream of gene containing transcripts, possess long non-coding regions (often >45 kb) and remain chromatin bound. DoGs are inducible by osmotic stress through an IP3 receptor signaling-dependent pathway, indicating active regulation. DoG levels are increased by decreased termination of the upstream transcript, a previously undescribed mechanism for rapid transcript induction. Relative depletion of polyA signals in DoG regions correlates with increased levels of DoGs after osmotic stress. We detect DoG transcription in several human cell lines and provide evidence for thousands of DoGs genome-wide. PMID:26190259

  17. Characteristics of post-transcriptional gene silencing.

    PubMed

    Chicas, A; Macino, G

    2001-11-01

    A number of gene silencing phenomena that inactivate genes at the post-transcriptional level have been identified. Due to its potential for studying gene function, post-transcriptional gene silencing (PTGS) has become an intense area of research. In this review we describe the different means of inducing PTGS and discuss the possible biological roles of these artificially induced phenomena. We also discuss other features of PTGS such as the mechanism of mRNA degradation, the nature of the silencing signal and the mechanism of PTGS inhibition by viral proteins.

  18. Characteristics of post-transcriptional gene silencing

    PubMed Central

    Chicas, Agustin; Macino, Giuseppe

    2001-01-01

    A number of gene silencing phenomena that inactivate genes at the post-transcriptional level have been identified. Due to its potential for studying gene function, post-transcriptional gene silencing (PTGS) has become an intense area of research. In this review we describe the different means of inducing PTGS and discuss the possible biological roles of these artificially induced phenomena. We also discuss other features of PTGS such as the mechanism of mRNA degradation, the nature of the silencing signal and the mechanism of PTGS inhibition by viral proteins. PMID:11713190

  19. Methylation Affects Transposition and Splicing of a Large CACTA Transposon from a MYB Transcription Factor Regulating Anthocyanin Synthase Genes in Soybean Seed Coats

    PubMed Central

    Zabala, Gracia; Vodkin, Lila O.

    2014-01-01

    We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-rm is homozygous for a mutable allele (rm) that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-rm line had a 13 kb CACTA subfamily transposon insertion (designated TgmR*) at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3) to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-rm progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element. PMID:25369033

  20. Reverse engineering transcriptional gene networks.

    PubMed

    Belcastro, Vincenzo; di Bernardo, Diego

    2014-01-01

    The aim of this chapter is a step-by-step guide on how to infer gene networks from gene expression profiles. The definition of a gene network is given in Subheading 1, where the different types of networks are discussed. The chapter then guides the readers through a data-gathering process in order to build a compendium of gene expression profiles from a public repository. Gene expression profiles are then discretized and a statistical relationship between genes, called mutual information (MI), is computed. Gene pairs with insignificant MI scores are then discarded by applying one of the described pruning steps. The retained relationships are then used to build up a Boolean adjacency matrix used as input for a clustering algorithm to divide the network into modules (or communities). The gene network can then be used as a hypothesis generator for discovering gene function and analyzing gene signatures. Some case studies are presented, and an online web-tool called Netview is described.

  1. Transcriptional Control of the TNF Gene

    PubMed Central

    Falvo, James V.; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2016-01-01

    The cytokine TNF is a critical mediator of immune and inflammatory responses. The TNF gene is an immediate early gene, rapidly transcribed in a variety of cell types following exposure to a broad range of pathogens and signals of inflammation and stress. Regulation of TNF gene expression at the transcriptional level is cell type- and stimulus-specific, involving the recruitment of distinct sets of transcription factors to a compact and modular promoter region. In this review, we describe our current understanding of the mechanisms through which TNF transcription is specifically activated by a variety of extracellular stimuli in multiple cell types, including T cells, B cells, macrophages, mast cells, dendritic cells, and fibroblasts. We discuss the role of nuclear factor of activated T cells and other transcription factors and coactivators in enhanceosome formation, as well as the contradictory evidence for a role for nuclear factor κB as a classical activator of the TNF gene. We describe the impact of evolutionarily conserved cis-regulatory DNA motifs in the TNF locus upon TNF gene transcription, in contrast to the neutral effect of single nucleotide polymorphisms. We also assess the regulatory role of chromatin organization, epigenetic modifications, and long-range chromosomal interactions at the TNF locus. PMID:20173386

  2. Topologies for perfect adaptation in gene transcription

    NASA Astrophysics Data System (ADS)

    Shi, Wenjia; Tang, Chao

    2014-03-01

    Adaptation is commonly used in sensory systems and signaling networks to allow the detection of further stimuli. Despite enzymatic network topologies for adaptation have been investigated systematically, the topology of transcriptional network that could perform adaptation still remains unclear, due to the complexity of transcriptional regulation. Here, we systematically investigated all three-node transcriptional networks, and found the topologies of transcriptional networks for adaptation are different from that of enzymatic ones. While both negative feedback loop (NFBL) and incoherent feed forward loop (IFFL) are capable of performing adaptation analytically, a positive self-regulation on buffer node is necessary for NFBL topology and more flexible structures emerge for IFFL than that of enzymatic networks. Most of the simulation results agree with analytical predictions. This study may explain the mechanism of adapted gene regulation behavior and supply a design table for gene regulatory adaptation.

  3. Heterodimeric Drosophila gap gene protein complexes acting as transcriptional repressors.

    PubMed Central

    Sauer, F; Jäckle, H

    1995-01-01

    The Drosophila gap gene Krüppel (Kr) encodes a transcriptional regulator. It acts both as an integral part of the Drosophila segmentation gene in the early blastoderm and in a variety of tissues and organs at later stages of embryogenesis. In transfected tissue culture cells, the Kr protein (Kr) was shown to both activate and repress gene expression in a concentration-dependent manner when acting from a single binding site close to the promoter. Here we show that KR can associate with the transcription factors encoded by the gap genes knirps (kni) and hunchback (hb) which affect KR-dependent gene expression in Drosophila tissue culture cells. The association of DNA-bound hb protein or free kni protein with distinct but different regions of KR results in the formation of DNA-bound transcriptional repressor complexes. Our results suggest that individual transcription factors can associate to form protein complexes which act as direct repressors of transcription. The interactions shown here add an unexpected level of complexity to the control of gene expression. Images PMID:7588607

  4. Aeromonas hydrophila Lateral Flagellar Gene Transcriptional Hierarchy

    PubMed Central

    Wilhelms, Markus; Gonzalez, Victor; Merino, Susana

    2013-01-01

    Aeromonas hydrophila AH-3 lateral flagella are not assembled when bacteria grow in liquid media; however, lateral flagellar genes are transcribed. Our results indicate that A. hydrophila lateral flagellar genes are transcribed at three levels (class I to III genes) and share some similarities with, but have many important differences from, genes of Vibrio parahaemolyticus. A. hydrophila lateral flagellum class I gene transcription is σ70 dependent, which is consistent with the fact that lateral flagellum is constitutively transcribed, in contrast to the characteristics of V. parahaemolyticus. The fact that multiple genes are included in class I highlights that lateral flagellar genes are less hierarchically transcribed than polar flagellum genes. The A. hydrophila lafK-fliEJL gene cluster (where the subscript L distinguishes genes for lateral flagella from those for polar flagella) is exclusively from class I and is in V. parahaemolyticus class I and II. Furthermore, the A. hydrophila flgAMNL cluster is not transcribed from the σ54/LafK-dependent promoter and does not contain class II genes. Here, we propose a gene transcriptional hierarchy for the A. hydrophila lateral flagella. PMID:23335410

  5. Nucleosomal arrangement affects single-molecule transcription dynamics

    PubMed Central

    Fitz, Veronika; Shin, Jaeoh; Ehrlich, Christoph; Farnung, Lucas; Cramer, Patrick; Zaburdaev, Vasily; Grill, Stephan W.

    2016-01-01

    In eukaryotes, gene expression depends on chromatin organization. However, how chromatin affects the transcription dynamics of individual RNA polymerases has remained elusive. Here, we use dual trap optical tweezers to study single yeast RNA polymerase II (Pol II) molecules transcribing along a DNA template with two nucleosomes. The slowdown and the changes in pausing behavior within the nucleosomal region allow us to determine a drift coefficient, χ, which characterizes the ability of the enzyme to recover from a nucleosomal backtrack. Notably, χ can be used to predict the probability to pass the first nucleosome. Importantly, the presence of a second nucleosome changes χ in a manner that depends on the spacing between the two nucleosomes, as well as on their rotational arrangement on the helical DNA molecule. Our results indicate that the ability of Pol II to pass the first nucleosome is increased when the next nucleosome is turned away from the first one to face the opposite side of the DNA template. These findings help to rationalize how chromatin arrangement affects Pol II transcription dynamics. PMID:27791062

  6. Transcriptional gene silencing as a tool for uncovering gene function in maize.

    PubMed

    Cigan, A Mark; Unger-Wallace, Erica; Haug-Collet, Kristin

    2005-09-01

    Transcriptional gene silencing has broad applications for studying gene function in planta. In maize, a large number of genes have been identified as tassel-preferred in their expression pattern, both by traditional genetic methods and by recent high-throughput expression profiling platforms. Approaches using RNA suppression may provide a rapid alternative means to identify genes directly related to pollen development in maize. The male fertility gene Ms45 and several anther-expressed genes of unknown function were used to evaluate the efficacy of generating male-sterile plants by transcriptional gene silencing. A high frequency of male-sterile plants was obtained by constitutively expressing inverted repeats (IR) of the Ms45 promoter. These sterile plants lacked MS45 mRNA due to transcriptional inactivity of the target promoter. Moreover, fertility was restored to these promoter IR-containing plants by expressing the Ms45 coding region using heterologous promoters. Transcriptional silencing of other anther-expressed genes also significantly affected male fertility phenotypes and led to increased methylation of the target promoter DNA sequences. These studies provide evidence of disruption of gene activity in monocots by RNA interference constructs directed against either native or transformed promoter regions. This approach not only enables the correlation of monocot anther-expressed genes with functions that are important for reproduction in maize, but may also provide a tool for studying gene function and identifying regulatory components unique to transcriptional gene control.

  7. Transcriptional effects of gene dose reduction

    PubMed Central

    2014-01-01

    Large-scale gene dose reductions usually lead to abnormal phenotypes or death. However, male mammals, Drosophila, and Caenorhabditis elegans have only one X chromosome and thus can be considered as monosomic for a major chromosome. Despite the deleterious effects brought about by such gene dose reduction in the case of an autosome, X chromosome monosomy in males is natural and innocuous. This is because of the nearly full transcriptional compensation for X chromosome genes in males, as opposed to no or partial transcriptional compensation for autosomal one-dose genes arising due to deletions. Buffering, the passive absorption of disturbance due to enzyme kinetics, and feedback responses triggered by expression change contribute to partial compensation. Feed-forward mechanisms, which are active responses to genes being located on the X, rather than actual gene dose are important contributors to full X chromosome compensation. In the last decade, high-throughput techniques have provided us with the tools to effectively and quantitatively measure the small-fold transcriptional effects of dose reduction. This is leading to a better understanding of compensatory mechanisms. PMID:24581086

  8. Transcriptional enhancer from milk protein genes

    DOEpatents

    Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.

    1999-01-01

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  9. Transcriptional enhancer from milk protein genes

    SciTech Connect

    Casperson, G.F.; Schmidhauser, C.T.; Bissell, M.J.

    1999-12-21

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  10. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    SciTech Connect

    Tennyson, C.N.; Worton, R.G.

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  11. The SCL gene is formed from a transcriptionally complex locus.

    PubMed Central

    Aplan, P D; Begley, C G; Bertness, V; Nussmeier, M; Ezquerra, A; Coligan, J; Kirsch, I R

    1990-01-01

    We describe the structural organization of the human SCL gene, a helix-loop-helix family member which we believe plays a fundamental role in hematopoietic differentiation. The SCL locus is composed of eight exons distributed over 16 kb. SCL shows a pattern of expression quite restricted to early hematopoietic tissues, although in malignant states expression of the gene may be somewhat extended into later developmental stages. A detailed analysis of the transcript(s) arising from the SCL locus revealed that (i) the 5' noncoding portion of the SCL transcript, which resides within a CpG island, has a complex pattern of alternative exon utilization as well as two distinct transcription initiation sites; (ii) the 5' portions of the SCL transcript contain features that suggest a possible regulatory role for these segments; (iii) the pattern of utilization of the 5' exons is cell lineage dependent; and (iv) all of the currently studied chromosomal aberrations that affect the SCL locus either structurally or functionally eliminate the normal 5' transcription initiation sites. These data suggest that the SCL gene, and specifically its 5' region, may be a target for regulatory interactions during early hematopoietic development. Images PMID:2247063

  12. Modular composition of gene transcription networks.

    PubMed

    Gyorgy, Andras; Del Vecchio, Domitilla

    2014-03-01

    Predicting the dynamic behavior of a large network from that of the composing modules is a central problem in systems and synthetic biology. Yet, this predictive ability is still largely missing because modules display context-dependent behavior. One cause of context-dependence is retroactivity, a phenomenon similar to loading that influences in non-trivial ways the dynamic performance of a module upon connection to other modules. Here, we establish an analysis framework for gene transcription networks that explicitly accounts for retroactivity. Specifically, a module's key properties are encoded by three retroactivity matrices: internal, scaling, and mixing retroactivity. All of them have a physical interpretation and can be computed from macroscopic parameters (dissociation constants and promoter concentrations) and from the modules' topology. The internal retroactivity quantifies the effect of intramodular connections on an isolated module's dynamics. The scaling and mixing retroactivity establish how intermodular connections change the dynamics of connected modules. Based on these matrices and on the dynamics of modules in isolation, we can accurately predict how loading will affect the behavior of an arbitrary interconnection of modules. We illustrate implications of internal, scaling, and mixing retroactivity on the performance of recurrent network motifs, including negative autoregulation, combinatorial regulation, two-gene clocks, the toggle switch, and the single-input motif. We further provide a quantitative metric that determines how robust the dynamic behavior of a module is to interconnection with other modules. This metric can be employed both to evaluate the extent of modularity of natural networks and to establish concrete design guidelines to minimize retroactivity between modules in synthetic systems.

  13. Transcriptional Targeting in Cancer Gene Therapy

    PubMed Central

    2003-01-01

    Cancer gene therapy has been one of the most exciting areas of therapeutic research in the past decade. In this review, we discuss strategies to restrict transcription of transgenes to tumour cells. A range of promoters which are tissue-specific, tumour-specific, or inducible by exogenous agents are presented. Transcriptional targeting should prevent normal tissue toxicities associated with other cancer treatments, such as radiation and chemotherapy. In addition, the specificity of these strategies should provide improved targeting of metastatic tumours following systemic gene delivery. Rapid progress in the ability to specifically control transgenes will allow systemic gene delivery for cancer therapy to become a real possibility in the near future. PMID:12721516

  14. Gene duplication of type-B ARR transcription factors systematically extends transcriptional regulatory structures in Arabidopsis

    PubMed Central

    Choi, Seung Hee; Hyeon, Do Young; Lee, ll Hwan; Park, Su Jin; Han, Seungmin; Lee, In Chul; Hwang, Daehee; Nam, Hong Gil

    2014-01-01

    Many of duplicated genes are enriched in signaling pathways. Recently, gene duplication of kinases has been shown to provide genetic buffering and functional diversification in cellular signaling. Transcription factors (TFs) are also often duplicated. However, how duplication of TFs affects their regulatory structures and functions of target genes has not been explored at the systems level. Here, we examined regulatory and functional roles of duplication of three major ARR TFs (ARR1, 10, and 12) in Arabidopsis cytokinin signaling using wild-type and single, double, and triple deletion mutants of the TFs. Comparative analysis of gene expression profiles obtained from Arabidopsis roots in wild-type and these mutants showed that duplication of ARR TFs systematically extended their transcriptional regulatory structures, leading to enhanced robustness and diversification in functions of target genes, as well as in regulation of cellular networks of target genes. Therefore, our results suggest that duplication of TFs contributes to robustness and diversification in functions of target genes by extending transcriptional regulatory structures. PMID:25425016

  15. Gene duplication of type-B ARR transcription factors systematically extends transcriptional regulatory structures in Arabidopsis.

    PubMed

    Choi, Seung Hee; Hyeon, Do Young; Lee, Ll Hwan; Park, Su Jin; Han, Seungmin; Lee, In Chul; Hwang, Daehee; Nam, Hong Gil

    2014-11-26

    Many of duplicated genes are enriched in signaling pathways. Recently, gene duplication of kinases has been shown to provide genetic buffering and functional diversification in cellular signaling. Transcription factors (TFs) are also often duplicated. However, how duplication of TFs affects their regulatory structures and functions of target genes has not been explored at the systems level. Here, we examined regulatory and functional roles of duplication of three major ARR TFs (ARR1, 10, and 12) in Arabidopsis cytokinin signaling using wild-type and single, double, and triple deletion mutants of the TFs. Comparative analysis of gene expression profiles obtained from Arabidopsis roots in wild-type and these mutants showed that duplication of ARR TFs systematically extended their transcriptional regulatory structures, leading to enhanced robustness and diversification in functions of target genes, as well as in regulation of cellular networks of target genes. Therefore, our results suggest that duplication of TFs contributes to robustness and diversification in functions of target genes by extending transcriptional regulatory structures.

  16. Human DJ-1-specific Transcriptional Activation of Tyrosine Hydroxylase Gene*

    PubMed Central

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M. M.

    2010-01-01

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-l-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice. PMID:20938049

  17. Human DJ-1-specific transcriptional activation of tyrosine hydroxylase gene.

    PubMed

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M M

    2010-12-17

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-L-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice.

  18. Most "dark matter" transcripts are associated with known genes.

    PubMed

    van Bakel, Harm; Nislow, Corey; Blencowe, Benjamin J; Hughes, Timothy R

    2010-05-18

    A series of reports over the last few years have indicated that a much larger portion of the mammalian genome is transcribed than can be accounted for by currently annotated genes, but the quantity and nature of these additional transcripts remains unclear. Here, we have used data from single- and paired-end RNA-Seq and tiling arrays to assess the quantity and composition of transcripts in PolyA+ RNA from human and mouse tissues. Relative to tiling arrays, RNA-Seq identifies many fewer transcribed regions ("seqfrags") outside known exons and ncRNAs. Most nonexonic seqfrags are in introns, raising the possibility that they are fragments of pre-mRNAs. The chromosomal locations of the majority of intergenic seqfrags in RNA-Seq data are near known genes, consistent with alternative cleavage and polyadenylation site usage, promoter- and terminator-associated transcripts, or new alternative exons; indeed, reads that bridge splice sites identified 4,544 new exons, affecting 3,554 genes. Most of the remaining seqfrags correspond to either single reads that display characteristics of random sampling from a low-level background or several thousand small transcripts (median length = 111 bp) present at higher levels, which also tend to display sequence conservation and originate from regions with open chromatin. We conclude that, while there are bona fide new intergenic transcripts, their number and abundance is generally low in comparison to known exons, and the genome is not as pervasively transcribed as previously reported.

  19. Lack of the COMPASS Component Ccl1 Reduces H3K4 Trimethylation Levels and Affects Transcription of Secondary Metabolite Genes in Two Plant–Pathogenic Fusarium Species

    PubMed Central

    Studt, Lena; Janevska, Slavica; Arndt, Birgit; Boedi, Stefan; Sulyok, Michael; Humpf, Hans-Ulrich; Tudzynski, Bettina; Strauss, Joseph

    2017-01-01

    In the two fungal pathogens Fusarium fujikuroi and Fusarium graminearum, secondary metabolites (SMs) are fitness and virulence factors and there is compelling evidence that the coordination of SM gene expression is under epigenetic control. Here, we characterized Ccl1, a subunit of the COMPASS complex responsible for methylating lysine 4 of histone H3 (H3K4me). We show that Ccl1 is not essential for viability but a regulator of genome-wide trimethylation of H3K4 (H3K4me3). Although, recent work in Fusarium and Aspergillus spp. detected only sporadic H3K4 methylation at the majority of the SM gene clusters, we show here that SM profiles in CCL1 deletion mutants are strongly deviating from the wild type. Cross-complementation experiments indicate high functional conservation of Ccl1 as phenotypes of the respective △ccl1 were rescued in both fungi. Strikingly, biosynthesis of the species-specific virulence factors gibberellic acid and deoxynivalenol produced by F. fujikuroi and F. graminearum, respectively, was reduced in axenic cultures but virulence was not attenuated in these mutants, a phenotype which goes in line with restored virulence factor production levels in planta. This suggests that yet unknown plant-derived signals are able to compensate for Ccl1 function during pathogenesis. PMID:28119673

  20. Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver

    PubMed Central

    Atger, Florian; Gobet, Cédric; Marquis, Julien; Martin, Eva; Wang, Jingkui; Weger, Benjamin; Lefebvre, Grégory; Descombes, Patrick; Naef, Felix; Gachon, Frédéric

    2015-01-01

    Diurnal oscillations of gene expression are a hallmark of rhythmic physiology across most living organisms. Such oscillations are controlled by the interplay between the circadian clock and feeding rhythms. Although rhythmic mRNA accumulation has been extensively studied, comparatively less is known about their transcription and translation. Here, we quantified simultaneously temporal transcription, accumulation, and translation of mouse liver mRNAs under physiological light–dark conditions and ad libitum or night-restricted feeding in WT and brain and muscle Arnt-like 1 (Bmal1)-deficient animals. We found that rhythmic transcription predominantly drives rhythmic mRNA accumulation and translation for a majority of genes. Comparison of wild-type and Bmal1 KO mice shows that circadian clock and feeding rhythms have broad impact on rhythmic gene expression, Bmal1 deletion affecting surprisingly both transcriptional and posttranscriptional levels. Translation efficiency is differentially regulated during the diurnal cycle for genes with 5′-Terminal Oligo Pyrimidine tract (5′-TOP) sequences and for genes involved in mitochondrial activity, many harboring a Translation Initiator of Short 5′-UTR (TISU) motif. The increased translation efficiency of 5′-TOP and TISU genes is mainly driven by feeding rhythms but Bmal1 deletion also affects amplitude and phase of translation, including TISU genes. Together this study emphasizes the complex interconnections between circadian and feeding rhythms at several steps ultimately determining rhythmic gene expression and translation. PMID:26554015

  1. Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver.

    PubMed

    Atger, Florian; Gobet, Cédric; Marquis, Julien; Martin, Eva; Wang, Jingkui; Weger, Benjamin; Lefebvre, Grégory; Descombes, Patrick; Naef, Felix; Gachon, Frédéric

    2015-11-24

    Diurnal oscillations of gene expression are a hallmark of rhythmic physiology across most living organisms. Such oscillations are controlled by the interplay between the circadian clock and feeding rhythms. Although rhythmic mRNA accumulation has been extensively studied, comparatively less is known about their transcription and translation. Here, we quantified simultaneously temporal transcription, accumulation, and translation of mouse liver mRNAs under physiological light-dark conditions and ad libitum or night-restricted feeding in WT and brain and muscle Arnt-like 1 (Bmal1)-deficient animals. We found that rhythmic transcription predominantly drives rhythmic mRNA accumulation and translation for a majority of genes. Comparison of wild-type and Bmal1 KO mice shows that circadian clock and feeding rhythms have broad impact on rhythmic gene expression, Bmal1 deletion affecting surprisingly both transcriptional and posttranscriptional levels. Translation efficiency is differentially regulated during the diurnal cycle for genes with 5'-Terminal Oligo Pyrimidine tract (5'-TOP) sequences and for genes involved in mitochondrial activity, many harboring a Translation Initiator of Short 5'-UTR (TISU) motif. The increased translation efficiency of 5'-TOP and TISU genes is mainly driven by feeding rhythms but Bmal1 deletion also affects amplitude and phase of translation, including TISU genes. Together this study emphasizes the complex interconnections between circadian and feeding rhythms at several steps ultimately determining rhythmic gene expression and translation.

  2. Drosophilia alpha-tubulin genes and their transcription patterns.

    PubMed

    Kalfayan, L; Loewenberg, J; Wensink, P C

    1982-01-01

    There are four different alpha-tubulin genes in D. melanogaster DNA; three of them appear as single copies and the other is present as either one or two copies in the haploid genome. The transcripts of three of these genes were examined. Each of them is complementary to a transcript of different length, implying that each is transcribed. Since these transcripts are found on polysomes, it is likely that they are translated. At least two of the genes are complementary to several transcripts, indicating that each of them has more than one transcription start or stop site or perhaps that there are alternative paths of posttranscriptional processing. There is a different developmental pattern of concentrations for transcripts from each of these genes, and different RNAs from the same gene also have different patterns. We conclude that the concentration of transcripts from each gene appears to be independently controlled and that even different transcription products from the same gene appear to independently controlled.

  3. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  4. Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes

    PubMed Central

    Pérez-Montarelo, Dafne; Fernández, Almudena; Barragán, Carmen; Noguera, Jose L.; Folch, Josep M.; Rodríguez, M. Carmen; Óvilo, Cristina; Silió, Luis; Fernández, Ana I.

    2013-01-01

    The leptin (LEP) and its receptor (LEPR) regulate food intake and energy balance through hypothalamic signaling. However, the LEP-LEPR axis seems to be more complex and its expression regulation has not been well described. In pigs, LEP and LEPR genes have been widely studied due to their relevance. Previous studies reported significant effects of SNPs located in both genes on growth and fatness traits. The aim of this study was to determine the expression profiles of LEP and LEPR across hypothalamic, adipose, hepatic and muscle tissues in Iberian x Landrace backcrossed pigs and to analyze the effects of gene variants on transcript abundance. To our knowledge, non porcine LEPR isoforms have been described rather than LEPRb. A short porcine LEPR isoform (LEPRa), that encodes a protein lacking the intracellular residues responsible of signal transduction, has been identified for the first time. The LEPRb isoform was only quantifiable in hypothalamus while LEPRa appeared widely expressed across tissues, but at higher levels in liver, suggesting that both isoforms would develop different roles. The unique LEP transcript showed expression in backfat and muscle. The effects of gene variants on transcript expression revealed interesting results. The LEPRc.1987C>T polymorphism showed opposite effects on LEPRb and LEPRa hypothalamic expression. In addition, one out of the 16 polymorphisms identified in the LEPR promoter region revealed high differential expression in hepatic LEPRa. These results suggest a LEPR isoform-specific regulation at tissue level. Conversely, non-differential expression of LEP conditional on the analyzed polymorphisms could be detected, indicating that its regulation is likely affected by other mechanisms rather than gene sequence variants. The present study has allowed a transcriptional characterization of LEP and LEPR isoforms on a range of tissues. Their expression patterns seem to indicate that both molecules develop peripheral roles apart from

  5. Divergence of the yeast transcription factor FZF1 affects sulfite resistance.

    PubMed

    Engle, Elizabeth K; Fay, Justin C

    2012-01-01

    Changes in gene expression are commonly observed during evolution. However, the phenotypic consequences of expression divergence are frequently unknown and difficult to measure. Transcriptional regulators provide a mechanism by which phenotypic divergence can occur through multiple, coordinated changes in gene expression during development or in response to environmental changes. Yet, some changes in transcriptional regulators may be constrained by their pleiotropic effects on gene expression. Here, we use a genome-wide screen for promoters that are likely to have diverged in function and identify a yeast transcription factor, FZF1, that has evolved substantial differences in its ability to confer resistance to sulfites. Chimeric alleles from four Saccharomyces species show that divergence in FZF1 activity is due to changes in both its coding and upstream noncoding sequence. Between the two closest species, noncoding changes affect the expression of FZF1, whereas coding changes affect the expression of SSU1, a sulfite efflux pump activated by FZF1. Both coding and noncoding changes also affect the expression of many other genes. Our results show how divergence in the coding and promoter region of a transcription factor alters the response to an environmental stress.

  6. Transcription-coupled changes to chromatin underpin gene silencing by transcriptional interference.

    PubMed

    Ard, Ryan; Allshire, Robin C

    2016-12-15

    Long non-coding RNA (lncRNA) transcription into a downstream promoter frequently results in transcriptional interference. However, the mechanism of this repression is not fully understood. We recently showed that drug tolerance in fission yeast Schizosaccharomyces pombe is controlled by lncRNA transcription upstream of the tgp1(+) permease gene. Here we demonstrate that transcriptional interference of tgp1(+) involves several transcription-coupled chromatin changes mediated by conserved elongation factors Set2, Clr6CII, Spt6 and FACT. These factors are known to travel with RNAPII and establish repressive chromatin in order to limit aberrant transcription initiation from cryptic promoters present in gene bodies. We therefore conclude that conserved RNAPII-associated mechanisms exist to both suppress intragenic cryptic promoters during genic transcription and to repress gene promoters by transcriptional interference. Our analyses also demonstrate that key mechanistic features of transcriptional interference are shared between S. pombe and the highly divergent budding yeast Saccharomyces cerevisiae Thus, transcriptional interference is an ancient, conserved mechanism for tightly controlling gene expression. Our mechanistic insights allowed us to predict and validate a second example of transcriptional interference involving the S. pombe pho1(+) gene. Given that eukaryotic genomes are pervasively transcribed, transcriptional interference likely represents a more general feature of gene regulation than is currently appreciated.

  7. Genome wide analysis of human genes transcriptionally and post-transcriptionally regulated by the HTLV-I protein p30

    PubMed Central

    Taylor, John M; Ghorbel, Sofiane; Nicot, Christophe

    2009-01-01

    Background Human T-cell leukemia virus type 1 (HTLV-I) is a human retrovirus that is etiologically linked to adult T-cell leukemia (ATL), an aggressive and fatal lymphoproliferative disease. The viral transactivator, Tax, is thought to play an important role during the initial stages of CD4+ T-cell immortalization by HTLV-1. Tax has been shown to activate transcription through CREB/ATF and NF-KB, and to alter numerous signaling pathways. These pleiotropic effects of Tax modify the expression of a wide array of cellular genes. Another viral protein encoded by HTLV-I, p30, has been shown to affect virus replication at the transcriptional and posttranscriptional levels. Little is currently known regarding the effect of p30 on the expression and nuclear export of cellular host mRNA transcripts. Identification of these RNA may reveal new targets and increase our understanding of HTLV-I pathogenesis. In this study, using primary peripheral blood mononuclear cells, we report a genome wide analysis of human genes transcriptionally and post-transcriptionally regulated by the HTLV-I protein p30. Results Using microarray analysis, we analyzed total and cytoplasmic cellular mRNA transcript levels isolated from PBMCs to assess the effect of p30 on cellular RNA transcript expression and their nuclear export. We report p30-dependent transcription resulting in the 2.5 fold up-regulation of 15 genes and the down-regulation of 65 human genes. We further tested nuclear export of cellular mRNA and found that p30 expression also resulted in a 2.5 fold post-transcriptional down-regulation of 90 genes and the up-regulation of 33 genes. Conclusion Overall, our study describes that expression of the HTLV-I protein p30 both positively and negatively alters the expression of cellular transcripts. Our study identifies for the first time the cellular genes for which nuclear export is affected by p30. These results suggest that p30 may possess a more global function with respect to m

  8. Synaptic, transcriptional and chromatin genes disrupted in autism.

    PubMed

    De Rubeis, Silvia; He, Xin; Goldberg, Arthur P; Poultney, Christopher S; Samocha, Kaitlin; Cicek, A Erucment; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarinder; Klei, Lambertus; Kosmicki, Jack; Shih-Chen, Fu; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F; Brownfeld, Jessica M; Cai, Jinlu; Campbell, Nicholas G; Carracedo, Angel; Chahrour, Maria H; Chiocchetti, Andreas G; Coon, Hilary; Crawford, Emily L; Curran, Sarah R; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A; Gallagher, Louise; Geller, Evan; Guter, Stephen J; Hill, R Sean; Ionita-Laza, Juliana; Jimenz Gonzalez, Patricia; Kilpinen, Helena; Klauck, Sabine M; Kolevzon, Alexander; Lee, Irene; Lei, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R; McInnes, Alison L; Neale, Benjamin; Owen, Michael J; Ozaki, Noriio; Parellada, Mara; Parr, Jeremy R; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Li-San, Wang; Weiss, Lauren A; Willsey, A Jeremy; Yu, Timothy W; Yuen, Ryan K C; Cook, Edwin H; Freitag, Christine M; Gill, Michael; Hultman, Christina M; Lehner, Thomas; Palotie, Aaarno; Schellenberg, Gerard D; Sklar, Pamela; State, Matthew W; Sutcliffe, James S; Walsh, Christiopher A; Scherer, Stephen W; Zwick, Michael E; Barett, Jeffrey C; Cutler, David J; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J; Buxbaum, Joseph D

    2014-11-13

    The genetic architecture of autism spectrum disorder involves the interplay of common and rare variants and their impact on hundreds of genes. Using exome sequencing, here we show that analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, plus a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic formation, transcriptional regulation and chromatin-remodelling pathways. These include voltage-gated ion channels regulating the propagation of action potentials, pacemaking and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodellers-most prominently those that mediate post-translational lysine methylation/demethylation modifications of histones.

  9. Correcting Transcription Factor Gene Sets for Copy Number and Promoter Methylation Variations

    PubMed Central

    Rathi, Komal S.; Gaykalova, Daria A.; Hennesey, Patrick; Califano, Joseph A.; Ochs, Michael F.

    2014-01-01

    Gene set analysis provides a method to generate statistical inferences across sets of linked genes, primarily using high-throughput expression data. Common gene sets include biological pathways, operons, and targets of transcriptional regulators. In higher eukaryotes, especially when dealing with diseases with strong genetic and epigenetic components such as cancer, copy number loss and gene silencing through promoter methylation can eliminate the possibility that a gene is transcribed. This, in turn, can adversely affect the estimation of transcription factor or pathway activity from a set of target genes, since some of the targets may not be responsive to transcriptional regulation. Here we introduce a simple filtering approach that removes genes from consideration if they show copy number loss or promoter methylation and demonstrate the improvement in inference of transcription factor activity in a simulated data set based on the background expression observed in normal head and neck tissue. PMID:25195578

  10. Correcting transcription factor gene sets for copy number and promoter methylation variations.

    PubMed

    Rathi, Komal S; Gaykalova, Daria A; Hennessey, Patrick; Califano, Joseph A; Ochs, Michael F

    2014-09-01

    Gene set analysis provides a method to generate statistical inferences across sets of linked genes, primarily using high-throughput expression data. Common gene sets include biological pathways, operons, and targets of transcriptional regulators. In higher eukaryotes, especially when dealing with diseases with strong genetic and epigenetic components such as cancer, copy number loss and gene silencing through promoter methylation can eliminate the possibility that a gene is transcribed. This, in turn, can adversely affect the estimation of transcription factor or pathway activity from a set of target genes, as some of the targets may not be responsive to transcriptional regulation. Here we introduce a simple filtering approach that removes genes from consideration if they show copy number loss or promoter methylation, and demonstrate the improvement in inference of transcription factor activity in a simulated dataset based on the background expression observed in normal head and neck tissue.

  11. Effects of hemorrhage on cytokine gene transcription.

    PubMed

    Shenkar, R; Abraham, E

    1993-08-01

    Injury and blood loss are often followed by infection and the rapid development of organ system dysfunction, frequently involving mucosal sites, such as the lung and intestine. To examine possible mechanisms contributing to these conditions, we used semiquantitative polymerase chain reactions to determine cytokine mRNA expression among cellular populations isolated from mucosal and systemic anatomic sites of mice at predetermined time points following 30% blood volume hemorrhage with resuscitation 1 hr later. Within 1 hr after hemorrhage, significant increases were observed in mRNA levels for IL-1 alpha, IL-1 beta, IL-5, and TGF-beta in intraparenchymal pulmonary mononuclear cells. The levels of TGF-beta transcripts among alveolar macrophages were increased 1 hr following blood loss, and increase in IL-1 alpha transcripts was found starting 2 hr posthemorrhage. Cells from Peyer's patches showed significant increases in mRNA levels for IL-1 beta, IL-2, IL-5, IL-6, IFN-gamma, and TGF-beta during the 4 hr following hemorrhage. Significant increases in mRNA levels for IL-1 beta, TNF-alpha, and TGF-beta were present within 4 hr of blood loss among cells isolated from mesenteric lymph nodes. The expression of mRNA for most cytokines was not significantly altered in splenocytes or peripheral blood mononuclear cells at any time point following hemorrhage. These experiments demonstrate that blood loss, even if resuscitated, produces significant increases in proinflammatory and immunoregulatory cytokine gene transcription as early as 1 hr following hemorrhage. These posthemorrhage alterations in cytokine mRNA expression were particularly prominent at mucosal sites, suggesting a mechanism for the increased incidence of pulmonary and intestinal involvement in organ system failure following severe blood loss and injury.

  12. Transcriptional regulation of the uncoupling protein-1 gene.

    PubMed

    Villarroya, Francesc; Peyrou, Marion; Giralt, Marta

    2017-03-01

    Regulated transcription of the uncoupling protein-1 (UCP1) gene, and subsequent UCP1 protein synthesis, is a hallmark of the acquisition of the differentiated, thermogenically competent status of brown and beige/brite adipocytes, as well as of the responsiveness of brown and beige/brite adipocytes to adaptive regulation of thermogenic activity. The 5' non-coding region of the UCP1 gene contains regulatory elements that confer tissue specificity, differentiation dependence, and neuro-hormonal regulation to UCP1 gene transcription. Two main regions-a distal enhancer and a proximal promoter region-mediate transcriptional regulation through interactions with a plethora of transcription factors, including nuclear hormone receptors and cAMP-responsive transcription factors. Co-regulators, such as PGC-1α, play a pivotal role in the concerted regulation of UCP1 gene transcription. Multiple interactions of transcription factors and co-regulators at the promoter region of the UCP1 gene result in local chromatin remodeling, leading to activation and increased accessibility of RNA polymerase II and subsequent gene transcription. Moreover, a commonly occurring A-to-G polymorphism in close proximity to the UCP1 gene enhancer influences the extent of UCP1 gene transcription. Notably, it has been reported that specific aspects of obesity and associated metabolic diseases are associated with human population variability at this site. On another front, the unique properties of the UCP1 promoter region have been exploited to develop brown adipose tissue-specific gene delivery tools for experimental purposes.

  13. Gene expression in plant mitochondria: transcriptional and post-transcriptional control.

    PubMed Central

    Binder, Stefan; Brennicke, Axel

    2003-01-01

    The informational content of the mitochondrial genome in plants is, although small, essential for each cell. Gene expression in these organelles involves a number of distinct transcriptional and post-transcriptional steps. The complex post-transcriptional processes of plant mitochondria such as 5' and 3' RNA processing, intron splicing, RNA editing and controlled RNA stability extensively modify individual steady-state RNA levels and influence the mRNA quantities available for translation. In this overview of the processes in mitochondrial gene expression, we focus on confirmed and potential sites of regulatory interference and discuss the evolutionary origins of the transcriptional and post-transcriptional processes. PMID:12594926

  14. Post-transcriptional RNA Regulons Affecting Cell Cycle and Proliferation

    PubMed Central

    Blackinton, Jeff G.

    2014-01-01

    The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

  15. Quantitative characterization of gene regulation by Rho dependent transcription termination.

    PubMed

    Hussein, Razika; Lee, Tiffany Y; Lim, Han N

    2015-08-01

    Rho factor dependent transcription termination (RTT) is common within the coding sequences of bacterial genes and it acts to couple transcription and translation levels. Despite the importance of RTT for gene regulation, its effects on mRNA and protein concentrations have not been quantitatively characterized. Here we demonstrate that the exogenous cfp gene encoding the cyan fluorescent protein can serve as a model for gene regulation by RTT. This was confirmed by showing that Psu and bicyclomycin decrease RTT and increase full length cfp mRNAs (but remarkably they have little effect on protein production). We then use cfp to characterize the relationship between its protein and full length mRNA concentrations when the translation initiation rate is varied by sequence modifications of the translation initiation region (TIR). These experiments reveal that the fold change in protein concentration (RP) and the fold change in full length mRNA concentration (Rm) have the relationship RP≈Rm(b), where b is a constant. The average value of b was determined from three separate data sets to be ~3.6. We demonstrate that the above power law function can predict how altering the translation initiation rate of a gene in an operon will affect the mRNA concentrations of downstream genes and specify a lower bound for the associated changes in protein concentrations. In summary, this study defines a simple phenomenological model to help program expression from single genes and operons that are regulated by RTT, and to guide molecular models of RTT.

  16. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders

    PubMed Central

    Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C.; Lipska, Barbara K.; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R.; Kleinman, Joel E.; Hyde, Thomas M.

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders. PMID:26848839

  17. Marker gene tethering by nucleoporins affects gene expression in plants.

    PubMed

    Smith, Sarah; Galinha, Carla; Desset, Sophie; Tolmie, Frances; Evans, David; Tatout, Christophe; Graumann, Katja

    2015-01-01

    In non-plant systems, chromatin association with the nuclear periphery affects gene expression, where interactions with nuclear envelope proteins can repress and interactions with nucleoporins can enhance transcription. In plants, both hetero- and euchromatin can localize at the nuclear periphery, but the effect of proximity to the nuclear periphery on gene expression remains largely unknown. This study explores the putative function of Seh1 and Nup50a nucleoporins on gene expression by using the Lac Operator / Lac Repressor (LacI-LacO) system adapted to Arabidopsis thaliana. We used LacO fused to the luciferase reporter gene (LacO:Luc) to investigate whether binding of the LacO:Luc transgene to nucleoporin:LacI protein fusions alters luciferase expression. Two separate nucleoporin-LacI-YFP fusions were introduced into single insert, homozygous LacO:Luc Arabidopsis plants. Homozygous plants carrying LacO:Luc and a single insert of either Seh1-LacI-YFP or Nup50a-LacI-YFP were tested for luciferase activity and compared to plants containing LacO:Luc only. Seh1-LacI-YFP increased, while Nup50a-LacI-YFP decreased luciferase activity. Seh1-LacI-YFP accumulated at the nuclear periphery as expected, while Nup50a-LacI-YFP was nucleoplasmic and was not selected for further study. Protein and RNA levels of luciferase were quantified by western blotting and RT-qPCR, respectively. Increased luciferase activity in LacO:Luc+Seh1-LacI-YFP plants was correlated with increased luciferase protein and RNA levels. This change of luciferase expression was abolished by disruption of LacI-LacO binding by treating with IPTG in young seedlings, rosette leaves and inflorescences. This study suggests that association with the nuclear periphery is involved in the regulation of gene expression in plants.

  18. Spatially coordinated dynamic gene transcription in living pituitary tissue.

    PubMed

    Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael R H; Davis, Julian R E

    2016-02-01

    Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary 'on-off' process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour.

  19. Transcription of functionally related constitutive genes is not coordinated.

    PubMed

    Gandhi, Saumil J; Zenklusen, Daniel; Lionnet, Timothée; Singer, Robert H

    2011-01-01

    Expression of an individual gene can vary considerably among genetically identical cells because of stochastic fluctuations in transcription. However, proteins comprising essential complexes or pathways have similar abundances and lower variability. It is not known whether coordination in the expression of subunits of essential complexes occurs at the level of transcription, mRNA abundance or protein expression. To directly measure the level of coordination in the expression of genes, we used highly sensitive fluorescence in situ hybridization (FISH) to count individual mRNAs of functionally related and unrelated genes within single Saccharomyces cerevisiae cells. Our results revealed that transcript levels of temporally induced genes are highly correlated in individual cells. In contrast, transcription of constitutive genes encoding essential subunits of complexes is not coordinated because of stochastic fluctuations. The coordination of these functional complexes therefore must occur post-transcriptionally, and likely post-translationally.

  20. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  1. A Complete Set of Nascent Transcription Rates for Yeast Genes

    PubMed Central

    Pelechano, Vicent; Chávez, Sebastián; Pérez-Ortín, José E.

    2010-01-01

    The amount of mRNA in a cell is the result of two opposite reactions: transcription and mRNA degradation. These reactions are governed by kinetics laws, and the most regulated step for many genes is the transcription rate. The transcription rate, which is assumed to be exercised mainly at the RNA polymerase recruitment level, can be calculated using the RNA polymerase densities determined either by run-on or immunoprecipitation using specific antibodies. The yeast Saccharomyces cerevisiae is the ideal model organism to generate a complete set of nascent transcription rates that will prove useful for many gene regulation studies. By combining genomic data from both the GRO (Genomic Run-on) and the RNA pol ChIP-on-chip methods we generated a new, more accurate nascent transcription rate dataset. By comparing this dataset with the indirect ones obtained from the mRNA stabilities and mRNA amount datasets, we are able to obtain biological information about posttranscriptional regulation processes and a genomic snapshot of the location of the active transcriptional machinery. We have obtained nascent transcription rates for 4,670 yeast genes. The median RNA polymerase II density in the genes is 0.078 molecules/kb, which corresponds to an average of 0.096 molecules/gene. Most genes have transcription rates of between 2 and 30 mRNAs/hour and less than 1% of yeast genes have >1 RNA polymerase molecule/gene. Histone and ribosomal protein genes are the highest transcribed groups of genes and other than these exceptions the transcription of genes is an infrequent phenomenon in a yeast cell. PMID:21103382

  2. Transcriptional Regulation of Gene Expression in C. elegans

    PubMed Central

    Reinke, Valerie; Krause, Michael; Okkema, Peter

    2013-01-01

    Protein coding gene sequences are converted to mRNA by the highly regulated process of transcription. The precise temporal and spatial control of transcription for many genes is an essential part of development in metazoans. Thus, understanding the molecular mechanisms underlying transcriptional control is essential to understanding cell fate determination during embryogenesis, post-embryonic development, many environmental interactions, and disease-related processes. Studies of transcriptional regulation in C. elegans exploit its genomic simplicity and physical characteristics to define regulatory events with single cell and minute time scale resolution. When combined with the genetics of the system, C. elegans offers a unique and powerful vantage point from which to study how chromatin-associated protein and their modifications interact with transcription factors and their binding sites to yield precise control of gene expression through transcriptional regulation. PMID:23801596

  3. The relationship between gene transcription and combinations of histone modifications

    NASA Astrophysics Data System (ADS)

    Cui, Xiangjun; Li, Hong; Luo, Liaofu

    2012-09-01

    Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

  4. A R2R3-MYB transcription factor, GmMYB12B2, affects the expression levels of flavonoid biosynthesis genes encoding key enzymes in transgenic Arabidopsis plants.

    PubMed

    Li, Xiao-Wei; Li, Jing-Wen; Zhai, Ying; Zhao, Yan; Zhao, Xu; Zhang, Hai-Jun; Su, Lian-Tai; Wang, Ying; Wang, Qing-Yu

    2013-12-10

    Isoflavones play diverse roles in plant-microbe interactions and are potentially important for human nutrition and health. To study the regulation of isoflavonoid synthesis in soybean, the R2R3-MYB transcription factor GmMYB12B2 was isolated and characterized. Yeast expression experiments demonstrated that GmMYB12B2 showed transcriptional activity. GmMYB12B2 was localized in the nucleus when it was transiently expressed in onion epidermal cells. Real-time quantitative PCR analysis revealed that GmMYB12B2 transcription was increased in roots and mature seeds compared with other organs. The gene expression level in immature embryos was consistent with the accumulation of isoflavones. CHS8 is a key enzyme in plant flavonoid biosynthesis. Transient expression experiments in soybean calli demonstrated that CHS8 was regulated by GmMYB12B2 and produced more fluorescence. The expression levels of some key enzymes in flavonoid biosynthesis were examined in transgenic Arabidopsis lines. The results showed that the expression levels of PAL1, CHS and FLS in transgenic plants were significantly higher than those in wild type plants. However, the expression level of DFR was lower, and the expression levels of CHI, F3H and F3'H were the same in all lines. GmMYB12B2 expression caused a constitutive increase in the accumulation of flavonoids in transgenic Arabidopsis lines compared with wild type plants.

  5. Does inbreeding affect gene expression in birds?

    PubMed

    Hansson, Bengt; Naurin, Sara; Hasselquist, Dennis

    2014-09-01

    Inbreeding increases homozygosity, exposes genome-wide recessive deleterious alleles and often reduces fitness. The physiological and reproductive consequences of inbreeding may be manifested already during gene regulation, but the degree to which inbreeding influences gene expression is unknown in most organisms, including in birds. To evaluate the pattern of inbreeding-affected gene expression over the genome and in relation to sex, we performed a transcriptome-wide gene expression (10 695 genes) study of brain tissue of 10-day-old inbred and outbred, male and female zebra finches. We found significantly lower gene expression in females compared with males at Z-linked genes, confirming that dosage compensation is incomplete in female birds. However, inbreeding did not affect gene expression at autosomal or sex-linked genes, neither in males nor in females. Analyses of single genes again found a clear sex-biased expression at Z-linked genes, whereas only a single gene was significantly affected by inbreeding. The weak effect of inbreeding on gene expression in zebra finches contrasts to the situation, for example, in Drosophila where inbreeding has been found to influence gene expression more generally and at stress-related genes in particular.

  6. Natural antisense transcripts of Alzheimer's disease associated genes.

    PubMed

    Guo, Jin-Hu; Cheng, Hai-Peng; Yu, Long; Zhao, Shouyuan

    2006-04-01

    Natural antisense transcripts (NATs), also named endogenous antisense transcripts, are a class of genes whose role in controlling gene expression is becoming more and more relevant. NATs might play important roles in gene expression and translation regulation. Present work investigated the presence of NATs of Alzheimer's disease associated genes including PRESENILIN1, PRESENILIN2, BACE1, BACE2, APP, APOE, TAU (MAPT), PRION, alpha-SYNUCLEIN (SNCA), NICASTRIN, PEN2, APH1A, APH1B as well as CD147 (BASIGIN), and the results revealed that APP, BACE2, APH1A, TAU, CD147 and alpha-SYNUCLEIN contain natural antisense transcripts. These NATs were characterized according to the sense-antisense overlapping information and potential functional mechanisms were proposed. Present findings provide preliminary but important information about transcription regulation of AD associated genes, which would further our understanding of the gene expression regulation of AD, and also suggest a novel potential strategy for the therapy of AD.

  7. Characterization of transcript processing of the gene encoding precerebellin-1.

    PubMed

    Kavety, B; Morgan, J I

    1998-12-10

    Precerebellin-1 (Cbln1) is a cerebellum-specific protein that shares significant sequence identity with the globular domains of the complement components C1qA, B and C, suggesting some common aspects of function and/or structure. As the C1q complex is composed of heterotrimers of C1qA, B and C it was hypothesized that multiple precerebellins may exist in a ternary complex. Northern blotting for cbln1 revealed multiple bands that could represent further family members or alternatively spliced variants. To discriminate these alternatives, probes derived from different regions of the cbln1 gene were used to identify and clone the transcripts detected on Northern blots. Four independent transcripts were repeatedly cloned from an adult mouse cerebellum cDNA library. Upon sequencing, all of these clones were found to be derived from the cbln1 gene and no additional precerebellin-related genes were isolated. Moreover, these clones accounted for the four cbln1-hybridizing bands (1.9, 2. 2, 3.2 and 5.5 kb) detected on Northern blots of adult cerebellum RNA. With one possible exception, these clones were all derived through alterations in the 3'-untranslated region (3'-UTR) of cbln1 that did not affect the coding sequence. This was achieved by the use of two polyadenylation sites and alternative (non-canonical) splicing in the 3'-UTR. Some additional variation in mRNA structure is provided by the use of alternative transcription start sites in cbln1. The possible significance of this level of diversity in the 3'-UTR is discussed.

  8. Studying Gene Expression: Database Searches and Promoter Fusions to Investigate Transcriptional Regulation in Bacteria†

    PubMed Central

    Martinez-Vaz, Betsy M.; Makarevitch, Irina; Stensland, Shane

    2010-01-01

    A laboratory project was designed to illustrate how to search biological databases and utilize the information provided by these resources to investigate transcriptional regulation in Escherichia coli. The students searched several databases (NCBI Genomes, RegulonDB and EcoCyc) to learn about gene function, regulation, and the organization of transcriptional units. A fluorometer and GFP promoter fusions were used to obtain fluorescence data and measure changes in transcriptional activity. The class designed and performed experiments to investigate the regulation of genes necessary for biosynthesis of amino acids and how expression is affected by environmental signals and transcriptional regulators. Assessment data showed that this activity enhanced students’ knowledge of databases, reporter genes and transcriptional regulation. PMID:23653697

  9. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  10. Precisely modulated pathogenicity island interference with late phage gene transcription.

    PubMed

    Ram, Geeta; Chen, John; Ross, Hope F; Novick, Richard P

    2014-10-07

    Having gone to great evolutionary lengths to develop resistance to bacteriophages, bacteria have come up with resistance mechanisms directed at every aspect of the bacteriophage life cycle. Most genes involved in phage resistance are carried by plasmids and other mobile genetic elements, including bacteriophages and their relatives. A very special case of phage resistance is exhibited by the highly mobile phage satellites, staphylococcal pathogenicity islands (SaPIs), which carry and disseminate superantigen and other virulence genes. Unlike the usual phage-resistance mechanisms, the SaPI-encoded interference mechanisms are carefully crafted to ensure that a phage-infected, SaPI-containing cell will lyse, releasing the requisite crop of SaPI particles as well as a greatly diminished crop of phage particles. Previously described SaPI interference genes target phage functions that are not required for SaPI particle production and release. Here we describe a SaPI-mediated interference system that affects expression of late phage gene transcription and consequently is required for SaPI and phage. Although when cloned separately, a single SaPI gene totally blocks phage production, its activity in situ is modulated accurately by a second gene, achieving the required level of interference. The advantage for the host bacteria is that the SaPIs curb excessive phage growth while enhancing their gene transfer activity. This activity is in contrast to that of the clustered regularly interspaced short palindromic repeats (CRISPRs), which totally block phage growth at the cost of phage-mediated gene transfer. In staphylococci the SaPI strategy seems to have prevailed during evolution: The great majority of Staphylococcus aureus strains carry one or more SaPIs, whereas CRISPRs are extremely rare.

  11. Acetylation of RNA polymerase II regulates growth-factor-induced gene transcription in mammalian cells.

    PubMed

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S; Capra, John A; Schnölzer, Martina; Cole, Philip A; Geyer, Matthias; Bruneau, Benoit G; Adelman, Karen; Ott, Melanie

    2013-11-07

    Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes.

  12. Transcription Interference and ORF Nature Strongly Affect Promoter Strength in a Reconstituted Metabolic Pathway

    PubMed Central

    Carquet, Marie; Pompon, Denis; Truan, Gilles

    2015-01-01

    Fine tuning of individual enzyme expression level is necessary to alleviate metabolic imbalances in synthetic heterologous pathways. A known approach consists of choosing a suitable combination of promoters, based on their characterized strengths in model conditions. We questioned whether each step of a multiple-gene synthetic pathway could be independently tunable at the transcription level. Three open reading frames, coding for enzymes involved in a synthetic pathway, were combinatorially associated to different promoters on an episomal plasmid in Saccharomyces cerevisiae. We quantified the mRNA levels of the three genes in each strain of our generated combinatorial metabolic library. Our results evidenced that the ORF nature, position, and orientation induce strong discrepancies between the previously reported promoters’ strengths and the observed ones. We conclude that, in the context of metabolic reconstruction, the strength of usual promoters can be dramatically affected by many factors. Among them, transcriptional interference and ORF nature seem to be predominant. PMID:25767795

  13. Transcription mediated insulation and interference direct gene cluster expression switches

    PubMed Central

    Nguyen, Tania; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane

    2014-01-01

    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change. DOI: http://dx.doi.org/10.7554/eLife.03635.001 PMID:25407679

  14. Inactivation of transcription by UV irradiation of T. brucei provides evidence for a multicistronic transcription unit including a VSG gene

    SciTech Connect

    Johnson, P.J.; Kooter, J.M.; Borst, P.

    1987-10-23

    We have used inactivation of transcription by UV irradiation to map transcription units in trypanosomes. The relative inactivation rate of the transcription of mini-exon, 5S, and rRNA genes was inversely proportional to the previously estimated lengths of these transcription units. The telomeric transcription unit containing the gene for variant-specific surface glycoprotein (VSG) 221 was inactivated as a single unit of 60 kb. This long transcription unit comprises at least one other protein-coding gene and yields seven other stable mRNAs. These data thus provide evidence for a multicistronic transcription unit for cellular genes in a eukaryote.

  15. [Transcription start site determination in Stylonychia lemnae tubulin genes].

    PubMed

    Pimenov, A Iu

    2008-01-01

    Contemporary experimental literature concerning transcription regulation study contains a lot of inconsistencies between data on precise transcription start site position in tubulin genes of hypotrychious ciliates. We have revealed that the reason of these inconsistencies lies in the methods applied by scientists. In present study, the basic methods of transcription start site identification were analyzed. The modification of transcription start site identification method based on the analysis of sequencing and primer extension reactions products on the same PAA gel was elaborated using Stylonychia lemnae tubulin genes as a model object. The use ofnon-phosphorylated primers in sequencing reaction (in accordance with standard procedure) leads to the appearance of band shifting which causes mistakes in results evaluation. This band shifting can be eliminated by the use of primers phosphorylated by non-radioactive phosphorus. In present study we applied this method to redetermine transcription start sites in alpha1-, alpha2-, beta1- and beta2-tubulin genes of S. lemnae.

  16. Toxaphene affects the levels of mRNA transcripts that encode antioxidant enzymes in Hydra.

    PubMed

    Woo, Seonock; Lee, Aekyung; Won, Hyokyoung; Ryu, Jae-Chun; Yum, Seungshic

    2012-06-01

    We evaluated toxaphene-induced acute toxicity in Hydra magnipapillata. The median lethal concentrations of the animals (LC(50)) were determined to be 34.5 mg/L, 25.0 mg/L and 12.0 mg/L after exposure to toxaphene for 24 h, 48 h and 72 h, respectively. Morphological responses of hydra polyps to a range of toxaphene concentrations suggested that toxaphene negatively affects the nervous system of H. magnipapillata. We used real-time quantitative PCR of RNA extracted from polyps exposed to two concentrations of toxaphene (0.3 mg/L and 3 mg/L) for 24 h to evaluate the differential regulation of levels of transcripts that encode six antioxidant enzymes (CAT, G6PD, GPx, GR, GST and SOD), two proteins involved in detoxification and molecular stress responses (CYP1A and UB), and two proteins involved in neurotransmission and nerve cell differentiation (AChE and Hym-355). Of the genes involved in antioxidant responses, the most striking changes were observed for transcripts that encode GPx, G6PD, SOD, CAT and GST, with no evident change in levels of transcripts encoding GR. Levels of UB and CYP1A transcripts increased in a dose-dependent manner following exposure to toxaphene. Given that toxaphene-induced neurotoxicity was not reflected in the level of AChE transcripts and only slight accumulation of Hym-355 transcript was observed only at the higher of the two doses of toxaphene tested, there remains a need to identify transcriptional biomarkers for toxaphene-mediated neurotoxicity in H. magnipapillata. Transcripts that respond to toxaphene exposure could be valuable biomarkers for stress levels in H. magnipapillata and may be useful for monitoring the pollution of aquatic environments.

  17. Intracompartmental and intercompartmental transcriptional networks coordinate the expression of genes for organellar functions.

    PubMed

    Leister, Dario; Wang, Xi; Haberer, Georg; Mayer, Klaus F X; Kleine, Tatjana

    2011-09-01

    Genes for mitochondrial and chloroplast proteins are distributed between the nuclear and organellar genomes. Organelle biogenesis and metabolism, therefore, require appropriate coordination of gene expression in the different compartments to ensure efficient synthesis of essential multiprotein complexes of mixed genetic origin. Whereas organelle-to-nucleus signaling influences nuclear gene expression at the transcriptional level, organellar gene expression (OGE) is thought to be primarily regulated posttranscriptionally. Here, we show that intracompartmental and intercompartmental transcriptional networks coordinate the expression of genes for organellar functions. Nearly 1,300 ATH1 microarray-based transcriptional profiles of nuclear and organellar genes for mitochondrial and chloroplast proteins in the model plant Arabidopsis (Arabidopsis thaliana) were analyzed. The activity of genes involved in organellar energy production (OEP) or OGE in each of the organelles and in the nucleus is highly coordinated. Intracompartmental networks that link the OEP and OGE gene sets serve to synchronize the expression of nucleus- and organelle-encoded proteins. At a higher regulatory level, coexpression of organellar and nuclear OEP/OGE genes typically modulates chloroplast functions but affects mitochondria only when chloroplast functions are perturbed. Under conditions that induce energy shortage, the intercompartmental coregulation of photosynthesis genes can even override intracompartmental networks. We conclude that dynamic intracompartmental and intercompartmental transcriptional networks for OEP and OGE genes adjust the activity of organelles in response to the cellular energy state and environmental stresses, and we identify candidate cis-elements involved in the transcriptional coregulation of nuclear genes. Regarding the transcriptional regulation of chloroplast genes, novel tentative target genes of σ factors are identified.

  18. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    SciTech Connect

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-05-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. /sup 32/P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA.

  19. Higher plant mitochondrial DNA: Genomes, genes, mutants, transcription, translation

    SciTech Connect

    Not Available

    1986-01-01

    This volume contains brief summaries of 63 presentations given at the International Workshop on Higher Plant Mitochondrial DNA. The presentations are organized into topical discussions addressing plant genomes, mitochondrial genes, cytoplasmic male sterility, transcription, translation, plasmids and tissue culture. (DT)

  20. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-06-16

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  1. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  2. Modulation of Elk-dependent-transcription by Gene33.

    PubMed

    Keeton, Adam B; Messina, Joseph L

    2005-04-15

    Gene33 is a cytoplasmic protein expressed in many cell types, including those of renal and hepatic origin. Its expression is regulated by a large number of mitogenic and stressful stimuli, both in cultured cells and in vivo. Gene33 protein possesses binding domains for ErbB receptors, 14-3-3 proteins, SH-3 domains, and GTP bound Cdc42, suggesting that it may play a role in signal transduction. Indeed, these regions of Gene33 have been reported to modulate signaling through the ERK, JNK, and NFkappaB pathways. In the present work, epitope-tagged full-length and truncation mutants, as well as wild-type Gene33, were overexpressed in 293 cells. The expression of these proteins was compared to the level of endogenous Gene33 by Western blot using a newly developed polyclonal antibody. As proxies for activity of the ERK and JNK pathways, Elk- and c-Jun-dependent transcription were measured by a luciferase reporter gene. Moderate expression levels of full-length Gene33 caused a twofold increase in Elk-dependent transcription, while at higher levels, c-Jun-dependent transcription was partially inhibited. The C-terminal half of Gene33 significantly increased both Elk- and c-Jun-dependent transcription when expressed at approximately threefold above control levels. This effect on Elk-dependent transcription was lost at higher levels of Gene33 expression. In contrast, higher levels of the C-terminal half of Gene33 caused a progressively greater effect on c-Jun-dependent transcription. These findings suggest that Gene33 may increase ERK activity, and that the C-terminal half of Gene33 may act less specifically in the absence of the N-terminal half, inducing JNK activity.

  3. Landscape of post-transcriptional gene regulation during hepatitis C virus infection

    PubMed Central

    Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram

    2015-01-01

    Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065

  4. CrBPF1 overexpression alters transcript levels of terpenoid indole alkaloid biosynthetic and regulatory genes

    PubMed Central

    Li, Chun Yao; Leopold, Alex L.; Sander, Guy W.; Shanks, Jacqueline V.; Zhao, Le; Gibson, Susan I.

    2015-01-01

    Terpenoid indole alkaloid (TIA) biosynthesis in Catharanthus roseus is a complex and highly regulated process. Understanding the biochemistry and regulation of the TIA pathway is of particular interest as it may allow the engineering of plants to accumulate higher levels of pharmaceutically important alkaloids. Toward this end, we generated a transgenic C. roseus hairy root line that overexpresses the CrBPF1 transcriptional activator under the control of a β-estradiol inducible promoter. CrBPF1 is a MYB-like protein that was previously postulated to help regulate the expression of the TIA biosynthetic gene STR. However, the role of CrBPF1 in regulation of the TIA and related pathways had not been previously characterized. In this study, transcriptional profiling revealed that overexpression of CrBPF1 results in increased transcript levels for genes from both the indole and terpenoid biosynthetic pathways that provide precursors for TIA biosynthesis, as well as for genes in the TIA biosynthetic pathway. In addition, overexpression of CrBPF1 causes increases in the transcript levels for 11 out of 13 genes postulated to act as transcriptional regulators of genes from the TIA and TIA feeder pathways. Interestingly, overexpression of CrBPF1 causes increased transcript levels for both TIA transcriptional activators and repressors. Despite the fact that CrBPF1 overexpression affects transcript levels of a large percentage of TIA biosynthetic and regulatory genes, CrBPF1 overexpression has only very modest effects on the levels of the TIA metabolites analyzed. This finding may be due, at least in part, to the up-regulation of both transcriptional activators and repressors in response to CrBPF1 overexpression, suggesting that CrBPF1 may serve as a “fine-tune” regulator for TIA biosynthesis, acting to help regulate the timing and amplitude of TIA gene expression. PMID:26483828

  5. TransFind—predicting transcriptional regulators for gene sets

    PubMed Central

    Kiełbasa, Szymon M.; Klein, Holger; Roider, Helge G.; Vingron, Martin; Blüthgen, Nils

    2010-01-01

    The analysis of putative transcription factor binding sites in promoter regions of coregulated genes allows to infer the transcription factors that underlie observed changes in gene expression. While such analyses constitute a central component of the in-silico characterization of transcriptional regulatory networks, there is still a lack of simple-to-use web servers able to combine state-of-the-art prediction methods with phylogenetic analysis and appropriate multiple testing corrected statistics, which returns the results within a short time. Having these aims in mind we developed TransFind, which is freely available at http://transfind.sys-bio.net/. PMID:20511592

  6. Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

    PubMed Central

    Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

    2016-01-01

    The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

  7. Rampant polyuridylylation of plastid gene transcripts in the dinoflagellate Lingulodinium

    PubMed Central

    Wang, Yunling; Morse, David

    2006-01-01

    Dinoflagellate plastid genes are believed to be encoded on small generally unigenic plasmid-like minicircles. The minicircle gene complement has reached saturation with an incomplete set of plastid genes (18) compared with typical functional plastids (60–200). While some of the missing plastid genes have recently been found in the nucleus, it is still unknown if additional genes, not located on minicircles, might also contribute to the plastid genome. Sequencing of tailed RNA showed that transcripts derived from the known minicircle genes psbA and atpB contained a homogenous 3′ polyuridine tract of 25–40 residues. This unusual modification suggested that random sequencing of a poly(dA) primed cDNA library could be used to characterize the plastid transcriptome. We have recovered only 12 different polyuridylylated transcripts from our library, all of which are encoded on minicircles in several dinoflagellate species. The correspondence of all polyuridylylated transcripts with previously described minicircle genes thus supports the dinoflagellate plastid as harbouring the smallest genome of any functional chloroplast. Interestingly, northern blots indicate that the majority of transcripts are modified, suggesting that polyuridylylation is unlikely to act as a degradation signal as do the heterogeneous poly(A)-rich extensions of transcripts in cyanobacteria and other plastids. PMID:16434702

  8. Regulation of cytokine gene transcription in the immune system.

    PubMed

    Holloway, A F; Rao, S; Shannon, M F

    2002-01-01

    The controlled expression of cytokine genes is an essential component of an immune response. The specific types of cytokines as well as the time and place of their production is important in generating an appropriate immune response to an infectious agent. Aberrant expression is associated with pathological conditions of the immune system such as autoimmunity, atopy and chronic inflammation. Cytokine gene transcription is generally induced in a cell-specific manner. Over the last 15 years, a large amount of information has been generated describing the transcriptional controls that are exerted on cytokine genes. Recently, efforts have been directed at understanding how these genes are transcribed in a chromatin context. This review will discuss the mechanisms by which cytokine genes become available for transcription in a cell-restricted manner as well as the mechanisms by which these genes sense their environment and activate high level transcription in a transient manner. Particular attention will be paid to the role of chromatin in allowing transcription factor access to appropriate genes.

  9. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  10. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  11. Widespread transcription of a Qa region gene in adult mice

    PubMed Central

    1987-01-01

    The mouse MHC class I family includes genes encoded in four regions: H- 2K, H-2D, Qa and Tla. While K/D genes are well characterized, relatively little is known about Qa or Tla genes. We have studied the transcription of a B10.P Qa region gene. DNA sequence comparisons of the transmembrane region, supported by Southern blot analysis of cosmid and genomic DNAs from BALB/c and C57BL/10, demonstrate the lambda 3a gene corresponds to Q4p. In both Northern blots and RNA protection experiments using probes derived from the 3' noncoding region, we found that Q4, like the H-2K and H-2D genes, is widely transcribed in B10.P tissues. These data demonstrate for the first time widespread transcription of a Qa gene. PMID:2439640

  12. Antisense transcription as a tool to tune gene expression.

    PubMed

    Brophy, Jennifer A N; Voigt, Christopher A

    2016-01-14

    A surprise that has emerged from transcriptomics is the prevalence of genomic antisense transcription, which occurs counter to gene orientation. While frequent, the roles of antisense transcription in regulation are poorly understood. We built a synthetic system in Escherichia coli to study how antisense transcription can change the expression of a gene and tune the response characteristics of a regulatory circuit. We developed a new genetic part that consists of a unidirectional terminator followed by a constitutive antisense promoter and demonstrate that this part represses gene expression proportionally to the antisense promoter strength. Chip-based oligo synthesis was applied to build a large library of 5,668 terminator-promoter combinations that was used to control the expression of three repressors (PhlF, SrpR, and TarA) in a simple genetic circuit (NOT gate). Using the library, we demonstrate that antisense promoters can be used to tune the threshold of a regulatory circuit without impacting other properties of its response function. Finally, we determined the relative contributions of antisense RNA and transcriptional interference to repressing gene expression and introduce a biophysical model to capture the impact of RNA polymerase collisions on gene repression. This work quantifies the role of antisense transcription in regulatory networks and introduces a new mode to control gene expression that has been previously overlooked in genetic engineering.

  13. Glucocorticoid receptor represses proinflammatory genes at distinct steps of the transcription cycle.

    PubMed

    Gupte, Rebecca; Muse, Ginger W; Chinenov, Yurii; Adelman, Karen; Rogatsky, Inez

    2013-09-03

    Widespread anti-inflammatory actions of glucocorticoid hormones are mediated by the glucocorticoid receptor (GR), a ligand-dependent transcription factor of the nuclear receptor superfamily. In conjunction with its corepressor GR-interacting protein-1 (GRIP1), GR tethers to the DNA-bound activator protein-1 and NF-κB and represses transcription of their target proinflammatory cytokine genes. However, these target genes fall into distinct classes depending on the step of the transcription cycle that is rate-limiting for their activation: Some are controlled through RNA polymerase II (PolII) recruitment and initiation, whereas others undergo signal-induced release of paused elongation complexes into productive RNA synthesis. Whether these genes are differentially regulated by GR is unknown. Here we report that, at the initiation-controlled inflammatory genes in primary macrophages, GR inhibited LPS-induced PolII occupancy. In contrast, at the elongation-controlled genes, GR did not affect PolII recruitment or transcription initiation but promoted, in a GRIP1-dependent manner, the accumulation of the pause-inducing negative elongation factor. Consistently, GR-dependent repression of elongation-controlled genes was abolished specifically in negative elongation factor-deficient macrophages. Thus, GR:GRIP1 use distinct mechanisms to repress inflammatory genes at different stages of the transcription cycle.

  14. The murine Sry gene encodes a nuclear transcriptional activator

    SciTech Connect

    Dubin, R.A.; Ostrer, H.

    1994-09-01

    The Sry gene functions as a genetic switch in gonadal ridge initiating testis determination. The murine Sry and human SRY open reading frames (ORF) share a conserved 79 amino acid motif, the HMG-box, that binds DNA. Outside this region the two genes share no additional homology. These studies were undertaken to determine whether the Sry/SRY genes encode nuclear transcriptional regulators. As judged by the accumulation of lacZ-SRY hybrid proteins in the nucleus, both the human and murine SRY ORFs contain a nuclear localization signal. The murine Sry HMG-box selectively binds the sequence NACAAT in vitro when presented with a random pool of oligonucleotides and binds AACAAT with the highest affinity. The murine Sry ORF, when expressed in HeLa cells, activates transcription of a reporter gene containing multiple copies of the AACAAT binding site. Activation was observed for a GAL4-responsive gene when the murine Sry ORF was linked to the DNA-binding domain of GAL4. Using this system, the activation function was mapped to a C-terminal glutamine/histidine-rich domain. In addition, LexA-Sry fusion genes activated a LexA-responsive gene in yeast. In contrast, a GAL4-human SRY fusion gene did not cause transcriptional activation. These studies suggest that both the human and mouse SRY ORFs encode nuclear, DNA-binding proteins, and that the mouse Sry ORF can function as a transcriptional activator with separable DNA-binding and activator domains.

  15. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    SciTech Connect

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb

  16. Molecular weight abnormalities of the CTCF transcription factor: CTCF migrates aberrantly in SDS-PAGE and the size of the expressed protein is affected by the UTRs and sequences within the coding region of the CTCF gene.

    PubMed

    Klenova, E M; Nicolas, R H; U, S; Carne, A F; Lee, R E; Lobanenkov, V V; Goodwin, G H

    1997-02-01

    CTCF belongs to the Zn finger transcription factors family and binds to the promoter region of c-myc. CTCF is highly conserved between species, ubiquitous and localised in nuclei. The endogenous CTCF migrates as a 130 kDa (CTCF-130) protein on SDS-PAGE, however, the open reading frame (ORF) of the CTCF cDNA encodes only a 82 kDa protein (CTCF-82). In the present study we investigate this phenomenon and show with mass-spectra analysis that this occurs due to aberrant mobility of the CTCF protein. Another paradox is that our original cDNA, composed of the ORF and 3'-untranslated region (3'-UTR), produces a protein with the apparent molecular weight of 70 kDa (CTCF-70). This paradox has been found to be an effect of the UTRs and sequences within the coding region of the CTCF gene resulting in C-terminal truncation of CTCF-130. The potential attenuator has been identified and point-mutated. This restored the electrophoretic mobility of the CTCF protein to 130 kDa. CTCF-70, the aberrantly migrating CTCF N-terminus per se, is also detected in some cell types and therefore may have some biological implications. In particular, CTCF-70 interferes with CTCF-130 normal function, enhancing transactivation induced by CTCF-130 in COS6 cells. The mechanism of CTCF-70 action and other possible functions of CTCF-70 are discussed.

  17. Molecular weight abnormalities of the CTCF transcription factor: CTCF migrates aberrantly in SDS-PAGE and the size of the expressed protein is affected by the UTRs and sequences within the coding region of the CTCF gene.

    PubMed Central

    Klenova, E M; Nicolas, R H; U, S; Carne, A F; Lee, R E; Lobanenkov, V V; Goodwin, G H

    1997-01-01

    CTCF belongs to the Zn finger transcription factors family and binds to the promoter region of c-myc. CTCF is highly conserved between species, ubiquitous and localised in nuclei. The endogenous CTCF migrates as a 130 kDa (CTCF-130) protein on SDS-PAGE, however, the open reading frame (ORF) of the CTCF cDNA encodes only a 82 kDa protein (CTCF-82). In the present study we investigate this phenomenon and show with mass-spectra analysis that this occurs due to aberrant mobility of the CTCF protein. Another paradox is that our original cDNA, composed of the ORF and 3'-untranslated region (3'-UTR), produces a protein with the apparent molecular weight of 70 kDa (CTCF-70). This paradox has been found to be an effect of the UTRs and sequences within the coding region of the CTCF gene resulting in C-terminal truncation of CTCF-130. The potential attenuator has been identified and point-mutated. This restored the electrophoretic mobility of the CTCF protein to 130 kDa. CTCF-70, the aberrantly migrating CTCF N-terminus per se, is also detected in some cell types and therefore may have some biological implications. In particular, CTCF-70 interferes with CTCF-130 normal function, enhancing transactivation induced by CTCF-130 in COS6 cells. The mechanism of CTCF-70 action and other possible functions of CTCF-70 are discussed. PMID:9016583

  18. Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization

    PubMed Central

    Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R.

    2014-01-01

    In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria. PMID

  19. TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes.

    PubMed

    Matys, V; Kel-Margoulis, O V; Fricke, E; Liebich, I; Land, S; Barre-Dirrie, A; Reuter, I; Chekmenev, D; Krull, M; Hornischer, K; Voss, N; Stegmaier, P; Lewicki-Potapov, B; Saxel, H; Kel, A E; Wingender, E

    2006-01-01

    The TRANSFAC database on transcription factors, their binding sites, nucleotide distribution matrices and regulated genes as well as the complementing database TRANSCompel on composite elements have been further enhanced on various levels. A new web interface with different search options and integrated versions of Match and Patch provides increased functionality for TRANSFAC. The list of databases which are linked to the common GENE table of TRANSFAC and TRANSCompel has been extended by: Ensembl, UniGene, EntrezGene, HumanPSD and TRANSPRO. Standard gene names from HGNC, MGI and RGD, are included for human, mouse and rat genes, respectively. With the help of InterProScan, Pfam, SMART and PROSITE domains are assigned automatically to the protein sequences of the transcription factors. TRANSCompel contains now, in addition to the COMPEL table, a separate table for detailed information on the experimental EVIDENCE on which the composite elements are based. Finally, for TRANSFAC, in respect of data growth, in particular the gain of Drosophila transcription factor binding sites (by courtesy of the Drosophila DNase I footprint database) and of Arabidopsis factors (by courtesy of DATF, Database of Arabidopsis Transcription Factors) has to be stressed. The here described public releases, TRANSFAC 7.0 and TRANSCompel 7.0, are accessible under http://www.gene-regulation.com/pub/databases.html.

  20. Gene looping facilitates TFIIH kinase-mediated termination of transcription

    PubMed Central

    Medler, Scott; Ansari, Athar

    2015-01-01

    TFIIH is a general transcription factor with kinase and helicase activities. The kinase activity resides in the Kin28 subunit of TFIIH. The role of Kin28 kinase in the early steps of transcription is well established. Here we report a novel role of Kin28 in the termination of transcription. We show that RNAPII reads through a termination signal upon kinase inhibition. Furthermore, the recruitment of termination factors towards the 3′ end of a gene was compromised in the kinase mutant, thus confirming the termination defect. A concomitant decrease in crosslinking of termination factors near the 5′ end of genes was also observed in the kinase-defective mutant. Simultaneous presence of termination factors towards both the ends of a gene is indicative of gene looping; while the loss of termination factor occupancy from the distal ends suggest the abolition of a looped gene conformation. Accordingly, CCC analysis revealed that the looped architecture of genes was severely compromised in the Kin28 kinase mutant. In a looping defective sua7-1 mutant, even the enzymatically active Kin28 kinase could not rescue the termination defect. These results strongly suggest a crucial role of Kin28 kinase-dependent gene looping in the termination of transcription in budding yeast. PMID:26286112

  1. Spatially coordinated dynamic gene transcription in living pituitary tissue

    PubMed Central

    Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael RH; Davis, Julian RE

    2016-01-01

    Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary ‘on-off’ process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour. DOI: http://dx.doi.org/10.7554/eLife.08494.001 PMID:26828110

  2. Expression of a Mutant kcnj2 Gene Transcript in Zebrafish

    PubMed Central

    Leong, Ivone U. S.; Skinner, Jonathan R.; Shelling, Andrew N.; Love, Donald R.

    2013-01-01

    Long QT 7 syndrome (LQT7, also known as Andersen-Tawil syndrome) is a rare autosomal-dominant disorder that causes cardiac arrhythmias, periodic paralysis, and dysmorphic features. Mutations in the human KCNJ2 gene, which encodes for the subunit of the potassium inwardly-rectifying channel (IK1), have been associated with the disorder. The majority of mutations are considered to be dominant-negative as mutant proteins interact to limit the function of wild type KCNJ2 proteins. Several LQT7 syndrome mouse models have been created that vary in the physiological similarity to the human disease. To complement the LQT7 mouse models, we investigated the usefulness of the zebrafish as an alternative model via a transient approach. Initial bioinformatic analysis identified the zebrafish orthologue of the human KCNJ2 gene, together with a spatial expression profile that was similar to that of human. The expression of a kcnj2-12 transcript carrying an in-frame deletion of critical amino acids identified in human studies resulted in embryos that exhibited defects in muscle development, thereby affecting movement, a decrease in jaw size, pupil-pupil distance, and signs of scoliosis. These defects correspond to some phenotypes expressed by human LQT7 patients. PMID:27335675

  3. Combinatorial Gene Regulation through Kinetic Control of the Transcription Cycle.

    PubMed

    Scholes, Clarissa; DePace, Angela H; Sánchez, Álvaro

    2017-01-25

    Cells decide when, where, and to what level to express their genes by "computing" information from transcription factors (TFs) binding to regulatory DNA. How is the information contained in multiple TF-binding sites integrated to dictate the rate of transcription? The dominant conceptual and quantitative model is that TFs combinatorially recruit one another and RNA polymerase to the promoter by direct physical interactions. Here, we develop a quantitative framework to explore kinetic control, an alternative model in which combinatorial gene regulation can result from TFs working on different kinetic steps of the transcription cycle. Kinetic control can generate a wide range of analog and Boolean computations without requiring the input TFs to be simultaneously bound to regulatory DNA. We propose experiments that will illuminate the role of kinetic control in transcription and discuss implications for deciphering the cis-regulatory "code."

  4. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

    EPA Science Inventory

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  5. Transcriptional regulation of the novobiocin biosynthetic gene cluster.

    PubMed

    Dangel, Volker; Härle, Johannes; Goerke, Christiane; Wolz, Christiane; Gust, Bertolt; Pernodet, Jean-Luc; Heide, Lutz

    2009-12-01

    The aminocoumarin antibiotic novobiocin is a gyrase inhibitor formed by a Streptomyces strain. The biosynthetic gene cluster of novobiocin spans 23.4 kb and contains 20 coding sequences, among them the two regulatory genes novE and novG. We investigated the location of transcriptional promoters within this cluster by insertion of transcriptional terminator cassettes and RT-PCR analysis of the resulting mutants. The cluster was found to contain eight DNA regions with promoter activity. The regulatory protein NovG binds to a previously identified binding site within the promoter region located upstream of novH, but apparently not to any of the other seven promoters. Quantitative real-time PCR was used to compare the number of transcripts in a strain carrying an intact novobiocin cluster with strains carrying mutated clusters. Both in-frame deletion of the regulatory gene novG and insertion of a terminator cassette into the biosynthetic gene novH led to a strong reduction of the number of transcripts of the genes located between novH and novW. This suggested that these 16 biosynthetic genes form a single operon. Three internal promoters are located within this operon but appear to be of minor importance, if any, under our experimental conditions. Transcription of novG was found to depend on the presence of NovE, suggesting that the two regulatory genes, novE and novG, act in a cascade-like mechanism. The resistance gene gyrB(R), encoding an aminocoumarin-resistant gyrase B subunit, may initially be co-transcribed with the genes from novH to novW. However, when the gyrase inhibitor novobiocin accumulates in the cultures, gyrB(R) is transcribed from its own promoter. Previous work has suggested that this promoter is controlled by the superhelical density of chromosomal DNA.

  6. Transcription of Inflammatory Genes: Long Noncoding RNA and Beyond

    PubMed Central

    Carpenter, Susan

    2015-01-01

    The innate immune system must coordinate elaborate signaling pathways to turn on expression of hundreds of genes to provide protection against pathogens and resolve acute inflammation. Multiple genes within distinct functional categories are coordinately and temporally regulated by transcriptional on and off switches in response to distinct external stimuli. Three classes of transcription factors act together with transcriptional coregulators and chromatin-modifying complexes to control these programs. In addition, newer studies implicate long noncoding RNA (lncRNA) as additional regulators of these responses. LncRNAs promote, fine-tune, and restrain the inflammatory program. In this study, we provide an overview of gene regulation and the emerging importance of lncRNAs in the immune system. PMID:25250698

  7. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-05

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases.

  8. Transcriptional targeting of tumor endothelial cells for gene therapy

    PubMed Central

    Dong, Zhihong; Nör, Jacques E.

    2009-01-01

    It is well known that angiogenesis plays a critical role in the pathobiology of tumors. Recent clinical trials have shown that inhibition of angiogenesis can be an effective therapeutic strategy for patients with cancer. However, one of the outstanding issues in anti-angiogenic treatment for cancer is the development of toxicities related to off-target effects of drugs. Transcriptional targeting of tumor endothelial cells involves the use of specific promoters for selective expression of therapeutic genes in the endothelial cells lining the blood vessels of tumors. Recently, several genes that are expressed specifically in tumor-associated endothelial cells have been identified and characterized. These discoveries have enhanced the prospectus of transcriptionaly targeting tumor endothelial cells for cancer gene therapy. In this manuscript, we review the promoters, vectors, and therapeutic genes that have been used for transcriptional targeting of tumor endothelial cells, and discuss the prospects of such approaches for cancer gene therapy. PMID:19393703

  9. Reference genes for normalizing transcription in diploid and tetraploid Arabidopsis.

    PubMed

    Wang, Haibin; Wang, Jingjing; Jiang, Jiafu; Chen, Sumei; Guan, Zhiyong; Liao, Yuan; Chen, Fadi

    2014-10-27

    Published transcription data from a set of 19 diploid Arabidopsis thaliana and 5 tetraploid (3 allo- and 2 auto- tetraploid) Arabidopsis accessions were re-analysed to identify reliable reference genes for normalization purposes. Five conventional and 16 novel reference genes previously derived from microarray data covering a wide range of abundance in absolute expression levels in diploid A. thaliana Col-0 were employed. Transcript abundance was well conserved for all 21 potential reference genes in the diploid A. thaliana accessions, with geNorm and NormFinder analysis indicating that AT5G46630, AT1G13320, AT4G26410, AT5G60390 and AT5G08290 were the most stable. However, conservation was less good among the tetraploid accessions, with the transcription of seven of the 21 genes being undetectable in all allotetraploids. The most stable gene was AT5G46630, while AT1G13440 was the unstable one. Hence, the choice of reference gene(s) for A. thaliana is quite wide, but with respect to the analysis of transcriptomic data derived from the tetraploids, it is probably necessary to select more than one reference gene.

  10. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo

    2016-01-01

    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  11. The WRKY Transcription Factor WRKY71/EXB1 Controls Shoot Branching by Transcriptionally Regulating RAX Genes in Arabidopsis

    PubMed Central

    Guo, Dongshu; Zhang, Jinzhe; Wang, Xinlei; Han, Xiang; Wei, Baoye; Yu, Hao; Huang, Qingpei

    2015-01-01

    Plant shoot branching is pivotal for developmental plasticity and crop yield. The formation of branch meristems is regulated by several key transcription factors including REGULATOR OF AXILLARY MERISTEMS1 (RAX1), RAX2, and RAX3. However, the regulatory network of shoot branching is still largely unknown. Here, we report the identification of EXCESSIVE BRANCHES1 (EXB1), which affects axillary meristem (AM) initiation and bud activity. Overexpression of EXB1 in the gain-of-function mutant exb1-D leads to severe bushy and dwarf phenotypes, which result from excessive AM initiation and elevated bud activities. EXB1 encodes the WRKY transcription factor WRKY71, which has demonstrated transactivation activities. Disruption of WRKY71/EXB1 by chimeric repressor silencing technology leads to fewer branches, indicating that EXB1 plays important roles in the control of shoot branching. We demonstrate that EXB1 controls AM initiation by positively regulating the transcription of RAX1, RAX2, and RAX3. Disruption of the RAX genes partially rescues the branching phenotype caused by EXB1 overexpression. We further show that EXB1 also regulates auxin homeostasis in control of shoot branching. Our data demonstrate that EXB1 plays pivotal roles in shoot branching by regulating both transcription of RAX genes and auxin pathways. PMID:26578700

  12. Transcription, chromatin condensation, and gene migration

    PubMed Central

    2009-01-01

    The binding of fluorescently tagged proteins to tandem DNA arrays has been instrumental in understanding nuclear organization and function. Through the use of more natural tandem DNA arrays, Hu et al. (Hu, Y., I. Kireev, M. Plutz, N. Ashourian, and A.S. Belmont. 2009. J. Cell Biol. 185:87–100) gain new insights into chromatin organization and dynamics, and into the association of splicing factors with active genes. PMID:19349577

  13. Simultaneous live imaging of the transcription and nuclear position of specific genes

    PubMed Central

    Ochiai, Hiroshi; Sugawara, Takeshi; Yamamoto, Takashi

    2015-01-01

    The relationship between genome organization and gene expression has recently been established. However, the relationships between spatial organization, dynamics, and transcriptional regulation of the genome remain unknown. In this study, we developed a live-imaging method for simultaneous measurements of the transcriptional activity and nuclear position of endogenous genes, which we termed the ‘Real-time Observation of Localization and EXpression (ROLEX)’ system. We demonstrated that ROLEX is highly specific and does not affect the expression level of the target gene. ROLEX enabled detection of sub-genome-wide mobility changes that depended on the state of Nanog transactivation in embryonic stem cells. We believe that the ROLEX system will become a powerful tool for exploring the relationship between transcription and nuclear dynamics in living cells. PMID:26092696

  14. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro

    2017-01-01

    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  15. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

    PubMed Central

    Naito, Yuki; Bono, Hidemasa

    2012-01-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

  16. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

    PubMed

    Naito, Yuki; Bono, Hidemasa

    2012-07-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

  17. BRCA1 transcriptionally regulates genes involved in breast tumorigenesis

    PubMed Central

    Welcsh, Piri L.; Lee, Ming K.; Gonzalez-Hernandez, Rachel M.; Black, Daniel J.; Mahadevappa, Mamatha; Swisher, Elizabeth M.; Warrington, Janet A.; King, Mary-Claire

    2002-01-01

    Loss of function of BRCA1 caused by inherited mutation and tissue-specific somatic mutation leads to breast and ovarian cancer. Nearly all BRCA1 germ-line mutations involve truncation or loss of the C-terminal BRCT transcriptional activation domain, suggesting that transcriptional regulation is a critical function of the wild-type gene. The purpose of this project was to determine whether there is a link between the role of BRCA1 in transcriptional regulation and its role in tumor suppression. We developed a cell line (in which BRCA1 can be induced) and used microarray analysis to compare transcription profiles of epithelial cells with low endogenous levels of BRCA1 vs. transcription profiles of cells with 2–4-fold higher induced levels of expression of BRCA1. At these levels of expression, BRCA1 did not induce apoptosis. Undirected cluster analysis of six paired experiments revealed 373 genes, the expression of which was altered significantly and consistently by BRCA1 induction. Expression of 62 genes was altered more than 2-fold. BRCA1-regulated genes associated with breast tumorigenesis included the estrogen-responsive genes MYC and cyclin D1, which are overexpressed in many breast tumors; STAT1 and JAK1, key components of the cytokine signal transduction pathway; the extracellular matrix protein laminin 3A; ID4, an inhibitor of DNA-binding transcriptional activators, which in turn negatively regulates BRCA1 expression; and the prohormone stanniocalcin, expression of which is lost in breast tumor cells. Coordinated expression of BRCA1 with ID4 and with stanniocalcin was confirmed in primary breast and ovarian tumors. PMID:12032322

  18. Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors.

    PubMed

    Thiel, Gerald; Rössler, Oliver G

    2017-03-01

    Resveratrol (trans-3,4',5-trihydroxystilbene), a polyphenolic phytoalexin of grapes and other fruits and plants, is a common constituent of our diet and of dietary supplements. Many health-promoting benefits have been connected with resveratrol in the treatment of cardiovascular diseases, cancer, diabetes, inflammation, neurodegeneration, and diseases connected with aging. To explain the pleiotropic effects of resveratrol, the molecular targets of this compound have to be identified on the cellular level. Resveratrol induces intracellular signal transduction pathways which ultimately lead to changes in the gene expression pattern of the cells. Here, we review the effect of resveratrol on the activation of the stimulus-responsive transcription factors CREB, AP-1, Egr-1, Elk-1, and Nrf2. Following activation, these transcription factors induce transcription of delayed response genes. The gene products of these delayed response genes are ultimately responsible for the changes in the biochemistry and physiology of resveratrol-treated cells. The activation of stimulus-responsive transcription factors may explain many of the intracellular activities of resveratrol. However, results obtained in vitro may not easily be transferred to in vivo systems.

  19. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    PubMed

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  20. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    PubMed Central

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  1. Transcript analysis of 250 novel yeast genes from chromosome XIV.

    PubMed

    Planta, R J; Brown, A J; Cadahia, J L; Cerdan, M E; de Jonge, M; Gent, M E; Hayes, A; Kolen, C P; Lombardia, L J; Sefton, M; Oliver, S G; Thevelein, J; Tournu, H; van Delft, Y J; Verbart, D J; Winderickx, J

    1999-03-15

    The European Functional Analysis Network (EUROFAN) is systematically analysing the function of novel Saccharomyces cerevisiae genes revealed by genome sequencing. As part of this effort our consortium has performed a detailed transcript analysis for 250 novel ORFs on chromosome XIV. All transcripts were quantified by Northern analysis under three quasi-steady-state conditions (exponential growth on rich fermentative, rich non-fermentative, and minimal fermentative media) and eight transient conditions (glucose derepression, glucose upshift, stationary phase, nitrogen starvation, osmo-stress, heat-shock, and two control conditions). Transcripts were detected for 82% of the 250 ORFs, and only one ORF did not yield a transcript of the expected length (YNL285w). Transcripts ranged from low (62%), moderate (16%) to high abundance (2%) relative to the ACT1 mRNA. The levels of 73% of the 206 chromosome XIV transcripts detected fluctuated in response to the transient states tested. However, only a small number responded strongly to the transients: eight ORFs were induced upon glucose upshift; five were repressed by glucose; six were induced in response to nitrogen starvation; three were induced in stationary phase; five were induced by osmo-stress; four were induced by heat-shock. These data provide useful clues about the general function of these ORFs and add to our understanding of gene regulation on a genome-wide basis.

  2. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  3. Tracing the dynamics of gene transcripts after organismal death

    PubMed Central

    2017-01-01

    In life, genetic and epigenetic networks precisely coordinate the expression of genes—but in death, it is not known if gene expression diminishes gradually or abruptly stops or if specific genes and pathways are involved. We studied this by identifying mRNA transcripts that apparently increase in relative abundance after death, assessing their functions, and comparing their abundance profiles through postmortem time in two species, mouse and zebrafish. We found mRNA transcript profiles of 1063 genes became significantly more abundant after death of healthy adult animals in a time series spanning up to 96 h postmortem. Ordination plots revealed non-random patterns in the profiles by time. While most of these transcript levels increased within 0.5 h postmortem, some increased only at 24 and 48 h postmortem. Functional characterization of the most abundant transcripts revealed the following categories: stress, immunity, inflammation, apoptosis, transport, development, epigenetic regulation and cancer. The data suggest a step-wise shutdown occurs in organismal death that is manifested by the apparent increase of certain transcripts with various abundance maxima and durations. PMID:28123054

  4. Angiotensin II-regulated transcription regulatory genes in adrenal steroidogenesis.

    PubMed

    Romero, Damian G; Gomez-Sanchez, Elise P; Gomez-Sanchez, Celso E

    2010-11-29

    Transcription regulatory genes are crucial modulators of cell physiology and metabolism whose intracellular levels are tightly controlled in response to extracellular stimuli. We previously reported a set of 29 transcription regulatory genes modulated by angiotensin II in H295R human adrenocortical cells and their roles in regulating the expression of the last and unique enzymes of the glucocorticoid and mineralocorticoid biosynthetic pathways, 11β-hydroxylase and aldosterone synthase, respectively, using gene expression reporter assays. To study the effect of this set of transcription regulatory genes on adrenal steroidogenesis, H295R cells were transfected by high-efficiency nucleofection and aldosterone and cortisol were measured in cell culture supernatants under basal and angiotensin II-stimulated conditions. BCL11B, BHLHB2, CITED2, ELL2, HMGA1, MAFF, NFIL3, PER1, SERTAD1, and VDR significantly stimulated aldosterone secretion, while EGR1, FOSB, and ZFP295 decreased aldosterone secretion. BTG2, HMGA1, MITF, NR4A1, and ZFP295 significantly increased cortisol secretion, while BCL11B, NFIL3, PER1, and SIX2 decreased cortisol secretion. We also report the effect of some of these regulators on the expression of endogenous aldosterone synthase and 11β-hydroxylase under basal and angiotensin II-stimulated conditions. In summary, this study reports for the first time the effects of a set of angiotensin II-modulated transcription regulatory genes on aldosterone and cortisol secretion and the expression levels of the last and unique enzymes of the mineralocorticoid and glucocorticoid biosynthetic pathways. Abnormal regulation of mineralocorticoid or glucocorticoid secretion is involved in several pathophysiological conditions. These transcription regulatory genes may be involved in adrenal steroidogenesis pathologies; thus they merit additional study as potential candidates for therapeutic intervention.

  5. The transcriptional regulation of the human CYP2C genes

    PubMed Central

    Chen, Yuping; Goldstein, Joyce A.

    2010-01-01

    In humans, four members of the CYP2C subfamily (CYP2C8, CYP2C9, CYP2C18, and CYP2C19) metabolize more than 20% of all therapeutic drugs as well as a number of endogenous compounds. The CYP2C enzymes are found predominantly in the liver, where they comprise ∼20% of the total cytochrome P450. A variety of xenobiotics such as phenobarbital, rifampicin, and hyperforin have been shown to induce the transcriptional expression of CYP2C genes in primary human hepatocytes and to increase the metabolism of CYP2C substrates in vivo in man. This induction can result in drug-drug interactions, drug tolerance, and therapeutic failure. Several drug-activated nuclear receptors including CAR, PXR, VDR, and GR recognize drug responsive elements within the 5′ flanking promoter region of CYP2C genes to mediate the transcriptional upregulation of these genes in response to xenobiotics and steroids. Other nuclear receptors and transcriptional factors including HNF4α, HNF3γ, C/EBPα and more recently RORs, have been reported to regulate the constitutive expression of CYP2C genes in liver. The maximum transcriptional induction of CYP2C genes appears to be achieved through a coordinative cross-talk between drug responsive nuclear receptors, hepatic factors, and coactivators. The transcriptional regulatory mechanisms of the expression of CYP2C genes in extrahepatic tissues has received less study, but these may be altered by perturbations from pathological conditions such as ischemia as well as some of the receptors mentioned above. PMID:19702536

  6. Sequential Logic Model Deciphers Dynamic Transcriptional Control of Gene Expressions

    PubMed Central

    Yeo, Zhen Xuan; Wong, Sum Thai; Arjunan, Satya Nanda Vel; Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar; Giuliani, Alessandro; Tsuchiya, Masa

    2007-01-01

    Background Cellular signaling involves a sequence of events from ligand binding to membrane receptors through transcription factors activation and the induction of mRNA expression. The transcriptional-regulatory system plays a pivotal role in the control of gene expression. A novel computational approach to the study of gene regulation circuits is presented here. Methodology Based on the concept of finite state machine, which provides a discrete view of gene regulation, a novel sequential logic model (SLM) is developed to decipher control mechanisms of dynamic transcriptional regulation of gene expressions. The SLM technique is also used to systematically analyze the dynamic function of transcriptional inputs, the dependency and cooperativity, such as synergy effect, among the binding sites with respect to when, how much and how fast the gene of interest is expressed. Principal Findings SLM is verified by a set of well studied expression data on endo16 of Strongylocentrotus purpuratus (sea urchin) during the embryonic midgut development. A dynamic regulatory mechanism for endo16 expression controlled by three binding sites, UI, R and Otx is identified and demonstrated to be consistent with experimental findings. Furthermore, we show that during transition from specification to differentiation in wild type endo16 expression profile, SLM reveals three binary activities are not sufficient to explain the transcriptional regulation of endo16 expression and additional activities of binding sites are required. Further analyses suggest detailed mechanism of R switch activity where indirect dependency occurs in between UI activity and R switch during specification to differentiation stage. Conclusions/Significance The sequential logic formalism allows for a simplification of regulation network dynamics going from a continuous to a discrete representation of gene activation in time. In effect our SLM is non-parametric and model-independent, yet providing rich biological

  7. Gene Isoform Specificity through Enhancer-Associated Antisense Transcription

    PubMed Central

    Onodera, Courtney S.; Underwood, Jason G.; Katzman, Sol; Jacobs, Frank; Greenberg, David; Salama, Sofie R.; Haussler, David

    2012-01-01

    Enhancers and antisense RNAs play key roles in transcriptional regulation through differing mechanisms. Recent studies have demonstrated that enhancers are often associated with non-coding RNAs (ncRNAs), yet the functional role of these enhancer:ncRNA associations is unclear. Using RNA-Sequencing to interrogate the transcriptomes of undifferentiated mouse embryonic stem cells (mESCs) and their derived neural precursor cells (NPs), we identified two novel enhancer-associated antisense transcripts that appear to control isoform-specific expression of their overlapping protein-coding genes. In each case, an enhancer internal to a protein-coding gene drives an antisense RNA in mESCs but not in NPs. Expression of the antisense RNA is correlated with expression of a shorter isoform of the associated sense gene that is not present when the antisense RNA is not expressed. We demonstrate that expression of the antisense transcripts as well as expression of the short sense isoforms correlates with enhancer activity at these two loci. Further, overexpression and knockdown experiments suggest the antisense transcripts regulate expression of their associated sense genes via cis-acting mechanisms. Interestingly, the protein-coding genes involved in these two examples, Zmynd8 and Brd1, share many functional domains, yet their antisense ncRNAs show no homology to each other and are not present in non-murine mammalian lineages, such as the primate lineage. The lack of homology in the antisense ncRNAs indicates they have evolved independently of each other and suggests that this mode of lineage-specific transcriptional regulation may be more widespread in other cell types and organisms. Our findings present a new view of enhancer action wherein enhancers may direct isoform-specific expression of genes through ncRNA intermediates. PMID:22937057

  8. Transient Phenomena in Gene Expression after Induction of Transcription

    PubMed Central

    Deneke, Carlus; Rudorf, Sophia; Valleriani, Angelo

    2012-01-01

    When transcription of a gene is induced by a stimulus, the number of its mRNA molecules changes with time. Here we discuss how this time evolution depends on the shape of the mRNA lifetime distribution. Analysis of the statistical properties of this change reveals transient effects on polysomes, ribosomal profiles, and rate of protein synthesis. Our studies reveal that transient phenomena in gene expression strongly depend on the specific form of the mRNA lifetime distribution. PMID:22558114

  9. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  10. Inferring transcription factor collaborations in gene regulatory networks

    PubMed Central

    2014-01-01

    Background Living cells are realized by complex gene expression programs that are moderated by regulatory proteins called transcription factors (TFs). The TFs control the differential expression of target genes in the context of transcriptional regulatory networks (TRNs), either individually or in groups. Deciphering the mechanisms of how the TFs control the expression of target genes is a challenging task, especially when multiple TFs collaboratively participate in the transcriptional regulation. Results We model the underlying regulatory interactions in terms of the directions (activation or repression) and their logical roles (necessary and/or sufficient) with a modified association rule mining approach, called mTRIM. The experiment on Yeast discovered 670 regulatory interactions, in which multiple TFs express their functions on common target genes collaboratively. The evaluation on yeast genetic interactions, TF knockouts and a synthetic dataset shows that our algorithm is significantly better than the existing ones. Conclusions mTRIM is a novel method to infer TF collaborations in transcriptional regulation networks. mTRIM is available at http://www.msu.edu/~jinchen/mTRIM. PMID:24565025

  11. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae

    PubMed Central

    Rantasalo, Anssi; Czeizler, Elena; Virtanen, Riitta; Rousu, Juho; Lähdesmäki, Harri; Penttilä, Merja

    2016-01-01

    This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF) onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1) the transcription-activation domain of the sTF, 2) the binding-site modules in the output promoter, and 3) the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications. PMID:26901642

  12. Transcription Profiling and Mutation Detection of Soybean Homoeologous Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The soybean genome maintains numerous gene duplications, many of which are derived from ancient large-scale duplication. We are interested in exploring the evolutionary fate of duplicated genes and the extent to which gene duplication affects selectable trait variation. We are applying quantitative ...

  13. Transcription without XPB Establishes a Unified Helicase-Independent Mechanism of Promoter Opening in Eukaryotic Gene Expression.

    PubMed

    Alekseev, Sergey; Nagy, Zita; Sandoz, Jérémy; Weiss, Amélie; Egly, Jean-Marc; Le May, Nicolas; Coin, Frederic

    2017-02-02

    Transcription starts with the assembly of pre-initiation complexes on promoters followed by their opening. Current models suggest that class II gene transcription requires ATP and the TFIIH XPB subunit to open a promoter. Here, we observe that XPB depletion surprisingly leaves transcription virtually intact. In contrast, inhibition of XPB ATPase activity affects transcription, revealing that mRNA expression paradoxically accommodates the absence of XPB while being sensitive to the inhibition of its ATPase activity. The XPB-depleted TFIIH complex is recruited to active promoters and contributes to transcription. We finally demonstrate that the XPB ATPase activity is only used to relieve a transcription initiation block imposed by XPB itself. In the absence of this block, transcription initiation can take place without XPB ATPase activity. These results suggest that a helicase is dispensable for mRNA transcription, thereby unifying the mechanism of promoter DNA opening for the three eukaryotic RNA polymerases.

  14. Transcript profiling of Eucalyptus xylem genes during tension wood formation.

    PubMed

    Paux, Etienne; Carocha, Víctor; Marques, Cristina; Mendes de Sousa, António; Borralho, Nuno; Sivadon, Pierre; Grima-Pettenati, Jacqueline

    2005-07-01

    Tension wood formed in response to gravitational force is a striking example of the plasticity of angiosperm wood. In this study our goal was to characterize the early changes in gene expression during tension wood formation in Eucalyptus. Using cDNA array technology, transcript profiling of 231 genes preferentially expressed in differentiating Eucalyptus xylem was followed from 6 h to 1 wk of a tension time course of artificially bent Eucalyptus trees. 196 genes were differentially regulated between control and bent trees, some exhibiting distinctive expression patterns related to changes in secondary cell wall structure and composition. For instance, expression of a cellulose synthase gene was well correlated with the appearance of the G-layers. Cluster correlation analysis revealed differential regulation of lignin biosynthetic genes and may also be used to help infer the function of unknown gene products. Eucalyptus wood transcriptome analysis during tension wood formation not only provided new clues into the transcriptional regulatory network of genes preferentially expressed in xylem, but also highlighted candidate genes responsible for the genetic and environmentally induced variation of wood quality traits.

  15. High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

    PubMed Central

    Sidarovich, Viktoryia; Adami, Valentina; Quattrone, Alessandro

    2015-01-01

    Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3' untranslated region (3’ UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3’ UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3’ UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3’ UTR. PMID:25867708

  16. Transcriptional activation of virulence genes of Rhizobium etli.

    PubMed

    Wang, Luyao; Lacroix, Benoît; Guo, Jianhua; Citovsky, Vitaly

    2017-01-09

    Recently, Rhizobium etli has emerged, in addition to Agrobacterium spp., as a prokaryotic species that encodes a functional machinery for DNA transfer to plant cells. To understand this R. etli-mediated genetic transformation, it would be useful to define how its vir genes respond to the host plants. Here, we explored the transcriptional activation of the vir genes contained on the R. etli p42a plasmid. Using a reporter construct harboring lacZ under the control of the R. etli virE promoter, we showed that the signal phenolic molecule acetosyringone (AS) induced R. etli vir gene expression both in R. etli and in A. tumefaciens background. Furthermore, in both bacterial backgrounds, the p42a plasmid also promoted plant genetic transformation with a reporter T-DNA. Importantly, the R. etli vir genes were transcriptionally activated by AS in a bacterial species-specific fashion in regard to the VirA/VirG signal sensor system, and this activation was induced by signals from the natural host species of this bacterium, but not from non-host plants. Early kinetics of transcriptional activation of the major vir genes of R. etli also revealed several features distinct from those known for A. tumefaciens: the expression of the virG gene reached saturation relatively quickly, and virB2, which in R. etli is located outside of the virB operon, was expressed only at low levels and did not respond to AS. These differences in vir gene transcription may contribute to the lower efficiency of T-DNA transfer of R. etli p42a versus pTiC58 of A. tumefaciens IMPORTANCE: The region encoding homologs of Agrobacterium tumefaciens virulence genes in the Rhizobium etli CE3 p42a plasmid was the first endogenous virulence system encoded by a non-Agrobacterium species demonstrated to be functional in DNA transfer and stable integration into plant cell genome. In this study, we explore the transcriptional regulation and induction of virulence genes in R. etli and show similarities and differences

  17. NELF Potentiates Gene Transcription in the Drosophila Embryo

    PubMed Central

    Wang, Xiaoling; Hang, Saiyu; Prazak, Lisa; Gergen, J. Peter

    2010-01-01

    A hallmark of genes that are subject to developmental regulation of transcriptional elongation is association of the negative elongation factor NELF with the paused RNA polymerase complex. Here we use a combination of biochemical and genetic experiments to investigate the in vivo function of NELF in the Drosophila embryo. NELF associates with different gene promoter regions in correlation with the association of RNA polymerase II (Pol II) and the initial activation of gene expression during the early stages of embryogenesis. Genetic experiments reveal that maternally provided NELF is required for the activation, rather than the repression of reporter genes that emulate the expression of key developmental control genes. Furthermore, the relative requirement for NELF is dictated by attributes of the flanking cis-regulatory information. We propose that NELF-associated paused Pol II complexes provide a platform for high fidelity integration of the combinatorial spatial and temporal information that is central to the regulation of gene expression during animal development. PMID:20634899

  18. Structure and in vitro transcription of human globin genes.

    PubMed

    Proudfoot, N J; Shander, M H; Manley, J L; Gefter, M L; Maniatis, T

    1980-09-19

    The alpha-like and beta-like subunits of human hemoglobin are encoded by a small family of genes that are differentially expressed during development. Through the use of molecular cloning procedures, each member of this gene family has been isolated and extensively characterized. Although the alpha-like and beta-like globin genes are located on different chromosomes, both sets of genes are arranged in closely linked clusters. In both clusters, each of the genes is transcribed from the same DNA strand, and the genes are arranged in the order of their expressions during development. Structural comparisons of immediately adjacent genes within each cluster have provided evidence for the occurrence of gene duplication and correction during evolution and have led to the discovery of pseudogenes, genes that have acquired numerous mutations that prevent their normal expression. Recently, in vivo and in vitro systems for studying the expression of cloned eukaryotic genes have been developed as a means of identifying DNA sequences that are necessary for normal gene function. This article describes the application of an in vitro transcription procedure to the study of human globin gene expression.

  19. The transcription factor RFX5 is a transcriptional activator of the TPP1 gene in hepatocellular carcinoma.

    PubMed

    Zhao, Yangjing; Xie, Xingwang; Liao, Weijia; Zhang, Henghui; Cao, Hui; Fei, Ran; Wang, Xueyan; Wei, Lai; Shao, Qixiang; Chen, Hongsong

    2017-01-01

    Regulatory factor X-5 (RFX5) was previously characterized as an essential and highly specific regulator of major histocompatibility class II (MHCII) gene expression in the immune system. We found that RFX5 is significantly upregulated in hepatocellular carcinoma (HCC) tumors and cell lines compared with non-tumor tissues in mRNA expression levels, but it fails to induce the expression of MHCII. However, RFX5 can strongly bind to the tripeptidyl peptidase 1 (TPP1) promoter region and then increase its transcriptional activity. We also found that manipulation the expression of RFX5 can significantly affect the expression of TPP1 in HepG2, which suggested that RFX5 can transcriptionally activate TPP1 in HCC. Moreover, TPP1 is overexpressed in HCC tissues and significantly correlated with poor prognosis of HCC patients, suggesting that it may have potential biological implications in HCC.

  20. Gene transcription in polar bears (Ursus maritimus) from disparate populations

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Waters, Shannon C.; Meyerson, Randi; Rode, Karyn D.; Atwood, Todd C.

    2015-01-01

    Polar bears in the Beaufort (SB) and Chukchi (CS) Seas experience different environments due primarily to a longer history of sea ice loss in the Beaufort Sea. Ecological differences have been identified as a possible reason for the generally poorer body condition and reproduction of Beaufort polar bears compared to those from the Chukchi, but the influence of exposure to other stressors remains unknown. We use molecular technology, quantitative PCR, to identify gene transcription differences among polar bears from the Beaufort and Chukchi Seas as well as captive healthy polar bears. We identified significant transcriptional differences among a priori groups (i.e., captive bears, SB 2012, SB 2013, CS 2013) for ten of the 14 genes of interest (i.e., CaM, HSP70, CCR3, TGFβ, COX2, THRα, T-bet, Gata3, CD69, and IL17); transcription levels of DRβ, IL1β, AHR, and Mx1 did not differ among groups. Multivariate analysis also demonstrated separation among the groups of polar bears. Specifically, we detected transcript profiles consistent with immune function impairment in polar bears from the Beaufort Sea, when compared with Chukchi and captive polar bears. Although there is no strong indication of differential exposure to contaminants or pathogens between CS and SB bears, there are clearly differences in important transcriptional responses between populations. Further investigation is warranted to refine interpretation of potential effects of described stress-related conditions for the SB population.

  1. Transcriptional regulation of steroid hydroxylase genes by corticotropin.

    PubMed Central

    John, M E; John, M C; Boggaram, V; Simpson, E R; Waterman, M R

    1986-01-01

    Maintenance of optimal steroidogenic capacity in the adrenal cortex is the result of a cAMP-dependent response to the peptide hormone corticotropin (ACTH). The molecular mechanism of this action of ACTH has been examined by using five recombinant DNA clones specific for enzymes of the steroidogenic pathway (P-450scc, P-45011 beta, P-450C21, P-45017 alpha, and adrenodoxin). The presence of nuclear precursors in steady-state RNA samples derived from cultured bovine adrenocortical cells and moderate increases in the number of RNA chain initiations, as determined by in vitro nuclear run-off assays, indicate that ACTH controls the expression of the gene(s) for each of these proteins at the transcriptional level. The ACTH-mediated increase in accumulation of transcripts specific for steroid hydroxylases in nuclear RNA can be specifically blocked by inhibiting protein synthesis in bovine adrenocortical cell cultures. The steady-state concentrations of nuclear RNA for control genes show no decrease upon cycloheximide treatment. These studies suggest that a primary action of ACTH in the adrenal cortex is to activate (via cAMP) the synthesis of rapidly turning over protein factors that in turn mediate increased initiation of transcription of steroid hydroxylase genes. We propose that these protein factors impart specificity of induction to genes encoding components of this pathway in steroidogenic tissues. Images PMID:3014507

  2. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed

    Jin, S; Sonenshein, A L

    1994-08-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ.

  3. Transcript abundance supercedes editing efficiency as a factor in developmental variation of chloroplast gene expression.

    PubMed Central

    Peeters, Nemo M; Hanson, Maureen R

    2002-01-01

    In maize plastids, transcripts are known to be modified at 27 C-to-U RNA editing sites, affecting the expression-of 15 different genes. The relative contribution of editing efficiency versus transcript abundance in regulation of chloroplast gene expression has previously been analyzed for only a few genes. We undertook a comprehensive analysis of the editing efficiency of each of the 27 maize editing sites in 10 different maize tissues, which contain a range of plastid types including chloroplasts, etioplasts, and amyloplasts. Using a reproducible poisoned primer extension assay, we detected variation between RNA editing extent of different sites in the same transcript in the same tissue, and between the same site in different tissues. The most striking editing deficiency is in an editing site in ndhB that is edited at only 8% and 1% in roots and callus plastids respectively, whereas green leaf chloroplasts edit this site at 100%. Editing efficiencies of some sites are not affected by the developmental stages we examined and are always edited close to 80-100%. The relative amounts of transcripts of each of the 10 genes that exhibited variable editing extents were determined by real-time PCR. Seven genes exhibited over 100 times lower transcript abundance in either roots or tissue-cultured cells relative to green leaf tissue. The quantitative analysis indicates that a particular editing site can be efficiently edited over a large range of transcript abundance, resulting in no general correlation of transcript abundance and editing extent. The independent variation of editing efficiency of different sites within the same transcript fits with a model that postulates individual trans-acting factors specific to each editing site. Because tissues where editing efficiency at certain sites is low invariably also exhibited greatly decreased abundance of the transcripts carrying those sites, decrease in the amounts of particular RNAs rather than a lack of editing is

  4. Transcriptional Regulation of the p16 Tumor Suppressor Gene.

    PubMed

    Kotake, Yojiro; Naemura, Madoka; Murasaki, Chihiro; Inoue, Yasutoshi; Okamoto, Haruna

    2015-08-01

    The p16 tumor suppressor gene encodes a specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 and is found altered in a wide range of human cancers. p16 plays a pivotal role in tumor suppressor networks through inducing cellular senescence that acts as a barrier to cellular transformation by oncogenic signals. p16 protein is relatively stable and its expression is primary regulated by transcriptional control. Polycomb group (PcG) proteins associate with the p16 locus in a long non-coding RNA, ANRIL-dependent manner, leading to repression of p16 transcription. YB1, a transcription factor, also represses the p16 transcription through direct association with its promoter region. Conversely, the transcription factors Ets1/2 and histone H3K4 methyltransferase MLL1 directly bind to the p16 locus and mediate p16 induction during replicative and premature senescence. In the present review, we discuss the molecular mechanisms by which these factors regulate p16 transcription.

  5. Mechanisms of post-transcriptional gene regulation in bacterial biofilms

    PubMed Central

    Martínez, Luary C.; Vadyvaloo, Viveka

    2014-01-01

    Biofilms are characterized by a dense multicellular community of microorganisms that can be formed by the attachment of bacteria to an inert surface and to each other. The development of biofilm involves the initial attachment of planktonic bacteria to a surface, followed by replication, cell-to-cell adhesion to form microcolonies, maturation, and detachment. Mature biofilms are embedded in a self-produced extracellular polymeric matrix composed primarily of bacterial-derived exopolysaccharides, specialized proteins, adhesins, and occasionally DNA. Because the synthesis and assembly of biofilm matrix components is an exceptionally complex process, the transition between its different phases requires the coordinate expression and simultaneous regulation of many genes by complex genetic networks involving all levels of gene regulation. The finely controlled intracellular level of the chemical second messenger molecule, cyclic-di-GMP is central to the post-transcriptional mechanisms governing the switch between the motile planktonic lifestyle and the sessile biofilm forming state in many bacteria. Several other post-transcriptional regulatory mechanisms are known to dictate biofilm development and assembly and these include RNA-binding proteins, small non-coding RNAs, toxin-antitoxin systems, riboswitches, and RNases. Post-transcriptional regulation is therefore a powerful molecular mechanism employed by bacteria to rapidly adjust to the changing environment and to fine tune gene expression to the developmental needs of the cell. In this review, we discuss post-transcriptional mechanisms that influence the biofilm developmental cycle in a variety of pathogenic bacteria. PMID:24724055

  6. The RNA polymerase flow model of gene transcription.

    PubMed

    Edri, Shlomit; Gazit, Eran; Cohen, Eyal; Tuller, Tamir

    2014-02-01

    Gene expression is a fundamental cellular process by which proteins are synthesized based on the information coded in the genes. The two major steps of this process are the transcription of the DNA segment corresponding to a gene to mRNA molecules and the translation of the mRNA molecules to proteins by the ribosome. Thus, understanding, modeling and engineering the different stages of this process have both important biotechnological applications and contributions to basic life science. In previous studies we have introduced the Homogenous Ribosome Flow Model (HRFM) and demonstrated its advantages in analyses of the translation process. In this study we introduce the RNA Polymerase Flow Model (RPFM), a non trivial extension of the HRFM, which also includes a backward flow and can be used for modeling transcription and maybe other similar processes. We compare the HRFM and the RPFM in the three regimes of the transcription process: rate limiting initiation, rate limiting elongation and rate limiting termination via a simulative and analytical analysis. In addition, based on experimental data, we show that RPFM is a better choice for modeling transcription process.

  7. TRANSCRIPTIONAL REGULATION OF THE HUMAN KiSS1 GENE

    PubMed Central

    Mueller, Johanna K.; Dietzel, Anja; Lomniczi, Alejandro; Loche, Alberto; Tefs, Katrin; Kiess, Wieland; Danne, Thomas; Ojeda, Sergio R.; Heger, Sabine

    2011-01-01

    Kisspeptin, the product of the KiSS1 gene, has emerged as a key component of the mechanism by which the hypothalamus controls puberty and reproductive development. It does so by stimulating the secretion of gonadotropin releasing hormone (GnRH). Little is known about the transcriptional control of the KiSS1 gene. Here we show that a set of proteins postulated to be upstream components of a hypothalamic network involved in controlling female puberty regulates KiSS1 transcriptional activity. Using RACE-PCR we determined that transcription of KiSS1 mRNA is initiated at a single transcription start site (TSS) located 153–156 bp upstream of the ATG translation initiation codon. Promoter assays performed using 293 MSR cells showed that the KiSS1 promoter is activated by TTF1 and CUX1-p200, and repressed by EAP1, YY1, and CUX1-p110. EAP1 and CUX-110 were also repressive in GT1-7 cells. All four TFs are recruited in vivo to the KiSS1 promoter and are expressed in kisspeptin neurons. These results suggest that expression of the KiSS1 gene is regulated by trans-activators and repressors involved in the system-wide control of mammalian puberty. PMID:21672609

  8. DAL82, a second gene required for induction of allantoin system gene transcription in Saccharomyces cerevisiae.

    PubMed Central

    Olive, M G; Daugherty, J R; Cooper, T G

    1991-01-01

    Several highly inducible enzyme activities are required for the degradation of allantoin in Saccharomyces cerevisiae. Induction of these pathway enzymes has been shown to be regulated at transcription, and response to inducer is lost in dal81 and dal82/durM mutants. The similar phenotypes generated by dal81 and dal82 mutations prompted the question of whether they were allelic. We demonstrated that the DAL81 and DAL82 loci are distinct, unlinked genes situated on chromosomes IX and XIV. DAL82 gene expression did not respond to induction by the allantoin pathway inducer or to nitrogen catabolite repression. Expression was also not significantly affected by mutation of the dal80 locus. From the nucleotide sequence of the DAL82 gene, we deduced that it encodes a protein with a mass of 29,079 Da that may possess the structural motifs expected of a regulatory protein. This protein was shown to be required for the function mediated by the cis-acting upstream induction sequence situated in the 5'-flanking regions of the inducible allantoin pathway genes. Images PMID:1898922

  9. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  10. Stochastic model of transcription factor-regulated gene expression

    NASA Astrophysics Data System (ADS)

    Karmakar, Rajesh; Bose, Indrani

    2006-09-01

    We consider a stochastic model of transcription factor (TF)-regulated gene expression. The model describes two genes, gene A and gene B, which synthesize the TFs and the target gene proteins, respectively. We show through analytic calculations that the TF fluctuations have a significant effect on the distribution of the target gene protein levels when the mean TF level falls in the highest sensitive region of the dose-response curve. We further study the effect of reducing the copy number of gene A from two to one. The enhanced TF fluctuations yield results different from those in the deterministic case. The probability that the target gene protein level exceeds a threshold value is calculated with the knowledge of the probability density functions associated with the TF and target gene protein levels. Numerical simulation results for a more detailed stochastic model are shown to be in agreement with those obtained through analytic calculations. The relevance of these results in the context of the genetic disorder haploinsufficiency is pointed out. Some experimental observations on the haploinsufficiency of the tumour suppressor gene, Nkx 3.1, are explained with the help of the stochastic model of TF-regulated gene expression.

  11. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  12. Nuclear actin activates human transcription factor genes including the OCT4 gene.

    PubMed

    Yamazaki, Shota; Yamamoto, Koji; Tokunaga, Makio; Sakata-Sogawa, Kumiko; Harata, Masahiko

    2015-01-01

    RNA microarray analyses revealed that nuclear actin activated many human transcription factor genes including OCT4, which is required for gene reprogramming. Oct4 is known to be activated by nuclear actin in Xenopus oocytes. Our findings imply that this process of OCT4 activation is conserved in vertebrates and among cell types and could be used for gene reprogramming of human cells.

  13. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  14. Demonstration of transcriptional regulation of specific genes by phytochrome action

    PubMed Central

    Silverthorne, Jane; Tobin, Elaine M.

    1984-01-01

    We have developed an in vitro transcription system that uses nuclei isolated from Lemna gibba G-3. The in vitro transcripts include sequences homologous to hybridization probes for the small subunit of ribulose-1,5-bisphosphate carboxylase [3-phospho-D-glycerate carboxy-lyase (dimerizing), EC 4.1.1.39], the light-harvesting chlorophyll a/b-protein, and rRNA. Light-harvesting chlorophyll a/b-protein sequences are transcribed to a greater extent in nuclei isolated from plants grown in darkness with 2 min of red light every 8 hr than in nuclei isolated from dark-treated plants. Furthermore, the amount of these transcripts measured in plants given a single minute of red light after dark treatment is increased over the amount measured in dark-treated plants. The effect of red light is at least partially reversible by 10 min of far-red light given immediately after the red light pulse. Transcription of both rRNA and small subunit sequences is also stimulated by a single minute of red light as compared to dark-treated tissue. However, the relative magnitudes of the increases compared to the dark levels are smaller than the increase seen for the chlorophyll a/b-protein, possibly because of the higher level of transcription of these sequences in the dark. The effect of red light on the transcription of small subunit and rRNA sequences is also reversible by immediate treatment with 10 min of far-red light. Pulse chase studies of dark-treated nuclei for up to 110 min do not show substantial turnover of in vitro labeled small subunit and chlorophyll a/b-protein transcripts. We therefore conclude that phytochrome action has induced specific changes in transcription of these genes. Images PMID:16593420

  15. Genetic variants in ABCA1 promoter affect transcription activity and plasma HDL level in pigs.

    PubMed

    Dang, Xiao-yong; Chu, Wei-wei; Shi, Heng-chuan; Yu, Shi-gang; Han, Hai-yin; Gu, Shu-Hua; Chen, Jie

    2015-01-25

    Excess accumulation of cholesterol in plasma may result in coronary artery disease. Numerous studies have demonstrated that ATP-binding cassette protein A1 (ABCA1) mediates the efflux of cholesterol and phospholipids to apolipoproteins, a process necessary for plasma high density lipoprotein (HDL) formation. Higher plasma levels of HDL are associated with lower risk for cardiovascular disease. Studies of human disease and animal models had shown that an increased hepatic ABCA1 activity relates to an enhanced plasma HDL level. In this study, we hypothesized that functional mutations in the ABCA1 promoter in pigs may affect gene transcription activity, and consequently the HDL level in plasma. The promoter region of ABCA1 was comparatively scanned by direct sequencing with pool DNA of high- and low-HDL groups (n=30 for each group). Two polymorphisms, c. - 608A>G and c. - 418T>A, were revealed with reverse allele distribution in the two groups. The two polymorphisms were completely linked and formed only G-A or A-T haplotypes when genotyped in a larger population (n=526). Furthermore, we found that the G-A/G-A genotype was associated with higher HDL and ABCA1 mRNA level than A-T/A-T genotype. Luciferase assay also revealed that G-A haplotype promoter had higher activity than A-T haplotype. Single-nucleotide mutant assay showed that c.-418T>A was the causal mutation for ABCA1 transcription activity alteration. Conclusively, we identified two completely linked SNPs in porcine ABCA1 promoter region which have influence on the plasma HDL level by altering ABCA1 gene transcriptional activity.

  16. Transcriptional activation of cloned human beta-globin genes by viral immediate-early gene products.

    PubMed

    Green, M R; Treisman, R; Maniatis, T

    1983-11-01

    When the human beta-globin gene is transfected into Hela cells, no beta-globin RNA is detected unless the gene is linked to a viral transcription enhancer. In this paper we show that trans-acting adenovirus and herpesvirus (pseudorabies) transcriptional regulatory proteins can circumvent this enhancer requirement for detectable beta-globin transcription in transient expression assays. The viral gene products can be provided by constitutively expressed, integrated viral genes in established cell lines, by viral infection of permissive cells, or by transfection of cells with bacterial plasmids carrying the viral immediate-early genes. These results demonstrate the utility of transient expression assays for studying regulatory mechanisms involving trans-acting factors. Analysis of beta-globin promoter mutants indicates that between 75 and 128 bp of sequence 5' to the mRNA cap site is required for enhancer-dependent transcription in Hela cells. In contrast, beta-globin transcription in the presence of viral immediate-early gene products requires only 36 bp of 5'-flanking sequence, which includes the TATA box. Thus both cis and trans-acting viral factors activate beta-globin gene transcription in transient expression experiments, but the mechanisms by which they act appear to be fundamentally different.

  17. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  18. Dynamic Post-Transcriptional Regulation of HIV-1 Gene Expression

    PubMed Central

    Kula, Anna; Marcello, Alessandro

    2012-01-01

    Gene expression of the human immunodeficiency virus type 1 (HIV-1) is a highly regulated process. Basal transcription of the integrated provirus generates early transcripts that encode for the viral products Tat and Rev. Tat promotes the elongation of RNA polymerase while Rev mediates the nuclear export of viral RNAs that contain the Rev-responsive RNA element (RRE). These RNAs are exported from the nucleus to allow expression of Gag-Pol and Env proteins and for the production of full-length genomic RNAs. A balance exists between completely processed mRNAs and RRE-containing RNAs. Rev functions as an adaptor that recruits cellular factors to re-direct singly spliced and unspliced viral RNAs to nuclear export. The aim of this review is to address the dynamic regulation of this post-transcriptional pathway in light of recent findings that implicate several novel cellular cofactors of Rev function. PMID:24832221

  19. Post-Transcriptional Control of Chloroplast Gene Expression

    PubMed Central

    del Campo, Eva M.

    2009-01-01

    Chloroplasts contain their own genome, organized as operons, which are generally transcribed as polycistronic transcriptional units. These primary transcripts are processed into smaller RNAs, which are further modified to produce functional RNAs. The RNA processing mechanisms remain largely unknown and represent an important step in the control of chloroplast gene expression. Such mechanisms include RNA cleavage of pre-existing RNAs, RNA stabilization, intron splicing, and RNA editing. Recently, several nuclear-encoded proteins that participate in diverse plastid RNA processing events have been characterised. Many of them seem to belong to the pentatricopeptide repeat (PPR) protein family that is implicated in many crucial functions including organelle biogenesis and plant development. This review will provide an overview of current knowledge of the post-transcriptional processing in chloroplasts. PMID:19838333

  20. Functional divergence and convergence between the transcript network and gene network in lung adenocarcinoma

    PubMed Central

    Hsu, Min-Kung; Pan, Chia-Lin; Chen, Feng-Chi

    2016-01-01

    Introduction Alternative RNA splicing is a critical regulatory mechanism during tumorigenesis. However, previous oncological studies mainly focused on the splicing of individual genes. Whether and how transcript isoforms are coordinated to affect cellular functions remain underexplored. Also of great interest is how the splicing regulome cooperates with the transcription regulome to facilitate tumorigenesis. The answers to these questions are of fundamental importance to cancer biology. Results Here, we report a comparative study between the transcript-based network (TN) and the gene-based network (GN) derived from the transcriptomes of paired tumor–normal tissues from 77 lung adenocarcinoma patients. We demonstrate that the two networks differ significantly from each other in terms of patient clustering and the number and functions of network modules. Interestingly, the majority (89.5%) of multi-transcript genes have their transcript isoforms distributed in at least two TN modules, suggesting regulatory and functional divergences between transcript isoforms. Furthermore, TN and GN modules share onlŷ50%–60% of their biological functions. TN thus appears to constitute a regulatory layer separate from GN. Nevertheless, our results indicate that functional convergence and divergence both occur between TN and GN, implying complex interactions between the two regulatory layers. Finally, we report that the expression profiles of module members in both TN and GN shift dramatically yet concordantly during tumorigenesis. The mechanisms underlying this coordinated shifting remain unclear yet are worth further explorations. Conclusion We show that in lung adenocarcinoma, transcript isoforms per se are coordinately regulated to conduct biological functions not conveyed by the network of genes. However, the two networks may interact closely with each other by sharing the same or related biological functions. Unraveling the effects and mechanisms of such interactions will

  1. Synchronous activation of gonadotropin-releasing hormone gene transcription and secretion by pulsatile kisspeptin stimulation

    PubMed Central

    Choe, Han Kyoung; Kim, Hee-Dae; Park, Sung Ho; Lee, Han-Woong; Park, Jae-Yong; Seong, Jae Young; Lightman, Stafford L.; Son, Gi Hoon; Kim, Kyungjin

    2013-01-01

    Pulsatile release of hypothalamic gonadotropin-releasing hormone (GnRH) is essential for pituitary gonadotrope function. Although the importance of pulsatile GnRH secretion has been recognized for several decades, the mechanisms underlying GnRH pulse generation in hypothalamic neural networks remain elusive. Here, we demonstrate the ultradian rhythm of GnRH gene transcription in single GnRH neurons using cultured hypothalamic slices prepared from transgenic mice expressing a GnRH promoter-driven destabilized luciferase reporter. Although GnRH promoter activity in each GnRH neuron exhibited an ultradian pattern of oscillations with a period of ∼10 h, GnRH neuronal cultures exhibited partially synchronized bursts of GnRH transcriptional activity at ∼2-h intervals. Surprisingly, pulsatile administration of kisspeptin, a potent GnRH secretagogue, evoked dramatic synchronous activation of GnRH gene transcription with robust stimulation of pulsatile GnRH secretion. We also addressed the issue of hierarchical interaction between the circadian and ultradian rhythms by using Bmal1-deficient mice with defective circadian clocks. The circadian molecular oscillator barely affected basal ultradian oscillation of GnRH transcription but was heavily involved in kisspeptin-evoked responses of GnRH neurons. In conclusion, we have clearly shown synchronous bursts of GnRH gene transcription in the hypothalamic GnRH neuronal population in association with episodic neurohormone secretion, thereby providing insight into GnRH pulse generation. PMID:23509283

  2. Noninvasive tracking of gene transcript and neuroprotection after gene therapy.

    PubMed

    Ren, J; Chen, Y I; Liu, C H; Chen, P-C; Prentice, H; Wu, J-Y; Liu, P K

    2016-01-01

    Gene therapy holds exceptional potential for translational medicine by improving the products of defective genes in diseases and/or providing necessary biologics from endogenous sources during recovery processes. However, validating methods for the delivery, distribution and expression of the exogenous genes from such therapy can generally not be applicable to monitor effects over the long term because they are invasive. We report here that human granulocyte colony-stimulating factor (hG-CSF) complimentary DNA (cDNA) encoded in self-complementary adeno-associated virus-type 2 adeno-associated virus, as delivered through eye drops at multiple time points after cerebral ischemia using bilateral carotid occlusion for 60 min (BCAO-60) led to significant reduction in mortality rates, cerebral atrophy and neurological deficits in C57black6 mice. Most importantly, we validated hG-CSF cDNA expression using translatable magnetic resonance imaging (MRI) in living brains. This noninvasive approach for monitoring exogenous gene expression in the brains has potential for great impact in the area of experimental gene therapy in animal models of heart attack, stroke, Alzheimer's dementia, Parkinson's disorder and amyotrophic lateral sclerosis, and the translation of such techniques to emergency medicine.

  3. Effects of transcription induction homogeneity and transcript stability on expression of two genes in a constructed operon.

    PubMed

    Smolke, C D; Khlebnikov, A; Keasling, J D

    2001-12-01

    A synthetic operon was constructed using the reporter genes gfp and lacZ and the arabinose-inducible araBAD promoter. DNA cassettes encoding mRNA secondary structures were placed at the 3' and 5' ends of the genes and a putative RNase E site was placed between the genes. These mRNA control elements have been shown to affect transcript processing and decay, resulting in altered protein levels. These constructs were transformed into cells harboring the native arabinose-inducible araE gene encoding the arabinose transport protein and engineered cells harboring a constitutively expressed araE. In the strains with arabinose-dependent transport the linear response in the production of both reporter proteins to inducer concentration occurred over a narrow range of arabinose concentrations. In the strains with constitutive transport the linear range of gene expression occurred over a much larger arabinose concentration range than in strains with the arabinose-inducible transport. Strains with the arabinose-inducible transport harboring different operon constructs produced the two reporter proteins at very different levels at low arabinose concentrations; as inducer concentrations increased, differences in relative expression levels decreased. In contrast, strains with constitutive transport harboring different operon constructs produced the reporter proteins at very different levels across the entire range of inducer concentrations, pointing to the importance of optimizing gene expression control at various levels to control the production of heterologous proteins.

  4. Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato

    PubMed Central

    Gong, Pengjuan; Zhang, Junhong; Li, Hanxia; Yang, Changxian; Zhang, Chanjuan; Zhang, Xiaohui; Khurram, Ziaf; Zhang, Yuyang; Wang, Taotao; Fei, Zhangjun; Ye, Zhibiao

    2010-01-01

    To unravel the molecular mechanisms of drought responses in tomato, gene expression profiles of two drought-tolerant lines identified from a population of Solanum pennellii introgression lines, and the recurrent parent S. lycopersicum cv. M82, a drought-sensitive cultivar, were investigated under drought stress using tomato microarrays. Around 400 genes identified were responsive to drought stress only in the drought-tolerant lines. These changes in genes expression are most likely caused by the two inserted chromosome segments of S. pennellii, which possibly contain drought-tolerance quantitative trait loci (QTLs). Among these genes are a number of transcription factors and signalling proteins which could be global regulators involved in the tomato responses to drought stress. Genes involved in organism growth and development processes were also specifically regulated by drought stress, including those controlling cell wall structure, wax biosynthesis, and plant height. Moreover, key enzymes in the pathways of gluconeogenesis (fructose-bisphosphate aldolase), purine and pyrimidine nucleotide biosynthesis (adenylate kinase), tryptophan degradation (aldehyde oxidase), starch degradation (β-amylase), methionine biosynthesis (cystathionine β-lyase), and the removal of superoxide radicals (catalase) were also specifically affected by drought stress. These results indicated that tomato plants could adapt to water-deficit conditions through decreasing energy dissipation, increasing ATP energy provision, and reducing oxidative damage. The drought-responsive genes identified in this study could provide further information for understanding the mechanisms of drought tolerance in tomato. PMID:20643807

  5. Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

    PubMed

    Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

    2016-04-01

    Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

  6. Stochastic model for gene transcription on Drosophila melanogaster embryos

    NASA Astrophysics Data System (ADS)

    Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.

    2016-02-01

    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

  7. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  8. Epigenetic Alterations Affecting Transcription Factors and Signaling Pathways in Stromal Cells of Endometriosis

    PubMed Central

    Yotova, Iveta; Hsu, Emily; Do, Catherine; Gaba, Aulona; Sczabolcs, Matthias; Dekan, Sabine; Kenner, Lukas; Wenzl, Rene; Tycko, Benjamin

    2017-01-01

    Endometriosis is characterized by growth of endometrial-like tissue outside the uterine cavity. Since its pathogenesis may involve epigenetic changes, we used Illumina 450K Methylation Beadchips to profile CpG methylation in endometriosis stromal cells compared to stromal cells from normal endometrium. We validated and extended the Beadchip data using bisulfite sequencing (bis-seq), and analyzed differential methylation (DM) at the CpG-level and by an element-level classification for groups of CpGs in chromatin domains. Genes found to have DM included examples encoding transporters (SLC22A23), signaling components (BDNF, DAPK1, ROR1, and WNT5A) and transcription factors (GATA family, HAND2, HOXA cluster, NR5A1, OSR2, TBX3). Intriguingly, among the TF genes with DM we also found JAZF1, a proto-oncogene affected by chromosomal translocations in endometrial stromal tumors. Using RNA-Seq we identified a subset of the DM genes showing differential expression (DE), with the likelihood of DE increasing with the extent of the DM and its location in enhancer elements. Supporting functional relevance, treatment of stromal cells with the hypomethylating drug 5aza-dC led to activation of DAPK1 and SLC22A23 and repression of HAND2, JAZF1, OSR2, and ROR1 mRNA expression. We found that global 5hmC is decreased in endometriotic versus normal epithelial but not stroma cells, and for JAZF1 and BDNF examined by oxidative bis-seq, found that when 5hmC is detected, patterns of 5hmC paralleled those of 5mC. Together with prior studies, these results define a consistent epigenetic signature in endometriosis stromal cells and nominate specific transcriptional and signaling pathways as therapeutic targets. PMID:28125717

  9. Analysis of gene order conservation in eukaryotes identifies transcriptionally and functionally linked genes.

    PubMed

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore

    2010-05-14

    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control.

  10. Analysis of Gene Order Conservation in Eukaryotes Identifies Transcriptionally and Functionally Linked Genes

    PubMed Central

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore

    2010-01-01

    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control. PMID:20498846

  11. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.

    PubMed

    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L; Stavans, Joel

    2016-08-19

    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts' threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation.

  12. Genetic Variants in the STMN1 Transcriptional Regulatory Region Affect Promoter Activity and Fear Behavior in English Springer Spaniels

    PubMed Central

    Zhang, Hanying; Xu, Yinxue

    2016-01-01

    Stathmin 1 (STMN1) is a neuronal growth-associated protein that is involved in microtubule dynamics and plays an important role in synaptic outgrowth and plasticity. Given that STMN1 affects fear behavior, we hypothesized that genetic variations in the STMN1 transcriptional regulatory region affect gene transcription activity and control fear behavior. In this study, two single nucleotide polymorphisms (SNPs), g. -327 A>G and g. -125 C>T, were identified in 317 English Springer Spaniels. A bioinformatics analysis revealed that both were loci located in the canine STMN1 putative promoter region and affected transcription factor binding. A statistical analysis revealed that the TT genotype at g.-125 C>T produced a significantly greater fear level than that of the CC genotype (P < 0.05). Furthermore, the H4H4 (GTGT) haplotype combination was significantly associated with canine fear behavior (P < 0.01). Using serially truncated constructs of the STMN1 promoters and the luciferase reporter, we found that a 395 bp (−312 nt to +83 nt) fragment constituted the core promoter region. The luciferase assay also revealed that the H4 (GT) haplotype promoter had higher activity than that of other haplotypes. Overall, our results suggest that the two SNPs in the canine STMN1 promoter region could affect canine fear behavior by altering STMN1 transcriptional activity. PMID:27390866

  13. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

  14. A gene transcription signature of obesity in breast cancer.

    PubMed

    Creighton, Chad J; Sada, Yvonne H; Zhang, Yiqun; Tsimelzon, Anna; Wong, Helen; Dave, Bhuvanesh; Landis, Melissa D; Bear, Harry D; Rodriguez, Angel; Chang, Jenny C

    2012-04-01

    Obesity is thought to contribute to worse disease outcome in breast cancer as a result of increased levels of adipocyte-secreted endocrine factors, insulin, and insulin-like growth factors (IGFs) that accelerate tumor cell proliferation and impair treatment response. We examined the effects of patient obesity on primary breast tumor gene expression, by profiling transcription of a set of 103 tumors for which the patients' body mass index (BMI) was ascertained. Sample profiles were stratified according to patients' obesity phenotype defined as normal (BMI < 25), overweight (BMI 25-29.9), or obese (BMI ≥ 30). Widespread gene expression alterations were evident in breast tumors from obese patients as compared to other tumors, allowing us to define an obesity-associated cancer transcriptional signature of 662 genes. In multiple public expression data sets of breast cancers (representing > 1,500 patients), manifestation of the obesity signature patterns correlated with manifestation of a gene signature for IGF signaling and (to a lesser extent) with lower levels of estrogen receptor. In one patient cohort, manifestation of the obesity signature correlated with shorter time to metastases. A number of small molecules either induced or suppressed the obesity-associated transcriptional program in vitro; estrogens alpha-estradiol, levonorgestrel, and hexestrol induced the program, while several anti-parkinsonian agents targeting neurotransmitter receptor pathways repressed the program. Obesity in breast cancer patients appears to impact the gene expression patterns of the tumor (perhaps as a result of altered body chemistry). These results warrant further investigation of obesity-associated modifiers of breast cancer risk and disease outcome.

  15. Zinc triggers a complex transcriptional and post-transcriptional regulation of the metal homeostasis gene FRD3 in Arabidopsis relatives

    PubMed Central

    Charlier, Jean-Benoit; Polese, Catherine; Nouet, Cécile; Carnol, Monique; Bosman, Bernard; Krämer, Ute; Motte, Patrick; Hanikenne, Marc

    2015-01-01

    In Arabidopsis thaliana, FRD3 (FERRIC CHELATE REDUCTASE DEFECTIVE 3) plays a central role in metal homeostasis. FRD3 is among a set of metal homeostasis genes that are constitutively highly expressed in roots and shoots of Arabidopsis halleri, a zinc hyperaccumulating and hypertolerant species. Here, we examined the regulation of FRD3 by zinc in both species to shed light on the evolutionary processes underlying the evolution of hyperaccumulation in A. halleri. We combined gene expression studies with the use of β-glucuronidase and green fluorescent protein reporter constructs to compare the expression profile and transcriptional and post-transcriptional regulation of FRD3 in both species. The AtFRD3 and AhFRD3 genes displayed a conserved expression profile. In A. thaliana, alternative transcription initiation sites from two promoters determined transcript variants that were differentially regulated by zinc supply in roots and shoots to favour the most highly translated variant under zinc-excess conditions. In A. halleri, a single transcript variant with higher transcript stability and enhanced translation has been maintained. The FRD3 gene thus undergoes complex transcriptional and post-transcriptional regulation in Arabidopsis relatives. Our study reveals that a diverse set of mechanisms underlie increased gene dosage in the A. halleri lineage and illustrates how an environmental challenge can alter gene regulation. PMID:25900619

  16. WRKY transcription factor genes in wild rice Oryza nivara.

    PubMed

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J

    2016-08-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara.

  17. WRKY transcription factor genes in wild rice Oryza nivara

    PubMed Central

    Xu, Hengjian; Watanabe, Kenneth A.; Zhang, Liyuan; Shen, Qingxi J.

    2016-01-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  18. In vitro transcription of a cloned mouse ribosomal RNA gene.

    PubMed Central

    Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M

    1981-01-01

    An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446

  19. The protein kinase TOUSLED is required for maintenance of transcriptional gene silencing in Arabidopsis

    PubMed Central

    Wang, Yu; Liu, Jun; Xia, Ran; Wang, Junguo; Shen, Jie; Cao, Rui; Hong, Xuhui; Zhu, Jian-Kang; Gong, Zhizhong

    2007-01-01

    TOUSLED-like kinases (TLKs) are highly conserved in plants and animals, but direct evidence linking TLKs and transcriptional gene silencing is lacking. We isolated two new alleles of TOUSLED (TSL). Mutations of TSL in ros1 reactivate the transcriptionally silent 35S-NPTII transgene and the transcriptionally silent endogenous loci TSI (TRANSCRIPTIONAL SILENCING INFORMATION). Chromatin immunoprecipitation (ChIP) analysis shows that histone H3Lys9 dimethylation is decreased in the reactivated transgene and endogenous TSI loci in the tsl ros1 mutant. However, there is no change in DNA methylation in the affected loci. Western blot and ChIP assay suggest that TSL might not be responsible for histone H3Ser10 phosphorylation. The tsl seedlings were more sensitive to DNA damage reagent methyl methanesulphonate and UV-B light. Our results provide direct evidence for a crucial role of the TOUSLED protein kinase in the maintenance of transcriptional gene silencing in some genomic regions in a DNA-methylation-independent manner in Arabidopsis. PMID:17110953

  20. The protein kinase TOUSLED is required for maintenance of transcriptional gene silencing in Arabidopsis.

    PubMed

    Wang, Yu; Liu, Jun; Xia, Ran; Wang, Junguo; Shen, Jie; Cao, Rui; Hong, Xuhui; Zhu, Jian-Kang; Gong, Zhizhong

    2007-01-01

    TOUSLED-like kinases (TLKs) are highly conserved in plants and animals, but direct evidence linking TLKs and transcriptional gene silencing is lacking. We isolated two new alleles of TOUSLED (TSL). Mutations of TSL in ros1 reactivate the transcriptionally silent 35S-NPTII transgene and the transcriptionally silent endogenous loci TSI (TRANSCRIPTIONAL SILENCING INFORMATION). Chromatin immunoprecipitation (ChIP) analysis shows that histone H3Lys9 dimethylation is decreased in the reactivated transgene and endogenous TSI loci in the tsl ros1 mutant. However, there is no change in DNA methylation in the affected loci. Western blot and ChIP assay suggest that TSL might not be responsible for histone H3Ser10 phosphorylation. The tsl seedlings were more sensitive to DNA damage reagent methyl methanesulphonate and UV-B light. Our results provide direct evidence for a crucial role of the TOUSLED protein kinase in the maintenance of transcriptional gene silencing in some genomic regions in a DNA-methylation-independent manner in Arabidopsis.

  1. The transcription analysis of duck enteritis virus UL49.5 gene using real-time quantitative reverse transcription PCR.

    PubMed

    Lin, Meng; Jia, Renyong; Wang, Mingshu; Gao, Xinghong; Zhu, Dekang; Chen, Shun; Yin, Zhongqiong; Wang, Yin; Chen, Xiaoyue; Cheng, Anchun

    2013-10-01

    Duck enteritis virus (DEV) UL49.5 encoding glycoprotein N was a conserved gene. The transcription dynamic process of UL49.5 homologous genes in herpesviruses was reported. However, the transcription dynamic process of DEV UL49.5 gene has not yet been established. In this study, a real-time quantitative reverse transcription PCR (real-time qRT-PCR) assay was established to test the transcription dynamic process of DEV UL49.5 gene, and the recombinant plasmid pUCm-T/UL49.5 was constructed as the standard DNA. The samples prepared from DEV-infected (at different time points) and uninfected cell were detected and calculated. The results demonstrated that the real-time qRT-PCR assay was successfully established. The transcription product of DEV UL49.5 gene was first detected at 0.5 h post infection (p.i.), increased at 8 h p.i. and reached a peak at 60 h p.i. Our results illustrated that DEV UL49.5 gene could be regarded as a late gene. The transcription dynamic process of DEV UL49.5 gene may provide a significant clue for further studies of DEV UL49.5 gene.

  2. Gene expression analysis of WRKY transcription factors in Arabidopsis thaliana cell cultures during a parabolic flight

    NASA Astrophysics Data System (ADS)

    Babbick, Maren; Barjaktarović, Žarko; Hampp, Ruediger

    Plants sense gravity by specialized cells (statocytes) and adjust growth and development accordingly. It has, however, also been shown that plant cells which are not part of specialized tissues are also able to sense gravitational forces. Therefore we used undifferentiated, homogeneous cell cultures of Arabidopsis thaliana (cv. Columbia) in order to identify early alterations in gene expression as a response to altered gravitational field strengths. In this contribution we report on cell cultures exposed to parabolic flights (approximately 20 sec of microgravity). For this short-term exposure study, we specifically checked for genes at the beginning of signal transduction chains, such as those coding for transcription factors (TFs). TFs are small proteins that regulate expression of their target genes by binding to specific promoter sequences. Our main focus were members of the so-called WRKY TF family. WRKY TFs are known to be involved in various physiological processes like senescence and pathogen defense. By quantifying transcriptional changes of these genes by real-time RT-PCR, we wanted to find out, how gene expression is affected by both hyperand microgravity conditions during a parabolic flight. For this purpose Arabidopsis thaliana callus cultures were metabolically quenched by the injection of RNAlater at the end of the microgravity-phase of each parabola. The data we present will show how fast changes in amounts of transcripts will occur, and to what degree the expression profiles are comparable with data obtained from exposures to hypergravity and simulated microgravity.

  3. V-src-induced-transcription of the avian clusterin gene.

    PubMed Central

    Herault, Y; Chatelain, G; Brun, G; Michel, D

    1992-01-01

    We have isolated the avian gene T64 corresponding to the mammalian clusterin, on the basis of high accumulation of its template mRNA in cells infected with oncogenic retroviruses. Since the clusterin was shown to have a protective effect against the immune system, its induction by oncogenic viruses is of major biological importance. The unique, short 5 kb-long T64 genomic locus is inactive in normal quail embryo fibroblasts in primary culture whereas it shows a high transcriptional activity after transformation by the Rous sarcoma virus. The 963 bp-long 5' flanking region is sufficient to drive the transcription of the chloramphenicol acetyltransferase reporter gene in a thermodependent manner when a thermosensitive version of pp60v-src is used. Deletion and point mutation analyses of the promoter show that the v-src response requires at least two separate elements: PUR and AP-1, located respectively at positions -167 to -152 and -25 to -19 relative to the single transcription initiation site. In addition, the binding of specific nuclear factors to these responsive elements correlates with the T64 promoter activation. Images PMID:1475199

  4. Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota

    PubMed Central

    Leyn, Semen A.; Rodionova, Irina A.; Li, Xiaoqing

    2015-01-01

    ABSTRACT Autotrophic microorganisms are able to utilize carbon dioxide as their only carbon source, or, alternatively, many of them can grow heterotrophically on organics. Different variants of autotrophic pathways have been identified in various lineages of the phylum Crenarchaeota. Aerobic members of the order Sulfolobales utilize the hydroxypropionate-hydroxybutyrate cycle (HHC) to fix inorganic carbon, whereas anaerobic Thermoproteales use the dicarboxylate-hydroxybutyrate cycle (DHC). Knowledge of transcriptional regulation of autotrophic pathways in Archaea is limited. We applied a comparative genomics approach to predict novel autotrophic regulons in the Crenarchaeota. We report identification of two novel DNA motifs associated with the autotrophic pathway genes in the Sulfolobales (HHC box) and Thermoproteales (DHC box). Based on genome context evidence, the HHC box regulon was attributed to a novel transcription factor from the TrmB family named HhcR. Orthologs of HhcR are present in all Sulfolobales genomes but were not found in other lineages. A predicted HHC box regulatory motif was confirmed by in vitro binding assays with the recombinant HhcR protein from Metallosphaera yellowstonensis. For the DHC box regulon, we assigned a different potential regulator, named DhcR, which is restricted to the order Thermoproteales. DhcR in Thermoproteus neutrophilus (Tneu_0751) was previously identified as a DNA-binding protein with high affinity for the promoter regions of two autotrophic operons. The global HhcR and DhcR regulons reconstructed by comparative genomics were reconciled with available omics data in Metallosphaera and Thermoproteus spp. The identified regulons constitute two novel mechanisms for transcriptional control of autotrophic pathways in the Crenarchaeota. IMPORTANCE Little is known about transcriptional regulation of carbon dioxide fixation pathways in Archaea. We previously applied the comparative genomics approach for reconstruction of Dtx

  5. Gene transcriptional networks integrate microenvironmental signals in human breast cancer.

    PubMed

    Xu, Ren; Mao, Jian-Hua

    2011-04-01

    A significant amount of evidence shows that microenvironmental signals generated from extracellular matrix (ECM) molecules, soluble factors, and cell-cell adhesion complexes cooperate at the extra- and intracellular level. This synergetic action of microenvironmental cues is crucial for normal mammary gland development and breast malignancy. To explore how the microenvironmental genes coordinate in human breast cancer at the genome level, we have performed gene co-expression network analysis in three independent microarray datasets and identified two microenvironment networks in human breast cancer tissues. Network I represents crosstalk and cooperation of ECM microenvironment and soluble factors during breast malignancy. The correlated expression of cytokines, chemokines, and cell adhesion proteins in Network II implicates the coordinated action of these molecules in modulating the immune response in breast cancer tissues. These results suggest that microenvironmental cues are integrated with gene transcriptional networks to promote breast cancer development.

  6. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli

    PubMed Central

    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L.; Stavans, Joel

    2016-01-01

    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli. In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts’ threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation. PMID:27085802

  7. Genome-scale study of the importance of binding site context for transcription factor binding and gene regulation

    PubMed Central

    Westholm, Jakub Orzechowski; Xu, Feifei; Ronne, Hans; Komorowski, Jan

    2008-01-01

    Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence) is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context. PMID:19014636

  8. Effect of replication on epigenetic memory and consequences on gene transcription

    NASA Astrophysics Data System (ADS)

    Zerihun, Mehari B.; Vaillant, Cédric; Jost, Daniel

    2015-04-01

    Gene activity in eukaryotes is in part regulated at the level of chromatin through the assembly of local chromatin states that are more or less permissive to transcription. How do these chromatin states achieve their functions and whether or not they contribute to the epigenetic inheritance of the transcriptional program remain to be elucidated. In cycling cells, stability is indeed strongly challenged by the periodic occurrence of replication and cell division. To address this question, we perform simulations of the stochastic dynamics of chromatin states when driven out-of-equilibrium by periodic perturbations. We show how epigenetic memory is significantly affected by the cell cycle length. In addition, we develop a simple model to connect the epigenetic state to the transcriptional state and gene activity. In particular, it suggests that replication may induce transcriptional bursting at repressive loci. Finally, we discuss how our findings—effect of replication and link to gene transcription—have original and deep implications to various biological contexts of epigenetic memory.

  9. Transcriptional regulation of the bovine oxytocin receptor gene.

    PubMed

    Telgmann, Ralph; Bathgate, Ross A D; Jaeger, Stefanie; Tillmann, Gina; Ivell, Richard

    2003-03-01

    The oxytocin receptor (OTR) is expressed in the cow uterus at high levels at estrus and at term of pregnancy. This expression appears to be controlled mostly at the transcriptional level and correlates with increasing estrogen concentration and progesterone withdrawal. Approximately 3200 base pairs of the upstream region of the bovine OTR gene were cloned and analyzed using a combination of bioinformatic, electrophoretic mobility shift (EMSA), and transfection analyses. Using nuclear proteins from high- and low-expressing tissues, EMSA indicated no significant quantitative or qualitative changes in specific DNA-protein binding, suggesting that transcription is probably controlled by signalling systems targeting constitutive factors. Using various cell types, including primary and immortalized ruminant endometrial epithelial cells, as hosts for transfection of promoter-reporter constructs showed that endogenous activity resided only in the longest, i.e., 3.2-kb, construct but not in those shorter than 1.0 kb. While estrogen appears to be important in vivo, no effect of estradiol was found on any construct directly; only when the longest 3.2-kb construct was used in combination with some cotransfected steroid receptor cofactors, e.g., SRC1e, was an estradiol-dependent effect observed. A putative interferon-responsive element (IRE) was found at approximately -2,400 from the transcription start site. This element was shown to bind mouse IRF1 and IRF2 as well as similar proteins from bovine endometrial and myometrial nuclear extracts. This element also responded to these factors when cotransfected into various cell types. The bovine equivalents to IRF1 and IRF2 were molecularly cloned from endometrial tissue and shown to be expressed in a temporal fashion, supporting the role of interferon-tau in maternal recognition of pregnancy. Of many factors tested or analyzed, these components of the IFN system are the only ones found to significantly influence the transcription

  10. Transcription of antifreeze protein genes in Choristoneura fumiferana.

    PubMed

    Qin, W; Doucet, D; Tyshenko, M G; Walker, V K

    2007-08-01

    Antifreeze proteins (AFPs) are encoded by approximately 17 genes in the spruce budworm, Choristoneura fumiferana. Northern analysis using 6 different cDNA probes showed isoform-specific patterns that varied during development. Transcripts for the majority of isoforms were most abundant in the second instar overwintering stage, but some were also detected in first instar and even in egg stages. In situ hybridization using riboprobes corresponding to two 9 kDa protein isoforms showed differential AFP expression even in second instars; CfAFP10 RNA was detected in all tissues, but CfAFP337 RNA distribution was more limited. Two genomic regions encoding three AFP genes have been isolated. Presumptive regulatory regions conferred transcriptional activity when placed upstream of a luciferase reporter sequence and transfected into a C. fumiferana cell line. The CfAFP2.26 core promoter is an 87 bp sequence containing a TATA box, whereas the CfAFP2.7 core promoter is a 76 bp sequence with both a TATA box and CAAT box, which directed higher reporter activities when tested in vitro. Reporter activity was not enhanced with five different hormones, although lower activities were observed with all intron-containing constructs. AFP message half-life, as assessed using reporter assays, was not appreciably influenced by isoform-specific-3'UTRs. These studies successfully demonstrate the temporal and spatial diversity of AFP expression encoded by this small gene family, and underscore the complexity of their regulation.

  11. Transcriptional regulation of FoxO3 gene by glucocorticoids in murine myotubes.

    PubMed

    Kuo, Taiyi; Liu, Patty H; Chen, Tzu-Chieh; Lee, Rebecca A; New, Jenny; Zhang, Danyun; Lei, Cassandra; Chau, Andy; Tang, Yicheng; Cheung, Edna; Wang, Jen-Chywan

    2016-04-01

    Glucocorticoids and FoxO3 exert similar metabolic effects in skeletal muscle. FoxO3 gene expression was increased by dexamethasone (Dex), a synthetic glucocorticoid, both in vitro and in vivo. In C2C12 myotubes the increased expression is due to, at least in part, the elevated rate of FoxO3 gene transcription. In the mouse FoxO3 gene, we identified three glucocorticoid receptor (GR) binding regions (GBRs): one being upstream of the transcription start site, -17kbGBR; and two in introns, +45kbGBR and +71kbGBR. Together, these three GBRs contain four 15-bp glucocorticoid response elements (GREs). Micrococcal nuclease (MNase) assay revealed that Dex treatment increased the sensitivity to MNase in the GRE of +45kbGBR and +71kbGBR upon 30- and 60-min Dex treatment, respectively. Conversely, Dex treatment did not affect the chromatin structure near the -17kbGBR, in which the GRE is located in the linker region. Dex treatment also increased histone H3 and/or H4 acetylation in genomic regions near all three GBRs. Moreover, using chromatin conformation capture (3C) assay, we showed that Dex treatment increased the interaction between the -17kbGBR and two genomic regions: one located around +500 bp and the other around +73 kb. Finally, the transcriptional coregulator p300 was recruited to all three GBRs upon Dex treatment. The reduction of p300 expression decreased FoxO3 gene expression and Dex-stimulated interaction between distinct genomic regions of FoxO3 gene identified by 3C. Overall, our results demonstrate that glucocorticoids activated FoxO3 gene transcription through multiple GREs by chromatin structural change and DNA looping.

  12. Estrogen Signaling Multiple Pathways to Impact Gene Transcription

    PubMed Central

    Marino, Maria; Galluzzo, Paola; Ascenzi, Paolo

    2006-01-01

    Steroid hormones exert profound effects on cell growth, development, differentiation, and homeostasis. Their effects are mediated through specific intracellular steroid receptors that act via multiple mechanisms. Among others, the action mechanism starting upon 17β-estradiol (E2) binds to its receptors (ER) is considered a paradigmatic example of how steroid hormones function. Ligand-activated ER dimerizes and translocates in the nucleus where it recognizes specific hormone response elements located in or near promoter DNA regions of target genes. Behind the classical genomic mechanism shared with other steroid hormones, E2 also modulates gene expression by a second indirect mechanism that involves the interaction of ER with other transcription factors which, in turn, bind their cognate DNA elements. In this case, ER modulates the activities of transcription factors such as the activator protein (AP)-1, nuclear factor-κB (NF-κB) and stimulating protein-1 (Sp-1), by stabilizing DNA-protein complexes and/or recruiting co-activators. In addition, E2 binding to ER may also exert rapid actions that start with the activation of a variety of signal transduction pathways (e.g. ERK/MAPK, p38/MAPK, PI3K/AKT, PLC/PKC). The debate about the contribution of different ER-mediated signaling pathways to coordinate the expression of specific sets of genes is still open. This review will focus on the recent knowledge about the mechanism by which ERs regulate the expression of target genes and the emerging field of integration of membrane and nuclear receptor signaling, giving examples of the ways by which the genomic and non-genomic actions of ERs on target genes converge. PMID:18369406

  13. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves.

    PubMed

    Christiansen, Michael W; Gregersen, Per L

    2014-07-01

    The senescence process of plants is important for the completion of their life cycle, particularly for crop plants, it is essential for efficient nutrient remobilization during seed filling. It is a highly regulated process, and in order to address the regulatory aspect, the role of genes in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription-PCR (qRT-PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47 studied NAC genes to be important for signalling processes and for the execution of degradation processes during leaf senescence in barley. Seven models for DNA-binding motifs for NAC transcription factors were designed based on published motifs, and available promoter sequences of barley genes were screened for the motifs. Genes up-regulated during senescence showed a significant over-representation of the motifs, suggesting regulation by the NAC transcription factors. Furthermore, co-regulation studies showed that genes possessing the motifs in the promoter in general were highly co-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71 senescence-associated genes that are potential target genes for these NAC transcription factors is presented.

  14. Transcriptional profiling and in silico analysis of Dof transcription factor gene family for understanding their regulation during seed development of rice Oryza sativa L.

    PubMed

    Gaur, Vikram Singh; Singh, U S; Kumar, Anil

    2011-04-01

    Seed development is a complex process controlled by temporal and spatial expression of many transcription factors (TF) inside the developing seed. In the present study, transcript profiles of all the 30 members of rice DofTFs from flowering to seed development stages were analyzed. It was found that 16 Dof genes besides a previously characterized Dof gene 'RPBF' are differentially expressed during the seed development and unlike RPBF are not seed specific. Based on the expression patterns, these rice DofTFs were categorized into four groups-6 genes were constitutive while 4 genes were up-regulated and 3 genes were down regulated and four genes were maximally expressed at specific stages of seed development viz. one gene at flowering, two genes at watery ripe and one gene at milky stage. The involvement of more than one gene at different stages of seed development is suggestive of combinatorial regulation of their downstream genes involved in seed development. In silico expression analysis of wheat and Arabidopsis Dof Tfs also revealed that more than 50% of the Dof genes are expressed during the seed development process. Further in silico study of regulatory elements present in the promoters of these genes revealed the presence of some unique and common motifs in the promoters of rice and wheat Dof genes which indicate that Dof genes are possibly involved in ethylene and jasmonate signaling pathways affecting grain filling and grain quality. These Dof genes containing ethylene responsive motifs in their promoter region could possibly be the targets of recently identified Sub1 gene which codes for a ethylene responsive factor.

  15. Variability of Gene Expression Identifies Transcriptional Regulators of Early Human Embryonic Development

    PubMed Central

    Hasegawa, Yu; Taylor, Deanne; Ovchinnikov, Dmitry A.; Wolvetang, Ernst J.; de Torrenté, Laurence; Mar, Jessica C.

    2015-01-01

    An analysis of gene expression variability can provide an insightful window into how regulatory control is distributed across the transcriptome. In a single cell analysis, the inter-cellular variability of gene expression measures the consistency of transcript copy numbers observed between cells in the same population. Application of these ideas to the study of early human embryonic development may reveal important insights into the transcriptional programs controlling this process, based on which components are most tightly regulated. Using a published single cell RNA-seq data set of human embryos collected at four-cell, eight-cell, morula and blastocyst stages, we identified genes with the most stable, invariant expression across all four developmental stages. Stably-expressed genes were found to be enriched for those sharing indispensable features, including essentiality, haploinsufficiency, and ubiquitous expression. The stable genes were less likely to be associated with loss-of-function variant genes or human recessive disease genes affected by a DNA copy number variant deletion, suggesting that stable genes have a functional impact on the regulation of some of the basic cellular processes. Genes with low expression variability at early stages of development are involved in regulation of DNA methylation, responses to hypoxia and telomerase activity, whereas by the blastocyst stage, low-variability genes are enriched for metabolic processes as well as telomerase signaling. Based on changes in expression variability, we identified a putative set of gene expression markers of morulae and blastocyst stages. Experimental validation of a blastocyst-expressed variability marker demonstrated that HDDC2 plays a role in the maintenance of pluripotency in human ES and iPS cells. Collectively our analyses identified new regulators involved in human embryonic development that would have otherwise been missed using methods that focus on assessment of the average expression

  16. Transcriptional profiling reveals regulated genes in the hippocampus during memory formation

    NASA Technical Reports Server (NTRS)

    Donahue, Christine P.; Jensen, Roderick V.; Ochiishi, Tomoyo; Eisenstein, Ingrid; Zhao, Mingrui; Shors, Tracey; Kosik, Kenneth S.

    2002-01-01

    Transcriptional profiling (TP) offers a powerful approach to identify genes activated during memory formation and, by inference, the molecular pathways involved. Trace eyeblink conditioning is well suited for the study of regional gene expression because it requires the hippocampus, whereas the highly parallel task, delay conditioning, does not. First, we determined when gene expression was most regulated during trace conditioning. Rats were exposed to 200 trials per day of paired and unpaired stimuli each day for 4 days. Changes in gene expression were most apparent 24 h after exposure to 200 trials. Therefore, we profiled gene expression in the hippocampus 24 h after 200 trials of trace eyeblink conditioning, on multiple arrays using additional animals. Of 1,186 genes on the filter array, seven genes met the statistical criteria and were also validated by real-time polymerase chain reaction. These genes were growth hormone (GH), c-kit receptor tyrosine kinase (c-kit), glutamate receptor, metabotropic 5 (mGluR5), nerve growth factor-beta (NGF-beta), Jun oncogene (c-Jun), transmembrane receptor Unc5H1 (UNC5H1), and transmembrane receptor Unc5H2 (UNC5H2). All these genes, except for GH, were downregulated in response to trace conditioning. GH was upregulated; therefore, we also validated the downregulation of the GH inhibitor, somatostatin (SST), even though it just failed to meet criteria on the arrays. By during situ hybridization, GH was expressed throughout the cell layers of the hippocampus in response to trace conditioning. None of the genes regulated in trace eyeblink conditioning were similarly affected by delay conditioning, a task that does not require the hippocampus. These findings demonstrate that transcriptional profiling can exhibit a repertoire of genes sensitive to the formation of hippocampal-dependent associative memories.

  17. Gene Transcript Abundance Profiles Distinguish Kawasaki Disease from Adenovirus Infection

    PubMed Central

    Popper, Stephen J.; Watson, Virginia E.; Shimizu, Chisato; Kanegaye, John T.; Burns, Jane C.; Relman, David A.

    2010-01-01

    Background Acute Kawasaki disease (KD) is difficult to distinguish from other illnesses that involve acute rash or fever, in part because the etiologic agent(s) and pathophysiology remain poorly characterized. As a result, diagnosis and critical therapies may be delayed. Methods We used DNA microarrays to identify possible diagnostic features of KD. We compared gene expression patterns in the blood of 23 children with acute KD and 18 age-matched febrile children with 3 illnesses that resemble KD. Results Genes associated with platelet and neutrophil activation were expressed at higher levels in patients with KD than in patients with acute adenovirus infections or systemic adverse drug reactions, but levels in patients with KD were not higher than those in patients with scarlet fever. Genes associated with B cell activation were also expressed at higher levels in patients with KD than in control subjects. A striking absence of interferon-stimulated gene expression in patients with KD was confirmed in an independent cohort of patients with KD. Using a set of 38 gene transcripts, we successfully predicted the diagnosis for 21 of 23 patients with KD and 7 of 8 patients with adenovirus infection. Conclusions These findings provide insight into the molecular features that distinguish KD from other febrile illnesses and support the feasibility of developing novel diagnostic reagents for KD based on the host response. PMID:19583510

  18. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement

    PubMed Central

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-01-01

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K+ (K+in) channels and reduced K+in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K+in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K+in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  19. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement.

    PubMed

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-Ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-04-12

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K(+) (K(+) in) channels and reduced K(+) in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K(+) in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K(+) in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants.

  20. Systematic repression of transcription factors reveals limited patterns of gene expression changes in ES cells

    PubMed Central

    Nishiyama, Akira; Sharov, Alexei A.; Piao, Yulan; Amano, Misa; Amano, Tomokazu; Hoang, Hien G.; Binder, Bernard Y.; Tapnio, Richard; Bassey, Uwem; Malinou, Justin N.; Correa-Cerro, Lina S.; Yu, Hong; Xin, Li; Meyers, Emily; Zalzman, Michal; Nakatake, Yuhki; Stagg, Carole; Sharova, Lioudmila; Qian, Yong; Dudekula, Dawood; Sheer, Sarah; Cadet, Jean S.; Hirata, Tetsuya; Yang, Hsih-Te; Goldberg, Ilya; Evans, Michele K.; Longo, Dan L.; Schlessinger, David; Ko, Minoru S. H.

    2013-01-01

    Networks of transcription factors (TFs) are thought to determine and maintain the identity of cells. Here we systematically repressed each of 100 TFs with shRNA and carried out global gene expression profiling in mouse embryonic stem (ES) cells. Unexpectedly, only the repression of a handful of TFs significantly affected transcriptomes, which changed in two directions/trajectories: one trajectory by the repression of either Pou5f1 or Sox2; the other trajectory by the repression of either Esrrb, Sall4, Nanog, or Tcfap4. The data suggest that the trajectories of gene expression change are already preconfigured by the gene regulatory network and roughly correspond to extraembryonic and embryonic fates of cell differentiation, respectively. These data also indicate the robustness of the pluripotency gene network, as the transient repression of most TFs did not alter the transcriptomes. PMID:23462645

  1. Genome-Wide Dissection of the Heat Shock Transcription Factor Family Genes in Arachis

    PubMed Central

    Wang, Pengfei; Song, Hui; Li, Changsheng; Li, Pengcheng; Li, Aiqin; Guan, Hongshan; Hou, Lei; Wang, Xingjun

    2017-01-01

    Heat shock transcription factors (Hsfs) are important transcription factors (TFs) in protecting plants from damages caused by various stresses. The released whole genome sequences of wild peanuts make it possible for genome-wide analysis of Hsfs in peanut. In this study, a total of 16 and 17 Hsf genes were identified from Arachis duranensis and A. ipaensis, respectively. We identified 16 orthologous Hsf gene pairs in both peanut species; however HsfXs was only identified from A. ipaensis. Orthologous pairs between two wild peanut species were highly syntenic. Based on phylogenetic relationship, peanut Hsfs were divided into groups A, B, and C. Selection pressure analysis showed that group B Hsf genes mainly underwent positive selection and group A Hsfs were affected by purifying selection. Small scale segmental and tandem duplication may play important roles in the evolution of these genes. Cis-elements, such as ABRE, DRE, and HSE, were found in the promoters of most Arachis Hsf genes. Five AdHsfs and two AiHsfs contained fungal elicitor responsive elements suggesting their involvement in response to fungi infection. These genes were differentially expressed in cultivated peanut under abiotic stress and Aspergillus flavus infection. AhHsf2 and AhHsf14 were significantly up-regulated after inoculation with A. flavus suggesting their possible role in fungal resistance. PMID:28220134

  2. Transcription initiation in vivo without classical transactivators: DNA kinks flanking the core promoter of the housekeeping yeast adenylate kinase gene, AKY2, position nucleosomes and constitutively activate transcription.

    PubMed

    Angermayr, Michaela; Oechsner, Ulrich; Gregor, Kerstin; Schroth, Gary P; Bandlow, Wolfhard

    2002-10-01

    The housekeeping gene of the major adenylate kinase in Saccharomyces cerevisiae (AKY2, ADK1) is constitutively transcribed at a moderate level. The promoter has been dissected in order to define elements that effect constitutive transcription. Initiation of mRNA synthesis at the AKY2 promoter is shown to be mediated by a non-canonic core promoter, (TA)(6). Nucleotide sequences 5' of this element only marginally affect transcription suggesting that promoter activation can dispense with transactivators and essentially involves basal transcription. We show that the core promoter of AKY2 is constitutively kept free of nucleosomes. Analyses of permutated AKY2 promoter DNA revealed the presence of bent DNA. DNA structure analysis by computer and by mutation identified two kinks flanking an interstitial stretch of 65 bp of moderately bent core promoter DNA. Kinked DNA is likely incompatible with packaging into nucleosomes and responsible for positioning nucleosomes at the flanks allowing unimpeded access of the basal transcription machinery to the core promoter. The data show that in yeast, constitutive gene expression can dispense with classical transcriptional activator proteins, if two prerequisites are met: (i) the core promoter is kept free of nucleosomes; this can be due to structural properties of the DNA as an alternative to chromatin remodeling factors; and (ii) the core promoter is pre-bent to allow a high rate of basal transcription initiation.

  3. A Weakened Transcriptional Enhancer Yields Variegated Gene Expression

    PubMed Central

    Collins, Cathy; Azmi, Peter; Berru, Maribel; Zhu, Xiaofu; Shulman, Marc J.

    2006-01-01

    Identical genes in the same cellular environment are sometimes expressed differently. In some cases, including the immunoglobulin heavy chain (IgH) locus, this type of differential gene expression has been related to the absence of a transcriptional enhancer. To gain additional information on the role of the IgH enhancer, we examined expression driven by enhancers that were merely weakened, rather than fully deleted, using both mutations and insulators to impair enhancer activity. For this purpose we used a LoxP/Cre system to place a reporter gene at the same genomic site of a stable cell line. Whereas expression of the reporter gene was uniformly high in the presence of the normal, uninsulated enhancer and undetectable in its absence, weakened enhancers yielded variegated expression of the reporter gene; i.e., the average level of expression of the same gene differed in different clones, and expression varied significantly among cells within individual clones. These results indicate that the weakened enhancer allows the reporter gene to exist in at least two states. Subtle aspects of the variegation suggest that the IgH enhancer decreases the average duration (half-life) of the silent state. This analysis has also tested the conventional wisdom that enhancer activity is independent of distance and orientation. Thus, our analysis of mutant (truncated) forms of the IgH enhancer revealed that the 250 bp core enhancer was active in its normal position, ∼1.4 kb 3′ of the promoter, but inactive ∼6 kb 3′, indicating that the activity of the core enhancer was distance-dependent. A longer segment – the core enhancer plus ∼1 kb of 3′ flanking material, including the 3′ matrix attachment region – was active, and the activity of this longer segment was orientation-dependent. Our data suggest that this 3′ flank includes binding sites for at least two activators. PMID:17183661

  4. The transcriptional repressor DREAM is involved in thyroid gene expression

    SciTech Connect

    D'Andrea, Barbara; Di Palma, Tina; Mascia, Anna; Motti, Maria Letizia; Viglietto, Giuseppe; Nitsch, Lucio; Zannini, Mariastella . E-mail: stella@szn.it

    2005-04-15

    Downstream regulatory element antagonistic modulator (DREAM) was originally identified in neuroendocrine cells as a calcium-binding protein that specifically binds to downstream regulatory elements (DRE) on DNA, and represses transcription of its target genes. To explore the possibility that DREAM may regulate the endocrine activity of the thyroid gland, we analyzed its mRNA expression in undifferentiated and differentiated thyroid cells. We demonstrated that DREAM is expressed in the normal thyroid tissue as well as in differentiated thyroid cells in culture while it is absent in FRT poorly differentiated cells. In the present work, we also show that DREAM specifically binds to DRE sites identified in the 5' untranslated region (UTR) of the thyroid-specific transcription factors Pax8 and TTF-2/FoxE1 in a calcium-dependent manner. By gel retardation assays we demonstrated that thapsigargin treatment increases the binding of DREAM to the DRE sequences present in Pax8 and TTF-2/Foxe1 5' UTRs, and this correlates with a significant reduction of the expression of these genes. Interestingly, in poorly differentiated thyroid cells overexpression of exogenous DREAM strongly inhibits Pax8 expression. Moreover, we provide evidence that a mutated form of DREAM unable to bind Ca{sup 2+} interferes with thyroid cell proliferation. Therefore, we propose that in thyroid cells DREAM is a mediator of the calcium-signaling pathway and it is involved in the regulation of thyroid cell function.

  5. Genes affecting heading date in cocksfoot (Dactylis glomerata)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several genes cause well known effects on heading date in cool-season forages: Vrn1, Constans, and FloweringTime. Vrn1 is a MADs box transcription factor that is induced upon vernalization and necessary for flowering. Constans genes are induced upon long days in cool-season grasses and induce exp...

  6. Saxitoxin Modulates Immunological Parameters and Gene Transcription in Mytilus chilensis Hemocytes

    PubMed Central

    Astuya, Allisson; Carrera, Crisleri; Ulloa, Viviana; Aballay, Ambbar; Núñez-Acuña, Gustavo; Hégaret, Hélène; Gallardo-Escárate, Cristian

    2015-01-01

    Saxitoxin (STX) is a neurotoxin produced by dinoflagellates in diverse species, such as Alexandrium spp., and it causes paralytic shellfish poisoning (PSP) in humans after the ingestion of contaminated shellfish. Recent studies have suggested that the immune functions of bivalves could be affected by harmful algae and/or by their toxins. Herein, hemocytes are the main effector cells of the immune cellular response. In this study, we evaluated the response of hemocytes from the mussel Mytilus chilensis to STX exposure in a primary culture. Cell cultures were characterized according to size and complexity, while reactive oxygen species (ROS) production was evaluated using a dichlorofluorescein diacetate (DCFH-DA) assay. Finally, phagocytic activity was measured using both flow cytometry and fluorescence microscopy assays. Additionally, gene transcription of candidate genes was evaluated by qPCR assays. The results evidenced that exposures to different concentrations of STX (1–100 nM) for 24 h did not affect cell viability, as determined by an MTT assay. However, when hemocytes were exposed for 4 or 16 h to STX (1–100 nM), there was a modulation of phagocytic activity and ROS production. Moreover, hemocytes exposed to 100 nM of STX for 4 or 16 h showed a significant increase in transcript levels of genes encoding for antioxidant enzymes (SOD, CAT), mitochondrial enzymes (COI, COIII, CYTB, ATP6, ND1) and ion channels (K+, Ca2+). Meanwhile, C-type lectin and toll-like receptor genes revealed a bi-phase transcriptional response after 16 and 24–48 h of exposure to STX. These results suggest that STX can negatively affect the immunocompetence of M. chilensis hemocytes, which were capable of responding to STX exposure in vitro by increasing the mRNA levels of antioxidant enzymes. PMID:26154765

  7. Sequence requirements for transcriptional arrest in exon 1 of the murine adenosine deaminase gene.

    PubMed Central

    Ramamurthy, V; Maa, M C; Harless, M L; Wright, D A; Kellems, R E

    1990-01-01

    We have previously shown that a transcription arrest site near the 5' end of the murine adenosine deaminase (ADA) gene is significantly involved in the regulation of ADA gene expression. To facilitate the analysis of this transcription arrest site, we have analyzed the transcription products from cloned ADA gene fragments injected into Xenopus laevis oocytes. When genomic fragments spanning the 5' end of the ADA gene were injected into oocytes, a 96-nucleotide (nt) ADA RNA was the major transcription product. The 5' end of this RNA mapped to the transcription initiation site for the ADA gene, and its 3' terminus mapped 7 nt downstream of the translation initiation codon within exon 1. A 300-base-pair fragment of genomic DNA spanning the 5' end of the ADA gene was sufficient to generate the 96-nt transcript which accounted for approximately one-half of the transcription products from injected templates. Deletion of a segment of approximately 65 base pairs, located immediately downstream of the 3' terminus of the 96-nt transcript, resulted in a substantial reduction in the synthesis of the 96-nt transcript and a corresponding increase in the production of larger transcripts. These studies show that the transcriptional apparatus of X. laevis oocytes responds to the transcription arrest site associated with exon 1 of the murine ADA gene and that oocyte injections provide a convenient functional assay for additional mechanistic studies. Images PMID:1690842

  8. VITELLOGENIN GENE TRANSCRIPTION: A RELATIVE QUANTITATIVE EXPOSURE INDICATOR OF ENVIRONMENTAL ESTROGENS

    EPA Science Inventory

    We report the development of a quantifiable exposure indicator for measuring the presence of environmental estrogens in aquatic systems. Synthetic oligonucleotides, designed specifically for the vitellogenin gene (Vg) transcription product, were used in a Reverse Transcription Po...

  9. Most “Dark Matter” Transcripts Are Associated With Known Genes

    PubMed Central

    van Bakel, Harm; Nislow, Corey; Blencowe, Benjamin J.; Hughes, Timothy R.

    2010-01-01

    A series of reports over the last few years have indicated that a much larger portion of the mammalian genome is transcribed than can be accounted for by currently annotated genes, but the quantity and nature of these additional transcripts remains unclear. Here, we have used data from single- and paired-end RNA-Seq and tiling arrays to assess the quantity and composition of transcripts in PolyA+ RNA from human and mouse tissues. Relative to tiling arrays, RNA-Seq identifies many fewer transcribed regions (“seqfrags”) outside known exons and ncRNAs. Most nonexonic seqfrags are in introns, raising the possibility that they are fragments of pre-mRNAs. The chromosomal locations of the majority of intergenic seqfrags in RNA-Seq data are near known genes, consistent with alternative cleavage and polyadenylation site usage, promoter- and terminator-associated transcripts, or new alternative exons; indeed, reads that bridge splice sites identified 4,544 new exons, affecting 3,554 genes. Most of the remaining seqfrags correspond to either single reads that display characteristics of random sampling from a low-level background or several thousand small transcripts (median length = 111 bp) present at higher levels, which also tend to display sequence conservation and originate from regions with open chromatin. We conclude that, while there are bona fide new intergenic transcripts, their number and abundance is generally low in comparison to known exons, and the genome is not as pervasively transcribed as previously reported. PMID:20502517

  10. Heat Stress Regulates the Expression of Genes at Transcriptional and Post-Transcriptional Levels, Revealed by RNA-seq in Brachypodium distachyon

    PubMed Central

    Chen, Shoukun; Li, Haifeng

    2017-01-01

    Heat stress greatly affects plant growth/development and influences the output of crops. With the increased occurrence of extreme high temperature, the negative influence on cereal products from heat stress becomes severer and severer. It is urgent to reveal the molecular mechanism in response to heat stress in plants. In this research, we used RNA-seq technology to identify differentially expressed genes (DEGs) in leaves of seedlings, leaves and inflorescences at heading stage of Brachypodium distachyon, one model plant of grasses. Results showed many genes in responding to heat stress. Of them, the expression level of 656 DEGs were altered in three groups of samples treated with high temperature. Gene ontology (GO) analysis showed that the highly enriched DEGs were responsible for heat stress and protein folding. According to KEGG pathway analysis, the DEGs were related mainly to photosynthesis-antenna proteins, the endoplasmic reticulum, and the spliceosome. Additionally, the expression level of 454 transcription factors belonging to 49 gene families was altered, as well as 1,973 splicing events occurred after treatment with high temperature. This research lays a foundation for characterizing the molecular mechanism of heat stress response and identifying key genes for those responses in plants. These findings also clearly show that heat stress regulates the expression of genes not only at transcriptional level, but also at post-transcriptional level. PMID:28119730

  11. Genetic Diversity Affects the Daily Transcriptional Oscillations of Marine Microbial Populations

    PubMed Central

    Shilova, Irina N.; Robidart, Julie C.; DeLong, Edward F.; Zehr, Jonathan P.

    2016-01-01

    Marine microbial communities are genetically diverse but have robust synchronized daily transcriptional patterns at the genus level that are similar across a wide variety of oceanic regions. We developed a microarray-inspired gene-centric approach to resolve transcription of closely-related but distinct strains/ecotypes in high-throughput sequence data. Applying this approach to the existing metatranscriptomics datasets collected from two different oceanic regions, we found unique and variable patterns of transcription by individual taxa within the abundant picocyanobacteria Prochlorococcus and Synechococcus, the alpha Proteobacterium Pelagibacter and the eukaryotic picophytoplankton Ostreococcus. The results demonstrate that marine microbial taxa respond differentially to variability in space and time in the ocean. These intra-genus individual transcriptional patterns underlie whole microbial community responses, and the approach developed here facilitates deeper insights into microbial population dynamics. PMID:26751368

  12. Genetic Diversity Affects the Daily Transcriptional Oscillations of Marine Microbial Populations.

    PubMed

    Shilova, Irina N; Robidart, Julie C; DeLong, Edward F; Zehr, Jonathan P

    2016-01-01

    Marine microbial communities are genetically diverse but have robust synchronized daily transcriptional patterns at the genus level that are similar across a wide variety of oceanic regions. We developed a microarray-inspired gene-centric approach to resolve transcription of closely-related but distinct strains/ecotypes in high-throughput sequence data. Applying this approach to the existing metatranscriptomics datasets collected from two different oceanic regions, we found unique and variable patterns of transcription by individual taxa within the abundant picocyanobacteria Prochlorococcus and Synechococcus, the alpha Proteobacterium Pelagibacter and the eukaryotic picophytoplankton Ostreococcus. The results demonstrate that marine microbial taxa respond differentially to variability in space and time in the ocean. These intra-genus individual transcriptional patterns underlie whole microbial community responses, and the approach developed here facilitates deeper insights into microbial population dynamics.

  13. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun

    2015-01-01

    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  14. Sucrose regulation of ADP-glucose pyrophosphorylase subunit genes transcript levels in leaves and fruits

    NASA Technical Reports Server (NTRS)

    Li, Xiangyang; Xing, Jinpeng; Gianfagna, Thomas J.; Janes, Harry W.

    2002-01-01

    ADP-glucose pyrophosphorylase (AGPase, EC2.7.7.27) is a key regulatory enzyme in starch biosynthesis. The enzyme is a heterotetramer with two S and two B subunits. In tomato, there are three multiple forms of the S subunit gene. Agp S1, S2 and B are highly expressed in fruit from 10 to 25 days after anthesis. Agp S3 is only weakly expressed in fruit. Sucrose significantly elevates expression of Agp S1, S2 and B in both leaves and fruits. Agp S1 exhibits the highest degree of regulation by sucrose. In fact, sucrose may be required for Agp S1 expression. For excised leaves incubated in water, no transcripts for Agp S1 could be detected in the absence of sucrose, whereas it took up to 16 h in water before transcripts were no longer detectable for Agp S2 and B. Neither Agp S3 nor the tubulin gene is affected by sucrose, demonstrating that this response is specifically regulated by a carbohydrate metabolic signal, and is not due to a general increase in metabolism caused by sucrose treatment. Truncated versions of the promoter for Agp S1 indicate that a specific region 1.3-3.0 kb upstream from the transcription site is responsible for sucrose sensitivity. This region of the S1 promoter contains several cis-acting elements present in the promoters of other genes that are also regulated by sucrose. c2002 Elsevier Science Ireland Ltd. All rights reserved.

  15. IKK{epsilon} modulates RSV-induced NF-{kappa}B-dependent gene transcription

    SciTech Connect

    Bao Xiaoyong; Indukuri, Hemalatha; Liu Tianshuang; Liao Suiling; Tian, Bing; Brasier, Allan R.; Garofalo, Roberto P.; Casola, Antonella

    2010-12-20

    Respiratory syncytial virus (RSV), a negative-strand RNA virus, is the most common cause of epidemic respiratory disease in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B). In this study we have investigated the role of the non canonical I{kappa}B kinase (IKK){epsilon} in modulating RSV-induced NF-{kappa}B activation. Our results show that inhibition of IKK{epsilon} activation results in significant impairment of viral-induced NF-{kappa}B-dependent gene expression, through a reduction in NF-{kappa}B transcriptional activity, without changes in nuclear translocation or DNA-binding activity. Absence of IKK{epsilon} results in a significant decrease of RSV-induced NF-{kappa}B phosphorylation on serine 536, a post-translational modification important for RSV-induced NF-{kappa}B-dependent gene expression, known to regulate NF-{kappa}B transcriptional activity without affecting nuclear translocation. This study identifies a novel mechanism by which IKK{epsilon} regulates viral-induced cellular signaling.

  16. Genome-Wide Transcriptional Analysis of Genes Associated with Acute Desiccation Stress in Anopheles gambiae

    PubMed Central

    Wang, Mei-Hui; Marinotti, Osvaldo; Vardo-Zalik, Anne; Boparai, Rajni; Yan, Guiyun

    2011-01-01

    Malaria transmission in sub-Saharan Africa varies seasonally in intensity. Outbreaks of malaria occur after the beginning of the rainy season, whereas, during the dry season, reports of the disease are less frequent. Anopheles gambiae mosquitoes, the main malaria vector, are observed all year long but their densities are low during the dry season that generally lasts several months. Aestivation, seasonal migration, and local adaptation have been suggested as mechanisms that enable mosquito populations to persist through the dry season. Studies of chromosomal inversions have shown that inversions 2La, 2Rb, 2Rc, 2Rd, and 2Ru are associated with various physiological changes that confer aridity resistance. However, little is known about how phenotypic plasticity responds to seasonally dry conditions. This study examined the effects of desiccation stress on transcriptional regulation in An. gambiae. We exposed female An. gambiae G3 mosquitoes to acute desiccation and conducted a genome-wide analysis of their transcriptomes using the Affymetrix Plasmodium/Anopheles Genome Array. The transcription of 248 genes (1.7% of all transcripts) was significantly affected in all experimental conditions, including 96 with increased expression and 152 with decreased expression. In general, the data indicate a reduction in the metabolic rate of mosquitoes exposed to desiccation. Transcripts accumulated at higher levels during desiccation are associated with oxygen radical detoxification, DNA repair and stress responses. The proportion of transcripts within 2La and 2Rs (2Rb, 2Rc, 2Rd, and 2Ru) (67/248, or 27%) is similar to the percentage of transcripts located within these inversions (31%). These data may be useful in efforts to elucidate the role of chromosomal inversions in aridity tolerance. The scope of application of the anopheline genome demonstrates that examining transcriptional activity in relation to genotypic adaptations greatly expands the number of candidate regions

  17. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-02

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming.

  18. Plant Elongator regulates auxin-related genes during RNA polymerase II transcription elongation.

    PubMed

    Nelissen, Hilde; De Groeve, Steven; Fleury, Delphine; Neyt, Pia; Bruno, Leonardo; Bitonti, Maria Beatrice; Vandenbussche, Filip; Van der Straeten, Dominique; Yamaguchi, Takahiro; Tsukaya, Hirokazu; Witters, Erwin; De Jaeger, Geert; Houben, Andreas; Van Lijsebettens, Mieke

    2010-01-26

    In eukaryotes, transcription of protein-encoding genes is strongly regulated by posttranslational modifications of histones that affect the accessibility of the DNA by RNA polymerase II (RNAPII). The Elongator complex was originally identified in yeast as a histone acetyltransferase (HAT) complex that activates RNAPII-mediated transcription. In Arabidopsis thaliana, the Elongator mutants elo1, elo2, and elo3 with decreased leaf and primary root growth due to reduced cell proliferation identified homologs of components of the yeast Elongator complex, Elp4, Elp1, and Elp3, respectively. Here we show that the Elongator complex was purified from plant cell cultures as a six-component complex. The role of plant Elongator in transcription elongation was supported by colocalization of the HAT enzyme, ELO3, with euchromatin and the phosphorylated form of RNAPII, and reduced histone H3 lysine 14 acetylation at the coding region of the SHORT HYPOCOTYL 2 auxin repressor and the LAX2 auxin influx carrier gene with reduced expression levels in the elo3 mutant. Additional auxin-related genes were down-regulated in the transcriptome of elo mutants but not targeted by the Elongator HAT activity showing specificity in target gene selection. Biological relevance was apparent by auxin-related phenotypes and marker gene analysis. Ethylene and jasmonic acid signaling and abiotic stress responses were up-regulated in the elo transcriptome and might contribute to the pleiotropic elo phenotype. Thus, although the structure of Elongator and its substrate are conserved, target gene selection has diverged, showing that auxin signaling and influx are under chromatin control.

  19. A viral function represses accumulation of transcripts from productive-cycle genes in mouse ganglia latently infected with herpes simplex virus.

    PubMed

    Chen, S H; Kramer, M F; Schaffer, P A; Coen, D M

    1997-08-01

    Latent infections of neurons by herpes simplex virus form reservoirs of recurrent viral infections that resist cure. In latently infected neurons, viral gene expression is severely repressed; only the latency-associated transcripts (LATs) are expressed abundantly. Using sensitive reverse transcriptase PCR assays, we analyzed the effects of a deletion mutation in the LAT locus on viral gene expression in latently infected mouse trigeminal ganglia. The deletion mutation, which reduced expression of the major LATs 10(5)-fold, resulted in a approximately 5-fold increase in accumulation of transcripts from the immediate-early gene encoding ICP4, an essential transactivator of viral gene expression. The LAT deletion also resulted in a >10-fold increase in the accumulation of transcripts from the early gene encoding thymidine kinase, whose expression during productive infection stringently depends on ICP4, and positively affected the correlation of the levels of these transcripts with the levels of ICP4 transcripts. We also detected transcripts antisense to ICP4 RNA, which were in substantial excess to ICP4 transcripts in ganglia latently infected with wild-type virus. In contrast to its effects on productive-cycle transcripts, the LAT deletion reduced the accumulation of these antisense transcripts approximately 15-fold. Thus, a viral function associated with the LAT locus represses the accumulation of transcripts from at least two productive-cycle genes in latently infected mouse ganglia. We discuss possible mechanisms and consequences of this repression.

  20. Light and an exogenous transcription factor qualitatively and quantitatively affect the biosynthetic pathway of condensed tannins in Lotus corniculatus leaves.

    PubMed

    Paolocci, Francesco; Bovone, Tessa; Tosti, Nicola; Arcioni, Sergio; Damiani, Francesco

    2005-04-01

    The effects of increasing light and of a heterologous bHLH transcription factor on the accumulation of condensed tannins (CT) were investigated in leaves of Lotus corniculatus, a model legume species which accumulates these secondary metabolites in leaves as well as reproductive tissues. Light and expression of the transgene increased the level of CT in a synergistic way. To monitor how the changes in accumulation of condensed tannins were achieved, the level of expression of four key genes in the flavonoid pathway was estimated by real-time RT-PCR analysis. Early genes of the pathway (PAL and CHS) were affected less in their expression and so appeared to be less involved in influencing the final level of CT than later genes in the pathway (DFR and ANS). Steady-state levels of DFR and ANS transcripts showed a strong positive correlation with CT and these genes might be considered the first rate-limiting steps in CT biosynthesis in Lotus leaves. However, additional factors mediated by light are limiting CT accumulation once these genes are up-regulated by the transgene. Therefore, the increment of the steady-state mRNA level for DFR and ANS might not be sufficient to up-regulate condensed tannins in leaves. The real-time RT-PCR approach adopted showed that members within the CHS and DFR gene families are differentially regulated by the exogenous bHLH gene and light. This finding is discussed in relation to the approaches for controlling CT biosynthesis and for studying the expression profile of multi-gene families.

  1. Structure and transcription of the Drosophila mulleri alcohol dehydrogenase genes.

    PubMed

    Fischer, J A; Maniatis, T

    1985-10-11

    The D. melanogaster Adh gene is transcribed from two different promoters; a proximal (larval) promoter is active during late embryonic and larval stages, and a distal (adult) promoter is active primarily in third instar larvae and in adult flies (1). Genetic analyses suggest that several species of the mulleri subgroup (distant relatives of D. melanogaster) have two closely-linked Adh genes, Adh-1 and Adh-2, each of which expresses a different ADH protein (2). The temporal pattern of expression of Adh-1 and Adh-2 is similar to the expression of D. melanogaster Adh from the proximal and distal promoters (2,3,4). We are interested in the molecular basis for the pattern of Adh expression in the mulleri subgroup species and in the mechanism of the switch in Adh promoter utilization. For these reasons, we have studied the structure and transcription of the Adh locus of D. mulleri, a species of the mulleri subgroup. We show that the ADH-1 and ADH-2 proteins are expressed from two distinct genes separated by 2 kilobase pairs, and that Adh-1 and Adh-2 are transcribed in the expected temporal pattern. In addition, we find a pseudogene 1.2 kb upstream from Adh-2, which is transcribed in a temporal pattern similar to Adh-2.

  2. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    SciTech Connect

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-08-23

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  3. Modulation of Aanat gene transcription in the rat pineal gland.

    PubMed

    Ho, Anthony K; Chik, Constance L

    2010-01-01

    The main function of the rat pineal gland is to transform the circadian rhythm generated in the suprachiasmatic nucleus into a rhythmic signal of circulating melatonin characterized by a large nocturnal increase that closely reflects the duration of night period. This is achieved through the tight coupling between environmental lighting and the expression of arylalkylamine-N-acetyltransferase, the rhythm-controlling enzyme in melatonin synthesis. The initiation of Aanat transcription at night is controlled largely by the norepinephrine-stimulated phosphorylation of cAMP response element-binding protein by protein kinase A. However, to accurately reflect the duration of darkness, additional signaling mechanisms also participate to fine-tune the temporal profile of adrenergic-induced Aanat transcription. Here, we reviewed some of these signaling mechanisms, with emphasis on the more recent findings. These signaling mechanisms can be divided into two groups: those involving modification of constitutively expressed proteins and those requiring synthesis of new proteins. This review highlights the pineal gland as an excellent model system for studying neurotransmitter-regulated rhythmic gene expression.

  4. Nuclear actin-binding proteins as modulators of gene transcription.

    PubMed

    Gettemans, Jan; Van Impe, Katrien; Delanote, Veerle; Hubert, Thomas; Vandekerckhove, Joël; De Corte, Veerle

    2005-10-01

    Dynamic transformations in the organization of the cellular microfilament system are the driving force behind fundamental biological processes such as cellular motility, cytokinesis, wound healing and secretion. Eukaryotic cells express a plethora of actin-binding proteins (ABPs) allowing cells to control the organization of the actin cytoskeleton in a flexible manner. These structural proteins were, not surprisingly, originally described as (major) constituents of the cytoplasm. However, in recent years, there has been a steady flow of reports detailing not only translocation of ABPs into and out of the nucleus but also describing their role in the nuclear compartment. This review focuses on recent developments pertaining to nucleocytoplasmic transport of ABPs, including their mode of translocation and nuclear function. In particular, evidence that structurally and functionally unrelated cytoplasmic ABPs regulate transcription activation by various nuclear (steroid hormone) receptors is steadily accruing. Furthermore, the recent finding that actin is a necessary component of the RNA polymerase II-containing preinitiation complex opens up new opportunities for nuclear ABPs in gene transcription regulation.

  5. Post-transcriptional gene regulation by mRNA modifications

    PubMed Central

    Zhao, Boxuan Simen; Roundtree, Ian A.; He, Chuan

    2016-01-01

    The recent discovery of reversible mRNA methylation has opened a new realm of post-transcriptional gene regulation in eukaryotes. The identification and functional characterization of proteins that specifically recognize RNA N6-methyladenosine (m6A) unveiled it as a modification that cells utilize to accelerate mRNA metabolism and translation. N6-adenosine methylation directs mRNAs to distinct fates by grouping them for differential processing, translation and decay in processes such as cell differentiation, embryonic development and stress responses. Other mRNA modifications, including N1-methyladenosine (m1A), 5-methylcytosine (m5C) and pseudouridine, together with m6A form the epitranscriptome and collectively code a new layer of information that controls protein synthesis. PMID:27808276

  6. Transcription factors and target genes of pre-TCR signaling.

    PubMed

    López-Rodríguez, Cristina; Aramburu, Jose; Berga-Bolaños, Rosa

    2015-06-01

    Almost 30 years ago pioneering work by the laboratories of Harald von Boehmer and Susumo Tonegawa provided the first indications that developing thymocytes could assemble a functional TCRβ chain-containing receptor complex, the pre-TCR, before TCRα expression. The discovery and study of the pre-TCR complex revealed paradigms of signaling pathways in control of cell survival and proliferation, and culminated in the recognition of the multifunctional nature of this receptor. As a receptor integrated in a dynamic developmental process, the pre-TCR must be viewed not only in the light of the biological outcomes it promotes, but also in context with those molecular processes that drive its expression in thymocytes. This review article focuses on transcription factors and target genes activated by the pre-TCR to drive its different outcomes.

  7. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    PubMed Central

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  8. 5' sequences are important positive and negative determinants of the longevity of Chlamydomonas chloroplast gene transcripts.

    PubMed Central

    Salvador, M L; Klein, U; Bogorad, L

    1993-01-01

    We have found that sequences in the 5' leader of the Chlamydomonas chloroplast rbcL gene, when fused 5' to foreign genes, destabilize transcripts of these chimeric genes in the chloroplast of transgenic Chlamydomonas but that 5' sequences of the rbcL structural gene prevent this destabilization. Transcripts of the chloroplast rbcL gene are about equally abundant at all times in Chlamydomonas reinhardtii growing on an alternating 12-h light/12-h dark cycle. However, Chlamydomonas chloroplast transformants, harboring chimeric genes containing the same rbcL promoter with 63 or 92 bp of the rbcL 5' leader sequence fused upstream of the Escherichia coli uidA (beta-glucuronidase, GUS) gene, accumulated GUS transcripts only in the dark. Transcripts disappeared rapidly upon illumination of the cells. The same phenomenon was exhibited by transcripts of chimeric genes in which the GUS gene coding sequence was replaced by other unrelated genes. The precipitous light-induced drop in GUS transcript abundance was found to be due to an approximately 16-fold increase in the rate of degradation of GUS transcripts in light rather than to a decrease in the rate of transcription of the GUS gene. Transcripts of a chimeric rbcL-GUS construct in which the leader sequence of the rbcL gene was replaced by 103 bp of the leader sequence of the atpB gene were stable in illuminated cells. The destabilizing effect of the rbcL 5' leader sequence was reversed by adding 257 bp of the 5' coding region of the rbcL gene. The results show that chloroplast transcript levels in illuminated Chlamydomonas cells--and perhaps in other cases--can be determined, at least to some extent, by sequences and interactions of sequences transcribed from the 5' ends of genes. Images PMID:8434017

  9. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.

    PubMed

    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent

    2016-01-15

    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context.

  10. Building gene expression signatures indicative of transcription factor activation to predict AOP modulation

    EPA Science Inventory

    Building gene expression signatures indicative of transcription factor activation to predict AOP modulation Adverse outcome pathways (AOPs) are a framework for predicting quantitative relationships between molecular initiatin...

  11. Factors affecting SFHR gene correction efficiency with single-stranded DNA fragment

    SciTech Connect

    Tsuchiya, Hiroyuki; Harashima, Hideyoshi; Kamiya, Hiroyuki . E-mail: hirokam@pharm.hokudai.ac.jp

    2005-11-04

    A 606-nt single-stranded (ss) DNA fragment, prepared by restriction enzyme digestion of ss phagemid DNA, improves the gene correction efficiency by 12-fold as compared with a PCR fragment, which is the conventional type of fragment used in the small fragment homologous replacement method [H. Tsuchiya, H. Harashima, H. Kamiya, Increased SFHR gene correction efficiency with sense single-stranded DNA, J. Gene Med. 7 (2005) 486-493]. To reveal the characteristic features of this gene correction with the ss DNA fragment, the effects on the gene correction in CHO-K1 cells of the chain length, 5'-phosphate, adenine methylation, and transcription were studied. Moreover, the possibility that the ss DNA fragment is integrated into the target DNA was examined with a radioactively labeled ss DNA fragment. The presence of methylated adenine, but not the 5'-phosphate, enhanced the gene correction efficiency, and the optimal length of the ss DNA fragment ({approx}600 nt) was determined. Transcription of the target gene did not affect the gene correction efficiency. In addition, the target DNA recovered from the transfected CHO-K1 cells was radioactive. The results obtained in this study indicate that length and adenine methylation were important factors affecting the gene correction efficiency, and that the ss DNA fragment was integrated into the double-stranded target DNA.

  12. The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

    PubMed Central

    Moncini, Silvia; Bevilacqua, Annamaria; Venturin, Marco; Fallini, Claudia; Ratti, Antonia; Nicolin, Angelo; Riva, Paola

    2007-01-01

    Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR) suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs). The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders. PMID:18053171

  13. Gene transcription and electromagnetic fields. Final progress report

    SciTech Connect

    Henderson, A.S.

    1992-12-31

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  14. Major genes affecting ovulation rate in sheep

    PubMed Central

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection. PMID:15601592

  15. Major genes affecting ovulation rate in sheep.

    PubMed

    Davis, George Henry

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection.

  16. Effects of 24-epibrassinolide and green light on plastid gene transcription and cytokinin content of barley leaves.

    PubMed

    Efimova, Marina V; Vankova, Radomira; Kusnetsov, Victor V; Litvinovskaya, Raisa P; Zlobin, Ilya E; Dobrev, Petre; Vedenicheva, Nina P; Savchuk, Alina L; Karnachuk, Raisa A; Kudryakova, Natalia V; Kuznetsov, Vladimir V

    2017-04-01

    In order to evaluate whether brassinosteroids (BS) and green light regulate the transcription of plastid genes in a cross-talk with cytokinins (CKs), transcription rates of 12 plastid genes (ndhF, rrn23, rpoB, psaA, psaB, rrn16, psbA, psbD, psbK, rbcL, atpB, and trnE/trnY) as well as the accumulation of transcripts of some photoreceptors (PHYA, CRY2, CRY1A, and CRY1B) and signaling (SERK and CAS) genes were followed in detached etiolated barley leaves exposed to darkness, green or white light ±1μm 24-epibrassinolide (EBL). EBL in the dark was shown to up-regulate the transcription of 12 plastid genes, while green light activated 10 genes and the EBL combined with the green light affected the transcription of only two genes (psaB and rpoB). Green light inhibited the expression of photoreceptor genes, except for CRY1A. Under the green light, EBL practically did not affect the expression of CRY1A, CAS and SERK genes, but it reduced the influence of white light on the accumulation of CAS, CRY1A, CRY1B, and SERK gene transcripts. The total content of BS in the dark and under white light remained largely unchanged, while under green light the total content of BRs (brassinolide, castasterone, and 6-deoxocastasterone) and HBRs (28-homobrassinolide, 28-homocastasterone, and 6-deoxo-28-homocastasterone) increased. The EBL-dependent up-regulation of plastome transcription in the dark was accompanied by a significant decrease in CK deactivation by O-glucosylation. However, no significant effect on the content of active CKs was detected. EBL combined with green light moderately increased the contents of trans-zeatin and isopentenyladenine, but had a negative effect on cis-zeatin. The most significant promotive effect of EBL on active CK bases was observed in white light. The data obtained suggest the involvement of CKs in the BS- and light-dependent transcription regulation of plastid genes.

  17. Transcriptional analysis and functional characterization of XCC1294 gene encoding a GGDEF domain protein in Xanthomonas campestris pv. campestris.

    PubMed

    Hsiao, Yi-Min; Song, Wan-Ling; Liao, Chao-Tsai; Lin, I-Hsuan; Pan, Mei-Ying; Lin, Ching-Fen

    2012-04-01

    The nucleotide cyclic di-GMP is a second messenger in bacteria that regulates a range of cellular functions including the virulence of pathogens. GGDEF is a protein domain involved in the synthesis of cyclic di-GMP. The genome of the crucifer pathogen Xanthomonas campestris pv. campestris (Xcc) encodes 21 proteins with a GGDEF domain. Clp, a homolog of the model transcription factor Crp of Escherichia coli, is a global regulator in Xcc. The aim of this study is to identify genes encoding GGDEF domain proteins whose expression is regulated by Clp. Results of reporter assay and RT-PCR analysis suggested that Clp regulates the expression of a set of genes encoding proteins harboring GGDEF domain. The transcription initiation site of XCC1294, one of the Clp regulated gene encoding a GGDEF domain protein, was mapped. Promoter analysis and gel retardation assay indicated that the transcription of XCC1294 is positively and directly regulated by Clp. Furthermore, transcription of XCC1294 was subject to catabolite repression and affected by several stress conditions. We also showed that mutation of XCC1294 results in enhanced surface attachment. In addition, transcription of three putative adhesin genes (xadA, fhaC, and yapH) was increased in the XCC1294 mutant. Taken together, the data presented here indicate that Clp positively regulates expression of XCC1294, and that XCC1294 serves a regulator of bacterial attachment and regulates different adhesin genes expression.

  18. Mammalian Glutaminase Gls2 Gene Encodes Two Functional Alternative Transcripts by a Surrogate Promoter Usage Mechanism

    PubMed Central

    Campos-Sandoval, José A.; Manzanares, Elisa; Lobo, Carolina; Segura, J. A.; Alonso, Francisco J.; Matés, José M.; Márquez, Javier

    2012-01-01

    Background Glutaminase is expressed in most mammalian tissues and cancer cells, but the regulation of its expression is poorly understood. An essential step to accomplish this goal is the characterization of its species- and cell-specific isoenzyme pattern of expression. Our aim was to identify and characterize transcript variants of the mammalian glutaminase Gls2 gene. Methodology/Principal Findings We demonstrate for the first time simultaneous expression of two transcript variants from the Gls2 gene in human, rat and mouse. A combination of RT-PCR, primer-extension analysis, bioinformatics, real-time PCR, in vitro transcription and translation and immunoblot analysis was applied to investigate GLS2 transcripts in mammalian tissues. Short (LGA) and long (GAB) transcript forms were isolated in brain and liver tissue of human, rat and mouse. The short LGA transcript arises by a combination of two mechanisms of transcriptional modulation: alternative transcription initiation and alternative promoter. The LGA variant contains both the transcription start site (TSS) and the alternative promoter in the first intron of the Gls2 gene. The full human LGA transcript has two in-frame ATGs in the first exon, which are missing in orthologous rat and mouse transcripts. In vitro transcription and translation of human LGA yielded two polypeptides of the predicted size, but only the canonical full-length protein displayed catalytic activity. Relative abundance of GAB and LGA transcripts showed marked variations depending on species and tissues analyzed. Conclusions/Significance This is the first report demonstrating expression of alternative transcripts of the mammalian Gls2 gene. Transcriptional mechanisms giving rise to GLS2 variants and isolation of novel GLS2 transcripts in human, rat and mouse are presented. Results were also confirmed at the protein level, where catalytic activity was demonstrated for the human LGA protein. Relative abundance of GAB and LGA transcripts was

  19. Two Different Transcripts of a LAMMER Kinase Gene Play Opposite Roles in Disease Resistance1[OPEN

    PubMed Central

    Xiao, Wenfei; Xia, Fan; Liu, Hongbo; Xiao, Jinghua

    2016-01-01

    Alternative splicing of genes can increase protein diversity and affect mRNA stability. Genome-wide transcriptome sequencing has demonstrated that alternative splicing occurs in a large number of intron-containing genes of different species. However, despite the phenomenon having been known for decades, it is largely unknown how the alternatively spliced transcripts function differently. Here, we report that two alternatively spliced transcripts of the rice (Oryza sativa) LAMMER kinase gene OsDR11, long OsDR11L and short OsDR11S, play opposite roles in rice resistance against Xanthomonas oryzae pv oryzae (Xoo), which causes the most damaging bacterial disease in rice worldwide. Overexpressing OsDR11S or suppressing OsDR11L in rice enhanced resistance to Xoo, which was accompanied by an accumulation of jasmonic acid (JA) and induced expression of JA signaling genes. In contrast, suppressing OsDR11S was associated with increased susceptibility to Xoo, along with decreased levels of JA and expression of JA signaling genes. The OsDR11S and OsDR11L proteins colocalized in the nucleus. OsDR11L showed autophosphorylation activity in vitro, while OsDR11S did not. In the presence of OsDR11S, autophosphorylation of OsDR11L was inhibited, and overexpression of OsDR11S suppressed OsDR11L expression. OsDR11 appeared to contribute to a minor quantitative trait locus against Xoo. These results suggest that OsDR11L is a negative regulator in rice disease resistance, which may be associated with suppression of JA signaling. The results also suggest that OsDR11S may inhibit the function of OsDR11L at both the transcription and protein kinase activity levels, leading to resistance against Xoo. PMID:27621422

  20. Comprehensive analysis of the transcription of starch synthesis genes and the transcription factor RSR1 in wheat (Triticum aestivum) endosperm.

    PubMed

    Kang, Guo-Zhang; Xu, Wei; Liu, Guo-Qin; Peng, Xiao-Qi; Guo, Tian-Cai

    2013-02-01

    The cDNA sequences of 26 starch synthesis genes were identified in common wheat (Triticum aestivum L.), and their transcript levels were measured using quantitative real-time RT-PCR to assess the function of individual genes and the regulatory mechanism in wheat endosperm. The expression patterns of 26 genes in wheat endosperm were classified into three groups. The genes in group 1 were richly expressed in the early stage of grain development and may be involved in the construction of fundamental cell machinery, synthesis of glucan primers, and initiation of starch granules. The genes in group 2 were highly expressed during the middle and late stages of grain development, and their expression profiles were similar to the accumulation rate of endosperm starch; these genes are presumed to play a crucial role in starch production. The genes in group 3 were scantily expressed throughout the grain development period and might be associated with transitory starch synthesis. Transcripts of the negative transcription factor TaRSR1 were high at the early and late stages of grain development but low during the middle stage. The expression pattern of TaRSR1 was almost opposite to those of the group 2 starch synthesis genes, indicating that TaRSR1 might negatively regulate the expression of many endosperm starch synthesis genes during grain development.

  1. Body-hypomethylated human genes harbor extensive intragenic transcriptional activity and are prone to cancer-associated dysregulation.

    PubMed

    Mendizabal, Isabel; Zeng, Jia; Keller, Thomas E; Yi, Soojin V

    2017-01-23

    Genomic DNA methylation maps (methylomes) encode genetic and environmental effects as stable chemical modifications of DNA. Variations in DNA methylation, especially in regulatory regions such as promoters and enhancers, are known to affect numerous downstream processes. In contrast, most transcription units (gene bodies) in the human genome are thought to be heavily methylated. However, epigenetic reprogramming in cancer often involves gene body hypomethylation with consequences on gene expression. In this study, we focus on the relatively unexplored phenomenon that some gene bodies are devoid of DNA methylation under normal conditions. Utilizing nucleotide-resolution methylomes of diverse samples, we show that nearly 2000 human genes are commonly hypomethylated. Remarkably, these genes occupy highly specialized genomic, epigenomic, evolutionary and functional niches in our genomes. For example, hypomethylated genes tend to be short yet encode significantly more transcripts than expected based upon their lengths, include many genes involved in nucleosome and chromatin formation, and are extensively and significantly enriched for histone-tail modifications and transcription factor binding with particular relevance for cis-regulation. Furthermore, they are significantly more prone to cancer-associated hypomethylation and mutation. Consequently, gene body hypomethylation represents an additional layer of epigenetic regulatory complexity, with implications on cancer-associated epigenetic reprogramming.

  2. Adenovirus E1A protein activates transcription of the E1A gene subsequent to transcription complex formation.

    PubMed Central

    Schaack, J; Logan, J; Vakalopoulou, E; Shenk, T

    1991-01-01

    The mechanism of transcriptional activation of the adenovirus E1A and E3 genes by E1A protein during infection was examined by using transcription-competition assays. Infection of HeLa cells with one virus led to inhibition of mRNA accumulation from a superinfecting virus. Synthesis of the E1A 289R protein by the first virus to infect reduced inhibition of transcription of the superinfecting virus, indicating that the E1A 289R protein was limiting for E1A-activated transcription. Infection with an E1A- virus, followed 6 h later by superinfection with a wild-type virus, led to preferential transcriptional activation of the E1A gene of the first virus, suggesting that a host transcription component(s) stably associated with the E1A promoter in the absence of E1A protein and that this complex was the substrate for transcriptional activation by E1A protein. The limiting host transcription component(s) bound to the E1A promoter to form a complex with a half-life greater than 24 h in the absence of E1A 289R protein, as demonstrated in a challenge assay with a large excess of superinfecting virus. In the presence of the E1A 289R protein, the E1A gene of the superinfecting virus was gradually activated with a reduction in E1A mRNA accumulation from the first virus. The kinetics of the activation suggest that this was due to an indirect effect rather than to destabilization of stable transcription complexes by the 289R protein. Images PMID:1825853

  3. Post-transcriptional regulation of gene PA5507 controls PQS concentration in Pseudomonas aeruginosa

    PubMed Central

    Tipton, Kyle A.; Coleman, James P.; Pesci, Everett C.

    2015-01-01

    Summary Pseudomonas aeruginosa can sense and respond to a myriad of environmental signals and utilizes a system of small molecules to communicate through intercellular signaling. The small molecule 2-heptyl-3-hydroxy-4-quinolone (Pseudomonas Quinolone Signal [PQS]) is one of these signals and its synthesis is important for virulence. Previously, we identified an RpiR-type transcriptional regulator, QapR, that positively affects PQS production by repressing the qapR operon. An in-frame deletion of this regulator caused P. aeruginosa to produce a greatly reduced concentration of PQS. Here, we report that QapR translation is linked to the downstream gene PA5507. We found that introduction of a premature stop codon within qapR eliminates transcriptional autorepression of the qapR operon as expected but has no effect on PQS concentration. This was investigated with a series of lacZ reporter fusions which showed that translation of QapR must terminate at, or close to, the native qapR stop codon in order for translation of PA5507 to occur. Also, it was shown that truncation of the 5′ end of the qapR transcript permitted PA5507 translation without translation of QapR. Our findings led us to conclude that PA5507 transcription and translation are both tightly controlled by QapR and this control is important for PQS homeostasis. PMID:25662317

  4. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  5. Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

    SciTech Connect

    Tucker, James D.; Joiner, Michael C.; Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V.; Chinkhota, Chantelle N.; Smolinski, Joseph M.; Divine, George W.; Auner, Gregory W.

    2014-03-15

    Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

  6. Introns and gene expression: Cellular constraints, transcriptional regulation, and evolutionary consequences

    PubMed Central

    Heyn, Patricia; Kalinka, Alex T; Tomancak, Pavel; Neugebauer, Karla M

    2015-01-01

    A gene's “expression profile” denotes the number of transcripts present relative to all other transcripts. The overall rate of transcript production is determined by transcription and RNA processing rates. While the speed of elongating RNA polymerase II has been characterized for many different genes and organisms, gene-architectural features – primarily the number and length of exons and introns – have recently emerged as important regulatory players. Several new studies indicate that rapidly cycling cells constrain gene-architecture toward short genes with a few introns, allowing efficient expression during short cell cycles. In contrast, longer genes with long introns exhibit delayed expression, which can serve as timing mechanisms for patterning processes. These findings indicate that cell cycle constraints drive the evolution of gene-architecture and shape the transcriptome of a given cell type. Furthermore, a tendency for short genes to be evolutionarily young hints at links between cellular constraints and the evolution of animal ontogeny. PMID:25400101

  7. Understanding the Role of Housekeeping and Stress-Related Genes in Transcription-Regulatory Networks

    NASA Astrophysics Data System (ADS)

    Heath, Allison; Kavraki, Lydia; Balázsi, Gábor

    2008-03-01

    Despite the increasing number of completely sequenced genomes, much remains to be learned about how living cells process environmental information and respond to changes in their surroundings. Accumulating evidence indicates that eukaryotic and prokaryotic genes can be classified in two distinct categories that we will call class I and class II. Class I genes are housekeeping genes, often characterized by stable, noise resistant expression levels. In contrast, class II genes are stress-related genes and often have noisy, unstable expression levels. In this work we analyze the large scale transcription-regulatory networks (TRN) of E. coli and S. cerevisiae and preliminary data on H. sapien. We find that stable, housekeeping genes (class I) are preferentially utilized as transcriptional inputs while stress related, unstable genes (class II) are utilized as transcriptional integrators. This might be the result of convergent evolution that placed the appropriate genes in the appropriate locations within transcriptional networks according to some fundamental principles that govern cellular information processing.

  8. Transcription of hexose transporters of Saccharomyces cerevisiae is affected by change in oxygen provision

    PubMed Central

    Rintala, Eija; Wiebe, Marilyn G; Tamminen, Anu; Ruohonen, Laura; Penttilä, Merja

    2008-01-01

    Background The gene family of hexose transporters in Saccharomyces cerevisiae consists of 20 members; 18 genes encoding transporters (HXT1-HXT17, GAL2) and two genes encoding sensors (SNF3, RGT2). The effect of oxygen provision on the expression of these genes was studied in glucose-limited chemostat cultivations (D = 0.10 h-1, pH 5, 30°C). Transcript levels were measured from cells grown in five steady state oxygen levels (0, 0.5, 1, 2.8 and 20.9% O2), and from cells under conditions in which oxygen was introduced to anaerobic cultures or removed from cultures receiving oxygen. Results The expression pattern of the HXT gene family was distinct in cells grown under aerobic, hypoxic and anaerobic conditions. The transcription of HXT2, HXT4 and HXT5 was low when the oxygen concentration in the cultures was low, both under steady state and non-steady state conditions, whereas the expression of HXT6, HXT13 and HXT15/16 was higher in hypoxic than in fully aerobic or anaerobic conditions. None of the HXT genes showed higher transcript levels in strictly anaerobic conditions. Expression of HXT9, HXT14 and GAL2 was not detected under the culture conditions studied. Conclusion When oxygen becomes limiting in a glucose-limited chemostat cultivation, the glucose uptake rate per cell increases. However, the expression of none of the hexose transporter encoding genes was increased in anaerobic conditions. It thus seems that the decrease in the moderately low affinity uptake and consequently the relative increase of high affinity uptake may itself allow the higher specific glucose consumption rate to occur in anaerobic compared to aerobic conditions. PMID:18373847

  9. Maternal transfer and transcriptional onset of immune genes during ontogenesis in Atlantic cod.

    PubMed

    Seppola, Marit; Johnsen, Hanne; Mennen, Saskia; Myrnes, Bjørnar; Tveiten, Helge

    2009-11-01

    The immune system in teleosts is not completely developed during embryonic and larval stages and immune competence is assumed to be restricted. This study is the first to address whether immune transcripts are maternally transferred to offspring and when immune genes are transcriptionally active in Atlantic cod (Gadus morhua). In unfertilised eggs, transcripts encoding lysozyme and cathelicidin were found indicating maternal transfer of antibacterial transcripts. Lysozyme activity was also present at this stage suggesting the presence of a functional protein. Transcripts of two other putative antibacterial genes (hepcidin and pentraxin) and antiviral genes (ISG15 and LGP2) were absent in unfertilised eggs. The transcriptional onset of these genes occurred during the gastrula period. Transcripts of the heavy chain constant regions of the immunoglobulin (Ig) D, membrane-associated and secreted form of IgM were absent in unfertilised eggs. Transcription of the heavy chain locus commenced at low levels during the segmentation period indicating the onset of B-cell development. Most innate immune genes showed an increase in transcription around hatch and first feeding, indicating a preparation for increased pathogen exposure at this time. Prior to and during metamorphosis all genes showed a pronounced elevation in transcript levels indicating a further maturation of the immune system during this period.

  10. Induction of AhR-Mediated Gene Transcription by Coffee

    PubMed Central

    Ishikawa, Toshio; Takahashi, Satoshi; Morita, Koji; Okinaga, Hiroko; Teramoto, Tamio

    2014-01-01

    Background Aryl hydrocarbon receptor (AhR) is classically known to be activated by xenobiotics such as dioxins and polycyclic aromatic hydrocarbons (PAHs). Although it has been reported that PAHs are contained in roasted coffee beans, in general coffee beverages are not considered to be AhR activators. We tested whether exposure to coffee would activate AhR in cultured cells. Methods HepG2 cells stably expressing an AhR-responsive reporter gene were treated with coffee samples. Also, expression of CYP1A1, an endogenous AhR-responsive gene, was quantitated by RT-PCR and Western blotting in HepG2, Caco-2, and MCF-7 cells, after treatment with coffee. In order to obtain sensitive and reproducible results, all the experiments were performed with the cells placed in either phosphate-buffered saline (PBS) or pure serum, instead of routinely-used culture medium, whose intrinsic AhR-stimulating activity turned out to be so strong as to interfere with the analyses. Results All the coffee samples tested robustly stimulated AhR-mediated transcription in the reporter gene assays. Of note, to what extent coffee and other AhR agonists activated AhR was different, depending on whether the experiments were done in PBS or serum. CYP1A1 mRNA was induced by coffee, in HepG2, Caco-2, and MCF-7 cells placed in either PBS or serum. CYP1A1 protein expression, which was not detected in these cells incubated in PBS, was also increased by coffee in cells placed in serum. Conclusions By using culture medium-free experimental settings, we have shown that coffee is a strong AhR activator. Our observation may help elucidate as-yet-unrecognized effects of coffee on human health. PMID:25007155

  11. Suppression of interferon β gene transcription by inhibitors of bromodomain and extra-terminal (BET) family members.

    PubMed

    Malik, Nazma; Vollmer, Stefan; Nanda, Sambit Kumar; Lopez-Pelaez, Marta; Prescott, Alan; Gray, Nathanael; Cohen, Philip

    2015-06-15

    PLK (Polo-like kinase) inhibitors, such as BI-2536, have been reported to suppress IFNB (encoding IFNβ, interferon β) gene transcription induced by ligands that activate TLR3 (Toll-like receptor 3) and TLR4. In the present study, we found that BI-2536 is likely to exert this effect by preventing the interaction of the transcription factors IRF3 (interferon-regulatory factor 3) and c-Jun with the IFNB promoter, but without affecting the TBK1 {TANK [TRAF (tumour-necrosis-factor-receptor-associated factor)-associated nuclear factor κB activator]-binding kinase 1}-catalysed phosphorylation of IRF3 at Ser³⁹⁶, the dimerization and nuclear translocation of IRF3 or the phosphorylation of c-Jun and ATF2 (activating transcription factor 2). Although BI-2536 inhibits few other kinases tested, it interacts with BET (bromodomain and extra-terminal) family members and displaces them from acetylated lysine residues on histones. We found that BET inhibitors that do not inhibit PLKs phenocopied the effect of BI-2536 on IFNB gene transcription. Similarly, BET inhibitors blocked the interaction of IRF5 with the IFNB promoter and the secretion of IFNβ induced by TLR7 or TLR9 ligands in the human plasmacytoid dendritic cell line GEN2.2, but without affecting the nuclear translocation of IRF5. We found that the BET family member BRD4 (bromodomain-containing protein 4) was associated with the IFNB promoter and that this interaction was enhanced by TLR3- or TLR4-ligation and prevented by BI-2536 and other BET inhibitors. Our results establish that BET family members are essential for TLR-stimulated IFNB gene transcription by permitting transcription factors to interact with the IFNB promoter. They also show that the interaction of the IFNB promoter with BRD4 is regulated by TLR ligation and that BI-2536 is likely to suppress IFNB gene transcription by targeting BET family members.

  12. The cancer gene WWOX behaves as an inhibitor of SMAD3 transcriptional activity via direct binding

    PubMed Central

    2013-01-01

    Background The WW domain containing protein WWOX has been postulated to behave as a tumor suppressor in breast and other cancers. Expression of this protein is lost in over 70% of ER negative tumors. This prompted us to investigate the phenotypic and gene expression effects of loss of WWOX expression in breast cells. Methods Gene expression microarrays and standard in vitro assays were performed on stably silenced WWOX (shRNA) normal breast cells. Bioinformatic analyses were used to identify gene networks and transcriptional regulators affected by WWOX silencing. Co-immunoprecipitations and GST-pulldowns were used to demonstrate a direct interaction between WWOX and SMAD3. Reporter assays, ChIP, confocal microscopy and in silico analyses were employed to determine the effect of WWOX silencing on TGFβ-signaling. Results WWOX silencing affected cell proliferation, motility, attachment and deregulated expression of genes involved in cell cycle, motility and DNA damage. Interestingly, we detected an enrichment of targets activated by the SMAD3 transcription factor, including significant upregulation of ANGPTL4, FST, PTHLH and SERPINE1 transcripts. Importantly, we demonstrate that the WWOX protein physically interacts with SMAD3 via WW domain 1. Furthermore, WWOX expression dramatically decreases SMAD3 occupancy at the ANGPTL4 and SERPINE1 promoters and significantly quenches activation of a TGFβ responsive reporter. Additionally, WWOX expression leads to redistribution of SMAD3 from the nuclear to the cytoplasmic compartment. Since the TGFβ target ANGPTL4 plays a key role in lung metastasis development, we performed a meta-analysis of ANGPTL4 expression relative to WWOX in microarray datasets from breast carcinomas. We observed a significant inverse correlation between WWOX and ANGPTL4. Furthermore, the WWOX lo /ANGPTL4 hi cluster of breast tumors is enriched in triple-negative and basal-like sub-types. Tumors with this gene expression signature could represent

  13. Transcriptional response to copper excess and identification of genes involved in heavy metal tolerance in the extremophilic microalga Chlamydomonas acidophila.

    PubMed

    Olsson, Sanna; Puente-Sánchez, Fernando; Gómez, Manuel J; Aguilera, Angeles

    2015-05-01

    High concentrations of heavy metals are typical of acidic environments. Therefore, studies on acidophilic organisms in their natural environments improve our understanding on the evolution of heavy metal tolerance and detoxification in plants. Here we sequenced the transcriptome of the extremophilic microalga Chlamydomonas acidophila cultivated in control conditions and with 500 μM of copper for 24 h. High-throughput 454 sequencing was followed by de novo transcriptome assembly. The reference transcriptome was annotated and genes related to heavy metal tolerance and abiotic stress were identified. Analyses of differentially expressed transcripts were used to detect genes involved in metabolic pathways related to abiotic stress tolerance, focusing on effects caused by increased levels of copper. Both transcriptomic data and observations from PAM fluorometry analysis suggested that the photosynthetic activity of C. acidophila is not adversely affected by addition of high amounts of copper. Up-regulated transcripts include several transcripts related to photosynthesis and carbohydrate metabolism, transcripts coding for general stress response, and a transcript annotated as homologous to the oil-body-associated protein HOGP coding gene. The first de novo assembly of C. acidophila significantly increases transcriptomic data available on extremophiles and green algae and thus provides an important reference for further molecular genetic studies. The differences between differentially expressed transcripts detected in our study suggest that the response to heavy metal exposure in C. acidophila is different from other studied green algae.

  14. Insight into transcription factor gene duplication from Caenorhabditis elegans Promoterome-driven expression patterns

    PubMed Central

    Reece-Hoyes, John S; Shingles, Jane; Dupuy, Denis; Grove, Christian A; Walhout, Albertha JM; Vidal, Marc; Hope, Ian A

    2007-01-01

    Background The C. elegans Promoterome is a powerful resource for revealing the regulatory mechanisms by which transcription is controlled pan-genomically. Transcription factors will form the core of any systems biology model of genome control and therefore the promoter activity of Promoterome inserts for C. elegans transcription factor genes was examined, in vivo, with a reporter gene approach. Results Transgenic C. elegans strains were generated for 366 transcription factor promoter/gfp reporter gene fusions. GFP distributions were determined, and then summarized with reference to developmental stage and cell type. Reliability of these data was demonstrated by comparison to previously described gene product distributions. A detailed consideration of the results for one C. elegans transcription factor gene family, the Six family, comprising ceh-32, ceh-33, ceh-34 and unc-39 illustrates the value of these analyses. The high proportion of Promoterome reporter fusions that drove GFP expression, compared to previous studies, led to the hypothesis that transcription factor genes might be involved in local gene duplication events less frequently than other genes. Comparison of transcription factor genes of C. elegans and Caenorhabditis briggsae was therefore carried out and revealed very few examples of functional gene duplication since the divergence of these species for most, but not all, transcription factor gene families. Conclusion Examining reporter expression patterns for hundreds of promoters informs, and thereby improves, interpretation of this data type. Genes encoding transcription factors involved in intrinsic developmental control processes appear acutely sensitive to changes in gene dosage through local gene duplication, on an evolutionary time scale. PMID:17244357

  15. Regulation of tissue-specific expression of alternative peripheral myelin protein-22 (PMP22) gene transcripts by two promoters

    SciTech Connect

    Patel, P.I.; Schoener-Scott, R.; Lupski, J.R.

    1994-09-01

    Mutations affecting the peripheral myelin protein-22 (PMP22) gene have been shown to be associated with inherited peripheral neuropathies. We have cloned and characterized the human PMP22 gene which spans approximately 40 kilobases and contains four coding exons. Towards developing gene therapy regimens for the associated peripheral neuropathies, we have initiated detailed analysis of the 5{prime} flanking region of the PMP22 gene and identified two alternatively transcribed, but untranslated exons. Mapping of separate PMP22 mRNA transcription initiation sites to each of these exons indicates that PMP22 expression is regulated by two alternatively used promoters. Both putative promoter sequences demonstrated the ability to drive expression of reporter genes in transfection experiments. Furthermore, the structure of the 5{prime} portion of the PMP22 gene appears to be identical in rat and human, supporting the biological significance of the observed arrangement of regulatory regions. The relative expression of the alternative PMP22 transcripts is tissue-specific and high levels of the exon 1A-containing transcript are tightly coupled to myelin formation. In contrast, exon 1B-containing transcripts are predominant in non-neural tissues and in growth-arrested primary fibroblasts. The observed regulation of the PMP22 by a complex molecular mechanism is consistent with the proposed dual role of PMP22 in neural and non-neural tissue.

  16. Isopentenyl transferase gene (ipt) downstream transcriptionally fused with gene expression improves the growth of transgenic plants.

    PubMed

    Guo, Jian-Chun; Duan, Rui-Jun; Hu, Xin-Wen; Li, Kai-Mian; Fu, Shao-Ping

    2010-04-01

    This research reports a promising approach to increase a plant's physiological cytokinin content. This approach also enables the increase to play a role in plant growth and development by introducing the ipt gene to downstream transcriptionally fuse with other genes under the control of a CaMV35S promoter, in which the ipt gene is far from the 35S promoter. According to Kozak's ribosome screening model, expression of the ipt gene is reduced by the terminal codon of the first gene and the internal untranslated nucleotides between the fused genes. In the transgenic plants pVKH35S-GUS-ipt, pVKH35S-AOC-ipt, and pVKH35S-AtGolS2-ipt, cytokinins were increased only two to threefold, and the plants grew more vigorously than the pVKH35S-AOC or pVKH35S-AtGolS2 transgenic plants lacking the ipt gene. The vigorous growth was reflected in rapid plant growth, a longer flowering period, a greater number of flowers, more seed product, and increased chlorophyll synthesis. The AOC and AtGolS2 genes play a role in a plant's tolerance of salt or cold, respectively. When the ipt gene transcriptionally fuses with AOC or AtGolS2 in the frame of AOC-ipt and AtGolS2-ipt, slight cytokinin increases were obtained in their transgenic plants; furthermore, those increases played a positive role in improvements of plant growth. Notably, an increased cytokinin volume at the physiological level, in concert with AtGolS2 expression, enhances a plant's tolerance to cold.

  17. Network and pathway analysis of microRNAs, transcription factors, target genes and host genes in human glioma

    PubMed Central

    ZHANG, YING; ZHAO, SHISHUN; XU, ZHIWEN

    2016-01-01

    To date, there has been rapid development with regard to gene and microRNA (miR/miRNA) research in gliomas. However, the regulatory mechanisms of the associated genes and miRNAs remain unclear. In the present study, the genes, miRNAs and transcription factors (TFs) were considered as elements in the regulatory network, and focus was placed on the associations between TFs and miRNAs, miRNAs and target genes, and miRNAs and host genes. In order to show the regulatory correlation clearly, all the elements were investigated and three regulatory networks, namely the differentially-expressed, related and global networks, were constructed. Certain important pathways were highlighted, with analysis of the similarities and differences among the networks. Next, the upstream and downstream elements of differentially-expressed genes, miRNAs and predicted TFs were listed. The most notable aspect of the present study was the three levels of network, particularly the differentially-expressed network, since the differentially-expressed associations that these networks provide appear at the initial stages of cancers such as glioma. If the states of the differentially-expressed associations can be adjusted to the normal state via alterations in regulatory associations, which were also recorded in the study networks and tables, it is likely that cancer can be regulated or even avoided. In the present study, the differentially-expressed network illuminated the pathogenesis of glioma; for example, a TF can regulate one or more miRNAs, and a target gene can be targeted by one or more miRNAs. Therefore, the host genes and target genes, the host genes and TFs, and the target genes and TFs indirectly affect each other through miRNAs. The association also exists between TFs and TFs, target genes and target genes, and host genes and host genes. The present study also demonstrated self-adaption associations and circle-regulations. The related network further described the regulatory mechanism

  18. Transcriptional organization and regulation of the Escherichia coli K30 group 1 capsule biosynthesis (cps) gene cluster.

    PubMed

    Rahn, Andrea; Whitfield, Chris

    2003-02-01

    Escherichia coli group 1 capsules are important virulence determinants, yet little is known about the transcriptional organization or regulation of their biosynthetic (cps) operons. Transcription of the prototype serotype K30 cluster is modulated by the JUMPStart-RfaH antitermination mechanism, with the cps promoter being localized to a region immediately upstream of the JUMPStart sequence. A putative stem-loop structure located within the K30 cps cluster separates conserved genes with products that are required for surface expression of capsule from serotype-specific genes encoding enzymes for polymer repeat-unit synthesis and polymerization. This putative stem-loop structure significantly reduces transcription in a termination-probe vector and may contribute to differential expression of the cps genes. Previous work indicated that increased amounts of group 1 capsular polysaccharide synthesis resulted from the overexpression of the Rcs (regulator of capsule synthesis) proteins. However, neither overexpression of the transcriptional activator RcsB nor an rcsB::aadA chromosomal insertion altered the level of transcription measured by cps::lacZ fusions. In the group 1 strains examined, an RcsAB box was found immediately upstream of galF, a gene involved in the production of sugar nucleotide precursors. Overexpression of RcsB was found to result in a threefold increase in transcription of a galF::lacZ chromosomal fusion. Moreover, overexpression of GalF gave rise to a two- to threefold increase in cell-free as well as cell-associated capsule, without affecting cps::lacZ activity. These results indicate that transcription of the E. coli group 1 capsule cluster itself is not regulated by the Rcs system and may, in fact, be constitutive. However, the Rcs system can potentially influence levels of capsular polysaccharide production by increasing galF transcription and influencing the available pool of biosynthetic precursors.

  19. Gene transcript profiling in sea otters post-Exxon Valdez oil spill: A tool for marine ecosystem health assessment

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Ballachey, Brenda E.; Waters, Shannon C.; Bodkin, James L.

    2016-01-01

    Using a panel of genes stimulated by oil exposure in a laboratory study, we evaluated gene transcription in blood leukocytes sampled from sea otters captured from 2006–2012 in western Prince William Sound (WPWS), Alaska, 17–23 years after the 1989 Exxon Valdez oil spill (EVOS). We compared WPWS sea otters to reference populations (not affected by the EVOS) from the Alaska Peninsula (2009), Katmai National Park and Preserve (2009), Clam Lagoon at Adak Island (2012), Kodiak Island (2005) and captive sea otters in aquaria. Statistically, sea otter gene transcript profiles separated into three distinct clusters: Cluster 1, Kodiak and WPWS 2006–2008 (higher relative transcription); Cluster 2, Clam Lagoon and WPWS 2010–2012 (lower relative transcription); and Cluster 3, Alaska Peninsula, Katmai and captive sea otters (intermediate relative transcription). The lower transcription of the aryl hydrocarbon receptor (AHR), an established biomarker for hydrocarbon exposure, in WPWS 2010–2012 compared to earlier samples from WPWS is consistent with declining hydrocarbon exposure, but the pattern of overall low levels of transcription seen in WPWS 2010–2012 could be related to other factors, such as food limitation, pathogens or injury, and may indicate an inability to mount effective responses to stressors. Decreased transcriptional response across the entire gene panel precludes the evaluation of whether or not individual sea otters show signs of exposure to lingering oil. However, related studies on sea otter demographics indicate that by 2012, the sea otter population in WPWS had recovered, which indicates diminishing oil exposure.

  20. A Photo-Degradable Gene Delivery System for Enhanced Nuclear Gene Transcription

    PubMed Central

    Hoyoung, Lee; Yeji, Kim; Patrick G., Schweickert; Stephen F., Konieczny; You-Yeon, Won

    2013-01-01

    There currently exists a significant gap in our understanding of how the detailed chemical characteristics of polycation gene carriers influence their delivery performances in overcoming an important cellular-level transport barrier, i.e., intranuclear gene transcription. In this study, a UV-degradable gene carrier material (ENE4-1) was synthesized by crosslinking low molecular weight branched polyethylenimine (bPEI-2k) molecules using UV-cleavable o-nitrobenzyl urethane (NBU) as the linker molecule. NBU degrades upon exposure to mild UV irradiation. Therefore, this UV-degradable carrier allows us to control the chemical characteristics of the polymer/DNA complex (polyplex) particles at desired locations within the intracellular environment. By using this photolytic DNA carrier, we found that the exact timing of the UV degradation significantly influences the gene transfection efficiencies of ENE4-1/DNA(pGL2) polyplexes in HeLa cells. Interestingly, even if the polyplexes were UV-degraded at different intracellular locations/times, their nuclear entry efficiency was not influenced by the location/timing of UV degradation. The UV treatment did not influence the size or binding strength of the polyplexes. However, we confirmed that the degradation of the carrier molecules impacts the chemical characteristics of the polyplexes (it produces carbamic acid and nitrosobenzyl aldehyde groups on ENE4-1). We believe that these anionic acid groups enhance the interaction of the polyplexes with nuclear transcription proteins and thus the final gene expression levels; this effect was found to occur, even though UV irradiation itself has a general effect of reducing transfection efficiencies. Excess (uncomplexed) ENE4-1 polymers appear to not play any role in the UV-enhanced gene transcription phenomenon. PMID:24172855

  1. Linker scanning mutagenesis of the 5'-flanking region of the mouse beta-major-globin gene: sequence requirements for transcription in erythroid and nonerythroid cells.

    PubMed

    Charnay, P; Mellon, P; Maniatis, T

    1985-06-01

    We analyzed the sequences required for transcription of the mouse beta-major-globin gene by introducing deletion and linker scanning mutations into the 5'-flanking region and then studying the effects of these mutations on beta-globin gene transcription in a HeLa cell transient expression assay or after stable introduction into mouse erythroleukemia cells. Consistent with earlier studies, we found that three distinct regions upstream from the RNA capping site are required for efficient beta-globin gene transcription in HeLa cells: the ATA box located 30 base pairs upstream from the mRNA capping site (-30), the CCAAT box located at -75, and the distal sequence element CCACACCC located at -90. In the ATA and CAAT box regions, the sequences necessary for efficient transcription extend beyond the limits of the canonical sequences. Mutations in the sequences located between the three transcriptional control elements do not significantly affect transcription in HeLa cells. Although the promoter defined in HeLa cell transfection experiments is also required for efficient transcription in mouse erythroleukemia cells, none of the mutations tested affects the regulation of beta-globin gene transcription during mouse erythroleukemia cell differentiation. Thus, DNA sequences downstream from the mRNA cap site appear to be sufficient for the regulation of beta-globin gene expression during the differentiation of mouse erythroleukemia cells in culture.

  2. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  3. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    PubMed

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  4. Effect of Soil Clay Content on RNA Isolation and on Detection and Quantification of Bacterial Gene Transcripts in Soil by Quantitative Reverse Transcription-PCR ▿†

    PubMed Central

    Novinscak, A.; Filion, M.

    2011-01-01

    In this study, we evaluated the effect of soil clay content on RNA isolation and on quantitative reverse transcription-PCR (qRT-PCR) quantification of microbial gene transcripts. The amount of clay significantly altered RNA isolation yields and qRT-PCR analyses. Recommendations are made for quantifying microbial gene transcripts in soil samples varying in clay content. PMID:21724880

  5. Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus.

    PubMed

    Gowda, S; Scholthof, H B; Wu, F C; Shepherd, R J

    1991-12-01

    The six major conserved genes of figwort mosaic virus (FMV), a caulimovirus, appear in tandem array on an RNA transcript that spans the entire viral genome. Gene VI, the only cistron that appears as a separate subgenomic RNA, has been reported to transactivate the expression of downstream genes of the full-length transcript. This transcript has a long 5'-leader of about 600 nucleotides followed by a small nonconserved region (gene VII), a smaller intergenic region (57 nucleotides), and the major conserved genes in a closely spaced array. In our present experiments we have constructed expression units containing the promoter for the full-length transcript followed by the 5' leader region, gene VII, and a reporter gene. These have been tested for expression with and without gene VI as a separate plasmid by electroporation into plant protoplasts. A series of these expression units containing truncated versions of the 5' leader region placed upstream of a reporter gene (CAT) showed that gene VI transactivation occurred only when gene VII sequences were present in cis between the leader region and the reporter gene. In addition, a more complete version of the FMV genome containing the reporter gene further downstream (in viral gene IV) showed CAT expression only when gene VII sequences were present in an upstream position. A similar construct failed to express CAT activity when gene VII was absent.

  6. Transcription factor regulation can be accurately predicted from the presence of target gene signatures in microarray gene expression data

    PubMed Central

    Essaghir, Ahmed; Toffalini, Federica; Knoops, Laurent; Kallin, Anders; van Helden, Jacques; Demoulin, Jean-Baptiste

    2010-01-01

    Deciphering transcription factor networks from microarray data remains difficult. This study presents a simple method to infer the regulation of transcription factors from microarray data based on well-characterized target genes. We generated a catalog containing transcription factors associated with 2720 target genes and 6401 experimentally validated regulations. When it was available, a distinction between transcriptional activation and inhibition was included for each regulation. Next, we built a tool (www.tfacts.org) that compares submitted gene lists with target genes in the catalog to detect regulated transcription factors. TFactS was validated with published lists of regulated genes in various models and compared to tools based on in silico promoter analysis. We next analyzed the NCI60 cancer microarray data set and showed the regulation of SOX10, MITF and JUN in melanomas. We then performed microarray experiments comparing gene expression response of human fibroblasts stimulated by different growth factors. TFactS predicted the specific activation of Signal transducer and activator of transcription factors by PDGF-BB, which was confirmed experimentally. Our results show that the expression levels of transcription factor target genes constitute a robust signature for transcription factor regulation, and can be efficiently used for microarray data mining. PMID:20215436

  7. Sequence requirements for transcriptional arrest in exon 1 of the human adenosine deaminase gene

    SciTech Connect

    Zhi Chen; Kellems, R.E.; Innis, J.W. ); Sun, Minghua; Wright, D.A. )

    1991-12-01

    The authors have previously demonstrated that a transcriptional arrest site exists in exon 1 of the human adenosine deaminase (ADA) gene and that this site may play a role in ADA gene expression. Sequences involved in this process are not known precisely. To further define the template requirements for transcriptional arrest within exon 1 of the human ADA gene, various ADA templates were constructed and their abilities to confer transcriptional arrest were determined following injection into Xenopus oocytes. The exon 1 transcriptional arrest signal functioned downstream of several RNA polymerase II promoters and an RNA polymerase II promoter, implying that the transcriptional arrest site in exon 1 of the ADA gene is promoter independent. They identified a 43-bp DNA fragment which functions as a transcriptional arrest signal. Additional studies showed that the transcriptional arrest site functioned only in the naturally occurring orientation. Therefore, they have identified a 43-bp DNA fragment which functions as a transcriptional arrest signal in an orientation-dependent and promoter-independent manner. On the basis of the authors findings, they hypothesize that tissue-specific expression of the ADA gene is governed by factors that function as antiterminators to promote transcriptional readthrough of the exon 1 transcriptional arrest site.

  8. Mining whole genomes and transcriptomes of Jatropha (Jatropha curcas) and Castor bean (Ricinus communis) for NBS-LRR genes and defense response associated transcription factors.

    PubMed

    Sood, Archit; Jaiswal, Varun; Chanumolu, Sree Krishna; Malhotra, Nikhil; Pal, Tarun; Chauhan, Rajinder Singh

    2014-11-01

    Jatropha (Jatropha curcas L.) and Castor bean (Ricinus communis) are oilseed crops of family Euphorbiaceae with the potential of producing high quality biodiesel and having industrial value. Both the bioenergy plants are becoming susceptible to various biotic stresses directly affecting the oil quality and content. No report exists as of today on analysis of Nucleotide Binding Site-Leucine Rich Repeat (NBS-LRR) gene repertoire and defense response transcription factors in both the plant species. In silico analysis of whole genomes and transcriptomes identified 47 new NBS-LRR genes in both the species and 122 and 318 defense response related transcription factors in Jatropha and Castor bean, respectively. The identified NBS-LRR genes and defense response transcription factors were mapped onto the respective genomes. Common and unique NBS-LRR genes and defense related transcription factors were identified in both the plant species. All NBS-LRR genes in both the species were characterized into Toll/interleukin-1 receptor NBS-LRRs (TNLs) and coiled-coil NBS-LRRs (CNLs), position on contigs, gene clusters and motifs and domains distribution. Transcript abundance or expression values were measured for all NBS-LRR genes and defense response transcription factors, suggesting their functional role. The current study provides a repertoire of NBS-LRR genes and transcription factors which can be used in not only dissecting the molecular basis of disease resistance phenotype but also in developing disease resistant genotypes in Jatropha and Castor bean through transgenic or molecular breeding approaches.

  9. Polycombs and microRNA-223 regulate human granulopoiesis by transcriptional control of target gene expression.

    PubMed

    Zardo, Giuseppe; Ciolfi, Alberto; Vian, Laura; Starnes, Linda M; Billi, Monia; Racanicchi, Serena; Maresca, Carmen; Fazi, Francesco; Travaglini, Lorena; Noguera, Nelida; Mancini, Marco; Nanni, Mauro; Cimino, Giuseppe; Lo-Coco, Francesco; Grignani, Francesco; Nervi, Clara

    2012-04-26

    Epigenetic modifications regulate developmental genes involved in stem cell identity and lineage choice. NFI-A is a posttranscriptional microRNA-223 (miR-223) target directing human hematopoietic progenitor lineage decision: NFI-A induction or silencing boosts erythropoiesis or granulopoiesis, respectively. Here we show that NFI-A promoter silencing, which allows granulopoiesis, is guaranteed by epigenetic events, including the resolution of opposing chromatin "bivalent domains," hypermethylation, recruitment of polycomb (PcG)-RNAi complexes, and miR-223 promoter targeting activity. During granulopoiesis, miR-223 localizes inside the nucleus and targets the NFI-A promoter region containing PcGs binding sites and miR-223 complementary DNA sequences, evolutionarily conserved in mammalians. Remarkably, both the integrity of the PcGs-RNAi complex and DNA sequences matching the seed region of miR-223 are required to induce NFI-A transcriptional silencing. Moreover, ectopic miR-223 expression in human myeloid progenitors causes heterochromatic repression of NFI-A gene and channels granulopoiesis, whereas its stable knockdown produces the opposite effects. Our findings indicate that, besides the regulation of translation of mRNA targets, endogenous miRs can affect gene expression at the transcriptional level, functioning in a critical interface between chromatin remodeling complexes and the genome to direct fate lineage determination of hematopoietic progenitors.

  10. Do products of the myc proto-oncogene play a role in transcriptional regulation of the prothymosin alpha gene?

    PubMed Central

    Mol, P C; Wang, R H; Batey, D W; Lee, L A; Dang, C V; Berger, S L

    1995-01-01

    The Myc protein has been reported to activate transcription of the rat prothymosin alpha gene by binding to an enhancer element or E box (CACGTG) located in the first intron (S. Gaubatz et al., Mol. Cell. Biol. 14:3853-3862, 1994). The human prothymosin alpha gene contains two such motifs: in the promoter region at kb -1.2 and in intron 1, approximately 2 kb downstream of the transcriptional start site in a region which otherwise bears little homology to the rat gene. Using chloramphenicol acetyltransferase (CAT) reporter constructs driven either by the 5-kb human prothymosin alpha promoter or by a series of truncated promoters, we showed that removal of the E-box sequence had no effect on transient expression of CAT activity in mouse L cells. When intron 1 of the prothymosin alpha gene was inserted into the most extensive promoter construct downstream of the CAT coding region, a diminution in transcription, which remained virtually unchanged upon disruption of the E boxes, was observed. CAT constructs driven by the native prothymosin alpha promoter or the native promoter and intron were indifferent to Myc; equivalent CAT activity was observed in the presence of ectopic normal or mutant Myc genes. Similarly, expression of a transiently transfected wild-type prothymosin alpha gene as the reporter was not affected by a repertoire of myc-derived genes, including myc itself and dominant or recessive negative myc mutants. In COS-1 cells, equivalent amounts of the protein were produced from transfected prothymosin alpha genes regardless of whether genomic E boxes were disrupted, intron 1 was removed, or a repertoire of myc-derived genes was included in the transfection cocktail. More importantly, cotransfection of a dominant negative Max gene failed to reduce transcription of the endogenous prothymosin alpha gene in COS cells or the wild-type transfected gene in COS or L cells. Taken together, the data do not support the idea that Myc activates transcription of the

  11. TGF-β stimulation in human and murine cells reveals commonly affected biological processes and pathways at transcription level

    PubMed Central

    2014-01-01

    Background The TGF-β signaling pathway is a fundamental pathway in the living cell, which plays a key role in many central cellular processes. The complex and sometimes contradicting mechanisms by which TGF-β yields phenotypic effects are not yet completely understood. In this study we investigated and compared the transcriptional response profile of TGF-β1 stimulation in different cell types. For this purpose, extensive experiments are performed and time-course microarray data are generated in human and mouse parenchymal liver cells, human mesenchymal stromal cells and mouse hematopoietic progenitor cells at different time points. We applied a panel of bioinformatics methods on our data to uncover common patterns in the dynamic gene expression response in respective cells. Results Our analysis revealed a quite variable and multifaceted transcriptional response profile of TGF-β1 stimulation, which goes far beyond the well-characterized classical TGF-β1 signaling pathway. Nonetheless, we could identify several commonly affected processes and signaling pathways across cell types and species. In addition our analysis suggested an important role of the transcription factor EGR1, which appeared to have a conserved influence across cell-types and species. Validation via an independent dataset on A549 lung adenocarcinoma cells largely confirmed our findings. Network analysis suggested explanations, how TGF-β1 stimulation could lead to the observed effects. Conclusions The analysis of dynamical transcriptional response to TGF-β treatment experiments in different human and murine cell systems revealed commonly affected biological processes and pathways, which could be linked to TGF-β1 via network analysis. This helps to gain insights about TGF-β pathway activities in these cell systems and its conserved interactions between the species and tissue types. PMID:24886091

  12. The effects of transcription on the nucleosome structure of four Dictyostelium genes.

    PubMed Central

    Pavlovic, J; Banz, E; Parish, R W

    1989-01-01

    Micrococcal nuclease digestion of Dictyostelium discoideum nuclei from various developmental stages was used to investigate transcription-related changes in the chromatin structure of the coding region of four genes. Gene activity was determined by Northern blotting and nuclear run on experiments. During strong transcription of the developmentally regulated cysteine proteinase I gene, a smear superimposed on a nucleosomal ladder was observed, indicating perturbation of nucleosomal structure was occurring. However, two other developmentally regulated genes, discoidin I and pSC253, showed only slight nucleosome disruption during high levels of transcription. The chromatin structure of a fourth gene (pCZ22) was disrupted throughout development, even at those stages where transcription was greatly reduced. We suggest that although nucleosome structure can be transiently perturbed by the passage of the transcription complex in vivo, the degree of perturbation and the speed with which nucleosomes reassemble is also influenced by the DNA sequence. Images PMID:2704621

  13. Transcriptional regulation is affected by subnuclear targeting of reporter plasmids to PML nuclear bodies.

    PubMed

    Block, Gregory J; Eskiw, Christopher H; Dellaire, Graham; Bazett-Jones, David P

    2006-12-01

    Whereas the PML protein has been reported to have both transcriptional coactivator and corepressor potential, the contribution of the PML nuclear body (PML NB) itself to transcriptional regulation is not well understood. Here we demonstrate that plasmid DNA artificially tethered to PML or the PML NB-targeting domain of Sp100 is preferentially localized to PML NBs. Using the tethering technique, we targeted a simian virus 40 promoter-driven luciferase reporter plasmid to PML NBs, resulting in the repression of the transgene transcriptional activity. Conversely, the tethering of a cytomegalovirus promoter-containing reporter plasmid resulted in activation. Targeting a minimal eukaryotic promoter did not affect its activity. The expression of targeted promoters could be modulated by altering the cellular concentration of PML NB components, including Sp100 and isoforms of the PML protein. Finally, we demonstrate that ICP0, the promiscuous herpes simplex virus transactivator, increases the level of transcriptional activation of plasmid DNA tethered to the PML NB. We conclude that when PML NB components are artificially tethered to reporter plasmids, the PML NB contributes to the regulation of the tethered DNA in a promoter-dependent manner. Our findings demonstrate that transient transcription assays are sensitive to the subnuclear localization of the transgene plasmid.

  14. Assessment of reference genes for reliable analysis of gene transcription by RT-qPCR in ovine leukocytes.

    PubMed

    Mahakapuge, T A N; Scheerlinck, J-P Y; Rojas, C A Alvarez; Every, A L; Hagen, J

    2016-03-01

    With the availability of genetic sequencing data, quantitative reverse transcription PCR (RT-qPCR) is increasingly being used for the quantification of gene transcription across species. Too often there is little regard to the selection of reference genes and the impact that a poor choice has on data interpretation. Indeed, RT-qPCR provides a snapshot of relative gene transcription at a given time-point, and hence is highly dependent on the stability of the transcription of the reference gene(s). Using ovine efferent lymph cells and peripheral blood mono-nuclear cells (PBMCs), the two most frequently used leukocytes in immunological studies, we have compared the stability of transcription of the most commonly used ovine reference genes: YWHAZ, RPL-13A, PGK1, B2M, GAPDH, HPRT, SDHA and ACTB. Using established algorithms for reference gene normalization "geNorm" and "Norm Finder", PGK1, GAPDH and YWHAZ were deemed the most stably transcribed genes for efferent leukocytes and PGK1, YWHAZ and SDHA were optimal in PBMCs. These genes should therefore be considered for accurate and reproducible RT-qPCR data analysis of gene transcription in sheep.

  15. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity

    PubMed Central

    Ahmed, Afsar U.; Williams, Bryan R. G.; Hannigan, Gregory E.

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  16. Evaluation of position effect variegation of the transcription of genes from the FSHD candidate region

    SciTech Connect

    Winokur, S.T.; Wasmuth, J.J.; Altherr, M.R.

    1994-09-01

    The gene for facioscapulohumeral muscular dystrophy (FSHD) lies in close proximity to the telomere of 4q. Deletion of several copies of a 3.2 kb tandem repeat have been associated with FSHD, although no genes have been identified within this repeat. We have shown that this repeat, as well as other repeats in the FSHD region, resemble constitutive heterochromatin both by sequence analysis and FISH cross-hybridization. We hypothesize that alterations in chromatin structure near the telomere of 4q due to deletion of these heterochromatic elements may lead to a position effect variegation of nearby genes. To test this hypothesis, we have isolated exons and candidate cDNAs from the FSHD region. A 2 kb polyadenylated cDNA was isolated from both fetal and infant brain cDNA libraries. Another cDNA hybridizes to a 7 kb skeletal muscle transcript on a Northern blot. Both of these cDNAs are chromosome 4-specific and map to the FSHD region. We have examined the expression pattern of these genes by RT-PCR, RNase protection and Northern analysis. Total RNA was isolated from normal and FSHD-affected lymphoblasts and from human-hamster somatic cell hybrids in which the normal and affected chromosomes 4 from FSHD patients were segregated. RT-PCR and RNase protection were then employed as quantitive assays to evaluate the potential for position effect variegation on RNA production in FSHD patients.

  17. Transcriptional regulation of the Drosophila glial gene repo.

    PubMed

    Lee, Bruce P; Jones, Bradley W

    2005-06-01

    reversed polarity (repo) is a putative target gene of glial cells missing (gcm), the primary regulator of glial cell fate in Drosophila. Transient expression of Gcm is followed by maintained expression of repo. Multiple Gcm binding sites are found in repo upstream DNA. However, while repo is expressed in Gcm positive glia, it is not expressed in Gcm positive hemocytes. These observations suggest factors in addition to Gcm are required for repo expression. Here we have undertaken an analysis of the cis-regulatory DNA elements of repo using lacZ reporter activity in transgenic embryos. We have found that a 4.2 kb DNA region upstream of the repo start site drives the wild-type repo expression pattern. We show that expression is dependent on multiple Gcm binding sites. By ectopically expressing Repo, we show that Repo can regulate its own enhancer. Finally, by systematically analyzing fragments of repo upstream DNA, we show that expression is dependent on multiple elements that are responsible for activity in subsets of glia, as well as repressing inappropriate expression in the epidermis. Our results suggest that Gcm acts synergistically with other factors to control repo transcription in glial cells.

  18. [Association of schizophrenia with variations in genes encoding transcription factors].

    PubMed

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  19. Transcriptional and post-transcriptional control of PHO8 expression by PHO regulatory genes in Saccharomyces cerevisiae.

    PubMed Central

    Kaneko, Y; Tamai, Y; Toh-e, A; Oshima, Y

    1985-01-01

    A DNA fragment bearing the PHO8 gene, which encodes repressible alkaline phosphatase of Saccharomyces cerevisiae, was cloned. Northern hybridizations with the PHO8 DNA as probe indicated that the PHO8 transcript is 1.8 kilobases in length and is more abundant in cells grown in low-phosphate medium than in high-phosphate medium. The pho9 mutant, whose phenotype is defective in the activity of repressible alkaline phosphatase, produced as much of the PHO8 transcript as did the PHO9+ cells. Hence, the PHO9 product should act at the post-transcriptional level. The pho4 mutant could not derepress the PHO8 transcript, whereas the pho80 mutant could, irrespective of the amount of Pi in the medium, as has been suggested by genetic study. Images PMID:2984552

  20. Suppression of the transcription factor MSX1 gene delays bovine preimplantation embryo development in vitro.

    PubMed

    Tesfaye, D; Regassa, A; Rings, F; Ghanem, N; Phatsara, C; Tholen, E; Herwig, R; Un, C; Schellander, K; Hoelker, M

    2010-05-01

    This study was conducted to investigate the effect of suppressing transcription factor gene MSX1 on the development of in vitro produced bovine oocytes and embryos, and identify its potential target genes regulated by this gene. Injection of long double-stranded RNA (LdsRNA) and small interfering RNA (siRNA) at germinal vesicle stage oocyte reduced MSX1 mRNA expression by 73 and 37% respectively at metaphase II stage compared with non-injected controls. Similarly, injection of the same anti-sense oligomers at zygote stage reduced MSX1 mRNA expression by 52 and 33% at 8-cell stage compared with non-injected controls. Protein expression was also reduced in LdsRNA- and siRNA-injected groups compared with non-injected controls at both stages. Blastocysts rates were 33, 28, 20 and 18% in non-injected control, scrambled RNA (scRNA), LdsRNA- and siRNA-injected groups respectively. Cleavage rates were also significantly reduced in Smartpool siRNA (SpsiRNA)-injected group (53.76%) compared with scRNA-injected group (57.76%) and non-injected control group (61%). Large-scale gene expression analysis showed that 135 genes were differentially regulated in SpsiRNA-injected group compared with non-injected controls, of which 54 and 81 were down- and up-regulated respectively due to suppression of MSX1. Additionally, sequence homology mapping and gene enrichment analysis with known human pathway information identified several functional modules that were affected due to suppression of MSX1. In conclusion, suppression of MSX1 affects oocyte maturation, embryo cleavage rate and the expression of several genes, suggesting its potential role in the development of bovine preimplantation embryos.

  1. Roles for the Saccharomyces cerevisiae SDS3, CBK1 and HYM1 genes in transcriptional repression by SIN3.

    PubMed Central

    Dorland, S; Deegenaars, M L; Stillman, D J

    2000-01-01

    The Saccharomyces cerevisiae Sin3 transcriptional repressor is part of a large multiprotein complex that includes the Rpd3 histone deacetylase. A LexA-Sin3 fusion protein represses transcription of promoters with LexA binding sites. To identify genes involved in repression by Sin3, we conducted a screen for mutations that reduce repression by LexA-Sin3. One of the mutations identified that reduces LexA-Sin3 repression is in the RPD3 gene, consistent with the known roles of Rpd3 in transcriptional repression. Mutations in CBK1 and HYM1 reduce repression by LexA-Sin3 and also cause defects in cell separation and altered colony morphology. cbk1 and hym1 mutations affect some but not all genes regulated by SIN3 and RPD3, but the effect on transcription is much weaker. Genetic analysis suggests that CBK1 and HYM1 function in the same pathway, but this genetic pathway is separable from that of SIN3 and RPD3. The remaining gene from this screen described in this report is SDS3, previously identified in a screen for mutations that increase silencing at HML, HMR, and telomere-linked genes, a phenotype also seen in sin3 and rpd3 mutants. Genetic analysis demonstrates that SDS3 functions in the same genetic pathway as SIN3 and RPD3, and coimmunoprecipitation experiments show that Sds3 is physically present in the Sin3 complex. PMID:10655212

  2. Differential expression of anthocyanin biosynthetic genes and transcription factor PcMYB10 in pears (Pyrus communis L.).

    PubMed

    Li, Li; Ban, Zhao-Jun; Li, Xi-Hong; Wu, Mao-Yu; Wang, Ai-Li; Jiang, Yu-Qian; Jiang, Yun-Hong

    2012-01-01

    Anthocyanin biosynthesis in various plants is affected by environmental conditions and controlled by the transcription level of the corresponding genes. In pears (Pyrus communis cv. 'Wujiuxiang'), anthocyanin biosynthesis is significantly induced during low temperature storage compared with that at room temperature. We further examined the transcriptional levels of anthocyanin biosynthetic genes in 'Wujiuxiang' pears during developmental ripening and temperature-induced storage. The expression of genes that encode flavanone 3-hydroxylase, dihydroflavonol 4-reductase, anthocyanidin synthase, UDP-glucose: flavonoid 3-O-glucosyltransferase, and R2R3 MYB transcription factor (PcMYB10) was strongly positively correlated with anthocyanin accumulation in 'Wujiuxiang' pears in response to both developmental and cold-temperature induction. Hierarchical clustering analysis revealed the expression patterns of the set of target genes, of which PcMYB10 and most anthocyanin biosynthetic genes were related to the same cluster. The present work may help explore the molecular mechanism that regulates anthocyanin biosynthesis and its response to abiotic stress at the transcriptional level in plants.

  3. Snf1-independent, glucose-resistant transcription of Adr1-dependent genes in a mediator mutant of Saccharomyces cerevisiae.

    PubMed

    Young, Elton T; Yen, Kuangyu; Dombek, Kenneth M; Law, G Lynn; Chang, Ella; Arms, Erin

    2009-10-01

    Glucose represses transcription of a network of co-regulated genes in Saccharomyces cerevisiae, ensuring that it is utilized before poorer carbon sources are metabolized. Adr1 is a glucose-regulated transcription factor whose promoter binding and activity require Snf1, the yeast homologue of the AMP-activated protein kinase in higher eukaryotes. In this study we found that a temperature-sensitive allele of MED14, a Mediator middle subunit that tethers the tail to the body, allowed a low level of Adr1-independent ADH2 expression that can be enhanced by Adr1 in a dose-dependent manner. A low level of TATA-independent ADH2 expression was observed in the med14-truncated strain and transcription of ADH2 and other Adr1-dependent genes occurred in the absence of Snf1 and chromatin remodeling coactivators. Loss of ADH2 promoter nucleosomes had occurred in the med14 strain in repressing conditions and did not require ADR1. A global analysis of transcription revealed that loss of Med14 function was associated with both up- and down- regulation of several groups of co-regulated genes, with ADR1-dependent genes being the most highly represented in the upregulated class. Expression of most genes was not significantly affected by the loss of Med14 function.

  4. Nested transcripts of gap junction gene have distinct expression patterns.

    PubMed

    Zhang, Z; Curtin, K D; Sun, Y A; Wyman, R J

    1999-09-05

    The shaking B locus (shakB, or Passover) codes for structural molecules of gap junctions in Drosophila. This report describes the complex set of transcripts from the shakB locus. A nested set of five transcripts is described. The transcripts share 3' exons, but each has its own 5' exon. The transcripts are arrayed as a series in the genomic DNA stretching over 60 kb. The 5' end of each successive transcript lies further proximal on the chromosome. Each new transcript shares all the 3' exons with the one preceding it, but adds one or two more 5' exons. The different transcripts are expressed in a wide variety of locations in the nervous system and in non-neural tissues. Some tissues express more than one transcript, and the expression pattern of each is developmentally regulated. Within the adult central nervous system (CNS), these transcripts have an expression pattern that is restricted to the giant fiber system (GFS). The GFS is a small set of neurons which mediates the visually induced escape jump. shakB is required for function of the GFS electrical synapses. The transcript previously defined as active in the giant fiber is not, in fact, expressed in that cell. Instead, we find that another transcript, shakB(N3), and perhaps shakB(N4) as well, is expressed in the GFS; this transcript is not expressed elsewhere in the adult CNS. Two other transcripts, shakB(N1) and shakB(N2), are expressed in the optic lamina but not elsewhere in the CNS. This expression pattern explains the neurophysiological and behavioral defects in escape exhibited in mutants of shakB.

  5. Genetic variants in SIRT3 transcriptional regulatory region affect promoter activity and fat deposition in three cattle breeds.

    PubMed

    Gui, Linsheng; Hong, Jieyun; Raza, Sayed Haidar Abbas; Zan, Linsen

    2016-12-12

    Sirtuin 3 (SIRT3) is a mitochondrial nicotinamide adenine dinucleotide (NAD)-dependent deacetylase. It has crucial roles in regulating the respiratory chain, in adenosine triphosphate (ATP) production, and in both the citric acid and urea cycles. The aim of this study was to investigate whether SIRT3 could be used as a candidate gene in the breeding of cattle. Expression analysis by quantitative real-time polymerase chain reactions (qPCR) indicated that expression levels of SIRT3 were highest in the kidney, rumen, liver, omasum and muscle. Using sequencing technology on a total of 913 cattle representing three indigenous Chinese beef cattle breeds, three single nucleotide polymorphisms (SNPs) were identified in the promoter region of SIRT3, and five haplotypes representing five potential transcription factor compositions of polymorphic potential cis-acting elements. Association analysis indicated that the Hap3/8 diplotype performed better than other combinations in intramuscular fat content. In addition, the promoter activity with Hap1 haplotype was higher than the Hap8 haplotype, consistent with the association analysis. The results indicate that the polymorphisms in transcription factor binding sites of SIRT3 promoter may affect the transcriptional activity of SIRT3, and thus alter intramuscular fat content in beef cattle.

  6. DNA methylation profiling of transcription factor genes in normal lymphocyte development and lymphomas.

    PubMed

    Ivascu, Claudia; Wasserkort, Reinhold; Lesche, Ralf; Dong, Jun; Stein, Harald; Thiel, Andreas; Eckhardt, Florian

    2007-01-01

    Transcription factors play a crucial role during hematopoiesis by orchestrating lineage commitment and determining cellular fate. Although tight regulation of transcription factor expression appears to be essential, little is known about the epigenetic mechanisms involved in transcription factor gene regulation. We have analyzed DNA methylation profiles of 13 key transcription factor genes in primary cells of the hematopoietic cascade, lymphoma cell lines and lymph node biopsies of diffuse large B-cell- and T-cell-non-Hodgkin lymphoma patients. Several of the transcription factor genes (SPI1, GATA3, TCF-7, Etv5, c-maf and TBX21) are differentially methylated in specific cell lineages and stages of the hematopoietic cascade. For some genes, such as SPI1, Etv5 and Eomes, we found an inverse correlation between the methylation of the 5' untranslated region and expression of the associated gene suggesting that these genes are regulated by DNA methylation. Differential methylation is not limited to cells of the healthy hematopoietic cascade, as we observed aberrant methylation of c-maf, TCF7, Eomes and SPI1 in diffuse large B-cell lymphomas. Our results suggest that epigenetic remodelling of transcription factor genes is a frequent mechanism during hematopoietic development. Aberrant methylation of transcription factor genes is frequently observed in diffuse large B-cell lymphomas and might have a functional role during tumorigenesis.

  7. SUMO functions in constitutive transcription and during activation of inducible genes in yeast.

    PubMed

    Rosonina, Emanuel; Duncan, Sarah M; Manley, James L

    2010-06-15

    Transcription factors represent one of the largest groups of proteins regulated by SUMO (small ubiquitin-like modifier) modification, and their sumoylation is usually associated with transcriptional repression. To investigate whether sumoylation plays a general role in regulating transcription in yeast, we determined the occupancy of sumoylated proteins at a variety of genes by chromatin immunoprecipitation (ChIP) using an antibody that recognizes the yeast SUMO peptide. Surprisingly, we detected sumoylated proteins at all constitutively transcribed genes tested but not at repressed genes. Ubc9, the SUMO conjugation enzyme, was not present on these genes, but its inactivation reduced SUMO at the constitutive promoters and modestly decreased RNA polymerase II levels. In contrast, activation of the inducible GAL1, STL1, and ARG1 genes caused not only a striking accumulation of SUMO at all three promoter regions, but also recruitment of Ubc9, indicating that gene activation involves sumoylation of promoter-bound factors. However, Ubc9 inactivation, while reducing sumoylation at the induced promoters, paradoxically resulted in increased transcription. Providing an explanation for this, the reduced sumoylation impaired the cell's ability to appropriately shut off transcription of the induced ARG1 gene, indicating that SUMO can facilitate transcriptional silencing. Our findings thus establish unexpected roles for sumoylation in both constitutive and activated transcription, and provide a novel mechanism for regulating gene expression.

  8. Early-late genes of the ecdysone cascade as models for transcriptional studies

    PubMed Central

    Mazina, Marina Yu; Nikolenko, Julia V; Fursova, Nadezda A; Nedil'ko, Petr N; Krasnov, Aleksey N; Vorobyeva, Nadezhda E

    2015-01-01

    The DHR3 and Hr4 early-late genes of the ecdysone cascade are described as models for transcriptional studies in Drosophila cells. In a set of experiments, it became clear that these genes are a convenient and versatile system for research into the physiological conditions upon 20-hydroxyecdysone induction. DHR3 and Hr4 gene transcription is characterized by fast activation kinetics, which enables transcriptional studies without the influence of indirect effects. A limited number of activated genes (only 73 genes are induced one hour after treatment) promote the selectivity of transcriptional studies via 20-hydroxyecdysone induction. DHR3 and Hr4 gene expression is dose dependent, is completely controlled by the hormone titer and decreases within hours of 20-hydroxyecdysone withdrawal. The DHR3 and Hr4 gene promoters become functional within 20 minutes after induction, which makes them useful tools for investigation if the early activation process. Their transcription is controlled by the RNA polymerase II pausing mechanism, which is widespread in the genome of Drosophila melanogaster but is still underinvestigated. Uniform expression activation of the DHR3 and Hr4 genes in a cell population was confirmed at both the RNA and protein levels. Homogeneity of the transcription response makes DHR3/Hr4 system valuable for investigation of the protein dynamics during transcription induction. PMID:26506480

  9. The ORD1 gene encodes a transcription factor involved in oxygen regulation and is identical to IXR1, a gene that confers cisplatin sensitivity to Saccharomyces cerevisiae.

    PubMed Central

    Lambert, J R; Bilanchone, V W; Cumsky, M G

    1994-01-01

    The yeast COX5a and COX5b genes encode isoforms of subunit Va of the mitochondrial inner membrane protein complex cytochrome c oxidase. These genes have been shown to be inversely regulated at the level of transcription by oxygen, which functions through the metabolic coeffector heme. In earlier studies we identified several regulatory elements that control transcriptional activation and aerobic repression of one of these genes, COX5b. Here, we report the isolation of trans-acting mutants that are defective in the aerobic repression of COX5b transcription. The mutants fall into two complementation groups. One group specifies ROX1, which encodes a product reported to be involved in transcriptional repression. The other group identified the gene we have designated ORD1. Mutations in ORD1 cause overexpression of COX5b aerobically but do not affect the expression of the hypoxic genes CYC7, HEM13, and ANB1. ORD1 mutations also do not affect the expression of the aerobic genes COX5a, CYC1, ROX1, ROX3, and TIF51A. The yeast genome contains a single ORD1 gene that resides on chromosome XI. Strains carrying chromosomal deletions of the ORD1 locus are viable and exhibit phenotypes similar to, but less severe than, that of the original mutant. The nucleotide sequence of ORD1 revealed that it is identical to IXR1, a yeast gene whose product contains two high mobility group boxes, binds to platinated DNA, and confers sensitivity to the antitumor drug cisplatin. Consistent with the latter observations, we found that the ORD1 product could bind to both the upstream region of COX5b and to DNA modified with cisplatin. Images PMID:8041793

  10. Changes in endogenous gene transcript and protein levels in maize plants expressing the soybean ferritin transgene

    PubMed Central

    Kanobe, Milly N.; Rodermel, Steven R.; Bailey, Theodore; Scott, M. Paul

    2013-01-01

    Transgenic agricultural crops with increased nutritive value present prospects for contributing to public health. However, their acceptance is poor in many countries due to the perception that genetic modification may cause unintended effects on expression of native genes in the host plant. Here, we tested effects of soybean ferritin transgene (SoyFer1, M64337) on transcript and protein levels of endogenous genes in maize. Results showed that the transgene was successfully introduced and expressed in the maize seed endosperm. mRNA abundance of seven tested iron homeostasis genes and seed storage protein genes differed significantly between seed samples positive and negative for the transgene. The PCR negative samples had higher zein and total protein content compared to the positive samples. However, PCR positive samples had significantly higher concentrations of calcium, magnesium, and iron. We have shown that the soybean ferritin transgene affected the expression of native iron homeostasis genes in the maize plant. These results underscore the importance of taking a holistic approach to the evaluation of transgenic events in target plants, comparing the transgenic plant to the untransformed controls. PMID:23785377

  11. Changes in endogenous gene transcript and protein levels in maize plants expressing the soybean ferritin transgene.

    PubMed

    Kanobe, Milly N; Rodermel, Steven R; Bailey, Theodore; Scott, M Paul

    2013-01-01

    Transgenic agricultural crops with increased nutritive value present prospects for contributing to public health. However, their acceptance is poor in many countries due to the perception that genetic modification may cause unintended effects on expression of native genes in the host plant. Here, we tested effects of soybean ferritin transgene (SoyFer1, M64337) on transcript and protein levels of endogenous genes in maize. Results showed that the transgene was successfully introduced and expressed in the maize seed endosperm. mRNA abundance of seven tested iron homeostasis genes and seed storage protein genes differed significantly between seed samples positive and negative for the transgene. The PCR negative samples had higher zein and total protein content compared to the positive samples. However, PCR positive samples had significantly higher concentrations of calcium, magnesium, and iron. We have shown that the soybean ferritin transgene affected the expression of native iron homeostasis genes in the maize plant. These results underscore the importance of taking a holistic approach to the evaluation of transgenic events in target plants, comparing the transgenic plant to the untransformed controls.

  12. Transcriptional Control of Steroid Biosynthesis Genes in the Drosophila Prothoracic Gland by Ventral Veins Lacking and Knirps

    PubMed Central

    Dorry, Elad; Komura-Kawa, Tatsuya; Fujimoto, Yoshinori; Troelsen, Jesper T.; Herder, Rachel; O'Connor, Michael B.; Niwa, Ryusuke; Rewitz, Kim F.

    2014-01-01

    Specialized endocrine cells produce and release steroid hormones that govern development, metabolism and reproduction. In order to synthesize steroids, all the genes in the biosynthetic pathway must be coordinately turned on in steroidogenic cells. In Drosophila, the steroid producing endocrine cells are located in the prothoracic gland (PG) that releases the steroid hormone ecdysone. The transcriptional regulatory network that specifies the unique PG specific expression pattern of the ecdysone biosynthetic genes remains unknown. Here, we show that two transcription factors, the POU-domain Ventral veins lacking (Vvl) and the nuclear receptor Knirps (Kni), have essential roles in the PG during larval development. Vvl is highly expressed in the PG during embryogenesis and is enriched in the gland during larval development, suggesting that Vvl might function as a master transcriptional regulator in this tissue. Vvl and Kni bind to PG specific cis-regulatory elements that are required for expression of the ecdysone biosynthetic genes. Knock down of either vvl or kni in the PG results in a larval developmental arrest due to failure in ecdysone production. Furthermore, Vvl and Kni are also required for maintenance of TOR/S6K and prothoracicotropic hormone (PTTH) signaling in the PG, two major pathways that control ecdysone biosynthesis and PG cell growth. We also show that the transcriptional regulator, Molting defective (Mld), controls early biosynthetic pathway steps. Our data show that Vvl and Kni directly regulate ecdysone biosynthesis by transcriptional control of biosynthetic gene expression and indirectly by affecting PTTH and TOR/S6K signaling. This provides new insight into the regulatory network of transcription factors involved in the coordinated regulation of steroidogenic cell specific transcription, and identifies a new function of Vvl and Knirps in endocrine cells during post-embryonic development. PMID:24945799

  13. Methods of Combinatorial Optimization to Reveal Factors Affecting Gene Length

    PubMed Central

    Bolshoy, Alexander; Tatarinova, Tatiana

    2012-01-01

    In this paper we present a novel method for genome ranking according to gene lengths. The main outcomes described in this paper are the following: the formulation of the genome ranking problem, presentation of relevant approaches to solve it, and the demonstration of preliminary results from prokaryotic genomes ordering. Using a subset of prokaryotic genomes, we attempted to uncover factors affecting gene length. We have demonstrated that hyperthermophilic species have shorter genes as compared with mesophilic organisms, which probably means that environmental factors affect gene length. Moreover, these preliminary results show that environmental factors group together in ranking evolutionary distant species. PMID:23300345

  14. Methods of combinatorial optimization to reveal factors affecting gene length.

    PubMed

    Bolshoy, Alexander; Tatarinova, Tatiana

    2012-01-01

    In this paper we present a novel method for genome ranking according to gene lengths. The main outcomes described in this paper are the following: the formulation of the genome ranking problem, presentation of relevant approaches to solve it, and the demonstration of preliminary results from prokaryotic genomes ordering. Using a subset of prokaryotic genomes, we attempted to uncover factors affecting gene length. We have demonstrated that hyperthermophilic species have shorter genes as compared with mesophilic organisms, which probably means that environmental factors affect gene length. Moreover, these preliminary results show that environmental factors group together in ranking evolutionary distant species.

  15. Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic stem cells

    PubMed Central

    Sigova, Alla A.; Mullen, Alan C.; Molinie, Benoit; Gupta, Sumeet; Orlando, David A.; Guenther, Matthew G.; Almada, Albert E.; Lin, Charles; Sharp, Phillip A.; Giallourakis, Cosmas C.; Young, Richard A.

    2013-01-01

    Many long noncoding RNA (lncRNA) species have been identified in mammalian cells, but the genomic origin and regulation of these molecules in individual cell types is poorly understood. We have generated catalogs of lncRNA species expressed in human and murine embryonic stem cells and mapped their genomic origin. A surprisingly large fraction of these transcripts (>60%) originate from divergent transcription at promoters of active protein-coding genes. The divergently transcribed lncRNA/mRNA gene pairs exhibit coordinated changes in transcription when embryonic stem cells are differentiated into endoderm. Our results reveal that transcription of most lncRNA genes is coordinated with transcription of protein-coding genes. PMID:23382218

  16. Carotenoid genes transcriptional regulation for astaxanthin accumulation in fresh water unicellular alga Haematococcus pluvialis by gibberellin A3 (GA3).

    PubMed

    Gao, Zhengquan; Meng, Chunxiao; Gao, Hongzheng; Li, Yan; Zhang, Xiaowen; Xu, Dong; Zhou, Shitan; Liu, Banghui; Su, Yuanfeng; Ye, Naihao

    2013-12-01

    The fresh water unicellular alga Haematococcus pluvialis is a promising natural source of astaxanthin. The present study investigated the transcriptional expression of carotenoid genes for astaxanthin accumulation in H. pluvialis using real-time fluorescence quantitative PCR (qRT-PCR). With treatments of 20 and 40 mg/L of gibberllin A3 (GA3), five genes ipi-1, ipi-2, psy, pds and bkt2 were up-regulated with different expression profiles. GA20 (20 mg/L of GA3) treatment had a greater effect on transcriptional expression of bkt2 than on ipi-1 ipi-2, psy and pds (> 4-fold up-regulation). However, GA40 (40 mg/L of GA3) induced more transcriptional expression of ipi-2, psy and bkt2 than both ipi-1 and pds. The expression of lyc, crtR-B and crtO for astaxanthin biosynthesis was not affected by GA3 in H. piuvialis. In the presence of GA3, astaxanthin biosynthesis genes of ipi-1, pds and bkt2 were up-regulated at transcriptional level, psy at post-transcriptional level, whereas ipi-2 was up-regulated at both levels. The study could potentially lead to a scale application of exogenous GA3 in astaxanthin production with H. pluvialis just like GAs perform in increasing crops production and it would provide new insight about the multifunctional roles of carotenogenesis in response to GA3.

  17. NFKBIZ in Psoriasis: Assessing the association with gene polymorphisms and report of a new transcript variant.

    PubMed

    Coto-Segura, Pablo; Gonzalez-Lara, Leire; Gómez, Juan; Eiris, Noemí; Batalla, Ana; Gómez, Celia; Requena, Sheila; Queiro, Rubén; Alonso, Belén; Iglesias, Sara; Coto, Eliecer

    2017-03-01

    The IκBζ protein (NFKBIZ gene) is a nuclear inhibitor of NF-κB and plays an important role in the pathogenesis of Psoriasis (Psor). We sought to determine whether common NFKBIZ variants were associated with the risk of developing Psor. A total of 392 patients and 336 controls were genotyped for a common intron 10 indel that could affect pre-mRNA splicing. We found a significantly higher frequency of the insertion among the cw6-positive patients (p=0.01). Cw6-positive+intron 10 ins/ins were significantly more frequent in the patients (OR=3.61). The analysis of the cDNA from leukocytes showed a NFKBIZ transcript lacking exon 10, present in all the tested samples. This new alternative transcript lacks a domain predicted to interact with the NFKB1/p50 protein. Functional studies to define the effect of this alternative transcript on the regulation of the NF-κB pathway are necessary.

  18. The grape berry-specific basic helix–loop–helix transcription factor VvCEB1 affects cell size

    PubMed Central

    Lecourieux, Fatma

    2013-01-01

    The development of fleshy fruits involves complex physiological and biochemical changes. After fertilization, fruit growth usually begins with cell division, continues with both cell division and expansion, allowing fruit set to occur, and ends with cell expansion only. In spite of the economical importance of grapevine, the molecular mechanisms controlling berry growth are not fully understood. The present work identified and characterized Vitis vinifera cell elongation bHLH protein (VvCEB1), a basic helix–loop–helix (bHLH) transcription factor controlling cell expansion in grape. VvCEB1 was expressed specifically in berry-expanding tissues with a maximum around veraison. The study of VvCEB1 promoter activity in tomato confirmed its specific fruit expression during the expansion phase. Overexpression of VvCEB1 in grape embryos showed that this protein stimulates cell expansion and affects the expression of genes involved in cell expansion, including genes of auxin metabolism and signalling. Taken together, these data show that VvCEB1 is a fruit-specific bHLH transcription factor involved in grape berry development. PMID:23314819

  19. The grape berry-specific basic helix-loop-helix transcription factor VvCEB1 affects cell size.

    PubMed

    Nicolas, Philippe; Lecourieux, David; Gomès, Eric; Delrot, Serge; Lecourieux, Fatma

    2013-02-01

    The development of fleshy fruits involves complex physiological and biochemical changes. After fertilization, fruit growth usually begins with cell division, continues with both cell division and expansion, allowing fruit set to occur, and ends with cell expansion only. In spite of the economical importance of grapevine, the molecular mechanisms controlling berry growth are not fully understood. The present work identified and characterized Vitis vinifera cell elongation bHLH protein (VvCEB1), a basic helix-loop-helix (bHLH) transcription factor controlling cell expansion in grape. VvCEB1 was expressed specifically in berry-expanding tissues with a maximum around veraison. The study of VvCEB1 promoter activity in tomato confirmed its specific fruit expression during the expansion phase. Overexpression of VvCEB1 in grape embryos showed that this protein stimulates cell expansion and affects the expression of genes involved in cell expansion, including genes of auxin metabolism and signalling. Taken together, these data show that VvCEB1 is a fruit-specific bHLH transcription factor involved in grape berry development.

  20. SVD identifies transcript length distribution functions from DNA microarray data and reveals evolutionary forces globally affecting GBM metabolism.

    PubMed

    Bertagnolli, Nicolas M; Drake, Justin A; Tennessen, Jason M; Alter, Orly

    2013-01-01

    To search for evolutionary forces that might act upon transcript length, we use the singular value decomposition (SVD) to identify the length distribution functions of sets and subsets of human and yeast transcripts from profiles of mRNA abundance levels across gel electrophoresis migration distances that were previously measured by DNA microarrays. We show that the SVD identifies the transcript length distribution functions as "asymmetric generalized coherent states" from the DNA microarray data and with no a-priori assumptions. Comparing subsets of human and yeast transcripts of the same gene ontology annotations, we find that in both disparate eukaryotes, transcripts involved in protein synthesis or mitochondrial metabolism are significantly shorter than typical, and in particular, significantly shorter than those involved in glucose metabolism. Comparing the subsets of human transcripts that are overexpressed in glioblastoma multiforme (GBM) or normal brain tissue samples from The Cancer Genome Atlas, we find that GBM maintains normal brain overexpression of significantly short transcripts, enriched in transcripts that are involved in protein synthesis or mitochondrial metabolism, but suppresses normal overexpression of significantly longer transcripts, enriched in transcripts that are involved in glucose metabolism and brain activity. These global relations among transcript length, cellular metabolism and tumor development suggest a previously unrecognized physical mode for tumor and normal cells to differentially regulate metabolism in a transcript length-dependent manner. The identified distribution functions support a previous hypothesis from mathematical modeling of evolutionary forces that act upon transcript length in the manner of the restoring force of the harmonic oscillator.

  1. A genome-wide view of transcription factor gene diversity in chordate evolution: less gene loss in amphioxus?

    PubMed

    Paps, Jordi; Holland, Peter W H; Shimeld, Sebastian M

    2012-03-01

    Previous studies of gene diversity in the homeobox superclass have shown that the Florida amphioxus Branchiostoma floridae has undergone remarkably little gene family loss. Here we use a combined BLAST and HMM search strategy to assess the family level diversity of four other transcription factor superclasses: the Paired/Pax genes, Tbx genes, Fox genes and Sox genes. We apply this across genomes from five chordate taxa, including B. floridae and Ciona intestinalis, plus two outgroup taxa. Our results show scattered gene family loss. However, as also found for homeobox genes, B. floridae has retained all ancient Pax, Tbx, Fox and Sox gene families that were present in the common ancestor of living chordates. We conclude that, at least in terms of transcription factor gene complexity, the genome of amphioxus has experienced remarkable stasis compared to the genomes of other chordates.

  2. The yeast BDF1 gene encodes a transcription factor involved in the expression of a broad class of genes including snRNAs.

    PubMed Central

    Lygerou, Z; Conesa, C; Lesage, P; Swanson, R N; Ruet, A; Carlson, M; Sentenac, A; Séraphin, B

    1994-01-01

    While screening for genes that affect the synthesis of yeast snRNPs, we identified a thermosensitive mutant that abolishes the production of a reporter snRNA at the non-permissive temperature. This mutant defines a new gene, named BDF1. In a bdf1-1 strain, the reporter snRNA synthesized before the temperature shift remains stable at the non-permissive temperature. This demonstrates that the BDF1 gene affects the synthesis rather than the stability of the reporter snRNA and suggests that the BDF1 gene encodes a transcription factor. BDF1 is present in single copy on yeast chromosome XII, and is important for normal vegetative growth but not essential for cell viability. bdf1 null mutants share common phenotypes with several mutants affecting general transcription and are defective in snRNA production. BDF1 encodes a protein of 687 amino-acids containing two copies of the bromodomain, a motif also present in other transcription factors as well as a new conserved domain, the ET domain, also present in Drosophila and human proteins. Images PMID:7816623

  3. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway.

  4. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.

    PubMed

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-04-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms.

  5. How the Neanderthal in Your Genes Affects Your Health

    MedlinePlus

    ... medlineplus.gov/news/fullstory_163749.html How the Neanderthal in Your Genes Affects Your Health The DNA ... 23, 2017 THURSDAY, Feb. 23, 2017 (HealthDay News) -- Neanderthals were wiped out about 40,000 years ago, ...

  6. Aging-induced alterations in gene transcripts and functional activity of mitochondrial oxidative phosphorylation complexes in the heart.

    PubMed

    Preston, Claudia C; Oberlin, Andrew S; Holmuhamedov, Ekhson L; Gupta, Anu; Sagar, Sandeep; Syed, Rashad H Khazi; Siddiqui, Sabeeh A; Raghavakaimal, Sreekumar; Terzic, Andre; Jahangir, Arshad

    2008-06-01

    Aging is associated with progressive decline in energetic reserves compromising cardiac performance and tolerance to injury. Although deviations in mitochondrial functions have been documented in senescent heart, the molecular bases for the decline in energy metabolism are only partially understood. Here, high-throughput transcription profiles of genes coding for mitochondrial proteins in ventricles from adult (6-months) and aged (24-months) rats were compared using microarrays. Out of 614 genes encoding for mitochondrial proteins, 94 were differentially expressed with 95% downregulated in the aged. The majority of changes affected genes coding for proteins involved in oxidative phosphorylation (39), substrate metabolism (14) and tricarboxylic acid cycle (6). Compared to adult, gene expression changes in aged hearts translated into a reduced mitochondrial functional capacity, with decreased NADH-dehydrogenase and F(0)F(1) ATPase complex activities and capacity for oxygen-utilization and ATP synthesis. Expression of genes coding for transcription co-activator factors involved in the regulation of mitochondrial metabolism and biogenesis were downregulated in aged ventricles without reduction in mitochondrial density. Thus, aging induces a selective decline in activities of oxidative phosphorylation complexes I and V within a broader transcriptional downregulation of mitochondrial genes, providing a substrate for reduced energetic efficiency associated with senescence.

  7. Aging-Induced Alterations in Gene Transcripts and Functional Activity of Mitochondrial Oxidative Phosphorylation Complexes in the Heart

    PubMed Central

    Preston, Claudia C.; Oberlin, Andrew S.; Holmuhamedov, Ekhson L.; Gupta, Anu; Sagar, Sandeep; Khazi Syed, Rashad H.; Siddiqui, Sabeeh; Raghavakaimal, Sreekumar; Terzic, Andre; Jahangir, Arshad

    2008-01-01

    Aging is associated with progressive decline in energetic reserves compromising cardiac performance and tolerance to injury. Although deviations in mitochondrial functions have been documented in senescent heart, the molecular bases for the decline in energy metabolism are only partially understood. Here, high-throughput transcription profiles of genes coding for mitochondrial proteins in ventricles from adult (6-months) and aged (24-months) rats were compared using microarrays. Out of 614 genes encoding for mitochondrial proteins, 94 were differentially expressed with 95% downregulated in the aged. The majority of changes affected genes coding for proteins involved in oxidative phosphorylation (39), substrate metabolism (14) and tricarboxylic acid cycle (6). Compared to adult, gene expression changes in aged hearts translated into a reduced mitochondrial functional capacity, with decreased NADH-dehydrogenase and F0F1-ATPase complex activities and capacity for oxygen-utilization and ATP synthesis. Expression of genes coding for transcription co-activator factors involved in the regulation of mitochondrial metabolism and biogenesis were downregulated in aged ventricles without reduction in mitochondrial density. Thus, aging induces a selective decline in activities of oxidative phosphorylation complexes I and V within a broader transcriptional downregulation of mitochondrial genes, providing a substrate for reduced energetic efficiency associated with senescence. PMID:18400259

  8. Transcriptional organization of the dnaN and recF genes of Escherichia coli K-12.

    PubMed

    Armengod, M E; García-Sogo, M; Lambíes, E

    1988-08-25

    The dnaN gene of Escherichia coli determines the beta subunit of DNA polymerase III, a multisubunit enzyme responsible for most of the replicative DNA synthesis. The dnaN gene maps between the dnaA and recF genes. We have characterized the regulatory region of the dnaN gene by screening DNA restriction fragments for promoter activity, S1 mapping of mRNAs, deletion analysis, and in vivo dnaN complementation tests. There are at least three dnaN promoters located in the second half of the dnaA coding region. The one closest to the dnaN structural gene is the weakest, but it provides sufficient dnaN expression for complementation when the gene is present on a multicopy plasmid. Deletion of sequences needed for initiation of dnaN translation or introduction of nonsense codons into dnaN causes reduction of recF expression. However, a deletion inactivating dnaN without changing the reading frame of the gene does not affect expression of the recF gene. These results indicate that the dnaN and recF genes are organized in an operon. We have previously shown the presence of termination signals within the dnaN coding region (Armengod, M.E., and Lambíes, E. (1986) Gene (Amst.) 43, 183-196). Therefore, we propose that the polarity produced by nonsense mutations in dnaN is primarily transcriptional. The uncoupling of transcription and translation of the dnaN gene (when translation is interrupted by premature nonsense codons or by other mechanisms) probably results in transcription termination at termination signals in dnaN.

  9. Structure of transcripts from the homeotic Antennapedia gene of Drosophila melanogaster: two promoters control the major protein-coding region.

    PubMed Central

    Laughon, A; Boulet, A M; Bermingham, J R; Laymon, R A; Scott, M P

    1986-01-01

    The Antennapedia (Antp) homeotic gene of Drosophila melanogaster regulates segmental identity in the thorax. Loss of Antp function results in altered development of the embryonic thoracic segments or can cause legs to be transformed into antennae. Certain combinations of Antp recessive lethal alleles complement to permit normal development. The structure of the Antp gene, analyzed by sequencing cDNA clones and exons and by transcript mapping, revealed some of the basis for its genetic complexity. It has two promoters governing two nested transcription units, one unit 36 and one 103 kilobase pairs (kb) long. Both units incorporated the same protein-coding exons, all of which are located in the 3'-most 13 kb of the gene. The two promoters resulted in the attachment of either of two long noncoding leader sequences (1.5 and 1.7 kb) to a 1.1-kb open reading frame. Both transcription units used the same pair of alternative polyadenylation sites 1.4 kb apart; the choice of sites was developmentally regulated. Some of the mutations that disrupt the larger transcription unit complemented a mutation affecting the smaller one. Dominant mutations that transform antennae into legs split the gene but left the coding exons intact. The encoded protein has unusually long runs of glutamine and a homeodomain near the C terminus. Images PMID:2879223

  10. Transcriptional activation of Xenopus class III genes in chromatin isolated from sperm and somatic nuclei.

    PubMed Central

    Wolffe, A P

    1989-01-01

    Xenopus sperm chromatin lacks class III transcription complexes and somatic histone H1. Inactive class III genes in sperm chromatin are easily programmed with transcription complexes de novo and transcribed in Xenopus oocyte nuclear extract. In contrast, repressed class III genes in somatic chromatin are not transcribed in the oocyte nuclear extract. Class III genes that are initially inactive or repressed in both types of chromatin can be efficiently transcribed in a cell free preparation of Xenopus eggs. Chromatin mediated repression of class III genes in somatic nuclei is reversible in Xenopus egg extract, but not in the oocyte nuclear extract. Any inhibition of transcription attributed to chromatin assembly onto a gene, will therefore depend on the extract in which transcription is assayed. Images PMID:2915929

  11. Trypanosoma brucei: Enrichment by UV of intergenic transcripts from the variable surface glycoprotein gene expression site

    SciTech Connect

    Coquelet, H.; Tebabi, P.; Pays, A.; Steinert, M.; Pays, E. )

    1989-09-01

    The expression site for the variable surface glycoprotein (VSG) gene AnTat 1.3A of Trypanosoma brucei is 45 kilobases long and encompasses seven expression site-associated genes (ESAGs). After UV irradiation, several large transcripts from the putative promoter region were strongly enriched. We report that one such major transcript starts near the poly(A) addition site of the first gene (ESAG 7), spans the intergenic region, and extends to the poly(A) addition site of the second gene (ESAG 6), thus bypassing the normal 3' splice site of the ESAG 6 mRNA. Since this transcript is spliced, we conclude that UV irradiation does not inhibit splicing but stabilizes unstable processing products. This demonstrates that at least some intergenic regions of the VSG gene expression site are continuously transcribed in accordance with a polycistronic transcription model.

  12. Identification of sequences regulating the transcription of a Dictyostelium gene selectively expressed in prespore cells.

    PubMed Central

    Early, A E; Williams, J G

    1989-01-01

    There has been considerable debate about the relative contributions of transcriptional and post-transcriptional mechanisms to the regulation of prespore gene expression in Dictyostelium. We have determined the DNA sequence upstream of D19, the Dictyostelium gene encoding PsA, a prespore-specific, cell surface protein of unknown function. Our analysis of gene fusions, in which D19 upstream sequences are placed adjacent to a heterologous reporter gene, indicates that transcriptional signals alone are sufficient for the correct temporal and cell-type specific expression of this gene. We also show that the 5' and 3' boundaries of the minimal sequences necessary for correct developmental regulation lie within the region 338 to 122 nucleotides upstream of the start site of transcription but that flanking sequences seem to be necessary for optimal expression. Images PMID:2550894

  13. Inferring biological functions and associated transcriptional regulators using gene set expression coherence analysis

    PubMed Central

    Kim, Tae-Min; Chung, Yeun-Jun; Rhyu, Mun-Gan; Ho Jung, Myeong

    2007-01-01

    Background Gene clustering has been widely used to group genes with similar expression pattern in microarray data analysis. Subsequent enrichment analysis using predefined gene sets can provide clues on which functional themes or regulatory sequence motifs are associated with individual gene clusters. In spite of the potential utility, gene clustering and enrichment analysis have been used in separate platforms, thus, the development of integrative algorithm linking both methods is highly challenging. Results In this study, we propose an algorithm for discovery of molecular functions and elucidation of transcriptional logics using two kinds of gene information, functional and regulatory motif gene sets. The algorithm, termed gene set expression coherence analysis first selects functional gene sets with significantly high expression coherences. Those candidate gene sets are further processed into a number of functionally related themes or functional clusters according to the expression similarities. Each functional cluster is then, investigated for the enrichment of transcriptional regulatory motifs using modified gene set enrichment analysis and regulatory motif gene sets. The method was tested for two publicly available expression profiles representing murine myogenesis and erythropoiesis. For respective profiles, our algorithm identified myocyte- and erythrocyte-related molecular functions, along with the putative transcriptional regulators for the corresponding molecular functions. Conclusion As an integrative and comprehensive method for the analysis of large-scaled gene expression profiles, our method is able to generate a set of testable hypotheses: the transcriptional regulator X regulates function Y under cellular condition Z. GSECA algorithm is implemented into freely available software package. PMID:18021416

  14. Mechanistic basis for transcriptional bursting of ribosomal genes in E. coli

    NASA Astrophysics Data System (ADS)

    Choubey, Sandeep; Sanchez, Alvaro; Kondev, Jane

    2012-02-01

    Upon adding more ribosomal genes to the E. coli cell, it adjusts the overall transcription of these genes by reducing the average transcription rate per gene, so as to keep constant the level of ribosomal RNA in the cell. It was observed that this reduction in the average transcription level per gene is accompanied by the generation of transcriptional bursts. The biophysical mechanism responsible for this type of transcriptional control is not yet known. We consider three possible mechanisms suggested in the literature: proximal pausing by RNA polymerase, cooperative recruitment of RNA polymerase by DNA supercoiling, and competition between RNA polymerase and a transcription factor for binding to regulatory DNA. We compute the expected statistical properties of transcription initiation for each one of these models,and compare our predictions with published distributions of distances between the polymerases transcribing the ribosomal genes, obtained from electron micrographs.We use this data to estimate the rates of transcription initiation, which are found to be in good agreement with independent measurements. We also show that the three mechanisms considered here can be discriminated by comparing their predictions for the mean and the variance of interpolymerase distances.

  15. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  16. Analysis of CD2 and TCR-{beta} gene expression in jurkat cell mutants suggests a cis regulation of gene transcription

    SciTech Connect

    Kamoun, M.; Woods, J.S.; Sano, N.

    1995-10-15

    Thirty CD2{sup -} J32 stable clones, derived by mutagenesis and subsequent immunoselection with anti-CD2 Ab, were used to study the regulation of CD2 and TCR gene expression. Analysis of RNA expression revealed that the loss of surface expression of CD2 was due to a lack of expression of CD2 mRNA and was associated with a lack of expression of VDJ TCR-{beta} transcripts in 12 of these mutants, sparing the expression of DJ TCR-{beta}, TCR-{alpha}, CD3{gamma}, {delta}, {epsilon}, and {zeta} RNA. The expression of other differentiation molecules was unaffected, except for CD1, CD4, and CD5, which were either decreased or absent in most of these mutants. A gain in the expression of TCR-{gamma} transcripts was observed in each of these mutants, while, as expected, no TCR-{gamma} transcripts were detected in wild-type J32 cells. Several mutants were able to use the human CD2 enhancer and the murine TCR-{beta} enhancer and promoter to activate transcription from reporter genes in the context of heterologous promoters, indicating that the mutation(s) does not affect transcription pathways. Consistent with this finding is the adequate expression in these mutants of several lineage-specific transcription factors. The expression of CD2 in several of these mutants was rescued by gene transfer using a genomic 28.5-kb CD2 fragment, suggesting that the enchancer function of this gene may be dependent on the enhancer site. These observations suggest that the coordinate expressions of CD2 and TCR-{beta} genes share common regulatory mechanisms involving factors regulating chromatin structure and accessibility. 51 refs., 6 figs., 3 tabs.

  17. Methoprene-tolerant 1 regulates gene transcription to maintain insect larval status.

    PubMed

    Zhao, Wen-Li; Liu, Chun-Yan; Liu, Wen; Wang, Di; Wang, Jin-Xing; Zhao, Xiao-Fan

    2014-08-01

    Insect molting and metamorphosis are regulated by two hormones: 20-hydroxyecdysone (20E) and juvenile hormone (JH). The hormone 20E regulates gene transcription via the nuclear receptor EcR to promote metamorphosis, whereas JH regulates gene transcription via its intracellular receptor methoprene-tolerant (Met) to prevent larval-pupal transition. However, the function and mechanism of Met in various insect developments are not well understood. We propose that Met1 plays a key role in maintaining larval status not only by promoting JH-responsive gene transcription but also by repressing 20E-responsive gene transcription in the Lepidopteran insect Helicoverpa armigera. Met1 protein is increased during feeding stage and decreased during molting and metamorphic stages. Met1 is upregulated by JH III and a low concentration of 20E independently, but is downregulated by a high concentration of 20E. Knockdown of Met1 in larvae causes precocious pupation, decrease in JH pathway gene expression, and increase in 20E pathway gene expression. Met1 interacts with heat shock protein 90 and binds to JH response element to regulate Krüppel homolog 1 transcription in JH III induction. Met1 interacts with ultraspiracle protein 1 (USP1) to repress 20E transcription complex EcRB1/USP1 formation and binding to ecdysone response element. These data indicate that JH via Met1 regulates JH pathway gene expression and represses 20E pathway gene expression to maintain the larval status.

  18. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    PubMed Central

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  19. Phosphorylation/dephosphorylation of the repressor MDBP-2-H1 selectively affects the level of transcription from a methylated promoter in vitro.

    PubMed Central

    Bruhat, A; Jost, J P

    1996-01-01

    We have previously shown that in vivo estradiol-dependent dephosphorylation of MDBP-2-H1 (a member of the histone H1 family) correlates with the loss of in vitro preferential binding to methylated DNA. To study the effects of the phosphorylation/dephosphorylation of MDBP-2-H1 on the expression of the avian vitellogenin II gene, we optimised an in vitro transcription system using HeLa nuclear extracts. We show that in the absence of the phosphorylated form of MDBP-2-H1 from rooster, methylation of the vitellogenin II promoter does not affect the transcription. Addition of purified MDBP-2-H1 from rooster to the in vitro transcription system inhibits transcription more efficiently from a methylated than an unmethylated DNA template. Dephosphorylation of rooster MDBP-2-H1 by phosphatase treatment or estradiol treatment of rooster lead to the loss of inhibitory activity of the protein when added to the in vitro transcription assays. These findings indicate that the phosphorylation of MDBP-2-H1 is essential for the repression of the transcription. Taken together these results establish the relationship between the dephosphorylation of MDBP-2-H1 caused by estradiol, the down regulation of its binding activity to methylated DNA and the derepression of vitellogenin II transcription. PMID:8657560

  20. Evidence That the Transcriptional Regulators Sin3 and Rpd3, and a Novel Gene (Sds3) with Similar Functions, Are Involved in Transcriptional Silencing in S. Cerevisiae

    PubMed Central

    Vannier, D.; Balderes, D.; Shore, D.

    1996-01-01

    In a screen for extragenic suppressors of a silencing defective rap1(s) hmrΔA strain, recessive mutations in 21 different genes were found that restored repression to HMR. We describe the characterization of three of these SDS (suppressors of defective silencing) genes. SDS16 and SDS6 are known transcriptional modifiers, SIN3(RPD1/UME4/SDI1/GAM2) and RPD3(SDI2), respectively, while the third is a novel gene, SDS3. SDS3 shares the meiotic functions of SIN3 and RPD3 in that it represses IME2 in haploid cells and is necessary for sporulation in diploid cells. However, sds3 mutations differ from sin3 and rpd3 mutations in that they do not derepress TRK2. These sds mutations suppress a variety of cis- and trans-defects, which impair the establishment of silencing at HMR. Any one of the sds mutations slightly increases telomere position effect while a striking synergistic increase in repression is observed in a rap1(s) background. Epistasis studies suggest that SDS3 works in a different pathway from RPD3 and SIN3 to affect silencing at HMR. Together these results show that defects in certain general transcriptional modifiers can have a pronounced influence on position-effect gene silencing in yeast. Mechanisms for this increase in postion effect are discussed. PMID:8978024

  1. DNA uptake sequences in Neisseria gonorrhoeae as intrinsic transcriptional terminators and markers of horizontal gene transfer

    PubMed Central

    Gurung, Neesha

    2016-01-01

    DNA uptake sequences are widespread throughout the Neisseria gonorrhoeae genome. These short, conserved sequences facilitate the exchange of endogenous DNA between members of the genus Neisseria. Often the DNA uptake sequences are present as inverted repeats that are able to form hairpin structures. It has been suggested previously that DNA uptake sequence inverted repeats present 3′ of genes play a role in rho-independent termination and attenuation. However, there is conflicting experimental evidence to support this role. The aim of this study was to determine the role of DNA uptake sequences in transcriptional termination. Both bioinformatics predictions, conducted using TransTermHP, and experimental evidence, from RNA-seq data, were used to determine which inverted repeat DNA uptake sequences are transcriptional terminators and in which direction. Here we show that DNA uptake sequences in the inverted repeat configuration occur in N. gonorrhoeae both where the DNA uptake sequence precedes the inverted version of the sequence and also, albeit less frequently, in reverse order. Due to their symmetrical configuration, inverted repeat DNA uptake sequences can potentially act as bi-directional terminators, therefore affecting transcription on both DNA strands. This work also provides evidence that gaps in DNA uptake sequence density in the gonococcal genome coincide with areas of DNA that are foreign in origin, such as prophage. This study differentiates for the first time, to our knowledge, between DNA uptake sequences that form intrinsic transcriptional terminators and those that do not, providing characteristic features within the flanking inverted repeat that can be identified. PMID:28348864

  2. Identifying Novel Transcriptional and Epigenetic Features of Nuclear Lamina-associated Genes.

    PubMed

    Wu, Feinan; Yao, Jie

    2017-12-01

    Because a large portion of the mammalian genome is associated with the nuclear lamina (NL), it is interesting to study how native genes resided there are transcribed and regulated. In this study, we report unique transcriptional and epigenetic features of nearly 3,500 NL-associated genes (NL genes). Promoter regions of active NL genes are often excluded from NL-association, suggesting that NL-promoter interactions may repress transcription. Active NL genes with higher RNA polymerase II (Pol II) recruitment levels tend to display Pol II promoter-proximal pausing, while Pol II recruitment and Pol II pausing are not correlated among non-NL genes. At the genome-wide scale, NL-association and H3K27me3 distinguishes two large gene classes with low transcriptional activities. Notably, NL-association is anti-correlated with both transcription and active histone mark levels among genes not significantly enriched with H3K9me3 or H3K27me3, suggesting that NL-association may represent a novel gene repression pathway. Interestingly, an NL gene subgroup is not significantly enriched with H3K9me3 or H3K27me3 and is transcribed at higher levels than the rest of NL genes. Furthermore, we identified distal enhancers associated with active NL genes and reported their epigenetic features.

  3. Identification of a novel reference gene for apple transcriptional profiling under postharvest conditions.

    PubMed

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference--ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)--along with two novel candidates--HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest.

  4. Non-small cell lung cancer exhibits transcript overexpression of genes associated with homologous recombination and DNA replication pathways.

    PubMed

    Saviozzi, Silvia; Ceppi, Paolo; Novello, Silvia; Ghio, Paolo; Lo Iacono, Marco; Borasio, Piero; Cambieri, Alberto; Volante, Marco; Papotti, Mauro; Calogero, Raffaele A; Scagliotti, Giorgio V

    2009-04-15

    Genes involved in DNA repair and replication have been recently investigated as predictive markers of response to chemotherapy in non-small cell lung cancer (NSCLC). However, few data on the expression of these genes in tumor compared with corresponding normal lung are available. The aim of this study was to evaluate differential mRNA levels of 22 DNA repair genes of five different DNA repair pathways: direct, base excision, nucleotide excision (NER), double-strand break (DSBR), and postreplicative repair. In addition, six genes involved in DNA replication (REP) and three telomere maintenance genes were investigated. Total RNAs extracted from fresh-frozen tumors and corresponding normal tissues of 50 consecutive chemo-naïve resected NSCLC patients were analyzed. Transcript levels were quantified by real-time PCR. A significant overexpression was detected in 20 of 30 (67%) genes, mostly belonging to DSBR pathways, whereas others (XPA, XPC, and UBE2N; 10%) were significantly underexpressed. For 7 of 30 (23%) genes, mostly belonging to NER pathway, no significant difference between paired tumor and normal samples was observed. Transcript overexpression of DSBR and REP genes was significantly higher in poorly differentiated carcinomas and DSBR levels were higher in men compared with women. The transcriptional overexpression of four genes (XRCC5, TOP3B, TYMS, and UNG) showed significant correlation with a shorter patients' outcome at the univariate, whereas only stage of disease appeared as an independent factor affecting prognosis, as assessed by multivariate analysis. In conclusion, genes belonging to DNA repair/replication pathways are overexpressed in NSCLC and are associated with a more aggressive phenotype.

  5. Differential transcription of multiple copies of a silk worm gene encoding tRNA(Gly1).

    PubMed

    Fournier, A; Taneja, R; Gopalkrishnan, R; Prudhomme, J C; Gopinathan, K P

    1993-12-08

    Ten different tRNA(Gly1) genes from the silk worm, Bombyx mori, have been cloned and characterized. These genes were transcribed in vitro in homologous nuclear extracts from the posterior silk gland (PSG) or nuclear extracts derived from the middle silk gland or ovarian tissues. Although the transcription levels were much higher in the PSG nuclear extracts, the transcriptional efficiency of the individual genes followed a similar pattern in all the extracts. Based on the levels of in vitro transcription, the ten tRNA(Gly1) genes could be divided into three groups, viz., those which were transcribed at very high levels (e.g., clone pR8), high to medium levels (e.g., pBmi1, pBmp1, pBmh1, pBmt1) and low to barely detectable levels (e.g., pBms1, pBmj1 and pBmk1). The coding sequences of all these tRNA genes being identical, the differential transcription suggested that the flanking sequences modulate their transcriptional efficiency. The presence of positive and negative regulatory elements in the 5' flanking regions of these genes was confirmed by transcription competition experiments. A positive element was present in the immediate upstream A+T-rich sequences in all the genes, but no consensus sequences correlating to the transcriptional status could be generated. The presence of negative elements on the other hand was indicated only in some of the genes and therefore may have a role in the differential transcription of these tRNA(Gly1) genes in vivo.

  6. Genetic variations in GPSM3 associated with protection from rheumatoid arthritis affect its transcript abundance

    PubMed Central

    Gall, BJ; Wilson, A; Schroer, AB; Gross, JD; Stoilov, P; Setola, V; Watkins, CM; Siderovski, DP

    2015-01-01

    G protein signaling modulator 3 (GPSM3) is a regulator of G protein-coupled receptor signaling, with expression restricted to leukocytes and lymphoid organs. Previous genome-wide association studies have highlighted single-nucleotide polymorphisms (SNPs rs204989, rs204991) in a region upstream of the GPSM3 transcription start site as being inversely correlated to the prevalence of rheumatoid arthritis (RA) -- this association is supported by the protection afforded to Gpsm3-deficient mice in models of inflammatory arthritis. Here, we assessed the functional consequences of these polymorphisms. We collected biospecimens from 50 volunteers with RA diagnoses, 50 RA-free volunteers matched to the aforementioned group, and 100 unmatched healthy young volunteers. We genotyped these individuals for GPSM3 (rs204989, rs204991), CCL21 (rs2812378), and HLA gene region (rs6457620) polymorphisms, and found no significant differences in minor allele frequencies between the RA and disease-free cohorts. However, we identified that individuals homozygous for SNPs rs204989 and rs204991 had decreased GPSM3 transcript abundance relative to individuals homozygous for the major allele. In vitro promoter activity studies suggest that SNP rs204989 is the primary cause of this decrease in transcript levels. Knockdown of GPSM3 in THP-1 cells, a human monocytic cell line, was found to disrupt ex vivo migration to the chemokine MCP-1. PMID:26821282

  7. Genetic variations in GPSM3 associated with protection from rheumatoid arthritis affect its transcript abundance.

    PubMed

    Gall, B J; Wilson, A; Schroer, A B; Gross, J D; Stoilov, P; Setola, V; Watkins, C M; Siderovski, D P

    2016-03-01

    G protein signaling modulator 3 (GPSM3) is a regulator of G protein-coupled receptor signaling, with expression restricted to leukocytes and lymphoid organs. Previous genome-wide association studies have highlighted single-nucleotide polymorphisms (SNPs; rs204989 and rs204991) in a region upstream of the GPSM3 transcription start site as being inversely correlated to the prevalence of rheumatoid arthritis (RA)-this association is supported by the protection afforded to Gpsm3-deficient mice in models of inflammatory arthritis. Here, we assessed the functional consequences of these polymorphisms. We collected biospecimens from 50 volunteers with RA diagnoses, 50 RA-free volunteers matched to the aforementioned group and 100 unmatched healthy young volunteers. We genotyped these individuals for GPSM3 (rs204989, rs204991), CCL21 (rs2812378) and HLA gene region (rs6457620) polymorphisms, and found no significant differences in minor allele frequencies between the RA and disease-free cohorts. However, we identified that individuals homozygous for SNPs rs204989 and rs204991 had decreased GPSM3 transcript abundance relative to individuals homozygous for the major allele. In vitro promoter activity studies suggest that SNP rs204989 is the primary cause of this decrease in transcript levels. Knockdown of GPSM3 in THP-1 cells, a human monocytic cell line, was found to disrupt ex vivo migration to the chemokine MCP-1.

  8. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.

    1995-01-01

    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  9. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    PubMed

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2016-12-06

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development.

  10. Involvement of the leucine response transcription factor LeuO in regulation of the genes for sulfa drug efflux.

    PubMed

    Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2009-07-01

    LeuO, a LysR family transcription factor, exists in a wide variety of bacteria of the family Enterobacteriaceae and is involved in the regulation of as yet unidentified genes affecting the stress response and pathogenesis expression. Using genomic screening by systematic evolution of ligands by exponential enrichment (SELEX) in vitro, a total of 106 DNA sequences were isolated from 12 different regions of the Escherichia coli genome. All of the SELEX fragments formed complexes in vitro with purified LeuO. After Northern blot analysis of the putative target genes located downstream of the respective LeuO-binding sequence, a total of nine genes were found to be activated by LeuO, while three genes were repressed by LeuO. The LeuO target gene collection included several multidrug resistance genes. A phenotype microarray assay was conducted to identify the gene(s) responsible for drug resistance and the drug species that are under the control of the LeuO target gene(s). The results described herein indicate that the yjcRQP operon, one of the LeuO targets, is involved in sensitivity control against sulfa drugs. We propose to rename the yjcRQP genes the sdsRQP genes (sulfa drug sensitivity determinant).

  11. Post-transcriptional regulation of ribosomal protein genes during serum starvation in Entamoeba histolytica.

    PubMed

    Ahamad, Jamaluddin; Ojha, Sandeep; Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha

    2015-06-01

    Ribosome synthesis involves all three RNA polymerases which are co-ordinately regulated to produce equimolar amounts of rRNAs and ribosomal proteins (RPs). Unlike model organisms where transcription of rRNA and RP genes slows down during stress, in E. histolytica rDNA transcription continues but pre-rRNA processing slows down and unprocessed pre-rRNA accumulates during serum starvation. To investigate the regulation of RP genes under stress we measured transcription of six selected RP genes from the small- and large-ribosomal subunits (RPS6, RPS3, RPS19, RPL5, RPL26, RPL30) representing the early-, mid-, and late-stages of ribosomal assembly. Transcripts of these genes persisted in growth-stressed cells. Expression of luciferase reporter under the control of two RP genes (RPS19 and RPL30) was studied during serum starvation and upon serum replenishment. Although luciferase transcript levels remained unchanged during starvation, luciferase activity steadily declined to 7.8% and 15% of control cells, respectively. After serum replenishment the activity increased to normal levels, suggesting post-transcriptional regulation of these genes. Mutations in the sequence -2 to -9 upstream of AUG in the RPL30 gene resulted in the phenotype expected of post-transcriptional regulation. Transcription of luciferase reporter was unaffected in this mutant, and luciferase activity did not decline during serum starvation, showing that this sequence is required to repress translation of RPL30 mRNA, and mutations in this region relieve repression. Our data show that during serum starvation E. histolytica blocks ribosome biogenesis post-transcriptionally by inhibiting pre-rRNA processing on the one hand, and the translation of RP mRNAs on the other.

  12. VITELLOGENIN GENE TRANSCRIPTION AS AN INDICATOR OF EXPOSURE TO 17-ALPHA-ETHYNYLESTRADIOL IN FATHEAD MINNOWS

    EPA Science Inventory

    Environmentally persistent chemicals that functionally mimic estrogen are ubiquitous in surface waters and have been shown to effect reproductive health of species living in these habitats. Toxicant induced transcription of specific genes is a sensitive indicator of exposure and ...

  13. AKT phosphorylates H3-threonine 45 to facilitate termination of gene transcription in response to DNA damage

    PubMed Central

    Lee, Jong-Hyuk; Kang, Byung-Hee; Jang, Hyonchol; Kim, Tae Wan; Choi, Jinmi; Kwak, Sojung; Han, Jungwon; Cho, Eun-Jung; Youn, Hong-Duk

    2015-01-01

    Post-translational modifications of core histones affect various cellular processes, primarily through transcription. However, their relationship with the termination of transcription has remained largely unknown. In this study, we show that DNA damage-activated AKT phosphorylates threonine 45 of core histone H3 (H3-T45). By genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis, H3-T45 phosphorylation was distributed throughout DNA damage-responsive gene loci, particularly immediately after the transcription termination site. H3-T45 phosphorylation pattern showed close-resemblance to that of RNA polymerase II C-terminal domain (CTD) serine 2 phosphorylation, which establishes the transcription termination signal. AKT1 was more effective than AKT2 in phosphorylating H3-T45. Blocking H3-T45 phosphorylation by inhibiting AKT or through amino acid substitution limited RNA decay downstream of mRNA cleavage sites and decreased RNA polymerase II release from chromatin. Our findings suggest that AKT-mediated phosphorylation of H3-T45 regulates the processing of the 3′ end of DNA damage-activated genes to facilitate transcriptional termination. PMID:25813038

  14. Transcriptional effects on double-strand break-induced gene conversion tracts.

    PubMed

    Weng, Y S; Xing, D; Clikeman, J A; Nickoloff, J A

    2000-10-16

    Transcription stimulates spontaneous homologous recombination, but prior studies have not investigated the effects of transcription on double-strand break (DSB)-induced recombination in yeast. We examined products of five ura3 direct repeat substrates in yeast using alleles that were transcribed at low or high levels. In each strain, recombination was stimulated by DSBs created in vivo at an HO site in one copy of ura3. Increasing transcription levels in donor or recipient alleles did not further stimulate DSB-induced recombination, nor did it alter the relative frequencies of conversion and deletion (pop-out) events. This result is consistent with the idea that transcription enhances spontaneous recombination by increasing initiation. Gene conversion tracts were measured using silent restriction fragment length polymorphisms (RFLPs) at approximately 100bp intervals. Transcription did not alter average tract lengths, but increased transcription in donor alleles increased both the frequency of promoter-proximal (5') unidirectional tracts and conversion of 5' markers. Increased transcription in recipient alleles increased the frequency of bidirectional tracts. We demonstrate that these effects are due to transcription per se, and not just transcription factor binding. These results suggest that transcription influences aspects of gene conversion after initiation, such as strand invasion and/or mismatch repair (MMR).

  15. Altered expression of the bZIP transcription factor DRINK ME affects growth and reproductive development in Arabidopsis thaliana.

    PubMed

    Lozano-Sotomayor, Paulina; Chávez Montes, Ricardo A; Silvestre-Vañó, Marina; Herrera-Ubaldo, Humberto; Greco, Raffaella; Pablo-Villa, Jeanneth; Galliani, Bianca M; Diaz-Ramirez, David; Weemen, Mieke; Boutilier, Kim; Pereira, Andy; Colombo, Lucia; Madueño, Francisco; Marsch-Martínez, Nayelli; de Folter, Stefan

    2016-11-01

    Here we describe an uncharacterized gene that negatively influences Arabidopsis growth and reproductive development. DRINK ME (DKM; bZIP30) is a member of the bZIP transcription factor family, and is expressed in meristematic tissues such as the inflorescence meristem (IM), floral meristem (FM), and carpel margin meristem (CMM). Altered DKM expression affects meristematic tissues and reproductive organ development, including the gynoecium, which is the female reproductive structure and is determinant for fertility and sexual reproduction. A microarray analysis indicates that DKM overexpression affects the expression of cell cycle, cell wall, organ initiation, cell elongation, hormone homeostasis, and meristem activity genes. Furthermore, DKM can interact in yeast and in planta with proteins involved in shoot apical meristem maintenance such as WUSCHEL, KNAT1/BP, KNAT2 and JAIBA, and with proteins involved in medial tissue development in the gynoecium such as HECATE, BELL1 and NGATHA1. Taken together, our results highlight the relevance of DKM as a negative modulator of Arabidopsis growth and reproductive development.

  16. The transcription factor SOX17 is involved in the transcriptional control of the uteroglobin gene in rabbit endometrium.

    PubMed

    Garcia, Carlos; Calvo, Enrique; Nieto, Antonio

    2007-10-15

    The transcription of the uteroglobin gene (ug) is induced by progesterone in the rabbit endometrium, primarily through the binding of the progesterone receptor to the distal region of the ug promoter. However, other transcription factors participate in the progesterone action. The proximal ug promoter contains several putative consensus sequences for the binding of various progesterone-dependent endometrial nuclear factors (Perez Martinez et al. [1996] Arch Biochem Biophys 333: 12-18), suggesting that several transcription factors might be implicated in the hormonal induction of ug. We report here that one of these progesterone-dependent factors specifically binds to the sequence CACAATG (-183/-177) of the rabbit ug promoter. This sequence (hereafter called element G') is very similar to the consensus sequence for binding of the SOX family of transcription factors. Mutation of the element G' reduced transcription from the ug promoter in transient expression experiments. The endometrial factor was purified and analyzed by nano-liquid chromatography and ion trap coupled mass spectrometry yielding two partial amino acid sequences corresponding to a region of SOX17 that is highly conserved inter-species. This identification was confirmed by immunological techniques using a specific anti-SOX17 antibody. In agreement with the above findings, overexpression of SOX17 in transfected endometrial cells increased transcription from the ug promoter. SOX17 gradually accumulated in the nucleus in vivo concomitant with the induction of ug expression by progesterone in the endometrium. Thus, these findings implicate, for the first time, SOX17 in the transcriptional control of rabbit ug.

  17. Transcriptional and post-transcriptional regulation of SPAST, the gene most frequently mutated in hereditary spastic paraplegia.

    PubMed

    Henson, Brian J; Zhu, Wan; Hardaway, Kelsey; Wetzel, Jaime L; Stefan, Mihaela; Albers, Kathryn M; Nicholls, Robert D

    2012-01-01

    Hereditary spastic paraplegias (HSPs) comprise a group of neurodegenerative disorders that are characterized by progressive spasticity of the lower extremities, due to axonal degeneration in the corticospinal motor tracts. HSPs are genetically heterogeneous and show autosomal dominant inheritance in ∼70-80% of cases, with additional cases being recessive or X-linked. The most common type of HSP is SPG4 with mutations in the SPAST gene, encoding spastin, which occurs in 40% of dominantly inherited cases and in ∼10% of sporadic cases. Both loss-of-function and dominant-negative mutation mechanisms have been described for SPG4, suggesting that precise or stoichiometric levels of spastin are necessary for biological function. Therefore, we hypothesized that regulatory mechanisms controlling expression of SPAST are important determinants of spastin biology, and if altered, could contribute to the development and progression of the disease. To examine the transcriptional and post-transcriptional regulation of SPAST, we used molecular phylogenetic methods to identify conserved sequences for putative transcription factor binding sites and miRNA targeting motifs in the SPAST promoter and 3'-UTR, respectively. By a variety of molecular methods, we demonstrate that SPAST transcription is positively regulated by NRF1 and SOX11. Furthermore, we show that miR-96 and miR-182 negatively regulate SPAST by effects on mRNA stability and protein level. These transcriptional and miRNA regulatory mechanisms provide new functional targets for mutation screening and therapeutic targeting in HSP.

  18. Transcriptional regulation of fucosyltransferase 1 gene expression in colon cancer cells.

    PubMed

    Taniuchi, Fumiko; Higai, Koji; Tanaka, Tomomi; Azuma, Yutaro; Matsumoto, Kojiro

    2013-01-01

    The α 1,2-fucosyltransferase I (FUT1) enzyme is important for the biosynthesis of H antigens, Lewis B, and Lewis Y. In this study, we clarified the transcriptional regulation of FUT1 in the DLD-1 colon cancer cell line, which has high expression of Lewis B and Lewis Y antigens, expresses the FUT1 gene, and shows α 1,2-fucosyltransferase (FUT) activity. 5'-rapid amplification of cDNA ends revealed a FUT1 transcriptional start site -10 nucleotides upstream of the site registered at NM_000148 in the DataBase of Human Transcription Start Sites (DBTSS). Using the dual luciferase assay, FUT1 gene expression was shown to be regulated at the region -91 to -81 nt to the transcriptional start site, which contains the Elk-1 binding site. Site-directed mutagenesis of this region revealed the Elk-1 binding site to be essential for FUT1 transcription. Furthermore, transfection of the dominant negative Elk-1 gene, and the chromatin immunoprecipitation (CHIp) assay, supported Elk-1-dependent transcriptional regulation of FUT1 gene expression in DLD-1 cells. These results suggest that a defined region in the 5'-flanking region of FUT1 is critical for FUT1 transcription and that constitutive gene expression of FUT1 is regulated by Elk-1 in DLD-1 cells.

  19. The transcription factor ultraspiracle influences honey bee social behavior and behavior-related gene expression.

    PubMed

    Ament, Seth A; Wang, Ying; Chen, Chieh-Chun; Blatti, Charles A; Hong, Feng; Liang, Zhengzheng S; Negre, Nicolas; White, Kevin P; Rodriguez-Zas, Sandra L; Mizzen, Craig A; Sinha, Saurabh; Zhong, Sheng; Robinson, Gene E

    2012-01-01

    Behavior is among the most dynamic animal phenotypes, modulated by a variety of internal and external stimuli. Behavioral differences are associated with large-scale changes in gene expression, but little is known about how these changes are regulated. Here we show how a transcription factor (TF), ultraspiracle (usp; the insect homolog of the Retinoid X Receptor), working in complex transcriptional networks, can regulate behavioral plasticity and associated changes in gene expression. We first show that RNAi knockdown of USP in honey bee abdominal fat bodies delayed the transition from working in the hive (primarily "nursing" brood) to foraging outside. We then demonstrate through transcriptomics experiments that USP induced many maturation-related transcriptional changes in the fat bodies by mediating transcriptional responses to juvenile hormone. These maturation-related transcriptional responses to USP occurred without changes in USP's genomic binding sites, as revealed by ChIP-chip. Instead, behaviorally related gene expression is likely determined by combinatorial interactions between USP and other TFs whose cis-regulatory motifs were enriched at USP's binding sites. Many modules of JH- and maturation-related genes were co-regulated in both the fat body and brain, predicting that usp and cofactors influence shared transcriptional networks in both of these maturation-related tissues. Our findings demonstrate how "single gene effects" on behavioral plasticity can involve complex transcriptional networks, in both brain and peripheral tissues.

  20. The Transcription Factor Ultraspiracle Influences Honey Bee Social Behavior and Behavior-Related Gene Expression

    PubMed Central

    Chen, Chieh-Chun; Blatti, Charles A.; Hong, Feng; Liang, Zhengzheng S.; Negre, Nicolas; White, Kevin P.; Rodriguez-Zas, Sandra L.; Mizzen, Craig A.; Sinha, Saurabh; Zhong, Sheng; Robinson, Gene E.

    2012-01-01

    Behavior is among the most dynamic animal phenotypes, modulated by a variety of internal and external stimuli. Behavioral differences are associated with large-scale changes in gene expression, but little is known about how these changes are regulated. Here we show how a transcription factor (TF), ultraspiracle (usp; the insect homolog of the Retinoid X Receptor), working in complex transcriptional networks, can regulate behavioral plasticity and associated changes in gene expression. We first show that RNAi knockdown of USP in honey bee abdominal fat bodies delayed the transition from working in the hive (primarily “nursing” brood) to foraging outside. We then demonstrate through transcriptomics experiments that USP induced many maturation-related transcriptional changes in the fat bodies by mediating transcriptional responses to juvenile hormone. These maturation-related transcriptional responses to USP occurred without changes in USP's genomic binding sites, as revealed by ChIP–chip. Instead, behaviorally related gene expression is likely determined by combinatorial interactions between USP and other TFs whose cis-regulatory motifs were enriched at USP's binding sites. Many modules of JH– and maturation-related genes were co-regulated in both the fat body and brain, predicting that usp and cofactors influence shared transcriptional networks in both of these maturation-related tissues. Our findings demonstrate how “single gene effects” on behavioral plasticity can involve complex transcriptional networks, in both brain and peripheral tissues. PMID:22479195

  1. Changes in cell wall polysaccharide composition, gene transcription and alternative splicing in germinating barley embryos.

    PubMed

    Zhang, Qisen; Zhang, Xiaoqi; Pettolino, Filomena; Zhou, Gaofeng; Li, Chengdao

    2016-02-01

    Barley (Hordeum vulgare L.) seed germination initiates many important biological processes such as DNA, membrane and mitochondrial repairs. However, little is known on cell wall modifications in germinating embryos. We have investigated cell wall polysaccharide composition change, gene transcription and alternative splicing events in four barley varieties at 24h and 48 h germination. Cell wall components in germinating barley embryos changed rapidly, with increases in cellulose and (1,3)(1,4)-β-D-glucan (20-100%) within 24h, but decreases in heteroxylan and arabinan (3-50%). There were also significant changes in the levels of type I arabinogalactans and heteromannans. Alternative splicing played very important roles in cell wall modifications. At least 22 cell wall transcripts were detected to undergo either alternative 3' splicing, alternative 5' splicing or intron retention type of alternative splicing. These genes coded enzymes catalyzing synthesis and degradation of cellulose, heteroxylan, (1,3)(1,4)-β-D-glucan and other cell wall polymers. Furthermore, transcriptional regulation also played very important roles in cell wall modifications. Transcript levels of primary wall cellulase synthase, heteroxylan synthesizing and nucleotide sugar inter-conversion genes were very high in germinating embryos. At least 50 cell wall genes changed transcript levels significantly. Expression patterns of many cell wall genes coincided with changes in polysaccharide composition. Our data showed that cell wall polysaccharide metabolism was very active in germinating barley embryos, which was regulated at both transcriptional and post-transcriptional levels.

  2. Changes in gravity affect gene expression, protein modulation and metabolite pools of arabidopsis

    NASA Astrophysics Data System (ADS)

    Hampp, R.; Martzivanou, M.; Maier, R. M.; Magel, E.

    Callus cultures of Arabidopsis thaliana (cv. Columbia) in Petri dishes / suspension cultures were exposed to altered g-forces by centrifugation (1 to 10 g), klinorotation, and μ g (sounding rocket flights). Using semi-quantitative RT-PCR, transcripts of genes coding for metabolic key enzymes (ADP-glucose pyrophosphorylase, ADPG-PP; ß-amylase, fructose-1,6-bisphosphatase, FBPase; glyceraldehyde-P dehydrogenase, GAPDH; hydroxymethylglutaryl-CoA reductase, HMG; phenylalanine-ammonium-lyase, PAL; PEP carboxylase, PEPC) were used to monitor threshold conditions for g-number (all) and time of exposure (ß-amylase) which led to altered amounts of the gene product. Exposure to approx. 5 g and higher for 1h resulted in altered transcript levels: transcripts of ß-amylase, PAL, and PEPC were increased, those of ADPG-PP decreased, while those of FBPase, GAPDH, and HMG were not affected. This probably indicates a shift from starch synthesis to starch degradation and increased rates of anaplerosis (PEPC: supply of ketoacids for amino acid synthesis). In order to get more information about g-related effects on gene expression, we used a 1h-exposure to 7 g for a microarray analysis. Transcripts of more than 200 genes were significantly increased in amount (ratio 7g / 1g control; 21.6 and larger). They fall into several categories. Transcripts coding for enzymes of major pathways form the largest group (25%), followed by gene products involved in cellular organisation and cell wall formation / rearrangement (17%), signalling, phosphorylation/dephosphorylation (12%), proteolysis and transport (10% each), hormone synthesis plus related events (8%), defense (4%), stress-response (2%), and gravisensing (2%). Many of the alterations are part of a general stress response, but some changes related to the synthesis / rearrangement of cell wall components could be more hyper-g-specific. Using macroarrays with selected genes according to our hypergravity study (metabolism / signalling

  3. Transcription of novel genes, including a gene linked to the mating-type locus, induced by Chlamydomonas fertilization.

    PubMed Central

    Ferris, P J; Goodenough, U W

    1987-01-01

    Six cDNA clones have been identified that are complementary to transcripts present in young zygotes of Chlamydomonas reinhardtii but absent from vegetative and gametic cells. Five early transcripts are synthesized within 5 to 10 min of fertilization; the sixth, late, transcript is not synthesized until 90 min following fertilization. Synthesis of both classes requires cell fusion between gametes. Cycloheximide fails to inhibit early mRNA synthesis, indicating that transcription factors must preexist in the gametes and be activated by cytoplasmic confluence. By contrast, cycloheximide blocks synthesis of the late transcript, suggesting that an early protein product(s) is required for expression of the late gene. Restriction fragment length polymorphism analysis of inter- and intraspecific genetic crosses demonstrates that one of the early genes is very tightly linked to the mating-type locus. Images PMID:3614194

  4. A parasitic selfish gene that affects host promiscuity.

    PubMed

    Giraldo-Perez, Paulina; Goddard, Matthew R

    2013-11-07

    Selfish genes demonstrate transmission bias and invade sexual populations despite conferring no benefit to their hosts. While the molecular genetics and evolutionary dynamics of selfish genes are reasonably well characterized, their effects on hosts are not. Homing endonuclease genes (HEGs) are one well-studied family of selfish genes that are assumed to be benign. However, we show that carrying HEGs is costly for Saccharomyces cerevisiae, demonstrating that these genetic elements are not necessarily benign but maybe parasitic. We estimate a selective load of approximately 1-2% in 'natural' niches. The second aspect we examine is the ability of HEGs to affect hosts' sexual behaviour. As all selfish genes critically rely on sex for spread, then any selfish gene correlated with increased host sexuality will enjoy a transmission advantage. While classic parasites are known to manipulate host behaviour, we are not aware of any evidence showing a selfish gene is capable of affecting host promiscuity. The data presented here show a selfish element may increase the propensity of its eukaryote host to undergo sex and along with increased rates of non-Mendelian inheritance, this may counterbalance mitotic selective load and promote spread. Demonstration that selfish genes are correlated with increased promiscuity in eukaryotes connects with ideas suggesting that selfish genes promoted the evolution of sex initially.

  5. Transcription termination between polo and snap, two closely spaced tandem genes of D. melanogaster.

    PubMed

    Henriques, Telmo; Ji, Zhe; Tan-Wong, Sue Mei; Carmo, Alexandre M; Tian, Bin; Proudfoot, Nicholas J; Moreira, Alexandra

    2012-01-01

    Transcription termination of RNA polymerase II between closely spaced genes is an important, though poorly understood, mechanism. This is true, in particular, in the Drosophila genome, where approximately 52% of tandem genes are separated by less than 1 kb. We show that a set of Drosophila tandem genes has a negative correlation of gene expression and display several molecular marks indicative of promoter pausing. We find that an intergenic spacing of 168 bp is sufficient for efficient transcription termination between the polo-snap tandem gene pair, by a mechanism that is independent of Pcf11 and Xrn2. In contrast, analysis of a tandem gene pair containing a longer intergenic region reveals that termination occurs farther downstream of the poly(A) signal and is, in this case, dependent on Pcf11 and Xrn2. For polo-snap, displacement of poised polymerase from the snap promoter by depletion of the initiation factor TFIIB results in an increase of polo transcriptional read-through. This suggests that poised polymerase is necessary for transcription termination. Interestingly, we observe that polo forms a TFIIB dependent gene loop between its promoter and terminator regions. Furthermore, in a plasmid containing the polo-snap locus, deletion of the polo promoter causes an increase in snap expression, as does deletion of polo poly(A) signals. Taken together, our results indicate that polo forms a gene loop and polo transcription termination occurs by an Xrn2 and Pcf11 independent mechanism that requires TFIIB.

  6. Checks and balances between cohesin and polycomb in gene silencing and transcription.

    PubMed

    Dorsett, Dale; Kassis, Judith A

    2014-06-02

    The cohesin protein complex was discovered for its roles in sister chromatid cohesion and segregation, and the Polycomb group (PcG) proteins for their roles in epigenetic gene silencing during development. Cohesin also controls gene transcription via multiple mechanisms. Genetic and molecular evidence from Drosophila argue that cohesin and the PRC1 PcG complex interact to control transcription of many active genes that are critical for development, and that via these interactions cohesin also controls the availability of PRC1 for gene silencing.

  7. A barley PHD finger transcription factor that confers male sterility by affecting tapetal development.

    PubMed

    Fernández Gómez, José; Wilson, Zoe A

    2014-08-01

    Controlling pollen development is of major commercial importance in generating hybrid crops and selective breeding, but characterized genes for male sterility in crops are rare, with no current examples in barley. However, translation of knowledge from model species is now providing opportunities to understand and manipulate such processes in economically important crops. We have used information from regulatory networks in Arabidopsis to identify and functionally characterize a barley PHD transcription factor MALE STERTILITY1 (MS1), which expresses in the anther tapetum and plays a critical role during pollen development. Comparative analysis of Arabidopsis, rice and Brachypodium genomes was used to identify conserved regions in MS1 for primer design to amplify the barley MS1 gene; RACE-PCR was subsequently used to generate the full-length sequence. This gene shows anther-specific tapetal expression, between late tetrad stage and early microspore release. HvMS1 silencing and overexpression in barley resulted in male sterility. Additionally, HvMS1 cDNA, controlled by the native Arabidopsis MS1 promoter, successfully complemented the homozygous ms1 Arabidopsis mutant. These results confirm the conservation of MS1 function in higher plants and in particular in temperate cereals. This has provided the first example of a characterized male sterility gene in barley, which presents a valuable tool for the future control of male fertility in barley for hybrid development.

  8. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    SciTech Connect

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  9. Genome-wide identification and characterization of reference genes with different transcript abundances for Streptomyces coelicolor

    PubMed Central

    Li, Shanshan; Wang, Weishan; Li, Xiao; Fan, Keqiang; Yang, Keqian

    2015-01-01

    The lack of reliable reference genes (RGs) in the genus Streptomyces hampers effort to obtain the precise data of transcript levels. To address this issue, we aimed to identify reliable RGs in the model organism Streptomyces coelicolor. A pool of potential RGs containing 1,471 genes was first identified by determining the intersection of genes with stable transcript levels from four time-series transcriptome microarray datasets of S. coelicolor M145 cultivated in different conditions. Then, following a strict rational selection scheme including homology analysis, disturbance analysis, function analysis and transcript abundance analysis, 13 candidates were selected from the 1,471 genes. Based on real-time quantitative reverse transcription PCR assays, SCO0710, SCO6185, SCO1544, SCO3183 and SCO4758 were identified as the top five genes with the most stable transcript levels among the 13 candidates. Further analyses showed these five genes also maintained stable transcript levels in different S. coelicolor strains, as well as in Streptomyces avermitilis MA-4680 and Streptomyces clavuligerus NRRL 3585, suggesting they could fulfill the requirements of accurate data normalization in streptomycetes. Moreover, the systematic strategy employed in this work could be used for reference in other microorganism to select reliable RGs. PMID:26527303

  10. Tandem transcription termination sites in the dnaN gene of Escherichia coli.

    PubMed

    Armengod, M E; García-Sogo, M; Pérez-Roger, I; Macián, F; Navarro-Aviñó, J P

    1991-10-15

    The dnaN gene of Escherichia coli encodes the beta-subunit of DNA polymerase III and maps between the dnaA and recF genes. We demonstrated previously that dnaN and recF constitute a transcriptional unit under control of the dnaN promoters. However, the recF gene has its own promoter region located in the middle of the dnaN structural gene. In this report, we use S1 mapping of mRNAs, transcriptional and translational fusions to the galK and lacZ genes, and in vitro mutagenesis to identify and characterize three tandem transcription termination sites responsible for transcriptional polarity in the dnaN-recF operon. These sites are located in the dnaN gene, downstream from the recF promoter region. Cumulatively, they terminate about 80% of the untranslated transcripts started at the recF promoters. As expected, they do not reduce transcription coming from the dnaN promoters unless dnaN translation was prematurely disrupted by the presence of a nonsense codon. The particular arrangement of regulatory elements (promoters and terminators) in the dnaN-recF region provides an exceptional in vivo system to confirm the latent termination site model of transcriptional polarity. In addition, our results contribute to the understanding of the complex regulation of the dnaA, dnaN, and recF genes. We propose that these three genes constitute an operon and that the terminators described in this work could be used to reduce expression of the distal genes of the operon under circumstances in which the dnaN translation happens to be slowed down.

  11. Identification of Gene Transcription Start Sites and Enhancers Responding to Pulmonary Carbon Nanotube Exposure in Vivo.

    PubMed

    Bornholdt, Jette; Saber, Anne Thoustrup; Lilje, Berit; Boyd, Mette; Jørgensen, Mette; Chen, Yun; Vitezic, Morana; Jacobsen, Nicklas Raun; Poulsen, Sarah Søs; Berthing, Trine; Bressendorff, Simon; Vitting-Seerup, Kristoffer; Andersson, Robin; Hougaard, Karin Sørig; Yauk, Carole L; Halappanavar, Sabina; Wallin, Håkan; Vogel, Ulla; Sandelin, Albin

    2017-03-31

    Increased use of nanomaterials in industry, medicine, and consumer products has raised concerns over their toxicity. To ensure safe use of nanomaterials, understanding their biological effects at the molecular level is crucial. In particular, the regulatory mechanisms responsible for the cascade of genes activated by nanomaterial exposure are not well-characterized. To this end, we profiled the genome-wide usage of gene transcription start sites and linked active enhancer regions in lungs of C57BL/6 mice 24 h after intratracheal instillation of a single dose of the multiwalled carbon nanotube (MWCNT) Mitsui-7. Our results revealed a massive gene regulatory response, where expression of key inflammatory genes (e.g., Csf3, Il24, and Fgf23) was increased >100-fold 24 h after Mitsui-7 exposure. Many of the Mitsui-7-responsive transcription start sites were alternative transcription start sites for known genes, and the number of alternative transcription start sites used in a given gene was correlated with overall Mitsui-7 response. Strikingly, genes that were up-regulated after Mitsui-7 exposure only through their main annotated transcription start site were linked to inflammatory and defense responses, while genes up-regulated only through alternative transcription start sites were functionally heterogeneous and not inflammation-associated. Furthermore, we identified almost 12 000 active enhancers, many of which were Mitsui-7-responsive, and we identified similarly responding putative target genes. Overall, our study provides the location and activity of Mitsui-7-induced enhancers and transcription start sites, providing a useful resource for targeted experiments elucidating the biological effects of nanomaterials and the identification of biomarkers for early detection of MWCNT-induced inflammation.

  12. Origins of immunity: transcription factors and homologues of effector genes of the vertebrate immune system expressed in sea urchin coelomocytes.

    PubMed

    Pancer, Z; Rast, J P; Davidson, E H

    1999-08-01

    Echinoderms share common ancestry with the chordates within the deuterostome clade. Molecular features that are shared between their immune systems and that of mammals thus illuminate the basal genetic framework on which these immune systems have been constructed during evolution. The immune effector cells of sea urchins are the coelomocytes, whose primary function is protection against invasive marine pathogens; here we identify six genes expressed in coelomocytes, homologues of which are also expressed in cells of the mammalian immune system. Three coelomocyte genes reported here encode transcription factors. These are an NFKB homologue (SpNFKB); a GATA-2/3 homologue (SpGATAc); and a runt domain factor (SpRunt-1). All three of these coelomocyte genes respond sharply to bacterial challenge: SpNFKB and SpRunt-1 genes are rapidly up-regulated, while transcripts of SpGATAc factor disappear within hours of injection of bacteria. Sham injection also activates SpNFKB and SpRunt, though with slower kinetics, but does not affect SpGATAc levels. Another gene, SpHS, encodes a protein related to the signal transduction intermediate HS1 of lymphoid cells. Two other newly discovered genes, SpSRCR1 and SpSRCR5, encode proteins featuring SRCR repeats. These genes are members of a complex family of SRCR genes all expressed specifically in coelomocytes. The SRCR repeats most closely resemble those of mammalian macrophage scavenger receptors. Remarkably, each individual sea urchin expresses a specific pattern of SRCR genes. Our results imply some shared immune functions and more generally, a shared regulatory architecture which underlies immune system gene expression in all deuterostomes. We conclude that the vertebrate immune system has evolved by inserting new genes into old gene regulatory networks dedicated to immunity.

  13. Pharmacological and Genetic Modulation of REV-ERB Activity and Expression Affects Orexigenic Gene Expression

    PubMed Central

    Amador, Ariadna; Wang, Yongjun; Banerjee, Subhashis; Kameneka, Theodore M.; Solt, Laura A.; Burris, Thomas P.

    2016-01-01

    The nuclear receptors REV-ERBα and REV-ERBβ are transcription factors that play pivotal roles in the regulation of the circadian rhythm and various metabolic processes. The circadian rhythm is an endogenous mechanism, which generates entrainable biological changes that follow a 24-hour period. It regulates a number of physiological processes, including sleep/wakeful cycles and feeding behaviors. We recently demonstrated that REV-ERB-specific small molecules affect sleep and anxiety. The orexinergic system also plays a significant role in mammalian physiology and behavior, including the regulation of sleep and food intake. Importantly, orexin genes are expressed in a circadian manner. Given these overlaps in function and circadian expression, we wanted to determine whether the REV-ERBs might regulate orexin. We found that acute in vivo modulation of REV-ERB activity, with the REV-ERB-specific synthetic ligand SR9009, affects the circadian expression of orexinergic genes in mice. Long term dosing with SR9009 also suppresses orexinergic gene expression in mice. Finally, REV-ERBβ-deficient mice present with increased orexinergic transcripts. These data suggest that the REV-ERBs may be involved in the repression of orexinergic gene expression. PMID:26963516

  14. Towards a Quantitative Understanding of Single-Gene Transcription

    NASA Astrophysics Data System (ADS)

    O'Maoiléidigh, Dáibhid

    2008-03-01

    The transcription of the genetic information in DNA into RNA is the first step in protein synthesis. This process is highly regulated and is carried out by RNA polymerase (RNAP), a complex molecular motor. Here we discuss some of the consequences of a Brownian ratchet model of transcription, which incorporates internal structural degrees of freedom of RNAP and kinetic barriers to backtracking of RNAP resulting from steric clashes with co-transcriptionally folded RNA. This approach was previously used (a) to successfully predict sequence dependent positions of pauses during the elongation process [1,2]; (b) to study the behavior of a number of mutants of RNAP, with different elongation behaviors, believed to involve different internal motions of the enzyme [3]; and (c) to gain insight into the interpretation of single-molecule transcription elongation experiments [2]. The same model can be used to characterize the stability of the elongation complex at specific termination sequences, places along DNA where, with high probability, RNAP releases the RNA transcript and disengages from the template. Recent experimental results on termination reinforce a picture of the elongation complex as a flexible structure, not a rigid body [4]. In more general terms, some of the modeling to be presented raises fundamental issues related to ``model comparison'' and ``model selection,'' the problem of identifying and characterizing quantitative models on the basis of limited sets of experimental data [5]. [1] Tadigotla V. R., 'O Maoil'eidigh D., Sengupta A. M., Epshtein V., Ebright R. H., Nudler E., Ruckenstein A. E., Thermodynamic and Kinetic Modeling of Transcriptional Pausing. Proc Natl Acad Sci U S A,03:4439-4444 (2006). [2] D. 'O Maoil'eidigh, Ph.D. Thesis, Rutgers University, 2006 [3] Bar-Nahum, G., Epshtein, V., Ruckenstein, A. E., Rafikov, R., Mustaev, A. and Nudler E., A Ratchet Mechanism of Transcription Elongation and its Control. Cell, 120:183-193 (2005). [4] Epshtein, V

  15. Eccentric exercise activates novel transcriptional regulation of hypertrophic signaling pathways not affected by hormone changes.

    PubMed

    MacNeil, Lauren G; Melov, Simon; Hubbard, Alan E; Baker, Steven K; Tarnopolsky, Mark A

    2010-05-18

    Unaccustomed eccentric exercise damages skeletal muscle tissue, activating mechanisms of recovery and remodeling that may be influenced by the female sex hormone 17beta-estradiol (E2). Using high density oligonucleotide based microarrays, we screened for differences in mRNA expression caused by E2 and eccentric exercise. After random assignment to 8 days of either placebo (CON) or E2 (EXP), eighteen men performed 150 single-leg eccentric contractions. Muscle biopsies were collected at baseline (BL), following supplementation (PS), +3 hours (3H) and +48 hours (48H) after exercise. Serum E2 concentrations increased significantly with supplementation (P<0.001) but did not affect microarray results. Exercise led to early transcriptional changes in striated muscle activator of Rho signaling (STARS), Rho family GTPase 3 (RND3), mitogen activated protein kinase (MAPK) regulation and the downstream transcription factor FOS. Targeted RT-PCR analysis identified concurrent induction of negative regulators of calcineurin signaling RCAN (P<0.001) and HMOX1 (P = 0.009). Protein contents were elevated for RND3 at 3H (P = 0.02) and FOS at 48H (P<0.05). These findings indicate that early RhoA and NFAT signaling and regulation are altered following exercise for muscle remodeling and repair, but are not affected by E2.

  16. The Agrobacterium tumefaciens virulence protein VirE3 is a transcriptional activator of the F-box gene VBF.

    PubMed

    Niu, Xiaolei; Zhou, Meiliang; Henkel, Christiaan V; van Heusden, G Paul H; Hooykaas, Paul J J

    2015-12-01

    During Agrobacterium tumefaciens-mediated transformation of plant cells a part of the tumour-inducing plasmid, T-DNA, is integrated into the host genome. In addition, a number of virulence proteins are translocated into the host cell. The virulence protein VirE3 binds to the Arabidopsis thaliana pBrp protein, a plant-specific general transcription factor of the TFIIB family. To study a possible role for VirE3 in transcriptional regulation, we stably expressed virE3 in A. thaliana under control of a tamoxifen-inducible promoter. By RNA sequencing we showed that upon expression of virE3 the RNA levels of 607 genes were increased more than three-fold and those of 132 genes decreased more than three-fold. One of the strongly activated genes was that encoding VBF (At1G56250), an F-box protein that may affect the levels of the VirE2 and VIP1 proteins. Using Arabidopsis cell suspension protoplasts we showed that VirE3 stimulates the VBF promoter, especially when co-expressed with pBrp. Although pBrp is localized at the external surface of plastids, co-expression of VirE3 and pBrp in Arabidopsis cell suspension protoplasts resulted in the accumulation of pBrp in the nucleus. Our results suggest that VirE3 affects the transcriptional machinery of the host cell to favour the transformation process.

  17. The WRKY transcription factor genes in eggplant (Solanum melongena L.) and Turkey Berry (Solanum torvum Sw.).

    PubMed

    Yang, Xu; Deng, Cao; Zhang, Yu; Cheng, Yufu; Huo, Qiuyue; Xue, Linbao

    2015-04-07

    WRKY transcription factors, which play critical roles in stress responses, have not been characterized in eggplant or its wild relative, turkey berry. The recent availability of RNA-sequencing data provides the opportunity to examine WRKY genes from a global perspective. We identified 50 and 62 WRKY genes in eggplant (SmelWRKYs) and turkey berry (StorWRKYs), respectively, all of which could be classified into three groups (I-III) based on the WRKY protein structure. The SmelWRKYs and StorWRKYs contain ~76% and ~95% of the number of WRKYs found in other sequenced asterid species, respectively. Positive selection analysis revealed that different selection constraints could have affected the evolution of these groups. Positively-selected sites were found in Groups IIc and III. Branch-specific selection pressure analysis indicated that most WRKY domains from SmelWRKYs and StorWRKYs are conserved and have evolved at low rates since their divergence. Comparison to homologous WRKY genes in Arabidopsis revealed several potential pathogen resistance-related SmelWRKYs and StorWRKYs, providing possible candidate genetic resources for improving stress tolerance in eggplant and probably other Solanaceae plants. To our knowledge, this is the first report of a genome-wide analyses of the SmelWRKYs and StorWRKYs.

  18. The WRKY Transcription Factor Genes in Eggplant (Solanum melongena L.) and Turkey Berry (Solanum torvum Sw.)

    PubMed Central

    Yang, Xu; Deng, Cao; Zhang, Yu; Cheng, Yufu; Huo, Qiuyue; Xue, Linbao

    2015-01-01

    WRKY transcription factors, which play critical roles in stress responses, have not been characterized in eggplant or its wild relative, turkey berry. The recent availability of RNA-sequencing data provides the opportunity to examine WRKY genes from a global perspective. We identified 50 and 62 WRKY genes in eggplant (SmelWRKYs) and turkey berry (StorWRKYs), respectively, all of which could be classified into three groups (I–III) based on the WRKY protein structure. The SmelWRKYs and StorWRKYs contain ~76% and ~95% of the number of WRKYs found in other sequenced asterid species, respectively. Positive selection analysis revealed that different selection constraints could have affected the evolution of these groups. Positively-selected sites were found in Groups IIc and III. Branch-specific selection pressure analysis indicated that most WRKY domains from SmelWRKYs and StorWRKYs are conserved and have evolved at low rates since their divergence. Comparison to homologous WRKY genes in Arabidopsis revealed several potential pathogen resistance-related SmelWRKYs and StorWRKYs, providing possible candidate genetic resources for improving stress tolerance in eggplant and probably other Solanaceae plants. To our knowledge, this is the first report of a genome-wide analyses of the SmelWRKYs and StorWRKYs. PMID:25853261

  19. The Role of Transcription Factors at Antisense-Expressing Gene Pairs in Yeast.

    PubMed

    Mostovoy, Yulia; Thiemicke, Alexander; Hsu, Tiffany Y; Brem, Rachel B

    2016-06-27

    Genes encoded close to one another on the chromosome are often coexpressed, by a mechanism and regulatory logic that remain poorly understood. We surveyed the yeast genome for tandem gene pairs oriented tail-to-head at which expression antisense to the upstream gene was conserved across species. The intergenic region at most such tandem pairs is a bidirectional promoter, shared by the downstream gene mRNA and the upstream antisense transcript. Genomic analyses of these intergenic loci revealed distinctive patterns of transcription factor regulation. Mutation of a given transcription factor verified its role as a regulator in trans of tandem gene pair loci, including the proximally initiating upstream antisense transcript and downstream mRNA and the distally initiating upstream mRNA. To investigate cis-regulatory activity at such a locus, we focused on the stress-induced NAD(P)H dehydratase YKL151C and its downstream neighbor, the metabolic enzyme GPM1 Previous work has implicated the region between these genes in regulation of GPM1 expression; our mutation experiments established its function in rich medium as a repressor in cis of the distally initiating YKL151C sense RNA, and an activator of the proximally initiating YKL151C antisense RNA. Wild-type expression of all three transcripts required the transcription factor Gcr2. Thus, at this locus, the intergenic region serves as a focal point of regulatory input, driving antisense expression and mediating the coordinated regulation of YKL151C and GPM1 Together, our findings implicate transcription factors in the joint control of neighboring genes specialized to opposing conditions and the antisense transcripts expressed between them.

  20. The Role of Transcription Factors at Antisense-Expressing Gene Pairs in Yeast

    PubMed Central

    Mostovoy, Yulia; Thiemicke, Alexander; Hsu, Tiffany Y.; Brem, Rachel B.

    2016-01-01

    Genes encoded close to one another on the chromosome are often coexpressed, by a mechanism and regulatory logic that remain poorly understood. We surveyed the yeast genome for tandem gene pairs oriented tail-to-head at which expression antisense to the upstream gene was conserved across species. The intergenic region at most such tandem pairs is a bidirectional promoter, shared by the downstream gene mRNA and the upstream antisense transcript. Genomic analyses of these intergenic loci revealed distinctive patterns of transcription factor regulation. Mutation of a given transcription factor verified its role as a regulator in trans of tandem gene pair loci, including the proximally initiating upstream antisense transcript and downstream mRNA and the distally initiating upstream mRNA. To investigate cis-regulatory activity at such a locus, we focused on the stress-induced NAD(P)H dehydratase YKL151C and its downstream neighbor, the metabolic enzyme GPM1. Previous work has implicated the region between these genes in regulation of GPM1 expression; our mutation experiments established its function in rich medium as a repressor in cis of the distally initiating YKL151C sense RNA, and an activator of the proximally initiating YKL151C antisense RNA. Wild-type expression of all three transcripts required the transcription factor Gcr2. Thus, at this locus, the intergenic region serves as a focal point of regulatory input, driving antisense expression and mediating the coordinated regulation of YKL151C and GPM1. Together, our findings implicate transcription factors in the joint control of neighboring genes specialized to opposing conditions and the antisense transcripts expressed between them. PMID:27190003

  1. Human cytomegalovirus decreases constitutive transcription of MHC class II genes in mature Langerhans cells by reducing CIITA transcript levels.

    PubMed

    Lee, Andrew W; Wang, Nan; Hornell, Tara M C; Harding, James J; Deshpande, Chetan; Hertel, Laura; Lacaille, Vashti; Pashine, Achal; Macaubas, Claudia; Mocarski, Edward S; Mellins, Elizabeth D

    2011-05-01

    Human cytomegalovirus (HCMV) productively infects CD34(+) progenitor-derived, mature Langerhans-type dendritic cells (matLC) and reduces surface expression of MHC class II complexes (MHC II) by increasing intracellular retention of these molecules. To determine whether HCMV also inhibits MHC II expression by other mechanisms, we assessed mRNA levels of the class II transcriptional regulator, CIITA, and several of its target genes in infected matLC. Levels of CIITA, HLA-DRA (DRA) and DRB transcripts, and new DR protein synthesis were compared in mock-infected and HCMV-infected cells by quantitative PCR and pulse-chase immunoprecipitation analyses, respectively. CIITA mRNA levels were significantly lower in HCMV-infected matLC as compared to mock-infected cells. When assessed in the presence of Actinomycin D, the stability of CIITA transcripts was not diminished by HCMV. Analysis of promoter-specific CIITA isoforms revealed that types I, III and IV all were decreased by HCMV, a result that differs from changes after incubation of these cells with lipopolysaccharide (LPS). Exposure to UV-inactivated virus failed to reduce CIITA mRNA levels, implicating de novo viral gene expression in this effect. HCMV-infected matLC also expressed lower levels of DR transcripts and reduced DR protein synthesis rates compared to mock-infected matLC. In summary, we demonstrate that HCMV infection of a human dendritic cell subset inhibits constitutive CIITA expression, most likely at the transcriptional level, resulting in reduced MHC II biosynthesis. We suggest this represents a new mechanism of modulation of mature LC by HCMV.

  2. The Drosophila Transcription Factor Dimmed Affects Neuronal Growth and Differentiation in Multiple Ways Depending on Neuron Type and Developmental Stage

    PubMed Central

    Liu, Yiting; Luo, Jiangnan; Nässel, Dick R.

    2016-01-01

    Growth of postmitotic neurons occurs during different stages of development, including metamorphosis, and may also be part of neuronal plasticity and regeneration. Recently we showed that growth of post-mitotic neuroendocrine cells expressing the basic helix loop helix (bHLH) transcription factor Dimmed (Dimm) in Drosophila could be regulated by insulin/IGF signaling and the insulin receptor (dInR). Dimm is also known to confer a secretory phenotype to neuroendocrine cells and can be part of a combinatorial code specifying terminal differentiation in peptidergic neurons. To further understand the mechanisms of Dimm function we ectopically expressed Dimm or Dimm together with dInR in a wide range of Dimm positive and Dimm negative peptidergic neurons, sensory neurons, interneurons, motor neurons, and gut endocrine cells. We provide further evidence that dInR mediated cell growth occurs in a Dimm dependent manner and that one source of insulin-like peptide (DILP) for dInR mediated cell growth in the CNS is DILP6 from glial cells. Expressing both Dimm and dInR in Dimm negative neurons induced growth of cell bodies, whereas dInR alone did not. We also found that Dimm alone can regulate cell growth depending on specific cell type. This may be explained by the finding that the dInR is a direct target of Dimm. Conditional gene targeting experiments showed that Dimm alone could affect cell growth in certain neuron types during metamorphosis or in the adult stage. Another important finding was that ectopic Dimm inhibits apoptosis of several types of neurons normally destined for programmed cell death (PCD). Taken together our results suggest that Dimm plays multiple transcriptional roles at different developmental stages in a cell type-specific manner. In some cell types ectopic Dimm may act together with resident combinatorial code transcription factors and affect terminal differentiation, as well as act in transcriptional networks that participate in long term maintenance

  3. FoxO1 deacetylation regulates thyroid hormone-induced transcription of key hepatic gluconeogenic genes.

    PubMed

    Singh, Brijesh Kumar; Sinha, Rohit Anthony; Zhou, Jin; Xie, Sherwin Ying; You, Seo-Hee; Gauthier, Karine; Yen, Paul Michael

    2013-10-18

    Hepatic gluconeogenesis is a concerted process that integrates transcriptional regulation with hormonal signals. A major regulator is thyroid hormone (TH), which acts through its nuclear receptor (TR) to induce the expression of the hepatic gluconeogenic genes, phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC). Forkhead transcription factor FoxO1 also is an important regulator of these genes; however, its functional interactions with TR are not known. Here, we report that TR-mediated transcriptional activation of PCK1 and G6PC in human hepatic cells and mouse liver was FoxO1-dependent and furthermore required FoxO1 deacetylation by the NAD(+)-dependent deacetylase, SirT1. siRNA knockdown of FoxO1 decreased, whereas overexpression of FoxO1 increased, TH-dependent transcriptional activation of PCK1 and G6PC in cultured hepatic cells. FoxO1 siRNA knockdown also decreased TH-mediated transcription in vivo. Additionally, TH was unable to induce FoxO1 deacetylation or hepatic PCK1 gene expression in TH receptor β-null (TRβ(-/-)) mice. Moreover, TH stimulated FoxO1 recruitment to the PCK1 and G6PC gene promoters in a SirT1-dependent manner. In summary, our results show that TH-dependent deacetylation of a second metabolically regulated transcription factor represents a novel mechanism for transcriptional integration of nuclear hormone action with cellular energy status.

  4. Histone ADP-Ribosylation Facilitates Gene Transcription by Directly Remodeling Nucleosomes

    PubMed Central

    Martinez-Zamudio, Ricardo

    2012-01-01

    The packaging of DNA into nucleosomes imposes obstacles on gene transcription, and histone-modifying and nucleosome-remodeling complexes work in concert to alleviate these obstacles so as to facilitate transcription. Emerging evidence shows that chromatin-associated poly(ADP-ribose) polymerase 1 (PARP-1) and its enzymatic activity facilitate inflammatory gene transcription and modulate the inflammatory response in animal models. However, the molecular mechanisms by which PARP-1 enzymatic activity facilitates transcription are not well understood. Here we show that through an intracellular signaling pathway, lipopolysaccharide (LPS) stimulation induces PARP-1 enzymatic activity and the ADP-ribosylation of histones at transcriptionally active and accessible chromatin regions in macrophages. In vitro DNase I footprinting and restriction endonuclease accessibility assays reveal that histone ADP-ribosylation directly destabilizes histone-DNA interactions in the nucleosome and increases the site accessibility of the nucleosomal DNA to nucleases. Consistent with this, LPS stimulation-induced ADP-ribosylation at the nucleosome-occupied promoters of il-1β, mip-2, and csf2 facilitates NF-κB recruitment and the transcription of these genes in macrophages. Therefore, our data suggest that PARP-1 enzymatic activity facilitates gene transcription through increasing promoter accessibility by histone ADP-ribosylation. PMID:22547677

  5. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    SciTech Connect

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

    2006-05-25

    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  6. Transcription Profile of Aging and Cognition-Related Genes in the Medial Prefrontal Cortex

    PubMed Central

    Ianov, Lara; Rani, Asha; Beas, Blanca S.; Kumar, Ashok; Foster, Thomas C.

    2016-01-01

    Cognitive function depends on transcription; however, there is little information linking altered gene expression to impaired prefrontal cortex function during aging. Young and aged F344 rats were characterized on attentional set shift and spatial memory tasks. Transcriptional differences associated with age and cognition were examined using RNA sequencing to construct transcriptomic profiles for the medial prefrontal cortex (mPFC), white matter, and region CA1 of the hippocampus. The results indicate regional differences in vulnerability to aging. Age-related gene expression in the mPFC was similar to, though less robust than, changes in the dorsolateral PFC of aging humans suggesting that aging processes may be similar. Importantly, the pattern of transcription associated with aging did not predict cognitive decline. Rather, increased mPFC expression of genes involved in regulation of transcription, including transcription factors that regulate the strength of excitatory and inhibitory inputs, and neural activity-related immediate-early genes was observed in aged animals that exhibit delayed set shift behavior. The specificity of impairment on a mPFC-dependent task, associated with a particular mPFC transcriptional profile indicates that impaired executive function involves altered transcriptional regulation and neural activity/plasticity processes that are distinct from that described for impaired hippocampal function. PMID:27242522

  7. Antisense suppression of donor splice site mutations in the dystrophin gene transcript

    PubMed Central

    Fletcher, Sue; Meloni, Penny L; Johnsen, Russell D; Wong, Brenda L; Muntoni, Francesco; Wilton, Stephen D

    2013-01-01

    We describe two donor splice site mutations, affecting dystrophin exons 16 and 45 that led to Duchenne muscular dystrophy (DMD), through catastrophic inactivation of the mRNA. These gene lesions unexpectedly resulted in the retention of the downstream introns, thereby increasing the length of the dystrophin mRNA by 20.2 and 36 kb, respectively. Splice-switching antisense oligomers targeted to exon 16 excised this in-frame exon and the following intron from the patient dystrophin transcript very efficiently in vitro, thereby restoring the reading frame and allowing synthesis of near-normal levels of a putatively functional dystrophin isoform. In contrast, targeting splice-switching oligomers to exon 45 in patient cells promoted only modest levels of an out-of-frame dystrophin transcript after transfection at high oligomer concentrations, whereas dual targeting of exons 44 and 45 or 45 and 46 resulted in more efficient exon skipping, with concomitant removal of intron 45. The splice site mutations reported here appear highly amenable to antisense oligomer intervention. We suggest that other splice site mutations may need to be evaluated for oligomer interventions on a case-by-case basis. PMID:24498612

  8. 3' Untranslated regions mediate transcriptional interference between convergent genes both locally and ectopically in Saccharomyces cerevisiae.

    PubMed

    Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J; Hu, Xiaohua; Luo, Zewei

    2014-01-01

    Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3'-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3'-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision

  9. Nucleotide sequence and transcriptional analysis of the type A2 neurotoxin gene cluster in Clostridium botulinum.

    PubMed

    Dineen, Sean S; Bradshaw, Marite; Karasek, Charles E; Johnson, Eric A

    2004-06-01

    The nucleotide sequences of the upstream regions of the botulinum neurotoxin type A1 (BoNT/A1) cluster of Clostridium botulinum strain NCTC 2916 and the BoNT/A2 cluster of strain Kyoto-F were determined. A novel gene, designated orfx3, was identified following the orfx2 gene in both clusters. ORF-X2 and ORF-X3 exhibit similarity to the BoNT cluster associated P-47 protein. The BoNT/A1 and BoNT/A2 clusters share a similar gene arrangement, but exhibit differences in the spacing between certain genes. Sequences with similarity to transposases were identified in these intergenic regions, suggesting that these differences arose from an ancestral insertion event. Transcriptional analysis of the BoNT/A2 cluster revealed that the genes of the cluster are primarily synthesized as three polycistronic transcripts. Two divergent polycistronic transcripts, one encoding the orfx1, orfx2, and orfx3 genes, the second encoding the p47, ntnh, and bont/a2 genes, are transcribed from conserved BoNT cluster promoters. The third polycistronic transcript, expressed at low levels, encodes the positive regulatory botR gene and the orfx genes. This is the first complete analysis of a botulinum toxin A2 cluster.

  10. Gene loops function to maintain transcriptional memory through interaction with the nuclear pore complex

    PubMed Central

    Tan-Wong, Sue Mei; Wijayatilake, Hashanthi D.; Proudfoot, Nick J.

    2009-01-01

    Inducible genes in yeast retain a “memory” of recent transcriptional activity during periods of short-term repression, allowing them to be reactivated faster when reinduced. This confers a rapid and versatile gene expression response to the environment. We demonstrate that this memory mechanism is associated with gene loop interactions between the promoter and 3′ end of the responsive genes HXK1 and GAL1∷FMP27. The maintenance of these memory gene loops (MGLs) during intervening periods of transcriptional repression is required for faster RNA polymerase II (Pol II) recruitment to the genes upon reinduction, thereby facilitating faster mRNA accumulation. Notably, a sua7-1 mutant or the endogenous INO1 gene that lacks this MGL does not display such faster reinduction. Furthermore, these MGLs interact with the nuclear pore complex through association with myosin-like protein 1 (Mlp1). An mlp1Δ strain does not maintain MGLs, and concomitantly loses transcriptional memory. We predict that gene loop conformations enhance gene expression by facilitating rapid transcriptional response to changing environmental conditions. PMID:19933151

  11. FAK and HAS Inhibition Synergistically Decrease Colon Cancer Cell Viability and Affect Expression of Critical Genes

    PubMed Central

    Heffler, Melissa; Golubovskaya, Vita; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William; Dunn, Kelli B.

    2013-01-01

    Focal adhesion kinase (FAK), hyaluronan (HA), and hyaluronan synthase-3 (HAS3) have been implicated in cancer growth and progression. FAK inhibition with the small molecule inhibitor Y15 decreases colon cancer cell growth in vitro and in vivo. HAS3 inhibition in colon cancer cells decreases FAK expression and activation, and exogenous HA increases FAK activation. We sought to determine the genes affected by HAS and FAK inhibition and hypothesized that dual inhibition would synergistically inhibit viability. Y15 (FAK inhibitor) and the HAS inhibitor 4-methylumbelliferone (4-MU) decreased viability in a dose dependent manner; viability was further inhibited by treatment with Y15 and 4-MU in colon cancer cells. HAS inhibited cells treated with 2μM of Y15 showed significantly decreased viability compared to HAS scrambled cells treated with the same dose (p<0.05) demonstrating synergistic inhibition of viability with dual FAK/HAS inhibition. Microarray analysis showed more than 2-fold up- or down-regulation of 121 genes by HAS inhibition, and 696 genes by FAK inhibition (p<0.05) and revealed 29 common genes affected by both signaling. Among the genes affected by FAK or HAS3 inhibition were genes, playing role in apoptosis, cell cycle regulation, adhesion, transcription, heat-shock and WNT pathways. Thus, FAK or HAS inhibition decreases SW620 viability and affects several similar genes, which are involved in the regulation of tumor survival. Dual inhibition of FAK and HAS3 decreases viability to a greater degree than with either agent alone, and suggests that synergistic inhibition of colon cancer cell growth can result from affecting similar genetic pathways. PMID:22934709

  12. FAK and HAS inhibition synergistically decrease colon cancer cell viability and affect expression of critical genes.

    PubMed

    Heffler, Melissa; Golubovskaya, Vita M; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G; Dunn, Kelli B

    2013-05-01

    Focal adhesion kinase (FAK), hyaluronan (HA), and hyaluronan synthase-3 (HAS3) have been implicated in cancer growth and progression. FAK inhibition with the small molecule inhibitor Y15 decreases colon cancer cell growth in vitro and in vivo. HAS3 inhibition in colon cancer cells decreases FAK expression and activation, and exogenous HA increases FAK activation. We sought to determine the genes affected by HAS and FAK inhibition and hypothesized that dual inhibition would synergistically inhibit viability. Y15 (FAK inhibitor) and the HAS inhibitor 4-methylumbelliferone (4-MU) decreased viability in a dose dependent manner; viability was further inhibited by treatment with Y15 and 4-MU in colon cancer cells. HAS inhibited cells treated with 2 μM of Y15 showed significantly decreased viability compared to HAS scrambled cells treated with the same dose (p < 0.05) demonstrating synergistic inhibition of viability with dual FAK/HAS inhibition. Microarray analysis showed more than 2-fold up- or down-regulation of 121 genes by HAS inhibition, and 696 genes by FAK inhibition (p < 0.05) and revealed 29 common genes affected by both signaling. Among the genes affected by FAK or HAS3 inhibition were genes, playing role in apoptosis, cell cycle regulation, adhesion, transcription, heatshock and WNT pathways. Thus, FAK or HAS inhibition decreases SW620 viability and affects several similar genes, which are involved in the regulation of tumor survival. Dual inhibition of FAK and HAS3 decreases viability to a greater degree than with either agent alone, and suggests that synergistic inhibition of colon cancer cell growth can result from affecting similar genetic pathways.

  13. Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

    PubMed Central

    Ronander, Elena; Bengtsson, Dominique C.; Joergensen, Louise; Jensen, Anja T. R.; Arnot, David E.

    2012-01-01

    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1. Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types. PMID:23070076

  14. Analysis of single-cell gene transcription by RNA fluorescent in situ hybridization (FISH).

    PubMed

    Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise; Jensen, Anja T R; Arnot, David E

    2012-10-07

    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System(2) (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

  15. Human glycolipid transfer protein (GLTP) genes: organization, transcriptional status and evolution

    PubMed Central

    Zou, Xianqiong; Chung, Taeowan; Lin, Xin; Malakhova, Margarita L; Pike, Helen M; Brown, Rhoderick E

    2008-01-01

    Background Glycolipid transfer protein is the prototypical and founding member of the new GLTP superfamily distinguished by a novel conformational fold and glycolipid binding motif. The present investigation provides the first insights into the organization, transcriptional status, phylogenetic/evolutionary relationships of GLTP genes. Results In human cells, single-copy GLTP genes were found in chromosomes 11 and 12. The gene at locus 11p15.1 exhibited several features of a potentially active retrogene, including a highly homologous (~94%), full-length coding sequence containing all key amino acid residues involved in glycolipid liganding. To establish the transcriptional activity of each human GLTP gene, in silico EST evaluations, RT-PCR amplifications of GLTP transcript(s), and methylation analyses of regulator CpG islands were performed using various human cells. Active transcription was found for 12q24.11 GLTP but 11p15.1 GLTP was transcriptionally silent. Heterologous expression and purification of the GLTP paralogs showed glycolipid intermembrane transfer activity only for 12q24.11 GLTP. Phylogenetic/evolutionary analyses indicated that the 5-exon/4-intron organizational pattern and encoded sequence of 12q24.11 GLTP were highly conserved in therian mammals and other vertebrates. Orthologs of the intronless GLTP gene were observed in primates but not in rodentiates, carnivorates, cetartiodactylates, or didelphimorphiates, consistent with recent evolutionary development. Conclusion The results identify and characterize the gene responsible for GLTP expression in humans and provide the first evidence for the existence of a GLTP pseudogene, while demonstrating the rigorous approach needed to unequivocally distinguish transcriptionally-active retrogenes from silent pseudogenes. The results also rectify errors in the Ensembl database regarding the organizational structure of the actively transcribed GLTP gene in Pan troglodytes and establish the intronless GLTP as

  16. Transcript RNA supports precise repair of its own DNA gene.

    PubMed

    Keskin, Havva; Meers, Chance; Storici, Francesca

    2016-01-01

    The transfer of genetic information from RNA to DNA is considered an extraordinary process in molecular biology. Despite the fact that cells transcribe abundant amount of RNA with a wide range of functions, it has been difficult to uncover whether RNA can serve as a template for DNA repair and recombination. An increasing number of experimental evidences suggest a direct role of RNA in DNA modification. Recently, we demonstrated that endogenous transcript RNA can serve as a template to repair a DNA double-strand break (DSB), the most harmful DNA lesion, not only indirectly via formation of a DNA copy (cDNA) intermediate, but also directly in a homology driven mechanism in budding yeast. These results point out that the transfer of genetic information from RNA to DNA is more general than previously thought. We found that transcript RNA is more efficient in repairing a DSB in its own DNA (in cis) than in a homologous but ectopic locus (in trans). Here, we summarize current knowledge about the process of RNA-driven DNA repair and recombination, and provide further data in support of our model of DSB repair by transcript RNA in cis. We show that a DSB is precisely repaired predominately by transcript RNA and not by residual cDNA in conditions in which formation of cDNA by reverse transcription is inhibited. Additionally, we demonstrate that defects in ribonuclease (RNase) H stimulate precise DSB repair by homologous RNA or cDNA sequence, and not by homologous DNA sequence carried on a plasmid. These results highlight an antagonistic role of RNase H in RNA-DNA recombination. Ultimately, we discuss several questions that should be addressed to better understand mechanisms and implications of RNA-templated DNA repair and recombination.

  17. Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

    PubMed

    Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

    2006-07-01

    Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

  18. Gene length may contribute to graded transcriptional responses in the Drosophila embryo

    PubMed Central

    McHale, Peter; Mizutani, Claudia M.; Kosman, David; MacKay, Danielle L.; Belu, Mirela; Hermann, Anita; McGinnis, William; Bier, Ethan; Hwa, Terence

    2011-01-01

    An important question in developmental biology is how relatively shallow gradients of morphogens can reliably establish a series of distinct transcriptional readouts. Current models emphasize interactions between transcription factors binding in distinct modes to cis-acting sequences of target genes. Another recent idea is that the cis-acting interactions may amplify preexisting biases or prepatterns to establish robust transcriptional responses. In this study, we examine the possible contribution of one such source of prepattern, namely gene length. We developed quantitative imaging tools to measure gene expression levels for several loci at a time on a single-cell basis and applied these quantitative imaging tools to dissect the establishment of a gene expression border separating the mesoderm and neuroectoderm in the early Drosophila embryo. We first characterized the formation of a transient ventral-to-dorsal gradient of the Snail (Sna) repressor and then examined the relationship between this gradient and repression of neural target genes in the mesoderm. We found that neural genes are repressed in a nested pattern within a zone of the mesoderm abutting the neuroectoderm, where Sna levels are graded. While several factors may contribute to the transient graded response to the Sna gradient, our analysis suggests that gene length may play an important, albeit transient, role in establishing these distinct transcriptional responses. One prediction of the gene-length-dependent transcriptional patterning model is that the co-regulated genes knirps (a short gene) and knirps-related (a long gene) should be transiently expressed in domains of differing widths, which we confirmed experimentally. These findings suggest that gene length may contribute to establishing graded responses to morphogen gradients by providing transient prepatterns that are subsequently amplified and stabilized by traditional cis-regulatory interactions. PMID:21920356

  19. Alternative splicing and differential expression of two transcripts of nicotine adenine dinucleotide phosphate oxidase B gene from Zea mays.

    PubMed

    Lin, Fan; Zhang, Yun; Jiang, Ming-Yi

    2009-03-01

    With the exception of rice, little is known about the existence of respiratory burst oxidase homolog (rboh) gene in cereals. The present study reports the cloning and analysis of a novel rboh gene, termed ZmrbohB, from maize (Zea mays L.). The full-length cDNA of ZmrbohB encodes a 942 amino acid protein containing all of the respiratory burst oxidase homolog catalytically critical motifs. Alternative splicing of ZmrbohB has generated two transcript isoforms, ZmrbohB-alpha and -beta. Spliced transcript ZmrbohB-beta retains an unspliced intron 11 that carries a premature termination codon and probably leads to nonsense-mediated mRNA decay. Expression analysis showed that two splice isoforms were differentially expressed in various tissues and at different developmental stages, and the major product was ZmrbohB-alpha. The transcripts of ZmrbohB-alpha accumulated markedly when the maize seedlings were subjected to various abiotic stimuli, such as wounding, cold (4 degrees C), heat (40 degrees C), UV and salinity stress. In addition, several abiotic stimuli also affected the alternative splicing pattern of ZmrbohB except wounding. These results provide new insight into roles in the expression regulation of plant rboh genes and suggest that ZmrbohB gene may play a role in response to environmental stresses.

  20. Cytogenetic and molecular localization of tipE: A gene affecting sodium channels in Drosophila melanogaster

    SciTech Connect

    Feng, G.; Deak, P.; Hall, L.M.

    1995-04-01

    Voltage-sensitive sodium channels play a key role in nerve cells where they are responsible for the increase in sodium permeability during the rising phase of action potentials. In Drosophila melanogaster a subset of temperature-sensitive paralytic mutations affect sodium channel function. One such mutation is temperature-induced paralysis locus E (tipE), which has been shown by electrophysiology and ligand binding studies to reduce sodium channel numbers. Three new {gamma}-ray-induced tipE alleles associated with either visible deletions in 64AB or a translocation breakpoint within 64B2 provide landmarks for positional cloning of tipE. Beginning with the flanking cloned gene Ras2, a 140-kb walk across the translocation breakpoint was completed. Germline transformation using a 42-kb cosmid clone and successively smaller subclones localized the tipE gene within a 7.4-kb genomic DNA segment. Although this chromosome region is rich in transcripts, only three overlapping mRNAs (5.4, 4.4, and 1.7 kb) lie completely within the smallest rescuing construct. The small sizes of the rescuing construct and transcripts suggests that tipE does not encode a standard sodium channel {alpha}-subunit with four homologous repeats. Sequencing these transcripts will elucidate the role of the tipE gene product in sodium channel functional regulation. 55 refs., 4 figs., 2 tabs.

  1. Cytogenetic and molecular localization of tipE: a gene affecting sodium channels in Drosophila melanogaster.

    PubMed

    Feng, G; Deák, P; Kasbekar, D P; Gil, D W; Hall, L M

    1995-04-01

    Voltage-sensitive sodium channels play a key role in nerve cells where they are responsible for the increase in sodium permeability during the rising phase of action potentials. In Drosophila melanogaster a subset of temperature-sensitive paralytic mutations affect sodium channel function. One such mutation is temperature-induced paralysis locus E (tipE), which has been shown by electrophysiology and ligand binding studies to reduce sodium channel numbers. Three new gamma-ray-induced tipE alleles associated with either visible deletions in 64AB or a translocation breakpoint within 64B2 provide landmarks for positional cloning of tipE. Beginning with the flanking cloned gene Ras2, a 140-kb walk across the translocation breakpoint was completed. Germline transformation using a 42-kb cosmid clone and successively smaller subclones localized the tipE gene within a 7.4-kb genomic DNA segment. Although this chromosome region is rich in transcripts, only three overlapping mRNAs (5.4, 4.4, and 1.7 kb) lie completely within the smallest rescuing construct. The small sizes of the rescuing construct and transcripts suggest that tipE does not encode a standard sodium channel alpha-subunit with four homologous repeats. Sequencing these transcripts will elucidate the role of the tipE gene product in sodium channel functional regulation.

  2. Biomarkers and transcription levels of cancer-related genes in cockles Cerastoderma edule from Galicia (NW Spain) with disseminated neoplasia.

    PubMed

    Ruiz, Pamela; Díaz, Seila; Orbea, Amaia; Carballal, Maria J; Villalba, Antonio; Cajaraville, Miren P

    2013-07-15

    Disseminated neoplasia (DN) is a pathological condition reported for several species of marine bivalves throughout the world, but its aetiology has not yet been satisfactorily explained. It has been suggested that chemical contamination could be a factor contributing to neoplasia. The aim of the present study was to compare cell and tissue biomarkers and the transcription level of cancer-related genes in cockles (Cerastoderma edule) affected by DN with those of healthy cockles in relation to chemical