Science.gov

Sample records for affect gene transcription

  1. Amino Acid Supplementation Affects Imprinted Gene Transcription Patterns in Parthenogenetic Porcine Blastocysts

    PubMed Central

    Park, Chi-Hun; Jeong, Young-Hee; Jeong, Yeun-Ik; Kwon, Jeong-Woo; Shin, Taeyoung; Hyun, Sang-Hwan; Jeung, Eui-Bae; Kim, Nam-Hyung; Seo, Sang-Kyo; Lee, Chang-Kyu; Hwang, Woo-Suk

    2014-01-01

    To determine whether exogenous amino acids affect gene transcription patterns in parthenogenetic porcine embryos, we investigated the effects of amino acid mixtures in culture medium. Parthenogenetic embryos were cultured in PZM3 medium under four experimental conditions: 1) control (no amino acids except L-glutamine and taurine); 2) nonessential amino acids (NEAA); 3) essential amino acids (EAA); and 4) NEAA and EAA. The rate of development of embryos to the four-cell stage was not affected by treatment. However, fewer (P<0.05) embryos cultured with EAA (12.8%) reached the blastocyst stage as compared with the control group (25.6%) and NEAA group (30.3%). Based on these findings, we identified genes with altered expression in parthenogenetic embryos exposed to medium with or without EAAs. The results indicated that EAA influenced gene expression patterns, particularly those of imprinted genes (e.g., H19, IGF2R, PEG1, XIST). However, NEAAs did not affect impaired imprinted gene expressions induced by EAA. The results also showed that mechanistic target of rapamycin (MTOR) mRNA expression was significantly increased by EAA alone as compared with control cultures, and that the combined treatment with NEAA and EAA did not differ significantly from those of control cultures. Our results revealed that gene transcription levels in porcine embryos changed differentially depending on the presence of EAA or NEAA. However, the changes in the H19 mRNA observed in the parthenogenetic blastocysts expression level was not related to the DNA methylation status in the IGF2/H19 domain. The addition of exogenous amino acid mixtures affected not only early embryonic development, but also gene transcription levels, particularly those of imprinted genes. However, this study did not reveal how amino acids affect expression of imprinted genes under the culture conditions used. Further studies are thus required to fully evaluate how amino acids affect transcriptional regulation in porcine

  2. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway. PMID:24389954

  3. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    SciTech Connect

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-04-23

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic {beta}-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  4. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs.

  5. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  6. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    PubMed

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer.

  7. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene

    PubMed Central

    Zhou, Jiawei

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  8. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene.

    PubMed

    Li, Yan; Wang, Lei; Zhou, Jiawei; Li, Fenge

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (-418 bp to -3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  9. Genome duplication and gene loss affect the evolution of heat shock transcription factor genes in legumes.

    PubMed

    Lin, Yongxiang; Cheng, Ying; Jin, Jing; Jin, Xiaolei; Jiang, Haiyang; Yan, Hanwei; Cheng, Beijiu

    2014-01-01

    Whole-genome duplication events (polyploidy events) and gene loss events have played important roles in the evolution of legumes. Here we show that the vast majority of Hsf gene duplications resulted from whole genome duplication events rather than tandem duplication, and significant differences in gene retention exist between species. By searching for intraspecies gene colinearity (microsynteny) and dating the age distributions of duplicated genes, we found that genome duplications accounted for 42 of 46 Hsf-containing segments in Glycine max, while paired segments were rarely identified in Lotus japonicas, Medicago truncatula and Cajanus cajan. However, by comparing interspecies microsynteny, we determined that the great majority of Hsf-containing segments in Lotus japonicas, Medicago truncatula and Cajanus cajan show extensive conservation with the duplicated regions of Glycine max. These segments formed 17 groups of orthologous segments. These results suggest that these regions shared ancient genome duplication with Hsf genes in Glycine max, but more than half of the copies of these genes were lost. On the other hand, the Glycine max Hsf gene family retained approximately 75% and 84% of duplicated genes produced from the ancient genome duplication and recent Glycine-specific genome duplication, respectively. Continuous purifying selection has played a key role in the maintenance of Hsf genes in Glycine max. Expression analysis of the Hsf genes in Lotus japonicus revealed their putative involvement in multiple tissue-/developmental stages and responses to various abiotic stimuli. This study traces the evolution of Hsf genes in legume species and demonstrates that the rates of gene gain and loss are far from equilibrium in different species. PMID:25047803

  10. Genome duplication and gene loss affect the evolution of heat shock transcription factor genes in legumes.

    PubMed

    Lin, Yongxiang; Cheng, Ying; Jin, Jing; Jin, Xiaolei; Jiang, Haiyang; Yan, Hanwei; Cheng, Beijiu

    2014-01-01

    Whole-genome duplication events (polyploidy events) and gene loss events have played important roles in the evolution of legumes. Here we show that the vast majority of Hsf gene duplications resulted from whole genome duplication events rather than tandem duplication, and significant differences in gene retention exist between species. By searching for intraspecies gene colinearity (microsynteny) and dating the age distributions of duplicated genes, we found that genome duplications accounted for 42 of 46 Hsf-containing segments in Glycine max, while paired segments were rarely identified in Lotus japonicas, Medicago truncatula and Cajanus cajan. However, by comparing interspecies microsynteny, we determined that the great majority of Hsf-containing segments in Lotus japonicas, Medicago truncatula and Cajanus cajan show extensive conservation with the duplicated regions of Glycine max. These segments formed 17 groups of orthologous segments. These results suggest that these regions shared ancient genome duplication with Hsf genes in Glycine max, but more than half of the copies of these genes were lost. On the other hand, the Glycine max Hsf gene family retained approximately 75% and 84% of duplicated genes produced from the ancient genome duplication and recent Glycine-specific genome duplication, respectively. Continuous purifying selection has played a key role in the maintenance of Hsf genes in Glycine max. Expression analysis of the Hsf genes in Lotus japonicus revealed their putative involvement in multiple tissue-/developmental stages and responses to various abiotic stimuli. This study traces the evolution of Hsf genes in legume species and demonstrates that the rates of gene gain and loss are far from equilibrium in different species.

  11. Low-temperature affected LC-PUFA conversion and associated gene transcript level in Nannochloropsis oculata CS-179

    NASA Astrophysics Data System (ADS)

    Ma, Xiaolei; Zhang, Lin; Zhu, Baohua; Pan, Kehou; Li, Si; Yang, Guanpin

    2011-09-01

    Nannochloropsis oculata CS-179, a marine eukaryotic unicellular microalga, is rich in long-chain polyunsaturated fatty acids (LC-PUFAs). Culture temperature affected cell growth and the composition of LC-PUFAs. At an initial cell density of 1.5 × 106 cell mL-1, the highest growth was observed at 25°C and the cell density reached 3 × 107 cell mL-1 at the beginning of logarithmic phase. The content of LC-PUFAs varied with culture temperature. The highest content of LC-PUFAs (43.96%) and EPA (36.6%) was gained at 20°C. Real-time PCR showed that the abundance of Δ6-desaturase gene transcripts was significantly different among 5 culture temperatures and the highest transcript level (15°C) of Nanoc-D6D took off at cycle 21.45. The gene transcript of C20-elongase gene was higher at lower temperatures (10, 15, and 20°C), and the highest transcript level (20°C) of Nanoc-E took off at cycle 21.18. The highest conversion rate (39.3%) of Δ6-desaturase was also gained at 20°C. But the conversion rate of Nanoc-E was not detected. The higher content of LC-PUFAs was a result of higher gene transcript level and higher enzyme activity. Compared with C20-elongase gene, Δ6-desaturase gene transcript and enzyme activity varied significantly with temperature. It will be useful to study the mechanism of how the content of LC-PUFAs is affected by temperature.

  12. Sphingolipids regulate telomere clustering by affecting the transcription of genes involved in telomere homeostasis.

    PubMed

    Ikeda, Atsuko; Muneoka, Tetsuya; Murakami, Suguru; Hirota, Ayaka; Yabuki, Yukari; Karashima, Takefumi; Nakazono, Kota; Tsuruno, Masahiro; Pichler, Harald; Shirahige, Katsuhiko; Kodama, Yukiko; Shimamoto, Toshi; Mizuta, Keiko; Funato, Kouichi

    2015-07-15

    In eukaryotic organisms, including mammals, nematodes and yeasts, the ends of chromosomes, telomeres are clustered at the nuclear periphery. Telomere clustering is assumed to be functionally important because proper organization of chromosomes is necessary for proper genome function and stability. However, the mechanisms and physiological roles of telomere clustering remain poorly understood. In this study, we demonstrate a role for sphingolipids in telomere clustering in the budding yeast Saccharomyces cerevisiae. Because abnormal sphingolipid metabolism causes downregulation of expression levels of genes involved in telomere organization, sphingolipids appear to control telomere clustering at the transcriptional level. In addition, the data presented here provide evidence that telomere clustering is required to protect chromosome ends from DNA-damage checkpoint signaling. As sphingolipids are found in all eukaryotes, we speculate that sphingolipid-based regulation of telomere clustering and the protective role of telomere clusters in maintaining genome stability might be conserved in eukaryotes.

  13. Copy number variants in patients with intellectual disability affect the regulation of ARX transcription factor gene.

    PubMed

    Ishibashi, Minaka; Manning, Elizabeth; Shoubridge, Cheryl; Krecsmarik, Monika; Hawkins, Thomas A; Giacomotto, Jean; Zhao, Ting; Mueller, Thomas; Bader, Patricia I; Cheung, Sau W; Stankiewicz, Pawel; Bain, Nicole L; Hackett, Anna; Reddy, Chilamakuri C S; Mechaly, Alejandro S; Peers, Bernard; Wilson, Stephen W; Lenhard, Boris; Bally-Cuif, Laure; Gecz, Jozef; Becker, Thomas S; Rinkwitz, Silke

    2015-11-01

    Protein-coding mutations in the transcription factor-encoding gene ARX cause various forms of intellectual disability (ID) and epilepsy. In contrast, variations in surrounding non-coding sequences are correlated with milder forms of non-syndromic ID and autism and had suggested the importance of ARX gene regulation in the etiology of these disorders. We compile data on several novel and some already identified patients with or without ID that carry duplications of ARX genomic region and consider likely genetic mechanisms underlying the neurodevelopmental defects. We establish the long-range regulatory domain of ARX and identify its brain region-specific autoregulation. We conclude that neurodevelopmental disturbances in the patients may not simply arise from increased dosage due to ARX duplication. This is further exemplified by a small duplication involving a non-functional ARX copy, but with duplicated enhancers. ARX enhancers are located within a 504-kb region and regulate expression specifically in the forebrain in developing and adult zebrafish. Transgenic enhancer-reporter lines were used as in vivo tools to delineate a brain region-specific negative and positive autoregulation of ARX. We find autorepression of ARX in the telencephalon and autoactivation in the ventral thalamus. Fluorescently labeled brain regions in the transgenic lines facilitated the identification of neuronal outgrowth and pathfinding disturbances in the ventral thalamus and telencephalon that occur when arxa dosage is diminished. In summary, we have established a model for how breakpoints in long-range gene regulation alter the expression levels of a target gene brain region-specifically, and how this can cause subtle neuronal phenotypes relating to the etiology of associated neuropsychiatric disease.

  14. The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance.

    PubMed

    Jiang, Yanjuan; Yu, Diqiu

    2016-08-01

    Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense. PMID:27268959

  15. The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance.

    PubMed

    Jiang, Yanjuan; Yu, Diqiu

    2016-08-01

    Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense.

  16. Thyroid hormone status affects expression of daily torpor and gene transcription in Djungarian hamsters (Phodopus sungorus).

    PubMed

    Bank, Jonathan H H; Kemmling, Julia; Rijntjes, Eddy; Wirth, Eva K; Herwig, Annika

    2015-09-01

    Thyroid hormones (TH) play a key role in regulation of seasonal as well as acute changes in metabolism. Djungarian hamsters (Phodopus sungorus) adapt to winter by multiple changes in behaviour and physiology including spontaneous daily torpor, a state of hypometabolism and hypothermia. We investigated effects of systemic TH administration and ablation on the torpor behaviour in Djungarian hamsters adapted to short photoperiod. Hyperthyroidism was induced by giving T4 or T3 and hypothyroidism by giving methimazole (MMI) and sodium perchlorate via drinking water. T3 treatment increased water, food intake and body mass, whereas MMI had the opposite effect. Continuous recording of body temperature revealed that low T3 serum concentrations increased torpor incidence, lowered Tb and duration, whereas high T3 serum concentrations inhibited torpor expression. Gene expression of deiodinases (dio) and uncoupling proteins (ucp) were analysed by qPCR in hypothalamus, brown adipose tissue (BAT) and skeletal muscle. Expression of dio2, the enzyme generating T3 by deiodination of T4, and ucps, involved in thermoregulation, indicated a tissue specific response to treatment. Torpor per se decreased dio2 expression irrespective of treatment or tissue, suggesting low intracellular T3 concentrations during torpor. Down regulation of ucp1 and ucp3 during torpor might be a factor for the inhibition of BAT thermogenesis. Hypothalamic gene expression of neuropeptide Y, propopiomelanocortin and somatostatin, involved in feeding behaviour and energy balance, were not affected by treatment. Taken together our data indicate a strong effect of thyroid hormones on torpor, suggesting that lowered intracellular T3 concentrations in peripheral tissues promote torpor.

  17. Aspergillus asexual reproduction and sexual reproduction are differentially affected by transcriptional and translational mechanisms regulating stunted gene expression.

    PubMed Central

    Wu, J; Miller, B L

    1997-01-01

    The Stunted protein (StuAp) is a member of a family of transcription factors that regulate fungal development and cell cycle progression. Regulated stuA gene expression is required for correct cell pattern formation during asexual reproduction (conidiation) and for initiation of the sexual reproductive cycle in Aspergillus nidulans. Transcriptional initiation from two different promoters yields overlapping mRNAs (stuA alpha and stuAbeta) that upon translation yield the same protein. Here we show that multiple regulatory mechanisms interact to control (i) developmental competence-dependent expression of both transcripts and (ii) induction-dependent expression of stuA alpha, but not stuAbeta, by the conidiation-specific Bristle (BrlAp) transcriptional activator. Quantitative levels of both mRNAs are further modulated by (i) an activator(s) located at a far-upstream upstream activation sequence, (ii) feedback regulation by StuAp, and (iii) positive translational regulation that requires the peptide product of a micro-open reading frame unique to the stuA alpha mRNA 5' untranslated region. Gradients in stuA alpha expression were most important for correct cell and tissue type development. Threshold requirements were as follows: metula-phialide differentiation < ascosporogenesis < cleistothecial shell-Hülle cell differentiation. Altered stuA expression affected conidiophore morphology and conidial yields quantitatively but did not alter the temporal development of cell types or conidiophore density. By contrast, the sexual cycle showed both temporal delay and quantitative reduction in the number of cleistothecial initials but normal morphogenesis of tissue types. PMID:9315680

  18. Parent-of-origin genetic background affects the transcriptional levels of circadian and neuronal plasticity genes following sleep loss

    PubMed Central

    Tinarelli, Federico; Garcia-Garcia, Celina; Nicassio, Francesco; Tucci, Valter

    2014-01-01

    Sleep homoeostasis refers to a process in which the propensity to sleep increases as wakefulness progresses and decreases as sleep progresses. Sleep is tightly organized around the circadian clock and is regulated by genetic and epigenetic mechanisms. The homoeostatic response of sleep, which is classically triggered by sleep deprivation, is generally measured as a rebound effect of electrophysiological measures, for example delta sleep. However, more recently, gene expression changes following sleep loss have been investigated as biomarkers of sleep homoeostasis. The genetic background of an individual may affect this sleep-dependent gene expression phenotype. In this study, we investigated whether parental genetic background differentially modulates the expression of genes following sleep loss. We tested the progeny of reciprocal crosses of AKR/J and DBA/2J mouse strains and we show a parent-of-origin effect on the expression of circadian, sleep and neuronal plasticity genes following sleep deprivation. Thus, we further explored, by in silico, specific functions or upstream mechanisms of regulation and we observed that several upstream mechanisms involving signalling pathways (i.e. DICER1, PKA), growth factors (CSF3 and BDNF) and transcriptional regulators (EGR2 and ELK4) may be differentially modulated by parental effects. This is the first report showing that a behavioural manipulation (e.g. sleep deprivation) in adult animals triggers specific gene expression responses according to parent-of-origin genomic mechanisms. Our study suggests that the same mechanism may be extended to other behavioural domains and that the investigation of gene expression following experimental manipulations should take seriously into account parent-of-origin effects. PMID:24446504

  19. Source of metabolizable energy affects gene transcription in metabolic pathways in adipose and liver tissue of nonlactating, pregnant dairy cows.

    PubMed

    Crookenden, M A; Mandok, K S; Grala, T M; Phyn, C V C; Kay, J K; Greenwood, S L; Roche, J R

    2015-02-01

    The objective of this experiment was to determine if transcript abundance of genes involved in metabolic pathways in adipose and liver tissue could provide some explanation for the low efficiency with which ME in autumn pasture is used for BW gain. Nonlactating, pregnant (208 ± 19 d of gestation or approximately 75 d precalving) dairy cows (n = 90) were randomly allocated to either a control diet (i.e., offered fresh autumn pasture to maintenance requirements: 0.55 MJ ME/kg of measured metabolic BW [BW0.75] per day) or, in addition to the control diet, 1 of 2 supplement amounts (2.5 and 5.0 kg DM/d) of autumn pasture or 1 of 4 supplementary feeds (i.e., a control and 2 levels of feeding for each of 5 feeds: 11 groups of cows). Along with autumn pasture, evaluated feeds included spring pasture silage, maize silage, maize grain, and palm kernel expeller. Adipose and liver tissues were biopsied in wk 4 of the experiment and transcript abundance of genes involved in metabolic pathways associated with energy metabolism, lipolysis, and lipogenesis was determined. Additional feed, irrespective of type, increased BW gain (P < 0.01) and this effect was reflected in the expression of genes in adipose and liver tissue. However, autumn pasture had lower energy-use efficiency than the other feeds. Genes involved in both lipogenesis (ACACA, THRSP, GPAM, GPD1, and LPL) and lipolysis (PNPLA2) were upregulated (P < 0.05) in adipose tissue in response to increased ME intake/kilogram BW0.75. Hepatic expression of APOA1 decreased and that of APOB increased (P < 0.05) in cows offered maize grain and maize silage (i.e., starch-containing feeds). In comparison, pasture-fed cows demonstrated a degree of uncoupling of the somatotropic axis, with lower hepatic transcript abundance of both GHR1A and IGF-1 compared with cows offered any of the other 4 feeds. Changes to gene transcription indicate a possible molecular mechanism for the poor BW gain evident in ruminants consuming autumn

  20. Phosphorylation of CREB affects its binding to high and low affinity sites: implications for cAMP induced gene transcription.

    PubMed Central

    Nichols, M; Weih, F; Schmid, W; DeVack, C; Kowenz-Leutz, E; Luckow, B; Boshart, M; Schütz, G

    1992-01-01

    Cyclic AMP treatment of hepatoma cells leads to increased protein binding at the cyclic AMP response element (CRE) of the tyrosine aminotransferase (TAT) gene in vivo, as revealed by genomic footprinting, whereas no increase is observed at the CRE of the phosphoenolpyruvate carboxykinase (PEPCK) gene. Several criteria establish that the 43 kDa CREB protein is interacting with both of these sites. Two classes of CRE with different affinity for CREB are described. One class, including the TATCRE, is characterized by asymmetric and weak binding sites (CGTCA), whereas the second class containing symmetrical TGACGTCA sites shows a much higher binding affinity for CREB. Both classes show an increase in binding after phosphorylation of CREB by protein kinase A (PKA). An in vivo phosphorylation-dependent change in binding of CREB increases the occupancy of weak binding sites used for transactivation, such as the TATCRE, while high affinity sites may have constitutive binding of transcriptionally active and inactive CREB dimers, as demonstrated by in vivo footprinting at the PEPCK CRE. Thus, lower basal level and higher relative stimulation of transcription by cyclic AMP through low affinity CREs should result, allowing finely tuned control of gene activation. Images PMID:1354612

  1. Abscisic acid affects transcription of chloroplast genes via protein phosphatase 2C-dependent activation of nuclear genes: repression by guanosine-3'-5'-bisdiphosphate and activation by sigma factor 5.

    PubMed

    Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas

    2015-06-01

    Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. PMID:25976841

  2. Overexpression of a cotton gene that encodes a putative transcription factor of AP2/EREBP family in Arabidopsis affects growth and development of transgenic plants.

    PubMed

    Zhou, Ying; Xia, Hui; Li, Xiao-Jie; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2013-01-01

    In the study, a gene encoding a putative ethylene response factor of AP2/EREBP family was isolated from cotton (Gossypium hirsutum) and designated as GhERF12. Sequence alignment showed that GhERF12 protein contains a central AP2/ERF domain (58 amino acids) with two functional conserved amino acid residues (ala14 and asp19). Transactivation assay indicated that GhERF12 displayed strong transcription activation activity in yeast cells, suggesting that this protein may be a transcriptional activator in cotton. Quantitative RT-PCR analysis showed that GhERF12 expression in cotton was induced by ACC and IAA. Overexpression of GhERF12 in Arabidopsis affected seedling growth and development. The GhERF12 transgenic plants grew slowly, and displayed a dwarf phenotype. The mean bolting time of the transgenic plants was delayed for about 10 days, compared with that of wild type. Further study revealed that some ethylene-related and auxin-related genes were dramatically up-regulated in the transgenic plants, compared with those of wild type. Collectively, we speculated that GhERF12, as a transcription factor, may be involved in regulation of plant growth and development by activating the constitutive ethylene response likely related to auxin biosynthesis and/or signaling.

  3. Mutations That Affect Transcription and Cyclic Amp-Crp Regulation of the Adenylate Cyclase Gene (Cya) of Salmonella Typhimurium

    PubMed Central

    Fandl, J. P.; Thorner, L. K.; Artz, S. W.

    1990-01-01

    We studied the expression of the cya promoter(s) in cya-lac fusion strains of Salmonella typhimurium and demonstrated cAMP receptor protein (CRP)-dependent repression by cAMP. Expression of cya was reduced about fourfold in cultures grown in acetate minimal medium as compared to cultures grown in glucose-6-phosphate minimal medium. Expression of cya was also reduced about fourfold by addition of 5 mM cAMP to cultures grown in glucose minimal medium. We constructed in vitro deletion and insertion mutations altering a major cya promoter (P2) and a putative CRP binding site overlapping P2. These mutations were recombined into the chromosome by allele replacement with M13mp::cya recombinant phages and the regulation of the mutant promoters was analyzed. A 4-bp deletion of the CRP binding site and a 4-bp insertion in this site nearly eliminated repression by cAMP. A mutant with the P2 promoter and the CRP binding site both deleted exhibited an 80% reduction in cya expression; the 20% residual expression was insensitive to cAMP repression. This mutant retained a Cya(+) phenotype. Taken together, the results establish that the cya gene is transcribed from multiple promoters one of which, P2, is negatively regulated by the cAMP-CRP complex. Correction for the contribution to transcription by the cAMP-CRP nonregulated cya promoters indicates that the P2 promoter is repressed at least eightfold by cAMP-CRP. PMID:2168849

  4. Synthetic enhancement of a TFIIB defect by a mutation in SSU72, an essential yeast gene encoding a novel protein that affects transcription start site selection in vivo.

    PubMed Central

    Sun, Z W; Hampsey, M

    1996-01-01

    An ssu72 mutant of Saccharomyces cerevisiae was identified as an enhancer of a TFIIB defect (sua7-1) that confers both a cold-sensitive growth defect and a downstream shift in transcription start site selection. The ssu72-1 allele did not affect cold sensitivity but, in combination with sua7-1, created a heat-sensitive phenotype. Moreover, start site selection at the ADH1 gene was dramatically shifted further downstream of the normal sites. Both of these effects could be rescued by either SUA7 or SSU72, thereby defining a functional relationship between the two genes. SSU72 is a single-copy, essential gene encoding a novel protein of 206 amino acids. The ssu72-1 allele is the result of a 30-bp duplication creating a sequence encoding a Cys-X2-Cys-X6-Cys-X2-Cys zinc binding motif near the N terminus of Ssu72p. Mutational analysis demonstrated that the N terminus of Ssu72p is essential for function and that cysteine residues in both the normal and mutant proteins are critical. We discuss the possibility that the potential zinc binding motif of Ssu72 facilitates assembly of the transcription preinitiation complex and that this effect is important for accurate start site selection in vivo. PMID:8657130

  5. The Shwachman-Bodian-Diamond syndrome associated protein interacts with HsNip7 and its down-regulation affects gene expression at the transcriptional and translational levels

    SciTech Connect

    Hesling, Cedric; Oliveira, Carla C.; Castilho, Beatriz A.; Zanchin, Nilson I.T.

    2007-12-10

    The Shwachman-Bodian-Diamond syndrome (SDS) is an autosomal disorder with pleiotropic phenotypes including pancreatic, skeletal and bone marrow deficiencies and predisposition to hematological dysfunctions. SDS has been associated to mutations in the SBDS gene, encoding a highly conserved protein that was shown to function in ribosome biogenesis in yeast. In this work, we show that SBDS is found in complexes containing the human Nip7 ortholog. Analysis of pre-rRNA processing in a stable SBDS knock-down HEK293-derivative cell line revealed accumulation of a small RNA which is a further indication of SBDS involvement in rRNA biosynthesis. Global transcription and polysome-bound mRNA profiling revealed that SBDS knock-down affects expression of critical genes involved in brain development and function, bone morphogenesis, blood cell proliferation and differentiation, and cell adhesion. Expression of a group of growth and signal transduction factors and of DNA damage response genes is also affected. In SBDS knock-down cells, 34 mRNAs showed decreased and 55 mRNAs showed increased association to polysomes, among which is a group encoding proteins involved in alternative splicing and RNA modification. These results indicate that SBDS is required for accurate expression of genes important for proper brain, skeletal, and blood cell development.

  6. [Transcriptional control of ciliary genes].

    PubMed

    Vieillard, Jennifer; Jerber, Julie; Durand, Bénédicte

    2014-11-01

    Cilia are found in many eukaryotic species and share a common microtubule architecture that can nonetheless show very diverse features within one animal. The genesis of cilia and their diversity require the expression of different specific genes. At least two classes of transcription factors are involved in ciliogenesis: the RFX family, essential for the assembly of most cilia and the FOXJ1 transcription factors that are key regulators of motile cilia assembly. These two different families of transcription factors have both specific and common target genes and they can also cooperate for the formation of cilia. In collaboration with cell type specific factors, they also contribute to the specialisation of cilia. As a consequence, the identification of RFX and FOXJ1 target genes has emerged as an efficient strategy to identify novel ciliary genes, and in particular genes potentially implicated in ciliopathies.

  7. Transcriptional regulation of tenascin genes

    PubMed Central

    Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias

    2015-01-01

    Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an “oncofetal” protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

  8. Histone deacetylase inhibitor abexinostat affects chromatin organization and gene transcription in normal B cells and in mantle cell lymphoma.

    PubMed

    Markozashvili, Diana; Pichugin, Andrei; Barat, Ana; Camara-Clayette, Valerie; Vasilyeva, Natalia V; Lelièvre, Hélène; Kraus-Berthier, Laurence; Depil, Stéphane; Ribrag, Vincent; Vassetzky, Yegor

    2016-04-15

    Mantle cell lymphoma (MCL) is a rare lymphoma caused by the t(11:14) juxtaposing the cyclin D1 (CCND1) locus on chromosome 11 and the immunoglobulin heavy chain (IgH) locus on chromosome 14. Several new treatments are proposed for MCL, including histone deacetylase inhibitors (HDACi). We have studied gene expression and chromatin organization in the translocated 11q13 locus in MCL cells as compared to lymphoblastoid cell lines as well as the effect of HDACi abexinostat on chromatin organization and gene expression in the 11q13 locus. We have identified a cluster of genes overexpressed in the translocation region on chromosome 11 in MCL cells. Abexinostat provokes a genome-wide disaggregation of heterochromatin. The genes upregulated after the t(11;14) translocation react to the HDACi treatment by increasing their expression, but their gene promoters do not show significant alterations in H3K9Ac and H3K9me2 levels in abexinostat-treated cells.

  9. Transposon insertions in the promoter of the Zea mays a1 gene differentially affect transcription by the Myb factors P and C1.

    PubMed Central

    Pooma, Wilailak; Gersos, Christos; Grotewold, Erich

    2002-01-01

    The understanding of control of gene regulation in higher eukaryotes relies heavily on results derived from non-in vivo studies, but rarely can the significance of these approximations be established in vivo. Here, we investigated the effect of Mutator and Spm insertions on the expression of the flavonoid biosynthetic gene a1, independently regulated by the transcription factors C1 and P. The a1-mum2 and a1-m2 alleles carry Mu1 and Spm insertions, respectively, in a cis-element (ARE) of unknown function located between the P- and C1-binding sites. We show that the insertions of Mu1 and Spm similarly influence the expression of a1 controlled by C1 or P. The P-controlled a1 expression in a1-m2 is Spm dependent, and the mutant phenotype of a1-mum2 is suppressed in the pericarp in the absence of the autonomous MuDR element. Footprints within the ARE affect the regulation of a1 by C1 and P differently, providing evidence that these factors control a1 expression using distinct cis-acting regulatory elements. Together, our findings contribute significantly to one of the best-described plant regulatory systems, while stressing the need to complement with in vivo experiments current approaches used for the study of control of gene expression. PMID:12072474

  10. Nascent transcription affected by RNA polymerase IV in Zea mays.

    PubMed

    Erhard, Karl F; Talbot, Joy-El R B; Deans, Natalie C; McClish, Allison E; Hollick, Jay B

    2015-04-01

    All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3'-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance.

  11. Nascent Transcription Affected by RNA Polymerase IV in Zea mays

    PubMed Central

    Erhard, Karl F.; Talbot, Joy-El R. B.; Deans, Natalie C.; McClish, Allison E.; Hollick, Jay B.

    2015-01-01

    All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3ʹ-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance. PMID:25653306

  12. Expression pattern of cellulolytic and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1 are affected by carbon source in Trichoderma reesei.

    PubMed

    Castro, Lilian dos Santos; Antoniêto, Amanda Cristina Campos; Pedersoli, Wellington Ramos; Silva-Rocha, Rafael; Persinoti, Gabriela F; Silva, Roberto Nascimento

    2014-03-01

    Trichoderma reesei is the most important fungus for the industrial production of enzymes to biomass deconstruction. Most of the genes encoding cellulases and hemicellulases are regulated by the transcription factors CRE1 and XYR1. In this work, the regulation of 22 genes of cellulases and xylanases by these transcription factors was investigated under three different carbon sources. Analysis of gene expression and enzymatic profiles of CMCase, β-glucosidase, and xylanases showed different regulation that was depended of the carbon source in both Δxyr1 and Δcre1 mutants. In the presence of glucose, the majority of genes evaluated (82%) showed increased expression levels in the Δcre1 mutant compared to the parental QM9414 strain. In the Δxyr1 mutant, it was observed that expression of cellulase and xylanase genes was reduced compared to the parental QM9414 strain, when cultured in the presence of cellulose or sophorose. Interesting, in the presence of glucose, approximately 60% of the analyzed genes had increased expression in the Δxyr1 mutant compared to parental strain. Furthermore, no correlation between gene expression and the number of putative binding sites of XYR1 and CRE1 to promoter region of cellulolytic and xylanolytic studied genes was observed. Therefore, these results demonstrated that the regulation of cellulase and xylanase by the transcription factors CRE1 and XYR1 is influenced by different carbon sources.

  13. Ectopic expression of R3 MYB transcription factor gene OsTCL1 in Arabidopsis, but not rice, affects trichome and root hair formation

    PubMed Central

    Zheng, Kaijie; Tian, Hainan; Hu, Qingnan; Guo, Hongyan; Yang, Li; Cai, Ling; Wang, Xutong; Liu, Bao; Wang, Shucai

    2016-01-01

    In Arabidopsis, a MYB-bHLH-WD40 (MBW) transcriptional activator complex activates the homeodomain protein gene GLABRA2 (GL2), leading to the promotion of trichome formation and inhibition of root hair formation. The same MBW complex also activates single-repeat R3 MYB genes. R3 MYBs in turn, play a negative feedback role by competing with R2R3 MYB proteins for binding bHLH proteins, thus blocking the formation of the MBW complex. By BLASTing the rice (Oryza sativa) protein database using the entire amino acid sequence of Arabidopsis R3 MYB transcription factor TRICHOMELESS1 (TCL1), we found that there are two genes in rice genome encoding R3 MYB transcription factors, namely Oryza sativa TRICHOMELESS1 (OsTCL1) and OsTCL2. Expressing OsTCL1 in Arabidopsis inhibited trichome formation and promoted root hair formation, and OsTCL1 interacted with GL3 when tested in Arabidopsis protoplasts. Consistent with these observations, expression levels of GL2, R2R3 MYB transcription factor gene GLABRA1 (GL1) and several R3 MYB genes were greatly reduced, indicating that OsTCL1 is functional R3 MYB. However, trichome and root hair formation in transgenic rice plants overexpressing OsTCL1 remained largely unchanged, and elevated expression of OsGL2 was observed in the transgenic rice plants, indicating that rice may use different mechanisms to regulate trichome formation. PMID:26758286

  14. Transcriptional interference among the murine β-like globin genes

    PubMed Central

    Hu, Xiao; Eszterhas, Susan; Pallazzi, Nicolas; Bouhassira, Eric E.; Fields, Jennifer; Tanabe, Osamu; Gerber, Scott A.; Bulger, Michael; Engel, James Douglas; Groudine, Mark

    2007-01-01

    Mammalian β-globin loci contain multiple genes that are activated at different developmental stages. Studies have suggested that the transcription of one gene in a locus can influence the expression of the other locus genes. The prevalent model to explain this transcriptional interference is that all potentially active genes compete for locus control region (LCR) activity. To investigate the influence of transcription by the murine embryonic genes on transcription of the other β-like genes, we generated mice with deletions of the promoter regions of Ey and βh1 and measured transcription of the remaining genes. Deletion of the Ey and βh1 promoters increased transcription of βmajor and βminor 2-fold to 3-fold during primitive erythropoiesis. Deletion of Ey did not affect βh1 nor did deletion of βh1 affect Ey, but Ey deletion uniquely activated transcription from βh0, a β-like globin gene immediately downstream of Ey. Protein analysis showed that βh0 encodes a translatable β-like globin protein that can pair with alpha globin. The lack of transcriptional interference between Ey and βh1 and the gene-specific repression of βh0 did not support LCR competition among the embryonic genes and suggested that direct transcriptional interference from Ey suppressed βh0. PMID:17077320

  15. Short-term treatment of adult male zebrafish (Danio Rerio) with 17α-ethinyl estradiol affects the transcription of genes involved in development and male sex differentiation.

    PubMed

    Reyhanian Caspillo, Nasim; Volkova, Kristina; Hallgren, Stefan; Olsson, Per-Erik; Porsch-Hällström, Inger

    2014-08-01

    The synthetic estrogen 17α-ethinyl estradiol (EE2) disturbs reproduction and causes gonadal malformation in fish. Effects on the transcription of genes involved in gonad development and function that could serve as sensitive biomarkers of reproductive effects in the field is, however, not well known. We have studied mRNA expression in testes and liver of adult zebrafish (Danio rerio) males treated with 0, 5 or 25 ng/L EE2for 14 days. qPCR analysis showed that the mRNA expression of four genes linked to zebrafish male sex determination and differentiation, Anti-Mullerian Hormone, Double sex and mab-related protein, Sry-related HMG box-9a and Nuclear receptor subfamily 5 group number 1b were significantly decreased by 25 ng/L, but not 5 ng/L EE2 compared with the levels in untreated fish. The decreased transcription was correlated with a previously shown spawning failure in these males (Reyhanian et al., 2011. Aquat Toxicol 105, 41-48), suggesting that decreased mRNA expression of genes regulating male sexual function could be involved in the functional sterility. The mRNA level of Cytochrome P-45019a, involved in female reproductive development, was unaffected by hormone treatment. The transcription of the female-specific Vitellogenin was significantly induced in testes. While testicular Androgen Receptor and the Estrogen Receptor-alpha mRNA levels were unchanged, Estrogen receptor-beta was significantly decreased by 25 ng/L EE2. Hepatic Estrogen Receptor-alpha mRNA was significantly increased by both exposure concentrations, while Estrogen Receptor-beta transcription was unaltered. The decreased transcription of male-predominant genes supports a demasculinization of testes by EE2 and might reflect reproductive disturbances in the environment. PMID:24747828

  16. Thyroid active agents T3 and PTU differentially affect immune gene transcripts in the head kidney of rainbow trout (Oncorynchus mykiss).

    PubMed

    Quesada-García, Alba; Encinas, Paloma; Valdehita, Ana; Baumann, Lisa; Segner, Helmut; Coll, Julio M; Navas, José M

    2016-05-01

    In mammals, numerous reports describe an immunomodulating effect of thyroid-active compounds. In contrast, only few reports have been published on this subject in fish. We previously demonstrated that immune cells of rainbow trout (Oncorhynchus mykiss) possess thyroid hormone receptors (THRs) and that exposure of trout to the thyroid hormone 3,3',5-triiodo-l-thyronine (T3) or the antithyroid drug propylthiouracil (PTU) alters immune cell transcript levels of THR and several immune genes. The present study aims to further characterize the immunomodulating action of thyroid-active compounds in trout immune cells. We report here the use of a custom-designed 60-mer oligo immune-targeted microarray for rainbow trout to analyze the gene expression profiles induced in the head kidney by T3 and PTU. Morphometric analyses of the thyroid showed that PTU exposure increased the size of the epithelial cells, whereas T3 induced no significant effects. Both T3 and PTU had diverse and partly contrasting effects on immune transcript profiles. The strongest differential effects of T3 and PTU on gene expressions were those targeting the Mitogen Associated Protein Kinase (MAPK), NFkB, Natural Killer (NK) and Toll-Like Receptor (TLR) pathways, a number of multipath genes (MPG) such as those encoding pleiotropic transcription factors (atf1, junb, myc), as well as important pro-inflammatory genes (tnfa, tnf6, il1b) and interferon-related genes (ifng, irf10). With these results we show for the first time in a fish species that the in vivo thyroidal status modulates a diversity of immune genes and pathways. This knowledge provides the basis to investigate both mechanisms and consequences of thyroid hormone- and thyroid disruptor-mediated immunomodulation for the immunocompetence of fish. PMID:26963519

  17. Thyroid active agents T3 and PTU differentially affect immune gene transcripts in the head kidney of rainbow trout (Oncorynchus mykiss).

    PubMed

    Quesada-García, Alba; Encinas, Paloma; Valdehita, Ana; Baumann, Lisa; Segner, Helmut; Coll, Julio M; Navas, José M

    2016-05-01

    In mammals, numerous reports describe an immunomodulating effect of thyroid-active compounds. In contrast, only few reports have been published on this subject in fish. We previously demonstrated that immune cells of rainbow trout (Oncorhynchus mykiss) possess thyroid hormone receptors (THRs) and that exposure of trout to the thyroid hormone 3,3',5-triiodo-l-thyronine (T3) or the antithyroid drug propylthiouracil (PTU) alters immune cell transcript levels of THR and several immune genes. The present study aims to further characterize the immunomodulating action of thyroid-active compounds in trout immune cells. We report here the use of a custom-designed 60-mer oligo immune-targeted microarray for rainbow trout to analyze the gene expression profiles induced in the head kidney by T3 and PTU. Morphometric analyses of the thyroid showed that PTU exposure increased the size of the epithelial cells, whereas T3 induced no significant effects. Both T3 and PTU had diverse and partly contrasting effects on immune transcript profiles. The strongest differential effects of T3 and PTU on gene expressions were those targeting the Mitogen Associated Protein Kinase (MAPK), NFkB, Natural Killer (NK) and Toll-Like Receptor (TLR) pathways, a number of multipath genes (MPG) such as those encoding pleiotropic transcription factors (atf1, junb, myc), as well as important pro-inflammatory genes (tnfa, tnf6, il1b) and interferon-related genes (ifng, irf10). With these results we show for the first time in a fish species that the in vivo thyroidal status modulates a diversity of immune genes and pathways. This knowledge provides the basis to investigate both mechanisms and consequences of thyroid hormone- and thyroid disruptor-mediated immunomodulation for the immunocompetence of fish.

  18. SSN genes that affect transcriptional repression in Saccharomyces cerevisiae encode SIN4, ROX3, and SRB proteins associated with RNA polymerase II.

    PubMed

    Song, W; Treich, I; Qian, N; Kuchin, S; Carlson, M

    1996-01-01

    The RNA polymerase II of Saccharomyces cerevisiae exists in holoenzyme forms containing a complex, known as the mediator, associated with the carboxyl-terminal domain. The mediator includes several SRB proteins and is required for transcriptional activation. Previous work showed that a cyclin-dependent kinase-cyclin pair encoded by SSN3 and SSN8, two members of the SSN suppressor family, are identical to two SRB proteins in the mediator. Here we have identified the remaining SSN genes by cloning and genetic analysis. SSN2 and SSN5 are identical to SRB9 and SRB8, respectively, which encode additional components of the mediator. Genetic evidence implicates the SSN genes in transcriptional repression. Thus, these identities provide genetic insight into mediator and carboxyl-terminal domain function, strongly suggesting a role in mediating transcriptional repression as well as activation. We also show that SSN4 and SSN7 are the same as SIN4 and ROX3, respectively, raising the possibility that these genes also encode mediator proteins.

  19. Effect of selenium deficiency on gene transcription

    SciTech Connect

    Christensen, M.J.; Burgener, K.W. )

    1991-03-11

    To investigate the general effects of dietary selenium (Se) deficiency on gene transcription, weanling male Sprague-Dawley rats were fed a basal Se-deficient Torula yeast-based diet or the same diet supplemented with 0.5 ppm Se as sodium selenite for 40 days. At that time three rats in each dietary group were sacrificed. Livers were excised and divided into two portions for isolation of nuclei and for assay of cytosolic Se-glutathione peroxidase (Se-GPX) activity. Se-GPX activity was 279 {plus minus} 4 (mean {plus minus} SEM) mUnits/mg protein in Se-adequate livers, and 10 {plus minus} 2 mUnits/mg protein in Se-deficient livers. One aliquot of nuclei from each dietary group was used in a run-on transcription assay, employing {alpha}-{sup 32}P-UTP to label nascent transcripts. Equal quantities of radioactivity from these nuclei were hybridized with cDNA probes bound to nitrocellulose. Message bound to each probe was quantitated by laser densitometry of autoradiographs, and by scintillation counting of dot blotted nitrocellulose. Transcription of most genes tested, including Se-GPX, was not significantly affected by dietary Se intake. However, the amount of hybridization to a murine oncogene probe (v-fos) was increased in Se deficiency.

  20. Transcription factor CecR (YbiH) regulates a set of genes affecting the sensitivity of Escherichia coli against cefoperazone and chloramphenicol.

    PubMed

    Yamanaka, Yuki; Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2016-07-01

    Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening was performed for identification of the binding site of YbiH, an as yet uncharacterized TetR-family transcription factor, on the Escherichia coli genome. YbiH was found to be a unique single-target regulator that binds in vitro within the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses indicated one clear binding site of YbiH, including a complete palindromic sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of the ybiH operon and activation of the rhlE operon by YbiH. After phenotype microarray screening, YbiH was indicated to confer resistance to chloramphenicol and cefazoline (a first-generation cephalosporin). A systematic survey of the participation of each of the predicted YbiH-regulated genes in the antibiotic sensitivity indicated involvement of the YbhFSR ABC-type transporter in the sensitivity to cefoperazone (a third-generation cephalosporin) and of the membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken together with the growth test in the presence of these two antibiotics and in vitro transcription assay, it was concluded that the hitherto uncharacterized YbiH regulates transcription of both the bidirectional transcription units, the ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the control of sensitivity to cefoperazone and chloramphenicol. We thus propose to rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity). PMID:27112147

  1. The poplar basic helix-loop-helix transcription factor BEE3 – Like gene affects biomass production by enhancing proliferation of xylem cells in poplar

    SciTech Connect

    Noh, Seol Ah Choi, Young-Im Cho, Jin-Seong Lee, Hyoshin

    2015-06-19

    Brassinosteroids (BRs) play important roles in many aspects of plant growth and development, including regulation of vascular cambium activities and cell elongation. BR-induced BEE3 (brassinosteroid enhanced expression 3) is required for a proper BR response. Here, we identified a poplar (Populus alba × Populus glandulosa) BEE3-like gene, PagBEE3L, encoding a putative basic helix-loop-helix (bHLH)-type transcription factor. Expression of PagBEE3L was induced by brassinolide (BL). Transcripts of PagBEE3L were mainly detected in stems, with the internode having a low level of transcription and the node having a relatively higher level. The function of the PagBEE3L gene was investigated through phenotypic analyses with PagBEE3L-overexpressing (ox) transgenic lines. This work particularly focused on a potential role of PagBEE3L in stem growth and development of polar. The PagBEE3L-ox poplar showed thicker and longer stems than wild-type plants. The xylem cells from the stems of PagBEE3L-ox plants revealed remarkably enhanced proliferation, resulting in an earlier thickening growth than wild-type plants. Therefore, this work suggests that xylem development of poplar is accelerated in PagBEE3L-ox plants and PagBEE3L plays a role in stem growth by increasing the proliferation of xylem cells to promote the initial thickening growth of poplar stems. - Highlights: • We identify the BEE3-like gene form hybrid poplar (Populus alba × Populus glandulosa). • We examine effects of overexpression of PagBEE3L on growth in poplar. • We found that 35S:BEE3L transgenic plants showed more rapid growth than wild-type plants. • BEE3L protein plays an important role in the development of plant stem.

  2. Gene transcription and electromagnetic fields

    SciTech Connect

    Henderson, A.S.

    1992-01-01

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  3. The peptide semax affects the expression of genes related to the immune and vascular systems in rat brain focal ischemia: genome-wide transcriptional analysis

    PubMed Central

    2014-01-01

    Background The nootropic neuroprotective peptide Semax (Met-Glu-His-Phe-Pro-Gly-Pro) has proved efficient in the therapy of brain stroke; however, the molecular mechanisms underlying its action remain obscure. Our genome-wide study was designed to investigate the response of the transcriptome of ischemized rat brain cortex tissues to the action of Semax in vivo. Results The gene-expression alteration caused by the action of the peptide Semax was compared with the gene expression of the “ischemia” group animals at 3 and 24 h after permanent middle cerebral artery occlusion (pMCAO). The peptide predominantly enhanced the expression of genes related to the immune system. Three hours after pMCAO, Semax influenced the expression of some genes that affect the activity of immune cells, and, 24 h after pMCAO, the action of Semax on the immune response increased considerably. The genes implicated in this response represented over 50% of the total number of genes that exhibited Semax-induced altered expression. Among the immune-response genes, the expression of which was modulated by Semax, genes that encode immunoglobulins and chemokines formed the most notable groups. In response to Semax administration, 24 genes related to the vascular system exhibited altered expression 3 h after pMCAO, whereas 12 genes were changed 24 h after pMCAO. These genes are associated with such processes as the development and migration of endothelial tissue, the migration of smooth muscle cells, hematopoiesis, and vasculogenesis. Conclusions Semax affects several biological processes involved in the function of various systems. The immune response is the process most markedly affected by the drug. Semax altered the expression of genes that modulate the amount and mobility of immune cells and enhanced the expression of genes that encode chemokines and immunoglobulins. In conditions of rat brain focal ischemia, Semax influenced the expression of genes that promote the formation and

  4. Transcript length mediates developmental timing of gene expression across Drosophila.

    PubMed

    Artieri, Carlo G; Fraser, Hunter B

    2014-11-01

    The time required to transcribe genes with long primary transcripts may limit their ability to be expressed in cells with short mitotic cycles, a phenomenon termed intron delay. As such short cycles are a hallmark of the earliest stages of insect development, we tested the impact of intron delay on the Drosophila developmental transcriptome. We find that long zygotically expressed genes show substantial delay in expression relative to their shorter counterparts, which is not observed for maternally deposited transcripts. Patterns of RNA-seq coverage along transcripts show that this delay is consistent with their inability to completely transcribe long transcripts, but not with transcriptional initiation-based regulatory control. We further show that highly expressed zygotic genes maintain compact transcribed regions across the Drosophila phylogeny, allowing conservation of embryonic expression patterns. We propose that the physical constraints of intron delay affect patterns of expression and the evolution of gene structure of a substantial portion of the Drosophila transcriptome.

  5. The poplar basic helix-loop-helix transcription factor BEE3 - Like gene affects biomass production by enhancing proliferation of xylem cells in poplar.

    PubMed

    Noh, Seol Ah; Choi, Young-Im; Cho, Jin-Seong; Lee, Hyoshin

    2015-06-19

    Brassinosteroids (BRs) play important roles in many aspects of plant growth and development, including regulation of vascular cambium activities and cell elongation. BR-induced BEE3 (brassinosteroid enhanced expression 3) is required for a proper BR response. Here, we identified a poplar (Populus alba × Populus glandulosa) BEE3-like gene, PagBEE3L, encoding a putative basic helix-loop-helix (bHLH)-type transcription factor. Expression of PagBEE3L was induced by brassinolide (BL). Transcripts of PagBEE3L were mainly detected in stems, with the internode having a low level of transcription and the node having a relatively higher level. The function of the PagBEE3L gene was investigated through phenotypic analyses with PagBEE3L-overexpressing (ox) transgenic lines. This work particularly focused on a potential role of PagBEE3L in stem growth and development of polar. The PagBEE3L-ox poplar showed thicker and longer stems than wild-type plants. The xylem cells from the stems of PagBEE3L-ox plants revealed remarkably enhanced proliferation, resulting in an earlier thickening growth than wild-type plants. Therefore, this work suggests that xylem development of poplar is accelerated in PagBEE3L-ox plants and PagBEE3L plays a role in stem growth by increasing the proliferation of xylem cells to promote the initial thickening growth of poplar stems.

  6. Repetitive sequence variations in the promoter region of the adhesin-encoding gene sabA of Helicobacter pylori affect transcription.

    PubMed

    Harvey, Vivian C; Acio, Catherine R; Bredehoft, Amy K; Zhu, Laurence; Hallinger, Daniel R; Quinlivan-Repasi, Vanessa; Harvey, Samuel E; Forsyth, Mark H

    2014-10-01

    The pathogenesis of diseases elicited by the gastric pathogen Helicobacter pylori is partially determined by the effectiveness of adaptation to the variably acidic environment of the host stomach. Adaptation includes appropriate adherence to the gastric epithelium via outer membrane protein adhesins such as SabA. The expression of sabA is subject to regulation via phase variation in the promoter and coding regions as well as repression by the two-component system ArsRS. In this study, we investigated the role of a homopolymeric thymine [poly(T)] tract -50 to -33 relative to the sabA transcriptional start site in H. pylori strain J99. We quantified sabA expression in H. pylori J99 by quantitative reverse transcription-PCR (RT-PCR), demonstrating significant changes in sabA expression associated with experimental manipulations of poly(T) tract length. Mimicking the length increase of this tract by adding adenines instead of thymines had similar effects, while the addition of other nucleotides failed to affect sabA expression in the same manner. We hypothesize that modification of the poly(T) tract changes DNA topology, affecting regulatory protein interaction(s) or RNA polymerase binding efficiency. Additionally, we characterized the interaction between the sabA promoter region and ArsR, a response regulator affecting sabA expression. Using recombinant ArsR in electrophoretic mobility shift assays (EMSA), we localized binding to a sequence with partial dyad symmetry -20 and +38 relative to the sabA +1 site. The control of sabA expression by both ArsRS and phase variation at two distinct repeat regions suggests the control of sabA expression is both complex and vital to H. pylori infection.

  7. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  8. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits

    PubMed Central

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-01-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. ‘Superficial scald’ of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  9. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  10. Silencing of molt-regulating transcription factor gene, CiHR3, affects growth and development of sugarcane stem borer, Chilo infuscatellus.

    PubMed

    Zhang, Yu-liang; Zhang, Shu-zhen; Kulye, Mahesh; Wu, Su-ran; Yu, Nai-tong; Wang, Jian-hua; Zeng, Hong-mei; Liu, Zhi-xin

    2012-01-01

    RNA interference (RNAi) is a technology for conducting functional genomic studies and a potential tool for crop protection against insect pests. Development of reliable methods for production and delivery of double-stranded RNA (dsRNA) is the major challenge for efficient pest control. In this study, Chilo infuscatellus Snellen (Crambidae: Lepidoptera) was fed with CiHR3 dsRNA expressed in bacteria or synthesized in vitro. The dsRNA ingested by C. infuscatellus successfully triggered silencing of the molt-regulating transcription factor CiHR3, an important gene for insect growth and development, and caused significant abnormalities and weight loss in insects within seven days of treatment. This study is an ideal example of feeding-based RNAi mediated by dsRNA expressed in bacteria or synthesized in vitro. The results also suggested that feeding-based RNA interference is a potential method for the management of C. infuscatellus. PMID:23427912

  11. The A2 gene of alcelaphine herpesvirus-1 is a transcriptional regulator affecting cytotoxicity in virus-infected T cells but is not required for malignant catarrhal fever induction in rabbits.

    PubMed

    Parameswaran, Nevi; Dewals, Benjamin G; Giles, Tom C; Deppmann, Christopher; Blythe, Martin; Vanderplasschen, Alain; Emes, Richard D; Haig, David

    2014-08-01

    Alcelaphine herpesvirus-1 (AlHV-1) causes malignant catarrhal fever (MCF). The A2 gene of AlHV-1 is a member of the bZIP transcription factor family. We wished to determine whether A2 is a virulence gene or not and whether it is involved in pathogenesis by interference with host transcription pathways. An A2 gene knockout (A2ΔAlHV-1) virus, revertant (A2revAlHV-1) virus, and wild-type virus (wtAlHV-1) were used to infect three groups of rabbits. A2ΔAlHV-1-infected rabbits succumbed to MCF, albeit with a delayed onset compared to the control groups, so A2 is not a critical virulence factor. Differential gene transcription analysis by RNAseq and qRT-PCR validation of a selection of these was performed in infected large granular lymphocyte (LGL) T cells obtained in culture from the MCF-affected animals. A2 was involved in the transcriptional regulation of immunological, cell cycle and apoptosis pathways. In particular, there was a bias towards γδ T cell receptor (TCR) expression and downregulation of αβ TCR. TCR signalling, apoptosis, cell cycle, IFN-γ and NFAT pathways were affected. Of particular interest was partial inhibition of the cytotoxicity-associated pathways involving perforin and the granzymes A and B in the A2ΔAlHV-1-infected LGLs compared to controls. In functional assays, A2ΔAlHV-1-infected LGLs were significantly less cytotoxic than wtAlHV-1- and A2revAlHV-1-infected LGLs using rabbit corneal epithelial cells (SIRC) as targets. This implies that A2 is involved in a pathway enhancing the expression of LGL cytotoxicity. This is important as virus-infected T cell cytotoxicity in vivo has been suggested as a potential mechanism of disease induction in MCF.

  12. The A2 gene of alcelaphine herpesvirus-1 is a transcriptional regulator affecting cytotoxicity in virus-infected T cells but is not required for malignant catarrhal fever induction in rabbits.

    PubMed

    Parameswaran, Nevi; Dewals, Benjamin G; Giles, Tom C; Deppmann, Christopher; Blythe, Martin; Vanderplasschen, Alain; Emes, Richard D; Haig, David

    2014-08-01

    Alcelaphine herpesvirus-1 (AlHV-1) causes malignant catarrhal fever (MCF). The A2 gene of AlHV-1 is a member of the bZIP transcription factor family. We wished to determine whether A2 is a virulence gene or not and whether it is involved in pathogenesis by interference with host transcription pathways. An A2 gene knockout (A2ΔAlHV-1) virus, revertant (A2revAlHV-1) virus, and wild-type virus (wtAlHV-1) were used to infect three groups of rabbits. A2ΔAlHV-1-infected rabbits succumbed to MCF, albeit with a delayed onset compared to the control groups, so A2 is not a critical virulence factor. Differential gene transcription analysis by RNAseq and qRT-PCR validation of a selection of these was performed in infected large granular lymphocyte (LGL) T cells obtained in culture from the MCF-affected animals. A2 was involved in the transcriptional regulation of immunological, cell cycle and apoptosis pathways. In particular, there was a bias towards γδ T cell receptor (TCR) expression and downregulation of αβ TCR. TCR signalling, apoptosis, cell cycle, IFN-γ and NFAT pathways were affected. Of particular interest was partial inhibition of the cytotoxicity-associated pathways involving perforin and the granzymes A and B in the A2ΔAlHV-1-infected LGLs compared to controls. In functional assays, A2ΔAlHV-1-infected LGLs were significantly less cytotoxic than wtAlHV-1- and A2revAlHV-1-infected LGLs using rabbit corneal epithelial cells (SIRC) as targets. This implies that A2 is involved in a pathway enhancing the expression of LGL cytotoxicity. This is important as virus-infected T cell cytotoxicity in vivo has been suggested as a potential mechanism of disease induction in MCF. PMID:24732177

  13. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

    PubMed Central

    De la Cruz, Miguel A.; Pérez-Morales, Deyanira; Palacios, Irene J.; Fernández-Mora, Marcos; Calva, Edmundo; Bustamante, Víctor H.

    2015-01-01

    Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella. PMID:26300871

  14. Widespread Inducible Transcription Downstream of Human Genes

    PubMed Central

    Vilborg, Anna; Passarelli, Maria C.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.

    2015-01-01

    Summary Pervasive transcription of the human genome generates RNAs whose mode of formation and functions are largely uncharacterized. Here, we combine RNA-Seq with detailed mechanistic studies to describe a transcript type derived from protein-coding genes. The resulting RNAs, which we call DoGs for downstream of gene containing transcripts, possess long non-coding regions (often >45 kb) and remain chromatin bound. DoGs are inducible by osmotic stress through an IP3 receptor signaling-dependent pathway, indicating active regulation. DoG levels are increased by decreased termination of the upstream transcript, a previously undescribed mechanism for rapid transcript induction. Relative depletion of polyA signals in DoG regions correlates with increased levels of DoGs after osmotic stress. We detect DoG transcription in several human cell lines and provide evidence for thousands of DoGs genome-wide. PMID:26190259

  15. Transcription of denitrification genes and kinetics of NO, N2O and N2 by soil bacteria as affected by pH

    NASA Astrophysics Data System (ADS)

    Liu, B.; Bakken, L. R.; Frostegard, A.

    2010-12-01

    Nitrous oxide (N2O), which is to a large part derived from denitrification in soil, is a major greenhouse gas and was also recently shown to be the single most important ozone-depleting substance. Previous studies demonstrate that the N2O/N2 product ratio of denitrification is strongly dependent on pH, increasing with decreasing soil pH. The mechanisms involved are, however, poorly understood. We here present an investigation of soils from a long-term liming experiment. Since it is difficult to control which pH is actually experienced by bacterial cells in intact soils, we extracted cells on a Nycodenz gradient and exposed them to different pH levels. Bacteria extracted from soils of 3 different pHs (4.0, 6.1 and 8.0) were incubated in minimal medium supplemented with nitrate (2mM) and glutamic acid (5 mM), buffered at three pH levels (5.7, 6.1 and 7.6). Both the pH of the medium and original soil pH showed profound effect on the denitrification activity in terms of gas emission kinetics. N2O reductase (N2OR) activity was only present when cells from the high pH soils (pH 6.1 and 8.0) were exposed to high pH medium (pH 7.6). Functional genes (nirS, nirK and nosZ) and their transcripts were quantified in the extracts from pH6.1-soil. A 10-25 fold higher expression of nosZ vs nirS was found when incubated at pH 7.6 compared to pH 6.1 and 5.7. The low but significant transcription of nosZ at pH 6.1 and 5.7 did not result in detectable N2O reduction however. Cells that had been allowed to assemble their proteome while growing in pH7 medium showed N2OR activity which was practically unaffected by pH within the range 5-7. On the contrary, no N2OR activity was detected if the proteome had been formed at pH 6. The cells extracted from acid soils (pH 5.8 and 6.1) showed very low nosZ transcritption and no N2OR activity if exposed to pH 7 during the transition from oxic to anoxic conditions, suggesting an adaptation to low pH in the sense that they do not transcribe the gene

  16. Methylation Affects Transposition and Splicing of a Large CACTA Transposon from a MYB Transcription Factor Regulating Anthocyanin Synthase Genes in Soybean Seed Coats

    PubMed Central

    Zabala, Gracia; Vodkin, Lila O.

    2014-01-01

    We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-rm is homozygous for a mutable allele (rm) that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-rm line had a 13 kb CACTA subfamily transposon insertion (designated TgmR*) at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3) to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-rm progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element. PMID:25369033

  17. Aeromonas hydrophila Lateral Flagellar Gene Transcriptional Hierarchy

    PubMed Central

    Wilhelms, Markus; Gonzalez, Victor; Merino, Susana

    2013-01-01

    Aeromonas hydrophila AH-3 lateral flagella are not assembled when bacteria grow in liquid media; however, lateral flagellar genes are transcribed. Our results indicate that A. hydrophila lateral flagellar genes are transcribed at three levels (class I to III genes) and share some similarities with, but have many important differences from, genes of Vibrio parahaemolyticus. A. hydrophila lateral flagellum class I gene transcription is σ70 dependent, which is consistent with the fact that lateral flagellum is constitutively transcribed, in contrast to the characteristics of V. parahaemolyticus. The fact that multiple genes are included in class I highlights that lateral flagellar genes are less hierarchically transcribed than polar flagellum genes. The A. hydrophila lafK-fliEJL gene cluster (where the subscript L distinguishes genes for lateral flagella from those for polar flagella) is exclusively from class I and is in V. parahaemolyticus class I and II. Furthermore, the A. hydrophila flgAMNL cluster is not transcribed from the σ54/LafK-dependent promoter and does not contain class II genes. Here, we propose a gene transcriptional hierarchy for the A. hydrophila lateral flagella. PMID:23335410

  18. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation

    PubMed Central

    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim Ø.; Usheva, Anny

    2010-01-01

    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA contacts. We use this effect to establish the separate contributions of transcription factor binding and DNA dynamics to transcriptional activity. Our results argue against a purely ‘transcription factor-centric’ view of transcription initiation, suggesting that both DNA dynamics and transcription factor binding are necessary conditions for transcription initiation. PMID:20019064

  19. Synaptic, transcriptional, and chromatin genes disrupted in autism

    PubMed Central

    De Rubeis, Silvia; He, Xin; Goldberg, Arthur P.; Poultney, Christopher S.; Samocha, Kaitlin; Cicek, A Ercument; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarjinder; Klei, Lambertus; Kosmicki, Jack; Fu, Shih-Chen; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F.; Brownfeld, Jessica M.; Cai, Jinlu; Campbell, Nicholas J.; Carracedo, Angel; Chahrour, Maria H.; Chiocchetti, Andreas G.; Coon, Hilary; Crawford, Emily L.; Crooks, Lucy; Curran, Sarah R.; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A.; Gallagher, Louise; Geller, Evan; Guter, Stephen J.; Hill, R. Sean; Ionita-Laza, Iuliana; Gonzalez, Patricia Jimenez; Kilpinen, Helena; Klauck, Sabine M.; Kolevzon, Alexander; Lee, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R.; McInnes, Alison L.; Neale, Benjamin; Owen, Michael J.; Ozaki, Norio; Parellada, Mara; Parr, Jeremy R.; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J.; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Wang, Li-San; Weiss, Lauren A.; Willsey, A. Jeremy; Yu, Timothy W.; Yuen, Ryan K.C.; Cook, Edwin H.; Freitag, Christine M.; Gill, Michael; Hultman, Christina M.; Lehner, Thomas; Palotie, Aarno; Schellenberg, Gerard D.; Sklar, Pamela; State, Matthew W.; Sutcliffe, James S.; Walsh, Christopher A.; Scherer, Stephen W.; Zwick, Michael E.; Barrett, Jeffrey C.; Cutler, David J.; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J.; Buxbaum, Joseph D.

    2014-01-01

    Summary The genetic architecture of autism spectrum disorder involves the interplay of common and rare variation and their impact on hundreds of genes. Using exome sequencing, analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, and a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic, transcriptional, and chromatin remodeling pathways. These include voltage-gated ion channels regulating propagation of action potentials, pacemaking, and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodelers, prominently histone post-translational modifications involving lysine methylation/demethylation. PMID:25363760

  20. Transcriptional enhancer from milk protein genes

    DOEpatents

    Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.

    1999-01-01

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  1. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    SciTech Connect

    Tennyson, C.N.; Worton, R.G.

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  2. Modular composition of gene transcription networks.

    PubMed

    Gyorgy, Andras; Del Vecchio, Domitilla

    2014-03-01

    Predicting the dynamic behavior of a large network from that of the composing modules is a central problem in systems and synthetic biology. Yet, this predictive ability is still largely missing because modules display context-dependent behavior. One cause of context-dependence is retroactivity, a phenomenon similar to loading that influences in non-trivial ways the dynamic performance of a module upon connection to other modules. Here, we establish an analysis framework for gene transcription networks that explicitly accounts for retroactivity. Specifically, a module's key properties are encoded by three retroactivity matrices: internal, scaling, and mixing retroactivity. All of them have a physical interpretation and can be computed from macroscopic parameters (dissociation constants and promoter concentrations) and from the modules' topology. The internal retroactivity quantifies the effect of intramodular connections on an isolated module's dynamics. The scaling and mixing retroactivity establish how intermodular connections change the dynamics of connected modules. Based on these matrices and on the dynamics of modules in isolation, we can accurately predict how loading will affect the behavior of an arbitrary interconnection of modules. We illustrate implications of internal, scaling, and mixing retroactivity on the performance of recurrent network motifs, including negative autoregulation, combinatorial regulation, two-gene clocks, the toggle switch, and the single-input motif. We further provide a quantitative metric that determines how robust the dynamic behavior of a module is to interconnection with other modules. This metric can be employed both to evaluate the extent of modularity of natural networks and to establish concrete design guidelines to minimize retroactivity between modules in synthetic systems.

  3. Asymmetric Regulation of Peripheral Genes by Two Transcriptional Regulatory Networks

    PubMed Central

    Li, Jing-Ru; Suzuki, Takahiro; Nishimura, Hajime; Kishima, Mami; Maeda, Shiori; Suzuki, Harukazu

    2016-01-01

    Transcriptional regulatory network (TRN) reconstitution and deconstruction occur simultaneously during reprogramming; however, it remains unclear how the starting and targeting TRNs regulate the induction and suppression of peripheral genes. Here we analyzed the regulation using direct cell reprogramming from human dermal fibroblasts to monocytes as the platform. We simultaneously deconstructed fibroblastic TRN and reconstituted monocytic TRN; monocytic and fibroblastic gene expression were analyzed in comparison with that of fibroblastic TRN deconstruction only or monocytic TRN reconstitution only. Global gene expression analysis showed cross-regulation of TRNs. Detailed analysis revealed that knocking down fibroblastic TRN positively affected half of the upregulated monocytic genes, indicating that intrinsic fibroblastic TRN interfered with the expression of induced genes. In contrast, reconstitution of monocytic TRN showed neutral effects on the majority of fibroblastic gene downregulation. This study provides an explicit example that demonstrates how two networks together regulate gene expression during cell reprogramming processes and contributes to the elaborate exploration of TRNs. PMID:27483142

  4. Angiotensinogen Gene Transcription in Pulmonary Fibrosis

    PubMed Central

    Uhal, Bruce D.; Dang, My-Trang T.; Li, Xiaopeng; Abdul-Hafez, Amal

    2012-01-01

    An established body of literature supports the hypothesis that activation of a local tissue angiotensin (ANG) system in the extravascular tissue compartment of the lungs is required for lung fibrogenesis. Transcriptional activation of the angiotensinogen (AGT) gene is believed to be a critical and necessary step in this activation. This paper summarizes the data in support of this theory and discusses transcriptional regulation of AGT, with an emphasis on lung AGT synthesis as a determinant of fibrosis severity. Genetic data linking AGT polymorphisms to the severity of disease in Idiopathic Pulmonary Fibrosis are also discussed. PMID:22500179

  5. Regulation of gene transcription by Polycomb proteins

    PubMed Central

    Aranda, Sergi; Mas, Gloria; Di Croce, Luciano

    2015-01-01

    The Polycomb group (PcG) of proteins defines a subset of factors that physically associate and function to maintain the positional identity of cells from the embryo to adult stages. PcG has long been considered a paradigmatic model for epigenetic maintenance of gene transcription programs. Despite intensive research efforts to unveil the molecular mechanisms of action of PcG proteins, several fundamental questions remain unresolved: How many different PcG complexes exist in mammalian cells? How are PcG complexes targeted to specific loci? How does PcG regulate transcription? In this review, we discuss the diversity of PcG complexes in mammalian cells, examine newly identified modes of recruitment to chromatin, and highlight the latest insights into the molecular mechanisms underlying the function of PcGs in transcription regulation and three-dimensional chromatin conformation. PMID:26665172

  6. Combinatorial Transcription Control in Gene Regulation

    NASA Astrophysics Data System (ADS)

    Hwa, Terence; Buchler, Nicolas E.; Gerland, Ulrich

    2003-03-01

    We develop a simple thermodynamic model for the regulation of gene transcription and explore the limits of combinatorial control. Our model is based on the ``regulated recruitment'' mechanism [M. Ptashne and A. Gann, Nature 386 (1997) 569], assuming weak contact interaction between the regulatory proteins together with specific protein-DNA interactions. We further assume "programmability" in the strengths of these interactions within a biophysically allowed range [U. Gerland, J.D. Moroz, and T.Hwa, PNAS 99 (2002) 12015], through the choices and the locations of the protein-binding DNA sequences in the regulatory region. Within our thermodynamic model, we demonstrate the implementability of various binary logic functions (including XOR) by computing the degree of gene transcription (output) for all combinations of regulatory protein concentrations (input).

  7. Bidirectional Transcription Directs Both Transcriptional Gene Activation and Suppression in Human Cells

    PubMed Central

    Morris, Kevin V.; Santoso, Sharon; Turner, Anne-Marie; Pastori, Chiara; Hawkins, Peter G.

    2008-01-01

    Small RNAs targeted to gene promoters in human cells have been shown to modulate both transcriptional gene suppression and activation. However, the mechanism involved in transcriptional activation has remained poorly defined, and an endogenous RNA trigger for transcriptional gene silencing has yet to be identified. Described here is an explanation for siRNA-directed transcriptional gene activation, as well as a role for non-coding antisense RNAs as effector molecules driving transcriptional gene silencing. Transcriptional activation of p21 gene expression was determined to be the result of Argonaute 2–dependent, post-transcriptional silencing of a p21-specific antisense transcript, which functions in Argonaute 1–mediated transcriptional control of p21 mRNA expression. The data presented here suggest that in human cells, bidirectional transcription is an endogenous gene regulatory mechanism whereby an antisense RNA directs epigenetic regulatory complexes to a sense promoter, resulting in RNA-directed epigenetic gene regulation. The observations presented here support the notion that epigenetic silencing of tumor suppressor genes, such as p21, may be the result of an imbalance in bidirectional transcription levels. This imbalance allows the unchecked antisense RNA to direct silent state epigenetic marks to the sense promoter, resulting in stable transcriptional gene silencing. PMID:19008947

  8. Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver

    PubMed Central

    Atger, Florian; Gobet, Cédric; Marquis, Julien; Martin, Eva; Wang, Jingkui; Weger, Benjamin; Lefebvre, Grégory; Descombes, Patrick; Naef, Felix; Gachon, Frédéric

    2015-01-01

    Diurnal oscillations of gene expression are a hallmark of rhythmic physiology across most living organisms. Such oscillations are controlled by the interplay between the circadian clock and feeding rhythms. Although rhythmic mRNA accumulation has been extensively studied, comparatively less is known about their transcription and translation. Here, we quantified simultaneously temporal transcription, accumulation, and translation of mouse liver mRNAs under physiological light–dark conditions and ad libitum or night-restricted feeding in WT and brain and muscle Arnt-like 1 (Bmal1)-deficient animals. We found that rhythmic transcription predominantly drives rhythmic mRNA accumulation and translation for a majority of genes. Comparison of wild-type and Bmal1 KO mice shows that circadian clock and feeding rhythms have broad impact on rhythmic gene expression, Bmal1 deletion affecting surprisingly both transcriptional and posttranscriptional levels. Translation efficiency is differentially regulated during the diurnal cycle for genes with 5′-Terminal Oligo Pyrimidine tract (5′-TOP) sequences and for genes involved in mitochondrial activity, many harboring a Translation Initiator of Short 5′-UTR (TISU) motif. The increased translation efficiency of 5′-TOP and TISU genes is mainly driven by feeding rhythms but Bmal1 deletion also affects amplitude and phase of translation, including TISU genes. Together this study emphasizes the complex interconnections between circadian and feeding rhythms at several steps ultimately determining rhythmic gene expression and translation. PMID:26554015

  9. Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes

    PubMed Central

    Pérez-Montarelo, Dafne; Fernández, Almudena; Barragán, Carmen; Noguera, Jose L.; Folch, Josep M.; Rodríguez, M. Carmen; Óvilo, Cristina; Silió, Luis; Fernández, Ana I.

    2013-01-01

    The leptin (LEP) and its receptor (LEPR) regulate food intake and energy balance through hypothalamic signaling. However, the LEP-LEPR axis seems to be more complex and its expression regulation has not been well described. In pigs, LEP and LEPR genes have been widely studied due to their relevance. Previous studies reported significant effects of SNPs located in both genes on growth and fatness traits. The aim of this study was to determine the expression profiles of LEP and LEPR across hypothalamic, adipose, hepatic and muscle tissues in Iberian x Landrace backcrossed pigs and to analyze the effects of gene variants on transcript abundance. To our knowledge, non porcine LEPR isoforms have been described rather than LEPRb. A short porcine LEPR isoform (LEPRa), that encodes a protein lacking the intracellular residues responsible of signal transduction, has been identified for the first time. The LEPRb isoform was only quantifiable in hypothalamus while LEPRa appeared widely expressed across tissues, but at higher levels in liver, suggesting that both isoforms would develop different roles. The unique LEP transcript showed expression in backfat and muscle. The effects of gene variants on transcript expression revealed interesting results. The LEPRc.1987C>T polymorphism showed opposite effects on LEPRb and LEPRa hypothalamic expression. In addition, one out of the 16 polymorphisms identified in the LEPR promoter region revealed high differential expression in hepatic LEPRa. These results suggest a LEPR isoform-specific regulation at tissue level. Conversely, non-differential expression of LEP conditional on the analyzed polymorphisms could be detected, indicating that its regulation is likely affected by other mechanisms rather than gene sequence variants. The present study has allowed a transcriptional characterization of LEP and LEPR isoforms on a range of tissues. Their expression patterns seem to indicate that both molecules develop peripheral roles apart from

  10. Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes.

    PubMed

    Pérez-Montarelo, Dafne; Fernández, Almudena; Barragán, Carmen; Noguera, Jose L; Folch, Josep M; Rodríguez, M Carmen; Ovilo, Cristina; Silió, Luis; Fernández, Ana I

    2013-01-01

    The leptin (LEP) and its receptor (LEPR) regulate food intake and energy balance through hypothalamic signaling. However, the LEP-LEPR axis seems to be more complex and its expression regulation has not been well described. In pigs, LEP and LEPR genes have been widely studied due to their relevance. Previous studies reported significant effects of SNPs located in both genes on growth and fatness traits. The aim of this study was to determine the expression profiles of LEP and LEPR across hypothalamic, adipose, hepatic and muscle tissues in Iberian x Landrace backcrossed pigs and to analyze the effects of gene variants on transcript abundance. To our knowledge, non porcine LEPR isoforms have been described rather than LEPRb. A short porcine LEPR isoform (LEPRa), that encodes a protein lacking the intracellular residues responsible of signal transduction, has been identified for the first time. The LEPRb isoform was only quantifiable in hypothalamus while LEPRa appeared widely expressed across tissues, but at higher levels in liver, suggesting that both isoforms would develop different roles. The unique LEP transcript showed expression in backfat and muscle. The effects of gene variants on transcript expression revealed interesting results. The LEPRc.1987C>T polymorphism showed opposite effects on LEPRb and LEPRa hypothalamic expression. In addition, one out of the 16 polymorphisms identified in the LEPR promoter region revealed high differential expression in hepatic LEPRa. These results suggest a LEPR isoform-specific regulation at tissue level. Conversely, non-differential expression of LEP conditional on the analyzed polymorphisms could be detected, indicating that its regulation is likely affected by other mechanisms rather than gene sequence variants. The present study has allowed a transcriptional characterization of LEP and LEPR isoforms on a range of tissues. Their expression patterns seem to indicate that both molecules develop peripheral roles apart from

  11. Post-transcriptional gene silencing, transcriptional gene silencing and human immunodeficiency virus

    PubMed Central

    Méndez, Catalina; Ahlenstiel, Chantelle L; Kelleher, Anthony D

    2015-01-01

    While human immunodeficiency virus 1 (HIV-1) infection is controlled through continuous, life-long use of a combination of drugs targeting different steps of the virus cycle, HIV-1 is never completely eradicated from the body. Despite decades of research there is still no effective vaccine to prevent HIV-1 infection. Therefore, the possibility of an RNA interference (RNAi)-based cure has become an increasingly explored approach. Endogenous gene expression is controlled at both, transcriptional and post-transcriptional levels by non-coding RNAs, which act through diverse molecular mechanisms including RNAi. RNAi has the potential to control the turning on/off of specific genes through transcriptional gene silencing (TGS), as well as fine-tuning their expression through post-transcriptional gene silencing (PTGS). In this review we will describe in detail the canonical RNAi pathways for PTGS and TGS, the relationship of TGS with other silencing mechanisms and will discuss a variety of approaches developed to suppress HIV-1 via manipulation of RNAi. We will briefly compare RNAi strategies against other approaches developed to target the virus, highlighting their potential to overcome the major obstacle to finding a cure, which is the specific targeting of the HIV-1 reservoir within latently infected cells. PMID:26279984

  12. Neurotoxocarosis alters myelin protein gene transcription and expression.

    PubMed

    Heuer, Lea; Beyerbach, Martin; Lühder, Fred; Beineke, Andreas; Strube, Christina

    2015-06-01

    Neurotoxocarosis is an infection of the central nervous system caused by migrating larvae of the common dog and cat roundworms (Toxocara canis and Toxocara cati), which are zoonotic agents. As these parasites are prevalent worldwide and neuropathological and molecular investigations on neurotoxocarosis are scare, this study aims to characterise nerve fibre demyelination associated with neurotoxocarosis on a molecular level. Transcription of eight myelin-associated genes (Cnp, Mag, Mbp, Mog, Mrf-1, Nogo-A, Plp1, Olig2) was determined in the mouse model during six time points of the chronic phase of infection using qRT-PCR. Expression of selected proteins was analysed by Western blotting or immunohistochemistry. Additionally, demyelination and neuronal damage were investigated histologically. Significant differences (p ≤ 0.05) between transcription rates of T. canis-infected and uninfected control mice were detected for all analysed genes while T. cati affected five of eight investigated genes. Interestingly, 2', 3 ´-cyclic nucleotide 3'-phosphodiesterase (Cnp) and myelin oligodendrocyte glycoprotein (Mog) were upregulated in both T. canis- and T. cati-infected mice preceding demyelination. Later, CNPase expression was additionally enhanced. As expected, myelin basic protein (Mbp) was downregulated in cerebra and cerebella of T. canis-infected mice when severe demyelination was present 120 days post infectionem (dpi). The transcriptional pattern observed in the present study appears to reflect direct traumatic and hypoxic effects of larval migration as well as secondary processes including host immune reactions, demyelination and attempts to remyelinate damaged areas.

  13. Synaptic, transcriptional and chromatin genes disrupted in autism.

    PubMed

    De Rubeis, Silvia; He, Xin; Goldberg, Arthur P; Poultney, Christopher S; Samocha, Kaitlin; Cicek, A Erucment; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarinder; Klei, Lambertus; Kosmicki, Jack; Shih-Chen, Fu; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F; Brownfeld, Jessica M; Cai, Jinlu; Campbell, Nicholas G; Carracedo, Angel; Chahrour, Maria H; Chiocchetti, Andreas G; Coon, Hilary; Crawford, Emily L; Curran, Sarah R; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A; Gallagher, Louise; Geller, Evan; Guter, Stephen J; Hill, R Sean; Ionita-Laza, Juliana; Jimenz Gonzalez, Patricia; Kilpinen, Helena; Klauck, Sabine M; Kolevzon, Alexander; Lee, Irene; Lei, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R; McInnes, Alison L; Neale, Benjamin; Owen, Michael J; Ozaki, Noriio; Parellada, Mara; Parr, Jeremy R; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Li-San, Wang; Weiss, Lauren A; Willsey, A Jeremy; Yu, Timothy W; Yuen, Ryan K C; Cook, Edwin H; Freitag, Christine M; Gill, Michael; Hultman, Christina M; Lehner, Thomas; Palotie, Aaarno; Schellenberg, Gerard D; Sklar, Pamela; State, Matthew W; Sutcliffe, James S; Walsh, Christiopher A; Scherer, Stephen W; Zwick, Michael E; Barett, Jeffrey C; Cutler, David J; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J; Buxbaum, Joseph D

    2014-11-13

    The genetic architecture of autism spectrum disorder involves the interplay of common and rare variants and their impact on hundreds of genes. Using exome sequencing, here we show that analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, plus a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic formation, transcriptional regulation and chromatin-remodelling pathways. These include voltage-gated ion channels regulating the propagation of action potentials, pacemaking and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodellers-most prominently those that mediate post-translational lysine methylation/demethylation modifications of histones.

  14. Divergence of the yeast transcription factor FZF1 affects sulfite resistance.

    PubMed

    Engle, Elizabeth K; Fay, Justin C

    2012-01-01

    Changes in gene expression are commonly observed during evolution. However, the phenotypic consequences of expression divergence are frequently unknown and difficult to measure. Transcriptional regulators provide a mechanism by which phenotypic divergence can occur through multiple, coordinated changes in gene expression during development or in response to environmental changes. Yet, some changes in transcriptional regulators may be constrained by their pleiotropic effects on gene expression. Here, we use a genome-wide screen for promoters that are likely to have diverged in function and identify a yeast transcription factor, FZF1, that has evolved substantial differences in its ability to confer resistance to sulfites. Chimeric alleles from four Saccharomyces species show that divergence in FZF1 activity is due to changes in both its coding and upstream noncoding sequence. Between the two closest species, noncoding changes affect the expression of FZF1, whereas coding changes affect the expression of SSU1, a sulfite efflux pump activated by FZF1. Both coding and noncoding changes also affect the expression of many other genes. Our results show how divergence in the coding and promoter region of a transcription factor alters the response to an environmental stress.

  15. Trans-Reactivation: A New Epigenetic Phenomenon Underlying Transcriptional Reactivation of Silenced Genes.

    PubMed

    Onorati, Maria Cristina; Arancio, Walter; Cavalieri, Vincenzo; Ingrassia, Antonia M R; Pavesi, Giulio; Corona, Davide F V

    2015-08-01

    In order to study the role played by cellular RNA pools produced by homologous genomic loci in defining the transcriptional state of a silenced gene, we tested the effect of non-functional alleles of the white gene in the presence of a functional copy of white, silenced by heterochromatin. We found that non-functional alleles of white, unable to produce a coding transcript, could reactivate in trans the expression of a wild type copy of the same gene silenced by heterochromatin. This new epigenetic phenomenon of transcriptional trans-reactivation is heritable, relies on the presence of homologous RNA's and is affected by mutations in genes involved in post-transcriptional gene silencing. Our data suggest a general new unexpected level of gene expression control mediated by homologous RNA molecules in the context of heterochromatic genes. PMID:26292210

  16. Evaluation of quantitative polymerase chain reaction-based approaches for determining gene copy and gene transcript numbers in environmental samples.

    PubMed

    Smith, Cindy J; Nedwell, David B; Dong, Liang F; Osborn, A Mark

    2006-05-01

    Quantitative polymerase chain reaction (Q-PCR) amplification is widely applied for determining gene and transcript numbers within environmental samples. This research evaluated Q-PCR reproducibility via TaqMan assays quantifying 16S rRNA gene and transcript numbers in sediments, within and between replicate Q-PCR assays. Intra-assay variation in 16S rRNA gene numbers in replicate DNA samples was low (coefficients of variation; CV from 3.2 to 5.2%). However, variability increased using replicated standard curves within separate Q-PCR assays (CV from 11.2% to 26%), indicating absolute comparison of gene numbers between Q-PCR assays was less reliable. 16S rRNA transcript quantification was evaluated using standard curves of diluted RNA or cDNA (before, or following, reverse transcription). These standard curves were statistically different with cDNA-derived curves giving higher r(2) values and Q-PCR efficiencies. Template concentrations used in Q-PCR also affected 16S rRNA gene and transcript numbers. For DNA, 10(-3) dilutions yielded higher gene numbers than 10(-1) and 10(-2) dilutions. Conversely, RNA template dilution reduced numbers of transcripts detected. Finally, different nucleic acid isolation methods also resulted in gene and transcript number variability. This research demonstrates Q-PCR determination of absolute numbers of genes and transcripts using environmental nucleic acids should be treated cautiously.

  17. Differential sensitivities of transcription factor target genes underlie cell type-specific gene expression profiles

    PubMed Central

    Johnson, Kirby D.; Kim, Shin-Il; Bresnick, Emery H.

    2006-01-01

    Changes in transcription factor levels and activities dictate developmental fate. Such a change might affect the full ensemble of target genes for a factor or only uniquely sensitive targets. We investigated the relationship among activity of the hematopoietic transcription factor GATA-1, chromatin occupancy, and target gene sensitivity. Graded activation of GATA-1 in GATA-1-null cells revealed high-, intermediate-, and low-sensitivity targets. GATA-1 activity requirements for occupancy and transcription often correlated. A GATA-1 amino-terminal deletion mutant severely deregulated the low-sensitivity gene Tac-2. Thus, cells expressing different levels of a cell type-specific activator can have qualitatively distinct target gene expression patterns, and factor mutations preferentially deregulate low-sensitivity genes. Unlike other target genes, GATA-1-mediated Tac-2 regulation was bimodal, with activation followed by repression, and the coregulator Friend of GATA-1 (FOG-1) selectively mediated repression. A GATA-1 mutant defective in FOG-1 binding occupied a Tac-2 regulatory region at levels higher than wild-type GATA-1, whereas FOG-1 facilitated chromatin occupancy at a distinct target site. These results indicate that FOG-1 is a determinant of GATA factor target gene sensitivity by either facilitating or opposing chromatin occupancy. PMID:17043224

  18. Post-transcriptional RNA Regulons Affecting Cell Cycle and Proliferation

    PubMed Central

    Blackinton, Jeff G.

    2014-01-01

    The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

  19. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders.

    PubMed

    Davis, Kasey N; Tao, Ran; Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C; Lipska, Barbara K; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R; Kleinman, Joel E; Hyde, Thomas M

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders. PMID:26848839

  20. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders.

    PubMed

    Davis, Kasey N; Tao, Ran; Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C; Lipska, Barbara K; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R; Kleinman, Joel E; Hyde, Thomas M

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders.

  1. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders

    PubMed Central

    Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C.; Lipska, Barbara K.; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R.; Kleinman, Joel E.; Hyde, Thomas M.

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders. PMID:26848839

  2. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  3. Cohesin modulates transcription of estrogen-responsive genes.

    PubMed

    Antony, Jisha; Dasgupta, Tanushree; Rhodes, Jenny M; McEwan, Miranda V; Print, Cristin G; O'Sullivan, Justin M; Horsfield, Julia A

    2015-03-01

    The cohesin complex has essential roles in cell division, DNA damage repair and gene transcription. The transcriptional function of cohesin is thought to derive from its ability to connect distant regulatory elements with gene promoters. Genome-wide binding of cohesin in breast cancer cells frequently coincides with estrogen receptor alpha (ER), leading to the hypothesis that cohesin facilitates estrogen-dependent gene transcription. We found that cohesin modulates the expression of only a subset of genes in the ER transcription program, either activating or repressing transcription depending on the gene target. Estrogen-responsive genes most significantly influenced by cohesin were enriched in pathways associated with breast cancer progression such as PI3K and ErbB1. In MCF7 breast cancer cells, cohesin depletion enhanced transcription of TFF1 and TFF2, and was associated with increased ER binding and increased interaction between TFF1 and its distal enhancer situated within TMPRSS3. In contrast, cohesin depletion reduced c-MYC mRNA and was accompanied by reduced interaction between a distal enhancer of c-MYC and its promoters. Our data indicates that cohesin is not a universal facilitator of ER-induced transcription and can even restrict enhancer-promoter communication. We propose that cohesin modulates transcription of estrogen-dependent genes to achieve appropriate directionality and amplitude of expression.

  4. Transcriptional and post-transcriptional regulation of chloroplast gene expression in Petunia hybrida.

    PubMed

    van Grinsven, M Q; Gielen, J J; Zethof, J L; Nijkamp, H J; Kool, A J

    1986-11-01

    To study the control of differential gene expression during plastid biogenesis in Petunia hybrida, we have investigated the in vivo translation and transcription of the rbc L gene, coding for the large subunit of ribulose bisphosphate carboxylase (LSU), and the psa A gene, coding for P700 chlorophyll-a apoprotein (AP700). Differential expression of these plastid-encoded genes was studied in two developmentally different plastid systems, proplastid-like organelles from the green cell suspension AK2401 and mature chloroplasts from green leaves. In vivo translation of rbc L and psa A transcripts was analysed using specific antibodies. Specific transcript levels were analysed using internal fragments of the rbc L and psa A genes. A standardization procedure was used so that a direct correlation could be made between the amount of products and gene copy number. In Petunia hybrida the amount of LSU polypeptides present in both plastid types does not correspond to the amount of specific mRNA for the gene. Although the rbc L transcripts are present in both plastid types, the LSU protein is only present in green leaf plastids and not in cell culture plastids. In vitro translation of isolated rbc L transcripts give similar results, thereby suggesting that differences in the primary structure of the transcripts are responsible for the observed discrepancy. In contrast to this, the amount of AP700 polypeptides does correspond to the amount of the psa A transcripts. Therefore, our results indicate that the expression of chloroplast genes during plastid biogenesis takes place on at least two different levels: expression of the rbc L gene is regulated post-transcriptionally while expression of the psa A gene is regulated at the transcriptional level.

  5. A Complete Set of Nascent Transcription Rates for Yeast Genes

    PubMed Central

    Pelechano, Vicent; Chávez, Sebastián; Pérez-Ortín, José E.

    2010-01-01

    The amount of mRNA in a cell is the result of two opposite reactions: transcription and mRNA degradation. These reactions are governed by kinetics laws, and the most regulated step for many genes is the transcription rate. The transcription rate, which is assumed to be exercised mainly at the RNA polymerase recruitment level, can be calculated using the RNA polymerase densities determined either by run-on or immunoprecipitation using specific antibodies. The yeast Saccharomyces cerevisiae is the ideal model organism to generate a complete set of nascent transcription rates that will prove useful for many gene regulation studies. By combining genomic data from both the GRO (Genomic Run-on) and the RNA pol ChIP-on-chip methods we generated a new, more accurate nascent transcription rate dataset. By comparing this dataset with the indirect ones obtained from the mRNA stabilities and mRNA amount datasets, we are able to obtain biological information about posttranscriptional regulation processes and a genomic snapshot of the location of the active transcriptional machinery. We have obtained nascent transcription rates for 4,670 yeast genes. The median RNA polymerase II density in the genes is 0.078 molecules/kb, which corresponds to an average of 0.096 molecules/gene. Most genes have transcription rates of between 2 and 30 mRNAs/hour and less than 1% of yeast genes have >1 RNA polymerase molecule/gene. Histone and ribosomal protein genes are the highest transcribed groups of genes and other than these exceptions the transcription of genes is an infrequent phenomenon in a yeast cell. PMID:21103382

  6. The relationship between gene transcription and combinations of histone modifications

    NASA Astrophysics Data System (ADS)

    Cui, Xiangjun; Li, Hong; Luo, Liaofu

    2012-09-01

    Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

  7. Neurotoxocarosis alters myelin protein gene transcription and expression.

    PubMed

    Heuer, Lea; Beyerbach, Martin; Lühder, Fred; Beineke, Andreas; Strube, Christina

    2015-06-01

    Neurotoxocarosis is an infection of the central nervous system caused by migrating larvae of the common dog and cat roundworms (Toxocara canis and Toxocara cati), which are zoonotic agents. As these parasites are prevalent worldwide and neuropathological and molecular investigations on neurotoxocarosis are scare, this study aims to characterise nerve fibre demyelination associated with neurotoxocarosis on a molecular level. Transcription of eight myelin-associated genes (Cnp, Mag, Mbp, Mog, Mrf-1, Nogo-A, Plp1, Olig2) was determined in the mouse model during six time points of the chronic phase of infection using qRT-PCR. Expression of selected proteins was analysed by Western blotting or immunohistochemistry. Additionally, demyelination and neuronal damage were investigated histologically. Significant differences (p ≤ 0.05) between transcription rates of T. canis-infected and uninfected control mice were detected for all analysed genes while T. cati affected five of eight investigated genes. Interestingly, 2', 3 ´-cyclic nucleotide 3'-phosphodiesterase (Cnp) and myelin oligodendrocyte glycoprotein (Mog) were upregulated in both T. canis- and T. cati-infected mice preceding demyelination. Later, CNPase expression was additionally enhanced. As expected, myelin basic protein (Mbp) was downregulated in cerebra and cerebella of T. canis-infected mice when severe demyelination was present 120 days post infectionem (dpi). The transcriptional pattern observed in the present study appears to reflect direct traumatic and hypoxic effects of larval migration as well as secondary processes including host immune reactions, demyelination and attempts to remyelinate damaged areas. PMID:25773181

  8. Oxytocin Regulates Stress-Induced Crf Gene Transcription through CREB-Regulated Transcription Coactivator 3

    PubMed Central

    Jurek, Benjamin; Slattery, David A.; Hiraoka, Yuichi; Liu, Ying; Nishimori, Katsuhiko; Aguilera, Greti; van den Burg, Erwin H.

    2015-01-01

    The major regulator of the neuroendocrine stress response in the brain is corticotropin releasing factor (CRF), whose transcription is controlled by CREB and its cofactors CRTC2/3 (TORC2/3). Phosphorylated CRTCs are sequestered in the cytoplasm, but rapidly dephosphorylated and translocated into the nucleus following a stressful stimulus. As the stress response is attenuated by oxytocin (OT), we tested whether OT interferes with CRTC translocation and, thereby, Crf expression. OT (1 nmol, i.c.v.) delayed the stress-induced increase of nuclear CRTC3 and Crf hnRNA levels in the paraventricular nucleus of male rats and mice, but did not affect either parameter in the absence of the stressor. The increase in Crf hnRNA levels at later time points was parallel to elevated nuclear CRTC2/3 levels. A direct effect of Thr4 Gly7-OT (TGOT) on CRTC3 translocation and Crf expression was found in rat primary hypothalamic neurons, amygdaloid (Ar-5), hypothalamic (H32), and human neuroblastoma (Be(2)M17) cell lines. CRTC3, but not CRCT2, knockdown using siRNA in Be(2)M17 cells prevented the effect of TGOT on Crf hnRNA levels. Chromatin-immunoprecipitation demonstrated that TGOT reduced CRTC3, but not CRTC2, binding to the Crf promoter after 10 min of forskolin stimulation. Together, the results indicate that OT modulates CRTC3 translocation, the binding of CRTC3 to the Crf promoter and, ultimately, transcription of the Crf gene. SIGNIFICANCE STATEMENT The neuropeptide oxytocin has been proposed to reduce hypothalamic-pituitary-adrenal (HPA) axis activation during stress. The underlying mechanisms are, however, elusive. In this study we show that activation of the oxytocin receptor in the paraventricular nucleus delays transcription of the gene encoding corticotropin releasing factor (Crf), the main regulator of the stress response. It does so by sequestering the coactivator of the transcription factor CREB, CRTC3, in the cytosol, resulting in reduced binding of CRTC3 to the Crf

  9. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  10. A R2R3-MYB transcription factor, GmMYB12B2, affects the expression levels of flavonoid biosynthesis genes encoding key enzymes in transgenic Arabidopsis plants.

    PubMed

    Li, Xiao-Wei; Li, Jing-Wen; Zhai, Ying; Zhao, Yan; Zhao, Xu; Zhang, Hai-Jun; Su, Lian-Tai; Wang, Ying; Wang, Qing-Yu

    2013-12-10

    Isoflavones play diverse roles in plant-microbe interactions and are potentially important for human nutrition and health. To study the regulation of isoflavonoid synthesis in soybean, the R2R3-MYB transcription factor GmMYB12B2 was isolated and characterized. Yeast expression experiments demonstrated that GmMYB12B2 showed transcriptional activity. GmMYB12B2 was localized in the nucleus when it was transiently expressed in onion epidermal cells. Real-time quantitative PCR analysis revealed that GmMYB12B2 transcription was increased in roots and mature seeds compared with other organs. The gene expression level in immature embryos was consistent with the accumulation of isoflavones. CHS8 is a key enzyme in plant flavonoid biosynthesis. Transient expression experiments in soybean calli demonstrated that CHS8 was regulated by GmMYB12B2 and produced more fluorescence. The expression levels of some key enzymes in flavonoid biosynthesis were examined in transgenic Arabidopsis lines. The results showed that the expression levels of PAL1, CHS and FLS in transgenic plants were significantly higher than those in wild type plants. However, the expression level of DFR was lower, and the expression levels of CHI, F3H and F3'H were the same in all lines. GmMYB12B2 expression caused a constitutive increase in the accumulation of flavonoids in transgenic Arabidopsis lines compared with wild type plants. PMID:24060295

  11. A R2R3-MYB transcription factor, GmMYB12B2, affects the expression levels of flavonoid biosynthesis genes encoding key enzymes in transgenic Arabidopsis plants.

    PubMed

    Li, Xiao-Wei; Li, Jing-Wen; Zhai, Ying; Zhao, Yan; Zhao, Xu; Zhang, Hai-Jun; Su, Lian-Tai; Wang, Ying; Wang, Qing-Yu

    2013-12-10

    Isoflavones play diverse roles in plant-microbe interactions and are potentially important for human nutrition and health. To study the regulation of isoflavonoid synthesis in soybean, the R2R3-MYB transcription factor GmMYB12B2 was isolated and characterized. Yeast expression experiments demonstrated that GmMYB12B2 showed transcriptional activity. GmMYB12B2 was localized in the nucleus when it was transiently expressed in onion epidermal cells. Real-time quantitative PCR analysis revealed that GmMYB12B2 transcription was increased in roots and mature seeds compared with other organs. The gene expression level in immature embryos was consistent with the accumulation of isoflavones. CHS8 is a key enzyme in plant flavonoid biosynthesis. Transient expression experiments in soybean calli demonstrated that CHS8 was regulated by GmMYB12B2 and produced more fluorescence. The expression levels of some key enzymes in flavonoid biosynthesis were examined in transgenic Arabidopsis lines. The results showed that the expression levels of PAL1, CHS and FLS in transgenic plants were significantly higher than those in wild type plants. However, the expression level of DFR was lower, and the expression levels of CHI, F3H and F3'H were the same in all lines. GmMYB12B2 expression caused a constitutive increase in the accumulation of flavonoids in transgenic Arabidopsis lines compared with wild type plants.

  12. Transcriptional and Post-Transcriptional Regulation of Nucleotide Excision Repair Genes in Human Cells

    PubMed Central

    Lefkofsky, Hailey B.; Veloso, Artur; Ljungman, Mats

    2014-01-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  13. Negative elongation factor NELF controls transcription of immediate early genes in a stimulus-specific manner

    SciTech Connect

    Fujita, Toshitsugu; Piuz, Isabelle; Schlegel, Werner

    2009-01-15

    The transcription rate of immediate early genes (IEGs) is controlled directly by transcription elongation factors at the transcription elongation step. Negative elongation factor (NELF) and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) stall RNA polymerase II (pol II) soon after transcription initiation. Upon induction of IEG transcription, DSIF is converted into an accelerator for pol II elongation. To address whether and how NELF as well as DSIF controls overall IEG transcription, its expression was reduced using stable RNA interference in GH4C1 cells. NELF knock-down reduced thyrotropin-releasing hormone (TRH)-induced transcription of the IEGs c-fos, MKP-1, and junB. In contrast, epidermal growth factor (EGF)-induced transcription of these IEGs was unaltered or even slightly increased by NELF knock-down. Thus, stable knock-down of NELF affects IEG transcription stimulation-specifically. Conversely, DSIF knock-down reduced both TRH- and EGF-induced transcription of the three IEGs. Interestingly, TRH-induced activation of the MAP kinase pathway, a pathway essential for transcription of the three IEGs, was down-regulated by NELF knock-down. Thus, stable knock-down of NELF, by modulating intracellular signaling pathways, caused stimulation-specific loss of IEG transcription. These observations indicate that NELF controls overall IEG transcription via multiple mechanisms both directly and indirectly.

  14. Transcriptional regulation differs in affected facioscapulohumeral muscular dystrophy patients compared to asymptomatic related carriers

    PubMed Central

    Arashiro, Patricia; Eisenberg, Iris; Kho, Alvin T.; Cerqueira, Antonia M. P.; Canovas, Marta; Silva, Helga C. A.; Pavanello, Rita C. M.; Verjovski-Almeida, Sergio; Kunkel, Louis M.; Zatz, Mayana

    2009-01-01

    Facioscapulohumeral muscular dystrophy (FSHD) is a progressive muscle disorder that has been associated with a contraction of 3.3-kb repeats on chromosome 4q35. FSHD is characterized by a wide clinical inter- and intrafamilial variability, ranging from wheelchair-bound patients to asymptomatic carriers. Our study is unique in comparing the gene expression profiles from related affected, asymptomatic carrier, and control individuals. Our results suggest that the expression of genes on chromosome 4q is altered in affected and asymptomatic individuals. Remarkably, the changes seen in asymptomatic samples are largely in products of genes encoding several chemokines, whereas the changes seen in affected samples are largely in genes governing the synthesis of GPI-linked proteins and histone acetylation. Besides this, the affected patient and related asymptomatic carrier share the 4qA161 haplotype. Thus, these polymorphisms by themselves do not explain the pathogenicity of the contracted allele. Interestingly, our results also suggest that the miRNAs might mediate the regulatory network in FSHD. Together, our results support the previous evidence that FSHD may be caused by transcriptional dysregulation of multiple genes, in cis and in trans, and suggest some factors potentially important for FSHD pathogenesis. The study of the gene expression profiles from asymptomatic carriers and related affected patients is a unique approach to try to enhance our understanding of the missing link between the contraction in D4Z4 repeats and muscle disease, while minimizing the effects of differences resulting from genetic background. PMID:19339494

  15. Acetylation of RNA Polymerase II Regulates Growth-Factor-Induced Gene Transcription in Mammalian Cells

    PubMed Central

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A.; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S.; Capra, John A.; Schnölzer, Martina; Cole, Philip A.; Geyer, Matthias; Bruneau, Benoit G.; Adelman, Karen; Ott, Melanie

    2014-01-01

    SUMMARY Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes. PMID:24207025

  16. Expression profiling of muscle reveals transcripts differentially expressed in muscle that affect water-holding capacity of pork.

    PubMed

    Ponsuksili, Siriluck; Murani, Eduard; Phatsara, Chirawath; Jonas, Elisabeth; Walz, Christina; Schwerin, Manfred; Schellander, Karl; Wimmers, Klaus

    2008-11-12

    To identify biological processes as well as molecular markers for drip loss, a parameter for water holding capacity of meat, the M. longissimus dorsi transcriptomes of six divergent sib pairs were analyzed using Affymetrix Porcine Genome Array. Functional categories of differentially regulated transcripts were determined by single-gene analysis and gene set analysis. The transcripts being up-regulated at high drip loss belong to groups of genes functionally categorized as genes of membrane proteins, signal transduction, cell communication, response to stimulus, and cytoskeleton. Among genes down-regulated with high drip loss, functional groups of oxidoreductase activity, lipid metabolism, and electron transport were identified. Differential regulation of the abundance of transcripts of these biological networks in live muscle affect mortem biochemical processes of meat maturation. Knowledge of this functional link is indicative for the identification of candidate genes for improvement of meat quality. PMID:18922009

  17. Transcription mediated insulation and interference direct gene cluster expression switches.

    PubMed

    Nguyen, Tania; Fischl, Harry; Howe, Françoise S; Woloszczuk, Ronja; Serra Barros, Ana; Xu, Zhenyu; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane

    2014-11-19

    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change.

  18. Transcription mediated insulation and interference direct gene cluster expression switches

    PubMed Central

    Nguyen, Tania; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane

    2014-01-01

    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change. DOI: http://dx.doi.org/10.7554/eLife.03635.001 PMID:25407679

  19. Somatic hypermutation of immunoglobulin genes is linked to transcription initiation.

    PubMed

    Peters, A; Storb, U

    1996-01-01

    To identify DNA sequences that target the somatic hypermutation process, the immunoglobulin gene promoter located upstream of the variable (V) region was duplicated upstream of the constant (C) region of a kappa transgene. Normally, kappa genes are somatically mutated only in the VJ region, but not in the C region. In B cell hybridomas from mice with this kappa transgene (P5'C), both the VJ region and the C region, but not the region between them, were mutated at similar frequencies, suggesting that the mutation mechanism is related to transcription. The downstream promoter was not occluded by transcripts from the upstream promoter. In fact, the levels of transcripts originating from the two promoters were similar, supporting a mutation model based on initiation of transcripts. Several "hot-spots" of somatic mutation were noted, further demonstrating that this transgene has the hallmarks of somatic mutation of endogenous immunoglobulin genes. A model linking somatic mutation to transcription-coupled DNA repair is proposed.

  20. Characterizing transcriptional heterogeneity through pathway and gene set overdispersion analysis

    PubMed Central

    Fan, Jean; Salathia, Neeraj; Liu, Rui; Kaeser, Gwendolyn E.; Yung, Yun C.; Herman, Joseph L.; Kaper, Fiona; Fan, Jian-Bing; Zhang, Kun; Chun, Jerold; Kharchenko, Peter V.

    2016-01-01

    The transcriptional state of a cell reflects a variety of biological factors, from persistent cell-type specific features to transient processes such as cell cycle. Depending on biological context, all such aspects of transcriptional heterogeneity may be of interest, but detecting them from noisy single-cell RNA-seq data remains challenging. We developed PAGODA to resolve multiple, potentially overlapping aspects of transcriptional heterogeneity by testing gene sets for coordinated variability amongst measured cells. PMID:26780092

  1. Intracompartmental and Intercompartmental Transcriptional Networks Coordinate the Expression of Genes for Organellar Functions1[W

    PubMed Central

    Leister, Dario; Wang, Xi; Haberer, Georg; Mayer, Klaus F.X.; Kleine, Tatjana

    2011-01-01

    Genes for mitochondrial and chloroplast proteins are distributed between the nuclear and organellar genomes. Organelle biogenesis and metabolism, therefore, require appropriate coordination of gene expression in the different compartments to ensure efficient synthesis of essential multiprotein complexes of mixed genetic origin. Whereas organelle-to-nucleus signaling influences nuclear gene expression at the transcriptional level, organellar gene expression (OGE) is thought to be primarily regulated posttranscriptionally. Here, we show that intracompartmental and intercompartmental transcriptional networks coordinate the expression of genes for organellar functions. Nearly 1,300 ATH1 microarray-based transcriptional profiles of nuclear and organellar genes for mitochondrial and chloroplast proteins in the model plant Arabidopsis (Arabidopsis thaliana) were analyzed. The activity of genes involved in organellar energy production (OEP) or OGE in each of the organelles and in the nucleus is highly coordinated. Intracompartmental networks that link the OEP and OGE gene sets serve to synchronize the expression of nucleus- and organelle-encoded proteins. At a higher regulatory level, coexpression of organellar and nuclear OEP/OGE genes typically modulates chloroplast functions but affects mitochondria only when chloroplast functions are perturbed. Under conditions that induce energy shortage, the intercompartmental coregulation of photosynthesis genes can even override intracompartmental networks. We conclude that dynamic intracompartmental and intercompartmental transcriptional networks for OEP and OGE genes adjust the activity of organelles in response to the cellular energy state and environmental stresses, and we identify candidate cis-elements involved in the transcriptional coregulation of nuclear genes. Regarding the transcriptional regulation of chloroplast genes, novel tentative target genes of σ factors are identified. PMID:21775496

  2. Dietary polyunsaturated fatty acid regulation of gene transcription.

    PubMed

    Clarke, S D; Jump, D B

    1994-01-01

    We have known for nearly 30 years that dietary polyenoic (n-6) and (n-3) fatty acids potentially inhibit hepatic fatty acid biosynthesis. The teleological explanation for this unique action of PUFAs resides in their ability to suppress the synthesis of (n-9) fatty acids. By inhibiting fatty acid biosynthesis, dietary PUFAs reduce the availability of substrate for delta 9 desaturase (7, 22, 34, 36) and in turn reduce the availability of (n-9) fatty acids for incorporation into plasma membranes. In this way, essential biological processes dependent on essential fatty acids (e.g. reproduction and trans-dermal water loss) continue to operate normally. Therefore, if essential fatty acid intake did not regulate (n-9) fatty acid synthesis, the survival of the organism would be threatened. During the past 20 years, we have gradually elucidated the cellular and molecular mechanisms by which dietary PUFAs modulate fatty acid biosynthesis and (n-9) fatty acid availability. Central to this mechanism has been our ability to determine that dietary PUFAs regulate the transcription of genes coding for lipogenic enzymes (12, 40). The potential mechanisms by which PUFAs govern gene transcription are numerous, and it is unlikely that any one mechanism can fully elucidate the nuclear actions of PUFA. The difficulty in providing a unifying hypothesis at this time stems from: (a) the many metabolic routes taken by PUFAs upon entering the hepatocyte (Figure 1); and (b) the lack of identity of a specific PUFA-regulated trans-acting factor. However, the studies described above indicate that macronutrients, like PUFA, are not only utilized as fuel and structural components of cells, but also serve as important mediators of gene expression (12, 14, 40). As regulators of gene expression, PUFAs (or metabolites) are thought to affect the activity of transcription factors, which in turn target key cis-linked elements associated with specific genes. Whether this targeting involves DNA

  3. Gene Transcription Profile of the Detached Retina (An AOS Thesis)

    PubMed Central

    Zacks, David N.

    2009-01-01

    Purpose: Separation of the neurosensory retina from the retinal pigment epithelium (RPE) yields many morphologic and functional consequences, including death of the photoreceptor cells, Müller cell hypertrophy, and inner retinal rewiring. Many of these changes are due to the separation-induced activation of specific genes. In this work, we define the gene transcription profile within the retina as a function of time after detachment. We also define the early activation of kinases that might be responsible for the detachment-induced changes in gene transcription. Methods: Separation of the retina from the RPE was induced in Brown-Norway rats by the injection of 1% hyaluronic acid into the subretinal space. Retinas were harvested at 1, 7, and 28 days after separation. Gene transcription profiles for each time point were determined using the Affymetrix Rat 230A gene microarray chip. Transcription levels in detached retinas were compared to those of nondetached retinas with the BRB-ArrayTools Version 3.6.0 using a random variance analysis of variance (ANOVA) model. Confirmation of the significant transcriptional changes for a subset of the genes was performed using microfluidic quantitative real-time polymerase chain reaction (qRT-PCR) assays. Kinase activation was explored using Western blot analysis to look for early phosphorylation of any of the 3 main families of mitogen-activated protein kinases (MAPK): the p38 family, the Janus kinase family, and the p42/p44 family. Results: Retinas separated from the RPE showed extensive alterations in their gene transcription profile. Many of these changes were initiated as early as 1 day after separation, with significant increases by 7 days. ANOVA analysis defined 144 genes that had significantly altered transcription levels as a function of time after separation when setting a false discovery rate at ≤0.1. Confirmatory RT-PCR was performed on 51 of these 144 genes. Differential transcription detected on the microarray

  4. Stochastic models of gene expression and post-transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Pendar, Hodjat; Kulkarni, Rahul; Jia, Tao

    2011-10-01

    The intrinsic stochasticity of gene expression can give rise to phenotypic heterogeneity in a population of genetically identical cells. Correspondingly, there is considerable interest in understanding how different molecular mechanisms impact the 'noise' in gene expression. Of particular interest are post-transcriptional regulatory mechanisms involving genes called small RNAs, which control important processes such as development and cancer. We propose and analyze general stochastic models of gene expression and derive exact analytical expressions quantifying the noise in protein distributions [1]. Focusing on specific regulatory mechanisms, we analyze a general model for post-transcriptional regulation of stochastic gene expression [2]. The results obtained provide new insights into the role of post-transcriptional regulation in controlling the noise in gene expression. [4pt] [1] T. Jia and R. V. Kulkarni, Phys. Rev. Lett.,106, 058102 (2011) [0pt] [2] T. Jia and R. V. Kulkarni, Phys. Rev. Lett., 105, 018101 (2010)

  5. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs.

  6. Higher plant mitochondrial DNA: Genomes, genes, mutants, transcription, translation

    SciTech Connect

    Not Available

    1986-01-01

    This volume contains brief summaries of 63 presentations given at the International Workshop on Higher Plant Mitochondrial DNA. The presentations are organized into topical discussions addressing plant genomes, mitochondrial genes, cytoplasmic male sterility, transcription, translation, plasmids and tissue culture. (DT)

  7. Topics in Transcriptional Control of Lipid Metabolism: from Transcription Factors to Gene-Promoter Polymorphisms

    PubMed Central

    Bergen, Werner G.; Burnett, Derris D.

    2013-01-01

    The central dogma of biology (DNA>>RNA>>Protein) has remained as an extremely useful scaffold to guide the study of molecular regulation of cellular metabolism. Molecular regulation of cellular metabolism has been pursued from an individual enzyme to a global assessment of protein function at the genomic (DNA), transcriptomic (RNA) and translation (Protein) levels. Details of a key role by inhibitory small RNAs and post-translational processing of cellular proteins on a whole cell/global basis are now just emerging. Below we emphasize the role of transcription factors (TF) in regulation of adipogenesis and lipogenesis. Additionally we have also focused on emerging additional TF that may also have hitherto unrecognized roles in adipogenesis and lipogenesis as compared to our present understanding. It is generally recognized that SNPs in structural genes can affect the final structure/function of a given protein. The implications of SNPs located in the non-transcribed promoter region on transcription have not been examined as extensively at this time. Here we have also summarized some emerging results on promoter SNPs for lipid metabolism and related cellular processes. PMID:25031651

  8. TransFind--predicting transcriptional regulators for gene sets.

    PubMed

    Kiełbasa, Szymon M; Klein, Holger; Roider, Helge G; Vingron, Martin; Blüthgen, Nils

    2010-07-01

    The analysis of putative transcription factor binding sites in promoter regions of coregulated genes allows to infer the transcription factors that underlie observed changes in gene expression. While such analyses constitute a central component of the in-silico characterization of transcriptional regulatory networks, there is still a lack of simple-to-use web servers able to combine state-of-the-art prediction methods with phylogenetic analysis and appropriate multiple testing corrected statistics, which returns the results within a short time. Having these aims in mind we developed TransFind, which is freely available at http://transfind.sys-bio.net/.

  9. Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli.

    PubMed

    Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

    2016-01-01

    The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

  10. Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

    PubMed Central

    Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

    2016-01-01

    The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

  11. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds

    PubMed Central

    Chai, Zhenguang; Guo, Wenzhu; Chen, Rumei; Wang, Lei; Zhao, Jun; Lang, Zhihong; Fan, Yunliu; Zhao, Jiuran; Zhang, Chunyi

    2015-01-01

    Background Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it’s a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively. Results The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis. Conclusions In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs. PMID:26469520

  12. Genomewide Identification of Genes Under Directional Selection: Gene Transcription QST Scan in Diverging Atlantic Salmon Subpopulations

    PubMed Central

    Roberge, C.; Guderley, H.; Bernatchez, L.

    2007-01-01

    Evolutionary genomics has benefited from methods that allow identifying evolutionarily important genomic regions on a genomewide scale, including genome scans and QTL mapping. Recently, genomewide scanning by means of microarrays has permitted assessing gene transcription differences among species or populations. However, the identification of differentially transcribed genes does not in itself suffice to measure the role of selection in driving evolutionary changes in gene transcription. Here, we propose and apply a “transcriptome scan” approach to investigating the role of selection in shaping differential profiles of gene transcription among populations. We compared the genomewide transcription levels between two Atlantic salmon subpopulations that have been diverging for only six generations. Following assessment of normality and unimodality on a gene-per-gene basis, the additive genetic basis of gene transcription was estimated using the animal model. Gene transcription h2 estimates were significant for 1044 (16%) of all detected cDNA clones. In an approach analogous to that of genome scans, we used the distribution of the QST values estimated from intra- and intersubpopulation additive genetic components of the transcription profiles to identify 16 outlier genes (average QST estimate = 0.11) whose transcription levels are likely to have evolved under the influence of directional selection within six generations only. Overall, this study contributes both empirically and methodologically to the quantitative genetic exploration of gene transcription data. PMID:17720934

  13. Transcriptional landscape and essential genes of Neisseria gonorrhoeae

    PubMed Central

    Remmele, Christian W.; Xian, Yibo; Albrecht, Marco; Faulstich, Michaela; Fraunholz, Martin; Heinrichs, Elisabeth; Dittrich, Marcus T.; Müller, Tobias; Reinhardt, Richard; Rudel, Thomas

    2014-01-01

    The WHO has recently classified Neisseria gonorrhoeae as a super-bacterium due to the rapid spread of antibiotic resistant derivatives and an overall dramatic increase in infection incidences. Genome sequencing has identified potential genes, however, little is known about the transcriptional organization and the presence of non-coding RNAs in gonococci. We performed RNA sequencing to define the transcriptome and the transcriptional start sites of all gonococcal genes and operons. Numerous new transcripts including 253 potentially non-coding RNAs transcribed from intergenic regions or antisense to coding genes were identified. Strikingly, strong antisense transcription was detected for the phase-variable opa genes coding for a family of adhesins and invasins in pathogenic Neisseria, that may have regulatory functions. Based on the defined transcriptional start sites, promoter motifs were identified. We further generated and sequenced a high density Tn5 transposon library to predict a core of 827 gonococcal essential genes, 133 of which have no known function. Our combined RNA-Seq and Tn-Seq approach establishes a detailed map of gonococcal genes and defines the first core set of essential gonococcal genes. PMID:25143534

  14. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  15. Age and Diet Affect Gene Expression Profile in Canine Skeletal Muscle

    PubMed Central

    Middelbos, Ingmar S.; Vester, Brittany M.; Karr-Lilienthal, Lisa K.; Schook, Lawrence B.; Swanson, Kelly S.

    2009-01-01

    We evaluated gene transcription in canine skeletal muscle (biceps femoris) using microarray analysis to identify effects of age and diet on gene expression. Twelve female beagles were used (six 1-year olds and six 12-year olds) and they were fed one of two experimental diets for 12 months. One diet contained primarily plant-based protein sources (PPB), whereas the second diet contained primarily animal-based protein sources (APB). Affymetrix GeneChip Canine Genome Arrays were used to hybridize extracted RNA. Age had the greatest effect on gene transcription (262 differentially expressed genes), whereas the effect of diet was relatively small (22 differentially expressed genes). Effects of age (regardless of diet) were most notable on genes related to metabolism, cell cycle and cell development, and transcription function. All these genes were predominantly down-regulated in geriatric dogs. Age-affected genes that were differentially expressed on only one of two diets were primarily noted in the PPB diet group (144/165 genes). Again, genes related to cell cycle (22/35) and metabolism (15/19) had predominantly decreased transcription in geriatric dogs, but 6/8 genes related to muscle development had increased expression. Effects of diet on muscle gene expression were mostly noted in geriatric dogs, but no consistent patterns in transcription were observed. The insight these data provide into gene expression profiles of canine skeletal muscle as affected by age, could serve as a foundation for future research pertaining to age-related muscle diseases. PMID:19221602

  16. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  17. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  18. Transcriptional modulator ZBED6 affects cell cycle and growth of human colorectal cancer cells.

    PubMed

    Akhtar Ali, Muhammad; Younis, Shady; Wallerman, Ola; Gupta, Rajesh; Andersson, Leif; Sjöblom, Tobias

    2015-06-23

    The transcription factor ZBED6 (zinc finger, BED-type containing 6) is a repressor of IGF2 whose action impacts development, cell proliferation, and growth in placental mammals. In human colorectal cancers, IGF2 overexpression is mutually exclusive with somatic mutations in PI3K signaling components, providing genetic evidence for a role in the PI3K pathway. To understand the role of ZBED6 in tumorigenesis, we engineered and validated somatic cell ZBED6 knock-outs in the human colorectal cancer cell lines RKO and HCT116. Ablation of ZBED6 affected the cell cycle and led to increased growth rate in RKO cells but reduced growth in HCT116 cells. This striking difference was reflected in the transcriptome analyses, which revealed enrichment of cell-cycle-related processes among differentially expressed genes in both cell lines, but the direction of change often differed between the cell lines. ChIP sequencing analyses displayed enrichment of ZBED6 binding at genes up-regulated in ZBED6-knockout clones, consistent with the view that ZBED6 modulates gene expression primarily by repressing transcription. Ten differentially expressed genes were identified as putative direct gene targets, and their down-regulation by ZBED6 was validated experimentally. Eight of these genes were linked to the Wnt, Hippo, TGF-β, EGF receptor, or PI3K pathways, all involved in colorectal cancer development. The results of this study show that the effect of ZBED6 on tumor development depends on the genetic background and the transcriptional state of its target genes.

  19. Transcriptional analysis of Penaeus stylirostris densovirus genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Penaeus stylirostris densovirus (PstDNV) genome contains three open reading frames (ORFs), left, middle, and right, which encode a non-structural (NS) protein, an unknown protein, and a capsid protein (CP), respectively. Transcription mapping revealed that P2, P11 and P61 promoters transcribe the le...

  20. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  1. Genome-wide modulation of gene transcription in ovarian carcinoma cells by a new mithramycin analogue.

    PubMed

    Vizcaíno, Carolina; Núñez, Luz-Elena; Morís, Francisco; Portugal, José

    2014-01-01

    Ovarian cancer has a poor prognosis due to intrinsic or acquired resistance to some cytotoxic drugs, raising the interest in new DNA-binding agents such as mithramycin analogues as potential chemotherapeutic agents in gynecological cancer. Using a genome-wide approach, we have analyzed gene expression in A2780 human ovarian carcinoma cells treated with the novel mithramycin analogue DIG-MSK (demycarosyl-3D-β-D-digitoxosyl-mithramycin SK) that binds to C+G-rich DNA sequences. Nanomolar concentrations of DIG-MSK abrogated the expression of genes involved in a variety of cell processes including transcription regulation and tumor development, which resulted in cell death. Some of those genes have been associated with cell proliferation and poor prognosis in ovarian cancer. Sp1 transcription factor regulated most of the genes that were down-regulated by the drug, as well as the up-regulation of other genes mainly involved in response to cell stress. The effect of DIG-MSK in the control of gene expression by other transcription factors was also explored. Some of them, such as CREB, E2F and EGR1, also recognize C/G-rich regions in gene promoters, which encompass potential DIG-MSK binding sites. DIG-MSK affected several biological processes and molecular functions related to transcription and its cellular regulation in A2780 cells, including transcription factor activity. This new compound might be a promising drug for the treatment of ovarian cancer.

  2. Antisense transcription as a tool to tune gene expression.

    PubMed

    Brophy, Jennifer A N; Voigt, Christopher A

    2016-01-14

    A surprise that has emerged from transcriptomics is the prevalence of genomic antisense transcription, which occurs counter to gene orientation. While frequent, the roles of antisense transcription in regulation are poorly understood. We built a synthetic system in Escherichia coli to study how antisense transcription can change the expression of a gene and tune the response characteristics of a regulatory circuit. We developed a new genetic part that consists of a unidirectional terminator followed by a constitutive antisense promoter and demonstrate that this part represses gene expression proportionally to the antisense promoter strength. Chip-based oligo synthesis was applied to build a large library of 5,668 terminator-promoter combinations that was used to control the expression of three repressors (PhlF, SrpR, and TarA) in a simple genetic circuit (NOT gate). Using the library, we demonstrate that antisense promoters can be used to tune the threshold of a regulatory circuit without impacting other properties of its response function. Finally, we determined the relative contributions of antisense RNA and transcriptional interference to repressing gene expression and introduce a biophysical model to capture the impact of RNA polymerase collisions on gene repression. This work quantifies the role of antisense transcription in regulatory networks and introduces a new mode to control gene expression that has been previously overlooked in genetic engineering.

  3. Transcriptional wiring of cell wall-related genes in Arabidopsis.

    PubMed

    Mutwil, Marek; Ruprecht, Colin; Giorgi, Federico M; Bringmann, Martin; Usadel, Björn; Persson, Staffan

    2009-09-01

    Transcriptional coordination, or co-expression, of genes may signify functional relatedness of the corresponding proteins. For example, several genes involved in secondary cell wall cellulose biosynthesis are co-expressed with genes engaged in the synthesis of xylan, which is a major component of the secondary cell wall. To extend these types of analyses, we investigated the co-expression relationships of all Carbohydrate-Active enZYmes (CAZy)-related genes for Arabidopsis thaliana. Thus, the intention was to transcriptionally link different cell wall-related processes to each other, and also to other biological functions. To facilitate easy manual inspection, we have displayed these interactions as networks and matrices, and created a web-based interface (http://aranet.mpimp-golm.mpg.de/corecarb) containing downloadable files for all the transcriptional associations.

  4. Stochasticity of gene products from transcriptional pulsing

    NASA Astrophysics Data System (ADS)

    Iyer-Biswas, Srividya; Hayot, F.; Jayaprakash, C.

    2009-03-01

    Transcriptional pulsing has been observed in both prokaryotes and eukaryotes and plays a crucial role in cell-to-cell variability of protein and mRNA numbers. An important issue is how the time constants associated with episodes of transcriptional bursting and mRNA and protein degradation rates lead to different cellular mRNA and protein distributions, starting from the transient regime leading to the steady state. We address this by deriving and then investigating the exact time-dependent solution of the master equation for a transcriptional pulsing model of mRNA distributions. We find a plethora of results. We show that, among others, bimodal and long-tailed (power-law) distributions occur in the steady state as the rate constants are varied over biologically significant time scales. Since steady state may not be reached experimentally we present results for the time evolution of the distributions. Because cellular behavior is determined by proteins, we also investigate the effect of the different mRNA distributions on the corresponding protein distributions using numerical simulations.

  5. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    SciTech Connect

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb

  6. Localization of dystrophin gene transcripts during mouse embryogenesis

    PubMed Central

    1992-01-01

    The spatial and temporal expression of the dystrophin gene has been examined during mouse embryogenesis, using in situ hybridization on tissue sections with a probe from the 5' end of the dystrophin coding sequence. In striated muscle, dystrophin transcripts are detectable from about 9 d in the heart and slightly later in skeletal muscle. However, there is an important difference between the two types of muscle: the heart is already functional as a contractile organ before the appearance of dystrophin transcripts, whereas this is not the case in skeletal muscle, where dystrophin and myosin heavy chain transcripts are first detectable at the same time. In the heart, dystrophin transcripts accumulate initially in the outflow tract and, at later stages, in both the atria and ventricles. In skeletal muscle, the gene is expressed in all myocytes irrespective of fiber type. In smooth muscle dystrophin transcripts are first detectable from 11 d post coitum in blood vessels, and subsequently in lung bronchi and in the digestive tract. The other major tissue where the dystrophin gene is expressed is the brain, where transcripts are clearly detectable in the cerebellum from 13 d. High-level expression of the gene is also seen in particular regions of the forebrain involved in the regulation of circadian rhythms, the endocrine system, and olfactory function, not previously identified in this context. The findings are discussed in the context of the pathology of Duchenne muscular dystrophy. PMID:1429837

  7. Transcriptional Analysis of a Unique Set of Genes Involved in Schistosoma mansoni Female Reproductive Biology

    PubMed Central

    Cogswell, Alexis A.; Kommer, Valerie P.; Williams, David L.

    2012-01-01

    Schistosomiasis affects more than 200 million people globally. The pathology of schistosome infections is due to chronic tissue inflammation and damage from immune generated granulomas surrounding parasite eggs trapped in host tissues. Schistosoma species are unique among trematode parasites because they are dioecious; females require paring with male parasites in order to attain reproductive maturity and produce viable eggs. Ex vivo cultured females lose the ability to produce viable eggs due to an involution of the vitellarium and loss of mature oocytes. In order to better understand schistosome reproductive biology we used data generated by serial analysis of gene expression (SAGE) to identify uncharacterized genes which have different transcript abundance in mature females, those that have been paired with males, and immature females obtained from unisexual infections. To characterize these genes we used bioinformatics, transcript localization, and transcriptional analysis during the regression of in vitro cultured females. Genes transcribed exclusively in mature females localize primarily in the vitellocytes and/or the ovary. Genes transcribed exclusively in females from single sex infections localize to vitellocytes and subtegumental cells. As female reproductive tissues regress, eggshell precursor proteins and genes involved in eggshell synthesis largely have decreased transcript abundance. However, some genes with elevated transcript abundance in mature adults have increased gene expression following regression indicating that the genes in this study function both in eggshell biology as well as vitellogenesis and maintenance of female reproductive tissues. In addition, we found that genes enriched in females from single sex infections have increased expression during regression in ex vivo females. By using these transcriptional analyses we can direct research to examine the areas of female biology that are both relevant to understanding the overall process

  8. Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

    PubMed Central

    Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

    2013-01-01

    The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

  9. Spatially coordinated dynamic gene transcription in living pituitary tissue

    PubMed Central

    Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael RH; Davis, Julian RE

    2016-01-01

    Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary ‘on-off’ process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour. DOI: http://dx.doi.org/10.7554/eLife.08494.001 PMID:26828110

  10. Towards resolving the transcription factor network controlling myelin gene expression

    PubMed Central

    Fulton, Debra L.; Denarier, Eric; Friedman, Hana C.; Wasserman, Wyeth W.; Peterson, Alan C.

    2011-01-01

    In the central nervous system (CNS), myelin is produced from spirally-wrapped oligodendrocyte plasma membrane and, as exemplified by the debilitating effects of inherited or acquired myelin abnormalities in diseases such as multiple sclerosis, it plays a critical role in nervous system function. Myelin sheath production coincides with rapid up-regulation of numerous genes. The complexity of their subsequent expression patterns, along with recently recognized heterogeneity within the oligodendrocyte lineage, suggest that the regulatory networks controlling such genes drive multiple context-specific transcriptional programs. Conferring this nuanced level of control likely involves a large repertoire of interacting transcription factors (TFs). Here, we combined novel strategies of computational sequence analyses with in vivo functional analysis to establish a TF network model of coordinate myelin-associated gene transcription. Notably, the network model captures regulatory DNA elements and TFs known to regulate oligodendrocyte myelin gene transcription and/or oligodendrocyte development, thereby validating our approach. Further, it links to numerous TFs with previously unsuspected roles in CNS myelination and suggests collaborative relationships amongst both known and novel TFs, thus providing deeper insight into the myelin gene transcriptional network. PMID:21729871

  11. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

    EPA Science Inventory

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  12. Bidirectional transcription of lipooligosaccharide synthesis genes from Campylobacter jejuni.

    PubMed

    Phongsisay, Vongsavanh; Fry, Benjamin N

    2007-10-01

    The lipooligosaccharide (LOS) molecules of Campylobacter jejuni are involved in virulence and induction of the Guillain-Barré syndrome (GBS). This study analysed the transcription of the LOS synthesis genes from the GBS-inducing C. jejuni strain HB 93-13 under microaerobic conditions. Fourteen consecutive genes Cj1132c, waaC, htrB, wlaNC, wlaND, cgtA, cgtB, cstII, neuB, neuC, neuA, wlaVA, wlaQA, and waaF were included. The results of rapid amplification of cDNA ends and single-stranded ligation of complementary ends showed initiation sites with potential promoter regions on both DNA strands in the Cj1132c/waaC, cgtB/cstII, and wlaQA/waaF strand-switch regions. Other termini without recognisable promoter region were also found throughout the LOS gene cluster, suggesting a low specificity of the polymerase during transcription. In addition, all gene junction regions were cloned into the shuttle vector pMW10 carrying the promoterless lacZ gene to identify functional promoter sites. Bidirectional active promoters were found in the strand-switch regions. The results of RT-PCR and cDNA blotting indicated that transcriptional linkage occurred between different operons, indicating a lack of transcription termination within the LOS gene cluster. Moreover, the results of semi-quantitative RT-PCR and real-time RT-PCR showed that both DNA strands were transcribed but transcription of the coding strand was at a higher rate. The results presented here provide an insight into transcription of the LOS synthesis gene cluster of C. jejuni.

  13. Transcriptional activation of heat-shock genes in eukaryotes.

    PubMed

    Tanguay, R M

    1988-06-01

    Prokaryotes and eukaryotes respond to thermal or various chemical stresses by the rapid induction of a group of genes collectively referred to as the heat shock genes. In eucaryotes, the expression of these genes is primarily regulated at the transcriptional level. The early observations that transfected heat shock genes were inducible in heterologous systems suggested the existence of common regulatory elements in these ubiquitous genes. Sequence analysis of cloned Drosophila heat shock genes revealed a conserved 14 base pair (bp) inverted repeat, which is essential for heat induction. This regulatory sequence, referred to as the heat shock element (HSE), is found in multiple imperfect copies upstream of the TATA box of all heat shock genes. While studies in heterologous systems indicated that a single copy of HSE was sufficient for inducibility, further analysis in homologous assays suggests that multiple HSE can act in a cooperative way and that the efficiency of transcriptional activation is related, within limits, to the number of HSE. Comparative analysis of heat shock genes reveals that HSE can be positioned at different distances from the TATA box in either orientation, a behavior reminiscent of enhancer elements. However, the presence of HSE does not necessarily confer heat inducibility, as shown by their presence in the constitutively expressed but non-heat-inducible homologous cognate genes. Footprinting and nuclease mapping have been used to show that a protein factor (HSTF: heat shock transcription factor) binds to the HSE element, activating heat shock gene transcription in a dose-dependent manner. The recent progress in the isolation and characterization of HSTF in Drosophila, yeast, and human cells is reviewed. Finally, different models suggested to account for the positive regulation of heat shock genes by the HSTF are presented.

  14. Transcriptional targeting of tumor endothelial cells for gene therapy

    PubMed Central

    Dong, Zhihong; Nör, Jacques E.

    2009-01-01

    It is well known that angiogenesis plays a critical role in the pathobiology of tumors. Recent clinical trials have shown that inhibition of angiogenesis can be an effective therapeutic strategy for patients with cancer. However, one of the outstanding issues in anti-angiogenic treatment for cancer is the development of toxicities related to off-target effects of drugs. Transcriptional targeting of tumor endothelial cells involves the use of specific promoters for selective expression of therapeutic genes in the endothelial cells lining the blood vessels of tumors. Recently, several genes that are expressed specifically in tumor-associated endothelial cells have been identified and characterized. These discoveries have enhanced the prospectus of transcriptionaly targeting tumor endothelial cells for cancer gene therapy. In this manuscript, we review the promoters, vectors, and therapeutic genes that have been used for transcriptional targeting of tumor endothelial cells, and discuss the prospects of such approaches for cancer gene therapy. PMID:19393703

  15. [Immunoglobulin genes in lymphoid cells and regulation of their transcription].

    PubMed

    Stepchenko, A G; Urakov, D N; Luchina, N N; Deev, S M; Polianovskiĭ, O L

    1990-01-01

    The hybridoma genomes contain polyploid sets of immunoglobulin genes. We have shown, that the hybridoma PTF-02 genome contains three genes of heavy chains and two genes of light chains. The genes responsible for antibody synthesis were cloned and their structure were determined. Investigation of the kappa gene transcription and its fragments which contain regulatory sequences revealed a nuclear factor. The latter interacts with the octanucleotide localized at the promoter region of the kappa gene. The purified factor activates the transcription of the kappa gene in a heterologous cell-free system. Together with the tissue-specific factor there is also an universal factor interacting with the octanucleotide sequence. We have shown an additional factor in lymphoid cells interact with the protein which binds to the octanucleotide sequence. We have shown an additional factor in lymphoid cells interacting with the protein which binds to the octanucleotide sequence. As a result, there is a family of factors which interact with ATTTGCAT sequence. One major factor (m.w. 60 +/- 2 kDa) is an obligatory component for the initiation of immunoglobulin genes transcription.

  16. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  17. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases.

  18. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor

    PubMed Central

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light–oxygen–voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na+-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na+ currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  19. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo

    2016-01-01

    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  20. Post-Transcriptional Regulation of Gene Expression in Yersinia Species

    PubMed Central

    Schiano, Chelsea A.; Lathem, Wyndham W.

    2012-01-01

    Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host. PMID:23162797

  1. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    PubMed

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  2. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    PubMed Central

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  3. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

    PubMed

    Naito, Yuki; Bono, Hidemasa

    2012-07-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

  4. Conditional enhancement of liver-specific gene transcription.

    PubMed Central

    Zaret, K S; DiPersio, C M; Jackson, D A; Montigny, W J; Weinstat, D L

    1988-01-01

    We sought to develop a cell line in which liver-specific transcription could be induced at will, to facilitate the study of factors that cause hepatocyte-specific transcription of the serum albumin gene in mice. We therefore created the H2.35 cell line from mouse hepatocytes infected with a temperature-sensitive strain of simian virus 40. During routine propagation at the permissive temperature, H2.35 cells exhibit extremely low levels of albumin transcription and mRNA. Albumin mRNA increases at least 100-fold when H2.35 cells are cultured at the restrictive temperature and in serum-free medium on a collagen substratum; the two latter conditions maintain the differentiated state of primary hepatocyte cultures. Although a major cause of the mRNA increase is posttranscriptional, the transcription rates of albumin and other liver-specific genes increase significantly. Transient-transfection experiments demonstrated that an induction of transcription is caused by activation of an albumin upstream sequence that was previously shown to enhance liver-specific transcription in transgenic mice. Thus, hepatocyte differentiation appears to be maintained in part by extracellular signals that stimulate the activity of a tissue-specific enhancer element. Images PMID:3194409

  5. Estrogen-dependent transcriptional activation and vitellogenin gene memory.

    PubMed

    Edinger, R S; Mambo, E; Evans, M I

    1997-12-01

    The concept of hepatic memory suggests that a gene responds more rapidly to a second exposure of an inducer than it does during the initial activation. To determine how soon estrogen-dependent DNA/protein interactions occur during the primary response, in vivo dimethylsulfate footprinting was carried out using genomic DNA amplified by ligation-mediated PCR. When estrogen was added to disrupted cells from a hormone-naive liver, changes within and around the estrogen response elements occurred within seconds, indicating a direct and rapid effect on this estrogen-responsive promoter that had never before been activated. Because this effect was so rapid relative to the delayed onset of mRNA accumulation during the primary response, run-on transcription assays were used to determine the transcription profiles for four of the yolk protein genes during the primary and secondary responses to estrogen. As with the accumulation of mRNA, the onset of transcription was delayed for all of these genes after a primary exposure to estrogen. Interestingly, after the secondary exposure to estrogen, the vitellogenin I, vitellogenin II, and very low density apolipoprotein II genes displayed a more rapid onset of transcription, whereas the primary and secondary profiles of apolipoprotein B transcription in response to estrogen were identical. Because the apoB gene is constitutively expressed in the absence of estrogen, and the vitellogenins are quiescent before the administration of the hormone, hepatic memory most likely represents a relatively stable event in the transition to an active state of a gene that is committed for tissue-specific expression.

  6. The transcription factor titration effect dictates level of gene expression.

    PubMed

    Brewster, Robert C; Weinert, Franz M; Garcia, Hernan G; Song, Dan; Rydenfelt, Mattias; Phillips, Rob

    2014-03-13

    Models of transcription are often built around a picture of RNA polymerase and transcription factors (TFs) acting on a single copy of a promoter. However, most TFs are shared between multiple genes with varying binding affinities. Beyond that, genes often exist at high copy number-in multiple identical copies on the chromosome or on plasmids or viral vectors with copy numbers in the hundreds. Using a thermodynamic model, we characterize the interplay between TF copy number and the demand for that TF. We demonstrate the parameter-free predictive power of this model as a function of the copy number of the TF and the number and affinities of the available specific binding sites; such predictive control is important for the understanding of transcription and the desire to quantitatively design the output of genetic circuits. Finally, we use these experiments to dynamically measure plasmid copy number through the cell cycle.

  7. The Transcription Factor Titration Effect Dictates Level of Gene Expression

    PubMed Central

    Brewster, Robert C.; Weinert, Franz M.; Garcia, Hernan G.; Song, Dan; Rydenfelt, Mattias; Phillips, Rob

    2014-01-01

    Models of transcription are often built around a picture of RNA polymerase and transcription factors (TFs) acting on a single copy of a promoter. However, most TFs are shared between multiple genes with varying binding affinities. Beyond that, genes often exist at high copy number; in multiple, identical copies on the chromosome or on plasmids or viral vectors with copy numbers in the hundreds. Using a thermodynamic model, we characterize the interplay between TF copy number and the demand for that TF. We demonstrate the parameter-free predictive power of this model as a function of the copy number of the TF and the number and affinities of the available specific binding sites; such predictive control is important for the understanding of transcription and the desire to quantitatively design the output of genetic circuits. Finally we use these experiments to dynamically measure plasmid copy number through the cell cycle. PMID:24612990

  8. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  9. Acute Targeting of General Transcription Factor IIB Restricts Cardiac Hypertrophy via Selective Inhibition of Gene Transcription

    PubMed Central

    Sayed, Danish; Yang, Zhi; He, Minzhen; Pfleger, Jessica M.; Abdellatif, Maha

    2014-01-01

    Background We previously reported that specialized and housekeeping genes are differentially regulated via de novo recruitment and pause-release of RNA polymerase II (pol II), respectively, during cardiac hypertrophy. However, the significance of this finding remains to be examined. Therefore, the purpose of this study was to determine the mechanisms that differentially regulate these gene groups and exploit them for therapeutic targeting. Methods and Results Here we show that general transcription factor IIB (TFIIB) and cyclin-dependent kinase 9 are upregulated during hypertrophy, both targeted by miR-1, and play preferential roles in regulating those two groups of genes. Chromatin immunoprecipitation-sequencing reveals that TFIIB is constitutively bound to all paused, housekeeping, promoters, whereas, de novo recruitment of TFIIB and pol II is required for specialized genes that are induced during hypertrophy. We exploited this dichotomy to acutely inhibit induction of the latter set, which encompasses cardiomyopathy, immune reaction, and extracellular matrix genes, using locked nucleic acid (LNA)-modified antisense TFIIB oligonucleotide treatment. This resulted in suppression of all specialized genes, while sparing the housekeeping ones, and, thus, attenuated pathological hypertrophy. Conclusions The data for the first time reveal distinct general transcription factor IIB dynamics that regulate specialized vs. housekeeping genes during cardiac hypertrophy. Thus, by acutely targeting TFIIB we were able to selectively inhibit the former set of genes and ameliorate pressure overload hypertrophy. We also demonstrate the feasibility of acutely and reversibly targeting cardiac mRNA for therapeutic purposes using LNA-modified antisense oligonucleotides. PMID:25398966

  10. Immunoglobulin genes and their transcriptional control in teleosts.

    PubMed

    Hikima, Jun-ichi; Jung, Tae-Sung; Aoki, Takashi

    2011-09-01

    Immunoglobulin (Ig), which exists only in jawed vertebrates, is one of the most important molecules in adaptive immunity. In the last two decades, many teleost Ig genes have been identified by in silico data mining from the enormous gene and EST databases of many fish species. In this review, the organization of Ig gene segments, the expressed Ig isotypes and their transcriptional controls are discussed. The Ig heavy chain (IgH) locus in teleosts encodes the variable (V), the diversity (D), the joining (J) segments and three different isotypic constant (C) regions including Cμ, Cδ, and Cζ/τ genes, and is organized as a "translocon" type like the IgH loci of higher vertebrates. In contrast, the Ig light (L) chain locus is arranged in a "multicluster" or repeating set of VL, JL, and CL segments. The IgL chains have four isotypes; two κ L1/G and L3/F), σ (L2) and λ. The transcription of IgH genes in teleosts is regulated by a VH promoter and the Eμ3' enhancer, which both function in a B cell-specific manner. The location of the IgH locus, structure and transcriptional function of the Eμ3' enhancer are important to our understanding of the evolutional changes that have occurred in the IgH gene locus.

  11. The myxoma virus thymidine kinase gene: sequence and transcriptional mapping.

    PubMed

    Jackson, R J; Bults, H G

    1992-02-01

    The myxoma virus thymidine kinase (TK) gene is encoded on a 1.6 kb SacI-SalI restriction fragment located between 57.7 and 59.3 kb on the 163 kb genomic map. The nucleotide sequence of this fragment as well as 228 bp from the adjacent SalI-AA2 fragment was determined and found to encode four major open reading frames (ORFs). Three of these ORFs are similar in nucleotide sequence to ORFs L5R and J1R, and the TK gene of vaccinia virus (VV). The fourth ORF, MF8a, shows similarity to the ORFs found in the same position relative to the TK genes of Shope fibroma virus, Kenya sheep-1 virus and swine-pox virus. A search of the complete VV nucleotide sequence for regions of similarity to MF8a identified the host specificity gene C7L. Northern blot analysis of early viral RNA identified transcripts of approximately 700 nucleotides for both the TK gene and ORF MF8a. The 5' ends of the TK gene and ORF MF8a early mRNAs were mapped by primer extension to initiation sites 13 nucleotides downstream of sequences with similarity to the VV early promoter consensus. The sizes of the TK and MF8a mRNAs are consistent with transcription termination and polyadenylation occurring downstream of the sequence TTTTTNT, which is identical to the consensus sequence for the VV transcription termination signal.

  12. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae.

    PubMed

    Rantasalo, Anssi; Czeizler, Elena; Virtanen, Riitta; Rousu, Juho; Lähdesmäki, Harri; Penttilä, Merja; Jäntti, Jussi; Mojzita, Dominik

    2016-01-01

    This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF) onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1) the transcription-activation domain of the sTF, 2) the binding-site modules in the output promoter, and 3) the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications. PMID:26901642

  13. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae

    PubMed Central

    Rantasalo, Anssi; Czeizler, Elena; Virtanen, Riitta; Rousu, Juho; Lähdesmäki, Harri; Penttilä, Merja

    2016-01-01

    This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF) onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1) the transcription-activation domain of the sTF, 2) the binding-site modules in the output promoter, and 3) the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications. PMID:26901642

  14. Transcription control of ribulose bisphosphate carboxylase/oxygenase activase and adjacent genes in Anabaena species.

    PubMed Central

    Li, L A; Tabita, F R

    1994-01-01

    The gene encoding ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) activase (rca) was uniformly localized downstream from the genes encoding the large and small subunits of RubisCO (rbcL and rbcS) in three strains of Anabaena species. However, two open reading frames (ORF1 and ORF2), situated between rbcS and rca in Anabaena sp. strain CA, were not found in the intergenic region of Anabaena variabilis and Anabaena sp. strain PCC 7120. During autotrophic growth of Anabaena cells, rca and rbc transcripts accumulated in the light and diminished in the dark; light-dependent expression of these genes was not affected by the nitrogen source and the concentration of exogenous CO2 supplied to the cells. When grown on fructose, rca- and rbc-specific transcripts accumulated in A. variabilis regardless of whether the cells were illuminated. Transcript levels, however, were much lower in dark-grown heterotrophic cultures than in photoheterotrophic cultures. In photoheterotrophic cultures, the expression of the rca and rbc genes was similar to that in cultures grown with CO2 as the sole source of carbon. Although the rbcL-rbcS and rca genes are linked and are in the same transcriptional orientation in Anabaena strains, hybridization of rbc and rca to distinct transcripts suggested that these genes are not cotranscribed, consistent with the results of primer extension and secondary structure analysis of the nucleotide sequence. Transcription from ORF1 and ORF2 was not detected under the conditions examined, and the function of these putative genes remains unknown. Images PMID:7961423

  15. Cis and trans activation of adenovirus IVa2 gene transcription.

    PubMed Central

    Natarajan, V; Salzman, N P

    1985-01-01

    The transcriptional control region of the adenovirus IVa2 promoter was analyzed by cloning this promoter in front of a gene coding for bacterial chloramphenicol acetyl transferase (CATase) and estimating levels of CATase and IVa2 promoter specific RNA synthesized after transfection. To produce detectable amounts of CATase with the IVa2 promoter, an enhancer has to be present in cis. In the absence of enhancer sequences, the adenovirus E1A gene can not stimulate CATase synthesis. When cells were transfected with plasmids containing enhancer sequences and various IVa2 mutant promoters upstream of the CAT gene, we observed that CATase activity was not reduced significantly even after deletion of all sequences upstream of the RNA initiation site. Synthesis of IVa2 specific RNA was dependent on plasmids containing an enhancer (SV40 72 bp repeat) that was present in cis. In the absence of enhancer sequences, co-transfection to provide the adenovirus E1A gene in trans also stimulated IVa2 RNA synthesis. When HeLa cells were transfected with various deletion mutants with an enhancer in cis it was seen that sequences -38 to -64 base pairs upstream of the RNA initiation site are necessary for efficient transcription. The E1A gene in trans and an enhancer in cis have an additive effect on RNA synthesis from both IVa2 and major late promoters. The basis for the conflicting results between transcription and CATase synthesis is discussed. Images PMID:2989786

  16. Gene transcription in polar bears (Ursus maritimus) from disparate populations

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Waters, Shannon C.; Meyerson, Randi; Rode, Karyn D.; Atwood, Todd C.

    2015-01-01

    Polar bears in the Beaufort (SB) and Chukchi (CS) Seas experience different environments due primarily to a longer history of sea ice loss in the Beaufort Sea. Ecological differences have been identified as a possible reason for the generally poorer body condition and reproduction of Beaufort polar bears compared to those from the Chukchi, but the influence of exposure to other stressors remains unknown. We use molecular technology, quantitative PCR, to identify gene transcription differences among polar bears from the Beaufort and Chukchi Seas as well as captive healthy polar bears. We identified significant transcriptional differences among a priori groups (i.e., captive bears, SB 2012, SB 2013, CS 2013) for ten of the 14 genes of interest (i.e., CaM, HSP70, CCR3, TGFβ, COX2, THRα, T-bet, Gata3, CD69, and IL17); transcription levels of DRβ, IL1β, AHR, and Mx1 did not differ among groups. Multivariate analysis also demonstrated separation among the groups of polar bears. Specifically, we detected transcript profiles consistent with immune function impairment in polar bears from the Beaufort Sea, when compared with Chukchi and captive polar bears. Although there is no strong indication of differential exposure to contaminants or pathogens between CS and SB bears, there are clearly differences in important transcriptional responses between populations. Further investigation is warranted to refine interpretation of potential effects of described stress-related conditions for the SB population.

  17. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  18. How microRNA and transcription factor co-regulatory networks affect osteosarcoma cell proliferation.

    PubMed

    Poos, Kathrin; Smida, Jan; Nathrath, Michaela; Maugg, Doris; Baumhoer, Daniel; Korsching, Eberhard

    2013-01-01

    Osteosarcomas (OS) are complex bone tumors with various genomic alterations. These alterations affect the expression and function of several genes due to drastic changes in the underlying gene regulatory network. However, we know little about critical gene regulators and their functional consequences on the pathogenesis of OS. Therefore, we aimed to determine microRNA and transcription factor (TF) co-regulatory networks in OS cell proliferation. Cell proliferation is an essential part in the pathogenesis of OS and deeper understanding of its regulation might help to identify potential therapeutic targets. Based on expression data of OS cell lines divided according to their proliferative activity, we obtained 12 proliferation-related microRNAs and corresponding target genes. Therewith, microRNA and TF co-regulatory networks were generated and analyzed regarding their structure and functional influence. We identified key co-regulators comprising the microRNAs miR-9-5p, miR-138, and miR-214 and the TFs SP1 and MYC in the derived networks. These regulators are implicated in NFKB- and RB1-signaling and focal adhesion processes based on their common or interacting target genes (e.g., CDK6, CTNNB1, E2F4, HES1, ITGA6, NFKB1, NOTCH1, and SIN3A). Thus, we proposed a model of OS cell proliferation which is primarily co-regulated through the interactions of the mentioned microRNA and TF combinations. This study illustrates the benefit of systems biological approaches in the analysis of complex diseases. We integrated experimental data with publicly available information to unravel the coordinated (post)-transcriptional control of microRNAs and TFs to identify potential therapeutic targets in OS. The resulting microRNA and TF co-regulatory networks are publicly available for further exploration to generate or evaluate own hypotheses of the pathogenesis of OS (http://www.complex-systems.uni-muenster.de/co_networks.html).

  19. Transcriptional Regulation of the p16 Tumor Suppressor Gene.

    PubMed

    Kotake, Yojiro; Naemura, Madoka; Murasaki, Chihiro; Inoue, Yasutoshi; Okamoto, Haruna

    2015-08-01

    The p16 tumor suppressor gene encodes a specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 and is found altered in a wide range of human cancers. p16 plays a pivotal role in tumor suppressor networks through inducing cellular senescence that acts as a barrier to cellular transformation by oncogenic signals. p16 protein is relatively stable and its expression is primary regulated by transcriptional control. Polycomb group (PcG) proteins associate with the p16 locus in a long non-coding RNA, ANRIL-dependent manner, leading to repression of p16 transcription. YB1, a transcription factor, also represses the p16 transcription through direct association with its promoter region. Conversely, the transcription factors Ets1/2 and histone H3K4 methyltransferase MLL1 directly bind to the p16 locus and mediate p16 induction during replicative and premature senescence. In the present review, we discuss the molecular mechanisms by which these factors regulate p16 transcription.

  20. Osteogenic transcription factors and proto-oncogene regulate bone sialoprotein gene transcription.

    PubMed

    Takai, Hideki; Mezawa, Masaru; Choe, Jin; Nakayama, Yohei; Ogata, Yorimasa

    2013-09-01

    Runt homeodomain protein 2 (Runx2), distalless 5 (Dlx5) and Smad1 are transcription factors that play critical roles in controlling the differentiation of osteoblasts and mineralization of bone. Proto-oncogene tyrosine-protein kinase, Src, is an enzyme encoded by the Src gene. The normal cellular gene is called cellular-Src (c-Src). Bone sialoprotein (BSP), a protein implicated in the initial mineralization of newly formed bone, is an early phenotypic marker of differentiated osteoblasts. In this study, we used overexpression plasmids with Runx2, Dlx5, Smad1 or c-Src inserts to search for the effects of these transcription factors and proto-oncogene on BSP gene expression using rat osteoblast-like ROS 17/2.8. When we used Runx2, Dlx5 or c-Src overexpression plasmids for the transfection, BSP and Runx2 mRNA levels were increased in ROS 17/2.8 cells. However, overexpression of Smad1 did not induce BSP and Runx2 mRNA. Transient transfection analyses were performed using chimeric constructs of the rat BSP gene promoter linked to a luciferase reporter gene. Transfection of ROS 17/2.8 cells with Runx2, Dlx5 or c-Src overexpression plasmid increased the luciferase activities of the constructs, pLUC3 (-116 to +60), pLUC4 (-425 to +60) and pLUC5 (-801 to +60). However, Smad1 overexpression had no effect on the luciferase activities. These results demonstrate that overexpression of Runx2, Dlx5 or c-Src stimulates BSP transcription, and suggest that Runx2, Dlx5 and c-Src might be crucial transcriptional regulators of mineralization and bone formation.

  1. Sperm is epigenetically programmed to regulate gene transcription in embryos.

    PubMed

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M; Zegerman, Philip; Bradshaw, Charles R; Peters, Antoine H F M; Gurdon, John B; Jullien, Jerome

    2016-08-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  2. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  3. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  4. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  5. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  6. Identification of the simian foamy virus transcriptional transactivator gene (taf).

    PubMed Central

    Mergia, A; Shaw, K E; Pratt-Lowe, E; Barry, P A; Luciw, P A

    1991-01-01

    Simian foamy virus type 1 (SFV-1), a member of spumavirus subfamily of retroviruses, encodes a transcriptional transactivator that functions to strongly augment gene expression directed by the viral long terminal repeat (LTR). The objective of this study was to identify the viral gene responsible for transactivation. Nucleotide sequences between the env gene and the LTR of SFV-1 were determined. The predicted amino acid sequence revealed two large open reading frames (ORFs), designated ORF-1 (311 amino acids) and ORF-2 (422 amino acids). In the corresponding region of the human foamy virus, three ORFs (bel-1, bel-2, and bel-3) have been identified (R. M. Flugel, A. Rethwilm, B. Maurer, and G. Darai, EMBO J. 6:2077-2084, 1987). Pairwise comparisons of the ORF-1 and ORF-2 with bel-1 and bel-2 show small clusters of homology; less than 39% overall homology of conserved amino acids is observed. A counterpart for human foamy virus bel-3 is not present in the SFV-1 sequence. Three species of viral RNA have been identified in cells infected with SFV-1; an 11.5-kb RNA representing full-length transcripts, a 6.5-kb RNA representing the env message, and a 2.8-kb RNA from the ORF region. Analysis of a cDNA clone encoding the ORF region of SFV-1 reveals that the 2.8-kb message is generated by complex splicing events involving the 3' end of the env gene. In transient expression assays in cell lines representing several species. ORF-1 was shown to be necessary and sufficient for transactivating viral gene expression directed by the SFV-1 LTR. The target for transactivation is located in the U3 domain of the LTR, upstream from position - 125 (+ 1 represents the transcription initiation site). We propose that OFF-1 of SFV-1 be designated the transcriptional transactivator of foamy virus (taf). Images PMID:1851862

  7. Transcriptional regulation of genes related to progesterone production.

    PubMed

    Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru

    2015-01-01

    Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production. PMID:26135521

  8. Early life stress and serotonin transporter gene variation interact to affect the transcription of the glucocorticoid and mineralocorticoid receptors, and the co-chaperone FKBP5, in the adult rat brain.

    PubMed

    van der Doelen, Rick H A; Calabrese, Francesca; Guidotti, Gianluigi; Geenen, Bram; Riva, Marco A; Kozicz, Tamás; Homberg, Judith R

    2014-01-01

    The short allelic variant of the serotonin transporter (5-HTT) promoter-linked polymorphic region (5-HTTLPR) has been associated with the etiology of major depression by interaction with early life stress (ELS). A frequently observed endophenotype in depression is the abnormal regulation of levels of stress hormones such as glucocorticoids. It is hypothesized that altered central glucocorticoid influence on stress-related behavior and memory processes could underlie the depressogenic interaction of 5-HTTLPR and ELS. One possible mechanism could be the altered expression of the genes encoding the glucocorticoid and mineralocorticoid receptors (GR, MR) and their inhibitory regulator FK506-binding protein 51 (FKBP5) in stress-related forebrain areas. To test this notion, we exposed heterozygous (5-HTT(+/-)) and homozygous (5-HTT(-/-)) serotonin transporter knockout rats and their wildtype littermates (5-HTT(+/+)) to daily 3 h maternal separations from postnatal day 2 to 14. In the medial prefrontal cortex (mPFC) and hippocampus of the adult male offspring, we found that GR, MR, and FKBP5 mRNA levels were affected by ELS × 5-HTT genotype interaction. Specifically, 5-HTT(+/+) rats exposed to ELS showed decreased GR and FKBP5 mRNA in the dorsal and ventral mPFC, respectively. In contrast, 5-HTT(+/-) rats showed increased MR mRNA levels in the hippocampus and 5-HTT(-/-) rats showed increased FKBP5 mRNA in the ventral mPFC after ELS exposure. These findings indicate that 5-HTT genotype determines the specific adaptation of GR, MR, and FKBP5 expression in response to early life adversity. Therefore, altered extra-hypothalamic glucocorticoid signaling should be considered to play a role in the depressogenic interaction of ELS and 5-HTTLPR.

  9. Functional divergence and convergence between the transcript network and gene network in lung adenocarcinoma

    PubMed Central

    Hsu, Min-Kung; Pan, Chia-Lin; Chen, Feng-Chi

    2016-01-01

    Introduction Alternative RNA splicing is a critical regulatory mechanism during tumorigenesis. However, previous oncological studies mainly focused on the splicing of individual genes. Whether and how transcript isoforms are coordinated to affect cellular functions remain underexplored. Also of great interest is how the splicing regulome cooperates with the transcription regulome to facilitate tumorigenesis. The answers to these questions are of fundamental importance to cancer biology. Results Here, we report a comparative study between the transcript-based network (TN) and the gene-based network (GN) derived from the transcriptomes of paired tumor–normal tissues from 77 lung adenocarcinoma patients. We demonstrate that the two networks differ significantly from each other in terms of patient clustering and the number and functions of network modules. Interestingly, the majority (89.5%) of multi-transcript genes have their transcript isoforms distributed in at least two TN modules, suggesting regulatory and functional divergences between transcript isoforms. Furthermore, TN and GN modules share onlŷ50%–60% of their biological functions. TN thus appears to constitute a regulatory layer separate from GN. Nevertheless, our results indicate that functional convergence and divergence both occur between TN and GN, implying complex interactions between the two regulatory layers. Finally, we report that the expression profiles of module members in both TN and GN shift dramatically yet concordantly during tumorigenesis. The mechanisms underlying this coordinated shifting remain unclear yet are worth further explorations. Conclusion We show that in lung adenocarcinoma, transcript isoforms per se are coordinately regulated to conduct biological functions not conveyed by the network of genes. However, the two networks may interact closely with each other by sharing the same or related biological functions. Unraveling the effects and mechanisms of such interactions will

  10. Post-Transcriptional Control of Chloroplast Gene Expression

    PubMed Central

    del Campo, Eva M.

    2009-01-01

    Chloroplasts contain their own genome, organized as operons, which are generally transcribed as polycistronic transcriptional units. These primary transcripts are processed into smaller RNAs, which are further modified to produce functional RNAs. The RNA processing mechanisms remain largely unknown and represent an important step in the control of chloroplast gene expression. Such mechanisms include RNA cleavage of pre-existing RNAs, RNA stabilization, intron splicing, and RNA editing. Recently, several nuclear-encoded proteins that participate in diverse plastid RNA processing events have been characterised. Many of them seem to belong to the pentatricopeptide repeat (PPR) protein family that is implicated in many crucial functions including organelle biogenesis and plant development. This review will provide an overview of current knowledge of the post-transcriptional processing in chloroplasts. PMID:19838333

  11. NFAT5 regulates transcription of the mouse telomerase reverse transcriptase gene

    SciTech Connect

    Fujiki, Tsukasa; Udono, Miyako; Kotake, Yojiro; Yamashita, Makiko; Shirahata, Sanetaka; Katakura, Yoshinori

    2010-12-10

    We aimed to clarify the transcription-regulation mechanisms of the mouse telomerase reverse transcriptase gene (mTERT). First, we searched for the promoter region required for transcriptional activation of mTERT and identified an enhancer cis-element (named mTERT-EE) located between - 200 and - 179 bp of the mouse TERT gene (mTERT). EMSA results suggested that nuclear factor of activated T cells (NFAT) member proteins bind to mTERT-EE. We then identified NFAT5 as the factor binding to mTERT-EE and found that it activates the transcription of the mTERT core promoter. The results that siRNA directed against NFAT5 significantly reduced mTERT expression and mTERT core promoter activity and that the expressions of NFAT5 and mTERT were well correlated in various mouse tissues except liver suggest that NFAT5 dominantly and directly regulates mTERT expression. To clarify their functionality further, we investigated the effect of hypertonic stress, a known stimulus affecting the expression and transcriptional activity of NFAT5, on mTERT expression. The result indicated that hypertonic stress activates mTERT transcription via the activation and recruitment of NFAT5 to the mTERT promoter. These results provide useful information about the transcription-regulation mechanisms of mTERT.

  12. Cloning and transcriptional control of a eucaryotic permease gene.

    PubMed Central

    Chevallier, M R

    1982-01-01

    The uracil permease gene of the yeast Saccharomyces cerevisiae was cloned on a hybrid plasmid which replicates autonomously in both yeast and Escherichia coli. Cloning was carried out by complementation in yeast. The smallest DNA fragment found to complement the uracil permease deficiency in recipient yeast cells measured approximately 2.3 kilobases. In strains transformed by the plasmid with the uracil permease gene inserted, initial rates of uracil uptake increased up to 25 times more than the rates found in the wild type. Using DNA probes carrying several regions of the cloned gene, I showed that a strain carrying the dhul-I mutation, which is not linked to the permease structural gene and is responsible for enhanced uptake velocity of uracil, had enhanced transcription of the permease gene. By using DNA probes recloned in phage M13 mp7, the direction of transcription of the permease gene relative to the restriction map was deduced. A half-life of 2 min was found for the permease mRNA in labeling kinetics experiments. PMID:6290876

  13. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

    PubMed Central

    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

    2015-01-01

    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

  14. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus.

    PubMed

    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

    2015-03-18

    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer-promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them.

  15. Noninvasive Tracking of Gene Transcript and Neuroprotection after Gene Therapy

    PubMed Central

    Ren, Jiaqian; Chen, Y. Iris; Liu, Christina H.; Chen, Po-Chih; Prentice, Howard; Wu, Jang-Yen; Liu, Philip K.

    2015-01-01

    Gene therapy holds exceptional potential for translational medicine by improving the products of defective genes in diseases and/or providing necessary biologics from endogenous sources during recovery processes. However, validating methods for the delivery, distribution and expression of the exogenous genes from such therapy can generally not be applicable to monitor effects over the long term because they are invasive. We report here that human granulocyte colony-stimulating factor (hG-CSF) cDNA encoded in scAAV-type 2 adeno-associated virus, as delivered through eye drops at multiple time points after cerebral ischemia using bilateral carotid occlusion for 60 min (BCAO-60) led to significant reduction in mortality rates, cerebral atrophy, and neurological deficits in C57black6 mice. Most importantly, we validated hG-CSF cDNA expression using translatable magnetic resonance imaging (MRI) in living brains. This noninvasive approach for monitoring exogenous gene expression in the brains has potential for great impact in the area of experimental gene therapy in animal models of heart attack, stroke, Alzheimer’s dementia, Parkinson’s disorder and amyotrophic lateral sclerosis, and the translation of such techniques to emergency medicine. PMID:26207935

  16. Widespread transcriptional gene inactivation initiated by a repair intermediate of 8-oxoguanine

    PubMed Central

    Allgayer, Julia; Kitsera, Nataliya; Bartelt, Solveig; Epe, Bernd; Khobta, Andriy

    2016-01-01

    DNA damage can significantly modulate expression of the affected genes either by direct structural interference with transcription components or as a collateral outcome of cellular repair attempts. Thus, DNA glycosylases of the base excision repair (BER) pathway have been implicated in negative transcriptional response to several spontaneously generated DNA base modifications, including a common oxidative DNA base modification 8-oxoguanine (8-oxoG). Here, we report that single 8-oxoG situated in the non-transcribed DNA strand of a reporter gene has a pronounced negative effect on transcription, driven by promoters of various strength and with different structural properties, including viral, human, and artificial promoters. We further show that the magnitude of the negative effect on the gene expression correlates with excision of the modified base by OGG1 in all promoter constructs tested. Moreover, by using expression vectors with nuclease resistant backbone modifications, we demonstrate that OGG1 does not catalyse DNA strand cleavage in vivo. Rather, cleavage of the phosphate bond 5′ to 8-oxodG (catalysed by APE1) is essential and universally required for the onset of transcriptional silencing, regardless of the promoter structure. Hence, induction of transcriptional silencing emerges as a ubiquitous mode of biological response to 8-oxoG in DNA. PMID:27220469

  17. Glucocorticoid modulation of casein gene transcription in mouse mammary gland.

    PubMed Central

    Ganguly, R; Mehta, N M; Ganguly, N; Banerjee, M R

    1979-01-01

    The influence of cortisol and prolactin on casein gene expression in the mammary gland of lactating BALB/c mice was measured by using a specific cDNA probe to 15S casein mRNA (cDNAcsn). Casein mRNA (mRNAcsn) level in the mammary gland was decreased by 85% 5 days after adrenal ablation, but then was increased 4.4-fold 12 hr after a single injection of hydrocortisone-21-acetate. An 80% decrease in serum prolactin level, induced by the prolactin inhibitor 2-bromo-alpha-ergocryptin (CB-154), did not alter the level of mRNAcsn in the gland. Specific transcription of the casein gene in nuclei isolated from lactating mammary glands was measured by cDNAcsn hybridization to the in vitro synthesized Hg-CTP-containing RNA (Hg-RNA), which was purified by SH-agarose chromatography. The level of the mRNAcsn in Hg-RNA synthesized in the isolated nuclei was 0.09% and this was decreased 85% by alpha-amanitin, indicating that the mRNAcsn sequences in the Hg-RNA were the products of RNA polymerase II-directed DNA-dependent RNA synthesis. Transcription of the mRNAcsn in isolated nuclei was decreased by 70% 5 days after adrenalectomy and a single injection of the glucocorticoid then increased the transcription level 2-fold at 6 hr. Essentially no alteration of the level of transcription was detectable in mammary nuclei isolated from lactating mice with 80% decreased serum prolactin level, induced by CB-154 treatment. The results thus demonstrate a glucocorticoid involvement on the modulation of casein gene expression at the transcriptional level of control. PMID:293734

  18. Stochastic model for gene transcription on Drosophila melanogaster embryos

    NASA Astrophysics Data System (ADS)

    Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.

    2016-02-01

    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

  19. Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

    PubMed

    Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

    2016-04-01

    Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

  20. Nongenic transcription, gene regulation and action at a distance.

    PubMed

    Cook, Peter R

    2003-11-15

    In eukaryotes, motifs such as silencers, enhancers and locus control regions act over thousands of base pairs to regulate adjacent genes; insulators limit such effects, and barriers confine repressive heterochromatin to particular chromosomal segments. Recent results show that many of these motifs are nongenic transcription units, and two of them directly contact their targets lying further down the chromosome to loop the intervening DNA: the barriers (scs and scs') flanking the 87A7 heat-shock locus in the fly contact each other, and a locus control region touches the beta-globin gene in the mouse. I hypothesize that the act of transcription underlies the function of these regulators; active polymerizing complexes tend to cluster into 'factories' and this facilitates molecular contact between the transcribed regulator and its distant (and transcribed) target. PMID:14576342

  1. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  2. Genetic variants in ABCA1 promoter affect transcription activity and plasma HDL level in pigs.

    PubMed

    Dang, Xiao-yong; Chu, Wei-wei; Shi, Heng-chuan; Yu, Shi-gang; Han, Hai-yin; Gu, Shu-Hua; Chen, Jie

    2015-01-25

    Excess accumulation of cholesterol in plasma may result in coronary artery disease. Numerous studies have demonstrated that ATP-binding cassette protein A1 (ABCA1) mediates the efflux of cholesterol and phospholipids to apolipoproteins, a process necessary for plasma high density lipoprotein (HDL) formation. Higher plasma levels of HDL are associated with lower risk for cardiovascular disease. Studies of human disease and animal models had shown that an increased hepatic ABCA1 activity relates to an enhanced plasma HDL level. In this study, we hypothesized that functional mutations in the ABCA1 promoter in pigs may affect gene transcription activity, and consequently the HDL level in plasma. The promoter region of ABCA1 was comparatively scanned by direct sequencing with pool DNA of high- and low-HDL groups (n=30 for each group). Two polymorphisms, c. - 608A>G and c. - 418T>A, were revealed with reverse allele distribution in the two groups. The two polymorphisms were completely linked and formed only G-A or A-T haplotypes when genotyped in a larger population (n=526). Furthermore, we found that the G-A/G-A genotype was associated with higher HDL and ABCA1 mRNA level than A-T/A-T genotype. Luciferase assay also revealed that G-A haplotype promoter had higher activity than A-T haplotype. Single-nucleotide mutant assay showed that c.-418T>A was the causal mutation for ABCA1 transcription activity alteration. Conclusively, we identified two completely linked SNPs in porcine ABCA1 promoter region which have influence on the plasma HDL level by altering ABCA1 gene transcriptional activity.

  3. Transcriptional Responses of Glutathione Transferase Genes in Ruditapes philippinarum Exposed to Microcystin-LR

    PubMed Central

    Reis, Bruno; Carneiro, Mariana; Machado, João; Azevedo, Joana; Vasconcelos, Vitor; Martins, José Carlos

    2015-01-01

    Glutathione Transferases (GSTs) are phase II detoxification enzymes known to be involved in the molecular response against microcystins (MCs) induced toxicity. However, the individual role of the several GST isoforms in the MC detoxification process is still unknown. In this study, the time-dependent changes on gene expression of several GST isoforms (pi, mu, sigma 1, sigma 2) in parallel with enzymatic activity of total GST were investigated in gills and hepatopancreas of the bivalve Ruditapes philippinarum exposed to pure MC-LR (10 and 100 µg/L). No significant changes in GST enzyme activities were found on both organs. In contrast, MC-LR affected the transcriptional activities of these detoxification enzymes both in gills and hepatopancreas. GST transcriptional changes in gills promoted by MC-LR were characterized by an early (12 h) induction of mu and sigma 1 transcripts. On the other hand, the GST transcriptional changes in hepatopancreas were characterized by a later induction (48 h) of mu transcript, but also by an early inhibition (6 h) of the four transcripts. The different transcription patterns obtained for the tested GST isoforms in this study highlight the potential divergent physiological roles played by these isoenzymes during the detoxification of MC-LR. PMID:25884330

  4. Repression of btuB gene transcription in Escherichia coli by the GadX protein

    PubMed Central

    2011-01-01

    Background BtuB (B  twelve uptake) is an outer membrane protein of Escherichia coli, it serves as a receptor for cobalamines uptake or bactericidal toxin entry. A decrease in the production of the BtuB protein would cause E. coli to become resistant to colicins. The production of BtuB has been shown to be regulated at the post-transcriptional level. The secondary structure switch of 5' untranslated region of butB and the intracellular concentration of adenosylcobalamin (Ado-Cbl) would affect the translation efficiency and RNA stability of btuB. The transcriptional regulation of btuB expression is still unclear. Results To determine whether the btuB gene is also transcriptionally controlled by trans-acting factors, a genomic library was screened for clones that enable E. coli to grow in the presence of colicin E7, and a plasmid carrying gadX and gadY genes was isolated. The lacZ reporter gene assay revealed that these two genes decreased the btuB promoter activity by approximately 50%, and the production of the BtuB protein was reduced by approximately 90% in the presence of a plasmid carrying both gadX and gadY genes in E. coli as determined by Western blotting. Results of electrophoretic mobility assay and DNase I footprinting indicated that the GadX protein binds to the 5' untranslated region of the btuB gene. Since gadX and gadY genes are more highly expressed under acidic conditions, the transcriptional level of btuB in cells cultured in pH 7.4 or pH 5.5 medium was examined by quantitative real-time PCR to investigate the effect of GadX. The results showed the transcription of gadX with 1.4-fold increase but the level of btuB was reduced to 57%. Conclusions Through biological and biochemical analysis, we have demonstrated the GadX can directly interact with btuB promoter and affect the expression of btuB. In conclusion, this study provides the first evidence that the expression of btuB gene is transcriptionally repressed by the acid responsive genes gadX and

  5. Rapid parallel evolutionary changes of gene transcription profiles in farmed Atlantic salmon.

    PubMed

    Roberge, Christian; Einum, Sigurd; Guderley, Helga; Bernatchez, Louis

    2006-01-01

    Farmed salmon strains have been selected to improve growth rates as well as other traits of commercial interest but the 2 million farmed salmon escaping annually may enhance the risk of extinction of wild populations through genetic and ecological interactions. Here, we compare the transcription profiles of 3557 genes in the progeny of farmed and wild Atlantic salmon from Norway and Canada grown in controlled conditions, and demonstrate that five to seven generations of artificial selection led to heritable changes in gene transcription profiles, the average magnitude of the differences being 25% and 18% for at least 1.4% and 1.7% of the expressed genes in juvenile salmon from Norway and Canada, respectively. Moreover, genes showing significant transcription profile differences in both farmed strains (16%) all exhibited parallel changes. These findings, along with the identification of several genes whose expression profiles were modified through artificial selection, provide new insights into the molecular basis of parallel evolution, and suggest how gene flow from farmed escapees may affect the genetic integrity of wild populations. PMID:16367826

  6. Rapid parallel evolutionary changes of gene transcription profiles in farmed Atlantic salmon.

    PubMed

    Roberge, Christian; Einum, Sigurd; Guderley, Helga; Bernatchez, Louis

    2006-01-01

    Farmed salmon strains have been selected to improve growth rates as well as other traits of commercial interest but the 2 million farmed salmon escaping annually may enhance the risk of extinction of wild populations through genetic and ecological interactions. Here, we compare the transcription profiles of 3557 genes in the progeny of farmed and wild Atlantic salmon from Norway and Canada grown in controlled conditions, and demonstrate that five to seven generations of artificial selection led to heritable changes in gene transcription profiles, the average magnitude of the differences being 25% and 18% for at least 1.4% and 1.7% of the expressed genes in juvenile salmon from Norway and Canada, respectively. Moreover, genes showing significant transcription profile differences in both farmed strains (16%) all exhibited parallel changes. These findings, along with the identification of several genes whose expression profiles were modified through artificial selection, provide new insights into the molecular basis of parallel evolution, and suggest how gene flow from farmed escapees may affect the genetic integrity of wild populations.

  7. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.

    PubMed

    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L; Stavans, Joel

    2016-08-19

    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts' threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation. PMID:27085802

  8. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.

    PubMed

    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L; Stavans, Joel

    2016-08-19

    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts' threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation.

  9. Cloning and transcriptional analysis of Crepis alpina fatty acid desaturases affecting the biosynthesis of crepenynic acid.

    PubMed

    Nam, Jeong-Won; Kappock, T Joseph

    2007-01-01

    Crepis alpina acetylenase is a variant FAD2 desaturase that catalyses the insertion of a triple bond at the Delta12 position of linoleic acid, forming crepenynic acid in developing seeds. Seeds contain a high level of crepenynic acid but other tissues contain none. Using reverse transcriptase-coupled PCR (RT-PCR), acetylenase transcripts were identified in non-seed C. alpina tissues, which were highest in flower heads. To understand why functional expression of the acetylenase is limited to seeds, genes that affect acetylenase activity by providing substrate (FAD2) or electrons (cytochrome b5), or that compete for substrate (FAD3), were cloned. RT-PCR analysis indicated that the availability of a preferred cytochrome b5 isoform is not a limiting factor. Developing seeds co-express acetylenase and FAD2 isoform 2 (FAD2-2) at high levels. Flower heads co-express FAD2-3 and FAD3 at high levels, and FAD2-2 and acetylenase at moderate levels. FAD2-3 was not expressed in developing seed. Real-time RT-PCR absolute transcript quantitation showed 10(4)-fold higher acetylenase expression in developing seeds than in flower heads. Collectively, the results show that both the acetylenase expression level and the co-expression of other desaturases may contribute to the tissue specificity of crepenynate production. Helianthus annuus contains a Delta12 acetylenase in a polyacetylene biosynthetic pathway, so does not accumulate crepenynate. Real-time RT-PCR analysis showed relatively strong acetylenase expression in young sunflowers. Acetylenase transcription is observed in both species without accumulation of the enzymatic product, crepenynate. Functional expression of acetylenase appears to be affected by competition and collaboration with other enzymes. PMID:17329262

  10. Manganese peroxidase gene transcription in Phanerochaete chrysosporium: Activation by manganese

    SciTech Connect

    Brown, J.A.; Alic, M. Gold, M.H. )

    1991-07-01

    The expression of manganese peroxidase in nitrogen-limited cultures of Phanerochaete chrysosporium is dependent on Mn, and initial work suggested that Mn regulates transcription of the mnp gene. In this study, using Northern (RNA) blot analysis of kinetic, dose-response, and inhibitor experiments, the authors demonstrate unequivocally that Mn regulates mnp gene transcription. The amount of mnp mRNA in cells of 4-day-old nitrogen-limited cultures is a direct function of the concentration of Mn in the culture medium up to a maximum of 180 {mu}M. Addition of Mn to nitrogen-limited Mn-deficient secondary metabolic (4-, 5-, and 6-day-old) cultures results in the appearance of mnp mRNA within 40 min. The appearance of this message is completely inhibited by the RNA synthesis inhibitor dactinomycin but not by the protein synthesis inhibitor cycloheximide. Furthermore, the amount of mnp mRNA produced is a direct function of the concentration of added Mn. In contrast, addition of Mn to low-nitrogen Mn-deficient 2- or 3-day-old cultures does not result in the appearance of mnp mRNA. Manganese peroxidase protein is detected by specific immunoprecipitation of the in vitro translation products of poly(A) RNA isolated from Mn-supplemented (but nor from Mn-deficient) cells. All of these results demonstrate that Mn, the substrate for the enzyme, regulates mnp gene transcription via a growth-stage-specific and concentration-dependent mechanism.

  11. The obesity-associated Fto gene is a transcriptional coactivator.

    PubMed

    Wu, Qiong; Saunders, Rudel A; Szkudlarek-Mikho, Maria; Serna, Ivana de la; Chin, Khew-Voon

    2010-10-22

    The fat mass and obesity associated, FTO, gene has been shown to be associated with obesity in human in several genome-wide association scans. In vitro studies suggest that Fto may function as a single-stranded DNA demethylase. In addition, homologous recombination-targeted knockout of Fto in mice resulted in growth retardation, loss of white adipose tissue, and increase energy metabolism and systemic sympathetic activation. Despite these intense investigations, the exact function of Fto remains unclear. We show here that Fto is a transcriptional coactivator that enhances the transactivation potential of the CCAAT/enhancer binding proteins (C/EBPs) from unmethylated as well as methylation-inhibited gene promoters. Fto also exhibits nuclease activity. We showed further that Fto enhances the binding C/EBP to unmethylated and methylated DNA. The coactivator role of FTO in modulating the transcriptional regulation of adipogenesis by C/EBPs is consistent with the temporal progressive loss of adipose tissue in the Fto-deficient mice, thus suggesting a role for Fto in the epigenetic regulation of the development and maintenance of fat tissue. How FTO reactivates transcription from methyl-repressed gene needs to be further investigated.

  12. Post-transcriptional regulation of the chicken thymidine kinase gene.

    PubMed

    Groudine, M; Casimir, C

    1984-02-10

    In attempting to understand the molecular basis of the control of chicken thymidine kinase (cTK) gene expression, we have examined the steady state cTK RNA content, and the patterns of DNA methylation, chromatin structure and endogenous nuclear runoff transcription of this gene in dividing and non-dividing cells. Our results reveal that the steady state level of cTK poly A+ RNA is correlated with the divisional activity of normal avian cells and tissues. However, no differences in the pattern of Hpa II site methylation or chromatin structure are found among cells containing high or undetectable levels of steady state cTK RNA. In addition, no differences in cTK transcription as assayed by nuclear runoff experiments are detectable in isolated nuclei derived from dividing or non-dividing cells containing high or low levels of steady state cTK RNA. These results suggest that the principal control of chicken thymidine kinase gene expression is post-transcriptional in nature.

  13. Transcriptional regulation of cathelicidin genes in chicken bone marrow cells.

    PubMed

    Lee, Sang In; Jang, Hyun June; Jeon, Mi-hyang; Lee, Mi Ock; Kim, Jeom Sun; Jeon, Ik-Soo; Byun, Sung June

    2016-04-01

    Cathelicidins form a family of vertebrate-specific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription factors (TFs) that bind to the 5'-flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5'-flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.

  14. Post-transcriptional control of GRF transcription factors by microRNA miR396 and GIF co-activator affects leaf size and longevity.

    PubMed

    Debernardi, Juan M; Mecchia, Martin A; Vercruyssen, Liesbeth; Smaczniak, Cezary; Kaufmann, Kerstin; Inze, Dirk; Rodriguez, Ramiro E; Palatnik, Javier F

    2014-08-01

    The growth-regulating factors (GRFs) are plant-specific transcription factors. They form complexes with GRF-interacting factors (GIFs), a small family of transcriptional co-activators. In Arabidopsis thaliana, seven out of the nine GRFs are controlled by microRNA miR396. Analysis of Arabidopsis plants carrying a GRF3 allele insensitive to miR396 revealed a strong boost in the number of cells in leaves, which was further enhanced synergistically by an additional increase of GIF1 levels. Genetic experiments revealed that GRF3 can still increase cell number in gif1 mutants, albeit to a much lesser extent. Genome-wide transcript profiling indicated that the simultaneous increase of GRF3 and GIF1 levels causes additional effects in gene expression compared to either of the transgenes alone. We observed that GIF1 interacts in vivo with GRF3, as well as with chromatin-remodeling complexes, providing a mechanistic explanation for the synergistic activities of a GRF3-GIF1 complex. Interestingly, we found that, in addition to the leaf size, the GRF system also affects the organ longevity. Genetic and molecular analysis revealed that the functions of GRFs in leaf growth and senescence can be uncoupled, demonstrating that the miR396-GRF-GIF network impinges on different stages of leaf development. Our results integrate the post-transcriptional control of the GRF transcription factors with the progression of leaf development.

  15. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. PMID:26768363

  16. Brain regions and genes affecting postural control.

    PubMed

    Lalonde, R; Strazielle, C

    2007-01-01

    Postural control is integrated in all facets of motor commands. The role of cortico-subcortical pathways underlying postural control, including cerebellum and its afferents (climbing, mossy, and noradrenergic fibers), basal ganglia, motor thalamus, and parieto-frontal neocortex has been identified in animal models, notably through the brain lesion technique in rats and in mice with spontaneous and induced mutations. These studies are complemented by analyses of the factors underlying postural deficiencies in patients with cerebellar atrophy. With the gene deletion technique in mice, specific genes expressed in cerebellum encoding glutamate receptors (Grid2 and Grm1) and other molecules (Prkcc, Cntn6, Klf9, Syt4, and En2) have also been shown to affect postural control. In addition, transgenic mouse models of the synucleinopathies and of Huntington's disease cause deficiencies of motor coordination resembling those of patients with basal ganglia damage.

  17. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1990--June 30, 1992

    SciTech Connect

    Kuchka, M.R.

    1992-08-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5` UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  18. Pathophysiological factors affecting CAR gene expression.

    PubMed

    Pascussi, Jean Marc; Dvorák, Zdenek; Gerbal-Chaloin, Sabine; Assenat, Eric; Maurel, Patrick; Vilarem, Marie José

    2003-11-01

    The body defends itself against potentially harmful compounds, such as drugs and toxic endogenous compounds and their metabolites, by inducing the expression of enzymes and transporters involved in their metabolism and elimination. The orphan nuclear receptor CAR (NR1I3 controls phase I (CYP2B, CYP2C, CYP3A), phase II (UGT1A1), and transporter (SLC21A6, MRP2) genes involved in drug metabolism and bilirubin clearance. Constitutive androstane receptor (CAR) is activated by xenobiotics, such as phenobarbital, but also by toxic endogenous compounds such as bilirubin metabolite(s). To better understand the inter- and intravariability in drug detoxification, we studied the molecular mechanisms involved in CAR gene expression in human hepatocytes. We clearly identified CAR as a glucocorticoid receptor (GR) target gene, and we proposed the hypothesis of a signal transduction where the activation of GR plays a critical function in CAR-mediated cellular response. According to our model, chemicals or pathophysiological factors that affect GR function should decrease CAR function. To test this hypothesis, we recently investigated the effect of microtubule disrupting agents (MIAs) or proinflammatory cytokines. These compounds are well-known inhibitors of GR transactivation property. MIAs activate c-Jun N-terminal kinase (JNK), which phosphorylates and inactivates GR, whereas proinflammatory cytokines, such as IL-6 or IL1beta, induce AP-1 or NF-kB activation, respectively, leading to GR inhibition. As expected, we observed that these molecules inhibit both CAR gene expression and phenobarbital-mediated CYP gene expression in human hepatocytes. PMID:14705859

  19. Transcriptional and posttranscriptional control of hepatitis B virus gene expression

    PubMed Central

    Uprichard, Susan L.; Wieland, Stefan F.; Althage, Alana; Chisari, Francis V.

    2003-01-01

    Hepatitis B virus (HBV) infects humans and certain nonhuman primates. Viral clearance and acute disease are associated with a strong, polyclonal, multispecific cytotoxic T lymphocyte response. Infiltrating T cells, as well as other activated inflammatory cells, produce cytokines that can regulate hepatocellular gene expression. Using an HBV transgenic mouse model, our laboratory has previously demonstrated that adoptive transfer of HBV-specific cytotoxic T lymphocytes or injection of IL-2 can noncytopathically inhibit HBV gene expression by a posttranscriptional IFN-γ- and/or tumor necrosis factor α-dependent mechanism. Here, we report that HBV gene expression can also be controlled at the posttranscriptional level during persistent lymphocytic choriomeningitis virus infection. In contrast, it is controlled at the transcriptional level during acute murine cytomegalovirus infection or after repetitive polyinosinic-polycytidylic acid injection. Finally, we show that transcriptional inhibition of HBV is associated with changes in liver-specific gene expression. These results elucidate pathways that regulate the viral life cycle and suggest additional approaches for the treatment of chronic HBV infection. PMID:12552098

  20. Transcriptional Truncation of the Long Coding Imprinted Gene Usp29

    PubMed Central

    He, Hongzhi; Ye, An; Kim, Joomyeong

    2016-01-01

    Usp29 (Ubiquitin-specific protease 29) is a paternally expressed gene located upstream of another imprinted gene Peg3. In the current study, the transcription of this long coding gene spanning a 250-kb genomic distance was truncated using a knockin allele. According to the results, paternal transmission of the mutant allele resulted in reduced body and litter sizes whereas the maternal transmission caused no obvious effects. In the paternal mutant, the expression levels of Usp29 were reduced to 14–18% level of the wild-type littermates due to the Poly-A signal included in the knockin cassette. Expression analyses further revealed an unusual female-specific up-regulation of the adjacent imprinted gene Zfp264 in the mutant. Consistent with this, the promoter of Zfp264 was hypomethylated only in the female mutant. Interestingly, this female-specific hypomethylation by the knockin allele was not detected in the offspring of an interspecific crossing, indicating its sensitivity to genetic background. Overall, the results suggest that the transcription of Usp29 may be involved in DNA methylation setting of Zfp264 promoter in a sex-specific manner. PMID:27327533

  1. Zinc triggers a complex transcriptional and post-transcriptional regulation of the metal homeostasis gene FRD3 in Arabidopsis relatives

    PubMed Central

    Charlier, Jean-Benoit; Polese, Catherine; Nouet, Cécile; Carnol, Monique; Bosman, Bernard; Krämer, Ute; Motte, Patrick; Hanikenne, Marc

    2015-01-01

    In Arabidopsis thaliana, FRD3 (FERRIC CHELATE REDUCTASE DEFECTIVE 3) plays a central role in metal homeostasis. FRD3 is among a set of metal homeostasis genes that are constitutively highly expressed in roots and shoots of Arabidopsis halleri, a zinc hyperaccumulating and hypertolerant species. Here, we examined the regulation of FRD3 by zinc in both species to shed light on the evolutionary processes underlying the evolution of hyperaccumulation in A. halleri. We combined gene expression studies with the use of β-glucuronidase and green fluorescent protein reporter constructs to compare the expression profile and transcriptional and post-transcriptional regulation of FRD3 in both species. The AtFRD3 and AhFRD3 genes displayed a conserved expression profile. In A. thaliana, alternative transcription initiation sites from two promoters determined transcript variants that were differentially regulated by zinc supply in roots and shoots to favour the most highly translated variant under zinc-excess conditions. In A. halleri, a single transcript variant with higher transcript stability and enhanced translation has been maintained. The FRD3 gene thus undergoes complex transcriptional and post-transcriptional regulation in Arabidopsis relatives. Our study reveals that a diverse set of mechanisms underlie increased gene dosage in the A. halleri lineage and illustrates how an environmental challenge can alter gene regulation. PMID:25900619

  2. WRKY transcription factor genes in wild rice Oryza nivara

    PubMed Central

    Xu, Hengjian; Watanabe, Kenneth A.; Zhang, Liyuan; Shen, Qingxi J.

    2016-01-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  3. Genetic Variants in the STMN1 Transcriptional Regulatory Region Affect Promoter Activity and Fear Behavior in English Springer Spaniels

    PubMed Central

    Zhang, Hanying; Xu, Yinxue

    2016-01-01

    Stathmin 1 (STMN1) is a neuronal growth-associated protein that is involved in microtubule dynamics and plays an important role in synaptic outgrowth and plasticity. Given that STMN1 affects fear behavior, we hypothesized that genetic variations in the STMN1 transcriptional regulatory region affect gene transcription activity and control fear behavior. In this study, two single nucleotide polymorphisms (SNPs), g. -327 A>G and g. -125 C>T, were identified in 317 English Springer Spaniels. A bioinformatics analysis revealed that both were loci located in the canine STMN1 putative promoter region and affected transcription factor binding. A statistical analysis revealed that the TT genotype at g.-125 C>T produced a significantly greater fear level than that of the CC genotype (P < 0.05). Furthermore, the H4H4 (GTGT) haplotype combination was significantly associated with canine fear behavior (P < 0.01). Using serially truncated constructs of the STMN1 promoters and the luciferase reporter, we found that a 395 bp (−312 nt to +83 nt) fragment constituted the core promoter region. The luciferase assay also revealed that the H4 (GT) haplotype promoter had higher activity than that of other haplotypes. Overall, our results suggest that the two SNPs in the canine STMN1 promoter region could affect canine fear behavior by altering STMN1 transcriptional activity. PMID:27390866

  4. Transcriptional and post-transcriptional regulation of tyrosine hydroxylase gene by protein kinase C.

    PubMed Central

    Vyas, S; Faucon Biguet, N; Mallet, J

    1990-01-01

    The role played by protein kinase C (PKC) in TH gene regulation was investigated at transcriptional and post-transcriptional levels using PC12 cells. The cells were treated with the phorbol ester TPA, which not only activates PKC but also causes down-regulation. PKC levels were monitored by [3H]PDBU binding assay and by using an anti-PKC antibody that detected intact PKC (79 kd) as well as its catalytic and regulatory domains. The [3H]PDBU binding to the membrane-associated PKC increased within 15-30 min of TPA treatment; thereafter total cellular [3H]PDBU binding decreased to a minimum of 20% of the control at 8 h. The rate of decrease in binding was greater than the decrease in the intensity of the staining of PKC holo enzyme visualized by anti-PKC antibody. TH mRNA levels, measured over the same time period, rose within 15 min of TPA treatment to peak at 4 h and subsequently declined below control level, paralleling the depletion of PKC. If cells depleted of PKC were reincubated in the normal medium, a recovery in PKC level was seen and, in parallel, TH mRNA levels increased to above control level. Furthermore, if down-regulation of PKC was prevented by incubating the cells with the protease inhibitor leupeptin, a decrease beyond control level in TH mRNA was not observed. TPA rapidly induced TH gene transcription; a maximal increase of two-fold was observed at 15 min, but the transcriptional rate then declined although it did not decrease beyond control values after 8 and 24 h of TPA treatment.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig.2 Fig.3 Fig.6 PMID:1976513

  5. Macromolecular Crowding as a Regulator of Gene Transcription

    PubMed Central

    Matsuda, Hiroaki; Putzel, Gregory Garbès; Backman, Vadim; Szleifer, Igal

    2014-01-01

    Studies of macromolecular crowding have shown its important effects on molecular transport and interactions in living cells. Less clear is the effect of crowding when its influence is incorporated into a complex network of interactions. Here, we explore the effects of crowding in the cell nucleus on a model of gene transcription as a network of reactions involving transcription factors, RNA polymerases, and DNA binding sites for these proteins. The novelty of our approach is that we determine the effects of crowding on the rates of these reactions using Brownian dynamics and Monte Carlo simulations, allowing us to integrate molecular-scale information, such as the shapes and sizes of each molecular species, into the rate equations of the model. The steady-state cytoplasmic mRNA concentration shows several regimes with qualitatively different dependences on the volume fraction, ϕ, of crowding agents in the nucleus, including a broad range of parameter values where it depends nonmonotonically on ϕ, with maximum mRNA production occurring at a physiologically relevant value. The extent of this crowding dependence can be modulated by a variety of means, suggesting that the transcriptional output of a gene can be regulated jointly by the local level of macromolecular crowding in the nucleus, together with the local concentrations of polymerases and DNA-binding proteins, as well as other properties of the gene’s physical environment. PMID:24739179

  6. Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota

    PubMed Central

    Leyn, Semen A.; Rodionova, Irina A.; Li, Xiaoqing

    2015-01-01

    ABSTRACT Autotrophic microorganisms are able to utilize carbon dioxide as their only carbon source, or, alternatively, many of them can grow heterotrophically on organics. Different variants of autotrophic pathways have been identified in various lineages of the phylum Crenarchaeota. Aerobic members of the order Sulfolobales utilize the hydroxypropionate-hydroxybutyrate cycle (HHC) to fix inorganic carbon, whereas anaerobic Thermoproteales use the dicarboxylate-hydroxybutyrate cycle (DHC). Knowledge of transcriptional regulation of autotrophic pathways in Archaea is limited. We applied a comparative genomics approach to predict novel autotrophic regulons in the Crenarchaeota. We report identification of two novel DNA motifs associated with the autotrophic pathway genes in the Sulfolobales (HHC box) and Thermoproteales (DHC box). Based on genome context evidence, the HHC box regulon was attributed to a novel transcription factor from the TrmB family named HhcR. Orthologs of HhcR are present in all Sulfolobales genomes but were not found in other lineages. A predicted HHC box regulatory motif was confirmed by in vitro binding assays with the recombinant HhcR protein from Metallosphaera yellowstonensis. For the DHC box regulon, we assigned a different potential regulator, named DhcR, which is restricted to the order Thermoproteales. DhcR in Thermoproteus neutrophilus (Tneu_0751) was previously identified as a DNA-binding protein with high affinity for the promoter regions of two autotrophic operons. The global HhcR and DhcR regulons reconstructed by comparative genomics were reconciled with available omics data in Metallosphaera and Thermoproteus spp. The identified regulons constitute two novel mechanisms for transcriptional control of autotrophic pathways in the Crenarchaeota. IMPORTANCE Little is known about transcriptional regulation of carbon dioxide fixation pathways in Archaea. We previously applied the comparative genomics approach for reconstruction of Dtx

  7. EBE, an AP2/ERF Transcription Factor Highly Expressed in Proliferating Cells, Affects Shoot Architecture in Arabidopsis[W

    PubMed Central

    Mehrnia, Mohammad; Balazadeh, Salma; Zanor, María-Inés; Mueller-Roeber, Bernd

    2013-01-01

    We report about ERF BUD ENHANCER (EBE; At5g61890), a transcription factor that affects cell proliferation as well as axillary bud outgrowth and shoot branching in Arabidopsis (Arabidopsis thaliana). EBE encodes a member of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor superfamily; the gene is strongly expressed in proliferating cells and is rapidly and transiently up-regulated in axillary meristems upon main stem decapitation. Overexpression of EBE promotes cell proliferation in growing calli, while the opposite is observed in EBE-RNAi lines. EBE overexpression also stimulates axillary bud formation and outgrowth, while repressing it results in inhibition of bud growth. Global transcriptome analysis of estradiol-inducible EBE overexpression lines revealed 48 EBE early-responsive genes, of which 14 were up-regulated and 34 were down-regulated. EBE activates several genes involved in cell cycle regulation and dormancy breaking, including D-type cyclin CYCD3;3, transcription regulator DPa, and BRCA1-ASSOCIATED RING DOMAIN1. Among the down-regulated genes were DORMANCY-ASSOCIATED PROTEIN1 (AtDRM1), AtDRM1 homolog, MEDIATOR OF ABA-REGULATED DORMANCY1, and ZINC FINGER HOMEODOMAIN5. Our data indicate that the effect of EBE on shoot branching likely results from an activation of genes involved in cell cycle regulation and dormancy breaking. PMID:23616605

  8. Effect of replication on epigenetic memory and consequences on gene transcription

    NASA Astrophysics Data System (ADS)

    Zerihun, Mehari B.; Vaillant, Cédric; Jost, Daniel

    2015-04-01

    Gene activity in eukaryotes is in part regulated at the level of chromatin through the assembly of local chromatin states that are more or less permissive to transcription. How do these chromatin states achieve their functions and whether or not they contribute to the epigenetic inheritance of the transcriptional program remain to be elucidated. In cycling cells, stability is indeed strongly challenged by the periodic occurrence of replication and cell division. To address this question, we perform simulations of the stochastic dynamics of chromatin states when driven out-of-equilibrium by periodic perturbations. We show how epigenetic memory is significantly affected by the cell cycle length. In addition, we develop a simple model to connect the epigenetic state to the transcriptional state and gene activity. In particular, it suggests that replication may induce transcriptional bursting at repressive loci. Finally, we discuss how our findings—effect of replication and link to gene transcription—have original and deep implications to various biological contexts of epigenetic memory.

  9. Mutant p53 is a transcriptional co-factor that binds to G-rich regulatory regions of active genes and generates transcriptional plasticity

    PubMed Central

    Quante, Timo; Otto, Benjamin; Brázdová, Marie; Kejnovská, Iva; Deppert, Wolfgang; Tolstonog, Genrich V.

    2012-01-01

    The molecular mechanisms underlying mutant p53 (mutp53) “gain-of-function” (GOF) are still insufficiently understood, but there is evidence that mutp53 is a transcriptional regulator that is recruited by specialized transcription factors. Here we analyzed the binding sites of mutp53 and the epigenetic status of mutp53-regulated genes that had been identified by global expression profiling upon depletion of endogenous mutp53 (R273H) expression in U251 glioblastoma cells. We found that mutp53 preferentially and autonomously binds to G/C-rich DNA around transcription start sites (TSS) of many genes characterized by active chromatin marks (H3K4me3) and frequently associated with transcription-competent RNA polymerase II. Mutp53-bound regions overlap predominantly with CpG islands and are enriched in G4-motifs that are prone to form G-quadruplex structures. In line, mutp53 binds and stabilizes a well-characterized G-quadruplex structure in vitro. Hence, we assume that binding of mutp53 to G/C-rich DNA regions associated with a large set of cancer-relevant genes is an initial step in their regulation by mutp53. Using GAS1 and HTR2A as model genes, we show that mutp53 affects several parameters of active transcription. Finally, we discuss a dual mode model of mutp53 GOF, which includes both stochastic and deterministic components. PMID:22894900

  10. Controlling for gene expression changes in transcription factor protein networks.

    PubMed

    Banks, Charles A S; Lee, Zachary T; Boanca, Gina; Lakshminarasimhan, Mahadevan; Groppe, Brad D; Wen, Zhihui; Hattem, Gaye L; Seidel, Chris W; Florens, Laurence; Washburn, Michael P

    2014-06-01

    The development of affinity purification technologies combined with mass spectrometric analysis of purified protein mixtures has been used both to identify new protein-protein interactions and to define the subunit composition of protein complexes. Transcription factor protein interactions, however, have not been systematically analyzed using these approaches. Here, we investigated whether ectopic expression of an affinity tagged transcription factor as bait in affinity purification mass spectrometry experiments perturbs gene expression in cells, resulting in the false positive identification of bait-associated proteins when typical experimental controls are used. Using quantitative proteomics and RNA sequencing, we determined that the increase in the abundance of a set of proteins caused by overexpression of the transcription factor RelA is not sufficient for these proteins to then co-purify non-specifically and be misidentified as bait-associated proteins. Therefore, typical controls should be sufficient, and a number of different baits can be compared with a common set of controls. This is of practical interest when identifying bait interactors from a large number of different baits. As expected, we found several known RelA interactors enriched in our RelA purifications (NFκB1, NFκB2, Rel, RelB, IκBα, IκBβ, and IκBε). We also found several proteins not previously described in association with RelA, including the small mitochondrial chaperone Tim13. Using a variety of biochemical approaches, we further investigated the nature of the association between Tim13 and NFκB family transcription factors. This work therefore provides a conceptual and experimental framework for analyzing transcription factor protein interactions.

  11. Transcriptional networks driving enhancer function in the CFTR gene.

    PubMed

    Kerschner, Jenny L; Harris, Ann

    2012-09-01

    A critical cis-regulatory element for the CFTR (cystic fibrosis transmembrane conductance regulator) gene is located in intron 11, 100 kb distal to the promoter, with which it interacts. This sequence contains an intestine-selective enhancer and associates with enhancer signature proteins, such as p300, in addition to tissue-specific TFs (transcription factors). In the present study we identify critical TFs that are recruited to this element and demonstrate their importance in regulating CFTR expression. In vitro DNase I footprinting and EMSAs (electrophoretic mobility-shift assays) identified four cell-type-selective regions that bound TFs in vitro. ChIP (chromatin immunoprecipitation) identified FOXA1/A2 (forkhead box A1/A2), HNF1 (hepatocyte nuclear factor 1) and CDX2 (caudal-type homeobox 2) as in vivo trans-interacting factors. Mutation of their binding sites in the intron 11 core compromised its enhancer activity when measured by reporter gene assay. Moreover, siRNA (small interfering RNA)-mediated knockdown of CDX2 caused a significant reduction in endogenous CFTR transcription in intestinal cells, suggesting that this factor is critical for the maintenance of high levels of CFTR expression in these cells. The ChIP data also demonstrate that these TFs interact with multiple cis-regulatory elements across the CFTR locus, implicating a more global role in intestinal expression of the gene.

  12. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves.

    PubMed

    Christiansen, Michael W; Gregersen, Per L

    2014-07-01

    The senescence process of plants is important for the completion of their life cycle, particularly for crop plants, it is essential for efficient nutrient remobilization during seed filling. It is a highly regulated process, and in order to address the regulatory aspect, the role of genes in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription-PCR (qRT-PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47 studied NAC genes to be important for signalling processes and for the execution of degradation processes during leaf senescence in barley. Seven models for DNA-binding motifs for NAC transcription factors were designed based on published motifs, and available promoter sequences of barley genes were screened for the motifs. Genes up-regulated during senescence showed a significant over-representation of the motifs, suggesting regulation by the NAC transcription factors. Furthermore, co-regulation studies showed that genes possessing the motifs in the promoter in general were highly co-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71 senescence-associated genes that are potential target genes for these NAC transcription factors is presented.

  13. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    PubMed Central

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.

    2015-01-01

    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by “top-down” and “guide-gene” approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via “top-down” approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by “guide-gene” approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  14. Transcription of the three HMG-CoA reductase genes of Mucor circinelloides

    PubMed Central

    2014-01-01

    Background Precursors of sterols, carotenoids, the prenyl groups of several proteins and other terpenoid compounds are synthesised via the acetate-mevalonate pathway. One of the key enzyme of this pathway is the 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase, which catalyses the conversion of HMG-CoA to mevalonate. HMG-CoA reductase therefore affects many biological processes, such as morphogenesis, synthesis of different metabolites or adaptation to environmental changes. In this study, transcription of the three HMG-CoA reductase genes (designated as hmgR1, hmgR2 and hmgR3) of the β-carotene producing Mucor circinelloides has been analysed under various culturing conditions; effect of the elevation of their copy number on the carotenoid and ergosterol content as well as on the sensitivity to statins has also been examined. Results Transcripts of each gene were detected and their relative levels varied under the tested conditions. Transcripts of hmgR1 were detected only in the mycelium and its relative transcript level seems to be strongly controlled by the temperature and the oxygen level of the environment. Transcripts of hmgR2 and hmgR3 are already present in the germinating spores and the latter is also strongly regulated by oxygen. Overexpression of hmgR2 and hmgR3 by elevating their copy numbers increased the carotenoid content of the fungus and decreased their sensitivity to statins. Conclusions The three HMG-CoA reductase genes of M. circinelloides displayed different relative transcript levels under the tested conditions suggesting differences in their regulation. They seem to be especially involved in the adaptation to the changing oxygen tension and osmotic conditions of the environment as well as to statin treatment. Overexpression of hmgR2 and hmgR3 may be used to improve the carotenoid content. PMID:24731286

  15. Estrogen Signaling Multiple Pathways to Impact Gene Transcription

    PubMed Central

    Marino, Maria; Galluzzo, Paola; Ascenzi, Paolo

    2006-01-01

    Steroid hormones exert profound effects on cell growth, development, differentiation, and homeostasis. Their effects are mediated through specific intracellular steroid receptors that act via multiple mechanisms. Among others, the action mechanism starting upon 17β-estradiol (E2) binds to its receptors (ER) is considered a paradigmatic example of how steroid hormones function. Ligand-activated ER dimerizes and translocates in the nucleus where it recognizes specific hormone response elements located in or near promoter DNA regions of target genes. Behind the classical genomic mechanism shared with other steroid hormones, E2 also modulates gene expression by a second indirect mechanism that involves the interaction of ER with other transcription factors which, in turn, bind their cognate DNA elements. In this case, ER modulates the activities of transcription factors such as the activator protein (AP)-1, nuclear factor-κB (NF-κB) and stimulating protein-1 (Sp-1), by stabilizing DNA-protein complexes and/or recruiting co-activators. In addition, E2 binding to ER may also exert rapid actions that start with the activation of a variety of signal transduction pathways (e.g. ERK/MAPK, p38/MAPK, PI3K/AKT, PLC/PKC). The debate about the contribution of different ER-mediated signaling pathways to coordinate the expression of specific sets of genes is still open. This review will focus on the recent knowledge about the mechanism by which ERs regulate the expression of target genes and the emerging field of integration of membrane and nuclear receptor signaling, giving examples of the ways by which the genomic and non-genomic actions of ERs on target genes converge. PMID:18369406

  16. Transcript profiling of transcription factor genes during silique development in Arabidopsis.

    PubMed

    de Folter, Stefan; Busscher, Jacqueline; Colombo, Lucia; Losa, Alessia; Angenent, Gerco C

    2004-10-01

    Flower development is a key process for all angiosperms and is essential for sexual reproduction. The last phase in flower development is fertilization of the ovules and formation of the fruits, which are both biologically and economically of importance. Here, we report the expression profiles of over 1100 unique Arabidopsis genes coding for known and putative transcription factors (TFs) during silique development using high-density filter array hybridizations. Hierarchical cluster analyses revealed distinct expression profiles for the different silique developmental stages. This allowed a functional classification of these expression profiles in groups, namely pistil development, embryogenesis, seed maturation, fruit maturation, and fruit development. A further focus was made on the MADS-box family, which contains many members that are functionally well-characterized. The expression profiles of these MADS-box genes during silique development give additional clues on their functions and evolutionary relationship. PMID:15604749

  17. The molecular clock regulates circadian transcription of tissue factor gene.

    PubMed

    Oishi, Katsutaka; Koyanagi, Satoru; Ohkura, Naoki

    2013-02-01

    Tissue factor (TF) is involved in endotoxin-induced inflammation and mortality. We found that the circadian expression of TF mRNA, which peaked at the day to night transition (activity onset), was damped in the liver of Clock mutant mice. Luciferase reporter and chromatin immunoprecipitation analyses using embryonic fibroblasts derived from wild-type or Clock mutant mice showed that CLOCK is involved in transcription of the TF gene. Furthermore, the results of real-time luciferase reporter experiments revealed that the circadian expression of TF mRNA is regulated by clock molecules through a cell-autonomous mechanism via an E-box element located in the promoter region.

  18. NF-Y transcriptionally regulates the Drosophila p53 gene.

    PubMed

    Tue, Nguyen Trong; Yoshioka, Yasuhide; Yamaguchi, Masamitsu

    2011-02-15

    The p53 protein is important in multicellular organisms, where it regulates the cell cycle and thus functions as a tumor suppressor that contributes to preventing cancer. However, molecular regulation of p53 gene expression is not fully understood. NF-YA is a subunit of the NF-Y trimeric complex, a transcription factor that binds to CCAAT motifs in the promoter regions of a variety of genes playing key roles in cell cycle regulation. We have identified four potential Drosophila NF-Y (dNF-Y)-binding sites located in the 5'-flanking region of the Drosophila p53 (dmp53) gene. Chromatin immunoprecipitation analyses using anti-dNF-YA antibodies confirmed that dNF-YA binds specifically to the genomic region containing CCAAT boxes in the dmp53 gene promoter in vivo. Furthermore, the thorax disclosed phenotype of dNF-YA knockdown flies can be enhanced by dmp53 mutation. In addition, the level of dmp53 mRNA was found to be decreased in the dNF-YA knockdown cells and transient expression of the luciferase gene revealed that wild-type dmp53 gene promoter activity is much stronger than mutated promoter activity in S2 cells. The requirement of CCAAT boxes for dmp53 promoter activity was further confirmed by expression of EGFP in various tissues from transgenic flies carrying wild-type and CCAAT box-mutated versions of dmp53 promoter-GFP fusion genes. These results taken together indicate that dNF-Y is necessary for dmp53 gene promoter activity.

  19. Transcriptional profiling reveals regulated genes in the hippocampus during memory formation

    NASA Technical Reports Server (NTRS)

    Donahue, Christine P.; Jensen, Roderick V.; Ochiishi, Tomoyo; Eisenstein, Ingrid; Zhao, Mingrui; Shors, Tracey; Kosik, Kenneth S.

    2002-01-01

    Transcriptional profiling (TP) offers a powerful approach to identify genes activated during memory formation and, by inference, the molecular pathways involved. Trace eyeblink conditioning is well suited for the study of regional gene expression because it requires the hippocampus, whereas the highly parallel task, delay conditioning, does not. First, we determined when gene expression was most regulated during trace conditioning. Rats were exposed to 200 trials per day of paired and unpaired stimuli each day for 4 days. Changes in gene expression were most apparent 24 h after exposure to 200 trials. Therefore, we profiled gene expression in the hippocampus 24 h after 200 trials of trace eyeblink conditioning, on multiple arrays using additional animals. Of 1,186 genes on the filter array, seven genes met the statistical criteria and were also validated by real-time polymerase chain reaction. These genes were growth hormone (GH), c-kit receptor tyrosine kinase (c-kit), glutamate receptor, metabotropic 5 (mGluR5), nerve growth factor-beta (NGF-beta), Jun oncogene (c-Jun), transmembrane receptor Unc5H1 (UNC5H1), and transmembrane receptor Unc5H2 (UNC5H2). All these genes, except for GH, were downregulated in response to trace conditioning. GH was upregulated; therefore, we also validated the downregulation of the GH inhibitor, somatostatin (SST), even though it just failed to meet criteria on the arrays. By during situ hybridization, GH was expressed throughout the cell layers of the hippocampus in response to trace conditioning. None of the genes regulated in trace eyeblink conditioning were similarly affected by delay conditioning, a task that does not require the hippocampus. These findings demonstrate that transcriptional profiling can exhibit a repertoire of genes sensitive to the formation of hippocampal-dependent associative memories.

  20. The Trypanosoma brucei protein phosphatase gene: polycistronic transcription with the RNA polymerase II largest subunit gene.

    PubMed Central

    Evers, R; Cornelissen, A W

    1990-01-01

    We have previously described the trypanosomal gene encoding the largest subunit of RNA polymerase II (RNAP II) and found that two almost identical genes are encoded within the Trypanosoma brucei genome. Here we show by Southern analyses that the 5' breakpoint between both loci is located approximately 7.5 kb upstream of the RNAP II genes. Northern analyses revealed that the 5' duplicated segment contains at least four other genes, which are transcribed in both bloodstream and procyclic trypanosomes. The gene located immediately upstream of the RNAP II gene in both loci was characterized by sequence analyses. The deduced amino acid sequences show a high degree of similarity to the catalytic subunit of protein phosphatase class 1 (PP1) genes. S1 mapping provided strong evidence in support of the fact that the PP1 and RNAP II genes belong to a single transcription unit. Images PMID:2169604

  1. Transcriptional mapping of the DNA polymerase gene of vaccinia virus

    SciTech Connect

    Traktman, P.; Sridhar, P.; Condit, R.C.; Roberts, B.E.

    1984-01-01

    Vaccinia virus DNA polymerase, a single-subunit enzyme of 110,000 molecular weight, is induced early after infection. Genetic analysis suggests that the gene encoding the enzyme maps within a 15-kilobase HindIII fragment located 45 kilobases from the left-hand end of the genome. The authors identified the in vitro translation product with these propeties and mapped the transcript by hybrid selection, RNA filter hybridization, and S1 nuclease mapping. Two mRNAs from this region, 3.4 and 3.9 kilobases in size, could be translated in vitro to yield a 110K polypeptide. The two RNAs shared a common 5' terminus and had staggered 3' ends. Sequences mapping entirely within the gene were shown to be biologically active in rescuing mutants with temperature-sensitive or drug-resistant polymerase activity to the wild-type phenotype.

  2. Transcription factor 4 gene rs9960767 polymorphism in bipolar disorder

    PubMed Central

    Ozel, Mavi Deniz; Onder, Mehmet Emin; Sazci, Ali

    2016-01-01

    The transcription factor 4 (TCF4) gene encodes a helix-loop-helix transcription factor protein, which initiates neuronal differentiation and is primarily expressed during nervous system development. The aim of the present study is to investigate the association of the TCF4 rs9960767 polymorphism and bipolar disorder, which is highly heritable. DNA isolation was performed on 95 patients with bipolar disorder and 108 healthy control subjects to examine the TCF4 rs9960767 polymorphism. Genotypic and allelic frequencies were determined using the polymerase chain reaction-restriction fragment length polymorphism method designed in our laboratory. Statistical analysis was performed using χ2 test within the 95% confidence interval. Odds ratios were calculated and Hardy-Weinberg equilibrium (HWE) was verified for all control subjects and patients. The A allele frequency was 95.8% in the patients and 94.4% in the control subjects, and 4.2% in the patients and 5.6% in the control subjects for the C allele. The genotype frequencies of the TCF4 gene rs9960767 variant were as follows: AA, 91.6% and AC, 8.4% in patients with bipolar (CC genotype was not observed in cases); AA, 89.8%; AC, 9.3% and CC, 0.9% in the control subjects. No statistically significant difference was identified between the patients and control subjects (χ2=0.937; P=0.626). In addition, gender specific analysis was performed, although no significant association was found according to the gender distrubition. All patients and control subjects were in HWE (P>0.05). Statistical analysis of the data indicates that the TCF4 gene rs9960767 polymorphism is not an independent risk factor for bipolar disorder in the overall population or in terms of gender; however, an increased population size would improve the statistical power. Furthermore, additional gene variants that are specifically involved in neuronal development may be analyzed for revealing the complex genetic architecture of bipolar disorder. An

  3. Docosahexaenoic Acid (DHA) and Hepatic Gene Transcription1,3

    PubMed Central

    Jump, Donald B.; Botolin, Daniela; Wang, Yun; Xu, Jinghua; Demeure, Olivier; Christian, Barbara

    2008-01-01

    The type and quantity of dietary fat ingested contributes to the onset and progression of chronic diseases, like diabetes and atherosclerosis. The liver plays a central role in whole body lipid metabolism and responds rapidly to changes in dietary fat composition. Polyunsaturated fatty acids (PUFA) play a key role in membrane composition and function, metabolism and the control of gene expression. Certain PUFA, like the n-3 PUFA, enhance hepatic fatty acid oxidation and inhibit fatty acid synthesis and VLDL secretion, in part, by regulating gene expression. Our studies have established that key transcription factors, like PPARα, SREBP-1, ChREBP and MLX, are regulated by n-3 PUFA, which in turn control levels of proteins involved in lipid and carbohydrate metabolism. Of the n-3 PUFA, 22:6,n-3 has recently been established as a key controller of hepatic lipid synthesis. 22:6,n-3 controls the 26S proteasomal degradation of the nuclear form of SREBP-1. SREBP-1 is a major transcription factor that controls the expression of multiple genes involved fatty acid synthesis and desaturation. 22:6,n-3 suppresses nuclear SREBP-1 which, in turn suppresses lipogenesis. This mechanism is achieved, in part, through control of the phosphorylation status of protein kinases. This review will examine both the general features of PUFA-regulated hepatic gene transcription and highlight the unique mechanisms by which 22:6,n-3 impacts gene expression. The outcome of this analysis will reveal that changes in hepatic 22:6,n-3 content has a major impact on hepatic lipid and carbohydrate metabolism. Moreover, the mechanisms involve 22:6,n-3 control of several well-known signaling pathways, such as Akt, Erk1/2, Gsk3β and PKC (novel or atypical). 22:6,n-3 control of these same signaling pathways in non-hepatic tissues may help explain the diverse actions of n-3 PUFA on such complex physiological processes as visual acuity and learning. PMID:18343222

  4. Transcription factor 4 gene rs9960767 polymorphism in bipolar disorder

    PubMed Central

    Ozel, Mavi Deniz; Onder, Mehmet Emin; Sazci, Ali

    2016-01-01

    The transcription factor 4 (TCF4) gene encodes a helix-loop-helix transcription factor protein, which initiates neuronal differentiation and is primarily expressed during nervous system development. The aim of the present study is to investigate the association of the TCF4 rs9960767 polymorphism and bipolar disorder, which is highly heritable. DNA isolation was performed on 95 patients with bipolar disorder and 108 healthy control subjects to examine the TCF4 rs9960767 polymorphism. Genotypic and allelic frequencies were determined using the polymerase chain reaction-restriction fragment length polymorphism method designed in our laboratory. Statistical analysis was performed using χ2 test within the 95% confidence interval. Odds ratios were calculated and Hardy-Weinberg equilibrium (HWE) was verified for all control subjects and patients. The A allele frequency was 95.8% in the patients and 94.4% in the control subjects, and 4.2% in the patients and 5.6% in the control subjects for the C allele. The genotype frequencies of the TCF4 gene rs9960767 variant were as follows: AA, 91.6% and AC, 8.4% in patients with bipolar (CC genotype was not observed in cases); AA, 89.8%; AC, 9.3% and CC, 0.9% in the control subjects. No statistically significant difference was identified between the patients and control subjects (χ2=0.937; P=0.626). In addition, gender specific analysis was performed, although no significant association was found according to the gender distrubition. All patients and control subjects were in HWE (P>0.05). Statistical analysis of the data indicates that the TCF4 gene rs9960767 polymorphism is not an independent risk factor for bipolar disorder in the overall population or in terms of gender; however, an increased population size would improve the statistical power. Furthermore, additional gene variants that are specifically involved in neuronal development may be analyzed for revealing the complex genetic architecture of bipolar disorder. An

  5. The transcriptional repressor DREAM is involved in thyroid gene expression

    SciTech Connect

    D'Andrea, Barbara; Di Palma, Tina; Mascia, Anna; Motti, Maria Letizia; Viglietto, Giuseppe; Nitsch, Lucio; Zannini, Mariastella . E-mail: stella@szn.it

    2005-04-15

    Downstream regulatory element antagonistic modulator (DREAM) was originally identified in neuroendocrine cells as a calcium-binding protein that specifically binds to downstream regulatory elements (DRE) on DNA, and represses transcription of its target genes. To explore the possibility that DREAM may regulate the endocrine activity of the thyroid gland, we analyzed its mRNA expression in undifferentiated and differentiated thyroid cells. We demonstrated that DREAM is expressed in the normal thyroid tissue as well as in differentiated thyroid cells in culture while it is absent in FRT poorly differentiated cells. In the present work, we also show that DREAM specifically binds to DRE sites identified in the 5' untranslated region (UTR) of the thyroid-specific transcription factors Pax8 and TTF-2/FoxE1 in a calcium-dependent manner. By gel retardation assays we demonstrated that thapsigargin treatment increases the binding of DREAM to the DRE sequences present in Pax8 and TTF-2/Foxe1 5' UTRs, and this correlates with a significant reduction of the expression of these genes. Interestingly, in poorly differentiated thyroid cells overexpression of exogenous DREAM strongly inhibits Pax8 expression. Moreover, we provide evidence that a mutated form of DREAM unable to bind Ca{sup 2+} interferes with thyroid cell proliferation. Therefore, we propose that in thyroid cells DREAM is a mediator of the calcium-signaling pathway and it is involved in the regulation of thyroid cell function.

  6. Sense and antisense transcription are associated with distinct chromatin architectures across genes.

    PubMed

    Murray, Struan C; Haenni, Simon; Howe, Françoise S; Fischl, Harry; Chocian, Karolina; Nair, Anitha; Mellor, Jane

    2015-09-18

    Genes from yeast to mammals are frequently subject to non-coding transcription of their antisense strand; however the genome-wide role for antisense transcription remains elusive. As transcription influences chromatin structure, we took a genome-wide approach to assess which chromatin features are associated with nascent antisense transcription, and contrast these with features associated with nascent sense transcription. We describe a distinct chromatin architecture at the promoter and gene body specifically associated with antisense transcription, marked by reduced H2B ubiquitination, H3K36 and H3K79 trimethylation and increased levels of H3 acetylation, chromatin remodelling enzymes, histone chaperones and histone turnover. The difference in sense transcription between genes with high or low levels of antisense transcription is slight; thus the antisense transcription-associated chromatin state is not simply analogous to a repressed state. Using mutants in which the level of antisense transcription is reduced at GAL1, or altered genome-wide, we show that non-coding transcription is associated with high H3 acetylation and H3 levels across the gene, while reducing H3K36me3. Set1 is required for these antisense transcription-associated chromatin changes in the gene body. We propose that nascent antisense and sense transcription have fundamentally distinct relationships with chromatin, and that both should be considered canonical features of eukaryotic genes.

  7. Herpes simplex virus type 1 protein IE63 affects the nuclear export of virus intron-containing transcripts.

    PubMed Central

    Phelan, A; Dunlop, J; Clements, J B

    1996-01-01

    Using in situ hybridization labelling methods, we have determined that the herpes simplex virus type 1 immediate-early protein IE63 (ICP27) affects the cellular localization of virus transcripts. Intronless transcripts from the IE63, UL38, and UL44 genes are rapidly exported to and accumulate in the cytoplasm throughout infection, in either the presence or absence of IE63 expression. The intron-containing transcripts from the IE110 and UL15 genes, while initially cytoplasmic, are increasingly retained in the nucleus in distinct clumps as infection proceeds, and the clumps colocalize with the redistributed small nuclear ribonucleoprotein particles. Infections with the IE63 mutant virus 27-lacZ demonstrated that in the absence of IE63 expression, nuclear retention of intron-containing transcripts was lost. The nuclear retention of UL15 transcripts, which demonstrated both nuclear and cytoplasmic label, was not as pronounced as that of the IE110 transcripts, and we propose that this is due to the late expression of UL15. Infections with the mutant virus 110C1, in which both introns of IE110 have been precisely removed (R.D. Everett, J. Gen. Virol. 72:651-659, 1991), demonstrated IE110 transcripts in both the nucleus and the cytoplasm; thus, exon definition sequences which regulate viral RNA transport are present in the IE110 transcript. By in situ hybridization a stable population of polyadenylated RNAs was found to accumulate in the nucleus in spots, most of which were separate from the small nuclear ribonucleoprotein particle clumps. The IE63 protein has an involvement, either direct or indirect, in the regulation of nucleocytoplasmic transport of viral transcripts, a function which contrasts with the recently proposed role of herpes simplex virus type 1 Us11 in promoting the nuclear export of partially spliced or unspliced transcripts (J.-J. Diaz, M. Duc Dodon, N. Schaerer-Uthurraly, D. Simonin, K. Kindbeiter, L. Gazzolo, and J.-J. Madjar, Nature [London] 379

  8. Multiple Yeast Genes, Including Paf1 Complex Genes, Affect Telomere Length via Telomerase RNA Abundance▿ †

    PubMed Central

    Mozdy, Amy D.; Podell, Elaine R.; Cech, Thomas R.

    2008-01-01

    Twofold reductions in telomerase RNA levels cause telomere shortening in both humans and the yeast Saccharomyces cerevisiae. To test whether multiple genes that affect telomere length act by modulating telomerase RNA abundance, we used real-time reverse transcription-PCR to screen S. cerevisiae deletion strains reported to maintain shorter or longer telomeres to determine the levels of their telomerase RNA (TLC1) abundance. Of 290 strains screened, 5 had increased TLC1 levels; 4 of these maintained longer telomeres. Twenty strains had decreased TLC1 levels; 18 of these are known to maintain shorter telomeres. Four strains with decreased TLC1 RNA levels contained deletions of subunits of Paf1C (polymerase II-associated factor complex). While Paf1C had been implicated in the transcription of both polyadenylated and nonpolyadenylated RNAs, Paf1C had not been associated previously with the noncoding telomerase RNA. In Paf1C mutant strains, TLC1 overexpression partially rescues telomere length and cell growth defects, suggesting that telomerase RNA is a critical direct or indirect Paf1C target. Other factors newly identified as affecting TLC1 RNA levels include cyclin-dependent kinase, the mediator complex, protein phosphatase 2A, and ribosomal proteins L13B and S16A. This report establishes that a subset of telomere length genes act by modulating telomerase RNA abundance. PMID:18411302

  9. Saxitoxin Modulates Immunological Parameters and Gene Transcription in Mytilus chilensis Hemocytes.

    PubMed

    Astuya, Allisson; Carrera, Crisleri; Ulloa, Viviana; Aballay, Ambbar; Núñez-Acuña, Gustavo; Hégaret, Hélène; Gallardo-Escárate, Cristian

    2015-01-01

    Saxitoxin (STX) is a neurotoxin produced by dinoflagellates in diverse species, such as Alexandrium spp., and it causes paralytic shellfish poisoning (PSP) in humans after the ingestion of contaminated shellfish. Recent studies have suggested that the immune functions of bivalves could be affected by harmful algae and/or by their toxins. Herein, hemocytes are the main effector cells of the immune cellular response. In this study, we evaluated the response of hemocytes from the mussel Mytilus chilensis to STX exposure in a primary culture. Cell cultures were characterized according to size and complexity, while reactive oxygen species (ROS) production was evaluated using a dichlorofluorescein diacetate (DCFH-DA) assay. Finally, phagocytic activity was measured using both flow cytometry and fluorescence microscopy assays. Additionally, gene transcription of candidate genes was evaluated by qPCR assays. The results evidenced that exposures to different concentrations of STX (1-100 nM) for 24 h did not affect cell viability, as determined by an MTT assay. However, when hemocytes were exposed for 4 or 16 h to STX (1-100 nM), there was a modulation of phagocytic activity and ROS production. Moreover, hemocytes exposed to 100 nM of STX for 4 or 16 h showed a significant increase in transcript levels of genes encoding for antioxidant enzymes (SOD, CAT), mitochondrial enzymes (COI, COIII, CYTB, ATP6, ND1) and ion channels (K+, Ca2+). Meanwhile, C-type lectin and toll-like receptor genes revealed a bi-phase transcriptional response after 16 and 24-48 h of exposure to STX. These results suggest that STX can negatively affect the immunocompetence of M. chilensis hemocytes, which were capable of responding to STX exposure in vitro by increasing the mRNA levels of antioxidant enzymes. PMID:26154765

  10. Saxitoxin Modulates Immunological Parameters and Gene Transcription in Mytilus chilensis Hemocytes

    PubMed Central

    Astuya, Allisson; Carrera, Crisleri; Ulloa, Viviana; Aballay, Ambbar; Núñez-Acuña, Gustavo; Hégaret, Hélène; Gallardo-Escárate, Cristian

    2015-01-01

    Saxitoxin (STX) is a neurotoxin produced by dinoflagellates in diverse species, such as Alexandrium spp., and it causes paralytic shellfish poisoning (PSP) in humans after the ingestion of contaminated shellfish. Recent studies have suggested that the immune functions of bivalves could be affected by harmful algae and/or by their toxins. Herein, hemocytes are the main effector cells of the immune cellular response. In this study, we evaluated the response of hemocytes from the mussel Mytilus chilensis to STX exposure in a primary culture. Cell cultures were characterized according to size and complexity, while reactive oxygen species (ROS) production was evaluated using a dichlorofluorescein diacetate (DCFH-DA) assay. Finally, phagocytic activity was measured using both flow cytometry and fluorescence microscopy assays. Additionally, gene transcription of candidate genes was evaluated by qPCR assays. The results evidenced that exposures to different concentrations of STX (1–100 nM) for 24 h did not affect cell viability, as determined by an MTT assay. However, when hemocytes were exposed for 4 or 16 h to STX (1–100 nM), there was a modulation of phagocytic activity and ROS production. Moreover, hemocytes exposed to 100 nM of STX for 4 or 16 h showed a significant increase in transcript levels of genes encoding for antioxidant enzymes (SOD, CAT), mitochondrial enzymes (COI, COIII, CYTB, ATP6, ND1) and ion channels (K+, Ca2+). Meanwhile, C-type lectin and toll-like receptor genes revealed a bi-phase transcriptional response after 16 and 24–48 h of exposure to STX. These results suggest that STX can negatively affect the immunocompetence of M. chilensis hemocytes, which were capable of responding to STX exposure in vitro by increasing the mRNA levels of antioxidant enzymes. PMID:26154765

  11. Genomewide identification of genes under directional selection: gene transcription Q(ST) scan in diverging Atlantic salmon subpopulations.

    PubMed

    Roberge, C; Guderley, H; Bernatchez, L

    2007-10-01

    Evolutionary genomics has benefited from methods that allow identifying evolutionarily important genomic regions on a genomewide scale, including genome scans and QTL mapping. Recently, genomewide scanning by means of microarrays has permitted assessing gene transcription differences among species or populations. However, the identification of differentially transcribed genes does not in itself suffice to measure the role of selection in driving evolutionary changes in gene transcription. Here, we propose and apply a "transcriptome scan" approach to investigating the role of selection in shaping differential profiles of gene transcription among populations. We compared the genomewide transcription levels between two Atlantic salmon subpopulations that have been diverging for only six generations. Following assessment of normality and unimodality on a gene-per-gene basis, the additive genetic basis of gene transcription was estimated using the animal model. Gene transcription h(2) estimates were significant for 1044 (16%) of all detected cDNA clones. In an approach analogous to that of genome scans, we used the distribution of the Q(ST) values estimated from intra- and intersubpopulation additive genetic components of the transcription profiles to identify 16 outlier genes (average Q(ST) estimate = 0.11) whose transcription levels are likely to have evolved under the influence of directional selection within six generations only. Overall, this study contributes both empirically and methodologically to the quantitative genetic exploration of gene transcription data. PMID:17720934

  12. VITELLOGENIN GENE TRANSCRIPTION: A RELATIVE QUANTITATIVE EXPOSURE INDICATOR OF ENVIRONMENTAL ESTROGENS

    EPA Science Inventory

    We report the development of a quantifiable exposure indicator for measuring the presence of environmental estrogens in aquatic systems. Synthetic oligonucleotides, designed specifically for the vitellogenin gene (Vg) transcription product, were used in a Reverse Transcription Po...

  13. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1991--May 31, 1992

    SciTech Connect

    Kuchka, M.R.

    1992-05-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  14. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement

    PubMed Central

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-01-01

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K+ (K+in) channels and reduced K+in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K+in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K+in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  15. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement.

    PubMed

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-Ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-04-12

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K(+) (K(+) in) channels and reduced K(+) in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K(+) in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K(+) in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  16. Genes affecting heading date in cocksfoot (Dactylis glomerata)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several genes cause well known effects on heading date in cool-season forages: Vrn1, Constans, and FloweringTime. Vrn1 is a MADs box transcription factor that is induced upon vernalization and necessary for flowering. Constans genes are induced upon long days in cool-season grasses and induce exp...

  17. IKK{epsilon} modulates RSV-induced NF-{kappa}B-dependent gene transcription

    SciTech Connect

    Bao Xiaoyong; Indukuri, Hemalatha; Liu Tianshuang; Liao Suiling; Tian, Bing; Brasier, Allan R.; Garofalo, Roberto P.; Casola, Antonella

    2010-12-20

    Respiratory syncytial virus (RSV), a negative-strand RNA virus, is the most common cause of epidemic respiratory disease in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B). In this study we have investigated the role of the non canonical I{kappa}B kinase (IKK){epsilon} in modulating RSV-induced NF-{kappa}B activation. Our results show that inhibition of IKK{epsilon} activation results in significant impairment of viral-induced NF-{kappa}B-dependent gene expression, through a reduction in NF-{kappa}B transcriptional activity, without changes in nuclear translocation or DNA-binding activity. Absence of IKK{epsilon} results in a significant decrease of RSV-induced NF-{kappa}B phosphorylation on serine 536, a post-translational modification important for RSV-induced NF-{kappa}B-dependent gene expression, known to regulate NF-{kappa}B transcriptional activity without affecting nuclear translocation. This study identifies a novel mechanism by which IKK{epsilon} regulates viral-induced cellular signaling.

  18. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun

    2015-01-01

    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  19. Sucrose regulation of ADP-glucose pyrophosphorylase subunit genes transcript levels in leaves and fruits

    NASA Technical Reports Server (NTRS)

    Li, Xiangyang; Xing, Jinpeng; Gianfagna, Thomas J.; Janes, Harry W.

    2002-01-01

    ADP-glucose pyrophosphorylase (AGPase, EC2.7.7.27) is a key regulatory enzyme in starch biosynthesis. The enzyme is a heterotetramer with two S and two B subunits. In tomato, there are three multiple forms of the S subunit gene. Agp S1, S2 and B are highly expressed in fruit from 10 to 25 days after anthesis. Agp S3 is only weakly expressed in fruit. Sucrose significantly elevates expression of Agp S1, S2 and B in both leaves and fruits. Agp S1 exhibits the highest degree of regulation by sucrose. In fact, sucrose may be required for Agp S1 expression. For excised leaves incubated in water, no transcripts for Agp S1 could be detected in the absence of sucrose, whereas it took up to 16 h in water before transcripts were no longer detectable for Agp S2 and B. Neither Agp S3 nor the tubulin gene is affected by sucrose, demonstrating that this response is specifically regulated by a carbohydrate metabolic signal, and is not due to a general increase in metabolism caused by sucrose treatment. Truncated versions of the promoter for Agp S1 indicate that a specific region 1.3-3.0 kb upstream from the transcription site is responsible for sucrose sensitivity. This region of the S1 promoter contains several cis-acting elements present in the promoters of other genes that are also regulated by sucrose. c2002 Elsevier Science Ireland Ltd. All rights reserved.

  20. Gene transcription analysis of carrot allergens by relative quantification with single and duplex reverse transcription real-time PCR.

    PubMed

    Zagon, Jutta; Jansen, Bärbel; Knoppik, Meike; Ehlers, Anke; Kroh, Lothar W; Holzhauser, Thomas; Vieths, Stefan; Broll, Hermann

    2010-01-01

    Single and duplex real-time polymerase chain reaction (PCR) systems have been developed to quantify specific mRNA transcription of genes coding for the major Daucus carota allergen isoforms Dau c 1.01 and Dau c 1.02. Methods were tested with samples from the local market. Whereas the gene transcription levels for Dau c 1.01 were consistently high in all investigated samples, significant differences for the Dau c 1.02 transcription could be demonstrated in randomly collected market samples. The gene transcription level for the minor Dau c 1.02 variant is about one log below Dau c 1.01. Both formats, single or duplex real-time methods, exhibit ideal cycle threshold (CT) ranges and good reproducibility. In particular, the easily performed duplex real-time PCR system is potentially suited for the selection of hypoallergenic varieties and studying the impact of post-harvesting or environmental conditions.

  1. ROMA: an in vitro approach to defining target genes for transcription regulators

    PubMed Central

    MacLellan, Shawn R.; Eiamphungporn, Warawan; Helmann, John D.

    2009-01-01

    We describe an in vitro transcription-based method called ROMA (run-off transcription-microarray analysis) for the genome-wide analysis of transcription regulated by sigma factors and other transcriptional regulators. ROMA uses purified RNA polymerase with and without a regulatory protein to monitor products of transcription from a genomic DNA template. Transcribed RNA is converted to cDNA and hybridized to gene arrays allowing for the identification of genes that are specifically activated by the regulator. We discuss the use of ROMA to define sigma factor regulons in Bacillus subtilis and its broad application to defining regulons for other transcriptional regulators in various species. PMID:18948201

  2. The neurofibromatosis 2 (NF2) tumor suppressor gene encodes multiple alternatively spliced transcripts.

    PubMed

    Pykett, M J; Murphy, M; Harnish, P R; George, D L

    1994-04-01

    Neurofibromatosis type 2 (NF2) is an autosomal dominantly-inherited disorder predisposing affected individuals to tumors of multiple cell types in the central nervous system, including meningiomas. A candidate tumor suppressor gene for this disorder has recently been cloned; the protein product of this gene has a predicted role in linking integral membrane proteins with the cytoskeleton. Utilizing reverse transcription-polymerase chain reaction (RT-PCR) analyses, we have identified a number of alternatively spliced transcription products encoded by the NF2 gene. These alternative splice variants were detected in RNA isolated from several sources, including primary leptomeningeal tissue and an established line of leptomeningeal cells (LMC). Several of these variants delete previously identified coding regions of this gene. Moreover, two of these splice variants add previously unrecognized exons to the NF2 coding region. These identified splice forms will serve as natural reagents for the functional dissection of the NF2 protein product(s). They also should be considered in studies investigating mutations of this gene in members of NF2 families and in tumor analyses.

  3. Transcriptional analysis of major chaperone genes in salt-tolerant and salt-sensitive mesorhizobia.

    PubMed

    Brígido, Clarisse; Alexandre, Ana; Oliveira, Solange

    2012-12-20

    Salinity is an important abiotic stress that limits rhizobia-legume symbiosis, affecting plant growth, thus reducing crop productivity. Our aims were to evaluate the tolerance to salinity of native chickpea rhizobia as well as to investigate the expression of chaperone genes groEL, dnaKJ and clpB in both tolerant and sensitive isolates. One hundred and six native chickpea mesorhizobia were screened for salinity tolerance by measuring their growth with 1.5% and 3% NaCl. Most isolates were salt-sensitive, showing a growth below 20% compared to control. An association between salt tolerance and province of origin of the isolates was found. The transcriptional analysis by northern hybridization of chaperone genes was performed using tolerant and sensitive isolates belonging to different Mesorhizobium species. Upon salt shock, most isolates revealed a slight increase in the expression of the dnaK gene, whereas the groESL and clpB expression was unchanged or slightly repressed. No clear relationship was found between the chaperone genes induction and the level of salt tolerance of the isolates. This is the first report on transcriptional analysis of the major chaperones genes in chickpea mesorhizobia under salinity, which may contribute to a better understanding of the mechanisms that influence rhizobia salt tolerance.

  4. Transcription of interferon-stimulated genes is induced by adenovirus particles but is suppressed by E1A gene products.

    PubMed Central

    Reich, N; Pine, R; Levy, D; Darnell, J E

    1988-01-01

    Interferon treatment of cell cultures results in the rapid transcriptional induction of a specific set of genes. In this paper we explore the effect of cellular infection by several adenoviruses, both wild type and mutant, on the expression of these genes. Infection with adenovirus induces the transcription of the interferon-stimulated genes in the absence of any protein synthesis. In fact, the inhibition of protein synthesis during a wild-type infection produces enhanced stimulation of transcription of these genes. Experiments with viral mutants indicate the ability to specifically suppress this transcription maps to the E1A gene. In addition, the E1A gene products are capable of suppressing the specific transcriptional induction of interferon-stimulated promoters during cotransfection experiments and therefore presumably during viral infection. The dual effect of adenovirus on the expression of interferon-stimulated genes may represent an example of action and evolutionary reaction between virus and host. Images PMID:2446013

  5. DNA sequences affecting specific initiation of transcription in vitro from the EIII promoter of adenovirus 2.

    PubMed Central

    Lee, D C; Roeder, R G; Wold, W S

    1982-01-01

    We have identified those sequences affecting the level of specific initiation of transcription in vitro from the EIII promoter of adenovirus 2. Mutants containing deletions in and around the initiation sites were constructed in cloned viral DNA fragments and assayed for their ability to initiate transcription in vitro. Three classes of mutants were studied with deletions in the following regions: -38 to -268, -21 to -71 (which includes the T-A-T-A-A box), and -29 through the cap sites (+1 and +3). Deletions that remove some or all of the area from -28 to several nucleotides downstream from the cap sites essentially abolished specific transcription. Small deletions in the region -30 to -41 reduced transcription to approximately 60% of wild type; larger deletions in the region -35 to -268 reduced transcription to 30-40% of wild type. Deletions beginning from approximately +10 to +25 and extending further downstream reduced transcription to 20-40% of wild type, whereas a deletion beginning at +31 had little or no effect. Our results suggest that the region including the T-A-T-A-A box and extending to the area immediately beyond the cap sites is essential for specific transcription in vitro from the EIII promoter. However, sequences upstream from the T-A-T-A-A box and those downstream from the cap sites appear to significantly modulate the levels of transcription. Images PMID:6275389

  6. Transcriptional Targeting in the Airway Using Novel Gene Regulatory Elements

    PubMed Central

    Burnight, Erin R.; Wang, Guoshun; McCray, Paul B.

    2012-01-01

    The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (∼ 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia. PMID:22447971

  7. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  8. RNAi related mechanisms affect both transcriptional and posttranscriptional transgene silencing in Drosophila.

    PubMed

    Pal-Bhadra, Manika; Bhadra, Utpal; Birchler, James A

    2002-02-01

    Two types of transgene silencing were found for the Alcohol dehydrogenase (Adh) transcription unit. Transcriptional gene silencing (TGS) is Polycomb dependent and occurs when Adh is driven by the white eye color gene promoter. Full-length Adh transgenes are silenced posttranscriptionally at high copy number or by a pulsed increase over a threshold. The posttranscriptional gene silencing (PTGS) exhibits molecular hallmarks typical of RNA interference (RNAi), including the production of 21--25 bp length sense and antisense RNAs homologous to the silenced RNA. Mutations in piwi, which belongs to a gene family with members required for RNAi, block PTGS and one aspect of TGS, indicating a connection between the two types of silencing. PMID:11864605

  9. Influence of Host Gene Transcription Level and Orientation on HIV-1 Latency in a Primary-Cell Model▿

    PubMed Central

    Shan, Liang; Yang, Hung-Chih; Rabi, S. Alireza; Bravo, Hector C.; Shroff, Neeta S.; Irizarry, Rafael A.; Zhang, Hao; Margolick, Joseph B.; Siliciano, Janet D.; Siliciano, Robert F.

    2011-01-01

    Human immunodeficiency virus type 1 (HIV-1) establishes a latent reservoir in resting memory CD4+ T cells. This latent reservoir is a major barrier to the eradication of HIV-1 in infected individuals and is not affected by highly active antiretroviral therapy (HAART). Reactivation of latent HIV-1 is a possible strategy for elimination of this reservoir. The mechanisms with which latency is maintained are unclear. In the analysis of the regulation of HIV-1 gene expression, it is important to consider the nature of HIV-1 integration sites. In this study, we analyzed the integration and transcription of latent HIV-1 in a primary CD4+ T cell model of latency. The majority of integration sites in latently infected cells were in introns of transcription units. Serial analysis of gene expression (SAGE) demonstrated that more than 90% of those host genes harboring a latent integrated provirus were transcriptionally active, mostly at high levels. For latently infected cells, we observed a modest preference for integration in the same transcriptional orientation as the host gene (63.8% versus 36.2%). In contrast, this orientation preference was not observed in acutely infected or persistently infected cells. These results suggest that transcriptional interference may be one of the important factors in the establishment and maintenance of HIV-1 latency. Our findings suggest that disrupting the negative control of HIV-1 transcription by upstream host promoters could facilitate the reactivation of latent HIV-1 in some resting CD4+ T cells. PMID:21430059

  10. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    SciTech Connect

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-08-23

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  11. Modulation of Aanat gene transcription in the rat pineal gland.

    PubMed

    Ho, Anthony K; Chik, Constance L

    2010-01-01

    The main function of the rat pineal gland is to transform the circadian rhythm generated in the suprachiasmatic nucleus into a rhythmic signal of circulating melatonin characterized by a large nocturnal increase that closely reflects the duration of night period. This is achieved through the tight coupling between environmental lighting and the expression of arylalkylamine-N-acetyltransferase, the rhythm-controlling enzyme in melatonin synthesis. The initiation of Aanat transcription at night is controlled largely by the norepinephrine-stimulated phosphorylation of cAMP response element-binding protein by protein kinase A. However, to accurately reflect the duration of darkness, additional signaling mechanisms also participate to fine-tune the temporal profile of adrenergic-induced Aanat transcription. Here, we reviewed some of these signaling mechanisms, with emphasis on the more recent findings. These signaling mechanisms can be divided into two groups: those involving modification of constitutively expressed proteins and those requiring synthesis of new proteins. This review highlights the pineal gland as an excellent model system for studying neurotransmitter-regulated rhythmic gene expression.

  12. Dynamic Encounters of Genes and Transcripts with the Nuclear Pore.

    PubMed

    Ben-Yishay, Rakefet; Ashkenazy, Asaf J; Shav-Tal, Yaron

    2016-07-01

    Transcribed mRNA molecules must reach the cytoplasm to undergo translation. Technological developments in imaging have placed mRNAs under the spotlight, allowing the quantitative study of the spatial and temporal dynamics of the nucleocytoplasmic mRNA export process. Here, we discuss studies that have used such experimental approaches to demonstrate that gene tethering at the nuclear pore complex (NPC) regulates mRNA expression, and to characterize mRNA dynamics during transport in real time. The paths taken by mRNAs as they move from their sites of transcription and travel through the nucleoplasm, in between chromatin domains, and finally through the NPC, can now be observed in detail. PMID:27185238

  13. Genetic Diversity Affects the Daily Transcriptional Oscillations of Marine Microbial Populations.

    PubMed

    Shilova, Irina N; Robidart, Julie C; DeLong, Edward F; Zehr, Jonathan P

    2016-01-01

    Marine microbial communities are genetically diverse but have robust synchronized daily transcriptional patterns at the genus level that are similar across a wide variety of oceanic regions. We developed a microarray-inspired gene-centric approach to resolve transcription of closely-related but distinct strains/ecotypes in high-throughput sequence data. Applying this approach to the existing metatranscriptomics datasets collected from two different oceanic regions, we found unique and variable patterns of transcription by individual taxa within the abundant picocyanobacteria Prochlorococcus and Synechococcus, the alpha Proteobacterium Pelagibacter and the eukaryotic picophytoplankton Ostreococcus. The results demonstrate that marine microbial taxa respond differentially to variability in space and time in the ocean. These intra-genus individual transcriptional patterns underlie whole microbial community responses, and the approach developed here facilitates deeper insights into microbial population dynamics.

  14. Genetic Diversity Affects the Daily Transcriptional Oscillations of Marine Microbial Populations

    PubMed Central

    Shilova, Irina N.; Robidart, Julie C.; DeLong, Edward F.; Zehr, Jonathan P.

    2016-01-01

    Marine microbial communities are genetically diverse but have robust synchronized daily transcriptional patterns at the genus level that are similar across a wide variety of oceanic regions. We developed a microarray-inspired gene-centric approach to resolve transcription of closely-related but distinct strains/ecotypes in high-throughput sequence data. Applying this approach to the existing metatranscriptomics datasets collected from two different oceanic regions, we found unique and variable patterns of transcription by individual taxa within the abundant picocyanobacteria Prochlorococcus and Synechococcus, the alpha Proteobacterium Pelagibacter and the eukaryotic picophytoplankton Ostreococcus. The results demonstrate that marine microbial taxa respond differentially to variability in space and time in the ocean. These intra-genus individual transcriptional patterns underlie whole microbial community responses, and the approach developed here facilitates deeper insights into microbial population dynamics. PMID:26751368

  15. Genetic Diversity Affects the Daily Transcriptional Oscillations of Marine Microbial Populations.

    PubMed

    Shilova, Irina N; Robidart, Julie C; DeLong, Edward F; Zehr, Jonathan P

    2016-01-01

    Marine microbial communities are genetically diverse but have robust synchronized daily transcriptional patterns at the genus level that are similar across a wide variety of oceanic regions. We developed a microarray-inspired gene-centric approach to resolve transcription of closely-related but distinct strains/ecotypes in high-throughput sequence data. Applying this approach to the existing metatranscriptomics datasets collected from two different oceanic regions, we found unique and variable patterns of transcription by individual taxa within the abundant picocyanobacteria Prochlorococcus and Synechococcus, the alpha Proteobacterium Pelagibacter and the eukaryotic picophytoplankton Ostreococcus. The results demonstrate that marine microbial taxa respond differentially to variability in space and time in the ocean. These intra-genus individual transcriptional patterns underlie whole microbial community responses, and the approach developed here facilitates deeper insights into microbial population dynamics. PMID:26751368

  16. Building gene expression signatures indicative of transcription factor activation to predict AOP modulation

    EPA Science Inventory

    Building gene expression signatures indicative of transcription factor activation to predict AOP modulation Adverse outcome pathways (AOPs) are a framework for predicting quantitative relationships between molecular initiatin...

  17. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    PubMed Central

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  18. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.

    PubMed

    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent

    2016-01-15

    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context. PMID:26456102

  19. A Mutant Trna Affects δ-Mediated Transcription in Saccharomyces Cerevisiae

    PubMed Central

    Happel, A. M.; Winston, F.

    1992-01-01

    Mutations in the SPT3, SPT7, SPT8 and SPT15 genes define one class of trans-acting mutations that are strong suppressors of insertion mutations caused by Ty elements or by the Ty long terminal repeat sequence, δ. These SPT genes are required for normal transcription of Ty elements, and their gene products are believed to be involved in initiation of Ty transcription from δ sequences. We have isolated and analyzed extragenic suppressors of spt3 mutations. These new mutations, named rsp, partially suppress the requirement for SPT3, SPT7, SPT8 and SPT15 functions. In addition, rsp mutations cause changes in transcription of some δ insertions in an SPT(+) genetic background. Interactions between mutations in the four identified RSP genes show a number of interesting genetic properties, including the failure of unlinked rsp mutations to complement for recessive phenotypes. Cloning and sequencing of one rsp mutant gene, rsp4-27, showed that it encodes a frameshift suppressor glycine tRNA. Our results indicate that the other three RSP genes also encode frameshift suppressor glycine tRNAs. In addition, other types of frameshift suppressor glycine tRNAs can confer some Rsp(-) phenotypes. PMID:1330824

  20. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-01

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming.

  1. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-01

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming. PMID:25384038

  2. Gene transcription and electromagnetic fields. Final progress report

    SciTech Connect

    Henderson, A.S.

    1992-12-31

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  3. Mutations in the CRE pocket of bacterial RNA polymerase affect multiple steps of transcription.

    PubMed

    Petushkov, Ivan; Pupov, Danil; Bass, Irina; Kulbachinskiy, Andrey

    2015-07-13

    During transcription, the catalytic core of RNA polymerase (RNAP) must interact with the DNA template with low-sequence specificity to ensure efficient enzyme translocation and RNA extension. Unexpectedly, recent structural studies of bacterial promoter complexes revealed specific interactions between the nontemplate DNA strand at the downstream edge of the transcription bubble (CRE, core recognition element) and a protein pocket formed by core RNAP (CRE pocket). We investigated the roles of these interactions in transcription by analyzing point amino acid substitutions and deletions in Escherichia coli RNAP. The mutations affected multiple steps of transcription, including promoter recognition, RNA elongation and termination. In particular, we showed that interactions of the CRE pocket with a nontemplate guanine immediately downstream of the active center stimulate RNA-hairpin-dependent transcription pausing but not other types of pausing. Thus, conformational changes of the elongation complex induced by nascent RNA can modulate CRE effects on transcription. The results highlight the roles of specific core RNAP-DNA interactions at different steps of RNA synthesis and suggest their importance for transcription regulation in various organisms.

  4. Mutations in the CRE pocket of bacterial RNA polymerase affect multiple steps of transcription

    PubMed Central

    Petushkov, Ivan; Pupov, Danil; Bass, Irina; Kulbachinskiy, Andrey

    2015-01-01

    During transcription, the catalytic core of RNA polymerase (RNAP) must interact with the DNA template with low-sequence specificity to ensure efficient enzyme translocation and RNA extension. Unexpectedly, recent structural studies of bacterial promoter complexes revealed specific interactions between the nontemplate DNA strand at the downstream edge of the transcription bubble (CRE, core recognition element) and a protein pocket formed by core RNAP (CRE pocket). We investigated the roles of these interactions in transcription by analyzing point amino acid substitutions and deletions in Escherichia coli RNAP. The mutations affected multiple steps of transcription, including promoter recognition, RNA elongation and termination. In particular, we showed that interactions of the CRE pocket with a nontemplate guanine immediately downstream of the active center stimulate RNA-hairpin-dependent transcription pausing but not other types of pausing. Thus, conformational changes of the elongation complex induced by nascent RNA can modulate CRE effects on transcription. The results highlight the roles of specific core RNAP–DNA interactions at different steps of RNA synthesis and suggest their importance for transcription regulation in various organisms. PMID:25990734

  5. Comprehensive analysis of the transcription of starch synthesis genes and the transcription factor RSR1 in wheat (Triticum aestivum) endosperm.

    PubMed

    Kang, Guo-Zhang; Xu, Wei; Liu, Guo-Qin; Peng, Xiao-Qi; Guo, Tian-Cai

    2013-02-01

    The cDNA sequences of 26 starch synthesis genes were identified in common wheat (Triticum aestivum L.), and their transcript levels were measured using quantitative real-time RT-PCR to assess the function of individual genes and the regulatory mechanism in wheat endosperm. The expression patterns of 26 genes in wheat endosperm were classified into three groups. The genes in group 1 were richly expressed in the early stage of grain development and may be involved in the construction of fundamental cell machinery, synthesis of glucan primers, and initiation of starch granules. The genes in group 2 were highly expressed during the middle and late stages of grain development, and their expression profiles were similar to the accumulation rate of endosperm starch; these genes are presumed to play a crucial role in starch production. The genes in group 3 were scantily expressed throughout the grain development period and might be associated with transitory starch synthesis. Transcripts of the negative transcription factor TaRSR1 were high at the early and late stages of grain development but low during the middle stage. The expression pattern of TaRSR1 was almost opposite to those of the group 2 starch synthesis genes, indicating that TaRSR1 might negatively regulate the expression of many endosperm starch synthesis genes during grain development.

  6. Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

    SciTech Connect

    Tucker, James D.; Joiner, Michael C.; Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V.; Chinkhota, Chantelle N.; Smolinski, Joseph M.; Divine, George W.; Auner, Gregory W.

    2014-03-15

    Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

  7. Major genes affecting ovulation rate in sheep

    PubMed Central

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection. PMID:15601592

  8. Identification, phylogeny, and transcript of chitinase family genes in sugarcane.

    PubMed

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function.

  9. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  10. Post-transcriptional regulation of gene PA5507 controls PQS concentration in Pseudomonas aeruginosa

    PubMed Central

    Tipton, Kyle A.; Coleman, James P.; Pesci, Everett C.

    2015-01-01

    Summary Pseudomonas aeruginosa can sense and respond to a myriad of environmental signals and utilizes a system of small molecules to communicate through intercellular signaling. The small molecule 2-heptyl-3-hydroxy-4-quinolone (Pseudomonas Quinolone Signal [PQS]) is one of these signals and its synthesis is important for virulence. Previously, we identified an RpiR-type transcriptional regulator, QapR, that positively affects PQS production by repressing the qapR operon. An in-frame deletion of this regulator caused P. aeruginosa to produce a greatly reduced concentration of PQS. Here, we report that QapR translation is linked to the downstream gene PA5507. We found that introduction of a premature stop codon within qapR eliminates transcriptional autorepression of the qapR operon as expected but has no effect on PQS concentration. This was investigated with a series of lacZ reporter fusions which showed that translation of QapR must terminate at, or close to, the native qapR stop codon in order for translation of PA5507 to occur. Also, it was shown that truncation of the 5′ end of the qapR transcript permitted PA5507 translation without translation of QapR. Our findings led us to conclude that PA5507 transcription and translation are both tightly controlled by QapR and this control is important for PQS homeostasis. PMID:25662317

  11. Characterization of transcriptional activation and inserted-into-gene preference of various transposable elements in the Brassica species.

    PubMed

    Gao, Caihua; Xiao, Meili; Jiang, Lingyan; Li, Jiana; Yin, Jiaming; Ren, Xiaodong; Qian, Wei; Oscar, Ortegón; Fu, Donghui; Tang, Zhanglin

    2012-07-01

    Transposable elements (TEs) have attracted increasing attention because of their tremendous contributions to genome reorganization and gene variation through dramatic proliferation and excision via transposition. However, less known are the transcriptional activation of various TEs and the characteristics of TE insertion into genomes at the genome-wide level. In the present study, we focused on TE genes for transposition and gene disruption by insertion of TEs in expression sequences of Brassica, to investigate the transcriptional activation of TEs, the biased insertion of TEs into genes, and their salient characteristics. Long terminal repeat (LTR-retrotransposon) accounted for the majority of these active TE genes (70.8%), suggesting that transposition activation varied with TE type. 6.1% genes were interrupted by LTR-retrotransposons, which indicated their preference for insertion into genes. TEs were preferentially inserted into cellular component-specific genes acted as "binding" elements and involved in metabolic processes. TEs have a biased insertion into some host genes that were involved with important molecular functions and TE genes exhibited spatiotemporal expression. These results suggested that various types of transposons differentially contributed to gene variation and affected gene function.

  12. Multiple GCD genes required for repression of GCN4, a transcriptional activator of amino acid biosynthetic genes in Saccharomyces cerevisiae.

    PubMed

    Harashima, S; Hinnebusch, A G

    1986-11-01

    GCN4 encodes a positive regulator of multiple unlinked genes encoding amino acid biosynthetic enzymes in Saccharomyces cerevisiae. Expression of GCN4 is coupled to amino acid availability by a control mechanism involving GCD1 as a negative effector and GCN1, GCN2, and GCN3 as positive effectors of GCN4 expression. We used reversion of a gcn2 gcn3 double mutation to isolate new alleles of GCD1 and mutations in four additional GCD genes which we designate GCD10, GCD11, GCD12, and GCD13. All of the mutations lead to constitutive derepression of HIS4 transcription in the absence of the GCN2+ and GCN3+ alleles. By contrast, the gcd mutations require the wild-type GCN4 allele for their derepressing effect, suggesting that each acts by influencing the level of GCN4 activity in the cell. Consistent with this interpretation, mutations in each GCD gene lead to constitutive derepression of a GCN4::lacZ gene fusion. Thus, at least five gene products are required to maintain the normal repressed level of GCN4 expression in nonstarvation conditions. Interestingly, the gcd mutations are pleiotropic and also affect growth rate in nonstarvation conditions. In addition, certain alleles lead to a loss of M double-stranded RNA required for the killer phenotype. This pleiotropy suggests that the GCD gene products contribute to an essential cellular function, in addition to, or in conjunction with, their role in GCN4 regulation.

  13. Model of gene transcription including the return of a RNA polymerase to the beginning of a transcriptional cycle

    NASA Astrophysics Data System (ADS)

    Zhdanov, Vladimir P.

    2009-11-01

    The gene transcription occurs via the RNA polymerase (RNAP) recruitment on the DNA promoter sequence, formation of a locally open DNA chain, promoter escape, steps of the RNA synthesis, and RNA and RNAP release after reading the final DNA base. Just after the end of the RNA synthesis, RNAP surrounds the closed DNA chain and may diffuse along DNA, desorb, or reach the promoter and start the RNA-synthesis cycle again. We present a generic kinetic model taking the latter steps into account and show analytically and by Monte Carlo simulations that it predicts transcriptional bursts even in the absence of explicit regulation of the transcription by master proteins.

  14. Induction of AhR-Mediated Gene Transcription by Coffee

    PubMed Central

    Ishikawa, Toshio; Takahashi, Satoshi; Morita, Koji; Okinaga, Hiroko; Teramoto, Tamio

    2014-01-01

    Background Aryl hydrocarbon receptor (AhR) is classically known to be activated by xenobiotics such as dioxins and polycyclic aromatic hydrocarbons (PAHs). Although it has been reported that PAHs are contained in roasted coffee beans, in general coffee beverages are not considered to be AhR activators. We tested whether exposure to coffee would activate AhR in cultured cells. Methods HepG2 cells stably expressing an AhR-responsive reporter gene were treated with coffee samples. Also, expression of CYP1A1, an endogenous AhR-responsive gene, was quantitated by RT-PCR and Western blotting in HepG2, Caco-2, and MCF-7 cells, after treatment with coffee. In order to obtain sensitive and reproducible results, all the experiments were performed with the cells placed in either phosphate-buffered saline (PBS) or pure serum, instead of routinely-used culture medium, whose intrinsic AhR-stimulating activity turned out to be so strong as to interfere with the analyses. Results All the coffee samples tested robustly stimulated AhR-mediated transcription in the reporter gene assays. Of note, to what extent coffee and other AhR agonists activated AhR was different, depending on whether the experiments were done in PBS or serum. CYP1A1 mRNA was induced by coffee, in HepG2, Caco-2, and MCF-7 cells placed in either PBS or serum. CYP1A1 protein expression, which was not detected in these cells incubated in PBS, was also increased by coffee in cells placed in serum. Conclusions By using culture medium-free experimental settings, we have shown that coffee is a strong AhR activator. Our observation may help elucidate as-yet-unrecognized effects of coffee on human health. PMID:25007155

  15. Transcriptional response to copper excess and identification of genes involved in heavy metal tolerance in the extremophilic microalga Chlamydomonas acidophila.

    PubMed

    Olsson, Sanna; Puente-Sánchez, Fernando; Gómez, Manuel J; Aguilera, Angeles

    2015-05-01

    High concentrations of heavy metals are typical of acidic environments. Therefore, studies on acidophilic organisms in their natural environments improve our understanding on the evolution of heavy metal tolerance and detoxification in plants. Here we sequenced the transcriptome of the extremophilic microalga Chlamydomonas acidophila cultivated in control conditions and with 500 μM of copper for 24 h. High-throughput 454 sequencing was followed by de novo transcriptome assembly. The reference transcriptome was annotated and genes related to heavy metal tolerance and abiotic stress were identified. Analyses of differentially expressed transcripts were used to detect genes involved in metabolic pathways related to abiotic stress tolerance, focusing on effects caused by increased levels of copper. Both transcriptomic data and observations from PAM fluorometry analysis suggested that the photosynthetic activity of C. acidophila is not adversely affected by addition of high amounts of copper. Up-regulated transcripts include several transcripts related to photosynthesis and carbohydrate metabolism, transcripts coding for general stress response, and a transcript annotated as homologous to the oil-body-associated protein HOGP coding gene. The first de novo assembly of C. acidophila significantly increases transcriptomic data available on extremophiles and green algae and thus provides an important reference for further molecular genetic studies. The differences between differentially expressed transcripts detected in our study suggest that the response to heavy metal exposure in C. acidophila is different from other studied green algae.

  16. Regulation of tissue-specific expression of alternative peripheral myelin protein-22 (PMP22) gene transcripts by two promoters

    SciTech Connect

    Patel, P.I.; Schoener-Scott, R.; Lupski, J.R.

    1994-09-01

    Mutations affecting the peripheral myelin protein-22 (PMP22) gene have been shown to be associated with inherited peripheral neuropathies. We have cloned and characterized the human PMP22 gene which spans approximately 40 kilobases and contains four coding exons. Towards developing gene therapy regimens for the associated peripheral neuropathies, we have initiated detailed analysis of the 5{prime} flanking region of the PMP22 gene and identified two alternatively transcribed, but untranslated exons. Mapping of separate PMP22 mRNA transcription initiation sites to each of these exons indicates that PMP22 expression is regulated by two alternatively used promoters. Both putative promoter sequences demonstrated the ability to drive expression of reporter genes in transfection experiments. Furthermore, the structure of the 5{prime} portion of the PMP22 gene appears to be identical in rat and human, supporting the biological significance of the observed arrangement of regulatory regions. The relative expression of the alternative PMP22 transcripts is tissue-specific and high levels of the exon 1A-containing transcript are tightly coupled to myelin formation. In contrast, exon 1B-containing transcripts are predominant in non-neural tissues and in growth-arrested primary fibroblasts. The observed regulation of the PMP22 by a complex molecular mechanism is consistent with the proposed dual role of PMP22 in neural and non-neural tissue.

  17. Gene transcript profiling in sea otters post-Exxon Valdez oil spill: A tool for marine ecosystem health assessment

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Ballachey, Brenda E.; Waters, Shannon C.; Bodkin, James L.

    2016-01-01

    Using a panel of genes stimulated by oil exposure in a laboratory study, we evaluated gene transcription in blood leukocytes sampled from sea otters captured from 2006–2012 in western Prince William Sound (WPWS), Alaska, 17–23 years after the 1989 Exxon Valdez oil spill (EVOS). We compared WPWS sea otters to reference populations (not affected by the EVOS) from the Alaska Peninsula (2009), Katmai National Park and Preserve (2009), Clam Lagoon at Adak Island (2012), Kodiak Island (2005) and captive sea otters in aquaria. Statistically, sea otter gene transcript profiles separated into three distinct clusters: Cluster 1, Kodiak and WPWS 2006–2008 (higher relative transcription); Cluster 2, Clam Lagoon and WPWS 2010–2012 (lower relative transcription); and Cluster 3, Alaska Peninsula, Katmai and captive sea otters (intermediate relative transcription). The lower transcription of the aryl hydrocarbon receptor (AHR), an established biomarker for hydrocarbon exposure, in WPWS 2010–2012 compared to earlier samples from WPWS is consistent with declining hydrocarbon exposure, but the pattern of overall low levels of transcription seen in WPWS 2010–2012 could be related to other factors, such as food limitation, pathogens or injury, and may indicate an inability to mount effective responses to stressors. Decreased transcriptional response across the entire gene panel precludes the evaluation of whether or not individual sea otters show signs of exposure to lingering oil. However, related studies on sea otter demographics indicate that by 2012, the sea otter population in WPWS had recovered, which indicates diminishing oil exposure.

  18. Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus.

    PubMed

    Gowda, S; Scholthof, H B; Wu, F C; Shepherd, R J

    1991-12-01

    The six major conserved genes of figwort mosaic virus (FMV), a caulimovirus, appear in tandem array on an RNA transcript that spans the entire viral genome. Gene VI, the only cistron that appears as a separate subgenomic RNA, has been reported to transactivate the expression of downstream genes of the full-length transcript. This transcript has a long 5'-leader of about 600 nucleotides followed by a small nonconserved region (gene VII), a smaller intergenic region (57 nucleotides), and the major conserved genes in a closely spaced array. In our present experiments we have constructed expression units containing the promoter for the full-length transcript followed by the 5' leader region, gene VII, and a reporter gene. These have been tested for expression with and without gene VI as a separate plasmid by electroporation into plant protoplasts. A series of these expression units containing truncated versions of the 5' leader region placed upstream of a reporter gene (CAT) showed that gene VI transactivation occurred only when gene VII sequences were present in cis between the leader region and the reporter gene. In addition, a more complete version of the FMV genome containing the reporter gene further downstream (in viral gene IV) showed CAT expression only when gene VII sequences were present in an upstream position. A similar construct failed to express CAT activity when gene VII was absent.

  19. The gooseberry-zipper region of Drosophila: five genes encode different spatially restricted transcripts in the embryo.

    PubMed

    Côté, S; Preiss, A; Haller, J; Schuh, R; Kienlin, A; Seifert, E; Jäckle, H

    1987-09-01

    Genetic analysis of the Drosophila chromosome region 60 E9-F1 identified two functions affecting embryonic development; gooseberry (gsb), a segment polarity gene, and zipper (zip), an unclassified gene which affects cuticle formation severely. By contrast, molecular analysis revealed five genes with different temporal and spatial patterns of expression in the embryo. Candidate genes for gsb and zip functions were identified. Two adjacent genes are eventually expressed in regular stripes within the posterior region of each segment. One of them is expressed initially in a pair-rule mode; the second gene expresses reduced levels of transcripts in a mutant which leaves the transcribed region and the sequences up to the second gene intact. This observation, the patterns of transcripts in the embryo and the genetic data suggest that both genes are involved in gooseberry segmentation function. zip is expressed in neural tissue and not in epidermal anlagen. Embryos lacking zip activity also develop abnormal neural tissue consistent with the argument that the zip cuticle phenotype is a secondary effect. Additional newly identified genes are expressed in specific domains of the embryo, covering mesoderm anlagen and the dorsal region of embryos at blastoderm stage, respectively. PMID:16453795

  20. dLKR/SDH regulates hormone-mediated histone arginine methylation and transcription of cell death genes.

    PubMed

    Cakouros, Dimitrios; Mills, Kathryn; Denton, Donna; Paterson, Alicia; Daish, Tasman; Kumar, Sharad

    2008-08-11

    The sequential modifications of histones form the basis of the histone code that translates into either gene activation or repression. Nuclear receptors recruit a cohort of histone-modifying enzymes in response to ligand binding and regulate proliferation, differentiation, and cell death. In Drosophila melanogaster, the steroid hormone ecdysone binds its heterodimeric receptor ecdysone receptor/ultraspiracle to spatiotemporally regulate the transcription of several genes. In this study, we identify a novel cofactor, Drosophila lysine ketoglutarate reductase (dLKR)/saccharopine dehydrogenase (SDH), that is involved in ecdysone-mediated transcription. dLKR/SDH binds histones H3 and H4 and suppresses ecdysone-mediated transcription of cell death genes by inhibiting histone H3R17me2 mediated by the Drosophila arginine methyl transferase CARMER. Our data suggest that the dynamic recruitment of dLKR/SDH to ecdysone-regulated gene promoters controls the timing of hormone-induced gene expression. In the absence of dLKR/SDH, histone methylation occurs prematurely, resulting in enhanced gene activation. Consistent with these observations, the loss of dLKR/SDH in Drosophila enhances hormone-regulated gene expression, affecting the developmental timing of gene activation. PMID:18695041

  1. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    PubMed

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  2. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  3. Effect of soil clay content on RNA isolation and on detection and quantification of bacterial gene transcripts in soil by quantitative reverse transcription-PCR.

    PubMed

    Novinscak, A; Filion, M

    2011-09-01

    In this study, we evaluated the effect of soil clay content on RNA isolation and on quantitative reverse transcription-PCR (qRT-PCR) quantification of microbial gene transcripts. The amount of clay significantly altered RNA isolation yields and qRT-PCR analyses. Recommendations are made for quantifying microbial gene transcripts in soil samples varying in clay content.

  4. DNA-binding motif and target genes of the imprinted transcription factor PEG3

    PubMed Central

    Thiaville, Michelle M.; Huang, Jennifer M.; Kim, Hana; Ekram, Muhammad B.; Roh, Tae-Young; Kim, Joomyeong

    2012-01-01

    The Peg3 gene is expressed only from the paternally inherited allele located on proximal mouse chromosome 7. The PEG3 protein encoded by this imprinted gene is predicted to bind DNA based on its multiple zinc finger motifs and nuclear localization. In the current study, we demonstrated PEG3’s DNA-binding ability by characterizing its binding motif and target genes. We successfully identified target regions bound by PEG3 from mouse brain extracts using chromatin immunoprecipitation analysis. PEG3 was demonstrated to bind these candidate regions through the consensus DNA-binding motif AGTnnCnnnTGGCT. In vitro promoter assays established that PEG3 controls the expression of a given gene through this motif. Consistent with these observations, the transcriptional levels of a subset of the target genes are also affected in a mutant mouse model with reduced levels of PEG3 protein. Overall, these results confirm PEG3 as a DNA-binding protein controlling specific target genes that are involved in distinct cellular functions. PMID:23078764

  5. Transcriptome analysis of human tissues and cell lines reveals one dominant transcript per gene

    PubMed Central

    2013-01-01

    Background RNA sequencing has opened new avenues for the study of transcriptome composition. Significant evidence has accumulated showing that the human transcriptome contains in excess of a hundred thousand different transcripts. However, it is still not clear to what extent this diversity prevails when considering the relative abundances of different transcripts from the same gene. Results Here we show that, in a given condition, most protein coding genes have one major transcript expressed at significantly higher level than others, that in human tissues the major transcripts contribute almost 85 percent to the total mRNA from protein coding loci, and that often the same major transcript is expressed in many tissues. We detect a high degree of overlap between the set of major transcripts and a recently published set of alternatively spliced transcripts that are predicted to be translated utilizing proteomic data. Thus, we hypothesize that although some minor transcripts may play a functional role, the major ones are likely to be the main contributors to the proteome. However, we still detect a non-negligible fraction of protein coding genes for which the major transcript does not code a protein. Conclusions Overall, our findings suggest that the transcriptome from protein coding loci is dominated by one transcript per gene and that not all the transcripts that contribute to transcriptome diversity are equally likely to contribute to protein diversity. This observation can help to prioritize candidate targets in proteomics research and to predict the functional impact of the detected changes in variation studies. PMID:23815980

  6. Mining whole genomes and transcriptomes of Jatropha (Jatropha curcas) and Castor bean (Ricinus communis) for NBS-LRR genes and defense response associated transcription factors.

    PubMed

    Sood, Archit; Jaiswal, Varun; Chanumolu, Sree Krishna; Malhotra, Nikhil; Pal, Tarun; Chauhan, Rajinder Singh

    2014-11-01

    Jatropha (Jatropha curcas L.) and Castor bean (Ricinus communis) are oilseed crops of family Euphorbiaceae with the potential of producing high quality biodiesel and having industrial value. Both the bioenergy plants are becoming susceptible to various biotic stresses directly affecting the oil quality and content. No report exists as of today on analysis of Nucleotide Binding Site-Leucine Rich Repeat (NBS-LRR) gene repertoire and defense response transcription factors in both the plant species. In silico analysis of whole genomes and transcriptomes identified 47 new NBS-LRR genes in both the species and 122 and 318 defense response related transcription factors in Jatropha and Castor bean, respectively. The identified NBS-LRR genes and defense response transcription factors were mapped onto the respective genomes. Common and unique NBS-LRR genes and defense related transcription factors were identified in both the plant species. All NBS-LRR genes in both the species were characterized into Toll/interleukin-1 receptor NBS-LRRs (TNLs) and coiled-coil NBS-LRRs (CNLs), position on contigs, gene clusters and motifs and domains distribution. Transcript abundance or expression values were measured for all NBS-LRR genes and defense response transcription factors, suggesting their functional role. The current study provides a repertoire of NBS-LRR genes and transcription factors which can be used in not only dissecting the molecular basis of disease resistance phenotype but also in developing disease resistant genotypes in Jatropha and Castor bean through transgenic or molecular breeding approaches.

  7. Correlation of Methane Production and Functional Gene Transcriptional Activity in a Peat Soil ▿

    PubMed Central

    Freitag, Thomas E.; Prosser, James I.

    2009-01-01

    The transcription dynamics of subunit A of the key gene in methanogenesis (methyl coenzyme M reductase; mcrA) was studied to evaluate the relationship between process rate (methanogenesis) and gene transcription dynamics in a peat soil ecosystem. Soil methanogen process rates were determined during incubation of peat slurries at temperatures from 4 to 37°C, and real-time quantitative PCR was applied to quantify the abundances of mcrA genes and transcripts; corresponding transcriptional dynamics were calculated from mcrA transcript/gene ratios. Internal standards suggested unbiased recovery of mRNA abundances in comparison to DNA levels. In comparison to those in pure-culture studies, mcrA transcript/gene ratios indicated underestimation by 1 order of magnitude, possibly due to high proportions of inactive or dead methanogens. Methane production rates were temperature dependent, with maxima at 25°C, but changes in abundance and transcription of the mcrA gene showed no correlation with temperature. However, mcrA transcript/gene ratios correlated weakly (regression coefficient = 0.76) with rates of methanogenesis. Methanogen process rates increased over 3 orders of magnitude, while the corresponding maximum transcript/gene ratio increase was only 18-fold. mcrA transcript dynamics suggested steady-state expression in peat soil after incubation for 24 and 48 h, similar to that in stationary-phase cultures. mcrA transcript/gene ratios are therefore potential in situ indicators of methanogen process rate changes in complex soil systems. PMID:19749064

  8. Correlation of methane production and functional gene transcriptional activity in a peat soil.

    PubMed

    Freitag, Thomas E; Prosser, James I

    2009-11-01

    The transcription dynamics of subunit A of the key gene in methanogenesis (methyl coenzyme M reductase; mcrA) was studied to evaluate the relationship between process rate (methanogenesis) and gene transcription dynamics in a peat soil ecosystem. Soil methanogen process rates were determined during incubation of peat slurries at temperatures from 4 to 37 degrees C, and real-time quantitative PCR was applied to quantify the abundances of mcrA genes and transcripts; corresponding transcriptional dynamics were calculated from mcrA transcript/gene ratios. Internal standards suggested unbiased recovery of mRNA abundances in comparison to DNA levels. In comparison to those in pure-culture studies, mcrA transcript/gene ratios indicated underestimation by 1 order of magnitude, possibly due to high proportions of inactive or dead methanogens. Methane production rates were temperature dependent, with maxima at 25 degrees C, but changes in abundance and transcription of the mcrA gene showed no correlation with temperature. However, mcrA transcript/gene ratios correlated weakly (regression coefficient = 0.76) with rates of methanogenesis. Methanogen process rates increased over 3 orders of magnitude, while the corresponding maximum transcript/gene ratio increase was only 18-fold. mcrA transcript dynamics suggested steady-state expression in peat soil after incubation for 24 and 48 h, similar to that in stationary-phase cultures. mcrA transcript/gene ratios are therefore potential in situ indicators of methanogen process rate changes in complex soil systems.

  9. Insulin post-transcriptionally modulates Bmal1 protein to affect the hepatic circadian clock

    PubMed Central

    Dang, Fabin; Sun, Xiujie; Ma, Xiang; Wu, Rong; Zhang, Deyi; Chen, Yaqiong; Xu, Qian; Wu, Yuting; Liu, Yi

    2016-01-01

    Although food availability is a potent synchronizer of the peripheral circadian clock in mammals, the underlying mechanisms are unclear. Here, we show that hepatic Bmal1, a core transcription activator of the molecular clock, is post-transcriptionally regulated by signals from insulin, an important hormone that is temporally controlled by feeding. Insulin promotes postprandial Akt-mediated Ser42-phosphorylation of Bmal1 to induce its dissociation from DNA, interaction with 14-3-3 protein and subsequently nuclear exclusion, which results in the suppression of Bmal1 transcriptional activity. Inverted feeding cycles not only shift the phase of daily insulin oscillation, but also elevate the amplitude due to food overconsumption. This enhanced and reversed insulin signalling initiates the reset of clock gene rhythms by altering Bmal1 nuclear accumulation in mouse liver. These results reveal the molecular mechanism of insulin signalling in regulating peripheral circadian rhythms. PMID:27576939

  10. Insulin post-transcriptionally modulates Bmal1 protein to affect the hepatic circadian clock.

    PubMed

    Dang, Fabin; Sun, Xiujie; Ma, Xiang; Wu, Rong; Zhang, Deyi; Chen, Yaqiong; Xu, Qian; Wu, Yuting; Liu, Yi

    2016-01-01

    Although food availability is a potent synchronizer of the peripheral circadian clock in mammals, the underlying mechanisms are unclear. Here, we show that hepatic Bmal1, a core transcription activator of the molecular clock, is post-transcriptionally regulated by signals from insulin, an important hormone that is temporally controlled by feeding. Insulin promotes postprandial Akt-mediated Ser42-phosphorylation of Bmal1 to induce its dissociation from DNA, interaction with 14-3-3 protein and subsequently nuclear exclusion, which results in the suppression of Bmal1 transcriptional activity. Inverted feeding cycles not only shift the phase of daily insulin oscillation, but also elevate the amplitude due to food overconsumption. This enhanced and reversed insulin signalling initiates the reset of clock gene rhythms by altering Bmal1 nuclear accumulation in mouse liver. These results reveal the molecular mechanism of insulin signalling in regulating peripheral circadian rhythms. PMID:27576939

  11. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.

    PubMed

    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  12. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.

    PubMed

    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E

    2015-11-11

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding.

  13. Regulation of calcitonin gene transcription by vitamin D metabolites in vivo in the rat.

    PubMed Central

    Naveh-Many, T; Silver, J

    1988-01-01

    Calcitonin is secreted by the C cells of the thyroid in response to a raised serum calcium, and acts on bone to lower serum calcium. The C cells have specific receptors for the dihydroxymetabolite of vitamin D3, 1,25(OH)2D3. Moreover, calcitonin stimulates the synthesis of 1,25(OH)2D3 in the kidney. Parathyroid hormone (PTH), the third calciotrophic hormone, is also trophic to the renal synthesis of 1,25(OH)2D3, and in turn 1,25(OH)2D3 inhibits PTH gene transcription and synthesis. We report here the marked inhibition of calcitonin gene transcription by the injection of physiologically relevant doses of 1,25(OH)2D3 to normal rats that did not raise serum calcium. Calcitonin mRNA levels after 100 pmol 1,25(OH)2D3 decreased to 6% of basal at 6 h and 4% at 48 h, and a dose response showed a marked effect even after 12.5 pmol 1,25(OH)2D3, with no appreciably greater effect with larger doses (up to 200 pmol). Control genes, actin, thyroglobulin (thyroid follicular cells), somatostatin (thyroid C-cells) were not affected by 1,25(OH)2D3. Gel blots showed that 1,25(OH)2D3 decreased calcitonin mRNA levels without any change in its size. In vitro nuclear transcription showed that 1,25(OH)2D3-treated (100 pmol) rats' calcitonin transcription was 10% of control, while thyroglobulin and actin were 100%. We propose that calcium is the major regulator of PTH and calcitonin secretion, while 1,25(OH)2D3 is an important regulator of PTH and calcitonin gene transcription. We believe this to be the first demonstration of an effect of 1,25(OH)2D3 on the C cells thereby establishing a new target organ and site of action of vitamin D. Calcitonin is trophic to 1,25(OH)2D3 synthesis, which in turn inhibits calcitonin synthesis, which are the components of a new endocrinological feedback loop. Images PMID:2891728

  14. Evaluation of position effect variegation of the transcription of genes from the FSHD candidate region

    SciTech Connect

    Winokur, S.T.; Wasmuth, J.J.; Altherr, M.R.

    1994-09-01

    The gene for facioscapulohumeral muscular dystrophy (FSHD) lies in close proximity to the telomere of 4q. Deletion of several copies of a 3.2 kb tandem repeat have been associated with FSHD, although no genes have been identified within this repeat. We have shown that this repeat, as well as other repeats in the FSHD region, resemble constitutive heterochromatin both by sequence analysis and FISH cross-hybridization. We hypothesize that alterations in chromatin structure near the telomere of 4q due to deletion of these heterochromatic elements may lead to a position effect variegation of nearby genes. To test this hypothesis, we have isolated exons and candidate cDNAs from the FSHD region. A 2 kb polyadenylated cDNA was isolated from both fetal and infant brain cDNA libraries. Another cDNA hybridizes to a 7 kb skeletal muscle transcript on a Northern blot. Both of these cDNAs are chromosome 4-specific and map to the FSHD region. We have examined the expression pattern of these genes by RT-PCR, RNase protection and Northern analysis. Total RNA was isolated from normal and FSHD-affected lymphoblasts and from human-hamster somatic cell hybrids in which the normal and affected chromosomes 4 from FSHD patients were segregated. RT-PCR and RNase protection were then employed as quantitive assays to evaluate the potential for position effect variegation on RNA production in FSHD patients.

  15. Ectopic expression of MYB46 identifies transcriptional regulatory genes involved in secondary wall biosynthesis in Arabidopsis.

    PubMed

    Ko, Jae-Heung; Kim, Won-Chan; Han, Kyung-Hwan

    2009-11-01

    MYB46 functions as a transcriptional switch that turns on the genes necessary for secondary wall biosynthesis. Elucidating the transcriptional regulatory network immediately downstream of MYB46 is crucial to our understanding of the molecular and biochemical processes involved in the biosynthesis and deposition of secondary walls in plants. To gain insights into MYB46-mediated transcriptional regulation, we first established an inducible secondary wall thickening system in Arabidopsis by expressing MYB46 under the control of dexamethasone-inducible promoter. Then, we used an ATH1 GeneChip microarray and Illumina digital gene expression system to obtain a series of transcriptome profiles with regard to the induction of secondary wall development. These analyses allowed us to identify a group of transcription factors whose expression coincided with or preceded the induction of secondary wall biosynthetic genes. A transient transcriptional activation assay was used to confirm the hierarchical relationships among the transcription factors in the network. The in vivo assay showed that MYB46 transcriptionally activates downstream target transcription factors, three of which (AtC3H14, MYB52 and MYB63) were shown to be able to activate secondary wall biosynthesis genes. AtC3H14 activated the transcription of all of the secondary wall biosynthesis genes tested, suggesting that AtC3H14 may be another master regulator of secondary wall biosynthesis. The transcription factors identified here may include direct activators of secondary wall biosynthesis genes. The present study discovered novel hierarchical relationships among the transcription factors involved in the transcriptional regulation of secondary wall biosynthesis, and generated several testable hypotheses.

  16. MEF2 transcription factors: developmental regulators and emerging cancer genes

    PubMed Central

    Pon, Julia R.; Marra, Marco A.

    2016-01-01

    The MEF2 transcription factors have roles in muscle, cardiac, skeletal, vascular, neural, blood and immune system cell development through their effects on cell differentiation, proliferation, apoptosis, migration, shape and metabolism. Altered MEF2 activity plays a role in human diseases and has recently been implicated in the development of several cancer types. In particular, MEF2B, the most divergent and least studied protein of the MEF2 family, has a role unique from its paralogs in non-Hodgkin lymphomas. The use of genome-scale technologies has enabled comprehensive MEF2 target gene sets to be identified, contributing to our understanding of MEF2 proteins as nodes in complex regulatory networks. This review surveys the molecular interactions of MEF2 proteins and their effects on cellular and organismal phenotypes. We include a discussion of the emerging roles of MEF2 proteins as oncogenes and tumor suppressors of cancer. Throughout this article we highlight similarities and differences between the MEF2 family proteins, including a focus on functions of MEF2B. PMID:26506234

  17. [Association of schizophrenia with variations in genes encoding transcription factors].

    PubMed

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  18. Genome-Wide Gene Expression Analysis Shows AKAP13-Mediated PKD1 Signaling Regulates the Transcriptional Response to Cardiac Hypertrophy

    PubMed Central

    Johnson, Keven R.; Nicodemus-Johnson, Jessie; Spindler, Mathew J.

    2015-01-01

    In the heart, scaffolding proteins such as A-Kinase Anchoring Proteins (AKAPs) play a crucial role in normal cellular function by serving as a signaling hub for multiple protein kinases including protein kinase D1 (PKD1). Under cardiac hypertrophic conditions AKAP13 anchored PKD1 activates the transcription factor MEF2 leading to subsequent fetal gene activation and hypertrophic response. We used an expression microarray to identify the global transcriptional response in the hearts of wild-type mice expressing the native form of AKAP13 compared to a gene-trap mouse model expressing a truncated form of AKAP13 that is unable to bind PKD1 (AKAP13-ΔPKD1). Microarray analysis showed that AKAP13-ΔPKD1 mice broadly failed to exhibit the transcriptional profile normally associated with compensatory cardiac hypertrophy following trans-aortic constriction (TAC). The identified differentially expressed genes in WT and AKAP13-ΔPKD1 hearts are vital for the compensatory hypertrophic response to pressure-overload and include myofilament, apoptotic, and cell growth/differentiation genes in addition to genes not previously identified as affected by AKAP13-anchored PKD1. Our results show that AKAP13-PKD1 signaling is critical for transcriptional regulation of key contractile, cell death, and metabolic pathways during the development of compensatory hypertrophy in vivo. PMID:26192751

  19. From cell membrane to the nucleus: an emerging role of E-cadherin in gene transcriptional regulation

    PubMed Central

    Du, Wenjun; Liu, Xi; Fan, Guiling; Zhao, Xingsheng; Sun, Yanying; Wang, Tianzhen; Zhao, Ran; Wang, Guangyu; Zhao, Ci; Zhu, Yuanyuan; Ye, Fei; Jin, Xiaoming; Zhang, Fengmin; Zhong, Zhaohua; Li, Xiaobo

    2014-01-01

    E-cadherin is a well-known mediator of cell–cell adherens junctions. However, many other functions of E-cadherin have been reported. Collectively, the available data suggest that E-cadherin may also act as a gene transcriptional regulator. Here, evidence supporting this claim is reviewed, and possible mechanisms of action are discussed. E-cadherin has been shown to modulate the activity of several notable cell signalling pathways, and given that most of these pathways in turn regulate gene expression, we proposed that E-cadherin may regulate gene transcription by affecting these pathways. Additionally, E-cadherin has been shown to accumulate in the nucleus where documentation of an E-cadherin fragment bound to DNA suggests that E-cadherin may directly regulate gene transcription. In summary, from the cell membrane to the nucleus, a role for E-cadherin in gene transcription may be emerging. Studies specifically focused on this potential role would allow for a more thorough understanding of this transmembrane glycoprotein in mediating intra- and intercellular activities. PMID:25164084

  20. Identification of brassinosteroid-related genes by means of transcript co-response analyses

    PubMed Central

    Lisso, Janina; Steinhauser, Dirk; Altmann, Thomas; Kopka, Joachim; Müssig, Carsten

    2005-01-01

    The comprehensive systems-biology database (CSB.DB) was used to reveal brassinosteroid (BR)-related genes from expression profiles based on co-response analyses. Genes exhibiting simultaneous changes in transcript levels are candidates of common transcriptional regulation. Combining numerous different experiments in data matrices allows ruling out outliers and conditional changes of transcript levels. CSB.DB was queried for transcriptional co-responses with the BR-signalling components BRI1 and BAK1: 301 out of 9694 genes represented in the nasc0271 database showed co-responses with both genes. As expected, these genes comprised pathway-involved genes (e.g. 72 BR-induced genes), because the BRI1 and BAK1 proteins are required for BR-responses. But transcript co-response takes the analysis a step further compared with direct approaches because BR-related non BR-responsive genes were identified. Insights into networks and the functional context of genes are provided, because factors determining expression patterns are reflected in correlations. Our findings demonstrate that transcript co-response analysis presents a valuable resource to uncover common regulatory patterns of genes. Different data matrices in CSB.DB allow examination of specific biological questions. All matrices are publicly available through CSB.DB. This work presents one possible roadmap to use the CSB.DB resources. PMID:15891113

  1. OsDREB2A, a rice transcription factor, significantly affects salt tolerance in transgenic soybean.

    PubMed

    Zhang, Xiu-Xiang; Tang, Yu-Juan; Ma, Qi-Bin; Yang, Cun-Yi; Mu, Ying-Hui; Suo, Hai-Cui; Luo, Lai-Hui; Nian, Hai

    2013-01-01

    The dehydration responsive element binding (DREB) transcription factors play an important role in regulating stress-related genes. OsDREB2A, a member of the DREBP subfamily of AP2/ERF transcription factors in rice (Oryza sativa), is involved in the abiotic stress response. OsDREB2A expression is induced by drought, low-temperature and salt stresses. Here, we report the ability of OsDREB2A to regulate high-salt response in transgenic soybean. Overexpressing OsDREB2A in soybeans enhanced salt tolerance by accumulating osmolytes, such as soluble sugars and free proline, and improving the expression levels of some stress-responsive transcription factors and key genes. The phenotypic characterization of transgenic soybean were significantly better than those of wild-type (WT). Electrophoresis mobility shift assay (EMSA) revealed that the OsDREB2A can bind to the DRE core element in vitro. These results indicate that OsDREB2A may participate in abiotic stress by directly binding with DRE element to regulate the expression of downstream genes. Overexpression of OsDREB2A in soybean might be used to improve tolerance to salt stress.

  2. Gene model 129 (Gm129) encodes a novel transcriptional repressor that modulates circadian gene expression.

    PubMed

    Annayev, Yunus; Adar, Sheera; Chiou, Yi-Ying; Lieb, Jason D; Sancar, Aziz; Ye, Rui

    2014-02-21

    The mammalian circadian clock is a molecular oscillator composed of a feedback loop that involves transcriptional activators CLOCK and BMAL1, and repressors Cryptochrome (CRY) and Period (PER). Here we show that a direct CLOCK·BMAL1 target gene, Gm129, is a novel regulator of the feedback loop. ChIP analysis revealed that the CLOCK·BMAL1·CRY1 complex strongly occupies the promoter region of Gm129. Both mRNA and protein levels of GM129 exhibit high amplitude circadian oscillations in mouse liver, and Gm129 gene encodes a nuclear-localized protein that directly interacts with BMAL1 and represses CLOCK·BMAL1 activity. In vitro and in vivo protein-DNA interaction results demonstrate that, like CRY1, GM129 functions as a repressor by binding to the CLOCK·BMAL1 complex on DNA. Although Gm129(-/-) or Cry1(-/-) Gm129(-/-) mice retain a robust circadian rhythm, the peaks of Nr1d1 and Dbp mRNAs in liver exhibit a significant phase delay compared with control. Our results suggest that, in addition to CRYs and PERs, the GM129 protein contributes to the transcriptional feedback loop by modulating CLOCK·BMAL1 activity as a transcriptional repressor.

  3. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2016-01-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  4. Transcriptional control of steroid biosynthesis genes in the Drosophila prothoracic gland by ventral veins lacking and knirps.

    PubMed

    Danielsen, E Thomas; Moeller, Morten E; Dorry, Elad; Komura-Kawa, Tatsuya; Fujimoto, Yoshinori; Troelsen, Jesper T; Herder, Rachel; O'Connor, Michael B; Niwa, Ryusuke; Rewitz, Kim F

    2014-06-01

    Specialized endocrine cells produce and release steroid hormones that govern development, metabolism and reproduction. In order to synthesize steroids, all the genes in the biosynthetic pathway must be coordinately turned on in steroidogenic cells. In Drosophila, the steroid producing endocrine cells are located in the prothoracic gland (PG) that releases the steroid hormone ecdysone. The transcriptional regulatory network that specifies the unique PG specific expression pattern of the ecdysone biosynthetic genes remains unknown. Here, we show that two transcription factors, the POU-domain Ventral veins lacking (Vvl) and the nuclear receptor Knirps (Kni), have essential roles in the PG during larval development. Vvl is highly expressed in the PG during embryogenesis and is enriched in the gland during larval development, suggesting that Vvl might function as a master transcriptional regulator in this tissue. Vvl and Kni bind to PG specific cis-regulatory elements that are required for expression of the ecdysone biosynthetic genes. Knock down of either vvl or kni in the PG results in a larval developmental arrest due to failure in ecdysone production. Furthermore, Vvl and Kni are also required for maintenance of TOR/S6K and prothoracicotropic hormone (PTTH) signaling in the PG, two major pathways that control ecdysone biosynthesis and PG cell growth. We also show that the transcriptional regulator, Molting defective (Mld), controls early biosynthetic pathway steps. Our data show that Vvl and Kni directly regulate ecdysone biosynthesis by transcriptional control of biosynthetic gene expression and indirectly by affecting PTTH and TOR/S6K signaling. This provides new insight into the regulatory network of transcription factors involved in the coordinated regulation of steroidogenic cell specific transcription, and identifies a new function of Vvl and Knirps in endocrine cells during post-embryonic development.

  5. Transcriptional Control of Steroid Biosynthesis Genes in the Drosophila Prothoracic Gland by Ventral Veins Lacking and Knirps

    PubMed Central

    Dorry, Elad; Komura-Kawa, Tatsuya; Fujimoto, Yoshinori; Troelsen, Jesper T.; Herder, Rachel; O'Connor, Michael B.; Niwa, Ryusuke; Rewitz, Kim F.

    2014-01-01

    Specialized endocrine cells produce and release steroid hormones that govern development, metabolism and reproduction. In order to synthesize steroids, all the genes in the biosynthetic pathway must be coordinately turned on in steroidogenic cells. In Drosophila, the steroid producing endocrine cells are located in the prothoracic gland (PG) that releases the steroid hormone ecdysone. The transcriptional regulatory network that specifies the unique PG specific expression pattern of the ecdysone biosynthetic genes remains unknown. Here, we show that two transcription factors, the POU-domain Ventral veins lacking (Vvl) and the nuclear receptor Knirps (Kni), have essential roles in the PG during larval development. Vvl is highly expressed in the PG during embryogenesis and is enriched in the gland during larval development, suggesting that Vvl might function as a master transcriptional regulator in this tissue. Vvl and Kni bind to PG specific cis-regulatory elements that are required for expression of the ecdysone biosynthetic genes. Knock down of either vvl or kni in the PG results in a larval developmental arrest due to failure in ecdysone production. Furthermore, Vvl and Kni are also required for maintenance of TOR/S6K and prothoracicotropic hormone (PTTH) signaling in the PG, two major pathways that control ecdysone biosynthesis and PG cell growth. We also show that the transcriptional regulator, Molting defective (Mld), controls early biosynthetic pathway steps. Our data show that Vvl and Kni directly regulate ecdysone biosynthesis by transcriptional control of biosynthetic gene expression and indirectly by affecting PTTH and TOR/S6K signaling. This provides new insight into the regulatory network of transcription factors involved in the coordinated regulation of steroidogenic cell specific transcription, and identifies a new function of Vvl and Knirps in endocrine cells during post-embryonic development. PMID:24945799

  6. Retroviral vectors containing Tet-controlled bidirectional transcription units for simultaneous regulation of two gene activities

    PubMed Central

    Loew, Rainer; Vigna, Elisa; Lindemann, Dirk; Naldini, Luigi; Bujard, Herman

    2006-01-01

    In this study retroviral self-inactivating (SIN)-vectors were constructed, that allow simultaneous regulation of two genes by integration of bidirectional Tet controlled transcription units. Marker genes (luciferase and eGFP) were expressed under the control of various bidirectional promoters Ptetbis, in order to determine (i) the fraction of HtTA-1 cells exhibiting tight doxycycline (Dox) dependent control; (ii) possible effects of the vector backbone on the regulation of gene transcription; (iii) the possibility for crosstalk between different minimal promoters within Ptetbi. When HtTA-1 cells, constitutively expressing the Tet-Transactivator (tTA), were transduced by S2f-lMCg retroviral vector, a high percentage (40) of the cell population displayed tight regulation (5000 fold) of Ptetbi activity over a wide range of Dox concentrations. As a result of our comparative study on the activity of virus derived minimal promoters (from MMTV, HIV and CMV), a clear hierarchy of activity as well as a different sensitivity to external influences among the various promoters studied was observed. Furthermore, our results strongly support the idea, that viral elements such as part of the MuLV pol/env region significantly affect the regulation capacity of an integrate. Taking into account our observations as outlined above, we succeeded in generating significantly optimized Tet regulated retroviral vectors. The application of such a one-step transfer system for Ptet controlled genes would be of particular relevance to applications where cellular systems do not allow prolonged selection procedures as it is the case with primary cells considered for ex vivo gene therapy. PMID:19565004

  7. Tissue-specific epigenetics in gene neighborhoods: myogenic transcription factor genes

    PubMed Central

    Chandra, Sruti; Terragni, Jolyon; Zhang, Guoqiang; Pradhan, Sriharsa; Haushka, Stephen; Johnston, Douglas; Baribault, Carl; Lacey, Michelle; Ehrlich, Melanie

    2015-01-01

    Myogenic regulatory factor (MRF) genes, MYOD1, MYOG, MYF6 and MYF5, are critical for the skeletal muscle lineage. Here, we used various epigenome profiles from human myoblasts (Mb), myotubes (Mt), muscle and diverse non-muscle samples to elucidate the involvement of multigene neighborhoods in the regulation of MRF genes. We found more far-distal enhancer chromatin associated with MRF genes in Mb and Mt than previously reported from studies in mice. For the MYF5/MYF6 gene-pair, regions of Mb-associated enhancer chromatin were located throughout the adjacent 236-kb PTPRQ gene even though Mb expressed negligible amounts of PTPRQ mRNA. Some enhancer chromatin regions inside PTPRQ in Mb were also seen in PTPRQ mRNA-expressing non-myogenic cells. This suggests dual-purpose PTPRQ enhancers that upregulate expression of PTPRQ in non-myogenic cells and MYF5/MYF6 in myogenic cells. In contrast, the myogenic enhancer chromatin regions distal to MYOD1 were intergenic and up to 19 kb long. Two of them contain small, known MYOD1 enhancers, and one displayed an unusually high level of 5-hydroxymethylcytosine in a quantitative DNA hydroxymethylation assay. Unexpectedly, three regions of MYOD1-distal enhancer chromatin in Mb and Mt overlapped enhancer chromatin in umbilical vein endothelial cells, which might upregulate a distant gene (PIK3C2A). Lastly, genes surrounding MYOG were preferentially transcribed in Mt, like MYOG itself, and exhibited nearby myogenic enhancer chromatin. These neighboring chromatin regions may be enhancers acting in concert to regulate myogenic expression of multiple adjacent genes. Our findings reveal the very different and complex organization of gene neighborhoods containing closely related transcription factor genes. PMID:26041816

  8. A distance difference matrix approach to identifying transcription factors that regulate differential gene expression

    PubMed Central

    De Bleser, Pieter; Hooghe, Bart; Vlieghe, Dominique; van Roy, Frans

    2007-01-01

    We introduce a method that considers target genes of a transcription factor, and searches for transcription factor binding sites (TFBSs) of secondary factors responsible for differential responses among these targets. Based on the distance difference matrix concept, the method simultaneously integrates statistical overrepresentation and co-occurrence of TFBSs. Our approach is validated on datasets of differentially regulated human genes and is shown to be highly effective in detecting TFBSs responsible for the observed differential gene expression. PMID:17504544

  9. Regulation of nitrogenase gene expression by transcript stability in the cyanobacterium Anabaena variabilis.

    PubMed

    Pratte, Brenda S; Thiel, Teresa

    2014-10-01

    The nitrogenase gene cluster in cyanobacteria has been thought to comprise multiple operons; however, in Anabaena variabilis, the promoter for the first gene in the cluster, nifB1, appeared to be the primary promoter for the entire nif cluster. The structural genes nifHDK1 were the most abundant transcripts; however, their abundance was not controlled by an independent nifH1 promoter, but rather, by RNA processing, which produced a very stable nifH1 transcript and a moderately stable nifD1 transcript. There was also no separate promoter for nifEN1. In addition to the nifB1 promoter, there were weak promoters inside the nifU1 gene and inside the nifE1 gene, and both promoters were heterocyst specific. In an xisA mutant, which effectively separated promoters upstream of an 11-kb excision element in nifD1 from the downstream genes, the internal nifE1 promoter was functional. Transcription of the nif1 genes downstream of the 11-kb element, including the most distant genes, hesAB1 and fdxH1, was reduced in the xisA mutant, indicating that the nifB1 promoter contributed to their expression. However, with the exception of nifK1 and nifE1, which had no expression, the downstream genes showed low to moderate levels of transcription in the xisA mutant. The hesA1 gene also had a promoter, but the fdxH gene had a processing site just upstream of the gene. The processing of transcripts at sites upstream of nifH1 and fdxH1 correlated with increased stability of these transcripts, resulting in greater amounts than transcripts that were not close to processing sites. PMID:25092030

  10. NanoScript: A Nanoparticle-Based Artificial Transcription Factor for Effective Gene Regulation

    PubMed Central

    2015-01-01

    Transcription factor (TF) proteins are master regulators of transcriptional activity and gene expression. TF-based gene regulation is a promising approach for many biological applications; however, several limitations hinder the full potential of TFs. Herein, we developed an artificial, nanoparticle-based transcription factor, termed NanoScript, which is designed to mimic the structure and function of TFs. NanoScript was constructed by tethering functional peptides and small molecules called synthetic transcription factors, which mimic the individual TF domains, onto gold nanoparticles. We demonstrate that NanoScript localizes within the nucleus and initiates transcription of a reporter plasmid by over 15-fold. Moreover, NanoScript can effectively transcribe targeted genes on endogenous DNA in a nonviral manner. Because NanoScript is a functional replica of TF proteins and a tunable gene-regulating platform, it has great potential for various stem cell applications. PMID:25133310

  11. Carotenoid genes transcriptional regulation for astaxanthin accumulation in fresh water unicellular alga Haematococcus pluvialis by gibberellin A3 (GA3).

    PubMed

    Gao, Zhengquan; Meng, Chunxiao; Gao, Hongzheng; Li, Yan; Zhang, Xiaowen; Xu, Dong; Zhou, Shitan; Liu, Banghui; Su, Yuanfeng; Ye, Naihao

    2013-12-01

    The fresh water unicellular alga Haematococcus pluvialis is a promising natural source of astaxanthin. The present study investigated the transcriptional expression of carotenoid genes for astaxanthin accumulation in H. pluvialis using real-time fluorescence quantitative PCR (qRT-PCR). With treatments of 20 and 40 mg/L of gibberllin A3 (GA3), five genes ipi-1, ipi-2, psy, pds and bkt2 were up-regulated with different expression profiles. GA20 (20 mg/L of GA3) treatment had a greater effect on transcriptional expression of bkt2 than on ipi-1 ipi-2, psy and pds (> 4-fold up-regulation). However, GA40 (40 mg/L of GA3) induced more transcriptional expression of ipi-2, psy and bkt2 than both ipi-1 and pds. The expression of lyc, crtR-B and crtO for astaxanthin biosynthesis was not affected by GA3 in H. piuvialis. In the presence of GA3, astaxanthin biosynthesis genes of ipi-1, pds and bkt2 were up-regulated at transcriptional level, psy at post-transcriptional level, whereas ipi-2 was up-regulated at both levels. The study could potentially lead to a scale application of exogenous GA3 in astaxanthin production with H. pluvialis just like GAs perform in increasing crops production and it would provide new insight about the multifunctional roles of carotenogenesis in response to GA3. PMID:24772980

  12. Mutations in the alpha-amanitin conserved domain of the largest subunit of yeast RNA polymerase III affect pausing, RNA cleavage and transcriptional transitions.

    PubMed Central

    Thuillier, V; Brun, I; Sentenac, A; Werner, M

    1996-01-01

    The alpha-amanitin domain or domain f of the largest subunit of RNA polymerases is one of the most conserved of these enzymes. We have found that the C-terminal part of domain f can be swapped between yeast RNA polymerase II and III. An extensive mutagenesis of domain f of C160, the largest subunit of RNA polymerase III, was carried out to better define its role and understand the mechanism through which C160 participates in transcription. One mutant enzyme, C160-270, showed much reduced transcription of a non-specific template at low DNA concentrations. Abortive synthesis of trinucleotides in a dinucleotide-primed reaction proceeded at roughly wild-type levels, indicating that the mutation did not affect the formation of the first phosphodiester bond, but rather the transition from abortive initiation to processive elongation. In specific transcription assays, on the SUP4 tRNA gene, pausing was extended but the rate of RNA elongation between pause sites was not affected. Finally, the rate of cleavage of nascent RNA transcripts by halted mutant RNA polymerase was increased approximately 10-fold. We propose that the domain f mutation affects the transition between two transcriptional modes, one being adopted during abortive transcription and at pause sites, the other during elongation between pause sites. Images PMID:8599945

  13. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway.

  14. Epigenetic silencing of spermatocyte-specific and neuronal genes by SUMO modification of the transcription factor Sp3.

    PubMed

    Stielow, Bastian; Krüger, Imme; Diezko, Rolf; Finkernagel, Florian; Gillemans, Nynke; Kong-a-San, John; Philipsen, Sjaak; Suske, Guntram

    2010-11-01

    SUMO modification of transcription factors is linked to repression of transcription. The physiological significance of SUMO attachment to a particular transcriptional regulator, however, is largely unknown. We have employed the ubiquitously expressed murine transcription factor Sp3 to analyze the role of SUMOylation in vivo. We generated mice and mouse embryonic fibroblasts (MEFs) carrying a subtle point mutation in the SUMO attachment sequence of Sp3 (IKEE(553)D mutation). The E(553)D mutation impedes SUMOylation of Sp3 at K(551)in vivo, without affecting Sp3 protein levels. Expression profiling revealed that spermatocyte-specific genes, such as Dmc1 and Dnahc8, and neuronal genes, including Paqr6, Rims3, and Robo3, are de-repressed in non-testicular and extra-neuronal mouse tissues and in mouse embryonic fibroblasts expressing the SUMOylation-deficient Sp3E(553)D mutant protein. Chromatin immunoprecipitation experiments show that transcriptional de-repression of these genes is accompanied by the loss of repressive heterochromatic marks such as H3K9 and H4K20 tri-methylation and impaired recruitment of repressive chromatin-modifying enzymes. Finally, analysis of the DNA methylation state of the Dmc1, Paqr6, and Rims3 promoters by bisulfite sequencing revealed that these genes are highly methylated in Sp3wt MEFs but are unmethylated in Sp3E(553)D MEFs linking SUMOylation of Sp3 to tissue-specific CpG methylation. Our results establish SUMO conjugation to Sp3 as a molecular beacon for the assembly of repression machineries to maintain tissue-specific transcriptional gene silencing.

  15. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway. PMID:27491940

  16. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.

    PubMed

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-04-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  17. Fur-Mediated Activation of Gene Transcription in the Human Pathogen Neisseria gonorrhoeae

    PubMed Central

    Yu, Chunxiao

    2012-01-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  18. Endosymbiotic gene transfer and transcriptional regulation of transferred genes in Paulinella chromatophora.

    PubMed

    Nowack, Eva C M; Vogel, Heiko; Groth, Marco; Grossman, Arthur R; Melkonian, Michael; Glöckner, Gernot

    2011-01-01

    Paulinella chromatophora is a cercozoan amoeba that contains "chromatophores," which are photosynthetic inclusions of cyanobacterial origin. The recent discovery that chromatophores evolved independently of plastids, underwent major genome reduction, and transferred at least two genes to the host nucleus has highlighted P. chromatophora as a model to infer early steps in the evolution of photosynthetic organelles. However, owing to the paucity of nuclear genome sequence data, the extent of endosymbiotic gene transfer (EGT) and host symbiont regulation are currently unknown. A combination of 454 and Illumina next generation sequencing enabled us to generate a comprehensive reference transcriptome data set for P. chromatophora on which we mapped short Illumina cDNA reads generated from cultures from the dark and light phases of a diel cycle. Combined with extensive phylogenetic analyses of the deduced protein sequences, these data revealed that 1) about 0.3-0.8% of the nuclear genes were obtained by EGT compared with 11-14% in the Plantae, 2) transferred genes show a distinct bias in that many encode small proteins involved in photosynthesis and photoacclimation, 3) host cells established control over expression of transferred genes, and 4) not only EGT, but to a minor extent also horizontal gene transfer from organisms that presumably served as food sources, helped to shape the nuclear genome of P. chromatophora. The identification of a significant number of transferred genes involved in photosynthesis and photoacclimation of thylakoid membranes as well as the observed transcriptional regulation of these genes strongly implies import of the encoded gene products into chromatophores, a feature previously thought to be restricted to canonical organelles. Thus, a possible mechanism by which P. chromatophora exerts control over the performance of its newly acquired photosynthetic organelle may involve controlling the expression of nuclear-encoded chromatophore

  19. Retinoic acid receptors and GATA transcription factors activate the transcription of the human lecithin:retinol acyltransferase gene

    PubMed Central

    Cai, Kun; Gudas, Lorraine J.

    2008-01-01

    Lecithin retinol acyltransferase (LRAT) catalyzes the esterification of retinol (vitamin A). Retinyl esters and LRAT protein levels are reduced in many types of cancer cells. We present data that both the LRAT and retinoic acid receptor β2 (RARβ2) mRNA levels in the human prostate cancer cell line PC-3 are lower than those in cultured normal human prostate epithelial cells (PrEC). The activity of the human LRAT promoter (2.0 kb) driving a luciferase reporter gene in PC-3 cells is less than 40% of that in PrEC cells. Retinoic acid (RA) treatment increased this LRAT promoter-luciferase activity in PrEC cells, but not in PC-3 cells. Deletion of various regions of the human LRAT promoter demonstrated that a 172-bp proximal promoter region is essential for LRAT transcription and confers RA responsiveness in PrEC cells. This 172-bp region, contained within the 186 bp pLRAT/luciferase construct, has five putative GATA binding sites. Co-transfection of RARβ2 or RARγ and the transcription factor GATA-4 increased LRAT (pLRAT186) promoter activity in both PrEC and PC-3 cells. In addition, we found that both retinoic acid and retinol induced transcripts for the STRA6 gene, which encodes a membrane receptor involved in retinol (vitamin A) uptake, in PrEC cells but not in PC-3 cells. In summary, our data show that the transcriptional regulation of the human LRAT gene is aberrant in human prostate cancer cells and that GATA transcription factors are involved in the transcriptional activation of LRAT in PrEC cells. PMID:18652909

  20. Gravity changes during animal development affect IgM heavy-chain transcription and probably lymphopoiesis.

    PubMed

    Huin-Schohn, Cécile; Guéguinou, Nathan; Schenten, Véronique; Bascove, Matthieu; Koch, Guillemette Gauquelin; Baatout, Sarah; Tschirhart, Eric; Frippiat, Jean-Pol

    2013-01-01

    Our previous research demonstrated that spaceflight conditions affect antibody production in response to an antigenic stimulation in adult amphibians. Here, we investigated whether antibody synthesis is affected when animal development occurs onboard a space station. To answer this question, embryos of the Iberian ribbed newt, Pleurodeles waltl, were sent to the International Space Station (ISS) before the initiation of immunoglobulin heavy-chain expression. Thus, antibody synthesis began in space. On landing, we determined the effects of spaceflight on P. waltl development and IgM heavy-chain transcription. Results were compared with those obtained using embryos that developed on Earth. We find that IgM heavy-chain transcription is doubled at landing and that spaceflight does not affect P. waltl development and does not induce inflammation. We also recreated the environmental modifications encountered by the embryos during their development onboard the ISS. This strategy allowed us to demonstrate that gravity change is the factor responsible for antibody heavy-chain transcription modifications that are associated with NF-κB mRNA level variations. Taken together, and given that the larvae were not immunized, these data suggest a modification of lymphopoiesis when gravity changes occur during ontogeny.

  1. Effect of bud burst forcing on transcript expression of selected genes in needles of Norway spruce during autumn.

    PubMed

    Asante, Daniel K A; Yakovlev, Igor A; Fossdal, Carl Gunnar; Timmerhaus, Gerrit; Partanen, Jouni; Johnsen, Oystein

    2009-08-01

    Expression of selected genes in needles of Norway spruce (Picea abies [L.] Karst) was investigated by following their transcription levels during late autumn. Transcription was assessed in mature needles which likely serve as sensor of environmental cues that enable trees in the temperate and boreal regions to change between stages of growth, frost tolerance and bud dormancy. Samples were collected from grafts kept under outdoor conditions and after bud burst forcing in greenhouse at 20 degrees C (12 h darkness) for one week. Transcription was assayed with real-time RT-PCR. During the sampling period, chilling requirement was partially fulfilled, and time to bud burst after forcing was decreased. Of the 27 transcripts studied, expression of 16 was significantly affected either by forcing, sampling time, or interaction between them. PaSAP, PaACP, PaSGS3, PaWRKY, PaDIR9, PaCCCH and dehydrin genes responded drastically to forcing temperatures at all sampling points, showing no correlation with readiness for bud burst. Expression patterns of some vernalization pathway gene homologs PaVIN3, and also of PaMDC, PaLOV1 and PaDAL3 had a clear opposite trends between forcing and outdoor conditions, which could imply their role in chilling accumulation and bud burst regulation/cold acclimation. These genes could constitute putative candidates for further detailed study, whose regulation in needles may be involved in preparation towards bud burst and chilling accumulation sensing.

  2. Transcription variants of SLA-7, a swine non classical MHC class I gene.

    PubMed

    Hu, Rui; Lemonnier, Gaëtan; Bourneuf, Emmanuelle; Vincent-Naulleau, Silvia; Rogel-Gaillard, Claire

    2011-06-03

    In pig, very little information is available on the non classical class I (Ib) genes of the Major Histocompatibility Complex (MHC) i.e. SLA-6, -7 and -8. Our aim was to focus on the transcription pattern of the SLA-7 gene. RT-PCR experiments were carried out with SLA-7 specific primers targeting either the full coding sequence (CDS) from exon 1 to the 3 prime untranslated region (3UTR) or a partial CDS from exon 4 to the 3UTR. We show that the SLA-7 gene expresses a full length transcript not yet identified that refines annotation of the gene with eight exons instead of seven as initially described from the existing RefSeq RNA. These two RNAs encode molecules that differ in cytoplasmic tail length. In this study, another SLA-7 transcript variant was characterized, which encodes a protein with a shorter alpha 3 domain, as a consequence of a splicing site within exon 4. Surprisingly, a cryptic non canonical GA-AG splicing site is used to generate this transcript variant. An additional SLA-7 variant was also identified in the 3UTR with a splicing site occurring 31 nucleotides downstream to the stop codon. In conclusion, the pig SLA-7 MHC class Ib gene presents a complex transcription pattern with two transcripts encoding various molecules and transcripts that do not alter the CDS and may be subject to post-transcriptional regulation.

  3. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  4. Translation of Two Nested Genes in Bacteriophage P4 Controls Immunity-Specific Transcription Termination

    PubMed Central

    Forti, Francesca; Polo, Simona; Lane, Kirk B.; Six, Erich W.; Sironi, Gianpiero; Dehò, Gianni; Ghisotti, Daniela

    1999-01-01

    In phage P4, transcription of the left operon may occur from both the constitutive PLE promoter and the regulated PLL promoter, about 400 nucleotides upstream of PLE. A strong Rho-dependent termination site, timm, is located downstream of both promoters. When P4 immunity is expressed, transcription starting at PLE is efficiently terminated at timm, whereas transcription from PLL is immunity insensitive and reads through timm. We report the identification of two nested genes, kil and eta, located in the P4 left operon. The P4 kil gene, which encodes a 65-amino-acid polypeptide, is the first translated gene downstream of the PLE promoter, and its expression is controlled by P4 immunity. Overexpression of kil causes cell killing. This gene is the terminal part of a longer open reading frame, eta, which begins upstream of PLE. The eta gene is expressed when transcription starts from the PLL promoter. Three likely start codons predict a size between 197 and 199 amino acids for the Eta gene product. Both kil and eta overlap the timm site. By cloning kil upstream of a tRNA reporter gene, we demonstrated that translation of the kil region prevents premature transcription termination at timm. This suggests that P4 immunity might negatively control kil translation, thus enabling transcription termination at timm. Transcription starting from PLL proceeds through timm. Mutations that create nonsense codons in eta caused premature termination of transcription starting from PLL. Suppression of the nonsense mutation restored transcription readthrough at timm. Thus, termination of transcription from PLL is prevented by translation of eta. PMID:10464191

  5. SVD identifies transcript length distribution functions from DNA microarray data and reveals evolutionary forces globally affecting GBM metabolism.

    PubMed

    Bertagnolli, Nicolas M; Drake, Justin A; Tennessen, Jason M; Alter, Orly

    2013-01-01

    To search for evolutionary forces that might act upon transcript length, we use the singular value decomposition (SVD) to identify the length distribution functions of sets and subsets of human and yeast transcripts from profiles of mRNA abundance levels across gel electrophoresis migration distances that were previously measured by DNA microarrays. We show that the SVD identifies the transcript length distribution functions as "asymmetric generalized coherent states" from the DNA microarray data and with no a-priori assumptions. Comparing subsets of human and yeast transcripts of the same gene ontology annotations, we find that in both disparate eukaryotes, transcripts involved in protein synthesis or mitochondrial metabolism are significantly shorter than typical, and in particular, significantly shorter than those involved in glucose metabolism. Comparing the subsets of human transcripts that are overexpressed in glioblastoma multiforme (GBM) or normal brain tissue samples from The Cancer Genome Atlas, we find that GBM maintains normal brain overexpression of significantly short transcripts, enriched in transcripts that are involved in protein synthesis or mitochondrial metabolism, but suppresses normal overexpression of significantly longer transcripts, enriched in transcripts that are involved in glucose metabolism and brain activity. These global relations among transcript length, cellular metabolism and tumor development suggest a previously unrecognized physical mode for tumor and normal cells to differentially regulate metabolism in a transcript length-dependent manner. The identified distribution functions support a previous hypothesis from mathematical modeling of evolutionary forces that act upon transcript length in the manner of the restoring force of the harmonic oscillator.

  6. Excess iodide decreases transcription of NIS and VEGF genes in rat FRTL-5 thyroid cells

    PubMed Central

    Suzuki, Koichi; Kimura, Hiroaki; Wu, Huhehasi; Kudo, Naoko; Kim, Won Bae; Suzuki, Sayuri; Yoshida, Akio; Caturegli, Patrizio; Kohn, Leonard D.

    2010-01-01

    Although it is well known that an excess of iodide suppresses thyroid function and blood flow in vivo, the underlying molecular mechanisms are not fully known. The functional effect of iodide occurs at multiple steps, which include inhibition of sodium/iodide symporter (NIS) expression, transient block of organification, and inhibition of hormonal release. The vascular effect likely involves suppression of the vascular endothelial growth factor (VEGF) gene. In this report, we show that excess iodide coordinately suppresses the expression of the NIS and VEGF genes in FRTL-5 thyroid cells. We also demonstrate that the mechanism of iodide suppression of NIS gene expression is transcriptional, which is synergized by the addition of thyroglobulin. Based on the findings of reporter gene assays and electrophoretic gel mobility shift analysis, we also report two novel DNA binding proteins that responded specifically to iodide and modulated NIS promoter activity. The results suggest that excess iodide affects thyroid vascular function in addition to iodide uptake. This study provides additional insights into the mechanism of action of excess iodide on thyroid function. PMID:20132794

  7. RNAi-directed post transcriptional gene silencing of an Arabidopsis Myb transgene in tobacco

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The AtMyb90 gene encodes the 'production of anthocyanin pigment 2' (PAP2) transcription factor of Arabidopsis thaliana and is able to induce a visible hyper-pigmented phenotype when expressed in tobacco. Based upon this phenotype, we have used the AtMyb90 gene as a reporter gene to examine RNAi-dire...

  8. Evidence That the Transcriptional Regulators Sin3 and Rpd3, and a Novel Gene (Sds3) with Similar Functions, Are Involved in Transcriptional Silencing in S. Cerevisiae

    PubMed Central

    Vannier, D.; Balderes, D.; Shore, D.

    1996-01-01

    In a screen for extragenic suppressors of a silencing defective rap1(s) hmrΔA strain, recessive mutations in 21 different genes were found that restored repression to HMR. We describe the characterization of three of these SDS (suppressors of defective silencing) genes. SDS16 and SDS6 are known transcriptional modifiers, SIN3(RPD1/UME4/SDI1/GAM2) and RPD3(SDI2), respectively, while the third is a novel gene, SDS3. SDS3 shares the meiotic functions of SIN3 and RPD3 in that it represses IME2 in haploid cells and is necessary for sporulation in diploid cells. However, sds3 mutations differ from sin3 and rpd3 mutations in that they do not derepress TRK2. These sds mutations suppress a variety of cis- and trans-defects, which impair the establishment of silencing at HMR. Any one of the sds mutations slightly increases telomere position effect while a striking synergistic increase in repression is observed in a rap1(s) background. Epistasis studies suggest that SDS3 works in a different pathway from RPD3 and SIN3 to affect silencing at HMR. Together these results show that defects in certain general transcriptional modifiers can have a pronounced influence on position-effect gene silencing in yeast. Mechanisms for this increase in postion effect are discussed. PMID:8978024

  9. Identification of a Novel Reference Gene for Apple Transcriptional Profiling under Postharvest Conditions

    PubMed Central

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference—ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)—along with two novel candidates—HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest. PMID:25774904

  10. Identification of a novel reference gene for apple transcriptional profiling under postharvest conditions.

    PubMed

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference--ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)--along with two novel candidates--HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest.

  11. Prostaglandin synthesis genes are differentially transcripted in normal and pyometra endometria of bitches.

    PubMed

    Silva, E; Leitão, S; Ferreira-Dias, G; Lopes da Costa, L; Mateus, L

    2009-07-01

    Pro-inflammatory stimuli, such as endotoxins released by Gram-negative bacteria, are potent stimulators of prostaglandin (PG) synthesis. The aim of this study was to evaluate the gene transcription pattern of PG synthesis enzymes in normal (anestrous, n = 6 and diestrous, n = 8) and pyometra (n = 7) endometria of bitches. Uteri were collected during routine ovariohysterectomy, processed for histopathological evaluation and uterine contents cultured. Gene transcription of COX-1, COX-2, mPGES-1 and PGF-synthase (PGFS) were evaluated by relative real-time PCR and normalized with the ribosomal protein L27 (RPL27) housekeeping gene. Normal uteri had no histological abnormalities and were negative for bacteriology. All pyometra uteri were hyperplasic and Escherichia coli was the only isolated bacterium. Except for COX-1, gene transcription was significantly higher in pyometra than in normal endometria. No significant differences in gene transcription were observed between normal diestrous and anestrous endometria. COX-2 gene transcription was 19 and 69 times higher in pyometra than in diestrous and anestrous endometria (p < 0.001), while PGFS gene transcription had a 3- and 600-fold increase in pyometra endometria compared to normal diestrous and anestrous endometria (p < 0.001). Gene transcription of mPGES-1 was 9 times higher in pyometra than in normal uteri (p < 0.01). Based on these results, we suggest that pyometra-associated E. coli endotoxin release stimulates the up-regulation of COX-2 PGFS and mPGES-1 gene transcription in the endometrium. PMID:19754568

  12. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.

    1995-01-01

    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  13. Involvement of the leucine response transcription factor LeuO in regulation of the genes for sulfa drug efflux.

    PubMed

    Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2009-07-01

    LeuO, a LysR family transcription factor, exists in a wide variety of bacteria of the family Enterobacteriaceae and is involved in the regulation of as yet unidentified genes affecting the stress response and pathogenesis expression. Using genomic screening by systematic evolution of ligands by exponential enrichment (SELEX) in vitro, a total of 106 DNA sequences were isolated from 12 different regions of the Escherichia coli genome. All of the SELEX fragments formed complexes in vitro with purified LeuO. After Northern blot analysis of the putative target genes located downstream of the respective LeuO-binding sequence, a total of nine genes were found to be activated by LeuO, while three genes were repressed by LeuO. The LeuO target gene collection included several multidrug resistance genes. A phenotype microarray assay was conducted to identify the gene(s) responsible for drug resistance and the drug species that are under the control of the LeuO target gene(s). The results described herein indicate that the yjcRQP operon, one of the LeuO targets, is involved in sensitivity control against sulfa drugs. We propose to rename the yjcRQP genes the sdsRQP genes (sulfa drug sensitivity determinant).

  14. Identifying Stress Transcription Factors Using Gene Expression and TF-Gene Association Data.

    PubMed

    Wu, Wei-Sheng; Chen, Bor-Sen

    2009-11-24

    Unicellular organisms such as yeasts have evolved to survive environmental stresses by rapidly reorganizing the genomic expression program to meet the challenges of harsh environments. The complex adaptation mechanisms to stress remain to be elucidated. In this study, we developed Stress Transcription Factor Identification Algorithm (STFIA), which integrates gene expression and TF-gene association data to identify the stress transcription factors (TFs) of six kinds of stresses. We identified some general stress TFs that are in response to various stresses, and some specific stress TFs that are in response to one specific stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs may be sufficient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the adaptation mechanisms to different stresses may have a bow-tie structure. Second, there may exist extensive regulatory cross-talk among different stress responses. In conclusion, this study proposes a network of the regulators of stress responses and their mechanism of action.

  15. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    PubMed

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

  16. Post-transcriptional regulation of ribosomal protein genes during serum starvation in Entamoeba histolytica.

    PubMed

    Ahamad, Jamaluddin; Ojha, Sandeep; Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha

    2015-06-01

    Ribosome synthesis involves all three RNA polymerases which are co-ordinately regulated to produce equimolar amounts of rRNAs and ribosomal proteins (RPs). Unlike model organisms where transcription of rRNA and RP genes slows down during stress, in E. histolytica rDNA transcription continues but pre-rRNA processing slows down and unprocessed pre-rRNA accumulates during serum starvation. To investigate the regulation of RP genes under stress we measured transcription of six selected RP genes from the small- and large-ribosomal subunits (RPS6, RPS3, RPS19, RPL5, RPL26, RPL30) representing the early-, mid-, and late-stages of ribosomal assembly. Transcripts of these genes persisted in growth-stressed cells. Expression of luciferase reporter under the control of two RP genes (RPS19 and RPL30) was studied during serum starvation and upon serum replenishment. Although luciferase transcript levels remained unchanged during starvation, luciferase activity steadily declined to 7.8% and 15% of control cells, respectively. After serum replenishment the activity increased to normal levels, suggesting post-transcriptional regulation of these genes. Mutations in the sequence -2 to -9 upstream of AUG in the RPL30 gene resulted in the phenotype expected of post-transcriptional regulation. Transcription of luciferase reporter was unaffected in this mutant, and luciferase activity did not decline during serum starvation, showing that this sequence is required to repress translation of RPL30 mRNA, and mutations in this region relieve repression. Our data show that during serum starvation E. histolytica blocks ribosome biogenesis post-transcriptionally by inhibiting pre-rRNA processing on the one hand, and the translation of RP mRNAs on the other.

  17. Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

    PubMed

    Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

    2016-06-01

    Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery.

  18. VITELLOGENIN GENE TRANSCRIPTION AS AN INDICATOR OF EXPOSURE TO 17-ALPHA-ETHYNYLESTRADIOL IN FATHEAD MINNOWS

    EPA Science Inventory

    Environmentally persistent chemicals that functionally mimic estrogen are ubiquitous in surface waters and have been shown to effect reproductive health of species living in these habitats. Toxicant induced transcription of specific genes is a sensitive indicator of exposure and ...

  19. Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

    PubMed

    Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

    2016-06-01

    Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. PMID:27181059

  20. Increased Transcript Complexity in Genes Associated with Chronic Obstructive Pulmonary Disease.

    PubMed

    Lackey, Lela; McArthur, Evonne; Laederach, Alain

    2015-01-01

    Genome-wide association studies aim to correlate genotype with phenotype. Many common diseases including Type II diabetes, Alzheimer's, Parkinson's and Chronic Obstructive Pulmonary Disease (COPD) are complex genetic traits with hundreds of different loci that are associated with varied disease risk. Identifying common features in the genes associated with each disease remains a challenge. Furthermore, the role of post-transcriptional regulation, and in particular alternative splicing, is still poorly understood in most multigenic diseases. We therefore compiled comprehensive lists of genes associated with Type II diabetes, Alzheimer's, Parkinson's and COPD in an attempt to identify common features of their corresponding mRNA transcripts within each gene set. The SERPINA1 gene is a well-recognized genetic risk factor of COPD and it produces 11 transcript variants, which is exceptional for a human gene. This led us to hypothesize that other genes associated with COPD, and complex disorders in general, are highly transcriptionally diverse. We found that COPD-associated genes have a statistically significant enrichment in transcript complexity stemming from a disproportionately high level of alternative splicing, however, Type II Diabetes, Alzheimer's and Parkinson's disease genes were not significantly enriched. We also identified a subset of transcriptionally complex COPD-associated genes (~40%) that are differentially expressed between mild, moderate and severe COPD. Although the genes associated with other lung diseases are not extensively documented, we found preliminary data that idiopathic pulmonary disease genes, but not cystic fibrosis modulators, are also more transcriptionally complex. Interestingly, complex COPD transcripts are more often the product of alternative acceptor site usage. To verify the biological importance of these alternative transcripts, we used RNA-sequencing analyses to determine that COPD-associated genes are frequently expressed in

  1. The Transcriptional Response in Human Umbilical Vein Endothelial Cells Exposed to Insulin: A Dynamic Gene Expression Approach

    PubMed Central

    Di Camillo, Barbara; Sanavia, Tiziana; Iori, Elisabetta; Bronte, Vincenzo; Roncaglia, Enrica; Maran, Alberto; Avogaro, Angelo; Toffolo, Gianna; Cobelli, Claudio

    2010-01-01

    Background In diabetes chronic hyperinsulinemia contributes to the instability of the atherosclerotic plaque and stimulates cellular proliferation through the activation of the MAP kinases, which in turn regulate cellular proliferation. However, it is not known whether insulin itself could increase the transcription of specific genes for cellular proliferation in the endothelium. Hence, the characterization of transcriptional modifications in endothelium is an important step for a better understanding of the mechanism of insulin action and the relationship between endothelial cell dysfunction and insulin resistance. Methodology and principal findings The transcriptional response of endothelial cells in the 440 minutes following insulin stimulation was monitored using microarrays and compared to a control condition. About 1700 genes were selected as differentially expressed based on their treated minus control profile, thus allowing the detection of even small but systematic changes in gene expression. Genes were clustered in 7 groups according to their time expression profile and classified into 15 functional categories that can support the biological effects of insulin, based on Gene Ontology enrichment analysis. In terms of endothelial function, the most prominent processes affected were NADH dehydrogenase activity, N-terminal myristoylation domain binding, nitric-oxide synthase regulator activity and growth factor binding. Pathway-based enrichment analysis revealed “Electron Transport Chain” significantly enriched. Results were validated on genes belonging to “Electron Transport Chain” pathway, using quantitative RT-PCR. Conclusions As far as we know, this is the first systematic study in the literature monitoring transcriptional response to insulin in endothelial cells, in a time series microarray experiment. Since chronic hyperinsulinemia contributes to the instability of the atherosclerotic plaque and stimulates cellular proliferation, some of the

  2. MYT3, A Myb-Like Transcription Factor, Affects Fungal Development and Pathogenicity of Fusarium graminearum

    PubMed Central

    Son, Hokyoung; Choi, Gyung Ja; Kim, Jin-Cheol; Lee, Yin-Won

    2014-01-01

    We previously characterized members of the Myb protein family, MYT1 and MYT2, in Fusarium graminearum. MYT1 and MYT2 are involved in female fertility and perithecium size, respectively. To expand knowledge of Myb proteins in F. graminearum, in this study, we characterized the functions of the MYT3 gene, which encodes a putative Myb-like transcription factor containing two Myb DNA-binding domains and is conserved in the subphylum Pezizomycotina of Ascomycota. MYT3 proteins were localized in nuclei during most developmental stages, suggesting the role of MYT3 as a transcriptional regulator. Deletion of MYT3 resulted in impairment of conidiation, germination, and vegetative growth compared to the wild type, whereas complementation of MYT3 restored the wild-type phenotype. Additionally, the Δmyt3 strain grew poorly on nitrogen-limited media; however, the mutant grew robustly on minimal media supplemented with ammonium. Moreover, expression level of nitrate reductase gene in the Δmyt3 strain was decreased in comparison to the wild type and complemented strain. On flowering wheat heads, the Δmyt3 strain exhibited reduced pathogenicity, which corresponded with significant reductions in trichothecene production and transcript levels of trichothecene biosynthetic genes. When the mutant was selfed, mated as a female, or mated as a male for sexual development, perithecia were not observed on the cultures, indicating that the Δmyt3 strain lost both male and female fertility. Taken together, these results demonstrate that MYT3 is required for pathogenesis and sexual development in F. graminearum, and will provide a robust foundation to establish the regulatory networks for all Myb-like proteins in F. graminearum. PMID:24722578

  3. The Transcription Factor Ultraspiracle Influences Honey Bee Social Behavior and Behavior-Related Gene Expression

    PubMed Central

    Chen, Chieh-Chun; Blatti, Charles A.; Hong, Feng; Liang, Zhengzheng S.; Negre, Nicolas; White, Kevin P.; Rodriguez-Zas, Sandra L.; Mizzen, Craig A.; Sinha, Saurabh; Zhong, Sheng; Robinson, Gene E.

    2012-01-01

    Behavior is among the most dynamic animal phenotypes, modulated by a variety of internal and external stimuli. Behavioral differences are associated with large-scale changes in gene expression, but little is known about how these changes are regulated. Here we show how a transcription factor (TF), ultraspiracle (usp; the insect homolog of the Retinoid X Receptor), working in complex transcriptional networks, can regulate behavioral plasticity and associated changes in gene expression. We first show that RNAi knockdown of USP in honey bee abdominal fat bodies delayed the transition from working in the hive (primarily “nursing” brood) to foraging outside. We then demonstrate through transcriptomics experiments that USP induced many maturation-related transcriptional changes in the fat bodies by mediating transcriptional responses to juvenile hormone. These maturation-related transcriptional responses to USP occurred without changes in USP's genomic binding sites, as revealed by ChIP–chip. Instead, behaviorally related gene expression is likely determined by combinatorial interactions between USP and other TFs whose cis-regulatory motifs were enriched at USP's binding sites. Many modules of JH– and maturation-related genes were co-regulated in both the fat body and brain, predicting that usp and cofactors influence shared transcriptional networks in both of these maturation-related tissues. Our findings demonstrate how “single gene effects” on behavioral plasticity can involve complex transcriptional networks, in both brain and peripheral tissues. PMID:22479195

  4. Diurnal Transcriptional Regulation of Endosymbiotically Derived Genes in the Chlorarachniophyte Bigelowiella natans.

    PubMed

    Suzuki, Shigekatsu; Ishida, Ken-Ichiro; Hirakawa, Yoshihisa

    2016-01-01

    Chlorarachniophyte algae possess complex plastids acquired by the secondary endosymbiosis of a green alga, and the plastids harbor a relict nucleus of the endosymbiont, the so-called nucleomorph. Due to massive gene transfer from the endosymbiont to the host, many proteins involved in plastid and nucleomorph are encoded by the nuclear genome. Genome sequences have provided a blueprint for the fate of endosymbiotically derived genes; however, transcriptional regulation of these genes remains poorly understood. To gain insight into the evolution of endosymbiotic genes, we performed genome-wide transcript profiling along the cell cycle of the chlorarachniophyte Bigelowiella natans, synchronized by light and dark cycles. Our comparative analyses demonstrated that transcript levels of 7,751 nuclear genes (35.7% of 21,706 genes) significantly oscillated along the diurnal/cell cycles, and those included 780 and 147 genes for putative plastid and nucleomorph-targeted proteins, respectively. Clustering analysis of those genes revealed the existence of transcriptional networks related to specific biological processes such as photosynthesis, carbon metabolism, translation, and DNA replication. Interestingly, transcripts of many plastid-targeted proteins in B. natans were induced before dawn, unlike other photosynthetic organisms. In contrast to nuclear genes, 99% nucleomorph genes were found to be constitutively expressed during the cycles. We also found that the nucleomorph DNA replication would be controlled by a nucleus-encoded viral-like DNA polymerase. The results of this study suggest that nucleomorph genes have lost transcriptional regulation along the diurnal cycles, and nuclear genes exert control over the complex plastid including the nucleomorph. PMID:27503292

  5. Network analysis of microRNAs, transcription factors, target genes and host genes in nasopharyngeal carcinoma

    PubMed Central

    WANG, HAO; XU, ZHIWEN; MA, MENGYAO; WANG, NING; WANG, KUNHAO

    2016-01-01

    Numerous studies on the morbidity of nasopharyngeal carcinoma (NPC) have identified several genes, microRNAs (miRNAs or miRs) and transcription factors (TFs) that influence the pathogenesis of NPC. However, summarizing all the regulatory networks involved in NPC is challenging. In the present study, the genes, miRNAs and TFs involved in NPC were considered as the nodes of the so-called regulatory network, and the associations between them were investigated. To clearly represent these associations, three regulatory networks were built seperately, namely, the differentially expressed network, the associated network and the global network. The differentially expressed network is the most important one of these three networks, since its nodes are differentially expressed genes whose mutations may lead to the development of NPC. Therefore, by modifying the aberrant expression of those genes that are differentially expressed in this network, their dysregulation may be corrected and the tumorigenesis of NPC may thus be prevented. Analysis of the aforementioned three networks highlighted the importance of certain pathways, such as self-adaptation pathways, in the development of NPC. For example, cyclin D1 (CCND1) was observed to regulate Homo sapiens-miR-20a, which in turn targeted CCND1. The present study conducted a systematic analysis of the pathogenesis of NPC through the three aforementioned regulatory networks, and provided a theoretical model for biologists. Future studies are required to evaluate the influence of the highlighted pathways in NPC. PMID:27313701

  6. A Synthetic Transcriptional Activator of Genes Associated with the Retina in Human Dermal Fibroblasts.

    PubMed

    Syed, Junetha; Chandran, Anandhakumar; Pandian, Ganesh N; Taniguchi, Junichi; Sato, Shinsuke; Hashiya, Kaori; Kashiwazaki, Gengo; Bando, Toshikazu; Sugiyama, Hiroshi

    2015-07-01

    Small molecules capable of modulating epigenetic signatures can activate the transcription of tissue-restricted genes in a totally unrelated cell type and have potential use in epigenetic therapy. To provide an example for an initial approach, we report here on one synthetic small-molecule compound-termed "SAHA-PIP X"-from our library of conjugates. This compound triggered histone acetylation accompanied by the transcription of retinal-tissue-related genes in human dermal fibroblasts (HDFs).

  7. Transcription termination between polo and snap, two closely spaced tandem genes of D. melanogaster.

    PubMed

    Henriques, Telmo; Ji, Zhe; Tan-Wong, Sue Mei; Carmo, Alexandre M; Tian, Bin; Proudfoot, Nicholas J; Moreira, Alexandra

    2012-01-01

    Transcription termination of RNA polymerase II between closely spaced genes is an important, though poorly understood, mechanism. This is true, in particular, in the Drosophila genome, where approximately 52% of tandem genes are separated by less than 1 kb. We show that a set of Drosophila tandem genes has a negative correlation of gene expression and display several molecular marks indicative of promoter pausing. We find that an intergenic spacing of 168 bp is sufficient for efficient transcription termination between the polo-snap tandem gene pair, by a mechanism that is independent of Pcf11 and Xrn2. In contrast, analysis of a tandem gene pair containing a longer intergenic region reveals that termination occurs farther downstream of the poly(A) signal and is, in this case, dependent on Pcf11 and Xrn2. For polo-snap, displacement of poised polymerase from the snap promoter by depletion of the initiation factor TFIIB results in an increase of polo transcriptional read-through. This suggests that poised polymerase is necessary for transcription termination. Interestingly, we observe that polo forms a TFIIB dependent gene loop between its promoter and terminator regions. Furthermore, in a plasmid containing the polo-snap locus, deletion of the polo promoter causes an increase in snap expression, as does deletion of polo poly(A) signals. Taken together, our results indicate that polo forms a gene loop and polo transcription termination occurs by an Xrn2 and Pcf11 independent mechanism that requires TFIIB.

  8. Clustered Transcription Factor Genes Regulate Nicotine Biosynthesis in Tobacco[W][OA

    PubMed Central

    Shoji, Tsubasa; Kajikawa, Masataka; Hashimoto, Takashi

    2010-01-01

    Tobacco (Nicotiana tabacum) synthesizes nicotine and related pyridine alkaloids in the root, and their synthesis increases upon herbivory on the leaf via a jasmonate-mediated signaling cascade. Regulatory NIC loci that positively regulate nicotine biosynthesis have been genetically identified, and their mutant alleles have been used to breed low-nicotine tobacco varieties. Here, we report that the NIC2 locus, originally called locus B, comprises clustered transcription factor genes of an ethylene response factor (ERF) subfamily; in the nic2 mutant, at least seven ERF genes are deleted altogether. Overexpression, suppression, and dominant repression experiments using transgenic tobacco roots showed both functional redundancy and divergence among the NIC2-locus ERF genes. These transcription factors recognized a GCC-box element in the promoter of a nicotine pathway gene and specifically activated all known structural genes in the pathway. The NIC2-locus ERF genes are expressed in the root and upregulated by jasmonate with kinetics that are distinct among the members. Thus, gene duplication events generated a cluster of highly homologous transcription factor genes with transcriptional and functional diversity. The NIC2-locus ERFs are close homologs of ORCA3, a jasmonate-responsive transcriptional activator of indole alkaloid biosynthesis in Catharanthus roseus, indicating that the NIC2/ORCA3 ERF subfamily was recruited independently to regulate jasmonate-inducible secondary metabolism in distinct plant lineages. PMID:20959558

  9. Transcription factor NF-Y is a functional regulator of the transcription of core clock gene Bmal1.

    PubMed

    Xiao, Jun; Zhou, Yongchun; Lai, Hao; Lei, Shi; Chi, Lisa H; Mo, Xianwei

    2013-11-01

    The circadian clock enables organisms to adjust to daily environmental changes and synchronize multiple molecular, biochemical, physiological, and behavioral processes accordingly. In mammalian clock work, Bmal1 is the most important core clock gene, which works with another core clock gene Clock to drive the expression of other clock genes and clock-controlled genes. However, the regulation of Bmal1 has not been fully understood. This work was aimed at identifying the positive regulator(s) of Bmal1 transcription. A series of 5' deletion reporter constructs was generated, and binding site mutations of mouse Bmal1 promoter fragments were cloned into pGL3-basic and pGL3(R2.1)-basic plasmids and transfected into NIH 3T3 cells. Luciferase activity was either measured 48 h after transfection or recorded for 4 days after serum shock. DNA affinity precipitation assay was used to detect the transcription factors binding to Bmal1 promoter. Small interfering RNA against nuclear factor Y, subunit A (NF-YA) and dominant negative NF-YA were employed to study the role of NF-Y in Bmal1 transcription regulation. Deletion and mutation analyses identified two clusters of CCAAT/GC-boxes at the proximal region of Bmal1 promoter as the activating cis-elements. Bmal1 promoter activity was up-regulated by NF-Y and/or Sp1 and repressed by dominant negative NF-YA or siRNA against NF-YA. The activation of Bmal1 promoter activity by NF-Y and Sp1 was inhibited by Rev-Erbα. DNA affinity precipitation assay showed that NF-Y and Sp1 bound to the two CCAAT/GC clusters of Bmal1 promoter. These results indicate that NF-Y is a functional activator of Bmal1 transcription and it cooperates with Sp1 and Rev-Erbα to generate the daily cycle of Bmal1 expression.

  10. Phage vectors that allow monitoring of transcription of secondary metabolism genes in Streptomyces.

    PubMed

    Bruton, C J; Guthrie, E P; Chater, K F

    1991-07-01

    We describe a bacteriophage phi C31-based system that permits the transcriptional fusion of the convenient reporter gene xylE to chromosomally located promoters in Streptomyces hosts. Applicability of the system to genes for secondary metabolism is demonstrated in an experiment showing that transcription of genes for actinorhodin production in Streptomyces coelicolor A3(2) depends on a transfer RNA gene (bldA) for the rare UUA codon. Two other phi C31::xylE vectors are described that allow detection of promoter activity away from their natural location, either at single copy in a prophage or during lytic infections in plaques.

  11. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    SciTech Connect

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  12. Genome-wide identification and characterization of reference genes with different transcript abundances for Streptomyces coelicolor

    PubMed Central

    Li, Shanshan; Wang, Weishan; Li, Xiao; Fan, Keqiang; Yang, Keqian

    2015-01-01

    The lack of reliable reference genes (RGs) in the genus Streptomyces hampers effort to obtain the precise data of transcript levels. To address this issue, we aimed to identify reliable RGs in the model organism Streptomyces coelicolor. A pool of potential RGs containing 1,471 genes was first identified by determining the intersection of genes with stable transcript levels from four time-series transcriptome microarray datasets of S. coelicolor M145 cultivated in different conditions. Then, following a strict rational selection scheme including homology analysis, disturbance analysis, function analysis and transcript abundance analysis, 13 candidates were selected from the 1,471 genes. Based on real-time quantitative reverse transcription PCR assays, SCO0710, SCO6185, SCO1544, SCO3183 and SCO4758 were identified as the top five genes with the most stable transcript levels among the 13 candidates. Further analyses showed these five genes also maintained stable transcript levels in different S. coelicolor strains, as well as in Streptomyces avermitilis MA-4680 and Streptomyces clavuligerus NRRL 3585, suggesting they could fulfill the requirements of accurate data normalization in streptomycetes. Moreover, the systematic strategy employed in this work could be used for reference in other microorganism to select reliable RGs. PMID:26527303

  13. Changes in gravity affect gene expression, protein modulation and metabolite pools of arabidopsis

    NASA Astrophysics Data System (ADS)

    Hampp, R.; Martzivanou, M.; Maier, R. M.; Magel, E.

    Callus cultures of Arabidopsis thaliana (cv. Columbia) in Petri dishes / suspension cultures were exposed to altered g-forces by centrifugation (1 to 10 g), klinorotation, and μ g (sounding rocket flights). Using semi-quantitative RT-PCR, transcripts of genes coding for metabolic key enzymes (ADP-glucose pyrophosphorylase, ADPG-PP; ß-amylase, fructose-1,6-bisphosphatase, FBPase; glyceraldehyde-P dehydrogenase, GAPDH; hydroxymethylglutaryl-CoA reductase, HMG; phenylalanine-ammonium-lyase, PAL; PEP carboxylase, PEPC) were used to monitor threshold conditions for g-number (all) and time of exposure (ß-amylase) which led to altered amounts of the gene product. Exposure to approx. 5 g and higher for 1h resulted in altered transcript levels: transcripts of ß-amylase, PAL, and PEPC were increased, those of ADPG-PP decreased, while those of FBPase, GAPDH, and HMG were not affected. This probably indicates a shift from starch synthesis to starch degradation and increased rates of anaplerosis (PEPC: supply of ketoacids for amino acid synthesis). In order to get more information about g-related effects on gene expression, we used a 1h-exposure to 7 g for a microarray analysis. Transcripts of more than 200 genes were significantly increased in amount (ratio 7g / 1g control; 21.6 and larger). They fall into several categories. Transcripts coding for enzymes of major pathways form the largest group (25%), followed by gene products involved in cellular organisation and cell wall formation / rearrangement (17%), signalling, phosphorylation/dephosphorylation (12%), proteolysis and transport (10% each), hormone synthesis plus related events (8%), defense (4%), stress-response (2%), and gravisensing (2%). Many of the alterations are part of a general stress response, but some changes related to the synthesis / rearrangement of cell wall components could be more hyper-g-specific. Using macroarrays with selected genes according to our hypergravity study (metabolism / signalling

  14. Dietary n-3 PUFA affect lipid metabolism and tissue function-related genes in bovine muscle.

    PubMed

    Hiller, Beate; Hocquette, Jean-Francois; Cassar-Malek, Isabelle; Nuernberg, Gerd; Nuernberg, Karin

    2012-09-01

    Gene expression profiles of bovine longissimus muscle as affected by dietary n-3 v. n-6 fatty acid (FA) intervention were analysed by microarray pre-screening of >3000 muscle biology/meat quality-related genes as well as subsequent quantitative RT-PCR gene expression validation of genes encoding lipogenesis-related transcription factors (CCAAT/enhancer-binding protein β, sterol regulatory element-binding transcription factor 1), key-lipogenic enzymes (acetyl-CoA carboxylase α (ACACA), fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD)), lipid storage-associated proteins (adipose differentiation-related protein (ADFP)) and muscle biology-related proteins (cholinergic receptor, nicotinic, α1, farnesyl diphosphate farnesyl transferase 1, sema domain 3C (SEMA3C)). Down-regulation of ACACA (P = 0·00), FASN (P = 0·09) and SCD (P = 0·02) gene expression upon an n-3 FA intervention directly corresponded to reduced SFA, MUFA and total FA concentrations in longissimus muscle, whereas changes in ADFP (P = 0·00) and SEMA3C (P = 0·05) gene expression indicated improved muscle function via enhanced energy metabolism, vasculogenesis, innervation and mediator synthesis. The present study highlights the significance of dietary n-3 FA intervention on muscle development, maintenance and function, which are relevant for meat quality tailoring of bovine tissues and modulating animal production-relevant physiological processes.

  15. Dysregulation of the homeobox transcription factor gene HOXB13: role in prostate cancer

    PubMed Central

    Decker, Brennan; Ostrander, Elaine A

    2014-01-01

    Prostate cancer (PC) is the most common noncutaneous cancer in men, and epidemiological studies suggest that about 40% of PC risk is heritable. Linkage analyses in hereditary PC families have identified multiple putative loci. However, until recently, identification of specific risk alleles has proven elusive. Cooney et al used linkage mapping and segregation analysis to identify a putative risk locus on chromosome 17q21-22. In search of causative variant(s) in genes from the candidate region, a novel, potentially deleterious G84E substitution in homeobox transcription factor gene HOXB13 was observed in multiple hereditary PC families. In follow-up testing, the G84E allele was enriched in cases, especially those with an early diagnosis or positive family history of disease. This finding was replicated by others, confirming HOXB13 as a PC risk gene. The HOXB13 protein plays diverse biological roles in embryonic development and terminally differentiated tissue. In tumor cell lines, HOXB13 participates in a number of biological functions, including coactivation and localization of the androgen receptor and FOXA1. However, no consensus role has emerged and many questions remain. All HOXB13 variants with a proposed role in PC risk are predicted to damage the protein and lie in domains that are highly conserved across species. The G84E variant has the strongest epidemiological support and lies in a highly conserved MEIS protein-binding domain, which binds cofactors required for activation. On the basis of epidemiological and biological data, the G84E variant likely modulates the interaction between the HOXB13 protein and the androgen receptor, as well as affecting FOXA1-mediated transcriptional programming. However, further studies of the mutated protein are required to clarify the mechanisms by which this translates into PC risk. PMID:25206306

  16. Dysregulation of the homeobox transcription factor gene HOXB13: role in prostate cancer.

    PubMed

    Decker, Brennan; Ostrander, Elaine A

    2014-01-01

    Prostate cancer (PC) is the most common noncutaneous cancer in men, and epidemiological studies suggest that about 40% of PC risk is heritable. Linkage analyses in hereditary PC families have identified multiple putative loci. However, until recently, identification of specific risk alleles has proven elusive. Cooney et al used linkage mapping and segregation analysis to identify a putative risk locus on chromosome 17q21-22. In search of causative variant(s) in genes from the candidate region, a novel, potentially deleterious G84E substitution in homeobox transcription factor gene HOXB13 was observed in multiple hereditary PC families. In follow-up testing, the G84E allele was enriched in cases, especially those with an early diagnosis or positive family history of disease. This finding was replicated by others, confirming HOXB13 as a PC risk gene. The HOXB13 protein plays diverse biological roles in embryonic development and terminally differentiated tissue. In tumor cell lines, HOXB13 participates in a number of biological functions, including coactivation and localization of the androgen receptor and FOXA1. However, no consensus role has emerged and many questions remain. All HOXB13 variants with a proposed role in PC risk are predicted to damage the protein and lie in domains that are highly conserved across species. The G84E variant has the strongest epidemiological support and lies in a highly conserved MEIS protein-binding domain, which binds cofactors required for activation. On the basis of epidemiological and biological data, the G84E variant likely modulates the interaction between the HOXB13 protein and the androgen receptor, as well as affecting FOXA1-mediated transcriptional programming. However, further studies of the mutated protein are required to clarify the mechanisms by which this translates into PC risk.

  17. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR.

    PubMed

    Castanera, Raúl; López-Varas, Leticia; Pisabarro, Antonio G; Ramírez, Lucía

    2015-06-15

    Recently, the lignin-degrading basidiomycete Pleurotus ostreatus has become a widely used model organism for fungal genomic and transcriptomic analyses. The increasing interest in this species has led to an increasing number of studies analyzing the transcriptional regulation of multigene families that encode extracellular enzymes. Reverse transcription (RT) followed by real-time PCR is the most suitable technique for analyzing the expression of gene sets under multiple culture conditions. In this work, we tested the suitability of 13 candidate genes for their use as reference genes in P. ostreatus time course cultures for enzyme production. We applied three different statistical algorithms and obtained a combination of stable reference genes for optimal normalization of RT-quantitative PCR assays. This reference index can be used for future transcriptomic analyses and validation of transcriptome sequencing or microarray data. Moreover, we analyzed the expression patterns of a laccase and a manganese peroxidase (lacc10 and mnp3, respectively) in lignocellulose and glucose-based media using submerged, semisolid, and solid-state fermentation. By testing different normalization strategies, we demonstrate that the use of nonvalidated reference genes as internal controls leads to biased results and misinterpretations of the biological responses underlying expression changes. PMID:25862220

  18. Transcription factor C/EBPβ promotes the transcription of the porcine GPR120 gene.

    PubMed

    Chen, Kun; Zhou, Ji-Dan; Zhang, Feng; Zhang, Fang; Zhang, Rui-Rui; Zhan, Meng-Si; Tang, Xiao-Yin; Deng, Bing; Lei, Ming-Gang; Xiong, Yuan-Zhu

    2016-02-01

    G protein-coupled receptor 120 (GPR120), an adipogenic receptor critical for the differentiation and maturation of adipocytes, plays an important role in controlling obesity in both humans and rodents and, thus, is an attractive target of obesity treatment studies. However, the mechanisms that regulate the expression of porcine GPR120 remain unclear. In this study, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) techniques were used to analyze and identify the binding of C/EBPβ (transcription factor CCAAT/enhancer binding protein beta) to the GPR120 promoter. C/EBPβ overexpression and RNA interference studies showed that C/EBPβ regulated GPR120 promoter activity and endogenous GPR120 expression. The binding site of C/EBPβ in the GPR120 promoter region from -101 to -87 was identified by promoter deletion analysis and site-directed mutagenesis. Overexpression of C/EBPβ increased endogenous GPR120 expression in pig kidney cells (PK). Furthermore, when endogenous C/EBPβ was knocked down, GPR120 mRNA and protein levels were decreased. The stimulatory effect of C/EBPβ on GPR120 transcription and its ability to bind the transcription factor-binding site were confirmed by luciferase, ChIP, and EMSA. Moreover, the mRNA and protein expression levels of C/EBPβ were induced by high fat diet feeding. Taken together, it can be concluded that C/EBPβ plays a vital role in regulating GPR120 transcription and suggests HFD-feeding induces GPR120 transcription by influencing C/EBPβ expression.

  19. Transcriptional profiling of CcpE-regulated genes in Staphylococcus aureus.

    PubMed

    Li, Han; Ding, Yue; Lan, Lefu

    2015-09-01

    The transcriptional regulator CcpE is an important citrate-sensing regulator that modulates metabolic state, virulence factor expression, and bacterial virulence of Staphylococcus aureus (Ding et al., 2014 [1]). In this article, we report detailed methods for genome-wide transcriptional profiling of CcpE-regulated genes generated for the research article "Metabolic sensor governing bacterial virulence in Staphylococcus aureus" (Ding et al., 2014 [1]). All transcriptional profiling data was deposited to Gene Expression Omnibus (GEO) database under accession number GSE57260. PMID:26484245

  20. Pleiohomeotic Interacts with the Core Transcription Elongation Factor Spt5 to Regulate Gene Expression in Drosophila

    PubMed Central

    Jennings, Barbara H.

    2013-01-01

    The early elongation checkpoint regulated by Positive Transcription Elongation Factor b (P-TEFb) is a critical control point for the expression of many genes. Spt5 interacts directly with RNA polymerase II and has an essential role in establishing this checkpoint, and also for further transcript elongation. Here we demonstrate that Drosophila Spt5 interacts both physically and genetically with the Polycomb Group (PcG) protein Pleiohomeotic (Pho), and the majority of Pho binding sites overlap with Spt5 binding sites across the genome in S2 cells. Our results indicate that Pho can interact with Spt5 to regulate transcription elongation in a gene specific manner. PMID:23894613

  1. The Role of Transcription Factors at Antisense-Expressing Gene Pairs in Yeast

    PubMed Central

    Mostovoy, Yulia; Thiemicke, Alexander; Hsu, Tiffany Y.; Brem, Rachel B.

    2016-01-01

    Genes encoded close to one another on the chromosome are often coexpressed, by a mechanism and regulatory logic that remain poorly understood. We surveyed the yeast genome for tandem gene pairs oriented tail-to-head at which expression antisense to the upstream gene was conserved across species. The intergenic region at most such tandem pairs is a bidirectional promoter, shared by the downstream gene mRNA and the upstream antisense transcript. Genomic analyses of these intergenic loci revealed distinctive patterns of transcription factor regulation. Mutation of a given transcription factor verified its role as a regulator in trans of tandem gene pair loci, including the proximally initiating upstream antisense transcript and downstream mRNA and the distally initiating upstream mRNA. To investigate cis-regulatory activity at such a locus, we focused on the stress-induced NAD(P)H dehydratase YKL151C and its downstream neighbor, the metabolic enzyme GPM1. Previous work has implicated the region between these genes in regulation of GPM1 expression; our mutation experiments established its function in rich medium as a repressor in cis of the distally initiating YKL151C sense RNA, and an activator of the proximally initiating YKL151C antisense RNA. Wild-type expression of all three transcripts required the transcription factor Gcr2. Thus, at this locus, the intergenic region serves as a focal point of regulatory input, driving antisense expression and mediating the coordinated regulation of YKL151C and GPM1. Together, our findings implicate transcription factors in the joint control of neighboring genes specialized to opposing conditions and the antisense transcripts expressed between them. PMID:27190003

  2. Towards a Quantitative Understanding of Single-Gene Transcription

    NASA Astrophysics Data System (ADS)

    O'Maoiléidigh, Dáibhid

    2008-03-01

    The transcription of the genetic information in DNA into RNA is the first step in protein synthesis. This process is highly regulated and is carried out by RNA polymerase (RNAP), a complex molecular motor. Here we discuss some of the consequences of a Brownian ratchet model of transcription, which incorporates internal structural degrees of freedom of RNAP and kinetic barriers to backtracking of RNAP resulting from steric clashes with co-transcriptionally folded RNA. This approach was previously used (a) to successfully predict sequence dependent positions of pauses during the elongation process [1,2]; (b) to study the behavior of a number of mutants of RNAP, with different elongation behaviors, believed to involve different internal motions of the enzyme [3]; and (c) to gain insight into the interpretation of single-molecule transcription elongation experiments [2]. The same model can be used to characterize the stability of the elongation complex at specific termination sequences, places along DNA where, with high probability, RNAP releases the RNA transcript and disengages from the template. Recent experimental results on termination reinforce a picture of the elongation complex as a flexible structure, not a rigid body [4]. In more general terms, some of the modeling to be presented raises fundamental issues related to ``model comparison'' and ``model selection,'' the problem of identifying and characterizing quantitative models on the basis of limited sets of experimental data [5]. [1] Tadigotla V. R., 'O Maoil'eidigh D., Sengupta A. M., Epshtein V., Ebright R. H., Nudler E., Ruckenstein A. E., Thermodynamic and Kinetic Modeling of Transcriptional Pausing. Proc Natl Acad Sci U S A,03:4439-4444 (2006). [2] D. 'O Maoil'eidigh, Ph.D. Thesis, Rutgers University, 2006 [3] Bar-Nahum, G., Epshtein, V., Ruckenstein, A. E., Rafikov, R., Mustaev, A. and Nudler E., A Ratchet Mechanism of Transcription Elongation and its Control. Cell, 120:183-193 (2005). [4] Epshtein, V

  3. The WRKY Transcription Factor Genes in Eggplant (Solanum melongena L.) and Turkey Berry (Solanum torvum Sw.)

    PubMed Central

    Yang, Xu; Deng, Cao; Zhang, Yu; Cheng, Yufu; Huo, Qiuyue; Xue, Linbao

    2015-01-01

    WRKY transcription factors, which play critical roles in stress responses, have not been characterized in eggplant or its wild relative, turkey berry. The recent availability of RNA-sequencing data provides the opportunity to examine WRKY genes from a global perspective. We identified 50 and 62 WRKY genes in eggplant (SmelWRKYs) and turkey berry (StorWRKYs), respectively, all of which could be classified into three groups (I–III) based on the WRKY protein structure. The SmelWRKYs and StorWRKYs contain ~76% and ~95% of the number of WRKYs found in other sequenced asterid species, respectively. Positive selection analysis revealed that different selection constraints could have affected the evolution of these groups. Positively-selected sites were found in Groups IIc and III. Branch-specific selection pressure analysis indicated that most WRKY domains from SmelWRKYs and StorWRKYs are conserved and have evolved at low rates since their divergence. Comparison to homologous WRKY genes in Arabidopsis revealed several potential pathogen resistance-related SmelWRKYs and StorWRKYs, providing possible candidate genetic resources for improving stress tolerance in eggplant and probably other Solanaceae plants. To our knowledge, this is the first report of a genome-wide analyses of the SmelWRKYs and StorWRKYs. PMID:25853261

  4. Promoter Identification and Transcription Analysis of Penicillin-Binding Protein Genes in Streptococcus pneumoniae R6

    PubMed Central

    Peters, Katharina; Pipo, Julia; Schweizer, Inga; Hakenbeck, Regine

    2016-01-01

    Penicillin-binding proteins (PBPs) are membrane-associated enzymes, which are involved in the last two steps of peptidoglycan biosynthesis, and some of them are key players in cell division. Furthermore, they are targets of β-lactams, the most widely used antibiotics. Nevertheless, very little is known about the expression and regulation of PBP genes. Using transcriptional mapping, we now determined the promoter regions of PBP genes from the laboratory strain Streptococcus pneumoniae R6 and examined the expression profile of these six promoters. The extended −10 region is highly conserved and complies with a σA-type promoter consensus sequence. In contrast, the −35 region is poorly conserved, indicating the possibility for differential PBP regulation. All PBP promoters were constitutively expressed and highly active during the exponential and early stationary growth phase. However, the individual expression of PBP promoters varied approximately fourfold, with pbp1a being the highest and pbp3 the lowest. Furthermore, the deletion of one nucleotide in the spacer region of the PBP3 promoter reduced pbp3 expression ∼10-fold. The addition of cefotaxime above the minimal inhibitory concentration (MIC) did not affect PBP expression in the penicillin-sensitive R6 strain. No evidence for regulation of S. pneumoniae PBP genes was obtained. PMID:27409661

  5. The WRKY transcription factor genes in eggplant (Solanum melongena L.) and Turkey Berry (Solanum torvum Sw.).

    PubMed

    Yang, Xu; Deng, Cao; Zhang, Yu; Cheng, Yufu; Huo, Qiuyue; Xue, Linbao

    2015-04-07

    WRKY transcription factors, which play critical roles in stress responses, have not been characterized in eggplant or its wild relative, turkey berry. The recent availability of RNA-sequencing data provides the opportunity to examine WRKY genes from a global perspective. We identified 50 and 62 WRKY genes in eggplant (SmelWRKYs) and turkey berry (StorWRKYs), respectively, all of which could be classified into three groups (I-III) based on the WRKY protein structure. The SmelWRKYs and StorWRKYs contain ~76% and ~95% of the number of WRKYs found in other sequenced asterid species, respectively. Positive selection analysis revealed that different selection constraints could have affected the evolution of these groups. Positively-selected sites were found in Groups IIc and III. Branch-specific selection pressure analysis indicated that most WRKY domains from SmelWRKYs and StorWRKYs are conserved and have evolved at low rates since their divergence. Comparison to homologous WRKY genes in Arabidopsis revealed several potential pathogen resistance-related SmelWRKYs and StorWRKYs, providing possible candidate genetic resources for improving stress tolerance in eggplant and probably other Solanaceae plants. To our knowledge, this is the first report of a genome-wide analyses of the SmelWRKYs and StorWRKYs.

  6. Operator Sequence Alters Gene Expression Independently of Transcription Factor Occupancy in Bacteria

    PubMed Central

    Garcia, Hernan G.; Sanchez, Alvaro; Boedicker, James Q.; Osborne, Melisa; Gelles, Jeff; Kondev, Jane; Phillips, Rob

    2012-01-01

    SUMMARY A canonical quantitative view of transcriptional regulation holds that the only role of operator sequence is to set the probability of transcription factor binding, with operator occupancy determining the level of gene expression. In this work, we test this idea by characterizing repression in vivo and the binding of RNA polymerase in vitro in experiments where operators of various sequences were placed either upstream or downstream from the promoter in Escherichia coli. Surprisingly, we find that operators with a weaker binding affinity can yield higher repression levels than stronger operators. Repressor bound to upstream operators modulates promoter escape, and the magnitude of this modulation is not correlated with the repressor-operator binding affinity. This suggests that operator sequences may modulate transcription by altering the nature of the interaction of the bound transcription factor with the transcriptional machinery, implying a new layer of sequence dependence that must be confronted in the quantitative understanding of gene expression. PMID:22840405

  7. Three Genes Are Required for trans-Activation of Ty Transcription in Yeast

    PubMed Central

    Winston, Fred; Dollard, Catherine; Malone, Elizabeth A.; Clare, Jeffrey; Kapakos, James G.; Farabaugh, Philip; Minehart, Patricia L.

    1987-01-01

    Mutations in the SPT3 gene were isolated as one class of suppressors of Ty and solo δ insertion mutations in Saccharomyces cerevisiae. Previous work has shown that null mutations in SPT3 abolish the normal Ty δ-δ transcript; instead, a transcript that initiates 800 bases farther downstream is made, suggesting that SPT3 is required for transcription initiation in δ sequences. We have selected for new spt mutations and have screened for those with the unique suppression pattern of spt3 mutations with respect to two insertion mutations. Our selection and screen has identified two additional genes, SPT7 and SPT8, that are also required for transcription initiation in δ sequences. We show that mutations in SPT7 or SPT8 result in the same alteration of Ty transcription as do mutations in SPT3. In addition, mutations in all three genes cause a sporulation defect. By assay of a Ty-lacZ fusion we have shown that spt3, spt7 and spt8 mutations reduce transcription from a δ sequence by 10–25-fold. Finally, we show that SPT3 mRNA levels are unaffected in either spt7 or spt8 mutants, suggesting that these two genes do not regulate transcription of SPT3. PMID:3034719

  8. Promoter-like sequences regulating transcriptional activity in neurexin and neuroligin genes.

    PubMed

    Runkel, Fabian; Rohlmann, Astrid; Reissner, Carsten; Brand, Stefan-Martin; Missler, Markus

    2013-10-01

    Synapse function requires the cell-adhesion molecules neurexins (Nrxn) and neuroligins (Nlgn). Although these molecules are essential for neurotransmission and prefer distinct isoform combinations for interaction, little is known about their transcriptional regulation. Here, we started to explore this important aspect because expression of Nrxn1-3 and Nlgn1-3 genes is altered in mice lacking the transcriptional regulator methyl-CpG-binding protein2 (MeCP2). Since MeCP2 can bind to methylated CpG-dinucleotides and Nrxn/Nlgn contain CpG-islands, we tested genomic sequences for transcriptional activity in reporter gene assays. We found that their influence on transcription are differentially activating or inhibiting. As we observed an activity difference between heterologous and neuronal cell lines for distinct Nrxn1 and Nlgn2 sequences, we dissected their putative promoter regions. In both genes, we identify regions in exon1 that can induce transcription, in addition to the alternative transcriptional start points in exon2. While the 5'-regions of Nrxn1 and Nlgn2 contain two CpG-rich elements that show distinct methylation frequency and binding to MeCP2, other regions may act independently of this transcriptional regulator. These data provide first insights into regulatory sequences of Nrxn and Nlgn genes that may represent an important aspect of their function at synapses in health and disease.

  9. Transcription Profile of Aging and Cognition-Related Genes in the Medial Prefrontal Cortex

    PubMed Central

    Ianov, Lara; Rani, Asha; Beas, Blanca S.; Kumar, Ashok; Foster, Thomas C.

    2016-01-01

    Cognitive function depends on transcription; however, there is little information linking altered gene expression to impaired prefrontal cortex function during aging. Young and aged F344 rats were characterized on attentional set shift and spatial memory tasks. Transcriptional differences associated with age and cognition were examined using RNA sequencing to construct transcriptomic profiles for the medial prefrontal cortex (mPFC), white matter, and region CA1 of the hippocampus. The results indicate regional differences in vulnerability to aging. Age-related gene expression in the mPFC was similar to, though less robust than, changes in the dorsolateral PFC of aging humans suggesting that aging processes may be similar. Importantly, the pattern of transcription associated with aging did not predict cognitive decline. Rather, increased mPFC expression of genes involved in regulation of transcription, including transcription factors that regulate the strength of excitatory and inhibitory inputs, and neural activity-related immediate-early genes was observed in aged animals that exhibit delayed set shift behavior. The specificity of impairment on a mPFC-dependent task, associated with a particular mPFC transcriptional profile indicates that impaired executive function involves altered transcriptional regulation and neural activity/plasticity processes that are distinct from that described for impaired hippocampal function. PMID:27242522

  10. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  11. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    SciTech Connect

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

    2006-05-25

    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  12. FoxO1 Deacetylation Regulates Thyroid Hormone-induced Transcription of Key Hepatic Gluconeogenic Genes*

    PubMed Central

    Singh, Brijesh Kumar; Sinha, Rohit Anthony; Zhou, Jin; Xie, Sherwin Ying; You, Seo-Hee; Gauthier, Karine; Yen, Paul Michael

    2013-01-01

    Hepatic gluconeogenesis is a concerted process that integrates transcriptional regulation with hormonal signals. A major regulator is thyroid hormone (TH), which acts through its nuclear receptor (TR) to induce the expression of the hepatic gluconeogenic genes, phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC). Forkhead transcription factor FoxO1 also is an important regulator of these genes; however, its functional interactions with TR are not known. Here, we report that TR-mediated transcriptional activation of PCK1 and G6PC in human hepatic cells and mouse liver was FoxO1-dependent and furthermore required FoxO1 deacetylation by the NAD+-dependent deacetylase, SirT1. siRNA knockdown of FoxO1 decreased, whereas overexpression of FoxO1 increased, TH-dependent transcriptional activation of PCK1 and G6PC in cultured hepatic cells. FoxO1 siRNA knockdown also decreased TH-mediated transcription in vivo. Additionally, TH was unable to induce FoxO1 deacetylation or hepatic PCK1 gene expression in TH receptor β-null (TRβ−/−) mice. Moreover, TH stimulated FoxO1 recruitment to the PCK1 and G6PC gene promoters in a SirT1-dependent manner. In summary, our results show that TH-dependent deacetylation of a second metabolically regulated transcription factor represents a novel mechanism for transcriptional integration of nuclear hormone action with cellular energy status. PMID:23995837

  13. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne

    PubMed Central

    Vissers, Elisabeth W.; Anselmetti, Flavio S.; Bodelier, Paul L. E.; Muyzer, Gerard; Schleper, Christa; Tourna, Maria; Laanbroek, Hendrikus J.

    2013-01-01

    Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO). This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA) and bacteria (AOB) over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally outnumbered AOB. However, in the surface water during summer stratification, when both AO were low in abundance, AOB were more numerous than AOA. Temporal distribution patterns of AOA and AOB were comparable. Higher abundances of amoA gene transcripts were observed at the onset and end of summer stratification. In summer, archaeal amoA genes and transcripts correlated negatively with temperature and conductivity. Concentrations of ammonium and oxygen did not vary enough to explain the amoA gene and transcript dynamics. The observed herbivorous zooplankton may have caused a hidden flux of mineralized ammonium and a change in abundance of genes and transcripts. At the surface, AO might have been repressed during summer stratification due to nutrient limitation caused by active phytoplankton. PMID:23533328

  14. Regulation of the human LAT gene by the Elf-1 transcription factor

    PubMed Central

    Finco, Timothy S; Justice-Healy, Geri E; Patel, Shivani J; Hamilton, Victoria E

    2006-01-01

    Background The LAT gene encodes an intracellular adaptor protein that links cell-surface receptor engagement to numerous downstream signalling events, and thereby plays an integral role in the function of cell types that express the gene, including T cells, mast cells, natural killer cells, and platelets. To date, the mechanisms responsible for the transcriptional regulation of this gene have not been investigated. Results In this study we have mapped the transcriptional start sites for the human LAT gene and localized the 5' and 3' boundaries of the proximal promoter. We find that the promoter contains both positive and negative regulatory regions, and that two binding sites for the Ets family of transcription factors have a strong, positive effect on gene expression. Each site binds the Ets family member Elf-1, and overexpression of Elf-1 augments LAT promoter activity. The promoter also contains a Runx binding site adjacent to one of the Ets sites. This site, which is shown to bind Runx-1, has an inhibitory effect on gene expression. Finally, data is also presented indicating that the identified promoter may regulate cell-type specific expression. Conclusion Collectively, these results provide the first insights into the transcriptional regulation of the LAT gene, including the discovery that the Ets transcription factor Elf-1 may play a central role in its expression. PMID:16464244

  15. Pharmacological and Genetic Modulation of REV-ERB Activity and Expression Affects Orexigenic Gene Expression

    PubMed Central

    Amador, Ariadna; Wang, Yongjun; Banerjee, Subhashis; Kameneka, Theodore M.; Solt, Laura A.; Burris, Thomas P.

    2016-01-01

    The nuclear receptors REV-ERBα and REV-ERBβ are transcription factors that play pivotal roles in the regulation of the circadian rhythm and various metabolic processes. The circadian rhythm is an endogenous mechanism, which generates entrainable biological changes that follow a 24-hour period. It regulates a number of physiological processes, including sleep/wakeful cycles and feeding behaviors. We recently demonstrated that REV-ERB-specific small molecules affect sleep and anxiety. The orexinergic system also plays a significant role in mammalian physiology and behavior, including the regulation of sleep and food intake. Importantly, orexin genes are expressed in a circadian manner. Given these overlaps in function and circadian expression, we wanted to determine whether the REV-ERBs might regulate orexin. We found that acute in vivo modulation of REV-ERB activity, with the REV-ERB-specific synthetic ligand SR9009, affects the circadian expression of orexinergic genes in mice. Long term dosing with SR9009 also suppresses orexinergic gene expression in mice. Finally, REV-ERBβ-deficient mice present with increased orexinergic transcripts. These data suggest that the REV-ERBs may be involved in the repression of orexinergic gene expression. PMID:26963516

  16. A feedback control element near the transcription start site of the maize Shrunken gene determines promoter activity.

    PubMed Central

    Maas, C; Schaal, S; Werr, W

    1990-01-01

    The transcriptional activity of the Shrunken (Sh) promoter of Zea mays was monitored in transient expression assays using the neomycin phosphotransferase (NPT) II gene as a reporter in maize suspension protoplasts. Shortly after transfection, expression of this chimeric NPTII gene was negatively affected by high extracellular sucrose concentrations in the protoplast cultivation medium. However, 3-5 days after transfection an up to 405-fold increase in NPTII activity was observed. This could be blocked by dichlorobenzonitril (DCB) an inhibitor of cellulose biosynthesis. In the analysis of promoter deletions 20 bp upstream of the Sh transcription start site were sufficient to reproduce the expression profile and the activity of the full promoter. Surprisingly this start sequence does not include the natural TATA-box. Images Fig.1 Fig.2 Fig.3 Fig.4 PMID:2145150

  17. Exploring the transcription factor activity in high-throughput gene expression data using RLQ analysis

    PubMed Central

    2013-01-01

    Background Interpretation of gene expression microarray data in the light of external information on both columns and rows (experimental variables and gene annotations) facilitates the extraction of pertinent information hidden in these complex data. Biologists classically interpret genes of interest after retrieving functional information from a subset of genes of interest. Transcription factors play an important role in orchestrating the regulation of gene expression. Their activity can be deduced by examining the presence of putative transcription factors binding sites in the gene promoter regions. Results In this paper we present the multivariate statistical method RLQ which aims to analyze microarray data where additional information is available on both genes and samples. As an illustrative example, we applied RLQ methodology to analyze transcription factor activity associated with the time-course effect of steroids on the growth of primary human lung fibroblasts. RLQ could successfully predict transcription factor activity, and could integrate various other sources of external information in the main frame of the analysis. The approach was validated by means of alternative statistical methods and biological validation. Conclusions RLQ provides an efficient way of extracting and visualizing structures present in a gene expression dataset by directly modeling the link between experimental variables and gene annotations. PMID:23742070

  18. What's that gene (or protein)? Online resources for exploring functions of genes, transcripts, and proteins

    PubMed Central

    Hutchins, James R. A.

    2014-01-01

    The genomic era has enabled research projects that use approaches including genome-scale screens, microarray analysis, next-generation sequencing, and mass spectrometry–based proteomics to discover genes and proteins involved in biological processes. Such methods generate data sets of gene, transcript, or protein hits that researchers wish to explore to understand their properties and functions and thus their possible roles in biological systems of interest. Recent years have seen a profusion of Internet-based resources to aid this process. This review takes the viewpoint of the curious biologist wishing to explore the properties of protein-coding genes and their products, identified using genome-based technologies. Ten key questions are asked about each hit, addressing functions, phenotypes, expression, evolutionary conservation, disease association, protein structure, interactors, posttranslational modifications, and inhibitors. Answers are provided by presenting the latest publicly available resources, together with methods for hit-specific and data set–wide information retrieval, suited to any genome-based analytical technique and experimental species. The utility of these resources is demonstrated for 20 factors regulating cell proliferation. Results obtained using some of these are discussed in more depth using the p53 tumor suppressor as an example. This flexible and universally applicable approach for characterizing experimental hits helps researchers to maximize the potential of their projects for biological discovery. PMID:24723265

  19. Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

    PubMed

    Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

    2006-07-01

    Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

  20. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts.

    PubMed

    Pandian, Ganesh N; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D; Sugiyama, Hiroshi

    2014-01-24

    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation.

  1. Gene characterization and transcription analysis of two new ammonium transporters in pear rootstock (Pyrus betulaefolia).

    PubMed

    Li, Hui; Han, Jin-Long; Chang, You-Hong; Lin, Jing; Yang, Qing-Song

    2016-07-01

    Ammonium is the primarily nitrogen source for plant growth, but the molecular basis of ammonium acquisition in fruit species remains poorly understood. In this study, we report on the characterization of two new ammonium transporters (AMT) in the perennial tree Pyrus betulaefolia. In silico analyses and yeast complementation assays revealed that both PbAMT1;3 and PbAMT1;5 can be classified in the AMT1 sub-family. The specific expression of PbAMT1;3 in roots and of PbAMT1;5 in leaves indicates that they have diverse functions in ammonium uptake or transport in P. betulaefolia. Their expression was strongly influenced by ammonium availability. In addition, the transcript level of PbAMT1;5 was significantly affected by the diurnal cycle and senescence hormones. They conferred the ability to uptake nitrogen to the yeast strain 31019b; however, the (15)NH4 (+) uptake kinetics of PbAMT1;3 were different from those of PbAMT1;5. Indeed, PbAMT1;3 had a higher affinity for (15)NH4 (+), and pH changes were associated with this substrates' transport in yeast. The present study provides basic gene features and transcriptional information for the two new members of the AMT1 sub-family in P. betulaefolia and will aid in decoding the precise roles of AMTs in P. betulaefolia physiology.

  2. Bypassing the Requirements for Epigenetic Modifications in Gene Transcription by Increasing Enhancer Strength▿

    PubMed Central

    Koutroubas, George; Merika, Menie; Thanos, Dimitris

    2008-01-01

    Our current concept postulates that histone acetylation is required for the recruitment of bromodomain-containing transcription complexes, such as the chromatin-remodeling machine SWI/SNF and the basal transcription factor TFIID. We generated simple NF-κB-dependent enhancers of increasing transcriptional strengths and found that the histone acetylation requirements for activation of transcription depended on the strengths of these enhancers. All enhancers function by recruiting SWI/SNF and TFIID to induce nucleosome sliding, a prerequisite for transcriptional activation. However, histone acetylation, although it occurs, is dispensable for TFIID and SWI/SNF recruitment by the strong enhancers, indicating that strong activators can overcome the chromatin barrier by directly recruiting the necessary transcriptional complexes. Weak enhancers depend on histone acetylation for recruitment, and this requirement is independent of a histone acetylation code. Thus, the need for nucleosome modifications is imposed on genes and translated according to the quality and strengths of the activators. PMID:18025106

  3. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  4. Biomarkers and transcription levels of cancer-related genes in cockles Cerastoderma edule from Galicia (NW Spain) with disseminated neoplasia.

    PubMed

    Ruiz, Pamela; Díaz, Seila; Orbea, Amaia; Carballal, Maria J; Villalba, Antonio; Cajaraville, Miren P

    2013-07-15

    Disseminated neoplasia (DN) is a pathological condition reported for several species of marine bivalves throughout the world, but its aetiology has not yet been satisfactorily explained. It has been suggested that chemical contamination could be a factor contributing to neoplasia. The aim of the present study was to compare cell and tissue biomarkers and the transcription level of cancer-related genes in cockles (Cerastoderma edule) affected by DN with those of healthy cockles in relation to chemical contaminant burdens. For this, cockles were collected from a natural bed in Cambados (Ria de Arousa, Galicia) in May 2009. The prevalence of DN was 12.36% and 3 degrees of DN severity were distinguished. No significant differences in metal accumulation, non-specific inflammatory responses and parasites were observed between healthy and DN-affected cockles. Lysosomal membrane stability was significantly reduced in cockles affected by DN, which indicates a poorer health condition. Very low frequencies of micronuclei were recorded and no significant differences were detected between DN severity groups. Haemolymph analyses showed a higher frequency of mitotic figures and binucleated cells in cockles affected by moderate and heavy DN than in healthy ones. Neoplastic animals showed significantly higher transcription levels of p53 and ras than healthy cockles and mutational alterations in ras gene sequence were detected. Low concentrations of metals, polycyclic aromatic hydrocarbons, polychlorinated biphenyls and phthalate esters were measured in cockles from Cambados. In conclusion, cockles affected by DN suffer a general stress situation and have altered patterns of cancer-related gene transcription. Further studies are in progress to elucidate mechanisms of carcinogenesis in this species.

  5. Biomarkers and transcription levels of cancer-related genes in cockles Cerastoderma edule from Galicia (NW Spain) with disseminated neoplasia.

    PubMed

    Ruiz, Pamela; Díaz, Seila; Orbea, Amaia; Carballal, Maria J; Villalba, Antonio; Cajaraville, Miren P

    2013-07-15

    Disseminated neoplasia (DN) is a pathological condition reported for several species of marine bivalves throughout the world, but its aetiology has not yet been satisfactorily explained. It has been suggested that chemical contamination could be a factor contributing to neoplasia. The aim of the present study was to compare cell and tissue biomarkers and the transcription level of cancer-related genes in cockles (Cerastoderma edule) affected by DN with those of healthy cockles in relation to chemical contaminant burdens. For this, cockles were collected from a natural bed in Cambados (Ria de Arousa, Galicia) in May 2009. The prevalence of DN was 12.36% and 3 degrees of DN severity were distinguished. No significant differences in metal accumulation, non-specific inflammatory responses and parasites were observed between healthy and DN-affected cockles. Lysosomal membrane stability was significantly reduced in cockles affected by DN, which indicates a poorer health condition. Very low frequencies of micronuclei were recorded and no significant differences were detected between DN severity groups. Haemolymph analyses showed a higher frequency of mitotic figures and binucleated cells in cockles affected by moderate and heavy DN than in healthy ones. Neoplastic animals showed significantly higher transcription levels of p53 and ras than healthy cockles and mutational alterations in ras gene sequence were detected. Low concentrations of metals, polycyclic aromatic hydrocarbons, polychlorinated biphenyls and phthalate esters were measured in cockles from Cambados. In conclusion, cockles affected by DN suffer a general stress situation and have altered patterns of cancer-related gene transcription. Further studies are in progress to elucidate mechanisms of carcinogenesis in this species. PMID:23665240

  6. Scaling of Gene Expression with Transcription-Factor Fugacity

    PubMed Central

    Weinert, Franz M.; Brewster, Robert C.; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K.

    2015-01-01

    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve. PMID:25554908

  7. Cytogenetic and molecular localization of tipE: A gene affecting sodium channels in Drosophila melanogaster

    SciTech Connect

    Feng, G.; Deak, P.; Hall, L.M.

    1995-04-01

    Voltage-sensitive sodium channels play a key role in nerve cells where they are responsible for the increase in sodium permeability during the rising phase of action potentials. In Drosophila melanogaster a subset of temperature-sensitive paralytic mutations affect sodium channel function. One such mutation is temperature-induced paralysis locus E (tipE), which has been shown by electrophysiology and ligand binding studies to reduce sodium channel numbers. Three new {gamma}-ray-induced tipE alleles associated with either visible deletions in 64AB or a translocation breakpoint within 64B2 provide landmarks for positional cloning of tipE. Beginning with the flanking cloned gene Ras2, a 140-kb walk across the translocation breakpoint was completed. Germline transformation using a 42-kb cosmid clone and successively smaller subclones localized the tipE gene within a 7.4-kb genomic DNA segment. Although this chromosome region is rich in transcripts, only three overlapping mRNAs (5.4, 4.4, and 1.7 kb) lie completely within the smallest rescuing construct. The small sizes of the rescuing construct and transcripts suggests that tipE does not encode a standard sodium channel {alpha}-subunit with four homologous repeats. Sequencing these transcripts will elucidate the role of the tipE gene product in sodium channel functional regulation. 55 refs., 4 figs., 2 tabs.

  8. Mitotic genes are transcriptionally upregulated in the fibroblast irradiated with very low doses of UV-C

    PubMed Central

    Takeuchi, Seiji; Matsuda, Toshiro; Ono, Ryusuke; Tsujimoto, Mariko; Nishigori, Chikako

    2016-01-01

    Ultraviolet (UV) radiation induces a variety of biological effects, including DNA damage response and cell signaling pathways. We performed transcriptome analysis using microarray in human primary cultured fibroblasts irradiated with UV-C (0.5 or 5 J/m2) and harvested at 4 or 12 h following UV exposure. All transcript data were analyzed by comparison with the corresponding results in non-irradiated (control) cells. The number of genes with significantly altered expression (≥2-fold difference relative to the control) is higher in the sample irradiated with high dose of UV, suggesting that gene expression was UV dose-dependent. Pathway analysis on the upregulated genes at 12 h indicates that the expression of some cell cycle-related genes was predominantly induced irrespective of UV-dose. Interestingly, almost all the genes with significant altered expression were cell cycle-related genes designated as ‘Mitotic Genes’, which function in the spindle assembly checkpoint. Therefore, even a low dose of UV could affect the transcriptional profile. PMID:27378355

  9. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    NASA Astrophysics Data System (ADS)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  10. The Drosophila Transcription Factor Dimmed Affects Neuronal Growth and Differentiation in Multiple Ways Depending on Neuron Type and Developmental Stage

    PubMed Central

    Liu, Yiting; Luo, Jiangnan; Nässel, Dick R.

    2016-01-01

    Growth of postmitotic neurons occurs during different stages of development, including metamorphosis, and may also be part of neuronal plasticity and regeneration. Recently we showed that growth of post-mitotic neuroendocrine cells expressing the basic helix loop helix (bHLH) transcription factor Dimmed (Dimm) in Drosophila could be regulated by insulin/IGF signaling and the insulin receptor (dInR). Dimm is also known to confer a secretory phenotype to neuroendocrine cells and can be part of a combinatorial code specifying terminal differentiation in peptidergic neurons. To further understand the mechanisms of Dimm function we ectopically expressed Dimm or Dimm together with dInR in a wide range of Dimm positive and Dimm negative peptidergic neurons, sensory neurons, interneurons, motor neurons, and gut endocrine cells. We provide further evidence that dInR mediated cell growth occurs in a Dimm dependent manner and that one source of insulin-like peptide (DILP) for dInR mediated cell growth in the CNS is DILP6 from glial cells. Expressing both Dimm and dInR in Dimm negative neurons induced growth of cell bodies, whereas dInR alone did not. We also found that Dimm alone can regulate cell growth depending on specific cell type. This may be explained by the finding that the dInR is a direct target of Dimm. Conditional gene targeting experiments showed that Dimm alone could affect cell growth in certain neuron types during metamorphosis or in the adult stage. Another important finding was that ectopic Dimm inhibits apoptosis of several types of neurons normally destined for programmed cell death (PCD). Taken together our results suggest that Dimm plays multiple transcriptional roles at different developmental stages in a cell type-specific manner. In some cell types ectopic Dimm may act together with resident combinatorial code transcription factors and affect terminal differentiation, as well as act in transcriptional networks that participate in long term maintenance

  11. Patterns of Transcript Abundance of Eukaryotic Biogeochemically-Relevant Genes in the Amazon River Plume.

    PubMed

    Zielinski, Brian L; Allen, Andrew E; Carpenter, Edward J; Coles, Victoria J; Crump, Byron C; Doherty, Mary; Foster, Rachel A; Goes, Joaquim I; Gomes, Helga R; Hood, Raleigh R; McCrow, John P; Montoya, Joseph P; Moustafa, Ahmed; Satinsky, Brandon M; Sharma, Shalabh; Smith, Christa B; Yager, Patricia L; Paul, John H

    2016-01-01

    The Amazon River has the largest discharge of all rivers on Earth, and its complex plume system fuels a wide array of biogeochemical processes, across a large area of the western tropical North Atlantic. The plume thus stimulates microbial processes affecting carbon sequestration and nutrient cycles at a global scale. Chromosomal gene expression patterns of the 2.0 to 156 μm size-fraction eukaryotic microbial community were investigated in the Amazon River Plume, generating a robust dataset (more than 100 million mRNA sequences) that depicts the metabolic capabilities and interactions among the eukaryotic microbes. Combining classical oceanographic field measurements with metatranscriptomics yielded characterization of the hydrographic conditions simultaneous with a quantification of transcriptional activity and identity of the community. We highlight the patterns of eukaryotic gene expression for 31 biogeochemically significant gene targets hypothesized to be valuable within forecasting models. An advantage to this targeted approach is that the database of reference sequences used to identify the target genes was selectively constructed and highly curated optimizing taxonomic coverage, throughput, and the accuracy of annotations. A coastal diatom bloom highly expressed nitrate transporters and carbonic anhydrase presumably to support high growth rates and enhance uptake of low levels of dissolved nitrate and CO2. Diatom-diazotroph association (DDA: diatoms with nitrogen fixing symbionts) blooms were common when surface salinity was mesohaline and dissolved nitrate concentrations were below detection, and hence did not show evidence of nitrate utilization, suggesting they relied on ammonium transporters to aquire recently fixed nitrogen. These DDA blooms in the outer plume had rapid turnover of the photosystem D1 protein presumably caused by photodegradation under increased light penetration in clearer waters, and increased expression of silicon transporters as

  12. Patterns of Transcript Abundance of Eukaryotic Biogeochemically-Relevant Genes in the Amazon River Plume.

    PubMed

    Zielinski, Brian L; Allen, Andrew E; Carpenter, Edward J; Coles, Victoria J; Crump, Byron C; Doherty, Mary; Foster, Rachel A; Goes, Joaquim I; Gomes, Helga R; Hood, Raleigh R; McCrow, John P; Montoya, Joseph P; Moustafa, Ahmed; Satinsky, Brandon M; Sharma, Shalabh; Smith, Christa B; Yager, Patricia L; Paul, John H

    2016-01-01

    The Amazon River has the largest discharge of all rivers on Earth, and its complex plume system fuels a wide array of biogeochemical processes, across a large area of the western tropical North Atlantic. The plume thus stimulates microbial processes affecting carbon sequestration and nutrient cycles at a global scale. Chromosomal gene expression patterns of the 2.0 to 156 μm size-fraction eukaryotic microbial community were investigated in the Amazon River Plume, generating a robust dataset (more than 100 million mRNA sequences) that depicts the metabolic capabilities and interactions among the eukaryotic microbes. Combining classical oceanographic field measurements with metatranscriptomics yielded characterization of the hydrographic conditions simultaneous with a quantification of transcriptional activity and identity of the community. We highlight the patterns of eukaryotic gene expression for 31 biogeochemically significant gene targets hypothesized to be valuable within forecasting models. An advantage to this targeted approach is that the database of reference sequences used to identify the target genes was selectively constructed and highly curated optimizing taxonomic coverage, throughput, and the accuracy of annotations. A coastal diatom bloom highly expressed nitrate transporters and carbonic anhydrase presumably to support high growth rates and enhance uptake of low levels of dissolved nitrate and CO2. Diatom-diazotroph association (DDA: diatoms with nitrogen fixing symbionts) blooms were common when surface salinity was mesohaline and dissolved nitrate concentrations were below detection, and hence did not show evidence of nitrate utilization, suggesting they relied on ammonium transporters to aquire recently fixed nitrogen. These DDA blooms in the outer plume had rapid turnover of the photosystem D1 protein presumably caused by photodegradation under increased light penetration in clearer waters, and increased expression of silicon transporters as

  13. Patterns of Transcript Abundance of Eukaryotic Biogeochemically-Relevant Genes in the Amazon River Plume

    PubMed Central

    Allen, Andrew E.; Carpenter, Edward J.; Coles, Victoria J.; Crump, Byron C.; Doherty, Mary; Foster, Rachel A.; Goes, Joaquim I.; Gomes, Helga R.; Hood, Raleigh R.; McCrow, John P.; Montoya, Joseph P.; Moustafa, Ahmed; Satinsky, Brandon M.; Sharma, Shalabh; Smith, Christa B.; Yager, Patricia L.; Paul, John H.

    2016-01-01

    The Amazon River has the largest discharge of all rivers on Earth, and its complex plume system fuels a wide array of biogeochemical processes, across a large area of the western tropical North Atlantic. The plume thus stimulates microbial processes affecting carbon sequestration and nutrient cycles at a global scale. Chromosomal gene expression patterns of the 2.0 to 156 μm size-fraction eukaryotic microbial community were investigated in the Amazon River Plume, generating a robust dataset (more than 100 million mRNA sequences) that depicts the metabolic capabilities and interactions among the eukaryotic microbes. Combining classical oceanographic field measurements with metatranscriptomics yielded characterization of the hydrographic conditions simultaneous with a quantification of transcriptional activity and identity of the community. We highlight the patterns of eukaryotic gene expression for 31 biogeochemically significant gene targets hypothesized to be valuable within forecasting models. An advantage to this targeted approach is that the database of reference sequences used to identify the target genes was selectively constructed and highly curated optimizing taxonomic coverage, throughput, and the accuracy of annotations. A coastal diatom bloom highly expressed nitrate transporters and carbonic anhydrase presumably to support high growth rates and enhance uptake of low levels of dissolved nitrate and CO2. Diatom-diazotroph association (DDA: diatoms with nitrogen fixing symbionts) blooms were common when surface salinity was mesohaline and dissolved nitrate concentrations were below detection, and hence did not show evidence of nitrate utilization, suggesting they relied on ammonium transporters to aquire recently fixed nitrogen. These DDA blooms in the outer plume had rapid turnover of the photosystem D1 protein presumably caused by photodegradation under increased light penetration in clearer waters, and increased expression of silicon transporters as

  14. Genomic organization and promoter analysis of a transcriptional repressor gene from Fenneropenaeus chinensis.

    PubMed

    Lai, Xiaofang; Shen, Shanrui; Gao, Huan; Yan, Binlun

    2015-02-01

    In this study, we cloned and sequenced genomic sequences from a Fenneropenaeus chinensis transcriptional repressor gene, FcTR. The FcTR gene is 2,671 bp in length and has four exons and three introns. The 873 bp promoter contains several transcription factor binding sites, including a TATA box and a cyclic AMP-responsive element. Promoter deletion analysis using a luciferase reporter gene identified regulatory elements. Challenge with white spot syndrome virus increased expression from the promoter-deletion constructs. These results suggest that FcTR might play an important role in the shrimp immune response.

  15. Genetic effects of an air discharge plasma on Staphylococcus aureus at the gene transcription level

    NASA Astrophysics Data System (ADS)

    Xu, Zimu; Wei, Jun; Shen, Jie; Liu, Yuan; Ma, Ronghua; Zhang, Zelong; Qian, Shulou; Ma, Jie; Lan, Yan; Zhang, Hao; Zhao, Ying; Xia, Weidong; Sun, Qiang; Cheng, Cheng; Chu, Paul K.

    2015-05-01

    The dynamics of gene expression regulation (at transcription level) in Staphylococcus aureus after different doses of atmospheric-pressure room-temperature air plasma treatments are investigated by monitoring the quantitative real-time polymerase chain reaction. The plasma treatment influences the transcription of genes which are associated with several important bio-molecular processes related to the environmental stress resistance of the bacteria, including oxidative stress response, biofilm formation, antibiotics resistance, and DNA damage protection/repair. The reactive species generated by the plasma discharge in the gas phase and/or induced in the liquid phase may account for these gene expression changes.

  16. Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

    NASA Technical Reports Server (NTRS)

    Morrow, Maureen A.

    2003-01-01

    Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

  17. Ethylene and pollination decrease transcript abundance of an ethylene receptor gene in Dendrobium petals.

    PubMed

    Thongkum, Monthathip; Burns, Parichart; Bhunchoth, Anjana; Warin, Nuchnard; Chatchawankanphanich, Orawan; van Doorn, Wouter G

    2015-03-15

    We studied the expression of a gene encoding an ethylene receptor, called Ethylene Response Sensor 1 (Den-ERS1), in the petals of Dendrobium orchid flowers. Transcripts accumulated during the young floral bud stage and declined by the time the flowers had been open for several days. Pollination or exposure to exogenous ethylene resulted in earlier flower senescence, an increase in ethylene production and a lower Den-ERS1 transcript abundance. Treatment with 1-methylcyclopropene (1-MCP), an inhibitor of the ethylene receptor, decreased ethylene production and resulted in high transcript abundance. The literature indicates two kinds of ethylene receptor genes with regard to the effects of ethylene. One group shows ethylene-induced down-regulated transcription, while the other has ethylene-induced up-regulation. The present gene is an example of the first group. The 5' flanking region showed binding sites for Myb and myb-like, homeodomain, MADS domain, NAC, TCP, bHLH and EIN3-like transcription factors. The binding site for the EIN3-like factor might explain the ethylene effect on transcription. A few other transcription factors (RAV1 and NAC) seem also related to ethylene effects.

  18. DNA methylation, riboswitches, and transcription factor activity: fundamental mechanisms of gene-nutrient interactions involving vitamins.

    PubMed

    Huang, Janet; Vieira, Amandio

    2006-12-01

    Nutrient-gene interactions occur with a variety of nutrients including some minerals, vitamins, polyunsaturated fatty acids and other lipids. Fundamental molecular mechanisms that underlie many of the effects of nutrients on gene expression are presented herein. Two of the mechanisms described influence gene transcription: DNA methylation and transcription factor activation. Another mechanism, riboswitching, can regulate gene expression at different levels, for example, at the mRNA translation level. The first two mechanisms are widely distributed across animal phyla. Riboswitches are documented primarily in more primitive organisms, but may prove to be of wider relevance. Riboswitches are known for several vitamins; those involving thiamine are presented here. The role of folates and retinoids in DNA methylation and transcriptional factor (nuclear retinoid receptor) activities, respectively, is presented in the context of cell proliferation and differentiation, and related physiological or pathological effects during embryogenesis and cancer.

  19. Role of Sam68 in post-transcriptional gene regulation.

    PubMed

    Sánchez-Jiménez, Flora; Sánchez-Margalet, Víctor

    2013-11-28

    The STAR family of proteins links signaling pathways to various aspects of post-transcriptional regulation and processing of RNAs. Sam68 belongs to this class of heteronuclear ribonucleoprotein particle K (hnRNP K) homology (KH) single domain-containing family of RNA-binding proteins that also contains some domains predicted to bind critical components in signal transduction pathways. In response to phosphorylation and other post-transcriptional modifications, Sam68 has been shown to have the ability to link signal transduction pathways to downstream effects regulating RNA metabolism, including transcription, alternative splicing or RNA transport. In addition to its function as a docking protein in some signaling pathways, this prototypic STAR protein has been identified to have a nuclear localization and to take part in the formation of both nuclear and cytosolic multi-molecular complexes such as Sam68 nuclear bodies and stress granules. Coupling with other proteins and RNA targets, Sam68 may play a role in the regulation of differential expression and mRNA processing and translation according to internal and external signals, thus mediating important physiological functions, such as cell death, proliferation or cell differentiation.

  20. Role of Sam68 in Post-Transcriptional Gene Regulation

    PubMed Central

    Sánchez-Jiménez, Flora; Sánchez-Margalet, Víctor

    2013-01-01

    The STAR family of proteins links signaling pathways to various aspects of post-transcriptional regulation and processing of RNAs. Sam68 belongs to this class of heteronuclear ribonucleoprotein particle K (hnRNP K) homology (KH) single domain-containing family of RNA-binding proteins that also contains some domains predicted to bind critical components in signal transduction pathways. In response to phosphorylation and other post-transcriptional modifications, Sam68 has been shown to have the ability to link signal transduction pathways to downstream effects regulating RNA metabolism, including transcription, alternative splicing or RNA transport. In addition to its function as a docking protein in some signaling pathways, this prototypic STAR protein has been identified to have a nuclear localization and to take part in the formation of both nuclear and cytosolic multi-molecular complexes such as Sam68 nuclear bodies and stress granules. Coupling with other proteins and RNA targets, Sam68 may play a role in the regulation of differential expression and mRNA processing and translation according to internal and external signals, thus mediating important physiological functions, such as cell death, proliferation or cell differentiation. PMID:24287914

  1. Insights from the cold transcriptome of Physcomitrella patens: global specialization pattern of conserved transcriptional regulators and identification of orphan genes involved in cold acclimation

    PubMed Central

    Beike, Anna K; Lang, Daniel; Zimmer, Andreas D; Wüst, Florian; Trautmann, Danika; Wiedemann, Gertrud; Beyer, Peter; Decker, Eva L; Reski, Ralf

    2015-01-01

    The whole-genome transcriptomic cold stress response of the moss Physcomitrella patens was analyzed and correlated with phenotypic and metabolic changes. Based on time-series microarray experiments and quantitative real-time polymerase chain reaction, we characterized the transcriptomic changes related to early stress signaling and the initiation of cold acclimation. Transcription-associated protein (TAP)-encoding genes of P. patens and Arabidopsis thaliana were classified using generalized linear models. Physiological responses were monitored with pulse-amplitude-modulated fluorometry, high-performance liquid chromatography and targeted high-performance mass spectrometry. The transcript levels of 3220 genes were significantly affected by cold. Comparative classification revealed a global specialization of TAP families, a transcript accumulation of transcriptional regulators of the stimulus/stress response and a transcript decline of developmental regulators. Although transcripts of the intermediate to later response are from evolutionarily conserved genes, the early response is dominated by species-specific genes. These orphan genes may encode as yet unknown acclimation processes. PMID:25209349

  2. Insights from the cold transcriptome of Physcomitrella patens: global specialization pattern of conserved transcriptional regulators and identification of orphan genes involved in cold acclimation.

    PubMed

    Beike, Anna K; Lang, Daniel; Zimmer, Andreas D; Wüst, Florian; Trautmann, Danika; Wiedemann, Gertrud; Beyer, Peter; Decker, Eva L; Reski, Ralf

    2015-01-01

    The whole-genome transcriptomic cold stress response of the moss Physcomitrella patens was analyzed and correlated with phenotypic and metabolic changes. Based on time-series microarray experiments and quantitative real-time polymerase chain reaction, we characterized the transcriptomic changes related to early stress signaling and the initiation of cold acclimation. Transcription-associated protein (TAP)-encoding genes of P. patens and Arabidopsis thaliana were classified using generalized linear models. Physiological responses were monitored with pulse-amplitude-modulated fluorometry, high-performance liquid chromatography and targeted high-performance mass spectrometry. The transcript levels of 3220 genes were significantly affected by cold. Comparative classification revealed a global specialization of TAP families, a transcript accumulation of transcriptional regulators of the stimulus/stress response and a transcript decline of developmental regulators. Although transcripts of the intermediate to later response are from evolutionarily conserved genes, the early response is dominated by species-specific genes. These orphan genes may encode as yet unknown acclimation processes.

  3. Caesium-affected gene expression in Arabidopsis thaliana.

    PubMed

    Sahr, Tobias; Voigt, Gabriele; Paretzke, Herwig G; Schramel, Peter; Ernst, Dieter

    2005-03-01

    * Excessive caesium can be toxic to plants. Here we investigated Cs uptake and caesium-induced gene expression in Arabidopsis thaliana. * Accumulation was measured in plants grown for 5 wk on agar supplemented with nontoxic and up to toxic levels of Cs. Caesium-induced gene expression was studied by suppression-subtractive hybridization (SSH) and RT-PCR. * Caesium accumulated in leaf rosettes dependent upon the external concentration in the growth media, whereas the potassium concentration decreased in rosettes. At a concentration of 850 microM, Cs plants showed reduced development, and withered with an increase in concentration to 1 mM Cs. SSH resulted in the isolation of 73 clones that were differentially expressed at a Cs concentration of 150 microM. Most of the genes identified belong to groups of genes encoding proteins in stress defence, detoxification, transport, homeostasis and general metabolism, and proteins controlling transcription and translation. * The present study identified a number of marker genes for Cs in Arabidopsis grown under nontoxic Cs concentrations, indicating that Cs acts as an abiotic stress factor.

  4. Assembly of a gene sequence tag microarray by reversible biotin-streptavidin capture for transcript analysis of Arabidopsis thaliana

    PubMed Central

    Wirta, Valtteri; Holmberg, Anders; Lukacs, Morten; Nilsson, Peter; Hilson, Pierre; Uhlén, Mathias; Bhalerao, Rishikesh P; Lundeberg, Joakim

    2005-01-01

    Background Transcriptional profiling using microarrays has developed into a key molecular tool for the elucidation of gene function and gene regulation. Microarray platforms based on either oligonucleotides or purified amplification products have been utilised in parallel to produce large amounts of data. Irrespective of platform examined, the availability of genome sequence or a large number of representative expressed sequence tags (ESTs) is, however, a pre-requisite for the design and selection of specific and high-quality microarray probes. This is of great importance for organisms, such as Arabidopsis thaliana, with a high number of duplicated genes, as cross-hybridisation signals between evolutionary related genes cannot be distinguished from true signals unless the probes are carefully designed to be specific. Results We present an alternative solid-phase purification strategy suitable for efficient preparation of short, biotinylated and highly specific probes suitable for large-scale expression profiling. Twenty-one thousand Arabidopsis thaliana gene sequence tags were amplified and subsequently purified using the described technology. The use of the arrays is exemplified by analysis of gene expression changes caused by a four-hour indole-3-acetic (auxin) treatment. A total of 270 genes were identified as differentially expressed (120 up-regulated and 150 down-regulated), including several previously known auxin-affected genes, but also several previously uncharacterised genes. Conclusions The described solid-phase procedure can be used to prepare gene sequence tag microarrays based on short and specific amplified probes, facilitating the analysis of more than 21 000 Arabidopsis transcripts. PMID:15689241

  5. In situ transcription and splicing in the Balbiani ring 3 gene

    PubMed Central

    Wetterberg, Ingela; Zhao, Jian; Masich, Sergej; Wieslander, Lars; Skoglund, Ulf

    2001-01-01

    The Balbiani ring 3 (BR3) gene contains 38 introns, and more than half of them are co-transcriptionally excised. We have determined the in situ structure of the active BR3 gene by electron tomography. Each of the 20–25 nascent transcripts on the gene is present together with splicing factors and the RNA polymerase II in a nascent transcript and splicing complex, here called the NTS complex. The results indicate that extensive changes in overall shape, substructure and molecular mass take place repeatedly within an NTS complex as it moves along the gene. The volume and calculated mass of the NTS complexes show that, maximally, one complete spliceosome is assembled on the multi-intron transcript at any given time point. The structural data show that the spliceosome is not a structurally well-defined unit in situ and that the C-terminal domain of the elongating RNA polymerase II cannot carry spliceosomal components for all introns in the BR3 transcript. Our data indicate that spliceosomal factors are continuously added to and released from the NTS complexes during transcription elongation. PMID:11350946

  6. Transcriptional profiling of hexaploid wheat (Triticum aestivum L.) roots identifies novel, dehydration-responsive genes.

    PubMed

    Mohammadi, Mohsen; Kav, Nat N V; Deyholos, Michael K

    2007-05-01

    We used a long-oligonucleotide microarray to identify transcripts that increased or decreased in abundance in roots of dehydration-tolerant hexaploid bread wheat, in response to withholding of water. We observed that the major classes of dehydration-responsive genes (e.g. osmoprotectants, compatible solutes, proteases, glycosyltransferases/hydrolases, signal transducers components, ion transporters) were generally similar to those observed previously in other species and osmotic stresses. More specifically, we highlighted increases in transcript expression for specific genes including those putatively related to the synthesis of asparagine, trehalose, oligopeptide transporters, metal-binding proteins, the gamma-aminobutyric acid (GABA) shunt and transcription factors. Conversely, we noted a decrease in transcript abundance for diverse classes of glutathione and sulphur-related enzymes, specific amino acids, as well as MATE-efflux carrier proteins. From these data, we identified a novel, dehydration-induced putative AP2/ERF transcription factor, which we predict to function as a transcriptional repressor. We also identified a dehydration-induced 'little protein' (LitP; predicted mass: 8 kDa) that is highly conserved across spermatophytes. Using qRT-PCR, we compared the expression patterns of selected genes between two related wheat genotypes that differed in their susceptibility to dehydration, and confirmed that these novel genes were highly inducible by water limitation in both genotypes, although the magnitude of induction differed.

  7. ZXDC, a novel zinc finger protein that binds CIITA and activates MHC gene transcription

    PubMed Central

    Al-Kandari, Wafa; Jambunathan, Srikarthika; Navalgund, Vandana; Koneni, Rupa; Freer, Margot; Parimi, Neeta; Mudhasani, Rajini; Fontes, Joseph D.

    2006-01-01

    The class II trans-activator (CIITA) is recognized as the master regulator of major histocompatibility complex (MHC) class II gene transcription and contributes to the transcription of MHC class I genes. To better understand the function of CIITA, we performed yeast two-hybrid with the C-terminal 807 amino acids of CIITA, and cloned a novel human cDNA named zinc finger, X-linked, duplicated family member C (ZXDC). The 858 amino acid ZXDC protein contains 10 zinc fingers and a transcriptional activation domain, and was found to interact with the region of CIITA containing leucine-rich repeats. Over-expression of ZXDC in human cell lines resulted in super-activation of MHC class I and class II promoters by CIITA. Conversely, silencing of ZXDC expression reduced the ability of CIITA to activate transcription of MHC class II genes. Given the specific interaction between the ZXDC and CIITA proteins, as well as the effect of ZXDC on MHC gene transcription, it appears that ZXDC is an important regulator of both MHC class I and class II transcription. PMID:16600381

  8. Transcription of interferon stimulated genes in response to Porcine rubulavirus infection in vitro

    PubMed Central

    Flores-Ocelotl, María del Rosario; Rosas-Murrieta, Nora Hilda; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio; Herrera-Camacho, Irma; Santos-López, Gerardo

    2011-01-01

    Porcine rubulavirus (PoRV) is an emerging virus causing meningo-encephalitis and reproductive failures in pigs. Little is known about the pathogenesis and immune evasion of this virus; therefore research on the mechanisms underlying tissue damage during infection is essential. To explore these mechanisms, the effect of PoRV on the transcription of interferon (IFN) pathway members was analyzed in vitro by semi-quantitative RT-PCR. Ten TCID50 of PoRV stimulated transcription of IFNα, IFNβ, STAT1, STAT2, p48 and OAS genes in neuroblastoma cells, whereas infection with 100 TCID50 did not stimulate transcription levels more than non-infected cells. When the cells were primed with IFNα, infection with 1 TCDI50 of PoRV sufficed to stimulate the transcription of the same genes, but 10 and 100 TCID50 did not modify the transcription level of those genes as compared with non-infected and primed controls. MxA gene transcription was observed only when the cells were primed with IFNα and stimulated with 10 TCID50, whereas 100 TCID50 of PoRV did not modify the MxA transcription level as compared to non-infected and primed cells. Our results show that PoRV replication at low titers stimulates the expression of IFN-responsive genes in neuroblastoma cells, and suggest that replication of PoRV at higher titers inhibits the transcription of several members of the IFN pathway. These findings may contribute to the understanding of the pathogenesis of PoRV. PMID:24031738

  9. Regulation of transcription of cell division genes in the Escherichia coli dcw cluster.

    PubMed

    Vicente, M; Gomez, M J; Ayala, J A

    1998-04-01

    The Escherichia coli dcw cluster contains cell division genes, such as the phylogenetically ubiquitous ftsZ, and genes involved in peptidoglycan synthesis. Transcription in the cluster proceeds in the same direction as the progress of the replication fork along the chromosome. Regulation is exerted at the transcriptional and post-transcriptional levels. The absence of transcriptional termination signals may, in principle, allow extension of the transcripts initiated at the up-stream promoter (mraZ1p) even to the furthest down-stream gene (envA). Complementation tests suggest that they extend into ftsW in the central part of the cluster. In addition, the cluster contains other promoters individually regulated by cis- and trans-acting signals. Dissociation of the expression of the ftsZ gene, located after ftsQ and A near the 3' end of the cluster, from its natural regulatory signals leads to an alteration in the physiology of cell division. The complexities observed in the regulation of gene expression in the cluster may then have an important biological role. Among them, LexA-binding SOS boxes have been found at the 5' end of the cluster, preceding promoters which direct the expression of ftsI (coding for PBP3, the penicillin-binding protein involved in septum formation). A gearbox promoter, ftsQ1p, forms part of the signals regulating the transcription of ftsQ, A and Z. It is an inversely growth-dependent mechanism driven by RNA polymerase containing sigma s, the factor involved in the expression of stationary phase-specific genes. Although the dcw cluster is conserved to a different extent in a variety of bacteria, the regulation of gene expression, the presence or absence of individual genes, and even the essentiality of some of them, show variations in the phylogenetic scale which may reflect adaptation to specific life cycles.

  10. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast.

    PubMed

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. (1)H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes.

  11. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection.

    PubMed

    Katsarou, Konstantina; Wu, Yun; Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E; Bryan, Glenn J; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection.

  12. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection

    PubMed Central

    Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E.; Bryan, Glenn J.; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection. PMID:26937634

  13. Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection.

    PubMed

    Katsarou, Konstantina; Wu, Yun; Zhang, Runxuan; Bonar, Nicola; Morris, Jenny; Hedley, Pete E; Bryan, Glenn J; Kalantidis, Kriton; Hornyik, Csaba

    2016-01-01

    Potato (Solanum tuberosum L) is a natural host of Potato spindle tuber viroid (PSTVd) which can cause characteristic symptoms on developing plants including stunting phenotype and distortion of leaves and tubers. PSTVd is the type species of the family Pospiviroidae, and can replicate in the nucleus and move systemically throughout the plant. It is not well understood how the viroid can affect host genes for successful invasion and which genes show altered expression levels upon infection. Our primary focus in this study is the identification of genes which can affect tuber formation since viroid infection can strongly influence tuber development and especially tuber shape. In this study, we used a large-scale method to identify differentially expressed genes in potato. We have identified defence, stress and sugar metabolism related genes having altered expression levels upon infection. Additionally, hormone pathway related genes showed significant up- or down-regulation. DWARF1/DIMINUTO, Gibberellin 7-oxidase and BEL5 transcripts were identified and validated showing differential expression in viroid infected tissues. Our study suggests that gibberellin and brassinosteroid pathways have a possible role in tuber development upon PSTVd infection. PMID:26937634

  14. Differential, Positional-Dependent Transcriptional Response of Antigenic Variation (var) Genes to Biological Stress in Plasmodium falciparum

    PubMed Central

    Shalev, Oshrit; Sinay, Rosa; Cowman, Alan

    2009-01-01

    1% of the genes of the human malaria causing agent Plasmodium falciparum belong to the heterogeneous var gene family which encodes P. falciparum erythrocyte membrane protein 1 (PFEMP1). This protein mediates part of the pathogenesis of the disease by causing adherence of infected erythrocytes (IE) to the host endothelium. At any given time, only one copy of the family is expressed on the IE surface. The cues which regulate the allelic exclusion of these genes are not known. We show the existence of a differential expression pattern of these genes upon exposure to biological stress in relation to their positional placement on the chromosome – expression of centrally located var genes is induced while sub-telomeric copies of the family are repressed - this phenomenon orchestrated by the histone deacetylase pfsir2. Moreover, stress was found to cause a switch in the pattern of the expressed var genes thus acting as a regulatory cue. By using pharmacological compounds which putatively affect pfsir2 activity, distinct changes of var gene expression patterns were achieved which may have therapeutic ramifications. As disease severity is partly associated with expression of particular var gene subtypes, manipulation of the IE environment may serve as a mechanism to direct transcription towards less virulent genes. PMID:19730749

  15. TCERG1 Regulates Alternative Splicing of the Bcl-x Gene by Modulating the Rate of RNA Polymerase II Transcription

    PubMed Central

    Montes, Marta; Cloutier, Alexandre; Sánchez-Hernández, Noemí; Michelle, Laetitia; Lemieux, Bruno; Blanchette, Marco; Hernández-Munain, Cristina; Chabot, Benoit

    2012-01-01

    Complex functional coupling exists between transcriptional elongation and pre-mRNA alternative splicing. Pausing sites and changes in the rate of transcription by RNA polymerase II (RNAPII) may therefore have fundamental impacts in the regulation of alternative splicing. Here, we show that the elongation and splicing-related factor TCERG1 regulates alternative splicing of the apoptosis gene Bcl-x in a promoter-dependent manner. TCERG1 promotes the splicing of the short isoform of Bcl-x (Bcl-xs) through the SB1 regulatory element located in the first half of exon 2. Consistent with these results, we show that TCERG1 associates with the Bcl-x pre-mRNA. A transcription profile analysis revealed that the RNA sequences required for the effect of TCERG1 on Bcl-x alternative splicing coincide with a putative polymerase pause site. Furthermore, TCERG1 modifies the impact of a slow polymerase on Bcl-x alternative splicing. In support of a role for an elongation mechanism in the transcriptional control of Bcl-x alternative splicing, we found that TCERG1 modifies the amount of pre-mRNAs generated at distal regions of the endogenous Bcl-x. Most importantly, TCERG1 affects the rate of RNAPII transcription of endogenous human Bcl-x. We propose that TCERG1 modulates the elongation rate of RNAPII to relieve pausing, thereby activating the proapoptotic Bcl-xS 5′ splice site. PMID:22158966

  16. [Transcriptional analysis of the Grp gene, a genomic homolog of the retrotransposon gypsy gag gene, in Drosophila melanogaster].

    PubMed

    Nefedova, L N; Kuz'min, I V; Burmistrova, D A; Rezazadekh, S; Kim, A I

    2011-08-01

    In the present work, we studied the Grp gene (CG4680, Gag related protein) expression at the transcriptional level. It was found that at the embryonic and larval stages of D. melanogaster development the Grp expression proceeds at a low level, but it significantly increases at the adult stage. Adult individuals display a tissue-specific expression: an eleveated level of transcription is observed in the gut tissues, but not in the chitin carcass, head, and gonads. Since the gut may potentially be a primary barrier for the penetration of a viral infection, we conducted a comparative analysis of Grp gene transcription in D. melanogaster strains differing in the presence of active copies of the gypsy errantivirus and in the status of the flamenco gene controlling sensitivity to errantiviral infections. No noticeable differences in the level of Grp gene transcription were revealed. Thus, the Grp gene is not a pseudogene, but it is a functional gene of the D. melanogaster genome whose role remains to be elucidated.

  17. [Transcriptional analysis of the Grp gene, a genomic homolog of the retrotransposon gypsy gag gene, in Drosophila melanogaster].

    PubMed

    Nefedova, L N; Kuz'min, I V; Burmistrova, D A; Rezazadekh, S; Kim, A I

    2011-08-01

    In the present work, we studied the Grp gene (CG4680, Gag related protein) expression at the transcriptional level. It was found that at the embryonic and larval stages of D. melanogaster development the Grp expression proceeds at a low level, but it significantly increases at the adult stage. Adult individuals display a tissue-specific expression: an eleveated level of transcription is observed in the gut tissues, but not in the chitin carcass, head, and gonads. Since the gut may potentially be a primary barrier for the penetration of a viral infection, we conducted a comparative analysis of Grp gene transcription in D. melanogaster strains differing in the presence of active copies of the gypsy errantivirus and in the status of the flamenco gene controlling sensitivity to errantiviral infections. No noticeable differences in the level of Grp gene transcription were revealed. Thus, the Grp gene is not a pseudogene, but it is a functional gene of the D. melanogaster genome whose role remains to be elucidated. PMID:21954611

  18. Medusa structure of the gene regulatory network: dominance of transcription factors in cancer subtype classification.

    PubMed

    Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui

    2011-05-01

    Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.

  19. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    PubMed Central

    Ha, Misook; Hong, Soondo

    2016-01-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac. PMID:27075878

  20. VIP gene transcription is regulated by far upstream enhancer and repressor elements.

    PubMed

    Liu, D; Krajniak, K; Chun, D; Sena, M; Casillas, R; Lelièvre, V; Nguyen, T; Bravo, D; Colburn, S; Waschek, J A

    2001-06-01

    SK-N-SH human neuroblastoma subclones differ widely in basal and second messenger induction of the gene encoding the neuropeptide vasoactive intestinal peptide (VIP). These differences were recapitulated by a chimeric gene which consisted of 5.2 kb of the human VIP gene 5' flanking sequence fused to a reporter. Subsequent gene deletion experiments revealed several regulatory regions on the gene, including a 645-bp sequence located approximately 4.0 upstream from the transcription start site. Here we examined this upstream region in detail. Inhibitory sequences were found to be present on each end of the 645-bp fragment. When removed, basal transcription increased more than 50-fold. Subsequent deletion/mutation analysis showed that the 213-bp fragment contained at least two enhancer elements. One of these was localized to an AT-rich 42-bp sequence shown by others to bind Oct proteins in neuroblastoma cells, while the other corresponded to a composite AP-1/ets element. In addition to these enhancers, a 28-bp sequence on the 213-bp fragment with no apparent homology to known silencers inhibited transcription. The studies provide molecular details of a complex regulatory region on the VIP gene that is likely to be used to finely tune the level of gene transcription in vivo.

  1. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    NASA Astrophysics Data System (ADS)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  2. Transcription of the procyclic acidic repetitive protein genes of Trypanosoma brucei.

    PubMed Central

    Clayton, C E; Fueri, J P; Itzhaki, J E; Bellofatto, V; Sherman, D R; Wisdom, G S; Vijayasarathy, S; Mowatt, M R

    1990-01-01

    The procyclic acidic repetitive protein (parp) genes of Trypanosoma brucei encode a small family of abundant surface proteins whose expression is restricted to the procyclic form of the parasite. They are found at two unlinked loci, parpA and parpB; transcription of both loci is developmentally regulated. The region of homology upstream of the A and B parp genes is only 640 base pairs long and may contain sequences responsible for transcriptional initiation and regulation. Transcription upstream of this putative promoter region is not developmentally regulated and is much less active than that of the parp genes; the polymerase responsible is inhibited by alpha-amanitin, whereas that transcribing the parp genes is not. Transcription of the parp genes is strongly stimulated by low levels of UV irradiation. The putative parp promoter, when placed upstream of the chloramphenicol acetyltransferase gene, is sufficient to cause production of chloramphenicol acetyltransferase in a T. brucei DNA transformation assay. Taken together, these results suggest that a promoter for an alpha-amanitin-resistant RNA polymerase lies less than 600 nucleotides upstream of the parp genes. Images PMID:2342468

  3. Global transcription network incorporating distal regulator binding reveals selective cooperation of cancer drivers and risk genes

    PubMed Central

    Kim, Kwoneel; Yang, Woojin; Lee, Kang Seon; Bang, Hyoeun; Jang, Kiwon; Kim, Sang Cheol; Yang, Jin Ok; Park, Seongjin; Park, Kiejung; Choi, Jung Kyoon

    2015-01-01

    Global network modeling of distal regulatory interactions is essential in understanding the overall architecture of gene expression programs. Here, we developed a Bayesian probabilistic model and computational method for global causal network construction with breast cancer as a model. Whereas physical regulator binding was well supported by gene expression causality in general, distal elements in intragenic regions or loci distant from the target gene exhibited particularly strong functional effects. Modeling the action of long-range enhancers was critical in recovering true biological interactions with increased coverage and specificity overall and unraveling regulatory complexity underlying tumor subclasses and drug responses in particular. Transcriptional cancer drivers and risk genes were discovered based on the network analysis of somatic and genetic cancer-related DNA variants. Notably, we observed that the risk genes were functionally downstream of the cancer drivers and were selectively susceptible to network perturbation by tumorigenic changes in their upstream drivers. Furthermore, cancer risk alleles tended to increase the susceptibility of the transcription of their associated genes. These findings suggest that transcriptional cancer drivers selectively induce a combinatorial misregulation of downstream risk genes, and that genetic risk factors, mostly residing in distal regulatory regions, increase transcriptional susceptibility to upstream cancer-driving somatic changes. PMID:26001967

  4. Transcriptional control of MHC class II gene expression during differentiation from B cells to plasma cells.

    PubMed

    Dellabona, P; Latron, F; Maffei, A; Scarpellino, L; Accolla, R S

    1989-04-15

    In this study we investigated the molecular mechanisms responsible for the extinction of the constitutive MHC class II gene expression of human B cells on somatic cell hybridization with murine plasmocytoma cells. We found that this event is due to trans-acting suppressor functions of mouse origin pre-existing in the plasmocytoma cells and acting at transcriptional level. Transcription of the entire family of human class II genes is suppressed, including genes as DO beta for which a distinct regulation of expression in B cells had been previously demonstrated. Suppression appears specific for class II genes because in the hybrids expression of MHC class I genes of mouse is unaffected and of human only partially reduced. Interestingly, also murine invariant chain gene is expressed in both parental plasmocytoma and hybrid cells although at reduced amounts as compared to a murine class II positive B cell line. The class II negative phenotype of hybrid cells and parental plasmocytoma cells is highly stable and unaffected by treatment with protein synthesis inhibitors, suggesting that the transcriptional suppressor function is not mediated by rapid, labile turning-over proteins. Possible mechanisms responsible for transcriptional regulation of MHC class II gene expression during terminal differentiation of B cells to plasma cells are discussed. PMID:2495328

  5. Analysis of BMP4 and BMP7 signaling in breast cancer cells unveils time-dependent transcription patterns and highlights a common synexpression group of genes

    PubMed Central

    2011-01-01

    Background Bone morphogenetic proteins (BMPs) are members of the TGF-beta superfamily of growth factors. They are known for their roles in regulation of osteogenesis and developmental processes and, in recent years, evidence has accumulated of their crucial functions in tumor biology. BMP4 and BMP7, in particular, have been implicated in breast cancer. However, little is known about BMP target genes in the context of tumor. We explored the effects of BMP4 and BMP7 treatment on global gene transcription in seven breast cancer cell lines during a 6-point time series, using a whole-genome oligo microarray. Data analysis included hierarchical clustering of differentially expressed genes, gene ontology enrichment analyses and model based clustering of temporal data. Results Both ligands had a strong effect on gene expression, although the response to BMP4 treatment was more pronounced. The cellular functions most strongly affected by BMP signaling were regulation of transcription and development. The observed transcriptional response, as well as its functional outcome, followed a temporal sequence, with regulation of gene expression and signal transduction leading to changes in metabolism and cell proliferation. Hierarchical clustering revealed distinct differences in the response of individual cell lines to BMPs, but also highlighted a synexpression group of genes for both ligands. Interestingly, the majority of the genes within these synexpression groups were shared by the two ligands, probably representing the core molecular responses common to BMP4 and BMP7 signaling pathways. Conclusions All in all, we show that BMP signaling has a remarkable effect on gene transcription in breast cancer cells and that the functions affected follow a logical temporal pattern. Our results also uncover components of the common cellular transcriptional response to BMP4 and BMP7. Most importantly, this study provides a list of potential novel BMP target genes relevant in breast cancer

  6. In silico analysis of polymorphisms in microRNAs that target genes affecting aerobic glycolysis

    PubMed Central

    Venkatesh, Thejaswini; Tsutsumi, Rie

    2016-01-01

    Background Cancer cells preferentially metabolize glucose through aerobic glycolysis, an observation known as the Warburg effect. Recently, studies have deciphered the role of oncogenes and tumor suppressor genes in regulating the Warburg effect. Furthermore, mutations in glycolytic enzymes identified in various cancers highlight the importance of the Warburg effect at the molecular and cellular level. MicroRNAs (miRNAs) are non-coding RNAs that posttranscriptionally regulate gene expression and are dysregulated in the pathogenesis of various types of human cancers. Single nucleotide polymorphisms (SNPs) in miRNA genes may affect miRNA biogenesis, processing, function, and stability and provide additional complexity in the pathogenesis of cancer. Moreover, mutations in miRNA target sequences in target mRNAs can affect expression. Methods In silico analysis and cataloguing polymorphisms in miRNA genes that target genes directly or indirectly controlling aerobic glycolysis was carried out using different publically available databases. Results miRNA SNP2.0 database revealed several SNPs in miR-126 and miR-25 in the upstream and downstream pre-miRNA flanking regions respectively should be inserted after flanking regions and miR-504 and miR-451 had the fewest. These miRNAs target genes that control aerobic glycolysis indirectly. SNPs in premiRNA genes were found in miR-96, miR-155, miR-25 and miR34a by miRNASNP. Dragon database of polymorphic regulation of miRNA genes (dPORE-miRNA) database revealed several SNPs that modify transcription factor binding sites (TFBS) or creating new TFBS in promoter regions of selected miRNA genes as analyzed by dPORE-miRNA. Conclusions Our results raise the possibility that integration of SNP analysis in miRNA genes with studies of metabolic adaptations in cancer cells could provide greater understanding of oncogenic mechanisms. PMID:27004216

  7. Nuclear translocation uncovers the amyloid peptide Aβ42 as a regulator of gene transcription.

    PubMed

    Barucker, Christian; Harmeier, Anja; Weiske, Joerg; Fauler, Beatrix; Albring, Kai Frederik; Prokop, Stefan; Hildebrand, Peter; Lurz, Rudi; Heppner, Frank L; Huber, Otmar; Multhaup, Gerhard

    2014-07-18

    Although soluble species of the amyloid-β peptide Aβ42 correlate with disease symptoms in Alzheimer disease, little is known about the biological activities of amyloid-β (Aβ). Here, we show that Aβ peptides varying in lengths from 38 to 43 amino acids are internalized by cultured neuroblastoma cells and can be found in the nucleus. By three independent methods, we demonstrate direct detection of nuclear Aβ42 as follows: (i) biochemical analysis of nuclear fractions; (ii) detection of biotin-labeled Aβ in living cells by confocal laser scanning microscopy; and (iii) transmission electron microscopy of Aβ in cultured cells, as well as brain tissue of wild-type and transgenic APPPS1 mice (overexpression of amyloid precursor protein and presenilin 1 with Swedish and L166P mutations, respectively). Also, this study details a novel role for Aβ42 in nuclear signaling, distinct from the amyloid precursor protein intracellular domain. Chromatin immunoprecipitation showed that Aβ42 specifically interacts as a repressor of gene transcription with LRP1 and KAI1 promoters. By quantitative RT-PCR, we confirmed that mRNA levels of the examined candidate genes were exclusively decreased by the potentially neurotoxic Aβ42 wild-type peptide. Shorter peptides (Aβ38 or Aβ40) and other longer peptides (nontoxic Aβ42 G33A substitution or Aβ43) did not affect mRNA levels. Overall, our data indicate that the nuclear translocation of Aβ42 impacts gene regulation, and deleterious effects of Aβ42 in Alzheimer disease pathogenesis may be influenced by altering the expression profiles of disease-modifying genes.

  8. Transcriptional Analysis of the Conjugal Transfer Genes of Rickettsia bellii RML 369-C

    PubMed Central

    Heu, Chan C.; Kurtti, Timothy J.; Nelson, Curtis M.; Munderloh, Ulrike G.

    2015-01-01

    Rickettsia bellii is an obligate intracellular bacterium that is one of the few rickettsiae that encode a complete set of conjugative transfer (tra) genes involved in bacterial conjugation and has been shown to exhibit pili-like structures. The reductive genomes of rickettsiae beg the question whether the tra genes are nonfunctional or functioning to enhance the genetic plasticity and biology of rickettsiae. We characterized the transcriptional dynamics of R. bellii tra genes in comparison to genes transcribed stably and above the background level to understand when and at what levels the tra genes are active or whether the tra genes are degenerative. We determined that the best reference genes, out of 10 tested, were methionyl tRNA ligase (metG) or a combination of metG and ribonucleoside diphosphate reductase 2 subunit beta (nrdF), using statistical algorithms from two different programs: Normfinder and BestKeeper. To validate the use of metG with other rickettsial genes exhibiting variable transcriptional patterns we examined its use with sca2 and rickA, genes involved in actin based motility. Both were shown to be up-regulated at different times of replication in Vero cells, showing variable and stable transcription levels of rickA and sca2, respectively. traATi was up-regulated at 72 hours post inoculation in the tick cell line ISE6, but showed no apparent changes in the monkey cell line Vero and mouse cell line L929. The transcription of tra genes was positively correlated with one another and up-regulated from 12 to 72 hours post inoculation (HPI) when compared to RBE_0422 (an inactivated transposase-derivative found within the tra cluster). Thus, the up-regulation of the tra genes indicated that the integrity and activity of each gene were intact and may facilitate the search for the optimal conditions necessary to demonstrate conjugation in rickettsiae. PMID:26352829

  9. Transcription of Quorum-Sensing System Genes in Clinical and Environmental Isolates of Pseudomonas aeruginosa

    PubMed Central

    Cabrol, Ségolène; Olliver, Anne; Pier, Gerald B.; Andremont, Antoine; Ruimy, Raymond

    2003-01-01

    Quorum sensing (QS)-based transcriptional responses in Pseudomonas aeruginosa have been defined on the basis of increases in transcript levels of QS-controlled genes such as lasB and aprA following the hierarchical transcriptional increases of central controllers such as the lasR gene. These increases occur at high bacterial concentrations such as early-stationary-phase growth in vitro. However, the extent to which the increases occur in a variety of clinical and environmental isolates has not been determined nor is there extensive information on allelic variation in lasR genes. An analysis of the sequences of the lasR gene among 66 clinical and environmental isolates showed that 81% have a sequence either identical to that of strain PAO1 or with a silent mutation, 15% have nucleotide changes resulting in amino acid changes, and 5% have an insertion sequence in the lasR gene. Using real-time PCR to quantify transcript levels of lasR, lasB, and aprA in the early log and early stationary phases among 35 isolates from bacteremia and pneumonia cases and the environment, we found most (33 of 35) strains had increases in lasR transcripts in early stationary phase but with a very wide range of final transcript levels per cell. There was a strong correlation (r2 = 0.84) between early-log- and early-stationary-phase transcript levels in all strains, but this finding remained true only for the 50% of strains above the median level of lasR found in early log phase. There were significant (P < 0.05) but weak-to-modest correlations of lasR transcript levels with aprA (r2 = 0.2) and lasB (r2 = 0.5) transcript levels, but again this correlation occurred only in the 50% of P. aeruginosa strains with the highest levels of lasR transcripts in early stationary phase. There were no differences in distribution of lasR alleles among the bacteremia, pneumonia, or environmental isolates. Overall, only about 50% of P. aeruginosa strains from clinical and environmental sources show a las

  10. Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.

    PubMed Central

    Deretic, V; Gill, J F; Chakrabarty, A M

    1987-01-01

    Transcriptional regulation of alginate biosynthesis by Pseudomonas aeruginosa was studied. A DNA region complementing the alg-5 mutation within the alginate gene cluster was found by RNA-DNA dot blot and Northern hybridization to be transcriptionally activated in mucoid P. aeruginosa. This region was subcloned as a 3.2-kilobase BglII-ClaI DNA fragment on the broad-host-range controlled transcription vector pMMB24, and gene products were analyzed by expression from the tac promoter. A 48-kilodalton polypeptide was detected in extracts of P. aeruginosa and 35S-labeled Escherichia coli maxicells. By using the same expression system, GDPmannose dehydrogenase activity was detected in both P. aeruginosa and E. coli. Thus, gene algD coding for this enzyme was found to be present in the transcriptionally active DNA area. Insertion of the xylE gene within the BglII-ClaI fragment disrupted the induction of the 48-kilodalton polypeptide, GDPmannose dehydrogenase activity, and alg-5 complementing ability. With the algD-xylE transcription fusion, activation of algD gene expression was shown to occur in mucoid P. aeruginosa of different origins. In addition, regulation of the algD promoter activity was demonstrated to be mediated by a diffusible factor. Images PMID:3025179

  11. Gα13 regulates MEF2-dependent gene transcription in endothelial cells: role in angiogenesis

    PubMed Central

    Liu, Guoquan; Han, Jingyan; Profirovic, Jasmina; Strekalova, Elena; Voyno-Yasenetskaya, Tatyana A.

    2010-01-01

    The α subunit of heterotrimeric G13 protein is required for the embryonic angiogenesis (Offermanns et al., Science 275:533–536, 1997). However, the molecular mechanism of Gα13-dependent angiogenesis is not understood. Here, we show that myocyte-specific enhancer factor-2 (MEF2) mediates Gα13-dependent angiogenesis. Our data showed that constitutively activated Gα13Q226L stimulated MEF2-dependent gene transcription. In addition, downregulation of endogenous Gα13 inhibited thrombin-stimulated MEF2-dependent gene transcription in endothelial cells. Both Ca2+/calmodulin-dependent kinase IV (CaMKIV) and histone deacetylase 5 (HDAC5) were involved in Gα13-mediated MEF2-dependent gene transcription. Gα13Q226L also increased Ca2+/calmodulin-independent CaMKIV activity, while dominant negative mutant of CaMKIV inhibited MEF2-dependent gene transcription induced by Gα13Q226L. Furthermore, Gα13Q226L was able to derepress HDAC5-mediated repression of gene transcription and induce the translocation of HDAC5 from nucleus to cytoplasm. Finally, downregulation of endogenous Gα13 and MEF2 proteins in endothelial cells reduced cell proliferation and capillary tube formation. Decrease of endothelial cell proliferation that was caused by the Gα13 downregulation was partially restored by the constitutively active MEF2-VP16. Our studies suggest that MEF2 proteins are an important component in Gα13-mediated angiogenesis. PMID:19093215

  12. The mean first passage time and stochastic resonance in gene transcriptional system with time delay

    NASA Astrophysics Data System (ADS)

    Feng, Y. L.; Zhu, J.; Zhang, M.; Gao, L. L.; Liu, Y. F.; Dong, J. M.

    2016-04-01

    In this paper, the gene transcriptional dynamics driven by correlated noises are investigated, where the time delay for the synthesis of transcriptional factor is introduced. The effects of the noise correlation strength and time delay on the stationary probability distribution (SPD), the mean first passage time and the stochastic resonance (SR) are analyzed in detail based on the delay Fokker-Planck equation. It is found that both the time delay and noise correlation strength play important roles in the bistable transcriptional system. The effect of the correlation strength reduces but the time delay enhances the mean first passage time (MFPT). Finally, the SR for this gene transcriptional system is found to be enhanced by the time delay.

  13. Isolation of Arabidopsis nuclei and measurement of gene transcription rates using nuclear run-on assays.

    PubMed

    Folta, Kevin M; Kaufman, Lon S

    2006-01-01

    Isolation of transcriptionally active nuclei from plant tissues is a fundamental first step in many plant molecular biology protocols. Enriched nuclear fractions may be used in "run-on" assays to measure the rate of transcription for any given gene, adding additional resolution to assays of steady-state transcript accumulation such as RNA-gel blots, RT-PCR or microarrays. The protocols presented here streamline, adapt and optimize existing methods for use in Arabidopsis thaliana. Plant materials are ground in hexylene glycol-based buffers and highly enriched nuclear fractions are obtained using Percoll density gradients. Standard and small-scale protocols are presented, along with a tested method for nuclear run-on assays. The entire process may be completed within 3 days. This capability complements the immense body of steady-state transcript measurements and indirectly identifies instances where message turnover may have a critical and/or primary role in regulating gene expression levels.

  14. Genome Wide Binding Site Analysis Reveals Transcriptional Coactivation of Cytokinin-Responsive Genes by DELLA Proteins

    PubMed Central

    Marín-de la Rosa, Nora; Pfeiffer, Anne; Hill, Kristine; Locascio, Antonella; Bhalerao, Rishikesh P.; Miskolczi, Pal; Grønlund, Anne L.; Wanchoo-Kohli, Aakriti; Thomas, Stephen G.; Bennett, Malcolm J.; Lohmann, Jan U.; Blázquez, Miguel A.; Alabadí, David

    2015-01-01

    The ability of plants to provide a plastic response to environmental cues relies on the connectivity between signaling pathways. DELLA proteins act as hubs that relay environmental information to the multiple transcriptional circuits that control growth and development through physical interaction with transcription factors from different families. We have analyzed the presence of one DELLA protein at the Arabidopsis genome by chromatin immunoprecipitation coupled to large-scale sequencing and we find that it binds at the promoters of multiple genes. Enrichment analysis shows a strong preference for cis elements recognized by specific transcription factor families. In particular, we demonstrate that DELLA proteins are recruited by type-B ARABIDOPSIS RESPONSE REGULATORS (ARR) to the promoters of cytokinin-regulated genes, where they act as transcriptional co-activators. The biological relevance of this mechanism is underpinned by the necessity of simultaneous presence of DELLAs and ARRs to restrict root meristem growth and to promote photomorphogenesis. PMID:26134422

  15. Dependence of Enhancer-Mediated Transcription of the Immunoglobulin μ Gene on Nuclear Matrix Attachment Regions

    NASA Astrophysics Data System (ADS)

    Forrester, William C.; van Genderen, Courtney; Jenuwein, Thomas; Grosschedl, Rudolf

    1994-08-01

    Transcription of the immunoglobulin μ heavy chain locus is regulated by an intronic enhancer that is flanked on both sides by nuclear matrix attachment regions (MARs). These MARs have now been shown to be essential for transcription of a rearranged μ gene in transgenic B lymphocytes, but they were not required in stably transfected tissue culture cells. Normal rates of transcriptional initiation at a variable region promoter and the formation of an extended deoxyribonuclease I (DNase I)-sensitive chromatin domain were dependent on MARs, although DNase I hypersensitivity at the enhancer was detected in the absence of MARs. Thus, transcriptional activation of the μ gene during normal lymphoid development requires a synergistic collaboration between the enhancer and flanking MARs.

  16. Transcription of the interleukin 4 gene is regulated by multiple promoter elements

    PubMed Central

    1993-01-01

    Activation of T helper cell 1 (Th1) and Th2 results in transcription of the interleukin 2 (IL-2) and IL-4 cytokine genes, respectively. Whereas many of the regulatory elements and factors responsible for IL-2 transcription in T cells are well defined, little is known about parallel mechanisms that drive transcription of the IL-4 gene. Here we have analyzed the murine IL-4 promoter, both in vivo and in a Th2 clone. 3 kb of IL-4 upstream sequence is shown to be sufficient to achieve tissue-specific and inducible expression of a thymidine kinase reporter gene in vivo in a manner that mirrors the expression of endogenous IL-4. Tissue-specific and inducible expression is also demonstrated in a Th2 clone, but not in a B cell line. Deletional and mutational analysis of the IL-4 promoter demonstrated that sequences from -100 to -28 were necessary for a transcriptional response to Concanavalin A or anti-CD3 monoclonal antibody. An overlapping, yet smaller region, spanning the sequences from -60 to -28 bp was shown to be required for the response to ionomycin. Mutation of an 8-bp region from -43 to -35 of the IL-4 promoter completely abrogated IL-4 gene transcription in response to all stimuli tested. In addition, our results show that the effects of the immunosuppressive agent Cyclosporin A map to the same DNA sequences as the positive control elements. These results identify DNA sequences that are functionally important for the control of IL-4 gene transcription both in vivo and in vitro. Although these sequences are highly conserved in the human and murine IL-4 genes, they are largely not present in the IL-2 enhancer complex. Thus, cytokine-specific cis-acting elements may be one mechanism by which these two cytokine genes are differentially regulated. PMID:8496684

  17. Transcriptional Gene Silencing Mediated by a Plastid Inner Envelope Phosphoenolpyruvate/Phosphate Translocator CUE1 in Arabidopsis1[OA

    PubMed Central

    Shen, Jie; Ren, Xiaozhi; Cao, Rui; Liu, Jun; Gong, Zhizhong

    2009-01-01

    Mutations in REPRESSOR OF SILENCING1 (ROS1) lead to the transcriptional gene silencing (TGS) of ProRD29A:LUC (LUCIFERASE) and Pro35S:NPTII (Neomycin Phosphotransferase II) reporter genes. We performed a genetic screen to find suppressors of ros1 that identified two mutant alleles in the Arabidopsis (Arabidopsis thaliana) CHLOROPHYLL A/B BINDING PROTEIN UNDEREXPRESSED1 (CUE1) gene, which encodes a plastid inner envelope phosphoenolpyruvate/phosphate translocator. The cue1 mutations released the TGS of Pro35S:NPTII and the transcriptionally silent endogenous locus TRANSCRIPTIONAL SILENCING INFORMATION in a manner that was independent of DNA methylation but dependent on chromatin modification. The cue1 mutations did not affect the TGS of ProRD29A:LUC in ros1, which was dependent on RNA-directed DNA methylation. It is possible that signals from chloroplasts help to regulate the epigenetic status of a subset of genomic loci in the nucleus. PMID:19515789

  18. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

    PubMed

    Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

    2015-10-01

    Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish. PMID:26057477

  19. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

    PubMed

    Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

    2015-10-01

    Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish.

  20. Upstream regions of the human cardiac actin gene that modulate its transcription in muscle cells: presence of an evolutionarily conserved repeated motif.

    PubMed Central

    Minty, A; Kedes, L

    1986-01-01

    Transfection into cultured cell lines was used to investigate the transcriptional regulation of the human cardiac actin gene. We first demonstrated that in both human heart and human skeletal muscle, cardiac actin mRNAs initiate at the identical site and contain the same first exon, which is separated from the first coding exon by an intron of 700 base pairs. A region of 485 base pairs upstream from the transcription initiation site of the human cardiac actin gene<