Affective immunology: where emotions and the immune response converge.
D'Acquisto, Fulvio
2017-03-01
Affect and emotion are defined as "an essential part of the process of an organism's interaction with stimuli." Similar to affect, the immune response is the "tool" the body uses to interact with the external environment. Thanks to the emotional and immunological response, we learn to distinguish between what we like and what we do not like, to counteract a broad range of challenges, and to adjust to the environment we are living in. Recent compelling evidence has shown that the emotional and immunological systems share more than a similarity of functions. This review article will discuss the crosstalk between these two systems and the need for a new scientific area of research called affective immunology. Research in this field will allow a better understanding and appreciation of the immunological basis of mental disorders and the emotional side of immune diseases.
Jenkins, Brooke N; Hunter, John F; Cross, Marie P; Acevedo, Amanda M; Pressman, Sarah D
2018-01-01
This study addresses methodological and theoretical questions about the association between affect and physical health. Specifically, we examine the role of affect variability and its interaction with mean levels of affect to predict antibody (Ab) levels in response to an influenza vaccination. Participants (N=83) received the vaccination and completed daily diary measures of affect four times a day for 13days. At one and four months post-vaccination, blood was collected from the participants to assess Ab levels. Findings indicate that affect variability and its interaction with mean levels of affect predict an individual's immune response. Those high in mean positive affect (PA) who had more PA variability were more likely to have a lower Ab response in comparison to those who had high mean PA and less PA variability. Although it did not interact with mean negative affect (NA), NA variability on its own was associated with Ab response, whereby those with less NA variability mounted a more robust immune response. Affect variability is related to immune response to an influenza vaccination and, in some cases, interacts with mean levels of affect. These oscillations in affective experiences are critical to consider in order to unpack the intricacies of how affect influences health. These findings suggest that future researchers should consider the important role of affect variability on physical health-relevant outcomes as well as examine the moderating effect of mean affect levels. Copyright © 2017 Elsevier Inc. All rights reserved.
Higher whole-blood selenium is associated with improved immune responses in footrot-affected sheep.
Hall, Jean A; Sendek, Rachel L; Chinn, Rachel M; Bailey, D Paul; Thonstad, Katie N; Wang, Yongqiang; Forsberg, Neil E; Vorachek, William R; Stang, Bernadette V; Van Saun, Robert J; Bobe, Gerd
2011-09-06
We reported previously that sheep affected with footrot (FR) have lower whole-blood selenium (WB-Se) concentrations and that parenteral Se-supplementation in conjunction with routine control practices accelerates recovery from FR. The purpose of this follow-up study was to investigate the mechanisms by which Se facilitates recovery from FR. Sheep affected with FR (n = 38) were injected monthly for 15 months with either 5 mg Se (FR-Se) or saline (FR-Sal), whereas 19 healthy sheep received no treatment. Adaptive immune function was evaluated after 3 months of Se supplementation by immunizing all sheep with a novel protein, keyhole limpet hemocyanin (KLH). The antibody titer and delayed-type hypersensitivity (DTH) skin test to KLH were used to assess humoral immunity and cell-mediated immunity, respectively. Innate immunity was evaluated after 3 months of Se supplementation by measuring intradermal responses to histamine 30 min after injection compared to KLH and saline, and after 15 months of Se supplementation by isolating neutrophils and measuring their bacterial killing ability and relative abundance of mRNA for genes associated with neutrophil migration. Compared to healthy sheep, immune responses to a novel protein were suppressed in FR-affected sheep with smaller decreases in FR-affected sheep that received Se or had WB-Se concentrations above 250 ng/mL at the time of the immune assays. Neutrophil function was suppressed in FR-affected sheep, but was not changed by Se supplementation or WB-Se status. Sheep FR is associated with depressed immune responses to a novel protein, which may be partly restored by improving WB-Se status (> 250 ng/mL).
Higher whole-blood selenium is associated with improved immune responses in footrot-affected sheep
2011-01-01
We reported previously that sheep affected with footrot (FR) have lower whole-blood selenium (WB-Se) concentrations and that parenteral Se-supplementation in conjunction with routine control practices accelerates recovery from FR. The purpose of this follow-up study was to investigate the mechanisms by which Se facilitates recovery from FR. Sheep affected with FR (n = 38) were injected monthly for 15 months with either 5 mg Se (FR-Se) or saline (FR-Sal), whereas 19 healthy sheep received no treatment. Adaptive immune function was evaluated after 3 months of Se supplementation by immunizing all sheep with a novel protein, keyhole limpet hemocyanin (KLH). The antibody titer and delayed-type hypersensitivity (DTH) skin test to KLH were used to assess humoral immunity and cell-mediated immunity, respectively. Innate immunity was evaluated after 3 months of Se supplementation by measuring intradermal responses to histamine 30 min after injection compared to KLH and saline, and after 15 months of Se supplementation by isolating neutrophils and measuring their bacterial killing ability and relative abundance of mRNA for genes associated with neutrophil migration. Compared to healthy sheep, immune responses to a novel protein were suppressed in FR-affected sheep with smaller decreases in FR-affected sheep that received Se or had WB-Se concentrations above 250 ng/mL at the time of the immune assays. Neutrophil function was suppressed in FR-affected sheep, but was not changed by Se supplementation or WB-Se status. Sheep FR is associated with depressed immune responses to a novel protein, which may be partly restored by improving WB-Se status (> 250 ng/mL). PMID:21896161
Tobin, Erin T.; Kane, Heidi S.; Saleh, Daniel J.; Wildman, Derek E.; Breen, Elizabeth Crabb; Secord, Elizabeth; Slatcher, Richard B.
2015-01-01
Objective Stressful family environments early in life have negative effects on physical health. However, less is known about the health effects of positive aspects of families. We examined the associations between maternal responsiveness and immune markers among youth with asthma and identified youth expressions of positive affect as a potential mechanism of these associations. Methods Forty-three youths with asthma (26 males; aged 10-17) wore the Electronically Activated Recorder (EAR) for four days to assess maternal responsiveness and youth expressions of affect from audio-recordings of daily life. Trained coders rated EAR sound files for expressions of maternal responsiveness and affect displayed by the youth. Peripheral blood mononuclear cells were isolated, cultured, and assayed to determine stimulated levels of interleukin(IL)-5, IL-13, and interferon(IFN)- γ. Results Greater maternal responsiveness was associated with decreased stimulated production of IL-5 (r = −.38, p = .012) and IL-13 (r = −.33, p = .031). Greater total positive affect in youth was linked with decreased stimulated production of IL-5 (r = −.46, p = .002) and IL-13 (r = −.37, p = .014). Total negative affect among youth was unrelated to immune responses. There was a significant indirect effect of maternal responsiveness via positive affect in youth on lower levels of IL-5 (95% CI = −3.41, −.03) and IL-13 (95% CI = −2.34, −.01) when adjusting for caregiver-youth conflict and negative affect among youth. Conclusions These results indicate the importance of positive family interactions for youth and provide preliminary evidence for a mechanism through which parenting can influence immune responses in youths with asthma. PMID:26407226
Tobin, Erin T; Kane, Heidi S; Saleh, Daniel J; Wildman, Derek E; Breen, Elizabeth Crabb; Secord, Elizabeth; Slatcher, Richard B
2015-10-01
Stressful family environments early in life have negative effects on physical health. However, less is known about the health effects of positive aspects of families. We examined the associations between maternal responsiveness and immune markers among youth with asthma and identified youth expressions of positive affect as a potential mechanism of these associations. Forty-three youths with asthma (26 boys; aged 10-17 years) wore the Electronically Activated Recorder for 4 days to assess maternal responsiveness and youth expressions of affect from audio-recordings of daily life. Trained coders rated Electronically Activated Recorder sound files for expressions of maternal responsiveness and affect displayed by the youth. Peripheral blood mononuclear cells were isolated, cultured, and assayed to determine stimulated levels of interleukin (IL)-5, IL-13, and interferon-γ. Greater maternal responsiveness was associated with decreased stimulated production of IL-5 (r = -0.38, p = .012) and IL-13 (r = -0.33, p = .031). Greater total positive affect in youth was linked to decreased stimulated production of IL-5 (r = -0.46, p = .002) and IL-13 (r = -0.37, p = .014). Total negative affect among youth was unrelated to immune responses. There was a significant indirect effect of maternal responsiveness via positive affect in youth on lower levels of IL-5 (95% confidence interval = -3.41 to -0.03) and IL-13 (95% confidence interval = -2.34 to -0.01) when adjusting for caregiver-youth conflict and negative affect among youth. These results indicate the importance of positive family interactions for youth and provide preliminary evidence for a mechanism through which parenting can influence immune responses in youth with asthma.
How Does Optimism Suppress Immunity? Evaluation of Three Affective Pathways
Segerstrom, Suzanne C.
2005-01-01
Studies have linked optimism to poorer immunity during difficult stressors. In the present report, when first-year law students (N = 46) relocated to attend law school, reducing conflict among curricular and extracurricular goals, optimism predicted larger delayed type hypersensitivity responses, indicating more robust in vivo cellular immunity. However, when students did not relocate, increasing goal conflict, optimism predicted smaller responses. Although this effect has been attributed to negative affect when difficult stressors violate optimistic expectancies, distress did not mediate optimism’s effects on immunity. Alternative affective mediators related to engagement – engaged affect and fatigue – likewise failed to mediate optimism’s effects, although all three types of affect independently influenced in vivo immunity. Alternative pathways include effort or self-regulatory depletion. PMID:17014284
Selenium Supplementation Restores Innate and Humoral Immune Responses in Footrot-Affected Sheep
Hall, Jean A.; Vorachek, William R.; Stewart, Whitney C.; Gorman, M. Elena; Mosher, Wayne D.; Pirelli, Gene J.; Bobe, Gerd
2013-01-01
Dietary selenium (Se) alters whole-blood Se concentrations in sheep, dependent upon Se source and dosage administered, but little is known about effects on immune function. We used footrot (FR) as a disease model to test the effects of supranutritional Se supplementation on immune function. To determine the effect of Se-source (organic Se-yeast, inorganic Na-selenite or Na-selenate) and Se-dosage (1, 3, 5 times FDA-permitted level) on FR severity, 120 ewes with and 120 ewes without FR were drenched weekly for 62 weeks with different Se sources and dosages (30 ewes/treatment group). Innate immunity was evaluated after 62 weeks of supplementation by measuring neutrophil bacterial killing ability. Adaptive immune function was evaluated by immunizing sheep with keyhole limpet hemocyanin (KLH). The antibody titer and delayed-type hypersensitivity skin test to KLH were used to assess humoral immunity and cell-mediated immunity, respectively. At baseline, FR-affected ewes had lower whole-blood and serum-Se concentrations; this difference was not observed after Se supplementation. Se supplementation increased neutrophil bacterial killing percentages in FR-affected sheep to percentages observed in supplemented and non-supplemented healthy sheep. Similarly, Se supplementation increased KLH antibody titers in FR-affected sheep to titers observed in healthy sheep. FR-affected sheep demonstrated suppressed cell-mediated immunity at 24 hours after intradermal KLH challenge, although there was no improvement with Se supplementation. We did not consistently prevent nor improve recovery from FR over the 62 week Se-treatment period. In conclusion, Se supplementation does not prevent FR, but does restore innate and humoral immune functions negatively affected by FR. PMID:24340044
Immune responses in space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1998-01-01
Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological
Spaceflight and immune responses of Rhesus monkeys
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1994-01-01
Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.
Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...
USDA-ARS?s Scientific Manuscript database
The alfalfa leafcutting bee (Megachile rotundata) is affected by a fungal disease called chalkbrood. In several species of bees, chalkbrood is more likely to occur in larvae kept at 25-30 C than at 35 C. We found that both high and low temperature stress increased the expression of immune response g...
Pomorska-Mól, Małgorzata; Czyżewska-Dors, Ewelina; Kwit, Krzysztof; Wierzchosławski, Karol; Pejsak, Zygmunt
2015-10-22
Cephalosporins are a class of antibiotics that are active against many Gram-positive and some Gram-negative bacteria. Beyond their antibacterial activity, they are reported to have various immunomodulatory properties. It has been shown that they reduce the secretion of cytokines as well as influence the humoral and cellular immune response. In the field conditions antibiotics are frequently administered at the same time as vaccines in pigs and, in the view of their potential immunomodulatory properties, it is important to examine their effect on the development and persistence of the post-vaccinal immune response. Ceftiofur is a very popular veterinary medicine third-generation cephalosporin with a broad spectrum of activity. It has been shown that it can inhibit cytokines secretion and in this way can potentially affect host immune response. The influence of ceftiofur on the immune response has not yet been investigated in pigs. In the present study we evaluated the influence of therapeutic doses of ceftiofur hydrochloride on the post-vaccinal immune response after vaccination with two model vaccines (live and inactivated). Seventy pigs were divided into five groups: control, unvaccinated (C), control vaccinated against swine influenza (SI-V), control vaccinated against pseudorabies (PR-V), vaccinated against SI during ceftiofur administration (SI-CEF) and vaccinated against PR during ceftiofur administration (PR-CEF). Pigs from SICEF and PR-CEF groups received therapeutic dose of ceftiofur for five days. Pigs from SI-CEF, PR-CEF, SIV and PR-V groups were vaccinated against SI and PR. Antibodies to PRV were determined with the use of blocking ELISA tests (IDEXX Laboratories, USA). Humoral responses to SIV were assessed based on haemagglutination inhibition assay. T-cell response was analyzed with the use of proliferation test. The concentrations of IFN- γ and IL-4 in culture supernatant were determined with the use of ELISA kits Invitrogen Corporation, USA). The
How sex and age affect immune responses, susceptibility to infections, and response to vaccination
Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix
2015-01-01
Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438
Virus-like nanostructures for tuning immune response
NASA Astrophysics Data System (ADS)
Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.
2015-11-01
Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.
Effect of antipyretic analgesics on immune responses to vaccination.
Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B
2016-09-01
While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.
Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens
Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.
2007-01-01
In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440
Effect of antipyretic analgesics on immune responses to vaccination
Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.
2016-01-01
ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296
Climatic anomaly affects the immune competence of California sea lions
Banuet-Martínez, Marina; Espinosa-de Aquino, Wendy; Elorriaga-Verplancken, Fernando R.; Flores-Morán, Adriana; García, Olga P.; Camacho, Mariela
2017-01-01
The past decades have been characterized by a growing number of climatic anomalies. As these anomalies tend to occur suddenly and unexpectedly, it is often difficult to procure empirical evidence of their effects on natural populations. We analysed how the recent sea surface temperature (SST) anomaly in the northeastern Pacific Ocean affects body condition, nutritional status, and immune competence of California sea lion pups. We found that pup body condition and blood glucose levels of the pups were lower during high SST events, although other biomarkers of malnutrition remained unchanged, suggesting that pups were experiencing early stages of starvation. Glucose-dependent immune responses were affected by the SST anomaly; specifically, pups born during high SST events had lower serum concentrations of IgG and IgA, and were unable to respond to an immune challenge. This means that not only were pups that were born during the SST anomaly less able to synthesize protective antibodies; they were also limited in their ability to respond rapidly to nonspecific immune challenges. Our study provides empirical evidence that atypical climatic conditions can limit energetic reserves and compromise physiological responses that are essential for the survival of a marine top predator. PMID:28658317
Spaans, Floor; Melgert, Barbro N; Borghuis, Theo; Klok, Pieter A; de Vos, Paul; Bakker, Winston W; van Goor, Harry; Faas, Marijke M
2014-09-01
Changes in the systemic immune response are found in preeclampsia. This may be related to high extracellular adenosine triphosphate (ATP) levels. The question arose whether ATP could affect immune responses in pregnancy. Previously, we investigated whether ATP affected monocyte activation and subpopulations. Here, we investigated ATP-induced changes in other immune cell populations in pregnant rats, systemically and in the kidney, an affected organ in preeclampsia. Using flow cytometry or immunohistochemistry, blood and kidney leukocytes were studied in pregnant and non-pregnant rats at different intervals after ATP or saline infusion. Adenosine triphosphate (ATP) infusion induced increased peripheral blood non-classical monocytes and decreased T lymphocyte subsets in pregnant rats only, higher glomerular macrophage and T lymphocyte numbers in non-pregnant animals 1 day after infusion, and higher glomerular macrophage numbers in pregnant rats 6 days after infusion. Adenosine triphosphate (ATP) infusion in pregnant rats induced a pregnancy-specific inflammatory response. Increased ATP levels could potentially contribute to development of the inflammatory response of preeclampsia. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Fetal immune response to chorioamnionitis
Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.
2014-01-01
Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922
López, Vladimir; Villar, Margarita; Queirós, João; Vicente, Joaquín; Mateos-Hernández, Lourdes; Díez-Delgado, Iratxe; Contreras, Marinela; Alves, Paulo C.; Alberdi, Pilar; Gortázar, Christian; de la Fuente, José
2016-01-01
Mycobacteria of the Mycobacterium tuberculosis complex (MTBC) greatly impact human and animal health worldwide. The mycobacterial life cycle is complex, and the mechanisms resulting in pathogen infection and survival in host cells are not fully understood. Eurasian wild boar (Sus scrofa) are natural reservoir hosts for MTBC and a model for mycobacterial infection and tuberculosis (TB). In the wild boar TB model, mycobacterial infection affects the expression of innate and adaptive immune response genes in mandibular lymph nodes and oropharyngeal tonsils, and biomarkers have been proposed as correlates with resistance to natural infection. However, the mechanisms used by mycobacteria to manipulate host immune response are not fully characterized. Our hypothesis is that the immune system proteins under-represented in infected animals, when compared to uninfected controls, are used by mycobacteria to guarantee pathogen infection and transmission. To address this hypothesis, a comparative proteomics approach was used to compare host response between uninfected (TB-) and M. bovis-infected young (TB+) and adult animals with different infection status [TB lesions localized in the head (TB+) or affecting multiple organs (TB++)]. The results identified host immune system proteins that play an important role in host response to mycobacteria. Calcium binding protein A9, Heme peroxidase, Lactotransferrin, Cathelicidin and Peptidoglycan-recognition protein were under-represented in TB+ animals when compared to uninfected TB- controls, but protein levels were higher as infection progressed in TB++ animals when compared to TB- and/or TB+ adult wild boar. MHCI was the only protein over-represented in TB+ adult wild boar when compared to uninfected TB- controls. The results reported here suggest that M. bovis manipulates host immune response by reducing the production of immune system proteins. However, as infection progresses, wild boar immune response recovers to limit pathogen
Innate Immune Responses in Leprosy
Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes
2018-01-01
Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852
Caroprese, Mariangela; Ciliberti, Maria Giovanna; Albenzio, Marzia; Annicchiarico, Giovanni; Sevi, Agostino
2015-11-15
The objective of the study was to characterize the immune profile of dairy ewes fed flaxseed, rich in polyunsaturated fatty acids (PUFA), around parturition. The hypothesis to be verified was that a physiological stressor, such as parturition, could be overcome with a nutritional manipulation in the diet of the animal in order to guarantee welfare of animals and to sustain their immune responses. Twenty Comisana ewes were divided in two groups (10 ewes/group), and fed a supplementation of whole flaxseed in the diet (FS group) or no supplementation (CON group). Blood samples were collected at parturition and then 7, 14, 21, 28, and 42 day post partum. Plasma samples were used to assess the humoral immune response after ovalbumin (OVA) immunization. At parturition, at 14 day, and 42 day post partum the level of plasma cytokines was assessed. The sheep showed a reduced responsiveness to OVA immunization. In FS ewes the IL-6 level remained unchanged until 14 day post partum and then significantly decreased from 14 day to 42 day post partum. IL-10 level was significantly higher in FS ewes than in CON ewes at 14 day. At parturition IL-1β level was significantly lower in FS ewes than in CON ewes and significantly decreased in both groups from parturition to 42 day. In conclusion, PUFA from flaxseed, as supplement in the diet of ewes around parturition can modulate sheep immune reactivity by influencing cytokine production. Copyright © 2015 Elsevier B.V. All rights reserved.
Berger, Christoph T; Greiff, Victor; Mehling, Matthias; Fritz, Stefanie; Meier, Marc A; Hoenger, Gideon; Conen, Anna; Recher, Mike; Battegay, Manuel; Reddy, Sai T; Hess, Christoph
2015-01-01
Vaccines dramatically reduce infection-related morbidity and mortality. Determining factors that modulate the host response is key to rational vaccine design and demands unsupervised analysis. To longitudinally resolve influenza-specific humoral immune response dynamics we constructed vaccine response profiles of influenza A- and B-specific IgM and IgG levels from 42 healthy and 31 HIV infected influenza-vaccinated individuals. Pre-vaccination antibody levels and levels at 3 predefined time points after vaccination were included in each profile. We performed hierarchical clustering on these profiles to study the extent to which HIV infection associated immune dysfunction, adaptive immune factors (pre-existing influenza-specific antibodies, T cell responses), an innate immune factor (Mannose Binding Lectin, MBL), demographic characteristics (gender, age), or the vaccine preparation (split vs. virosomal) impacted the immune response to influenza vaccination. Hierarchical clustering associated vaccine preparation and pre-existing IgG levels with the profiles of healthy individuals. In contrast to previous in vitro and animal data, MBL levels had no impact on the adaptive vaccine response. Importantly, while HIV infected subjects with low CD4 T cell counts showed a reduced magnitude of their vaccine response, their response profiles were indistinguishable from those of healthy controls, suggesting quantitative but not qualitative deficits. Unsupervised profile-based analysis ranks factors impacting the vaccine-response by relative importance, with substantial implications for comparing, designing and improving vaccine preparations and strategies. Profile similarity between HIV infected and HIV negative individuals suggests merely quantitative differences in the vaccine response in these individuals, offering a rationale for boosting strategies in the HIV infected population.
Factors that deregulate the protective immune response in tuberculosis.
Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana
2009-01-01
Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.
Costs of mounting an immune response during pregnancy in a lizard.
Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald
2013-01-01
Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.
Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.
Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy
2018-02-01
We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.
Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam
2017-01-01
Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086
Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.
Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi
2018-04-16
While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Modulation of Human Immune Response by Fungal Biocontrol Agents
Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane
2017-01-01
Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107
Zimmermann, Michael T; Oberg, Ann L; Grill, Diane E; Ovsyannikova, Inna G; Haralambieva, Iana H; Kennedy, Richard B; Poland, Gregory A
2016-01-01
Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50-74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant's propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens.
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
French, Susannah S.; Chester, Emily M.; Demas, Gregory E.
2016-01-01
Maternal influences are an important contributing factor to offspring survival, development, and behavior. Common environmental pathogens can induce maternal immune responses and affect subsequent development of offspring. There are likely sensitive periods during pregnancy when animals are particularly vulnerable to environmental disruption. Here we characterize the effects of maternal immunization across pregnancy and postpartum on offspring physiology and behavior in Siberian hamsters (Phodopus sungorus). Hamsters were injected with the antigen keyhole limpet hemocyanin (KLH) 1) prior to pairing with a male (pre-mating), 2) at separation (post-mating), 3) at mid-pregnancy, or 4) after birth (lactation). Maternal food intake, body mass, and immunity were monitored throughout gestation, and litters were measured weekly for growth until adulthood when social behavior, hormone concentrations, and immune responses were determined. We found that immunizations altered maternal immunity throughout pregnancy and lactation. The effects of maternal treatment differed between male and female offspring. Aggressive behavior was enhanced in offspring of both sexes born to mothers treated post-mating and thus early in pregnancy relative to other stages. In contrast, maternal treatment and maternal stage differentially affected innate immunity in males and females. Offspring cortisol, however, was unaffected by maternal treatment. Collectively, these data demonstrate that maternal immunization affects offspring physiology and behavior in a time-dependent and sex-specific manner. More broadly, these findings contribute to our understanding of the effects of maternal immune activation, whether it be from environmental exposure or immunization, on immunological and behavioral responses of offspring. PMID:27320639
The Skin Microbiome: Is It Affected by UV-induced Immune Suppression?
Patra, VijayKumar; Byrne, Scott N.; Wolf, Peter
2016-01-01
Human skin apart from functioning as a physical barricade to stop the entry of pathogens, also hosts innumerable commensal organisms. The skin cells and the immune system constantly interact with microbes, to maintain cutaneous homeostasis, despite the challenges offered by various environmental factors. A major environmental factor affecting the skin is ultraviolet radiation (UV-R) from sunlight. UV-R is well known to modulate the immune system, which can be both beneficial and deleterious. By targeting the cells and molecules within skin, UV-R can trigger the production and release of antimicrobial peptides, affect the innate immune system and ultimately suppress the adaptive cellular immune response. This can contribute to skin carcinogenesis and the promotion of infectious agents such as herpes simplex virus and possibly others. On the other hand, a UV-established immunosuppressive environment may protect against the induction of immunologically mediated skin diseases including some of photodermatoses such as polymorphic light eruption. In this article, we share our perspective about the possibility that UV-induced immune suppression may alter the landscape of the skin’s microbiome and its components. Alternatively, or in concert with this, direct UV-induced DNA and membrane damage to the microbiome may result in pathogen associated molecular patterns (PAMPs) that interfere with UV-induced immune suppression. PMID:27559331
Granot, Esther; Jakobovich, Einat; Rabinowitz, Ruth; Levy, Paloma; Schlesinger, Michael
2011-01-01
It is currently recommended that diet of pregnant mothers contain 200-300 mg DHA/day. Aim. To determine whether DHA supplementation during pregnancy and lactation affects infants' immune response. 60 women in ≥3rd pregnancy studied; 30 randomly assigned to receive DHA 400 mg/day from 12th week gestation until 4 months postpartum. From breast-fed infants, blood obtained for anti-HBs antibodies, immunoglobulins, lymphocyte subset phenotyping, and intracellular cytokine production. CD4+ lymphocytes did not differ between groups, but CD4CD45RA/CD4 (naïve cells) significantly higher in infants in DHA+ group. Proportion of CD4 and CD8 cells producing IFN(γ) significantly lower in DHA+ group, with no differences in proportion of IL4-producing cells. Immunoglobulins and anti-HBs levels did not differ between groups. In infants of mothers receiving DHA supplementation, a higher percentage of CD4 naïve cells and decreased CD4 and CD8 IFN(γ) production is compatible with attenuation of a proinflammatory response.
Adjuvant effects of saponins on animal immune responses*
Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.
2007-01-01
Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426
Wei, F X; Hu, X F; Xu, B; Zhang, M H; Li, S Y; Sun, Q Y; Lin, P
2015-04-10
To investigate the effect of ammonia (NH3) and humidity on the immune response of broilers, broilers were exposed to 30 or 70 mg/kg atmospheric NH3 for 21 days. Additionally, birds were exposed to 35, 60, and 85% relative humidity (RH). The relative weights of lymphoid organs, serum total protein, serum globulin, serum albumin, serum lysozyme, proliferation index of peripheral blood lymphocytes, and splenic cytokine gene expression were determined. Exposure to 70 mg/kg NH3 decreased the relative weight of the spleen during the experimental period, serum lysozyme concentration in the first and second weeks, and serum globulin concentration in the third week. The proliferation of peripheral blood lymphocytes was reduced. High levels of NH3 caused increase in IL-1β gene expression in the experimental period and IL-4 gene expression in the first week. Birds exposed to 85% RH had lower thymus and bursa of Fabricius weights in the third week and serum lysozyme concentration in the first week; IL-1β and IL-4 expressions were higher in the second and third weeks and first and second weeks, respectively, than in birds exposed to 60% RH. IL-4 expression was lower during the first week, and IL-1β expression was higher during the second week with 35% RH than with 60% RH. In conclusion, high NH3 level in the poultry house suppressed the immune response of broiler chickens. Neither high nor low RH benefited the immune response of broilers. Furthermore, there was an interactive effect between NH3 and RH on the immune response of broilers.
Malnutrition: Modulator of Immune Responses in Tuberculosis
Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth
2017-01-01
Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710
Immune oncology, immune responsiveness and the theory of everything.
Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue
2018-06-05
Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.
A multiherbal formulation influencing immune response in vitro.
Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L
2012-02-01
Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.
ALD1 Regulates Basal Immune Components and Early Inducible Defense Responses in Arabidopsis.
Cecchini, Nicolás M; Jung, Ho Won; Engle, Nancy L; Tschaplinski, Timothy J; Greenberg, Jean T
2015-04-01
Robust immunity requires basal defense machinery to mediate timely responses and feedback cycles to amplify defenses against potentially spreading infections. AGD2-LIKE DEFENSE RESPONSE PROTEIN 1 (ALD1) is needed for the accumulation of the plant defense signal salicylic acid (SA) during the first hours after infection with the pathogen Pseudomonas syringae and is also upregulated by infection and SA. ALD1 is an aminotransferase with multiple substrates and products in vitro. Pipecolic acid (Pip) is an ALD1-dependent bioactive product induced by P. syringae. Here, we addressed roles of ALD1 in mediating defense amplification as well as the levels and responses of basal defense machinery. ALD1 needs immune components PAD4 and ICS1 (an SA synthesis enzyme) to confer disease resistance, possibly through a transcriptional amplification loop between them. Furthermore, ALD1 affects basal defense by controlling microbial-associated molecular pattern (MAMP) receptor levels and responsiveness. Vascular exudates from uninfected ALD1-overexpressing plants confer local immunity to the wild type and ald1 mutants yet are not enriched for Pip. We infer that, in addition to affecting Pip accumulation, ALD1 produces non-Pip metabolites that play roles in immunity. Thus, distinct metabolite signals controlled by the same enzyme affect basal and early defenses versus later defense responses, respectively.
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses
Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.
Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.
Vertyporokh, Lidiia; Taszłow, Paulina; Samorek-Pieróg, Małgorzata; Wojda, Iwona
2015-09-01
We aimed to investigate how exposition of infected insects to short-term heat shock affects the biochemical and molecular aspects of their immune response. Galleria mellonella larvae were exposed to 43°C for 15min, at the seventy second hour after natural infection with entomopathogenic fungus Beauveria bassiana. As a result, both qualitative and quantitative changes in hemolymph protein profiles, and among them infection-induced changes in the amount of apolipophorin III (apoLp-III), were observed. Heat shock differently affects the expression of the tested immune-related genes. It transiently inhibits expression of antifungal peptides gallerimycin and galiomicin in both the fat body and hemocytes of infected larvae. The same, although to a lesser extent, concerned apoLp-III gene expression and was observed directly after heat shock. Nevertheless, in larvae that had recovered from heat shock, apoLp-III expression was higher in comparison to unshocked larvae in the fat body but not in hemocytes, which was consistent with the higher amount of this protein detected in the hemolymph of the infected, shocked larvae. Furthermore, lysozyme-type activity was higher directly after heat shock, while antifungal activity was significantly higher also in larvae that had recovered from heat shock, in comparison to the respective values in their non-shocked, infected counterparts. These results show how changes in the external temperature modulate the immune response of G. mellonella suffering from infection with its natural pathogen B. bassiana. Copyright © 2015 Elsevier Inc. All rights reserved.
Verification of immune response optimality through cybernetic modeling.
Batt, B C; Kompala, D S
1990-02-09
An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.
Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight
Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila
2011-01-01
Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297
Gimbo, Rodrigo Y; Fávero, Gisele C; Franco Montoya, Luz N; Urbinati, Elisabeth C
2015-04-01
We investigated if the energy deficit following a 30-day starvation period could affect the ability of fish to mount immune responses after experimental exposure to Aeromonas hydrophila. Fish were submitted to two feeding strategies during 30 days: starvation and continuously feeding. Fish were then sampled to allow for the assessment of baseline metabolic and immune system indicators, were next intraperitonially inoculated with A. hydrophila, and finally were sampled at 3 and 24 h after the challenge. The respiratory activity of leukocytes was lower in starved fish at baseline, increasing after bacterial inoculation to levels similar to those seen among fed fish. Levels of serum lysozyme were higher in starved fish at baseline. The same response profile was observed 3 h after inoculation, but among fed fish, these levels increased to values similar to those of starved fish 24 h after infection. Among starved fish, lysozyme concentration did not change over the course of the experiment. The serum ACH activity was lower in starved fish at baseline and increased after bacterial inoculation in both fish groups. Baseline levels of blood glucose of starved fish were lower than those of fed fish and increased 3 h after bacterial inoculation in both fish groups, decreasing in both groups at 24 h after inoculation. Baseline liver glycogen levels were similar in both fish groups and higher than at 3 and 24 h after inoculation. Three hours after bacterial inoculation, liver glycogen was less reduced in fed fish. Baseline levels of blood triglycerides were lower in starved fish and the profile remained unchanged 3 h after inoculation. There was a gradual decrease in fed fish, and the levels of starved fish remained unchanged throughout the observation period. Blood glycerol levels at baseline were higher in starved fish than in fed fish and remained unaltered at 3 h after inoculation. However those levels increased at 24 h. In fed fish there was a gradual increase of
Immune response and immunopathology during toxoplasmosis1
Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.
2012-01-01
Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326
Association of psychosis, affective disorders and diseases affecting the immune system.
Larsen, Jeanette Brun; Iversen, Valentina Cabral; Reitan, Solveig Klæbo
2018-02-01
Purpose of the article: There are indications of altered immune activity in depressed and psychotic patients compared to healthy controls in several studies. To explore the clinical importance of this phenomenon we examined the relation between different disorders affecting the immune system and psychoses and depression, respectively. A total of 276 patients consecutively admitted to a psychiatric acute ward were included in the study. Of these 41 patients fulfilled the criteria for ICD-10 F20-29 (psychotic) diagnosis and 157 patients a F30-39 (affective) diagnosis. Information on diseases affecting the immune system in patients themselves and family members of the patients were obtained by a self-report questionnaire. Comparing the two groups showed a significant correlation between the F20-29 group and eczema (r = -0.116, p = .037). Comparing what patients reported for family members showed a significantly higher frequency of epilepsy (p = .033) in the F20-29 group. Summarizing all immunological diseases for family members showed a significantly higher frequency in the F30-39 group compared to the F20-29 group (χ 2 = 4, 82, df = 1, p = .028). There may be differences between the F20-29 and F30-39 groups and their family members regarding risk for diseases affecting the immune system. This is in line with different activity of the immune system measured in blood for the disorders and may add information regarding etiology and pathology of these psychiatric diseases. Further studies including a greater number of subjects, as well as confirmation of the immunological diseases through blood samples are needed.
Toll immune signal activates cellular immune response via eicosanoids.
Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun
2018-07-01
Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids
Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe
2016-01-01
The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406
Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery
NASA Astrophysics Data System (ADS)
Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole
2015-12-01
Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized
Innate immune response to Burkholderia mallei.
Saikh, Kamal U; Mott, Tiffany M
2017-06-01
Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.
Innate immune response to Burkholderia mallei
Saikh, Kamal U.; Mott, Tiffany M.
2017-01-01
Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960
Tilapia show immunization response against Ich
USDA-ARS?s Scientific Manuscript database
This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...
The immune response to human CMV
La Rosa, Corinna; Diamond, Don J
2012-01-01
This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079
The influence of the microbiota on the immune response to transplantation
Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa
2015-01-01
Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985
Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying
2007-01-01
BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844
Cellular immune responses to HIV
NASA Astrophysics Data System (ADS)
McMichael, Andrew J.; Rowland-Jones, Sarah L.
2001-04-01
The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.
Rodríguez, Airam; Broggi, Juli; Alcaide, Miguel; Negro, Juan José; Figuerola, Jordi
2014-08-01
Individual immune responses are likely affected by genetic, physiological, and environmental determinants. We studied the determinants and short-term consequences of Phytohaemagglutinin (PHA) induced immune response, a commonly used immune challenge eliciting both innate and acquired immunity, on lesser kestrel (Falco naumanni) nestlings in semi-captivity conditions and with a homogeneous diet composition. We conducted a repeated measures analyses of a set of blood parameters (carotenoids, triglycerides, β-hydroxybutyrate, cholesterol, uric acid, urea, total proteins, and total antioxidant capacity), metabolic (resting metabolic rate), genotypic (MHC class II B heterozygosity), and biometric (body mass) variables. PHA challenge did not affect the studied physiological parameters on a short-term basis (<12 hr), except plasma concentrations of triglycerides and carotenoids, which decreased and increased, respectively. Uric acid was the only physiological parameter correlated with the PHA induced immune response (skin swelling), but the change of body mass, cholesterol, total antioxidant capacity, and triglycerides between sessions (i.e., post-pre treatment) were also positively correlated to PHA response. No relationships were detected between MHC gene heterozygosity or resting metabolic rate and PHA response. Our results indicate that PHA response in lesser kestrel nestlings growing in optimal conditions does not imply a severe energetic cost 12 hr after challenge, but is condition-dependent as a rapid mobilization of carotenoids and decrease of triglycerides is elicited on a short-term basis. © 2014 Wiley Periodicals, Inc.
Obanewa, Olayinka; Newell, Marie-Louise
2017-09-01
To systematically review the association between maternal nutritional status in pregnancy and infant immune response to childhood vaccines. We reviewed literature on maternal nutrition during pregnancy, fetal immune system and vaccines and possible relationships. Thereafter, we undertook a systematic review of the literature of maternal nutritional status and infant vaccine response, extracted relevant information, assessed quality of the nine papers identified and present findings in a narrative format. From limited evidence of average quality, intrauterine nutrition deficiency could lead to functional deficit in the infant's immune function; child vaccine response may thus be negatively affected by maternal malnutrition. Response to childhood vaccination may be associated with fetal and early life environment; evaluation of programs should take this into account.
Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E
2016-10-01
Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights
Work stress and innate immune response.
Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L
2011-01-01
Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.
2013-01-01
CMV exposure. Conclusions A profile of T-cell immunity associated with CMV exposure influences the clinical response to DMARD therapy in patients with early RA. Because CMV latency is associated with greater joint destruction, our findings suggest that changes in T-cell immunity mediated by viral persistence may affect treatment response and possibly long-term outcomes of RA. PMID:24267267
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.
Evaluation of the humoral immune response of children with low level lead exposure
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reigart, J.R.; Graber, C.D.
1976-07-01
Twelve lead-exposed children, with evidence of metabolic impairment, and seven non-lead exposed children were examined for evidence of impairment of their immunological response. There were no differences between the control group and the lead exposed group with reference to complement levels, immunoglobulins, or anamnestic response to the tetanus toxoid antigen. It remains to be demonstrated whether or not there is deficient response to primary immunization, whether other antigens are more affected by lead, or whether impairment of humoral immune response requires a more serious degree of lead intoxication.
Immune responses in humans after 60 days of confinement
NASA Technical Reports Server (NTRS)
Schmitt, D. A.; Peres, C.; Sonnenfeld, G.; Tkackzuk, J.; Arquier, M.; Mauco, G.; Ohayon, E.
1995-01-01
A confinement experiment in a normobaric diving chamber was undertaken to better understand the effect of confinement and isolation on human psychology and physiology. Pre- and postconfinement blood samples were obtained from four test subjects and control donors to analyze immune responses. No modification in the levels of CD2+, CD3+, CD4+, CD8+, CD19+, and CD56+ cells was observed after confinement. Mitogen-induced T-lymphocyte proliferation and interleukin-2 receptor expression were not altered significantly. Whole blood interferon-alpha and gamma-induction and plasma cortisol levels were also unchanged, as was natural killer cell activity. These data suggest that in humans, no specific components of the immune response are affected by a 2-month isolation and confinement of a small group.
Rindsjö, E; Joerink, M; Johansson, C; Bremme, K; Malmström, V; Scheynius, A
2010-07-01
It is hypothesized that the in utero environment in allergic mothers can affect the neonatal immune responses. The aim of this study was to analyse the effect of maternal allergic disease on cord blood mononuclear cell (CBMC) phenotype and proliferative responses upon allergen stimulation. Peripheral blood mononuclear cells (PBMC) from 12 allergic and 14 nonallergic mothers and CBMC from their children were analysed. In the mothers, we determined cell proliferation, production of IL-4 and expression of FOXP3 in response to allergen stimulation. In the children, we evaluated cell proliferation and FOXP3 expression following allergen stimulation. Furthermore, expression of different homing markers on T cells and regulatory T cells and maturity of the T cells and B cell subsets were evaluated directly ex vivo. The timothy- and birch-allergic mothers responded with increased proliferation and/or IL-4 production towards timothy and birch extract, respectively, when compared to nonallergic mothers. This could not be explained by impairment of FOXP3(+) regulatory T cells in the allergic mothers. CBMC proliferation and FOXP3 expression in response to allergens were not affected by the allergic status of the mother. Also, phenotype of T cells, FOXP3(+) regulatory T cells and B cells was not affected by the allergic status of the mother. Our results suggest that maternal allergic disease has no effect on the neonatal response to allergens or the phenotype of neonatal lymphocytes. The factors studied here could, however, still affect later development of allergy.
Costs of immune responses are related to host body size and lifespan
Brace, Amber J.; Lajeunesse, Marc J.; Ardia, Daniel R.; ...
2017-06-01
A central assumption in ecological immunology is that immune responses are costly, with costs manifesting directly (e.g., increases in metabolic rate and increased amino acid usage) or as tradeoffs with other life processes (e.g., reduced growth and reproductive success). Across taxa, host longevity, timing of maturity, and reproductive effort affect the organization of immune systems. It is reasonable, therefore, to expect that these and related factors should also affect immune activation costs. Specifically, species that spread their breeding efforts over a long lifetime should experience lower immune costs than those that mature and breed quickly and die comparatively early. Likewise,more » body mass should affect immune costs, as body size affects the extent to which hosts are exposed to parasites as well as how hosts can combat infections (via its effects on metabolic rates and other factors). Here in this paper, we used phylogenetic meta-regression to reveal that, in general, animals incur costs of immune activation, but small species that are relatively long-lived incur the largest costs. These patterns probably arise because of the relative need for defense when infection risk is comparatively high and fitness can only be realized over a comparatively long period. However, given the diversity of species considered here and the overall modest effects of body mass and life history on immune costs, much more research is necessary before generalizations are appropriate.« less
Costs of immune responses are related to host body size and lifespan
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brace, Amber J.; Lajeunesse, Marc J.; Ardia, Daniel R.
A central assumption in ecological immunology is that immune responses are costly, with costs manifesting directly (e.g., increases in metabolic rate and increased amino acid usage) or as tradeoffs with other life processes (e.g., reduced growth and reproductive success). Across taxa, host longevity, timing of maturity, and reproductive effort affect the organization of immune systems. It is reasonable, therefore, to expect that these and related factors should also affect immune activation costs. Specifically, species that spread their breeding efforts over a long lifetime should experience lower immune costs than those that mature and breed quickly and die comparatively early. Likewise,more » body mass should affect immune costs, as body size affects the extent to which hosts are exposed to parasites as well as how hosts can combat infections (via its effects on metabolic rates and other factors). Here in this paper, we used phylogenetic meta-regression to reveal that, in general, animals incur costs of immune activation, but small species that are relatively long-lived incur the largest costs. These patterns probably arise because of the relative need for defense when infection risk is comparatively high and fitness can only be realized over a comparatively long period. However, given the diversity of species considered here and the overall modest effects of body mass and life history on immune costs, much more research is necessary before generalizations are appropriate.« less
Sedimentation rapidly induces an immune response and depletes energy stores in a hard coral
NASA Astrophysics Data System (ADS)
Sheridan, C.; Grosjean, Ph.; Leblud, J.; Palmer, C. V.; Kushmaro, A.; Eeckhaut, I.
2014-12-01
High sedimentation rates have been linked to reduced coral health within multiple systems; however, whether this is a direct result of compromised coral immunity has not been previously investigated. The potential effects of sedimentation on immunity of the hard coral Montipora patula were examined by comparing physiological responses of coral fragments inoculated with sterilized marine sediments and those under control conditions. Sediments were collected from terrestrial runoff-affected reefs in SW Madagascar and applied cyclically for a total of 24 h at a rate observed during precipitation-induced sedimentation events. Coral health was determined 24 h after the onset of the sedimentation stress through measuring metabolic proxies of O2 budget and lipid ratios. Immune response of the melanin synthesis pathway was measured by quantifying phenoloxidase activity and melanin deposits. Sedimentation induced both immune and metabolic responses in M. patula. Both phenoloxidase activity and melanin deposition were significantly higher in the sediment treatment compared to controls, indicating an induced immune response. Sediment-treated corals also showed a tendency towards increased respiration (during the night) and decreased photosynthesis (during the day) and a significant depletion of energy reserves as compared to controls. These data highlight that short-term (24 h) sedimentation, free of live microorganisms, compromises the health of M. patula. The energetically costly immune response, potentially elicited by residual endotoxins and other inflammatory particles associated with the sterile sediments, likely contributes to the energy depletion. Overall, exposure to sedimentation adversely affects coral health and continued exposure may lead to resource depletion and an increased susceptibility to disease.
Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.
VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H
1996-04-01
Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.
Perillyl alcohol suppresses antigen-induced immune responses in the lung
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide
Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less
Altered Innate and Lymphocytic Immune Responses in Mouse Splenocytes Post-Flight
NASA Technical Reports Server (NTRS)
Hwang, ShenAn; Crucian, Brian E.; Sams, Clarence F.; Actor, Jeffrey K.
2011-01-01
Space flight is known to affect immune responses of astronauts and animals, decreasing lymphocytic responses to mitogenic stimuli, delayed typed hypersensitivity reactions, and T-cell activation. Despite changes in immune suppression, there are no reports of consistent adverse clinical events post flight. To further investigate the spectrum of affected immune responses, murine splenocytes were stimulated immediately post-shuttle flight (14 days on STS-135) with T-cell stimulators or toll-like receptor agonists. Comparisons were made to ground control splenocytes from age-matched mice. Cell phenotypes were assessed, as well as activation markers and associated cytokine production. The CD4+ population decreased with no concurrent decrease in CD8+ cells from shuttle mice post flight compared to ground controls. Regarding antigen presenting cell populations, the number of CD11c+ cells were slightly elevated post flight, compared to ground controls, with increased MHC Class I expression (I-A(sup b)) and no change in Class II expression (H-2K(sup b)). CD86+ populations were also significantly diminished. However, the decreased markers did not correlate with activity. Stimulation of splenocytes post flight showed significant increase in bead uptake, increased Class I expression, increased TNF-alpha and IL-6 production in response to TLR-2 (zymosan) and TLR-4 (LPS) agonists. While most activated (ConA or anti-CD3/anti-CD28) CD4+ cells showed markedly diminished responses (reduced IL-2 production), non-specific T cell responses to superantigen (SEA/SEB) increased post flight as determined by expression of early activation markers. Production of additional cytokines was also dysregulated postflight. Overall, persistent immune changes during space flight could represent unique clinical risks for exploration class missions. The consequences of pathogenic encounter remain an important concern that should be addressed.
Leptin, immune responses and autoimmune disease. Perspectives on the use of leptin antagonists.
Peelman, F; Iserentant, H; Eyckerman, S; Zabeau, L; Tavernier, J
2005-01-01
The pivotal role of leptin in regulating body weight and energy homeostasis is very well established. More recently, leptin also emerged as an important regulator of T-cell-dependent immunity. Reduced leptin levels, as observed during periods of starvation, correlate with an impaired cellular immune response, whereby especially the T(H)1 pro-inflammatory immune response appears to be affected. Physiologically, this could reflect the high energy demand of such processes, which are suppressed in animals or people with nutrient shortage. Several autoimmune diseases are T(H)1 T-cell dependent. In line with a pro-inflammatory role for leptin, animal models of leptin deficiency are markedly resistant to a variety of T-cell dependent autoimmune diseases. Here, we review the role of leptin in immune responses, with emphasis on autoimmune diseases. The design and potential use of leptin antagonists is also discussed.
Assessment of the innate immune response in the periparturient cow.
Trevisi, Erminio; Minuti, Andrea
2018-02-01
The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hallmarks of response to immune checkpoint blockade
Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A
2017-01-01
Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159
Pizarro, Lorena; Leibman-Markus, Meirav; Schuster, Silvia; Bar, Maya; Meltz, Tal; Avni, Adi
2018-01-01
Plants recognize microbial/pathogen associated molecular patterns (MAMP/PAMP) through pattern recognition receptors (PRRs) triggering an immune response against pathogen progression. MAMP/PAMP triggered immune response requires PRR endocytosis and trafficking for proper deployment. LeEIX2 is a well-known Solanum lycopersicum RLP-PRR, able to recognize and respond to the fungal MAMP/PAMP ethylene-inducing xylanase (EIX), and its function is highly dependent on intracellular trafficking. Identifying protein machinery components regulating LeEIX2 intracellular trafficking is crucial to our understanding of LeEIX2 mediated immune responses. In this work, we identified a novel trafficking protein, SlPRA1A, a predicted regulator of RAB, as an interactor of LeEIX2. Overexpression of SlPRA1A strongly decreases LeEIX2 endosomal localization, as well as LeEIX2 protein levels. Accordingly, the innate immune responses to EIX are markedly reduced by SlPRA1A overexpression, presumably due to a decreased LeEIX2 availability. Studies into the role of SlPRA1A in LeEIX2 trafficking revealed that LeEIX2 localization in multivesicular bodies/late endosomes is augmented by SlPRA1A. Furthermore, inhibiting vacuolar function prevents the LeEIX2 protein level reduction mediated by SlPRA1A, suggesting that SlPRA1A may redirect LeEIX2 trafficking to the vacuole for degradation. Interestingly, SlPRA1A overexpression reduces the amount of several RLP-PRRs, but does not affect the protein level of receptor-like kinase PRRs, suggesting a specific role of SlPRA1A in RLP-PRR trafficking and degradation. PMID:29545816
Bivalve immunity and response to infections: Are we looking at the right place?
Allam, Bassem; Pales Espinosa, Emmanuelle
2016-06-01
Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Avian influenza (AI) infection in poultry can result in high morbidity and mortality, and negatively affect international trade. Because most AI vaccines used for poultry are inactivated, our knowledge of immunity against AI is based largely on humoral immune responses. In fact, little is known abo...
Dai, Wen-Fang; Zhang, Jin-Jie; Qiu, Qiong-Fen; Chen, Jiong; Yang, Wen; Ni, Sui; Xiong, Jin-Bo
2018-05-24
Aquatic animals are frequently suffered from starvation due to restricted food availability or deprivation. It is currently known that gut microbiota assists host in nutrient acquisition. Thus, exploring the gut microbiota responses would improve our understanding on physiological adaptation to starvation. To achieve this, we investigated how the gut microbiota and shrimp digestion and immune activities were affected under starvation stress. The results showed that the measured digestion activities in starved shrimp were significantly lower than in normal cohorts; while the measured immune activities exhibited an opposite trend. A structural equation modeling (SEM) revealed that changes in the gut bacterial community were directly related to digestive and immune enzyme activities, which in turn markedly affected shrimp growth traits. Notably, several gut bacterial indicators that characterized the shrimp nutrient status were identified, with more abundant opportunistic pathogens in starved shrimp, although there were no statistical differences in the overall diversity and the structures of gut bacterial communities between starved and normal shrimp. Starved shrimp exhibited less connected and cooperative interspecies interaction as compared with normal cohorts. Additionally, the functional pathways involved in carbohydrate and protein digestion, glycan biosynthesis, lipid and enzyme metabolism remarkably decreased in starved shrimp. These attenuations could increase the susceptibility of starved shrimp to pathogens infection. In summary, this study provides novel insights into the interplay among shrimp digestion, immune activities and gut microbiota in response to starvation stress. Copyright © 2018 Elsevier Ltd. All rights reserved.
Nebel, Silke; Buehler, Deborah M; MacMillan, Alexander; Guglielmo, Christopher G
2013-07-15
Migratory birds have been implicated in the spread of some zoonotic diseases, but how well infected individuals can fly remains poorly understood. We used western sandpipers, Calidris mauri, to experimentally test whether flight is affected when long-distance migrants are mounting an immune response and whether migrants maintain immune defences during a flight in a wind tunnel. We measured five indicators of innate immunity in 'flown-healthy' birds (flying in a wind tunnel without mounting an immune response), 'flown-sick' birds (flying while mounting an acute phase response, which is part of induced innate immunity), and a non-flying control group ('not-flown'). Voluntary flight duration did not differ between flown-healthy and flown-sick birds, indicating that mounting an acute phase response to simulated infection did not hamper an individual's ability to fly for up to 3 h. However, in comparison to not-flown birds, bacterial killing ability of plasma was significantly reduced after flight in flown-sick birds. In flown-healthy birds, voluntary flight duration was positively correlated with bacterial killing ability and baseline haptoglobin concentration of the blood plasma measured 1-3 weeks before experimental flights, suggesting that high quality birds had strong immune systems and greater flight capacity. Our findings indicate that flight performance is not diminished by prior immune challenge, but that flight while mounting an acute phase response negatively affects other aspects of immune function. These findings have important implications for our understanding of the transmission of avian diseases, as they suggest that birds can still migrate while fighting an infection.
Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.
Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia
2017-01-01
During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.
Immune Response in Thyroid Cancer: Widening the Boundaries
Ward, Laura Sterian
2014-01-01
The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756
Immune response in asymptomatic smokers.
Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H
2002-09-01
It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production
Measles virus-induced suppression of immune responses.
Griffin, Diane E
2010-07-01
Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.
Immune Responses to HCV and Other Hepatitis Viruses
Park, Su-Hyung; Rehermann, Barbara
2014-01-01
Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Garth, Jaleesa M; Mackel, Joseph J; Reeder, Kristen M; Blackburn, Jonathan P; Dunaway, Chad W; Yu, Zhihong; Matalon, Sadis; Fitz, Lori; Steele, Chad
2018-07-01
Chitin is a polysaccharide that provides structure and rigidity to the cell walls of fungi and insects. Mammals possess multiple chitinases, which function to degrade chitin, thereby supporting a role for chitinases in immune defense. However, chitin degradation has been implicated in the pathogenesis of asthma. Here, we determined the impact of acidic mammalian chitinase (AMCase) ( Chia ) deficiency on host defense during acute exposure to the fungal pathogen Aspergillus fumigatus as well as its contribution to A. fumigatus -associated allergic asthma. We demonstrate that chitin in the fungal cell wall was detected at low levels in A. fumigatus conidia, which emerged at the highest level during hyphal transition. In response to acute A. fumigatus challenge, Chia -/- mice unexpectedly demonstrated lower A. fumigatus lung burdens at 2 days postchallenge. The lower fungal burden correlated with decreased lung interleukin-33 (IL-33) levels yet increased IL-1β and prostaglandin E 2 (PGE 2 ) production, a phenotype that we reported previously to promote the induction of IL-17A and IL-22. During chronic A. fumigatus exposure, AMCase deficiency resulted in lower dynamic and airway lung resistance than in wild-type mice. Improved lung physiology correlated with attenuated levels of the proallergic chemokines CCL17 and CCL22. Surprisingly, examination of inflammatory responses during chronic exposure revealed attenuated IL-17A and IL-22 responses, but not type 2 responses, in the absence of AMCase. Collectively, these data suggest that AMCase functions as a negative regulator of immune responses during acute fungal exposure and is a contributor to fungal asthma severity, putatively via the induction of proinflammatory responses. Copyright © 2018 American Society for Microbiology.
Cross, Martin L; Lambeth, Matthew R; Aldwell, Frank E
2010-02-01
Oral delivery of live Mycobacterium bovis BCG in a lipid matrix invokes cell-mediated immune (CMI) responses in mice and consequent protection against pulmonary challenge with virulent mycobacteria. To investigate the influence of prior BCG sensitization on oral vaccine efficacy, we assessed CMI responses and BCG colonization of the alimentary tract lymphatics 5 months after oral vaccination, in both previously naive mice and in mice that had been sensitized to BCG by injection 6 months previously. CMI responses did not differ significantly between mice that received subcutaneous BCG followed by oral BCG and those that received either injected or oral BCG alone. In vivo BCG colonization was predominant in the mesenteric lymph nodes after oral vaccination; this colonizing ability was not influenced by prior BCG sensitization. From this murine model study, we conclude that although prior parenteral-route BCG sensitization does not detrimentally affect BCG colonization after oral vaccination, there is no significant immune-boosting effect of the oral vaccine either.
Rezende, Taia Maria Berto; Vieira, Leda Quercia; Sobrinho, Antônio Paulino Ribeiro; Oliveira, Ricardo Reis; Taubman, Martin A; Kawai, Toshihisa
2008-09-01
This study assessed the influence of mineral trioxide aggregate (MTA) on adaptive immune responses. BALB/c mice were immunized with heat-killed Fusobacterium nucleatum (Fn) in MTA or other control adjuvants, and serum IgG responses to Fn were measured. Either Fn- or Peptostreptococcus anaerobius (Pa)-reactive memory T cells (Tm) were preincubated in vitro with/without MTA and restimulated with Fn or Pa. Tm proliferation and cytokine production were assessed. Compared with control groups, immunoglobulin G-antibody responses were upregulated in mice immunized with Fn in MTA in a similar manner to animals immunized with Fn in Freund's adjuvant or aluminum hydroxide adjuvant. Although MTA did not affect the upregulated expression of interleukin 10, tumor necrosis factor alpha, or RANKL by Tm, it suppressed the proliferation of Pa- or Fn-Tm and inhibited their production of Th1- or Th2-signature cytokines. MTA upregulated the adaptive humoral immune responses but had little or no effect on pro- or anti-inflammatory cytokine production by Tm.
Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.
Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M
2017-09-04
Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.
Immune responses to invasive aspergillosis: new understanding and therapeutic opportunities
Hohl, Tobias M.
2017-01-01
Purpose of review Invasive aspergillosis is a worldwide disease that primarily affects immune-compromised patients, agricultural workers with corneal abrasions, individuals with structural lung disease, and patients with primary immune deficiency. The critical function of the immune system is to prevent the germination of airborne conidia into tissue-invasive hyphae. This review covers recent advances that shape our understanding of anti-Aspergillus immunity at the molecular and cellular level. Recent findings Host defense against conidia and hyphae occurs via distinct molecular mechanisms that involve intracellular and extracellular killing pathways, as well as cooperation between different myeloid cell subsets. The strength and efficacy of the host response is shaped by the tissue microenvironment. In preclinical models of disease, host immune augmentation strategies have yielded benefits, yet translating these insights into therapeutic strategies in humans remains challenging. Summary Although advances in early diagnostic strategies and in antifungal drugs have ameliorated clinical outcomes of invasive aspergillosis, further improvements depend on gaining deeper insight into and translating advances in anti-Aspergillus immunity. PMID:28509673
Fonseca, Adriana Barbosa de Lima; Simon, Marise do Vale; Cazzaniga, Rodrigo Anselmo; de Moura, Tatiana Rodrigues; de Almeida, Roque Pacheco; Duthie, Malcolm S; Reed, Steven G; de Jesus, Amelia Ribeiro
2017-02-06
Leprosy is a chronic infectious disease caused by Mycobacterium leprae. According to official reports from 121 countries across five WHO regions, there were 213 899 newly diagnosed cases in 2014. Although leprosy affects the skin and peripheral nerves, it can present across a spectrum of clinical and histopathological forms that are strongly influenced by the immune response of the infected individuals. These forms comprise the extremes of tuberculoid leprosy (TT), with a M. leprae-specific Th1, but also a Th17, response that limits M. leprae multiplication, through to lepromatous leprosy (LL), with M. leprae-specific Th2 and T regulatory responses that do not control M. leprae replication but rather allow bacterial dissemination. The interpolar borderline clinical forms present with similar, but less extreme, immune biases. Acute inflammatory episodes, known as leprosy reactions, are complications that may occur before, during or after treatment, and cause further neurological damages that can cause irreversible chronic disabilities. This review discusses the innate and adaptive immune responses, and their interactions, that are known to affect pathogenesis and influence the clinical outcome of leprosy.
Th2 and Th1 Responses: Clear and Hidden Sides of Immunity Against Intestinal Helminths.
Cortés, Alba; Muñoz-Antoli, Carla; Esteban, J Guillermo; Toledo, Rafael
2017-09-01
Intestinal helminthiases affect millions of people worldwide, mainly in developing regions, where they cause a significant negative impact on human health and socioeconomic growth of affected populations. However, intestinal helminthiases are still among the most neglected tropical diseases. Protective immunity against intestinal helminths is associated with development of type 2 responses. Nevertheless, in some host-intestinal helminth combinations, local Th1 responses are initiated, inducing chronicity. The usage of helminth-mouse models is useful for elucidating the mechanisms behind the initiation of each type of response. Herein, the current knowledge on these topics is reviewed, paying particular attention to the earliest events of the immune cascade which eventually lead to either susceptibility or resistance to infection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Muñoz-Carrillo, J L; Contreras-Cordero, J F; Muñoz-López, J L; Maldonado-Tapia, C H; Muñoz-Escobedo, J J; Moreno-García, M A
2017-09-01
In the early stage of the intestinal phase of Trichinella spiralis infection, the host triggers a Th1-type immune response with the aim of eliminating the parasite. However, this response damages the host which favours the survival of the parasite. In the search for novel pharmacological strategies that inhibit the Th1 immune response and assist the host against T. spiralis infection, a recent study showed that resiniferatoxin had anti-inflammatory activity contributed to the host in T. spiralis infection. In this study, we evaluated whether RTX modulates the host immune response through the inhibition of Th1 cytokines in the intestinal phase. In addition, it was determined whether the treatment with RTX affects the infectivity of T. spiralis-L1 and the development of the T. spiralis life cycle. Our results show that RTX decreased serum levels of IL-12, INF-γ, IL-1β, TNF-α and parasite burden on muscle tissue. It was observed that T. spiralis-L1 treated with RTX decreased their infectivity affecting the development of the T. spiralis life cycle in mouse. These results demonstrate that RTX is able to inhibit the production of Th1 cytokines, contributing to the defence against T. spiralis, which places it as a potential drug modulator of the immune response. © 2017 John Wiley & Sons Ltd.
The weight of obesity on the human immune response to vaccination
Painter, Scott D.; Ovsyannikova, Inna G.; Poland, Gregory A.
2015-01-01
Despite the high success of protection against several infectious diseases through effective vaccines, some sub-populations have been observed to respond poorly to vaccines, putting them at increased risk for vaccine-preventable diseases. In particular, the limited data concerning the effect of obesity on vaccine immunogenicity and efficacy suggests that obesity is a factor that increases the likelihood of a poor vaccine-induced immune response. Obesity occurs through the deposition of excess lipids into adipose tissue through the production of adipocytes, and is defined as a body-mass index (BMI) ≥ 30 kg/m2. The immune system is adversely affected by obesity, and these “immune consequences” raise concern for the lack of vaccine-induced immunity in the obese patient requiring discussion of how this sub-population might be better protected. PMID:26163925
Cold exposure down-regulates immune response pathways in ferret aortic perivascular adipose tissue.
Reynés, Bàrbara; van Schothorst, Evert M; García-Ruiz, Estefanía; Keijer, Jaap; Palou, Andreu; Oliver, Paula
2017-05-03
Perivascular adipose tissue (PVAT) surrounds blood vessels and releases paracrine factors, such as cytokines, which regulate local inflammation. The inflammatory state of PVAT has an important role in vascular disease; a pro-inflammatory state has been related with atherosclerosis development, whereas an anti-inflammatory one is protective. Cold exposure beneficially affects immune responses and, could thus impact the pathogenesis of cardiovascular diseases. In this study, we investigated the effects of one-week of cold exposure at 4°C of ferrets on aortic PVAT (aPVAT) versus subcutaneous adipose tissue. Ferrets were used because of the similarity of their adipose tissues to those of humans. A ferret-specific Agilent microarray was designed to cover the complete ferret genome and global gene expression analysis was performed. The data showed that cold exposure altered gene expression mainly in aPVAT. Most of the regulated genes were associated with cell cycle, immune response and gene expression regulation, and were mainly down-regulated. Regarding the effects on immune response, cold acclimation decreased the expression of genes involved in antigen recognition and presentation, cytokine signalling and immune system maturation and activation. This immunosuppressive gene expression pattern was depot-specific, as it was not observed in the inguinal subcutaneous depot. Interestingly, this depression in immune response related genes was also evident in peripheral blood mononuclear cells (PBMC). In conclusion, these results reveal that cold acclimation produces an inhibition of immune response-related pathways in aPVAT, reflected in PBMC, indicative of an anti-inflammatory response, which can potentially be exploited for the enhancement or maintenance of cardiovascular health.
Potential for Cell-Mediated Immune Responses in Mouse Models of Pelizaeus-Merzbacher Disease
Southwood, Cherie M.; Fykkolodziej, Bozena; Dachet, Fabien; Gow, Alexander
2013-01-01
Although activation of the innate and adaptive arms of the immune system are undoubtedly involved in the pathophysiology of neurodegenerative diseases, it is unclear whether immune system activation is a primary or secondary event. Increasingly, published studies link primary metabolic stress to secondary inflammatory responses inside and outside of the nervous system. In this study, we show that the metabolic stress pathway known as the unfolded protein response (UPR) leads to secondary activation of the immune system. First, we observe innate immune system activation in autopsy specimens from Pelizaeus-Merzbacher disease (PMD) patients and mouse models stemming from PLP1 gene mutations. Second, missense mutations in mildly- and severely-affected Plp1-mutant mice exhibit immune-associated expression profiles with greater disease severity causing an increasingly proinflammatory environment. Third, and unexpectedly, we find little evidence for dysregulated expression of major antioxidant pathways, suggesting that the unfolded protein and oxidative stress responses are separable. Together, these data show that UPR activation can precede innate and/or adaptive immune system activation and that neuroinflammation can be titrated by metabolic stress in oligodendrocytes. Whether or not such activation leads to autoimmune disease in humans is unclear, but the case report of steroid-mitigated symptoms in a PMD patient initially diagnosed with multiple sclerosis lends support. PMID:24575297
The regulation of autoreactive B cells during innate immune responses.
Vilen, Barbara J; Rutan, Jennifer A
2008-01-01
Systemic lupus erythematosus (SLE) highlights the dangers of dysregulated B cells and the importance of initiating and maintaining tolerance. In addition to central deletion, receptor editing, peripheral deletion, receptor revision, anergy, and indifference, we have described a new mechanism of B cell tolerance wherein dendritic cells (DCs) and macrophages (MPhis) regulate autoreactive B cells during innate immune responses. In part, DCs and MPhis repress autoreactive B cells by releasing IL-6 and soluble CD40L (sCD40L). This mechanism is selective in that IL-6 and sCD40L do not affect Ig secretion by naïve cells during innate immune responses, allowing immunity in the absence of autoimmunity. In lupus-prone mice, DCs and MPhis are defective in secretion of IL-6 and sCD40L and cannot effectively repress autoantibody secretion suggesting that defects in DC/MPhi-mediated tolerance may contribute to the autoimmune phenotype. Further, these studies suggest that reconstituting DCs and MPhis in SLE patients might restore regulation of autoreactive B cells and provide an alternative to immunosuppressive therapies.
Mannose Receptor Mediates the Immune Response to Ganoderma atrum Polysaccharides in Macrophages.
Li, Wen-Juan; Tang, Xiao-Fang; Shuai, Xiao-Xue; Jiang, Cheng-Jia; Liu, Xiang; Wang, Le-Feng; Yao, Yu-Fei; Nie, Shao-Ping; Xie, Ming-Yong
2017-01-18
The ability of mannose receptor (MR) to recognize the carbohydrate structures is well-established. Here, we reported that MR was crucial for the immune response to a Ganoderma atrum polysaccharide (PSG-1), as evidenced by elevation of MR in association with increase of phagocytosis and concentrations of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) in normal macrophages. Elevation of MR triggered by PSG-1 also led to control lipopolysaccharide (LPS)-triggered inflammatory response via the increase of interleukin-10 (IL-10) and inhibition of phagocytosis and IL-1β. Anti-MR antibody partly attenuated PSG-1-mediated anti-inflammatory responses, while it could not affect TNF-α secretion, suggesting that another receptor was involved in PSG-1-triggered immunomodulatory effects. MR and toll-like receptor (TLR)4 coordinated the influences on the TLR4-mediated signaling cascade by the nuclear factor-κB (NF-κB) pathway in LPS-stimulated macrophages subjected to PSG-1. Collectively, immune response to PSG-1 required recognition by MR in macrophages. The NF-κB pathway served as a central role for the coordination of MR and TLR4 to elicit immune response to PSG-1.
Mechanisms by which pesticides affect insect immunity.
James, R R; Xu, J
2012-02-01
The current state of knowledge regarding the effect of pesticides on insect immunity is reviewed here. A basic understanding of these interactions is needed for several reasons, including to improve methods for controlling pest insects in agricultural settings, for controlling insect vectors of human diseases, and for reducing mortality in beneficial insects. Bees are particularly vulnerable to sublethal pesticide exposures because they gather nectar and pollen, concentrating environmental toxins in their nests in the process. Pesticides do have effects on immunity. Organophosphates and some botanicals have been found to impact hemocyte number, differentiation, and thus affect phagocytosis. The phenoloxidase cascade and malanization have also been shown to be affected by several insecticides. Many synthetic insecticides increase oxidative stress, and this could have severe impacts on the production of some antimicrobial peptides in insects, but research is needed to determine the actual effects. Pesticides can also affect grooming behaviors, rendering insects more susceptible to disease. Despite laboratory data documenting pesticide/pathogen interactions, little field data is available at the population level. Published by Elsevier Inc.
New perspectives on central and peripheral immune responses to acute traumatic brain injury
2012-01-01
Traumatic injury to the brain (TBI) results in a complex set of responses involving various symptoms and long-term consequences. TBI of any form can cause cognitive, behavioral and immunologic changes in later life, which underscores the problem of underdiagnosis of mild TBI that can cause long-term neurological deficits. TBI disrupts the blood–brain barrier (BBB) leading to infiltration of immune cells into the brain and subsequent inflammation and neurodegeneration. TBI-induced peripheral immune responses can also result in multiorgan damage. Despite worldwide research efforts, the methods of diagnosis, monitoring and treatment for TBI are still relatively ineffective. In this review, we delve into the mechanism of how TBI-induced central and peripheral immune responses affect the disease outcome and discuss recent developments in the continuing effort to combat the consequences of TBI and new ways to enhance repair of the damaged brain. PMID:23061919
Leite Figueiredo, Débora Alvares; Branco, Paola Cristina; Dos Santos, Douglas Amaral; Emerenciano, Andrews Krupinski; Iunes, Renata Stecca; Shimada Borges, João Carlos; Machado Cunha da Silva, José Roberto
2016-11-01
The rising concentration of atmospheric CO 2 by anthropogenic activities is changing the chemistry of the oceans, resulting in a decreased pH. Several studies have shown that the decrease in pH can affect calcification rates and reproduction of marine invertebrates, but little attention has been drawn to their immune response. Thus this study evaluated in two adult tropical sea urchin species, Lytechinus variegatus and Echinometra lucunter, the effects of ocean acidification over a period of 24h and 5days, on parameters of the immune response, the extracellular acid base balance, and the ability to recover these parameters. For this reason, the phagocytic capacity (PC), the phagocytic index (PI), the capacity of cell adhesion, cell spreading, cell spreading area of phagocytic amebocytes in vitro, and the coelomic fluid pH were analyzed in animals exposed to a pH of 8.0 (control group), 7.6 and 7.3. Experimental pH's were predicted by IPCC for the future of the two species. Furthermore, a recovery test was conducted to verify whether animals have the ability to restore these physiological parameters after being re-exposed to control conditions. Both species presented a significant decrease in PC, in the pH of coelomic fluid and in the cell spreading area. Besides that, Echinometra lucunter showed a significant decrease in cell spreading and significant differences in coelomocyte proportions. The recovery test showed that the PC of both species increased, also being below the control values. Even so, they were still significantly higher than those exposed to acidified seawater, indicating that with the re-establishment of the pH value the phagocytic capacity of cells tends to restore control conditions. These results demonstrate that the immune system and the coelomic fluid pH of these animals can be affected by ocean acidification. However, the effects of a short-term exposure can be reversible if the natural values are re-established. Thus, the effects of
The twilight of immunity: emerging concepts in aging of the immune system.
Nikolich-Žugich, Janko
2018-01-01
Immunosenescence is a series of age-related changes that affect the immune system and, with time, lead to increased vulnerability to infectious diseases. This Review addresses recent developments in the understanding of age-related changes that affect key components of immunity, including the effect of aging on cells of the (mostly adaptive) immune system, on soluble molecules that guide the maintenance and function of the immune system and on lymphoid organs that coordinate both the maintenance of lymphocytes and the initiation of immune responses. I further address the effect of the metagenome and exposome as key modifiers of immune-system aging and discuss a conceptual framework in which age-related changes in immunity might also affect the basic rules by which the immune system operates.
Neuropeptide Substance P and the Immune Response
Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza
2016-01-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883
Neuropeptide substance P and the immune response.
Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza
2016-11-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.
Anti-gluten immune response following Toxoplasma gondii infection in mice.
Severance, Emily G; Kannan, Geetha; Gressitt, Kristin L; Xiao, Jianchun; Alaedini, Armin; Pletnikov, Mikhail V; Yolken, Robert H
2012-01-01
Gluten sensitivity may affect disease pathogenesis in a subset of individuals who have schizophrenia, bipolar disorder or autism. Exposure to Toxoplasma gondii is a known risk factor for the development of schizophrenia, presumably through a direct pathological effect of the parasite on brain and behavior. A co-association of antibodies to wheat gluten and to T. gondii in individuals with schizophrenia was recently uncovered, suggesting a coordinated gastrointestinal means by which T. gondii and dietary gluten might generate an immune response. Here, we evaluated the connection between these infectious- and food-based antigens in mouse models. BALB/c mice receiving a standard wheat-based rodent chow were infected with T. gondii via intraperitoneal, peroral and prenatal exposure methods. Significant increases in the levels of anti-gluten IgG were documented in all infected mice and in offspring from chronically infected dams compared to uninfected controls (repetitive measures ANOVAs, two-tailed t-tests, all p≤0.00001). Activation of the complement system accompanied this immune response (p≤0.002-0.00001). Perorally-infected females showed higher levels of anti-gluten IgG than males (p≤0.009) indicating that T. gondii-generated gastrointestinal infection led to a significant anti-gluten immune response in a sex-dependent manner. These findings support a gastrointestinal basis by which two risk factors for schizophrenia, T. gondii infection and sensitivity to dietary gluten, might be connected to produce the immune activation that is becoming an increasingly recognized pathology of psychiatric disorders.
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation
Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.
1978-01-01
A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541
Host Immune Response to Influenza A Virus Infection.
Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long
2018-01-01
Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.
Immunomodulator-based enhancement of anti smallpox immune responses.
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.
Huntley, Nichole F; Nyachoti, C Martin; Patience, John F
2018-01-01
Pathogen or diet-induced immune activation can partition energy and nutrients away from growth, but clear relationships between immune responses and the direction and magnitude of energy partitioning responses have yet to be elucidated. The objectives were to determine how β-mannanase supplementation and lipopolysaccharide (LPS) immune stimulation affect maintenance energy requirements (MEm) and to characterize immune parameters, digestibility, growth performance, and energy balance. In a randomized complete block design, 30 young weaned pigs were assigned to either the control treatment (CON; basal corn, soybean meal and soybean hulls diet), the enzyme treatment (ENZ; basal diet + 0.056% β-mannanase), or the immune system stimulation treatment (ISS; basal diet + 0.056% β-mannanase, challenged with repeated increasing doses of Escherichia coli LPS). The experiment consisted of a 10-d adaptation period, 5-d digestibility and nitrogen balance measurement, 22 h of heat production (HP) measurements, and 12 h of fasting HP measurements in indirect calorimetry chambers. The immune challenge consisted of 4 injections of either LPS (ISS) or sterile saline (CON and ENZ), one every 48 h beginning on d 10. Blood was collected pre- and post-challenge for complete blood counts with differential, haptoglobin and mannan binding lectin, 12 cytokines, and glucose and insulin concentrations. Beta-mannanase supplementation did not affect immune status, nutrient digestibility, growth performance, energy balance, or ME m . The ISS treatment induced fever, elevated proinflammatory cytokines and decreased leukocyte concentrations ( P < 0.05). The ISS treatment did not impact nitrogen balance or nutrient digestibility ( P > 0.10), but increased total HP (21%) and ME m (23%), resulting in decreased lipid deposition (-30%) and average daily gain (-18%) ( P < 0.05). This experiment provides novel data on β-mannanase supplementation effects on immune parameters and
Stress proteins and the immune response.
Moseley, P
2000-07-25
The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61
Human Immune Responses to Dengue Viruses.
1984-08-01
ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON
Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran
2016-01-01
Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population
The unfolded protein response in immunity and inflammation
Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.
2017-01-01
The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803
Injury-induced immune responses in Hydra.
Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte
2014-08-01
The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights
B cell function in the immune response to helminths
Harris, Nicola
2010-01-01
Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556
Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833
APRIL:TACI axis is dispensable for the immune response to rabies vaccination.
Haley, Shannon L; Tzvetkov, Evgeni P; Lytle, Andrew G; Alugupalli, Kishore R; Plummer, Joseph R; McGettigan, James P
2017-08-01
There is significant need to develop a single-dose rabies vaccine to replace the current multi-dose rabies vaccine regimen and eliminate the requirement for rabies immune globulin in post-exposure settings. To accomplish this goal, rabies virus (RABV)-based vaccines must rapidly activate B cells to secrete antibodies which neutralize pathogenic RABV before it enters the CNS. Increased understanding of how B cells effectively respond to RABV-based vaccines may improve efforts to simplify post-exposure prophylaxis (PEP) regimens. Several studies have successfully employed the TNF family cytokine a proliferation-inducing ligand (APRIL) as a vaccine adjuvant. APRIL binds to the receptors TACI and B cell maturation antigen (BCMA)-expressed by B cells in various stages of maturation-with high affinity. We discovered that RABV-infected primary murine B cells upregulate APRIL ex vivo. Cytokines present at the time of antigen exposure affect the outcome of vaccination by influencing T and B cell activation and GC formation. Therefore, we hypothesized that the presence of APRIL at the time of RABV-based vaccine antigen exposure would support the generation of protective antibodies against RABV glycoprotein (G). In an effort to improve the response to RABV vaccination, we constructed and characterized a live recombinant RABV-based vaccine vector which expresses murine APRIL (rRABV-APRIL). Immunogenicity testing in mice demonstrated that expressing APRIL from the RABV genome does not impact the primary antibody response against RABV G compared to RABV alone. In order to evaluate the necessity of APRIL for the response to rabies vaccination, we compared the responses of APRIL-deficient and wild-type mice to immunization with rRABV. APRIL deficiency does not affect the primary antibody response to vaccination. Furthermore, APRIL expression by the vaccine did not improve the generation of long-lived antibody-secreting plasma cells (PCs) as serum antibody levels were equivalent
Mucosal immune response to poliovirus vaccines in childhood.
Ogra, P L
1984-01-01
Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.
Rodenas, M C; Cabas, I; García-Alcázar, A; Meseguer, J; Mulero, V; García-Ayala, A
2016-05-01
17α-ethynylestradiol (EE2), a synthetic estrogen used in oral contraceptives and hormone replacement therapy, tamoxifen (Tmx), a selective estrogen-receptor modulator used in hormone replacement therapy, and G1, a G protein-coupled estrogen receptor (GPER) selective agonist, differentially increased the hepatic vitellogenin (vtg) gene expression and altered the immune response in adult gilthead seabream (Sparus aurata L.) males. However, no information exists on the effects of these compounds on the immune response of juveniles. This study aims, for the first time, to investigate the effects of the dietary intake of EE2, Tmx or G1 on the immune response of gilthead seabream juveniles and the capacity of the immune system of the specimens to recover its functionality after ceasing exposures (recovery period). The specimens were immunized with hemocyanin in the presence of aluminium adjuvant 1 (group A) or 120 (group B) days after the treatments ceased (dpt). The results indicate that EE2 and Tmx, but not G1, differentially promoted a transient alteration in hepatic vtg gene expression. Although all three compounds did not affect the production of reactive oxygen intermediates, they inhibited the induction of interleukin-1β (il1b) gene expression after priming. Interestingly, although Tmx increased the percentage of IgM-positive cells in both head kidney and spleen during the recovery period, the antibody response of vaccinated fish varied depending on the compound used and when the immunization was administered. Taken together, our results suggest that these compounds differentially alter the capacity of fish to respond to infection during ontogeny and, more interestingly, that the adaptive immune response remained altered to an extent that depends on the compound. Copyright © 2016 Elsevier Ltd. All rights reserved.
Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke
2013-01-01
Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066
Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K
2014-01-01
We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.
Antitumor immune responses mediated by dendritic cells
Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne
2013-01-01
Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744
2013-01-01
Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half
Mina, Despoina; Sagonas, Kostas; Fragopoulou, Adamantia F; Pafilis, Panayiotis; Skouroliakou, Aikaterini; Margaritis, Lukas H; Tsitsilonis, Ourania E; Valakos, Efstratios D
2016-01-01
During the last three decades, the number of devices that emit non-ionizing electromagnetic radiation (EMR) at the wireless communication spectrum has rapidly increased and possible effects on living organisms have become a major concern. The purpose of this study was to investigate the effects of radiofrequency EMR emitted by a widely used wireless communication device, namely the Digital Enhanced Communication Telephony (DECT) base, on the immune responses of the Aegean wall lizard (Podarcis erhardii). Adult male lizards were exposed 24 h/day for 8 weeks to 1880-1900 MHz DECT base radiation at average electric field intensity of 3.2 V/m. Immune reactivity was assessed using the phytohemagglutinin (PHA) skin swelling and mixed lymphocyte reaction (MLR) tests. Our results revealed a noticeable suppression (approximately 45%) of inflammatory responses in EMR-exposed lizards compared to sham-exposed animals. T cell-mediated responses were marginally affected. Daily radiofrequency EMR exposure seems to affect, at least partially, the immunocompetence of the Aegean wall lizard.
Damage signals in the insect immune response
Krautz, Robert; Arefin, Badrul; Theopold, Ulrich
2014-01-01
Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815
Anti-Gluten Immune Response following Toxoplasma gondii Infection in Mice
Severance, Emily G.; Kannan, Geetha; Gressitt, Kristin L.; Xiao, Jianchun; Alaedini, Armin; Pletnikov, Mikhail V.; Yolken, Robert H.
2012-01-01
Gluten sensitivity may affect disease pathogenesis in a subset of individuals who have schizophrenia, bipolar disorder or autism. Exposure to Toxoplasma gondii is a known risk factor for the development of schizophrenia, presumably through a direct pathological effect of the parasite on brain and behavior. A co-association of antibodies to wheat gluten and to T. gondii in individuals with schizophrenia was recently uncovered, suggesting a coordinated gastrointestinal means by which T. gondii and dietary gluten might generate an immune response. Here, we evaluated the connection between these infectious- and food-based antigens in mouse models. BALB/c mice receiving a standard wheat-based rodent chow were infected with T. gondii via intraperitoneal, peroral and prenatal exposure methods. Significant increases in the levels of anti-gluten IgG were documented in all infected mice and in offspring from chronically infected dams compared to uninfected controls (repetitive measures ANOVAs, two-tailed t-tests, all p≤0.00001). Activation of the complement system accompanied this immune response (p≤0.002–0.00001). Perorally-infected females showed higher levels of anti-gluten IgG than males (p≤0.009) indicating that T. gondii-generated gastrointestinal infection led to a significant anti-gluten immune response in a sex-dependent manner. These findings support a gastrointestinal basis by which two risk factors for schizophrenia, T. gondii infection and sensitivity to dietary gluten, might be connected to produce the immune activation that is becoming an increasingly recognized pathology of psychiatric disorders. PMID:23209841
Interplay between behavioural thermoregulation and immune response in mealworms.
Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco
2012-11-01
Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.
2014-01-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276
Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C
2015-03-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Branched-chain amino acid supplementation and the immune response of long-distance athletes.
Bassit, Reinaldo A; Sawada, Letícia A; Bacurau, Reury F P; Navarro, Franciso; Martins, Eivor; Santos, Ronaldo V T; Caperuto, Erico C; Rogeri, Patrícia; Costa Rosa, Luís F B P
2002-05-01
Intense long-duration exercise has been associated with immunosuppression, which affects natural killer cells, lymphokine-activated killer cells, and lymphocytes. The mechanisms involved, however, are not fully determined and seem to be multifactorial, including endocrine changes and alteration of plasma glutamine concentration. Therefore, we evaluated the effect of branched-chain amino acid supplementation on the immune response of triathletes and long-distance runners. Peripheral blood was collected prior to and immediately after an Olympic Triathlon or a 30k run. Lymphocyte proliferation, cytokine production by cultured cells, and plasma glutamine were measured. After the exercise bout, athletes from the placebo group presented a decreased plasma glutamine concentration that was abolished by branched-chain amino acid supplementation and an increased proliferative response in their peripheral blood mononuclear cells. Those cells also produced, after exercise, less tumor necrosis factor, interleukins-1 and -4, and interferon and 48% more interleukin-2. Supplementation stimulated the production of interleukin-2 and interferon after exercise and a more pronounced decrease in the production of interleukin-4, indicating a diversion toward a Th1 type immune response. Our results indicate that branched-chain amino acid (BCAA) supplementation recovers the ability of peripheral blood mononuclear cells proliferate in response to mitogens after a long distance intense exercise, as well as plasma glutamine concentration. The amino acids also modify the pattern of cytokine production leading to a diversion of the immune response toward a Th1 type of immune response.
Immune Response to Giardia duodenalis
Faubert, Gaétan
2000-01-01
The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490
Piasecka, Barbara; Duffy, Darragh; Urrutia, Alejandra; Quach, Hélène; Patin, Etienne; Posseme, Céline; Bergstedt, Jacob; Charbit, Bruno; Rouilly, Vincent; MacPherson, Cameron R; Hasan, Milena; Albaud, Benoit; Gentien, David; Fellay, Jacques; Albert, Matthew L; Quintana-Murci, Lluis
2018-01-16
The contribution of host genetic and nongenetic factors to immunological differences in humans remains largely undefined. Here, we generated bacterial-, fungal-, and viral-induced immune transcriptional profiles in an age- and sex-balanced cohort of 1,000 healthy individuals and searched for the determinants of immune response variation. We found that age and sex affected the transcriptional response of most immune-related genes, with age effects being more stimulus-specific relative to sex effects, which were largely shared across conditions. Although specific cell populations mediated the effects of age and sex on gene expression, including CD8 + T cells for age and CD4 + T cells and monocytes for sex, we detected a direct effect of these intrinsic factors for the majority of immune genes. The mapping of expression quantitative trait loci (eQTLs) revealed that genetic factors had a stronger effect on immune gene regulation than age and sex, yet they affected a smaller number of genes. Importantly, we identified numerous genetic variants that manifested their regulatory effects exclusively on immune stimulation, including a Candida albicans -specific master regulator at the CR1 locus. These response eQTLs were enriched in disease-associated variants, particularly for autoimmune and inflammatory disorders, indicating that differences in disease risk may result from regulatory variants exerting their effects only in the presence of immune stress. Together, this study quantifies the respective effects of age, sex, genetics, and cellular heterogeneity on the interindividual variability of immune responses and constitutes a valuable resource for further exploration in the context of different infection risks or disease outcomes. Copyright © 2018 the Author(s). Published by PNAS.
Khattar, Sunil K; Palaniyandi, Senthilkumar; Samal, Sweety; LaBranche, Celia C; Montefiori, David C; Zhu, Xiaoping; Samal, Siba K
2015-01-01
The combination of multiple HIV antigens in a vaccine can broaden antiviral immune responses. In this study, we used NDV vaccine strain LaSota to generate rNDV (rLaSota/optGag) expressing human codon optimized p55 Gag protein of HIV-1. We examined the effect of co-immunization of rLaSota/optGag with rNDVs expressing different forms of Env protein gp160, gp120, gp140L [a version of gp140 that lacked cytoplasmic tail and contained complete membrane-proximal external region (MPER)] and gp140S (a version of gp140 that lacked cytoplasmic tail and distal half of MPER) on magnitude and breadth of humoral, mucosal and cellular immune responses in guinea pigs and mice. Our results showed that inclusion of rLaSota/optGag with rNDVs expressing different forms of Env HIV Gag did not affect the Env-specific humoral and mucosal immune responses in guinea pigs and that the potent immune responses generated against Env persisted for at least 13 weeks post immunization. The highest Env-specific humoral and mucosal immune responses were observed with gp140S+optGag group. The neutralizing antibody responses against HIV strains BaL.26 and MN.3 induced by gp140S+optGag and gp160+optGag were higher than those elicited by other groups. Inclusion of Gag with gp160, gp140S and gp140L enhanced the level of Env-specific IFN-γ-producing CD8+ T cells in mice. Inclusion of Gag with gp160 and gp140L also resulted in increased Env-specific CD4+ T cells. The level of Gag-specific CD8+ and CD4+ T cells was also enhanced in mice immunized with Gag along with gp140S and gp120. These results indicate lack of antigen interference in a vaccine containing rNDVs expressing Env and Gag proteins. PMID:25695657
Immune drug discovery from venoms.
Jimenez, Rocio; Ikonomopoulou, Maria P; Lopez, J Alejandro; Miles, John J
2018-01-01
This review catalogues recent advances in knowledge on venoms as standalone therapeutic agents or as blueprints for drug design, with an emphasis on venom-derived compounds that affects the immune system. We discuss venoms and venom-derived compounds that affect total immune cell numbers, immune cell proliferation, immune cell migration, immune cell phenotype and cytokine secretion. Identifying novel compounds that 'tune' the system, up-regulating the immune response during infectious disease and cancer and down-regulating the immune response during autoimmunity, will greatly expand the tool kit of human immunotherapeutics. Targeting these pathways may also open therapeutic options that alleviate symptoms of envenomation. Finally, combining recent advances in venomics with progress in low cost, high-throughput screening platforms will no doubt yield hundreds of prototype immune modulating compounds in the coming years. Copyright © 2017 Elsevier Ltd. All rights reserved.
Interaction between sleep and the immune response in Drosophila: a role for the NFkappaB relish.
Williams, Julie A; Sathyanarayanan, Sriram; Hendricks, Joan C; Sehgal, Amita
2007-04-01
The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFkappaB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response.
Interaction Between Sleep and the Immune Response in Drosophila: A Role for the NFκB Relish
Williams, Julie A.; Sathyanarayanan, Sriram; Hendricks, Joan C.; Sehgal, Amita
2010-01-01
Study Objectives The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. Design We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. Results A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFκB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. Conclusion These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response. PMID:17520783
Immune status influences fear and anxiety responses in mice after acute stress exposure
Clark, Sarah M.; Sand, Joseph; Francis, T. Chase; Nagaraju, Anitha; Michael, Kerry C.; Keegan, Achsah D.; Kusnecov, Alexander; Gould, Todd D.; Tonelli, Leonardo H.
2014-01-01
Significant evidence suggests that exposure to traumatic and/or acute stress in both mice and humans results in compromised immune function that in turn may affect associated brain processes. Additionally, recent studies in mouse models of immune deficiency have suggested that adaptive immunity may play a role during traumatic stress exposure and that impairments in lymphocyte function may contribute to increased susceptibility to various psychogenic stressors. However, rodent studies on the relationship between maladaptive stress responses and lymphocyte deficiency have been complicated by the fact that genetic manipulations in these models may also result in changes in CNS function due to the expression of targeted genes in tissues other than lymphocytes, including the brain. To address these issues we utilized mice with a deletion of recombination-activating gene 2 (Rag2), which has no confirmed expression in the CNS; thus, its loss should result in the absence of mature lymphocytes without altering CNS function directly. Stress responsiveness of immune deficient Rag2−/− mice on a BALB/c background was evaluated in three different paradigms: predator odor exposure (POE), fear conditioning (FC) and learned helplessness (LH). These models are often used to study different aspects of stress responsiveness after the exposure to an acute stressor. In addition, immunoblot analysis was used to assess hippocampal BDNF expression under both stressed and non-stressed conditions. Subsequent to POE, Rag2−/− mice exhibited a reduced acoustic startle response compared to BALB/c mice; no significant differences in behavior were observed in either FC or LH. Furthermore, analysis of hippocampal BDNF indicated that Rag2−/− mice have elevated levels of the mature form of BDNF compared to BALB/c mice. Results from our studies suggest that the absence of mature lymphocytes is associated with increased resilience to stress exposure in the POE and does not affect
Q fever in pregnant goats: humoral and cellular immune responses
2013-01-01
Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213
The innate and adaptive immune response to avian influenza virus
USDA-ARS?s Scientific Manuscript database
Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...
Human Immune Responses to Dengue Viruses.
1986-07-01
0-1 NO- 3K1- INO. "o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in
Leukocyte susceptibility and immune response against Vibrio parahaemolyticus in Totoaba macdonaldi.
Reyes-Becerril, Martha; Alamillo, Erika; Sánchez-Torres, Luvia; Ascencio-Valle, Felipe; Perez-Urbiola, Juan C; Angulo, Carlos
2016-12-01
Vibrio parahaemolyticus is a serious pathogen that affects aquaculture. Nonetheless, to the best of our knowledge, no studies have focused on its immunological implications in Totoaba macdonaldi. Thus, the early immune response to V. parahaemolyticus in juveniles of totoaba was studied at 24 h post-infection with an in vivo study. In addition, changes in cellular innate immune parameters - phagocytosis, respiratory burst activity and viability (annexin V/propidium iodide) - were evaluated in vitro in head-kidney, spleen and thymus leukocytes at 6 and 24 h after bacterial stimulation by flow cytometry. Simultaneously, the expression levels of two immune-relevant genes (IL-1β and IL-8) were measured by using real time PCR. During in vivo study, mRNA transcripts of IL-1β were highly expressed in spleen, thymus and intestine and down-regulated in liver after 24 h post-infection. IL-8 gene expression was upregulated in spleen, intestine and liver compared to that of non-infected fish and down-regulated in thymus after 24 h post-infection. Generally, the results showed a significant decrease in cellular immune responses during the infection, principally in phagocytic ability and respiratory burst. The survival or viability of stimulated leukocytes was significantly reduced causing necrosis and apoptosis, indicating a robust killing response by V. parahaemolyticus. Finally the in vitro analysis showed that transcript levels of IL-1β and IL-8 were up-regulated during stimulation with V. parahaemolyticus in head-kidney, spleen and intestine and down-regulated in thymus at any time of the experiment. Although V. parahaemolyticus has been reported to be an important pathogen for many aquatic organisms, to our knowledge this might be the first report of early-immune response in juvenile totoaba and these immune parameters may be reliable indicators and can be useful in the health control of this species. Copyright © 2016 Elsevier Ltd. All rights reserved.
SUMO-Enriched Proteome for Drosophila Innate Immune Response
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.
2015-01-01
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570
SUMO-Enriched Proteome for Drosophila Innate Immune Response.
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S
2015-08-18
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.
Phillips, Derrick J; Savenkova, Marina I; Karatsoreos, Ilia N
2015-07-01
In mammals, one of the most salient outputs of the circadian (daily) clock is the timing of the sleep-wake cycle. Modern industrialized society has led to a fundamental breakdown in the relationship between our endogenous timekeeping systems and the solar day, disrupting normal circadian rhythms. We have argued that disrupted circadian rhythms could lead to changes in allostatic load, and the capacity of organisms to respond to other environmental challenges. In this set of studies, we apply a model of circadian disruption characterized in our lab in which mice are housed in a 20h long day, with 10h of light and 10h of darkness. We explored the effects of this environmental disruption on sleep patterns, to establish if this model results in marked sleep deprivation. Given the interaction between circadian, sleep, and immune systems, we further probed if our model of circadian disruption also alters the innate immune response to peripheral bacterial endotoxin challenge. Our results demonstrate that this model of circadian disruption does not lead to marked sleep deprivation, but instead affects the timing and quality of sleep. We also show that while circadian disruption does not lead to basal changes in the immune markers we explored, the immune response is affected, both in the brain and the periphery. Together, our findings further strengthen the important role of the circadian timing system in sleep regulation and immune responses, and provide evidence that disrupting the circadian clock increases vulnerability to further environmental stressors, including immunological challenges. Copyright © 2014 Elsevier Inc. All rights reserved.
Immune function trade-offs in response to parasite threats.
Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W
2017-04-01
Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Innate immune sensing and response to influenza.
Pulendran, Bali; Maddur, Mohan S
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.
Control of epithelial immune-response genes and implications for airway immunity and inflammation.
Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J
1998-01-01
A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.
Innate immune response development in nestling tree swallows
Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.
2011-01-01
We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.
Gleditsch, Dorothy D; Shornick, Laurie P; Van Steenwinckel, Juliette; Gressens, Pierre; Weisert, Ryan P; Koenig, Joyce M
2014-07-01
Chorioamnionitis, an inflammatory gestational disorder, commonly precedes preterm delivery. Preterm infants may be at particular risk for inflammation-related morbidity related to infection, although the pathogenic mechanisms are unclear. We hypothesized that maternal inflammation modulates immune programming to drive postnatal inflammatory processes. We used a novel combined murine model to treat late gestation dams with low-dose lipopolysaccharide (LPS) and to secondarily challenge exposed neonates or weanlings with Sendai virus (SeV) lung infection. Multiple organs were analyzed to characterize age-specific postnatal immune and inflammatory responses. Maternal LPS treatment enhanced innate immune populations in the lungs, livers, and/or spleens of exposed neonates or weanlings. Secondary lung SeV infection variably affected neutrophil, macrophage, and dendritic cell proportions in multiple organs of exposed pups. Neonatal lung infection induced brain interleukin (IL)-4 expression, although this response was muted in LPS-exposed pups. Adaptive immune cells, including lung, lymph node, and thymic lymphocytes and lung CD4 cells expressing FoxP3, interferon (IFN)-γ, or IL-17, were variably prominent in LPS-exposed pups. Maternal inflammation modifies postnatal immunity and augments systemic inflammatory responses to viral lung infection in an age-specific manner. We speculate that inflammatory modulation of the developing immune system contributes to chronic morbidity and mortality in preterm infants.
Modeling Systems-Level Regulation of Host Immune Responses
Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka
2007-01-01
Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300
Serologic and mucosal immune response to rotavirus infection in the rabbit model.
Conner, M E; Gilger, M A; Estes, M K; Graham, D Y
1991-01-01
We examined the humoral immune response to rotavirus infection in specific pathogen-free rabbits inoculated and challenged orally with rabbit Ala rotavirus (7.5 x 10(5) to 1 x 10(7) PFU). The humoral immune response in both serologic and mucosal samples was monitored by using total antibody enzyme-linked immunosorbent assays (ELISAs), isotype-specific ELISAs, and plaque reduction neutralization assays. Following a primary infection, all rabbits shed virus and serologic and mucosal antibody responses were initially detected by 1 week postinoculation. Intestinal immunoglobulin M was detected by 3 days postinoculation, and secretory immunoglobulin A was detected by 6 days postinoculation. Following challenge, rabbits were protected (no detectable virus shedding) from infection. An anamnestic immune response was observed only with mucosal neutralizing antibodies, and all serologic and mucosal immune responses persisted at high levels until at least 175 days postchallenge (204 days postinoculation). Detection of neutralization responses was influenced by the virus strain used in the neutralization assay; all inoculated rabbits developed detectable serum and intestinal neutralizing antibodies against the infecting (Ala) virus strain. Neutralization activity in both serum and mucosal samples was generally, but not exclusively, homotypic (VP7 serotype 3) after both primary and challenge inoculations with Ala virus. Heterotypic serum neutralization activity was observed with serotype 8 (9 of 12 rabbits) and 9 (12 of 12 rabbits) viruses and may be based on reactivity with the outer capsid protein VP4 or on a shared epitope in the C region of VP7. Comparisons of heterologous (serotype 3) and heterotypic neutralizing responses in mucosal and serologic samples revealed that 43% (21 of 49) of the responses were discordant. In 19 of 49 (39%) of these cases, a heterotypic serologic response was seen in the absence of a heterotypic mucosal response, but in 2 of 49 (4%) instances, a
Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.
Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C
2016-05-01
Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.
Agouron and immune response to commercialize remune immune-based treatment.
James, J S
1998-06-19
Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.
Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877
Modeling the interactions between pathogenic bacteria, bacteriophage and immune response
NASA Astrophysics Data System (ADS)
Leung, Chung Yin (Joey); Weitz, Joshua S.
The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.
ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.
2009-01-01
Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune
Immune response of laying hens exposed to 30 ppm ammonia for 25 weeks
USDA-ARS?s Scientific Manuscript database
Ammonia is one of the most prominent aerial pollutants inside poultry production facilities, affecting chicken health and well-being based on its levels and exposure durations. The aim of this study was to investigate the effect of 30 ppm ammonia on the immune response of laying hens. Hens at 18 wk ...
Host genetics affect microbial ecosystems via host immunity.
El Kafsi, Hela; Gorochov, Guy; Larsen, Martin
2016-10-01
Genetic evolution of multicellular organisms has occurred in response to environmental challenges, including competition for nutrients, climate change, physical and chemical stressors, and pathogens. However, fitness of an organism is dependent not only on defense efficacy, but also on the ability to take advantage of symbiotic organisms. Indeed, microbes not only encompass pathogenicity, but also enable efficient nutrient uptake from diets nondegradable by the host itself. Moreover, microbes play important roles in the development of host immunity. Here we review associations between specific host genes and variance in microbiota composition and compare with interactions between microbes and host immunity. Recent genome-wide association studies reveal that symbiosis between host and microbiota is the exquisite result of genetic coevolution. Moreover, a subset of microbes from human and mouse microbiota have been identified to interact with humoral and cellular immunity. Interestingly, microbes associated with both host genetics and host immunity are taxonomically related. Most involved are Bifidobacterium, Lactobacillus, and Akkermansia, which are dually associated with both host immunity and host genetics. We conclude that future therapeutics targeting microbiota in the context of chronic inflammatory diseases need to consider both immune and genetic host features associated with microbiota homeostasis.
Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor
2008-04-01
Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.
Peroxiredoxin 5 modulates immune response in Drosophila
Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.
2010-01-01
Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624
The innate immune response during urinary tract infection and pyelonephritis
Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.
2013-01-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397
The innate immune response during urinary tract infection and pyelonephritis.
Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S
2014-07-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.
Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas
Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.
2000-01-01
Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a
Salmonella Fecal Shedding and Immune Responses are Dose- and Serotype- Dependent in Pigs
Ivanek, Renata; Österberg, Julia; Gautam, Raju; Sternberg Lewerin, Susanna
2012-01-01
Despite the public health importance of Salmonella infection in pigs, little is known about the associated dynamics of fecal shedding and immunity. In this study, we investigated the transitions of pigs through the states of Salmonella fecal shedding and immune response post-Salmonella inoculation as affected by the challenge dose and serotype. Continuous-time multistate Markov models were developed using published experimental data. The model for shedding had four transient states, of which two were shedding (continuous and intermittent shedding) and two non-shedding (latency and intermittent non-shedding), and one absorbing state representing permanent cessation of shedding. The immune response model had two transient states representing responses below and above the seroconversion level. The effects of two doses [low (0.65×106 CFU/pig) and high (0.65×109 CFU/pig)] and four serotypes (Salmonella Yoruba, Salmonella Cubana, Salmonella Typhimurium, and Salmonella Derby) on the models' transition intensities were evaluated using a proportional intensities model. Results indicated statistically significant effects of the challenge dose and serotype on the dynamics of shedding and immune response. The time spent in the specific states was also estimated. Continuous shedding was on average 10–26 days longer, while intermittent non-shedding was 2–4 days shorter, in pigs challenged with the high compared to low dose. Interestingly, among pigs challenged with the high dose, the continuous and intermittent shedding states were on average up to 10–17 and 3–4 days longer, respectively, in pigs infected with S. Cubana compared to the other three serotypes. Pigs challenged with the high dose of S. Typhimurium or S. Derby seroconverted on average up to 8–11 days faster compared to the low dose. These findings highlight that Salmonella fecal shedding and immune response following Salmonella challenge are dose- and serotype-dependent and that the detection of specific
Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.
Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M
2013-04-16
Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.
Immune and stress responses in oysters with insights on adaptation.
Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude
2015-09-01
Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.
Innate Immune Sensing and Response to Influenza
Pulendran, Bali; Maddur, Mohan S.
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919
Pan, Tingru; Liu, Tianqi; Tan, Siran; Wan, Na; Zhang, Yiming; Li, Shu
2018-04-01
The objective of the present study was to investigate whether dietary selenium (Se) deficiency would affect the expression of selenoprotein T (SelT) and immune response in the immune organs of broilers. Changes in expression of inflammatory cytokines and oxidative stress response caused by Se deficiency can lead to organism damage, which in turn leads to immune response. Sixty (1-day-old) broilers were divided into the control group and Se-deficiency group. Animal models with exudative diathesis were duplicated in the broilers by feeding them Se-deficient diet for 20 days. After the Se-deficient group exhibited symptoms of exudative diathesis, all the broilers were euthanized, and their immune organs were taken for analysis. The tissues including spleen, bursa of Fabricius, and thymus were treated to determine the pathological changes (including microscopic and ultramicroscopic), the messenger RNA (mRNA) expression levels of SelT and its synthetase (SecS and SPS1), cytokine mRNA expression levels, and antioxidant status. The microscopic and ultramicroscopic analyses showed that immune tissues were obviously injured in the Se-deficient group. The mRNA expression of SelT was decreased compared with that in the control group. Meanwhile, the mRNA expression levels of SecS and SPS1 were downregulated. In the Se-deficient group, the mRNA expression levels of IL-1R and IL-1β were higher than those of three control organs. Additionally, the IL-2 and INF-γ mRNA expression levels were lower than those of the control group. The activity of CAT was decreased, and the contents of H 2 O 2 and •OH were increased due to Se deficiency. Pearson method analysis showed that the expression of SelT had a positive correlation with IL-2, INF-γ, SecS, and SPS1 and a negative correlation with IL-1R and IL-1β. In summary, these data indicated that Se-deficient diet decreased the SelT expression and its regulation of oxidative stress, and it inhibited a pleiotropic mechanism of the
Probiotics, antibiotics and the immune responses to vaccines
Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep
2015-01-01
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456
Probiotics, antibiotics and the immune responses to vaccines.
Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep
2015-06-19
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Sombetzki, Martina; Koslowski, Nicole; Rabes, Anne; Seneberg, Sonja; Winkelmann, Franziska; Fritzsche, Carlos; Loebermann, Micha; Reisinger, Emil C
2018-01-01
Infection with the intravascular diecious trematode Schistosoma spp . remains a serious tropical disease and public health problem in the developing world, affecting over 258 million people worldwide. During chronic Schistosoma mansoni infection, complex immune responses to tissue-entrapped parasite eggs provoke granulomatous inflammation which leads to serious damage of the liver and intestine. The suppression of protective host immune mechanisms by helminths promotes parasite survival and benefits the host by reducing tissue damage. However, immune-suppressive cytokines may reduce vaccine-induced immune responses. By combining a single-sex infection system with a murine air pouch model, we were able to demonstrate that male and female schistosomes play opposing roles in modulating the host's immune response. Female schistosomes suppress early innate immune responses to invading cercariae in the skin and upregulate anergy-associated genes. In contrast, male schistosomes trigger strong innate immune reactions which lead to a reduction in worm and egg burden in the liver. Our data suggest that the female worm is a neglected player in the dampening of the host's immune defense system and is therefore a promising target for new immune modulatory therapies.
Characterization of host immune responses in Ebola virus infections.
Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo
2014-06-01
Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.
Hall, Jessica M. F.; Cruser, desAnges; Podawiltz, Alan; Mummert, Diana I.; Jones, Harlan; Mummert, Mark E.
2012-01-01
Psychological stress, an evolutionary adaptation to the fight-or-flight response, triggers a number of physiological responses that can be deleterious under some circumstances. Stress signals activate the hypothalamus-pituitary-adrenal (HPA) axis and the sympathetic nervous system. Elements derived from those systems (e.g., cortisol, catecholamines and neuropeptides) can impact the immune system and possible disease states. Skin provides a first line of defense against many environmental insults. A number of investigations have indicated that the skin is especially sensitive to psychological stress, and experimental evidence shows that the cutaneous innate and adaptive immune systems are affected by stressors. For example, psychological stress has been shown to reduce recovery time of the stratum corneum barrier after its removal (innate immunity) and alters antigen presentation by epidermal Langerhans cells (adaptive immunity). Moreover, psychological stress may trigger or exacerbate immune mediated dermatological disorders. Understanding how the activity of the psyche-nervous -immune system axis impinges on skin diseases may facilitate coordinated treatment strategies between dermatologists and psychiatrists. Herein, we will review the roles of the HPA axis and the sympathetic nervous system on the cutaneous immune response. We will selectively highlight how the interplay between psychological stress and the immune system affects atopic dermatitis and psoriasis. PMID:22969795
Body height affects the strength of immune response in young men, but not young women.
Krams, Indrikis A; Skrinda, Ilona; Kecko, Sanita; Moore, Fhionna R; Krama, Tatjana; Kaasik, Ants; Meija, Laila; Lietuvietis, Vilnis; Rantala, Markus J
2014-08-28
Body height and other body attributes of humans may be associated with a diverse range of social outcomes such as attractiveness to potential mates. Despite evidence that each parameter plays a role in mate choice, we have little understanding of the relative role of each, and relationships between indices of physical appearance and general health. In this study we tested relationships between immune function and body height of young men and women. In men, we report a non-linear relationship between antibody response to a hepatitis-B vaccine and body height, with a positive relationship up to a height of 185 cm, but an inverse relationship in taller men. We did not find any significant relationship between body height and immune function in women. Our results demonstrate the potential of vaccination research to reveal costly traits that govern evolution of mate choice in humans and the importance of trade-offs among these traits.
Body height affects the strength of immune response in young men, but not young women
Krams, Indrikis A.; Skrinda, Ilona; Kecko, Sanita; Moore, Fhionna R.; Krama, Tatjana; Kaasik, Ants; Meija, Laila; Lietuvietis, Vilnis; Rantala, Markus J.
2014-01-01
Body height and other body attributes of humans may be associated with a diverse range of social outcomes such as attractiveness to potential mates. Despite evidence that each parameter plays a role in mate choice, we have little understanding of the relative role of each, and relationships between indices of physical appearance and general health. In this study we tested relationships between immune function and body height of young men and women. In men, we report a non-linear relationship between antibody response to a hepatitis-B vaccine and body height, with a positive relationship up to a height of 185 cm, but an inverse relationship in taller men. We did not find any significant relationship between body height and immune function in women. Our results demonstrate the potential of vaccination research to reveal costly traits that govern evolution of mate choice in humans and the importance of trade-offs among these traits. PMID:25164474
Effects of fenbendazole on routine immune response parameters of BALB/c mice.
Cray, Carolyn; Villar, David; Zaias, Julia; Altman, Norman H
2008-11-01
Fenbendazole (FBZ) is an anthelmintic drug widely used to treat and prevent pinworm outbreaks in laboratory rodents. Although data in nonrodent species indicate possible effects of fenbendazole on the bone marrow and lymphocyte proliferation and function, little has been reported regarding possible effects on the rodent immune system. The purpose of the current study was to determine the effects of a therapeutic regimen of FBZ on immune parameters in BALB/c mice. Both 9-wk on-off and 5-wk continuous medicated feed protocols were assessed. No significant differences between normal and FBZ diet treated mice were observed in the following parameters: complete blood count, blood chemistry, quantitation of major T and B cell markers in spleen, quantitation of T cell markers in the thymus, spleen cell proliferation to T and B cell mitogens, bone marrow colony-forming cell assays, skin graft rejection, and primary and secondary humoral immune responses. These data indicate that FBZ treatment does not affect many standard broad measures of immune function.
Arginine and Citrulline and the Immune Response in Sepsis
Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn
2015-01-01
Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985
The immune response to Nipah virus infection.
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J
2012-09-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.
Chemokine-mediated immune responses in the female genital tract mucosa.
Deruaz, Maud; Luster, Andrew D
2015-04-01
The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.
The RNA-Editing Enzyme ADAR1 Controls Innate Immune Responses to RNA
Mannion, Niamh M.; Greenwood, Sam M.; Young, Robert; Cox, Sarah; Brindle, James; Read, David; Nellåker, Christoffer; Vesely, Cornelia; Ponting, Chris P.; McLaughlin, Paul J.; Jantsch, Michael F.; Dorin, Julia; Adams, Ian R.; Scadden, A.D.J.; Öhman, Marie; Keegan, Liam P.; O’Connell, Mary A.
2014-01-01
Summary The ADAR RNA-editing enzymes deaminate adenosine bases to inosines in cellular RNAs. Aberrant interferon expression occurs in patients in whom ADAR1 mutations cause Aicardi-Goutières syndrome (AGS) or dystonia arising from striatal neurodegeneration. Adar1 mutant mouse embryos show aberrant interferon induction and die by embryonic day E12.5. We demonstrate that Adar1 embryonic lethality is rescued to live birth in Adar1; Mavs double mutants in which the antiviral interferon induction response to cytoplasmic double-stranded RNA (dsRNA) is prevented. Aberrant immune responses in Adar1 mutant mouse embryo fibroblasts are dramatically reduced by restoring the expression of editing-active cytoplasmic ADARs. We propose that inosine in cellular RNA inhibits antiviral inflammatory and interferon responses by altering RLR interactions. Transfecting dsRNA oligonucleotides containing inosine-uracil base pairs into Adar1 mutant mouse embryo fibroblasts reduces the aberrant innate immune response. ADAR1 mutations causing AGS affect the activity of the interferon-inducible cytoplasmic isoform more severely than the nuclear isoform. PMID:25456137
The RNA-editing enzyme ADAR1 controls innate immune responses to RNA.
Mannion, Niamh M; Greenwood, Sam M; Young, Robert; Cox, Sarah; Brindle, James; Read, David; Nellåker, Christoffer; Vesely, Cornelia; Ponting, Chris P; McLaughlin, Paul J; Jantsch, Michael F; Dorin, Julia; Adams, Ian R; Scadden, A D J; Ohman, Marie; Keegan, Liam P; O'Connell, Mary A
2014-11-20
The ADAR RNA-editing enzymes deaminate adenosine bases to inosines in cellular RNAs. Aberrant interferon expression occurs in patients in whom ADAR1 mutations cause Aicardi-Goutières syndrome (AGS) or dystonia arising from striatal neurodegeneration. Adar1 mutant mouse embryos show aberrant interferon induction and die by embryonic day E12.5. We demonstrate that Adar1 embryonic lethality is rescued to live birth in Adar1; Mavs double mutants in which the antiviral interferon induction response to cytoplasmic double-stranded RNA (dsRNA) is prevented. Aberrant immune responses in Adar1 mutant mouse embryo fibroblasts are dramatically reduced by restoring the expression of editing-active cytoplasmic ADARs. We propose that inosine in cellular RNA inhibits antiviral inflammatory and interferon responses by altering RLR interactions. Transfecting dsRNA oligonucleotides containing inosine-uracil base pairs into Adar1 mutant mouse embryo fibroblasts reduces the aberrant innate immune response. ADAR1 mutations causing AGS affect the activity of the interferon-inducible cytoplasmic isoform more severely than the nuclear isoform. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Freitak, Dalial; Wheat, Christopher W; Heckel, David G; Vogel, Heiko
2007-01-01
Background Insects helped pioneer, and persist as model organisms for, the study of specific aspects of immunity. Although they lack an adaptive immune system, insects possess an innate immune system that recognizes and destroys intruding microorganisms. Its operation under natural conditions has not been well studied, as most studies have introduced microbes to laboratory-reared insects via artificial mechanical wounding. One of the most common routes of natural exposure and infection, however, is via food; thus, the role of dietary microbial communities in herbivorous insect immune system evolution invites study. Here, we examine the immune system response and consequences of exposing a lepidopteran agricultural pest to non-infectious microorganisms via simple oral consumption. Results Immune system response was compared between Trichoplusia ni larvae reared on diets with or without non-pathogenic bacteria (Escherichia coli and Micrococcus luteus). Two major immune response-related enzymatic activities responded to diets differently – phenoloxidase activity was inhibited in the bacteria-fed larvae, whereas general antibacterial activity was enhanced. Eight proteins were highly expressed in the hemolymph of the bacteria fed larvae, among them immune response related proteins arylphorin, apolipophorin III and gloverin. Expression response among 25 putative immune response-related genes were assayed via RT-qPCR. Seven showed more than fivefold up regulation in the presence of bacterial diet, with 22 in total being differentially expressed, among them apolipophorin III, cecropin, gallerimycin, gloverin, lysozyme, and phenoloxidase inhibiting enzyme. Finally, potential life-history trade-offs were studied, with pupation time and pupal mass being negatively affected in bacteria fed larvae. Conclusion The presence of bacteria in food, even if non-pathogenic, can trigger an immune response cascade with life history tradeoffs. Trichoplusia ni larvae are able to detect
Influence of ionizing radiation on the immune response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brocadeszaalberg, O.
1974-01-01
The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)
Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K
2011-08-01
The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.
Sex-dependent genetic effects on immune responses to a parasitic nematode.
Hayes, Kelly S; Hager, Reinmar; Grencis, Richard K
2014-03-14
Many disease aetiologies have sex specific effects, which have important implications for disease management. It is now becoming increasingly evident that such effects are the result of the differential expression of autosomal genes rather than sex-specific genes. Such sex-specific variation in the response to Trichuris muris, a murine parasitic nematode infection and model for the human parasitic nematode T. trichiura, has been well documented, however, the underlying genetic causes of these differences have been largely neglected. We used the BXD mouse set of recombinant inbred strains to identify sex-specific loci that contribute to immune phenotypes in T. muris infection. Response phenotypes to T. muris infection were found to be highly variable between different lines of BXD mice. A significant QTL on chromosome 5 (TM5) associated with IFN-γ production was found in male mice but not in female mice. This QTL was in the same location as a suggestive QTL for TNF-α and IL-6 production in male mice suggesting a common control of these pro-inflammatory cytokines. A second QTL was identified on chromosome 4 (TM4) affecting worm burden in both male and female cohorts. We have identified several genes as potential candidates for modifying responses to T. muris infection. We have used the largest mammalian genetic model system, the BXD mouse population, to identify candidate genes with sex-specific effects in immune responses to T. muris infection. Some of these genes may be differentially expressed in male and female mice leading to the difference in immune response between the sexes reported in previous studies. Our study further highlights the importance of considering sex as an important factor in investigations of immune response at the genome-wide level, in particular the bias that can be introduced when generalizing results obtained from only one sex or a mixed sex population. Rather, analyses of interaction effects between sex and genotype should be part of
Lowry, C.A.; Hollis, J.H.; de Vries, A.; Pan, B.; Brunet, L.R.; Hunt, J.R.F.; Paton, J.F.R.; van Kampen, E.; Knight, D.M.; Evans, A.K.; Rook, G.A.W.; Lightman, S.L.
2007-01-01
Peripheral immune activation can have profound physiological and behavioral effects including induction of fever and sickness behavior. One mechanism through which immune activation or immunomodulation may affect physiology and behavior is via actions on brainstem neuromodulatory systems, such as serotonergic systems. We have found that peripheral immune activation with antigens derived from the nonpathogenic, saprophytic bacterium, Mycobacterium vaccae, activated a specific subset of serotonergic neurons in the interfascicular part of the dorsal raphe nucleus (DRI) of mice, as measured by quantification of c-Fos expression following intratracheal (12 h) or s.c. (6 h) administration of heat-killed, ultrasonically disrupted M. vaccae, or heat-killed, intact M. vaccae, respectively. These effects were apparent after immune activation by M. vaccae or its components but not by ovalbumin, which induces a qualitatively different immune response. The effects of immune activation were associated with increases in serotonin metabolism within the ventromedial prefrontal cortex, consistent with an effect of immune activation on mesolimbocortical serotonergic systems. The effects of M. vaccae administration on serotonergic systems were temporally associated with reductions in immobility in the forced swim test, consistent with the hypothesis that the stimulation of mesolimbocortical serotonergic systems by peripheral immune activation alters stress-related emotional behavior. These findings suggest that the immune-responsive subpopulation of serotonergic neurons in the DRI is likely to play an important role in the neural mechanisms underlying regulation of the physiological and pathophysiological responses to both acute and chronic immune activation, including regulation of mood during health and disease states. Together with previous studies, these findings also raise the possibility that immune stimulation activates a functionally and anatomically distinct subset of
Onchocerciasis modulates the immune response to mycobacterial antigens
Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E
1999-01-01
Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056
Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID
Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.
Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis
2017-02-01
Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.
Enhancing the Immune Response to Recombinant Plague Antigens
2006-05-01
Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant
Senescence in immune priming and attractiveness in a beetle.
Daukšte, J; Kivleniece, I; Krama, T; Rantala, M J; Krams, I
2012-07-01
Age-related decline in immune activity is referred to as immunosenescence and has been observed for both the adaptive immune response of vertebrates and the innate immune system of invertebrates. Because maintaining a basic level of immune defence and mounting an immune response is costly, optimal investment in immune function should vary over a wide range of individual states such as the individual's age. In this study, we tested whether the immune response and immunological priming within individuals become less efficient with age using mealworm beetles, Tenebrio molitor, as a model organism. We also tested whether ageing and immunological priming affected the odours produced by males. We found that young males of T. molitor were capable of mounting an immune response a sterile nylon monofilament implant with the potential to exhibit a simple form of immune memory through mechanisms of immune priming. Older males did not increase their immune response to a second immune challenge, which negatively affected their sexual attractiveness and remaining life span. Our results indicate that the immune system of older males in T. molitor is less effective, suggesting complex evolutionary trade-offs between ageing, immune response and sexual attractiveness. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.
Multiscale modeling of mucosal immune responses
2015-01-01
Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut
Multiscale modeling of mucosal immune responses.
Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep
2015-01-01
Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T
Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai
2010-12-01
The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).
The immune response to Nipah virus infection
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.
2012-01-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317
Cytomegalovirus infection enhances the immune response to influenza.
Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M
2015-04-01
Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.
Cellular immune response experiment MA-031
NASA Technical Reports Server (NTRS)
Criswell, B. S.
1976-01-01
Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.
Suppressive influences in the immune response to cancer.
Bronte, Vincenzo; Mocellin, Simone
2009-01-01
Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.
Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar
2017-12-24
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis
Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar
2017-01-01
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550
Immunizations challenge healthcare personnel and affects immunization rates.
Strohfus, Pamela K; Kim, Susan C; Palma, Sara; Duke, Russell A; Remington, Richard; Roberts, Caleb
2017-02-01
This study measured 1. medical office immunization rates and 2. health care personnel competency in managing vaccine practices before and after evidence-based immunization education was provided. This descriptive study compared 32 family medicine and pediatric offices and 178 medical assistants, licensed practical nurses, registered nurses, nurse practitioners, and physicians in knowledge-based testing pre-education, post-education, and 12-months post-education. Immunization rates were assessed before and 18-months post-education. Immunization rates increased 10.3% - 18months post-education; knowledge increased 7.8% - 12months post-education. Family medicine offices, licensed practical nurses, and medical assistants showed significant knowledge deficits before and 12-months post-education. All demographic groups scored less in storage/handling 12-months post-education. This study is one of the first studies to identify competency challenges in effective immunization delivery among medical assistants, licensed practical nurses, and family medicine offices. Formal and continuous education in immunization administration and storage/handling is recommended among these select groups. Copyright © 2016 Elsevier Inc. All rights reserved.
Rybacka-Mossakowska, J; Ramlau, R; Gazdulska, J; Gołda-Gocka, I; Kozubski, W; Michalak, S
2016-01-01
Cognitive impairment develops as a clinical manifestation of immune-mediated indirect effects of malignancy in lung cancer patients. This study aimed to evaluate the effects of humoral immune response on cognition in lung cancer patients. Fifty-one lung cancer patients were subjected to neurological examination: Mini Mental State Examination (MMSE), Trail Making Test (TMT), and Hamilton scale. The Psychology Experiment Building Language software was used for the evaluation of digit span, simple reaction time (SRT), and choice reaction time (CRT) tests. Serum samples were tested for the presence of onconeuronal antibodies and antineural antibodies. The results demonstrate that autoantibodies were found in 31 % patients. MMSE scores were lower (26.7 ± 2.7) in seropositive patients than in seronegative subjects (28.7 ± 1.2; p = 0.013). Executive functions were also influenced by the presence of autoantibodies. The humoral immune response in lung cancer patients affected both SRT and CRT. We conclude that the humoral immune response in lung cancer patients is associated with cognitive impairment. Cognitive impairment is associated with both specific reactions against onconeuronal or antineural antigens and non-organ specific reactions against nucleosome antigens.
Human Immune Response to Dengue Infections
1989-07-31
antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8
Early-life inflammation, immune response and ageing.
Khan, Imroze; Agashe, Deepa; Rolff, Jens
2017-03-15
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).
Early-life inflammation, immune response and ageing
2017-01-01
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145
Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu
2017-01-01
While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733
Strain difference in the immune response to hydralazine in inbred guinea-pigs
Ellman, L.; Inman, J.; Green, Ira
1971-01-01
Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639
Roberts, Mark L; Buchanan, Katherine L; Evans, Matthew R; Marin, Raul H; Satterlee, Daniel G
2009-10-01
The immunocompetence handicap hypothesis (ICHH) suggests that the male sex hormone testosterone has a dual effect; it controls the development and expression of male sexually selected signals, and it suppresses the immune system. Therefore only high quality males are able to fully express secondary sexual traits because only they can tolerate the immunosuppressive qualities of testosterone. A modified version of the ICHH suggests that testosterone causes immunosuppression indirectly by increasing the stress hormone corticosterone (CORT). Lines of Japanese quail (Coturnix japonica) selected for divergent responses in levels of plasma CORT were used to test these hypotheses. Within each CORT response line (as well as in a control stock) we manipulated levels of testosterone in castrated quail by treatment with zero (sham), low or high testosterone implants, before testing the birds' humoral immunity and phytohaemagglutinin (PHA)-induced immune response, as well as body condition. The PHA-induced response was not significantly affected by CORT selected line, testosterone treatment or their interaction. There was, however, a significant effect of CORT line on humoral immunity in that the control birds exhibited the greatest antibody production, but there was no significant effect of testosterone manipulation on humoral immunity. The males in the sham implant treatment group had significantly greater mass than the males in the high testosterone group, suggesting a negative effect of high testosterone on general body condition. We discuss these results in the context of current hypotheses in the field of sexual selection.
Liu, Lanxia; Ma, Pingchuan; Wang, Hai; Zhang, Chao; Sun, Hongfan; Wang, Chun; Song, Cunxian; Leng, Xigang; Kong, Deling; Ma, Guilei
2016-03-10
In this study, we used cationic lipid-poly(lactide-co-glycolide) acid (PLGA) hybrid nanoparticles as antigen delivery carriers to investigate how antigen-loading methods affect antigen exposure to the immune system and evaluated the resulting antigen-specific immune responses. We formulated three classes of antigen adsorbed and/or encapsulated cationic lipid-PLGA hybrid nanoparticles; we designated antigen-adsorbed (out), antigen-encapsulated (in), and antigen-adsorbed/encapsulated (both) nanoparticles. Our results demonstrate significantly more efficient lysosomal escape and cross-presentation of antigen from dendritic cells (DCs) that were exposed to "both" and "in" nanoparticles. In vivo experiments further revealed that "both" nanoparticles significantly more effectively provided not only adequate initial antigen exposure but also long-term antigen persistence at the injection site. Data from flow cytometry and ELISA analyses demonstrated elevated in vivo immune responses from mice that were immunized with nanoparticles-delivered OVA when compared with free OVA. In addition, "in" and "both" nanoparticles elicited significantly higher antigen-specific immune response than "out" nanoparticles and free OVA. These results suggest that the location of antigen entrapment is an important factor in modulating the immune responses of antigens delivered by nanoparticles. Overall, we propose here a promising approach for the future design of vaccines using cationic lipid-PLGA nanoparticles. Copyright © 2016 Elsevier B.V. All rights reserved.
Transcriptional Profiling of the Immune Response to Marburg Virus Infection.
Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J
2015-10-01
Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells
Hajam, Irshad Ahmed; Lee, John Hwa
2017-06-01
Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.
Sex-specific life history responses to nymphal diet quality and immune status in a field cricket.
Kelly, C D; Neyer, A A; Gress, B E
2014-02-01
Individual fitness is expected to benefit from earlier maturation at a larger body size and higher body condition. However, poor nutritional quality or high prevalence of disease make this difficult because individuals either cannot acquire sufficient resources or must divert resources to other fitness-related traits such as immunity. Under such conditions, individuals are expected to mature later at a smaller body size and in poorer body condition. Moreover, the juvenile environment can also produce longer-term effects on adult fitness by causing shifts in resource allocation strategies that could alter investment in immune function and affect adult lifespan. We manipulated diet quality and immune status of juvenile Texas field crickets, Gryllus texensis, to investigate how poor developmental conditions affect sex-specific investment in fitness-related traits. As predicted, a poor juvenile diet was related to smaller mass and body size at eclosion in both sexes. However, our results also reveal sexually dimorphic responses to different facets of the rearing environment: female life history decisions are affected more by diet quality, whereas males are affected more by immune status. We suggest that females respond to decreased nutritional income because this threatens their ability to achieve a large adult body size, whereas male fitness is more dependent on reaching adulthood and so they invest in immunity and survival to eclosion. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.
Natural Immunity to Ebola Virus in the Syrian Hamster Requires Antibody Responses.
Prescott, Joseph; Falzarano, Darryl; Feldmann, Heinz
2015-10-01
Most ebolaviruses can cause severe disease in humans and other primates, with high case fatality rates during human outbreaks. Although these viruses have been studied for almost 4 decades, little is know regarding the mechanisms by which they cause disease and what is important for protection or treatment after infection. Because of the sporadic nature of the outbreaks and difficulties accessing the populations affected by ebolaviruses, little is also known about what constitutes an appropriate immune response to infection in humans that survive infection. Such knowledge would allow a targeted approach to therapies. In contrast to humans, rodents are protected from disease on infection with ebolaviruses, although adapted versions of some of the viruses are lethal in mice, hamsters and guinea pigs. Using the recently described hamster model, along with T-cell depletion strategies, we show that CD4(+) T cells are required for natural immunity to Ebola virus infection and that CD4-dependent antibody responses are required for immunity in this model. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Innate Immune Responses to Cryptococcus.
Heung, Lena J
2017-09-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.
Leptospirosis in human: Biomarkers in host immune responses.
Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha
2018-03-01
Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.
Preterm Birth Affects the Risk of Developing Immune-Mediated Diseases
Goedicke-Fritz, Sybelle; Härtel, Christoph; Krasteva-Christ, Gabriela; Kopp, Matthias V.; Meyer, Sascha; Zemlin, Michael
2017-01-01
Prematurity affects approximately 10% of all children, resulting in drastically altered antigen exposure due to premature confrontation with microbes, nutritional antigens, and other environmental factors. During the last trimester of pregnancy, the fetal immune system adapts to tolerate maternal and self-antigens, while also preparing for postnatal immune defense by acquiring passive immunity from the mother. Since the perinatal period is regarded as the most important “window of opportunity” for imprinting metabolism and immunity, preterm birth may have long-term consequences for the development of immune-mediated diseases. Intriguingly, preterm neonates appear to develop bronchial asthma more frequently, but atopic dermatitis less frequently in comparison to term neonates. The longitudinal study of preterm neonates could offer important insights into the process of imprinting for immune-mediated diseases. On the one hand, preterm birth may interrupt influences of the intrauterine environment on the fetus that increase or decrease the risk of later immune disease (e.g., maternal antibodies and placenta-derived factors), whereas on the other hand, it may lead to the premature exposure to protective or harmful extrauterine factors such as microbiota and nutritional antigen. Solving this puzzle may help unravel new preventive and therapeutic approaches for immune diseases. PMID:29062316
Novikov, Eugene; Petrovski, Dmitry; Mak, Viktoria; Kondratuk, Ekaterina; Krivopalov, Anton; Moshkin, Mikhail
2016-08-01
Restricted mobility and spatial isolation of social units in gregarious subterranean mammals ensure good defence mechanisms against parasites, which in turn allows for a reduction of immunity components. In contrast, a parasite invasion may cause an increased adaptive immune response. Therefore, it can be expected that spatial and temporal distribution of parasites within a population will correlate with the local variability in the host's immunocompetence. To test this hypothesis, the intra-population variability of a whipworm infestation and the humoral immune response to non-replicated antigens in mole voles (Ellobius talpinus Pall.), social subterranean rodents, was estimated. Whipworm prevalence in mole voles increased from spring to autumn, and this tendency was more pronounced in settlements living in natural meadows compared to settlements in man-made meadows. However, humoral immune response was lowest in animals from natural meadows trapped in autumn. Since whipworm infestation does not directly affect the immunity of mole voles, the reciprocal tendencies in seasonal dynamics and spatial distribution of whipworm abundance and host immunocompetence may be explained by local deterioration of habitat conditions, which increases the probability of an infestation.
A basic mathematical model of the immune response
NASA Astrophysics Data System (ADS)
Mayer, H.; Zaenker, K. S.; an der Heiden, U.
1995-03-01
Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.
Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira
2016-01-01
ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel
Short-term repeated HRV-16 exposure results in an attenuated immune response in vivo in humans
Koch, Rebecca M.; Kox, Matthijs; van den Kieboom, Corné; Ferwerda, Gerben; Gerretsen, Jelle; ten Bruggencate, Sandra; van der Hoeven, Johannes G.; de Jonge, Marien I.; Pickkers, Peter
2018-01-01
Introduction Naturally, development of adaptive immunity following HRV infection affects the immune response. However, it is currently unclear whether or not HRV re-exposure within a short time frame leads to an altered innate immune response. The “experimental cold model” is used to investigate the pathogenesis of HRV infection and allows us to investigate the effects of repeated exposure on both local and systemic innate immunity. Methods 40 healthy male and female (1:1) subjects were nasally inoculated with HRV-16 or placebo. One week later, all subjects received HRV-16. Baseline seronegative subjects (n = 18) were included for further analysis. Results Infection rate was 82%. Primary HRV infection induced a marked increase in viral load and IP-10 levels in nasal wash, while a similar trend was observed for IL-6 and IL-10. Apart from an increase in IP-10 plasma levels, HRV infection did not induce systemic immune effects nor lower respiratory tract inflammation. With similar viral load present during the second HRV challenge, IP-10 and IL-6 in nasal wash showed no increase, but gradually declined, with a similar trend for IL-10. Conclusion Upon a second HRV challenge one week after the first, a less pronounced response for several innate immune parameters is observed. This could be the result of immunological tolerance and possibly increases vulnerability towards secondary infections. PMID:29447199
Short-term repeated HRV-16 exposure results in an attenuated immune response in vivo in humans.
Koch, Rebecca M; Kox, Matthijs; van den Kieboom, Corné; Ferwerda, Gerben; Gerretsen, Jelle; Ten Bruggencate, Sandra; van der Hoeven, Johannes G; de Jonge, Marien I; Pickkers, Peter
2018-01-01
Naturally, development of adaptive immunity following HRV infection affects the immune response. However, it is currently unclear whether or not HRV re-exposure within a short time frame leads to an altered innate immune response. The "experimental cold model" is used to investigate the pathogenesis of HRV infection and allows us to investigate the effects of repeated exposure on both local and systemic innate immunity. 40 healthy male and female (1:1) subjects were nasally inoculated with HRV-16 or placebo. One week later, all subjects received HRV-16. Baseline seronegative subjects (n = 18) were included for further analysis. Infection rate was 82%. Primary HRV infection induced a marked increase in viral load and IP-10 levels in nasal wash, while a similar trend was observed for IL-6 and IL-10. Apart from an increase in IP-10 plasma levels, HRV infection did not induce systemic immune effects nor lower respiratory tract inflammation. With similar viral load present during the second HRV challenge, IP-10 and IL-6 in nasal wash showed no increase, but gradually declined, with a similar trend for IL-10. Upon a second HRV challenge one week after the first, a less pronounced response for several innate immune parameters is observed. This could be the result of immunological tolerance and possibly increases vulnerability towards secondary infections.
Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores
Lampert, Evan
2012-01-01
Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545
Photodynamic therapy for cancer and activation of immune response
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.
2010-02-01
Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.
Evaluation of outbreak response immunization in the control of pertussis using agent-based modeling.
Doroshenko, Alexander; Qian, Weicheng; Osgood, Nathaniel D
2016-01-01
, respectively. During the same time periods, 53, 96, and 163 cases were averted in the 10-14 age group, and 6, 11, 20 in infants under 1 (p < 0.001, all groups). Numbers needed to vaccinate ranged from 49 to 221, from 130 to 519 and from 1,031 to 4,903 for all ages, the 10-14 age group and for infants, respectively. Most sensitivity analyses resulted in minimal impact on a number of cases averted. Our model generated 30 years of longitudinal data to evaluate effects of outbreak response immunization in a controlled study. Immunization campaign implemented as an outbreak response measure among adolescents may confer benefits across all ages accruing over a 10-year period. Our inference is dependent on having an outbreak of significant magnitude affecting predominantly the selected age and achieving a comprehensive vaccine coverage during the campaign. Economic evaluations and comparisons with other control measures can add to conclusions generated by our work.
Proteomic contributions to our understanding of vaccine and immune responses
Galassie, Allison C.; Link, Andrew J.
2015-01-01
Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619
Effects of Fenbendazole on Routine Immune Response Parameters of BALB/c Mice
Cray, Carolyn; Villar, David; Zaias, Julia; Altman, Norman H
2008-01-01
Fenbendazole (FBZ) is an anthelmintic drug widely used to treat and prevent pinworm outbreaks in laboratory rodents. Although data in nonrodent species indicate possible effects of fenbendazole on the bone marrow and lymphocyte proliferation and function, little has been reported regarding possible effects on the rodent immune system. The purpose of the current study was to determine the effects of a therapeutic regimen of FBZ on immune parameters in BALB/c mice. Both 9-wk on–off and 5-wk continuous medicated feed protocols were assessed. No significant differences between normal and FBZ diet treated mice were observed in the following parameters: complete blood count, blood chemistry, quantitation of major T and B cell markers in spleen, quantitation of T cell markers in the thymus, spleen cell proliferation to T and B cell mitogens, bone marrow colony-forming cell assays, skin graft rejection, and primary and secondary humoral immune responses. These data indicate that FBZ treatment does not affect many standard broad measures of immune function. PMID:19049250
Innate Immune Response to Burkholderia mallei
2017-02-16
stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the
Immune Responses in Rhinovirus-Induced Asthma Exacerbations.
Steinke, John W; Borish, Larry
2016-11-01
Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.
Coping strategies and immune neglect in affective forecasting: Direct evidence and key moderators
Hoerger, Michael
2012-01-01
Affective forecasting skills have important implications for decision making. However, recent research suggests that immune neglect – the tendency to overlook coping strategies that reduce future distress – may lead to affective forecasting problems. Prior evidence for immune neglect has been indirect. More direct evidence and a deeper understanding of immune neglect are vital to informing the design of future decision-support interventions. In the current study, young adults (N = 325) supplied predicted, actual, and recollected reactions to an emotionally-evocative interpersonal event, Valentine’s Day. Based on participants’ qualitative descriptions of the holiday, a team of raters reliably coded the effectiveness of their coping strategies. Supporting the immune neglect hypothesis, participants overlooked the powerful role of coping strategies when predicting their emotional reactions. Immune neglect was present not only for those experiencing the holiday negatively (non-daters) but also for those experiencing it positively (daters), suggesting that the bias may be more robust than originally theorized. Immune neglect was greater for immediate emotional reactions than more enduring reactions. Further, immune neglect was conspicuously absent from recollected emotional reactions. Implications for decision-support interventions are discussed. PMID:22375161
Hayama, Yoshitomo; Kimura, Tetsuya; Takeda, Yoshito; Nada, Shigeyuki; Koyama, Shohei; Takamatsu, Hyota; Kang, Sujin; Ito, Daisuke; Maeda, Yohei; Nishide, Masayuki; Nojima, Satoshi; Sarashina-Kida, Hana; Hosokawa, Takashi; Kinehara, Yuhei; Kato, Yasuhiro; Nakatani, Takeshi; Nakanishi, Yoshimitsu; Tsuda, Takeshi; Koba, Taro; Okada, Masato; Kumanogoh, Atsushi
2018-06-01
Amino acid metabolism plays important roles in innate immune cells, including macrophages. Recently, we reported that a lysosomal adaptor protein, Lamtor1, which serves as the scaffold for amino acid-activated mechanistic target of rapamycin complex 1 (mTORC1), is critical for the polarization of M2 macrophages. However, little is known about how Lamtor1 affects the inflammatory responses that are triggered by the stimuli for TLRs. In this article, we show that Lamtor1 controls innate immune responses by regulating the phosphorylation and nuclear translocation of transcription factor EB (TFEB), which has been known as the master regulator for lysosome and autophagosome biogenesis. Furthermore, we show that nuclear translocation of TFEB occurs in alveolar macrophages of myeloid-specific Lamtor1 conditional knockout mice and that these mice are hypersensitive to intratracheal administration of LPS and bleomycin. Our observation clarified that the amino acid-sensing pathway consisting of Lamtor1, mTORC1, and TFEB is involved in the regulation of innate immune responses. Copyright © 2018 by The American Association of Immunologists, Inc.
Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses
van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.
2012-01-01
The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167
Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia
Madigan, Allison A.; Sobek, Kathryn M.; Cummings, Jessica L.; Green, William R.; Bacich, Dean J.; O’Keefe, Denise S.
2012-01-01
Benign Prostatic Hyperplasia (BPH)is the most common urologic disease in men over age 50. Symptoms include acute urinary retention, urgency to urinate and nocturia. For patients with severe symptoms, surgical treatment is used to remove the affected tissue. Interestingly, the presence of histologic BPH does not always correlate with symptoms. The molecular basis of symptomatic BPH and how it differs from asymptomatic BPH is unknown. Investigation into the molecular players involved in symptomatic BPH will likely give insight into novel therapeutic, and potentially preventative, targets. We determined the expression of genes involved in the innate anti-viral immune response in tissues from patients undergoing surgery to alleviate the symptoms of BPH, and compared the results to prostate tissue with histologic BPH, but from patients with few urinary issues (asymptomatic BPH). We found that expression of CFI, APOBEC3G, OAS2, and IFIT1, four genes whose protein products are involved in the innate anti-viral immune response, were significantly transcriptionally upregulated in symptomatic BPH. Additionally we observe hypomethylation and concomitant expression of ancient retroviral-like sequences, the LINE-1 retrotransposons, in symptomatic BPH when compared to normal prostate tissue. These findings merit further investigation into the anti-viral immune response in symptomatic BPH. PMID:22952051
Nitric oxide and redox mechanisms in the immune response
Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.
2011-01-01
The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414
Di Prisco, Gennaro; Cavaliere, Valeria; Annoscia, Desiderato; Varricchio, Paola; Caprio, Emilio; Nazzi, Francesco; Gargiulo, Giuseppe; Pennacchio, Francesco
2013-01-01
Large-scale losses of honey bee colonies represent a poorly understood problem of global importance. Both biotic and abiotic factors are involved in this phenomenon that is often associated with high loads of parasites and pathogens. A stronger impact of pathogens in honey bees exposed to neonicotinoid insecticides has been reported, but the causal link between insecticide exposure and the possible immune alteration of honey bees remains elusive. Here, we demonstrate that the neonicotinoid insecticide clothianidin negatively modulates NF-κB immune signaling in insects and adversely affects honey bee antiviral defenses controlled by this transcription factor. We have identified in insects a negative modulator of NF-κB activation, which is a leucine-rich repeat protein. Exposure to clothianidin, by enhancing the transcription of the gene encoding this inhibitor, reduces immune defenses and promotes the replication of the deformed wing virus in honey bees bearing covert infections. This honey bee immunosuppression is similarly induced by a different neonicotinoid, imidacloprid, but not by the organophosphate chlorpyriphos, which does not affect NF-κB signaling. The occurrence at sublethal doses of this insecticide-induced viral proliferation suggests that the studied neonicotinoids might have a negative effect at the field level. Our experiments uncover a further level of regulation of the immune response in insects and set the stage for studies on neural modulation of immunity in animals. Furthermore, this study has implications for the conservation of bees, as it will contribute to the definition of more appropriate guidelines for testing chronic or sublethal effects of pesticides used in agriculture. PMID:24145453
Innate Immune Responses to Cryptococcus
Heung, Lena J.
2017-01-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464
Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata
2018-01-01
Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream
Chronic bystander infections and immunity to unrelated antigens
Stelekati, Erietta; Wherry, E. John
2012-01-01
Chronic infections with persistent pathogens such as helminths, mycobacteria, Plasmodium and hepatitis viruses affect more than a third of the human population and are associated with increased susceptibility to other pathogens as well as reduced vaccine efficacy. Although these observations suggest an impact of chronic infections in modulating immunity to unrelated antigens, little is known regarding the underlying mechanisms. Here, we summarize evidence of the most prevalent infections affecting immunity to unrelated pathogens and vaccines, and discuss potential mechanisms of how different bystander chronic infections might impact immune responses. We suggest that bystander chronic infections affect different stages of host responses and may impact transmission of other pathogens, recognition and innate immune responses, priming and differentiation of adaptive effector responses, as well as the development and maintenance of immunological memory. Further understanding of the immunological effects of co-infection should provide opportunities to enhance vaccine efficacy and control infectious diseases. PMID:23084915
Negri, Pedro; Ramirez, Leonor; Quintana, Silvina; Szawarski, Nicolás; Maggi, Matías; Le Conte, Yves; Lamattina, Lorenzo; Eguaras, Martin
2017-08-15
Many biotic and abiotic stressors impact bees' health, acting as immunosupressors and contribute to colony losses. Thus, the importance of studying the immune response of honey bees is central to develop new strategies aiming to enhance bees' fitness to confront the threats affecting them. If a pathogen breaches the physical and chemical barriers, honey bees can protect themselves from infection with cellular and humoral immune responses which represent a second line of defense. Through a series of correlative studies we have previously reported that abscisic acid (ABA) and nitric oxide (NO) share roles in the same immune defenses of Apis mellifera ( A. mellifera ). Here we show results supporting that the supplementation of bee larvae's diet reared in vitro with l-Arginine (precursor of NO) or ABA enhanced the immune activation of the granulocytes in response to wounding and lipopolysaccharide (LPS) injection.
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete
2009-07-30
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.
Immune Response to Dengue and Zika.
Ngono, Annie Elong; Shresta, Sujan
2018-04-26
Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.
An epidemiological study of immune-mediated skin diseases affecting the oral cavity.
Carvalho, Cyntia Helena Pereira de; Santos, Bruna Rafaela Martins dos; Vieira, Camila de Castro; Lima, Emeline das Neves de Araújo; Santos, Pedro Paulo de Andrade; Freitas, Roseana de Almeida
2011-01-01
Immune-mediated skin diseases encompass a variety of pathologies that present in different forms in the body. The objective of this study was to establish the prevalence of the principal immune-mediated skin diseases affecting the oral cavity. A total of 10,292 histopathology reports stored in the archives of the Anatomical Pathology Laboratory, Department of Oral Pathology, Federal University of Rio Grande do Norte, covering the period from 1988 to 2009, were evaluated. For the cases diagnosed with some type of disease relevant to the study, clinical data such as the gender, age and ethnicity of the patient, the anatomical site of the disease and its symptomatology were collected. Of all the cases registered at the above-mentioned service, 82 (0.8%) corresponded to immune-mediated skin diseases with symptoms affecting the oral cavity. The diseases found in this study were: oral lichen planus, pemphigus vulgaris and benign mucous membrane pemphigoid. Oral lichen planus was the most common lesion, comprising 68.05% of the cases analyzed. Of these cases, 64.3% were women and the cheek mucosa was the anatomical site most commonly affected (46.8%). Immune-mediated skin diseases affecting the oral cavity continue to be rare, the prevalence found in this study being similar to that reported for the majority of regions worldwide. Nevertheless, early diagnosis is indispensable in the treatment of these diseases, bearing in mind that systemic involvement is possible in these patients.
Eosinophils in mucosal immune responses
Travers, J; Rothenberg, M E
2015-01-01
Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184
Spaceflight and Development of Immune Responses
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1996-01-01
Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.
Effect of gender and sex hormones on immune responses following shock.
Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H
2000-08-01
Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.
Pathogen recognition in the innate immune response.
Kumar, Himanshu; Kawai, Taro; Akira, Shizuo
2009-04-28
Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.
Inflammatory cytokines in the brain: does the CNS shape immune responses?
Owens, T; Renno, T; Taupin, V; Krakowski, M
1994-12-01
Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.
Drosophila blood cells and their role in immune responses.
Vlisidou, Isabella; Wood, Will
2015-04-01
Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.
SIRT1 and HIF1α signaling in metabolism and immune responses.
Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei
2018-04-01
SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Barrett, John Christopher
Inducing a strong and specific immune response is the hallmark of a successful vaccine. Nanoparticles have emerged as promising vaccine delivery devices to discover and elicit immune responses. Modular platforms are attractive for their engineerability and broad potential applications. Fine-tuning a nanoparticle vaccine to create an immune response with specific antibody and other cellular responses is influenced by many factors such as shape, size and composition. Peptide amphiphile micelles are a unique biomaterials platform that can function as a modular vaccine delivery system, enabling control over many of these important factors. Peptide amphiphiles (PAs) consist of a hydrophilic peptide antigen conjugated to a hydrophobic lipid tail. The PAs then self-assemble into micelles, with the micelle characteristics determined by the chemical composition of the PA and micelle preparation methods. PA micelles contain a large design space, so it is important to have a basic understanding of how each design feature can affect the platform's interaction with the immune system. In this dissertation, the structure, composition, and biodistribution properties of PA micelles are evaluated for their ability to impact an immune response against a Group A Streptococcus B cell antigen (J8). Through structural design and physical characterization, micelles are shown to self-assemble into either short rod-like or long cylindrical shapes. Analyzing these shape effects on the immune response showed that cylindrical micelles induced higher antibody titers than rod-like micelles, providing evidence that the cylindrical micelle shape is important to induce immune responses and a possible mechanism of action. Shape was also seen to impact the activation profile of dendritic cells, B cells and T cells. Assembly into cylindrical micelles also stabilizes the secondary structure of peptide antigens, which may impact the immune response raised. In composition, the hydrophobic
Influence of bedding type on mucosal immune responses.
Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E
2002-10-01
The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.
CELLS INVOLVED IN THE IMMUNE RESPONSE
Singhal, Sharwan K.; Richter, Maxwell
1968-01-01
Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID
The responses of immune cells to iron oxide nanoparticles.
Xu, Yaolin; Sherwood, Jennifer A; Lackey, Kimberly H; Qin, Ying; Bao, Yuping
2016-04-01
Immune cells play an important role in recognizing and removing foreign objects, such as nanoparticles. Among various parameters, surface coatings of nanoparticles are the first contact with biological system, which critically affect nanoparticle interactions. Here, surface coating effects on nanoparticle cellular uptake, toxicity and ability to trigger immune response were evaluated on a human monocyte cell line using iron oxide nanoparticles. The cells were treated with nanoparticles of three types of coatings (negatively charged polyacrylic acid, positively charged polyethylenimine and neutral polyethylene glycol). The cells were treated at various nanoparticle concentrations (5, 10, 20, 30, 50 μg ml(-1) or 2, 4, 8, 12, 20 μg cm(-2)) with 6 h incubation or treated at a nanoparticle concentration of 50 μg ml(-1) (20 μg cm(-2)) at different incubation times (6, 12, 24, 48 or 72 h). Cell viability over 80% was observed for all nanoparticle treatment experiments, regardless of surface coatings, nanoparticle concentrations and incubation times. The much lower cell viability for cells treated with free ligands (e.g. ~10% for polyethylenimine) suggested that the surface coatings were tightly attached to the nanoparticle surfaces. The immune responses of cells to nanoparticles were evaluated by quantifying the expression of toll-like receptor 2 and tumor necrosis factor-α. The expression of tumor necrosis factor-α and toll-like receptor 2 were not significant in any case of the surface coatings, nanoparticle concentrations and incubation times. These results provide useful information to select nanoparticle surface coatings for biological and biomedical applications. Copyright © 2016 John Wiley & Sons, Ltd.
EVOLUTION OF THE IMMUNE RESPONSE
Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.
1964-01-01
1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that
Age and genetic selection affect auto-immune profiles of chickens.
Parmentier, Henk K; Harms, Elmer; Lammers, Aart; Nieuwland, Mike G B
2014-12-01
Specificity, antibody isotype distribution and levels, of natural autoantibodies (NAAb) may be potential informative parameters for immune mediated natural disease resistance, immune modulation, and maintenance of physiological homeostasis. In a previous study we detected IgM and IgG antibodies to liver antigens in plasma from 1 year old chickens. Auto-immune profiles directed towards liver antigens differed between chicken lines divergently selected for specific antibody responses to sheep red blood cells. In the present study we measured the presence and typed levels and antibody isotypes (IgG and IgM) of NAAb binding the 'auto-antigen' complex chicken liver cell lysate (CLL) in plasma samples obtained from chickens at 5 weeks and at 1-year of age, respectively, by quantitative western blotting. Extensive staining patterns of plasma antibodies binding CLL were found for both isotypes and at both ages in all birds. At both ages, IgM and IgG bound similar numbers of CLL antigens, which remained almost constant for IgM, whereas the number of IgG stained bands in time was enhanced. Significant differences of binding patterns of NAAb (stained antigen fragments of CLL and staining intensity) were detected between the three different chicken lines at both ages and between both ages, and lines could be clustered on the basis of their auto-antibody profile. The present results indicate that analysis of the plasma NAAb repertoire of poultry like in mammals could provide a way of distinguishing differences of immune competence (as reflected by the selection criterion of antibody responses) between individuals and lines, and could provide tools to select individual birds for health and other traits. The age-dependency of the auto-immune profile suggest that such profiles may also reflect immune maturation, which should be taken into account when relating an auto-immune profile with other traits. Copyright © 2014 Elsevier Ltd. All rights reserved.
Infection before pregnancy affects immunity and response to social challenge in the next generation.
Curno, Olivia; Reader, Tom; McElligott, Alan G; Behnke, Jerzy M; Barnard, Chris J
2011-12-12
Natural selection should favour parents that are able to adjust their offspring's life-history strategy and resource allocation in response to changing environmental and social conditions. Pathogens impose particularly strong and variable selective pressure on host life histories, and parental genes will benefit if offspring are appropriately primed to meet the immunological challenges ahead. Here, we investigated transgenerational immune priming by examining reproductive resource allocation by female mice in response to direct infection with Babesia microti prior to pregnancy. Female mice previously infected with B. microti gained more weight over pregnancy, and spent more time nursing their offspring. These offspring generated an accelerated response to B. microti as adults, clearing the infection sooner and losing less weight as a result of infection. They also showed an altered hormonal response to novel social environments, decreasing instead of increasing testosterone production upon social housing. These results suggest that a dominance-resistance trade-off can be mediated by cues from the previous generation. We suggest that strategic maternal investment in response to an infection leads to increased disease resistance in the following generation. Offspring from previously infected mothers downregulate investment in acquisition of social dominance, which in natural systems would reduce access to mating opportunities. In doing so, however, they avoid the reduced disease resistance associated with increased testosterone and dominance. The benefits of accelerated clearance of infection and reduced weight loss during infection may outweigh costs associated with reduced social dominance in an environment where the risk of disease is high.
Chu, Wan-Loy; Quynh, Le Van; Radhakrishnan, Ammu Kutty
2013-09-01
The aim of this study was to investigate whether Spirulina (Arthrospira) supplementation could enhance the immune response to tetanus toxoid (TT) vaccine in a mouse model. Vaccination of TT was performed on day 7 and 21 in mice fed daily with Spirulina (50 and 150 mg/kg body weight). Both Spirulina supplementation and TT vaccination did not significantly affect body weight gain of the mice. Supplementation of Spirulina significantly enhanced IgG level (p = .01) after the first but not after the second TT vaccination. The anti-TT IgG levels of the groups that received low dose and high dose of Spirulina were not significantly different. Spirulina supplementation did not show significant effects on in vitro splenocyte proliferation and cytokine (IFN-γ and IL-4) production induced by Con A and TT. This study showed that Spirulina supplementation could enhance primary immune response in terms of antibody production, but not secondary immune response following TT vaccination in a mouse model.
Norris, Michael H.; Schweizer, Herbert P.
2017-01-01
Burkholderia pseudomallei (Bp) causes the disease melioidosis. The main cause of mortality in this disease is septic shock triggered by the host responding to lipopolysaccharide (LPS) components of the Gram-negative outer membrane. Bp LPS is thought to be a weak inducer of the host immune system. LPS from several strains of Bp were purified and their ability to induce the inflammatory mediators TNF-α and iNOS in murine macrophages at low concentrations was investigated. Innate and adaptive immunity qPCR arrays were used to profile expression patterns of 84 gene targets in response to the different LPS types. Additional qPCR validation confirmed large differences in macrophage response. LPS from a high-virulence serotype B strain 576a and a virulent rough central nervous system tropic strain MSHR435 greatly induced the innate immune response indicating that the immunopathogenesis of these strains is different than in infections with strains similar to the prototype strain 1026b. The accumulation of autophagic vesicles was also increased in macrophages challenged with highly immunogenic Bp LPS. Gene induction and concomitant cytokine secretion profiles of human PBMCs in response to the various LPS were also investigated. MALDI-TOF/TOF was used to probe the lipid A portions of the LPS, indicating substantial structural differences that likely play a role in host response to LPS. These findings add to the evolving knowledge of host-response to bacterial LPS, which can be used to better understand septic shock in melioidosis patients and in the rational design of vaccines. PMID:28453531
The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.
Griffin, Diane E
2016-10-12
Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.
Metcalf, Talibah U; Cubas, Rafael A; Ghneim, Khader; Cartwright, Michael J; Grevenynghe, Julien Van; Richner, Justin M; Olagnier, David P; Wilkinson, Peter A; Cameron, Mark J; Park, Byung S; Hiscott, John B; Diamond, Michael S; Wertheimer, Anne M; Nikolich-Zugich, Janko; Haddad, Elias K
2015-01-01
Aging leads to dysregulation of multiple components of the immune system that results in increased susceptibility to infections and poor response to vaccines in the aging population. The dysfunctions of adaptive B and T cells are well documented, but the effect of aging on innate immunity remains incompletely understood. Using a heterogeneous population of peripheral blood mononuclear cells (PBMCs), we first undertook transcriptional profiling and found that PBMCs isolated from old individuals (≥ 65 years) exhibited a delayed and altered response to stimulation with TLR4, TLR7/8, and RIG-I agonists compared to cells obtained from adults (≤ 40 years). This delayed response to innate immune agonists resulted in the reduced production of pro-inflammatory and antiviral cytokines and chemokines including TNFα, IL-6, IL-1β, IFNα, IFNγ, CCL2, and CCL7. While the major monocyte and dendritic cell subsets did not change numerically with aging, activation of specific cell types was altered. PBMCs from old subjects also had a lower frequency of CD40+ monocytes, impaired up-regulation of PD-L1 on monocytes and T cells, and increased expression of PD-L2 and B7-H4 on B cells. The defective immune response to innate agonists adversely affected adaptive immunity as TLR-stimulated PBMCs (minus CD3 T cells) from old subjects elicited significantly lower levels of adult T-cell proliferation than those from adult subjects in an allogeneic mixed lymphocyte reaction (MLR). Collectively, these age-associated changes in cytokine, chemokine and interferon production, as well as co-stimulatory protein expression could contribute to the blunted memory B- and T-cell immune responses to vaccines and infections. PMID:25728020
The host immune response to Clostridium difficile infection
2013-01-01
Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542
Ramirez, Leonor; Quintana, Silvina; Szawarski, Nicolás; Maggi, Matías; Le Conte, Yves; Lamattina, Lorenzo; Eguaras, Martin
2017-01-01
Many biotic and abiotic stressors impact bees’ health, acting as immunosupressors and contribute to colony losses. Thus, the importance of studying the immune response of honey bees is central to develop new strategies aiming to enhance bees’ fitness to confront the threats affecting them. If a pathogen breaches the physical and chemical barriers, honey bees can protect themselves from infection with cellular and humoral immune responses which represent a second line of defense. Through a series of correlative studies we have previously reported that abscisic acid (ABA) and nitric oxide (NO) share roles in the same immune defenses of Apis mellifera (A. mellifera). Here we show results supporting that the supplementation of bee larvae’s diet reared in vitro with l-Arginine (precursor of NO) or ABA enhanced the immune activation of the granulocytes in response to wounding and lipopolysaccharide (LPS) injection. PMID:28809782
Cytokines in Drosophila immunity.
Vanha-Aho, Leena-Maija; Valanne, Susanna; Rämet, Mika
2016-02-01
Cytokines are a large and diverse group of small proteins that can affect many biological processes, but most commonly cytokines are known as mediators of the immune response. In the event of an infection, cytokines are produced in response to an immune stimulus, and they function as key regulators of the immune response. Cytokines come in many shapes and sizes, and although they vary greatly in structure, their functions have been well conserved in evolution. The immune signaling pathways that respond to cytokines are remarkably conserved from fly to man. Therefore, Drosophila melanogaster, provides an excellent platform for studying the biology and function of cytokines. In this review, we will describe the cytokines and cytokine-like molecules found in the fly and discuss their roles in host immunity. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
Intravital imaging of cutaneous immune responses.
Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji
2018-05-25
Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.
Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.
Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier
2009-03-23
Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.
The trenbolone acetate affects the immune system in rainbow trout, Oncorhynchus mykiss.
Massart, Sophie; Redivo, Baptiste; Flamion, Enora; Mandiki, S N M; Falisse, Elodie; Milla, Sylvain; Kestemont, Patrick
2015-06-01
In aquatic systems, the presence of endocrine-disrupting chemicals (EDC) can disrupt the reproductive function but also the immune system of wildlife. Some studies have investigated the effects of androgens on the fish immune parameters but the mechanisms by which the xenoandrogens alter the immunity are not well characterized. In order to test the effects of trenbolone acetate (TbA) on fish immune system, we exposed rainbow trout male juveniles during three weeks to TbA levels at 0.1 and 1μg/L. The present results suggest that TbA impacts, in a tissue-dependent manner, the rainbow trout immunity by affecting primarily the humoral immunity. Indeed, TbA inhibited lysozyme activity in plasma and liver and enhanced the alternative complement pathway activity (ACH50) in kidney. In plasma, the modulation of the complement system was time-dependent. The mRNA expression of genes encoding some cytokines such as renal TGF-β1, TNF-α in skin and hepatic IL-1β was also altered in fish exposed to TbA. Regarding the cellular immunity, no effect was observed on the leucocyte population. However, the expression of genes involved in the development and maturation of lymphoid cells (RAG-1 and RAG-2) was decreased in TbA-treated fish. Among those effects, we suggest that the modulation of RAG-1 and mucus apolipoprotein-A1 gene expression as well as plasma and hepatic lysozyme activities are mediated through the action of the androgen receptor. All combined, we conclude that trenbolone affects the rainbow trout immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
Interplay of parasite-driven immune responses and autoimmunity.
Zaccone, Paola; Burton, Oliver T; Cooke, Anne
2008-01-01
As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.
Immune response to 60-day head-down bed rest
NASA Astrophysics Data System (ADS)
Song, Jinping; Guo, Aihua; Zhong, Ping; Zhang, Hongyu; Wu, Feng; Wan, Yumin; Bai, Yanqiang; Chen, Shanguang; Li, Yinghui
Introduction: Exposure of humans to spaceflight has resulted in disregulation of the immune system. Head-down bed rest (HDBR) has been extensively used as an earth-bound analog to study physiologic effects mimicking those occurring in weightlessness during spaceflight. It is uncertain how a prolonged period of bed rest affect human immune responses. The objective of this study was to investigate the effects of 60-day HDBR on immune function and EB virus reactivation in seven male volunteers. Methods: There were seven healthy male volunteers who were subjected to HDBR for 60d. Immunological parameters including leukocyte subset distribution, lymphocyte proliferation to mitogens, secreted cytokine profiles and EB virus reactivation were monitored. Results: Total WBC conunts increased significantly 10d post-HDBR as compared with pre-HDBR. At the same time, the relative percentage of neutrophils was also higher than pre-HDBR but not significant. MFI of CD11b in neutrophils was reduced obviously at thd end of HDBR. T Lymphocyte proliferations to PHA reduced at HDBR 30, HDBR 60 and 10d post-HDBR while IL-2 production decreased significantly at the same time. IFN-and IL-4 production trended to decrease at HDBR 30 and HDBR 60. The relative percentage of T lymphocyte subset, B lymphocyte and NK cells were not altered. EBV EA (early antigen) were negative and EBV VCA titers had no changes through HDBR. Conclusion: The results indicate that several immunological parameters (mainly cellular immunity) are altered significantly by prolonged HDBR, and these changes were similar to those happened in spaceflight.
Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis
2007-03-07
The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.
Anti-tumor immune response after photodynamic therapy
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.
2009-06-01
Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp
Effects of dietary Capsicum oleoresin on productivity and immune responses in lactating dairy cows.
Oh, J; Giallongo, F; Frederick, T; Pate, J; Walusimbi, S; Elias, R J; Wall, E H; Bravo, D; Hristov, A N
2015-09-01
This study investigated the effect of Capsicum oleoresin in granular form (CAP) on nutrient digestibility, immune responses, oxidative stress markers, blood chemistry, rumen fermentation, rumen bacterial populations, and productivity of lactating dairy cows. Eight multiparous Holstein cows, including 3 ruminally cannulated, were used in a replicated 4×4 Latin square design experiment. Experimental periods were 25 d in duration, including a 14-d adaptation and an 11-d data collection and sampling period. Treatments included control (no CAP) and daily supplementation of 250, 500, or 1,000 mg of CAP/cow. Dry matter intake was not affected by CAP (average 27.0±0.64 kg/d), but milk yield tended to quadratically increase with CAP supplementation (50.3 to 51.9±0.86 kg/d). Capsicum oleoresin quadratically increased energy-corrected milk yield, but had no effect on milk fat concentration. Rumen fermentation variables, apparent total-tract digestibility of nutrients, and N excretion in feces and urine were not affected by CAP. Blood serum β-hydroxybutyrate was quadratically increased by CAP, whereas the concentration of nonesterified fatty acids was similar among treatments. Rumen populations of Bacteroidales, Prevotella, and Roseburia decreased and Butyrivibrio increased quadratically with CAP supplementation. T cell phenotypes were not affected by treatment. Mean fluorescence intensity for phagocytic activity of neutrophils tended to be quadratically increased by CAP. Numbers of neutrophils and eosinophils and the ratio of neutrophils to lymphocytes in peripheral blood linearly increased with increasing CAP. Oxidative stress markers were not affected by CAP. Overall, in the conditions of this experiment, CAP did not affect feed intake, rumen fermentation, nutrient digestibility, T cell phenotypes, and oxidative stress markers. However, energy-corrected milk yield was quadratically increased by CAP, possibly as a result of enhanced mobilization of body fat reserves. In
Mulder, Sasja F; Jacobs, Joannes F M; Olde Nordkamp, Michel A M; Galama, Joep M D; Desar, Ingrid M E; Torensma, Ruurd; Teerenstra, Steven; Mulders, Peter F A; Vissers, Kris C P; Punt, Cornelis J A; de Vries, I Jolanda M; van Herpen, Carla M L
2011-07-01
The tyrosine kinase inhibitors sorafenib and sunitinib have efficacy in several types of cancer. Recent studies indicate that these agents affect the immune system. The way it affects the immune response to influenza vaccination is unknown. The aim of this study was to elucidate the specific immune response to seasonal flu vaccination in cancer patients treated with sunitinib or sorafenib. Sunitinib- or sorafenib-treated cancer patients were vaccinated against seasonal influenza with an inactivated vaccine. Healthy controls and patients with metastatic renal cell cancer (mRCC) without systemic treatment (nontreated mRCC controls) were included for comparison. Antibody responses were measured at baseline, day 8, and day 22 by a standard hemagglutination inhibition assay and cellular T-cell responses at baseline and day 8 by proliferation assay and secretion of cytokines. Forty subjects were enrolled: 16 patients treated with sunitinib, 6 patients with sorafenib, 7 nontreated mRCC controls, and 11 healthy controls. All patients treated with sunitinib and sorafenib developed seroprotection rates comparable with controls. Functional T-cell reactivity was observed in all groups, except for patients treated with sorafenib who showed a decreased proliferation rate and IFN-γ/IL-2 production and increased IL-10 compared with healthy controls. We conclude that influenza vaccination should be recommended to cancer patients treated with sunitinib or sorafenib.
Radiation-induced immune responses: mechanisms and therapeutic perspectives.
Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One
2016-09-01
Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.
The role of dehydroepiandrosterone on functional innate immune responses to acute stress.
Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P
2017-12-01
The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.
RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes
Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.
2011-01-01
Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response
Zhong, Hong; Ma, Minjuan
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304
Role of muscarinic receptors in the regulation of immune and inflammatory responses
Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.
2008-01-01
Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972
A comparative study of an innate immune response in Lamprologine cichlid fishes.
O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
A comparative study of an innate immune response in Lamprologine cichlid fishes
NASA Astrophysics Data System (ADS)
O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
Immune response to measles vaccine in Peruvian children.
Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.
2001-01-01
OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811
Lingohr, Philipp; Dohmen, Jonas; Matthaei, Hanno; Schwandt, Timo; Stein, Kathy; Hong, Gun-Soo; Steitz, Julia; Longerich, Thomas; Bölke, Edwin; Wehner, Sven; Kalff, Jörg C
2017-06-01
Laparoscopic surgery (LS) has proved superior compared to conventional surgery (CS) regarding morbidity, length of hospital stay, rate of wound infection and time until recovery. An improved preservation of the postoperative immune function is assumed to contribute to these benefits though the role of the local peritoneal immune response is still poorly understood. Our study investigates the peritoneal immune response subsequent to abdominal surgery and compares it between laparoscopic and conventional surgery to find an immunological explanation for the clinically proven benefits of LS. Wistar rats (N = 140) underwent laparoscopic cecum resection (LCR; N = 28), conventional cecum resection (CCR; N = 28), laparoscopic sham operation (LSO; N = 28), conventional sham operation (CSO; N = 28), or no surgical treatment (CTRL; N = 28). Postoperatively, peritoneal lavages were performed, leukocytes isolated and analyzed regarding immune function and phagocytosis activity. Immune function was inhibited postoperatively in animals undergoing LCR or CCR compared to CTRL reflected by a lower TNF-α (CTRL 3956.65 pg/ml, LCR 2018.48 pg/ml (p = 0.023), CCR 2793.78 pg/ml (n.s.)) and IL-6 secretion (CTRL 625.84 pg/ml, LCR 142.84 pg/ml (p = 0.009), CCR 169.53 pg/ml (p = 0.01)). Phagocytosis was not affected in rats undergoing any kind of surgery compared to CTRL. Neither cytokine secretion nor phagocytosis activity differed significantly between laparoscopic and conventional surgery. According to our findings the benefits associated with LS compared to CS cannot be explained by differences in the postoperative peritoneal innate immune response. Further studies are needed to elucidate the causes for a more favorable postoperative outcome in patients after LS compared to CS.
The host immune response to gastrointestinal nematode infection in sheep.
McRae, K M; Stear, M J; Good, B; Keane, O M
2015-12-01
Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.
[Bone marrow stromal damage mediated by immune response activity].
Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H
1994-01-01
The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.
The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)
King, Paul T.; Sharma, Roleen
2015-01-01
Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124
Bretscher, P A
2014-01-01
It is well recognized that the physiological/pathological consequences of an immune response, against a foreign or a self-antigen, are often critically dependent on the class of immunity generated. Here we focus on how antigen interacts with the cells of the immune system to determine whether antigen predominantly generates Th1 or Th2 cells. We refer to this mechanism as the ‘decision criterion’ controlling the Th1/Th2 phenotype of the immune response. A plausible decision criterion should account for the variables of immunization known to affect the Th1/Th2 phenotype of the ensuing immune response. Documented variables include the nature of the antigen, in terms of its degree of foreignness, the dose of antigen and the time after immunization at which the Th1/Th2 phenotype of the immune response is assessed. These are quantitative variables made at the level of the system. In addition, the route of immunization is also critical. I describe a quantitative hypothesis as to the nature of the decision criterion, referred to as the Threshold Hypothesis. This hypothesis accounts for the quantitative variables of immunization known to affect the Th1/Th2 phenotype of the immune response generated. I suggest and illustrate how this is not true of competing, contemporary hypotheses. I outline studies testing predictions of the hypothesis and illustrate its potential utility in designing strategies to prevent or treat medical situations where a predominant Th1 response is required to contain an infection, such as those caused by HIV-1 and by Mycobacterium tuberculosis, or to contain cancers. PMID:24684592
Radiation induces an antitumour immune response to mouse melanoma.
Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling
2009-12-01
Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.
Teixeira, Luzia; Moreira, João; Melo, Joana; Bezerra, Filipa; Marques, Raquel M; Ferreirinha, Pedro; Correia, Alexandra; Monteiro, Mariana P; Ferreira, Paula G; Vilanova, Manuel
2015-01-01
The adipose tissue can make important contributions to immune function. Nevertheless, only a limited number of reports have investigated in lean hosts the immune response elicited in this tissue upon infection. Previous studies suggested that the intracellular protozoan Neospora caninum might affect adipose tissue physiology. Therefore, we investigated in mice challenged with this protozoan if immune cell populations within adipose tissue of different anatomical locations could be differently affected. Early in infection, parasites were detected in the adipose tissue and by 7 days of infection increased numbers of macrophages, regulatory T (Treg) cells and T-bet+ cells were observed in gonadal, mesenteric, omental and subcutaneous adipose tissue. Increased expression of interferon-γ was also detected in gonadal adipose tissue of infected mice. Two months after infection, parasite DNA was no longer detected in these tissues, but T helper type 1 (Th1) cell numbers remained above control levels in the infected mice. Moreover, the Th1/Treg cell ratio was higher than that of controls in the mesenteric and subcutaneous adipose tissue. Interestingly, chronically infected mice presented a marked increase of serum leptin, a molecule that plays a role in energy balance regulation as well as in promoting Th1-type immune responses. Altogether, we show that an apicomplexa parasitic infection influences immune cellular composition of adipose tissue throughout the body as well as adipokine production, still noticed at a chronic phase of infection when parasites were already cleared from that particular tissue. This strengthens the emerging view that infections can have long-term consequences for the physiology of adipose tissue. PMID:25581844
Carbo, Adria; Bassaganya-Riera, Josep; Pedragosa, Mireia; Viladomiu, Monica; Marathe, Madhav; Eubank, Stephen; Wendelsdorf, Katherine; Bisset, Keith; Hoops, Stefan; Deng, Xinwei; Alam, Maksudul; Kronsteiner, Barbara; Mei, Yongguo; Hontecillas, Raquel
2013-01-01
T helper (Th) cells play a major role in the immune response and pathology at the gastric mucosa during Helicobacter pylori infection. There is a limited mechanistic understanding regarding the contributions of CD4+ T cell subsets to gastritis development during H. pylori colonization. We used two computational approaches: ordinary differential equation (ODE)-based and agent-based modeling (ABM) to study the mechanisms underlying cellular immune responses to H. pylori and how CD4+ T cell subsets influenced initiation, progression and outcome of disease. To calibrate the model, in vivo experimentation was performed by infecting C57BL/6 mice intragastrically with H. pylori and assaying immune cell subsets in the stomach and gastric lymph nodes (GLN) on days 0, 7, 14, 30 and 60 post-infection. Our computational model reproduced the dynamics of effector and regulatory pathways in the gastric lamina propria (LP) in silico. Simulation results show the induction of a Th17 response and a dominant Th1 response, together with a regulatory response characterized by high levels of mucosal Treg) cells. We also investigated the potential role of peroxisome proliferator-activated receptor γ (PPARγ) activation on the modulation of host responses to H. pylori by using loss-of-function approaches. Specifically, in silico results showed a predominance of Th1 and Th17 cells in the stomach of the cell-specific PPARγ knockout system when compared to the wild-type simulation. Spatio-temporal, object-oriented ABM approaches suggested similar dynamics in induction of host responses showing analogous T cell distributions to ODE modeling and facilitated tracking lesion formation. In addition, sensitivity analysis predicted a crucial contribution of Th1 and Th17 effector responses as mediators of histopathological changes in the gastric mucosa during chronic stages of infection, which were experimentally validated in mice. These integrated immunoinformatics approaches characterized the
Wang, Huan; Wang, Qingguo; Yang, Meijuan; Yang, Lili; Wang, Weili; Ding, Haobin; Zhang, Dong; Xu, Jing; Tang, Xuezhang; Ding, Haitao; Wang, Qingfu
2018-02-01
Osteoarthritis (OA) is a common chronic degenerative disease that affects all joints. At present, the pathological processes and mechanisms of OA are still unclear. Innate immunity, a key player in damage to the structure of the joint and the mechanism by which the host attempts to repair OA, affects all pathological stages of the disease. In the present study, our aim was to assess changes in innate immunity during the pathological processes of OA in articular cartilage (AC) and the synovial membrane (SM), which are the major structures in joints, and to systematically examine the histological changes in AC and SM in mild, moderate and severe cases of OA, in order to further speculate about the manner in which the interactions of AC and SM are facilitated by innate immunity. Histological methods (including HE and Safranin O-fast green staining), immunofluorescent double staining, TUNEL stain, and Western blots were used to assess the morphological changes within AC and SM tissues in healthy and mild, moderate, or severe OA rats. Our results showed that the damage to AC and SM within the joints progressively worsened in different degrees during the course of the disease, and that the innate immune system was closely involved in the AC and SM during each stage of OA. These findings also confirmed that SM may affect the pathological changes in AC through the innate immune system, and therefore affect the progress of OA. © 2017 Wiley Periodicals, Inc.
Austrup, F; Kucharzik, T; Kölsch, E
1991-01-01
The humoral immune response to the so-called thymus independent antigen dextran B 1355 S in conventionally raised BALB/c mice consists solely of IgM antibodies. Expression of IgG anti-Dex antibodies in these mice is prevented by pre- or perinatally activated idiotype-specific T-suppressor lymphocytes. IgG B-memory cells nevertheless develop during the course of immunization, but are arrested in an anergic state. In the presence of Cremophor EL the induction of this anergic state is inhibited and the immune response shifts fully to an IgG anti-Dex response. Images Figure 1 PMID:1717371
Córdoba-Aguilar, A; Nava-Sánchez, A; González-Tokman, D M; Munguía-Steyer, R; Gutiérrez-Cabrera, A E
2016-08-01
Some insect species are capable of producing an enhanced immune response after a first pathogenic encounter, a process called immune priming. However, whether and how such ability is driven by particular diet components (protein/carbohydrate) have not been explored. Such questions are sound given that, in general, immune response is dietary dependent. We have used adults of the house cricket Acheta domesticus L. (Orthoptera: Gryllidae) and exposed them to the bacteria Serratia marcescens. We first addressed whether survival rate after priming and nonpriming treatments is dietary dependent based on access/no access to proteins and carbohydrates. Second, we investigated how these dietary components affected fat reserves, muscle mass, and body weight, three key traits in insect fitness. Thus, we exposed adult house crickets to either a protein or a carbohydrate diet and measured the three traits. After being provided with protein, primed animals survived longer compared to the other diet treatments. Interestingly, this effect was also sex dependent with primed males having a higher survival than primed females when protein was supplemented. For the second experiment, protein-fed animals had more fat, muscle mass, and body weight than carbohydrate-fed animals. Although we are not aware of the immune component underlying immune priming, our results suggest that its energetic demand for its functioning and/or consequent survival requires a higher demand of protein with respect to carbohydrate. Thus, protein shortage can impair key survival-related traits related to immune and energetic condition. Further studies varying nutrient ratios should verify our results.
Ubiquitin enzymes in the regulation of immune responses.
Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo
2017-08-01
Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.
Tang, Chun-Lian; Liu, Zhi-Ming; Gao, Yan Ru; Xiong, Fei
2018-01-01
Studies on parasite-induced immunoregulatory mechanisms could contribute to the development of new therapies for inflammatory diseases such as type 2 diabetes (T2D), which is a chronic inflammatory disease characterized by persistent elevated glucose levels due to insulin resistance. The association between previous Schistosoma infection and T2D has been confirmed—Schistosoma infection and Schistosoma-derived products modulate the immune system, including innate and acquired immune responses, contributing to T2D disease control. Schistosoma infections and Schistosoma-derived molecules affect the immune cell composition in adipose tissue, dampening inflammation and improving glucose tolerance. This protective role includes the polarization of immune cells to alternatively activated macrophages, dendritic cells, eosinophils, and group 2 innate lymphoid cells. Furthermore, Schistosoma infection and Schistosoma products are effective for the treatment of T2D, as they increase the number of type 2 helper T cells (Th2) and regulatory T cells (Tregs) and decrease type 1 helper T cells (Th1) and type 17 helper T cells (Th17) cells. Thus, our aim was to comprehensively review the mechanism through which Schistosoma infection and Schistosoma products modulate the immune response against T2D. PMID:29387059
Tang, Chun-Lian; Liu, Zhi-Ming; Gao, Yan Ru; Xiong, Fei
2017-01-01
Studies on parasite-induced immunoregulatory mechanisms could contribute to the development of new therapies for inflammatory diseases such as type 2 diabetes (T2D), which is a chronic inflammatory disease characterized by persistent elevated glucose levels due to insulin resistance. The association between previous Schistosoma infection and T2D has been confirmed- Schistosoma infection and Schistosoma -derived products modulate the immune system, including innate and acquired immune responses, contributing to T2D disease control. Schistosoma infections and Schistosoma -derived molecules affect the immune cell composition in adipose tissue, dampening inflammation and improving glucose tolerance. This protective role includes the polarization of immune cells to alternatively activated macrophages, dendritic cells, eosinophils, and group 2 innate lymphoid cells. Furthermore, Schistosoma infection and Schistosoma products are effective for the treatment of T2D, as they increase the number of type 2 helper T cells (Th2) and regulatory T cells (Tregs) and decrease type 1 helper T cells (Th1) and type 17 helper T cells (Th17) cells. Thus, our aim was to comprehensively review the mechanism through which Schistosoma infection and Schistosoma products modulate the immune response against T2D.
Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response
Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.
2016-01-01
Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed
Microarray analyses reveal distinct roles for Rel proteins in the Drosophila immune response
Pal, Subhamoy; Wu, Junlin; Wu, Louisa P.
2007-01-01
The NF-κB group of transcription factors play an important role in mediating immune responses in organisms as diverse as insects and mammals. The fruit fly Drosophila melanogaster express three closely related NF-κB-like transcription factors: Dorsal, Dif, and Relish. To study their roles in vivo, we used microarrays to determine the effect of null mutations in individual Rel transcription factors on larval immune gene expression. Of the 188 genes that were significantly up-regulated in wildtype larvae upon bacterial challenge, overlapping but distinct groups of genes were affected in the Rel mutants. We also ectopically expressed Dorsal or Dif and used cDNA microarrays to determine the genes that were up-regulated in the presence of these transcription factors. This expression was sufficient to drive expression of some immune genes, suggesting redundancy in the regulation of these genes. Combining this data, we also identified novel genes that may be specific targets of Dif. PMID:17537510
Tsuji, Petra A.; Carlson, Bradley A.; Anderson, Christine B.; Seifried, Harold E.; Hatfield, Dolph L.; Howard, Michael T.
2015-01-01
Selenium is an essential element that is required to support a number of cellular functions and biochemical pathways. The objective of this study was to examine the effects of reduced dietary selenium levels on gene expression to assess changes in expression of non-selenoprotein genes that may contribute to the physiological consequences of selenium deficiency. Mice were fed diets that were either deficient in selenium or supplemented with selenium in the form of sodium selenite for six weeks. Differences in liver mRNA expression and translation were measured using a combination of ribosome profiling, RNA-Seq, microarrays, and qPCR. Expression levels and translation of mRNAs encoding stress-related selenoproteins were shown to be up-regulated by increased selenium status, as were genes involved in inflammation and response to interferon-γ. Changes in serum cytokine levels were measured which confirmed that interferon-γ, as well as IL-6, were increased in selenium adequate mice. Finally, microarray and qPCR analysis of lung tissue demonstrated that the selenium effects on immune function are not limited to liver. These data are consistent with previous reports indicating that adequate selenium levels can support beneficial immune responses, and further identify the IL-6 and interferon-γ pathways as being responsive to dietary selenium intake. PMID:26258789
Current views on the mechanisms of immune responses to trauma and infection
Michalak, Grzegorz; Słotwiński, Robert
2015-01-01
According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036
Sex-specific consequences of an induced immune response on reproduction in a moth.
Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T
2015-12-16
Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-01-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-03-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.
Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.
Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon
2018-01-01
Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.
A cognitive computational model inspired by the immune system response.
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.
A novel mode of induction of the humoral innate immune response in Drosophila larvae
Kenmoku, Hiroyuki
2017-01-01
ABSTRACT Drosophila adults have been utilized as a genetically tractable model organism to decipher the molecular mechanisms of humoral innate immune responses. In an effort to promote the utility of Drosophila larvae as an additional model system, in this study, we describe a novel aspect of an induction mechanism for innate immunity in these larvae. By using a fine tungsten needle created for manipulating semi-conductor devices, larvae were subjected to septic injury. However, although Toll pathway mutants were susceptible to infection with Gram-positive bacteria as had been shown for Drosophila adults, microbe clearance was not affected in the mutants. In addition, Drosophila larvae were found to be sensitive to mechanical stimuli with respect to the activation of a sterile humoral response. In particular, pinching with forceps to a degree that might cause minor damage to larval tissues could induce the expression of the antifungal peptide gene Drosomycin; notably, this induction was partially independent of the Toll and immune deficiency pathways. We therefore propose that Drosophila larvae might serve as a useful model to analyze the infectious and non-infectious inflammation that underlies various inflammatory diseases such as ischemia, atherosclerosis and cancer. PMID:28250052
Dietary astaxanthin enhances immune response in dogs.
Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon
2011-04-15
No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.
Stockwell, Melissa S; Irigoyen, Matilde; Martinez, Raquel Andres; Findley, Sally
2011-01-01
Little is known about how families' experiences with immunization visits within the medical home may affect children's immunization status. We assessed the association between families' negative immunization experiences within the medical home and underimmunization. We surveyed parents (n = 392) of children aged 2-36 months about immunization experiences at community health centers, hospital-based clinics, private practices, and community-based organizations in New York City. We used Chi-square tests and odds ratios (ORs) to assess the relationship between medical home elements and parental immunization experience ratings. We used multivariable analysis to determine the association between negative experiences during immunization visits and underimmunization, controlling for insurance, maternal education, and receipt of benefits from the Special Supplemental Nutrition Program for Women, Infants, and Children. The majority of children were of Latino race/ethnicity and had Medicaid and a medical home. One-sixth (16.9%) of families reported a previous negative immunization experience, primarily related to the child's reaction, waiting time, and attitudes of medical and office staff. Parents' negative immunization experiences were associated with the absence of four components of the medical home: continuity of care, family-centered care, compassionate care, and comprehensive care. In addition, children in families who reported a negative experience were more likely to have been underimmunized (adjusted OR = 2.00; 95% confidence interval 1.12, 3.58). In a community in New York City, underimmunization of young children was associated with negative immunization experiences. Strategies to improve family experiences with immunization visits within the medical home (particularly around support for the family), medical and ancillary staff attitudes, and reduced waiting time may lead to improved immunization delivery.
Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M
2004-03-01
Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.
Effect of nanovaccine chemistry on humoral immune response kinetics and maturation
NASA Astrophysics Data System (ADS)
Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji
2014-10-01
Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry
Phenytoin promotes Th2 type immune response in mice
Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U
2001-01-01
The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401
Ubiquitin enzymes in the regulation of immune responses
Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo
2017-01-01
Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749
IL-2 infusion abrogates humoral immune responses in humans.
Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K
1992-01-01
Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235
[Immune response to live influenza vaccine].
Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G
2002-01-01
Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.
Kulski, Jerzy K; Kenworthy, William; Bellgard, Matthew; Taplin, Ross; Okamoto, Koichi; Oka, Akira; Mabuchi, Tomotaka; Ozawa, Akira; Tamiya, Gen; Inoko, Hidetoshi
2005-12-01
Gene expression profiling was performed on biopsies of affected and unaffected psoriatic skin and normal skin from seven Japanese patients to obtain insights into the pathways that control this disease. HUG95A Affymetrix DNA chips that contained oligonucleotide arrays of approximately 12,000 well-characterized human genes were used in the study. The statistical analysis of the Affymetrix data, based on the ranking of the Student t-test statistic, revealed a complex regulation of molecular stress and immune gene responses. The majority of the 266 induced genes in affected and unaffected psoriatic skin were involved with interferon mediation, immunity, cell adhesion, cytoskeleton restructuring, protein trafficking and degradation, RNA regulation and degradation, signalling transduction, apoptosis and atypical epidermal cellular proliferation and differentiation. The disturbances in the normal protein degradation equilibrium of skin were reflected by the significant increase in the gene expression of various protease inhibitors and proteinases, including the induced components of the ATP/ubiquitin-dependent non-lysosomal proteolytic pathway that is involved with peptide processing and presentation to T cells. Some of the up-regulated genes, such as TGM1, IVL, FABP5, CSTA and SPRR, are well-known psoriatic markers involved in atypical epidermal cellular organization and differentiation. In the comparison between the affected and unaffected psoriatic skin, the transcription factor JUNB was found at the top of the statistical rankings for the up-regulated genes in affected skin, suggesting that it has an important but as yet undefined role in psoriasis. Our gene expression data and analysis suggest that psoriasis is a chronic interferon- and T-cell-mediated immune disease of the skin where the imbalance in epidermal cellular structure, growth and differentiation arises from the molecular antiviral stress signals initiating inappropriate immune responses.
NASA Astrophysics Data System (ADS)
Tan, Jie; Li, Fenghui; Sun, Huiling; Gao, Fei; Yan, Jingping; Gai, Chunlei; Chen, Aihua; Wang, Qingyin
2015-04-01
Grading procedure in routine sea cucumber hatchery production is thought to affect juvenile sea cucumber immunological response. The present study investigated the impact of a 3-min mechanical perturbation mimicking the grading procedure on neuroendocrine and immune parameters of the sea cucumber Apostichopus japonicus. During the application of stress, concentrations of noradrenaline and dopamine in coelomic fluid increased significantly, indicating that the mechanical perturbation resulted in a transient state of stress in sea cucumbers. Coelomocytes concentration in coelomic fluid increased transiently after the beginning of stressing, and reached the maximum in 1 h. Whereas, coelomocytes phagocytosis at 3 min, superoxide anion production from 3 min to 0.5 h, acid phosphatase activity at 0.5 h, and phenoloxidase activity from 3 min to 0.5 h were all significantly down-regulated. All of the immune parameters recovered to baseline levels after the experiment was conducted for 8 h, and an immunostimulation occurred after the stress considering the phagocytosis and acid phosphatase activity. The results suggested that, as in other marine invertebrates, neuroendocrine/immune connections exist in sea cucumber A. japonicus. Mechanical stress can elicit a profound influence on sea cucumber neuroendocrine system. Neuroendocrine messengers act in turn to modulate the immunity functions. Therefore, these effects should be considered for developing better husbandry procedures.
Barth, Kenneth; Genco, Caroline Attardo
2016-01-01
The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456
Immune responses to bioengineered organs
Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.
2017-01-01
Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545
Feeding Immunity: Physiological and Behavioral Responses to Infection and Resource Limitation
Budischak, Sarah A.; Hansen, Christina B.; Caudron, Quentin; Garnier, Romain; Kartzinel, Tyler R.; Pelczer, István; Cressler, Clayton E.; van Leeuwen, Anieke; Graham, Andrea L.
2018-01-01
Resources are a core currency of species interactions and ecology in general (e.g., think of food webs or competition). Within parasite-infected hosts, resources are divided among the competing demands of host immunity and growth as well as parasite reproduction and growth. Effects of resources on immune responses are increasingly understood at the cellular level (e.g., metabolic predictors of effector function), but there has been limited consideration of how these effects scale up to affect individual energetic regimes (e.g., allocation trade-offs), susceptibility to infection, and feeding behavior (e.g., responses to local resource quality and quantity). We experimentally rewilded laboratory mice (strain C57BL/6) in semi-natural enclosures to investigate the effects of dietary protein and gastrointestinal nematode (Trichuris muris) infection on individual-level immunity, activity, and behavior. The scale and realism of this field experiment, as well as the multiple physiological assays developed for laboratory mice, enabled us to detect costs, trade-offs, and potential compensatory mechanisms that mice employ to battle infection under different resource conditions. We found that mice on a low-protein diet spent more time feeding, which led to higher body fat stores (i.e., concentration of a satiety hormone, leptin) and altered metabolite profiles, but which did not fully compensate for the effects of poor nutrition on albumin or immune defenses. Specifically, immune defenses measured as interleukin 13 (IL13) (a primary cytokine coordinating defense against T. muris) and as T. muris-specific IgG1 titers were lower in mice on the low-protein diet. However, these reduced defenses did not result in higher worm counts in mice with poorer diets. The lab mice, living outside for the first time in thousands of generations, also consumed at least 26 wild plant species occurring in the enclosures, and DNA metabarcoding revealed that the consumption of different wild foods
Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.
Luu, L; Coombes, J L
2015-03-01
Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.
The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides
Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria
2010-01-01
The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388
Host Immune Response to Histophilus somni.
Corbeil, Lynette B
2016-01-01
Histophilus somni is known to cause several overlapping syndromes or to be found in genital or upper respiratory carrier states in ruminants. Vaccines have been used for decades, yet efficacy is controversial and mechanisms of protective immunity are not well understood. Since H. somni survives phagocytosis, it has sometimes been considered to be a facultative intercellular parasite, implying that cell-mediated immunity would be critical in protection. However, H. somni not only inhibits phagocyte function, but also is cytotoxic for macrophages. Therefore, it does not live for long periods in healthy phagocytes. Protection of calves against H. somni pneumonia by passive immunization is also evidence that H. somni is more like an extracellular pathogen than an intracellular pathogen. Several studies showed that bovine IgG2 antibodies are more protective than IgG1 antibodies. Even the IgG2 allotypes tend to vary in protection. Of course, antigenic specificity also determines protection. So far, there is most evidence for protection by a 40 K outer membrane protein and by Immunoglobulin binding protein A fibrils. Serology and immunohistochemistry have both been used for immunodiagnosis. Many evasive mechanisms by H. somni have been defined, including decreased phagocyte function, antibodies bound by shed antigens, decreased immune stimulation, and antigenic variation. Interaction of H. somni with other bovine respiratory disease organisms is another layer of pathogenesis. Studies of bovine respiratory syncytial virus (BRSV) and H. somni in calfhood pneumonia revealed an increase in IgE antibodies to H. somni, which were associated with more severe disease of longer duration than with either agent alone. Innate immune mechanisms at the epithelial cell level are also affected by dual infection by BRSV and H. somni as compared to either pathogen alone. Although much more work needs to be done, the complex mechanisms of H. somni immunity are becoming clearer.
Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model
Cao, Yongsheng; Zhang, Qiya; Xu, Liming; Li, Shaowu; Wang, Di; Zhao, Jingzhuang; Liu, Hongbai; Feng, Jian; Lu, Tongyan
2017-01-01
Seven rainbow trout cytokine genes (interleukin (IL)-2, IL-8, IL-15, IL-17, IL-1β, intracellular interferon (iIFN) 1a, and IFN-γ2) were evaluated for their adjuvant effects on a DNA vaccine, called pG, containing the glycoprotein gene of infectious hematopoietic necrosis virus (IHNV). Distinct DNA constructs in expression plasmid pcDNA3.1 encoding a cytokine gene were generated. Immunofluorescence assays in rainbow trout gonadal cells demonstrated successful protein expression from all these constructs. Subsequently, fish were immunized with pG alone or together with a cytokine expression plasmid. Results showed that each cytokine plasmids at an appropriate dose showed notable effects on immune gene expression. IL-17 and IFN-γ2 can enhance early specific IgM response. All cytokines, except IL-8, can benefit initial neutralizing antibody (NAb) titers. At 35 days post immunization (dpi), NAb titers of fish immunized with pG and IL-2, iIFN1a, or IFN-γ2 plasmids remained at high levels (1:160). NAb titers of fish immunized with pG alone decreased to 1:40. IL-8 or IL-1β can enhance antigen-specific proliferative T-cell responses at 14 dpi. At 28 dpi, coinjection of pG with IL-2, IL-8, IL-15, or IL-17 plasmids induced considerably stronger lymphocyte proliferation than that with injection of pG alone. All cytokine plasmids delivered with pG plasmid enhanced protection of trout against IHNV-mediated mortality. These results indicate that the type and dose of trout cytokine genes injected into fish affect quality of immune response to DNA vaccination. PMID:29348820
CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL
Zhu, Yuwen; Yao, Sheng; Chen, Lieping
2011-01-01
Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182
Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA
Mandadi, Kranthi K.; Scholthof, Karen-Beth G.
2013-01-01
Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626
A modified live canine parvovirus vaccine. II. Immune response.
Carmichael, L E; Joubert, J C; Pollock, R V
1983-01-01
The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.
Mesenchymal stem cells: a double-edged sword in regulating immune responses
Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y
2012-01-01
Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969
Innate immune responses following Kawasaki disease and toxic shock syndrome
Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181
Innate immune responses following Kawasaki disease and toxic shock syndrome.
Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.
Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.
Fins, Joseph J
2015-04-01
Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.
A Cognitive Computational Model Inspired by the Immune System Response
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131
Gonzalez-Jurado, Jose A.; Pradas, Francisco; Molina, Edgardo S.; de Teresa, Carlos
2011-01-01
Exercise training is considered a good model to provoke different degrees of immune dysfunction affecting physical performance and some physiological responses related to oxidative stress and low grade inflammation. Phlebodium decumanum is a polypodiaceae may induce shown immunomodulating effects, specifically directed to the release of proinflammatory cytokines by macrophages in response to various stimuli, as reported different in vitro studies. The aim of this study was to evaluate the modulating effect of phlebodium decumanum, on the immune response induced by physical exercise. Thirty-one subjects (males only) were randomly divided into two groups: Group PD (n = 18); age: 22.1 ± 1.81, weight 74.21 ± 8.74 kg) that was treated with phlebodium decumanum; Group P (n = 13); age: 22.5 ± 1.63, weight 78 ± 12.5 kg) that was treated with a placebo. Before and after one month training program performed by both groups (three times a week), the following performance parameters and immune response variables were measured: Dynamic Maximum Force; Interval-Training; Tennis test; pro-inflammatory (TNF , IL6) and anti-inflammatory (TNFα-IIrs, IL1-ra) cytokines levels. Data were statistically analyzed with Mann- Whitney U test and Wilcoxon paired test (p < 0.05). Statistically significant differences were recorded within groups before and after the training program. PD group showed a significant improvement in the performance parameters (Strength Muscle Test: dorsal: p < 0.002; deltoids: p < 0.03; and pectorals: p < 0.07; Interval Training: p < 0.06; Tennis Test: p < 0.02). Cytokine levels resulted in a more positive profile in the PD group rather than in the P group, in which higher levels of IL-6 (p < 0.02) and a reduction of TNF-IIrs (p < 0.003) and IL1-ra (p < 0.03) were recorded. In this study the use of phlebodium decumanum demonstrated beneficial effects in the modulation of the immune response during physical performance. Key points Practicing sport or physical
Martyka, Rafał; Śliwińska, Ewa B; Martyka, Mirosław; Cichoń, Mariusz; Tryjanowski, Piotr
2018-01-01
Prenatal antibody transfer is an immune-mediated maternal effect by which females can shape postnatal offspring resistance to pathogens and parasites. Maternal antibodies passed on to offspring provide primary protection to neonates against diverse pathogenic antigens, but they may also affect offspring growth and influence the development of an offspring's own immune response. The effects of maternal antibodies on offspring performance commonly require that the disease environment experienced by a mother prior to breeding matches the environment encountered by her offspring after hatching/birth. However, other circumstances, like postnatal rearing conditions that affect offspring food availability, may also determine the effects of maternal antibodies on offspring growth and immunity. To date, knowledge about how prenatal immune-mediated maternal effects interact with various postnatal rearing conditions to affect offspring development and phenotype in wild bird population remains elusive. Here we experimentally studied the interactive effects of pre-laying maternal immunization with a bacterial antigen (lipopolysaccharide) and post-hatching rearing conditions, altered by brood size manipulation, on offspring growth and humoral immunity of wild great tits ( Parus major ). We found that maternal immunization and brood size manipulation interactively affected the growth and specific humoral immune response of avian offspring. Among nestlings reared in enlarged broods, only those that originated from immunized mothers grew better and were heavier at fledging stage compared to those that originated from non-immunized mothers. In contrast, no such effects were observed among nestlings reared in non-manipulated (control) broods. Moreover, offspring of immunized females had a stronger humoral immune response to lipopolysaccharide during postnatal development than offspring of non-immunized females, but only when the nestling was reared in control broods. This study
Angiotensin converting enzyme over expression in myelocytes enhances the immune response
Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.
2015-01-01
Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750
Seghatoleslam, Atefeh; Hemmati, Mina; Ebadat, Saeedeh; Movahedi, Bahram; Mostafavi-Pour, Zohreh
2016-01-01
Background: Macrophage immune responses are affected by the secretory proteins of Mycobacterium tuberculosis (Mtb). This study aimed to examine the immune responses of macrophages to Mtb secretory antigens, namely ESAT-6, CFP-10, and ESAT-6/CFP-10. Methods: THP-1 cells (a human monocytic cell line) were cultured and differentiated to macrophages by phorbol 12-myristate 13-acetate. The cytotoxicity of the recombinant Mtb proteins was assessed using the MTT assay. Two important immune responses of macrophages, namely NO and ROS production, were measured in response to the ESAT-6, CFP-10, and ESAT-6/CFP-10 antigens. The data were analyzed using one-way ANOVA with SPSS, version 16, and considered significant at P<0.05. Results: The results showed that the ESAT-6, CFP-10, and ESAT-6/CFP-10 proteins markedly reduced macrophage immune response. The treatment of the THP-1-differentiated cells with ESAT-6, CFP-10, and ESAT-6/CFP-10 reduced NO and ROS production. The treated THP-1-differentiated cells exhibited less inducible NO synthase activity than did the untreated cells. No toxic effect on macrophage viability was observed for the applied proteins at the different concentrations. Conclusion: It seems that the decline in macrophage immune response is due to the suppression of NO and ROS production pathways without any effect on cell viability. PMID:27365551
Induction of the immune response suppression in mice inoculated with Candida albicans.
Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G
1986-03-01
There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).
Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.
West, A Phillip
2017-11-01
A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Geng, Tao; Lv, Ding-Ding; Huang, Yu-Xia; Hou, Cheng-Xiang; Qin, Guang-Xing; Guo, Xi-Jie
2016-12-20
Innate immunity was critical in insects defensive system and able to be induced by Janus kinase/signal transducer and activator of transcription cascade transduction (JAK/STAT) signaling pathway. Currently, it had been identified many JAK/STAT signaling pathway-related genes in silkworm, but little function was known on insect innate immunity. To explore the roles of JAK/STAT pathway in antifungal immune response in silkworm (Bombyx mori) against Beauveria bassiana infection, the expression patterns of B. mori C-type lectin 5 (BmCTL5) and genes encoding 6 components of JAK/STAT signaling pathway in silkworm challenged by B. bassiana were analyzed using quantitative real time PCR. Meanwhile the activation of JAK/STAT signaling pathway by various pathogenic micro-organisms and the affect of JAK/STAT signaling pathway inhibitors on antifungal activity in silkworm hemolymph was also detected. Moreover, RNAi assay of BmCTL5 and the affect on expression levels of signaling factors were also analyzed. We found that JAK/STAT pathway could be obviously activated in silkworm challenged with B. bassiana and had no response to bacteria and B. mori cytoplasmic polyhedrosis virus (BmCPV). However, the temporal expression patterns of JAK/STAT signaling pathway related genes were significantly different. B. mori downstream receptor kinase (BmDRK) might be a positive regulator of JAK/STAT signaling pathway in silkworm against B. bassiana infection. Moreover, antifungal activity assay showed that the suppression of JAK/STAT signaling pathway by inhibitors could significantly inhibit the antifungal activity in hemolymph and resulted in increased sensitivity of silkworm to B. bassiana infection, indicating that JAK/STAT signaling pathway might be involved in the synthesis and secretion of antifungal substances. The results of RNAi assays suggested that BmCTL5 might be one pattern recognition receptors for JAK/STAT signaling pathway in silkworm. These findings yield insights for better
Immune responses to West Nile virus infection in the central nervous system.
Cho, Hyelim; Diamond, Michael S
2012-12-17
West Nile virus (WNV) continues to cause outbreaks of severe neuroinvasive disease in humans and other vertebrate animals in the United States, Europe, and other regions of the world. This review discusses our understanding of the interactions between virus and host that occur in the central nervous system (CNS), the outcome of which can be protection, viral pathogenesis, or immunopathogenesis. We will focus on defining the current state of knowledge of WNV entry, tropism, and host immune response in the CNS, all of which affect the balance between injury and successful clearance.
Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J
2011-03-01
The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.
Surviving Sepsis: Taming a Deadly Immune Response
... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...
Respiratory tract immune response to microbial pathogens.
Wilkie, B N
1982-11-15
Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.
Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza
Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom
2015-01-01
The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761
Innate Immune Responses of Bat and Human Cells to Filoviruses: Commonalities and Distinctions
Kuzmin, Ivan V.; Schwarz, Toni M.; Ilinykh, Philipp A.; Jordan, Ingo; Ksiazek, Thomas G.; Sachidanandam, Ravi; Basler, Christopher F.
2017-01-01
ABSTRACT Marburg (MARV) and Ebola (EBOV) viruses are zoonotic pathogens that cause severe hemorrhagic fever in humans. The natural reservoir of MARV is the Egyptian rousette bat (Rousettus aegyptiacus); that of EBOV is unknown but believed to be another bat species. The Egyptian rousette develops subclinical productive infection with MARV but is refractory to EBOV. Interaction of filoviruses with hosts is greatly affected by the viral interferon (IFN)-inhibiting domains (IID). Our study was aimed at characterization of innate immune responses to filoviruses and the role of filovirus IID in bat and human cells. The study demonstrated that EBOV and MARV replicate to similar levels in all tested cell lines, indicating that permissiveness for EBOV at cell and organism levels do not necessarily correlate. Filoviruses, particularly MARV, induced a potent innate immune response in rousette cells, which was generally stronger than that in human cells. Both EBOV VP35 and VP24 IID were found to suppress the innate immune response in rousette cells, but only VP35 IID appeared to promote virus replication. Along with IFN-α and IFN-β, IFN-γ was demonstrated to control filovirus infection in bat cells but not in human cells, suggesting host species specificity of the antiviral effect. The antiviral effects of bat IFNs appeared not to correlate with induction of IFN-stimulated genes 54 and 56, which were detected in human cells ectopically expressing bat IFN-α and IFN-β. As bat IFN-γ induced the type I IFN pathway, its antiviral effect is likely to be partially induced via cross talk. IMPORTANCE Bats serve as reservoirs for multiple emerging viruses, including filoviruses, henipaviruses, lyssaviruses, and zoonotic coronaviruses. Although there is no evidence for symptomatic disease caused by either Marburg or Ebola viruses in bats, spillover of these viruses into human populations causes deadly outbreaks. The reason for the lack of symptomatic disease in bats infected with
Innate Immune Responses of Bat and Human Cells to Filoviruses: Commonalities and Distinctions.
Kuzmin, Ivan V; Schwarz, Toni M; Ilinykh, Philipp A; Jordan, Ingo; Ksiazek, Thomas G; Sachidanandam, Ravi; Basler, Christopher F; Bukreyev, Alexander
2017-04-15
Marburg (MARV) and Ebola (EBOV) viruses are zoonotic pathogens that cause severe hemorrhagic fever in humans. The natural reservoir of MARV is the Egyptian rousette bat ( Rousettus aegyptiacus ); that of EBOV is unknown but believed to be another bat species. The Egyptian rousette develops subclinical productive infection with MARV but is refractory to EBOV. Interaction of filoviruses with hosts is greatly affected by the viral interferon (IFN)-inhibiting domains (IID). Our study was aimed at characterization of innate immune responses to filoviruses and the role of filovirus IID in bat and human cells. The study demonstrated that EBOV and MARV replicate to similar levels in all tested cell lines, indicating that permissiveness for EBOV at cell and organism levels do not necessarily correlate. Filoviruses, particularly MARV, induced a potent innate immune response in rousette cells, which was generally stronger than that in human cells. Both EBOV VP35 and VP24 IID were found to suppress the innate immune response in rousette cells, but only VP35 IID appeared to promote virus replication. Along with IFN-α and IFN-β, IFN-γ was demonstrated to control filovirus infection in bat cells but not in human cells, suggesting host species specificity of the antiviral effect. The antiviral effects of bat IFNs appeared not to correlate with induction of IFN-stimulated genes 54 and 56, which were detected in human cells ectopically expressing bat IFN-α and IFN-β. As bat IFN-γ induced the type I IFN pathway, its antiviral effect is likely to be partially induced via cross talk. IMPORTANCE Bats serve as reservoirs for multiple emerging viruses, including filoviruses, henipaviruses, lyssaviruses, and zoonotic coronaviruses. Although there is no evidence for symptomatic disease caused by either Marburg or Ebola viruses in bats, spillover of these viruses into human populations causes deadly outbreaks. The reason for the lack of symptomatic disease in bats infected with
Selection for avian immune response: a commercial breeding company challenge.
Fulton, J E
2004-04-01
Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.
Rodríguez, Felipe E; Valenzuela, Beatriz; Farías, Ana; Sandino, Ana María; Imarai, Mónica
2016-12-01
The diets of farmed salmon are usually supplemented with immunostimulants to improve health status. Because β-glucan is one of the most common immunostimulants used in diets, here we examined the effect of two β-1,3/1,6-glucan-supplemented diets on the expression of immune response genes of Atlantic salmon. The relative abundances of IFN-α1, Mx, IFN-γ, IL-12, TGF-β1, IL-10, and CD4 transcripts were evaluated in head kidney by qRT-PCR. We assessed the effects of the diets under normoxia and acute hypoxia, as salmon are especially sensitive to changes in the concentration of dissolved oxygen, which can also affect immunity. These effects were also tested on vaccinated fish, as we expected that β-1,3/1,6-glucan-supplemented diets would enhance the adaptive immune response to the vaccine. We found that administration of the Bg diet (containing β-1,3/1,6-glucan) under normoxia had no effects on the expression of the analyzed genes in the kidney of the diet-fed fish, but under hypoxia/re-oxygenation (90 min of acute hypoxia), the βg diet affected the expression of the antiviral genes, IFN-α1 and Mx, preventing their decrease caused by hypoxia. The Bax diet, which in addition to β-1,3/1,6-glucan, contained astaxanthin, increased IL-12 and IFN-γ in kidneys. With fish exposed to hypoxia/reoxygenation, the diet prevented the decrease of IFN-α1 and Mx levels observed after hypoxia. When fish were vaccinated, only the levels of IL-12 and CD4 transcripts increased, but interestingly if fish were also fed the Bax diet, the vaccination induced a significant increase in all the analyzed transcripts. Finally, when vaccinated fish were exposed to hypoxia, the effect of the Bax diet was greatly reduced for all genes tested and moreover, inducible effects completely disappeared for IL-12, IFN-α, and Mx. Altogether, these results showed that the tested β-1,3/1,6-glucan diets increased the levels of transcripts of key genes involved in innate and adaptive immune response
Osthole promotes anti-tumor immune responses in tumor-bearing mice with hepatocellular carcinoma.
Zhang, Lurong; Jiang, Guorong; Yao, Fei; Liang, Guoqiang; Wang, Fei; Xu, Heng; Wu, Yan; Yu, Xiao; Liu, Haiyan
2015-06-01
Osthole, a natural coumarin derivative, has been shown to have anti-tumor and anti-inflammatory activity. However, the effect of osthole on anti-tumor immune responses in tumor-bearing mice has not yet been reported. In the present study, osthole treatment did not affect the weight and the coefficient of thymus and spleen in tumor-bearing mice with hepatocellular carcinoma (HCC). However, osthole administration significantly elevated the proportion and number of the splenic CD8(+) T cells, the proportion of CD4(+) T and CD8(+) T cells in tumor tissues, and the levels of IL-2 and TNF-α in the serum of HCC tumor-bearing mice. Our results suggested that osthole could promote the activation of the tumor-infiltrating CD4(+) T and CD8(+) T cells, and elevate the proportion of CD4(+) and CD8(+) effector T cells. Osthole treatment also significantly decreased the proportion of CD4(+)CD25(+)Foxp3(+) regulatory T cells in the spleen. Taken together, osthole could enhance the T cell mediated anti-tumor immune responses in the tumor-bearing mice with HCC.
Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng
2013-11-19
Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.
The Impact of Western Diet and Nutrients on the Microbiota and Immune Response at Mucosal Interfaces
Statovci, Donjete; Aguilera, Mònica; MacSharry, John; Melgar, Silvia
2017-01-01
Recent findings point toward diet having a major impact on human health. Diets can either affect the gut microbiota resulting in alterations in the host’s physiological responses or by directly targeting the host response. The microbial community in the mammalian gut is a complex and dynamic system crucial for the development and maturation of both systemic and mucosal immune responses. Therefore, the complex interaction between available nutrients, the microbiota, and the immune system are central regulators in maintaining homeostasis and fighting against invading pathogens at mucosal sites. Westernized diet, defined as high dietary intake of saturated fats and sucrose and low intake of fiber, represent a growing health risk contributing to the increased occurrence of metabolic diseases, e.g., diabetes and obesity in countries adapting a westernized lifestyle. Inflammatory bowel diseases (IBD) and asthma are chronic mucosal inflammatory conditions of unknown etiology with increasing prevalence worldwide. These conditions have a multifactorial etiology including genetic factors, environmental factors, and dysregulated immune responses. Their increased prevalence cannot solely be attributed to genetic considerations implying that other factors such as diet can be a major contributor. Recent reports indicate that the gut microbiota and modifications thereof, due to a consumption of a diet high in saturated fats and low in fibers, can trigger factors regulating the development and/or progression of both conditions. While asthma is a disease of the airways, increasing evidence indicates a link between the gut and airways in disease development. Herein, we provide a comprehensive review on the impact of westernized diet and associated nutrients on immune cell responses and the microbiota and how these can influence the pathology of IBD and asthma. PMID:28804483
Differential Immune Responses to New World and Old World Mammalian Arenaviruses
Ly, Hinh
2017-01-01
Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311
Nallagatla, Himaja; Hemalatha, Rajkumar; Kondapalli, Narendra Babu; Mohammed, Shujauddin
2017-06-01
Prebiotics from various regularly consumed cereals and novel substrates are currently being utilised as functional foods. The aim of this study was to determine the effect of synbiotic, formulated with prebiotic extracted from natural resources like green gram (Vigna radiata) along with probiotic Lactobacillus rhamnosus GG (LGG) in modulating immune responses in the offspring when supplemented during gestation and lactation. Synbiotic supplementation was effective in improving cell mediated immunity and humoral immunity among F0 dams. Among F1 pups (F1 Syn + and F1 Syn-), synbiotic supplementation showed significantly heightened (P < 0.05) splenocyte proliferation, increased interleukin-10, interferon gamma and interleukin-17 responses, leucocyte phagocytic ability and increased secretory-immunoglobulin A. However, four-fold increase in IgG titres to Hepatitis-B vaccine was observed only in those mice that were supplemented with synbiotic postweaning (F1 Syn+). Synbiotic supplementation to pregnant dams affected the offspring's cellular and mucosal immunity favorably. However, IgG response to Hepatitis-B vaccine was influenced positively only when the supplementation was extended to the offsprings in the post weaning period. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses
Feng, Pinghui; Moses, Ashlee; Früh, Klaus
2015-01-01
γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334
Group selection for adaptation to multiple-hen cages: humoral immune response.
Hester, P Y; Muir, W M; Craig, J V
1996-11-01
A selected line of White Leghorns, which has shown improved survivability and reduced feather loss in large multiple-hen cages, was evaluated for humoral immune response to SRBC under both stressed and unstressed conditions. Three lines of chickens (selected, control, and commercial) were housed in either single- (1 hen) or multiple-hen cages (12 hens, social competition) and subjected to a cold ambient temperature (0 C) at 33 wk of age and to two heating episodes (38 C) at 44 wk of age. Each hen was challenged intravenously with 1 mL of a 7% saline suspension of SRBC at the time that cold exposure was initiated. Hens subjected to high ambient temperatures had been exposed previously to a cold temperature, but were not challenged with SRBC until 16 to 18 h following the end of the second heating episode. Exposure to cold caused immunosuppression in single-caged hens, but not in hens in colony cages. Single- vs colony-caged hens of the control environment challenged with SRBC at 33 wk of age had similar primary hemagglutinin responses to SRBC. Hens subjected to heat experienced immunosuppression at 9 and 12 d following challenge to SRBC when compared to the controls. Hens of multiple-bird cages challenged with antigen at 44 wk of age had a significantly lower hemagglutinin response to SRBC than those reared in single-bird cages. The three lines of genetic stock had similar primary hemagglutinin responses to SRBC; the interactions of genetic stock with cage size or environmental temperature were not significant. It was concluded that genetically selecting hens for survival in multiple-hen cages did not affect their humoral immune response to SRBC.
Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke
2017-02-06
In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.
Nutritional modulation of the immune response in poultry
USDA-ARS?s Scientific Manuscript database
Economic efficiency demanded by the poultry industry has pushed selection towards high production with improved feed conversion ratios (FCR) and high yield; however, selection based heavily on growth characteristics and other phenotypic traits has adversely affected immune competence. Despite incre...
Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E
2000-04-01
Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.
Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.
Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna
2014-01-01
Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.
Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine
Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.
1973-01-01
The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112
Complex pattern of immune evasion in MSI colorectal cancer.
Ozcan, Mine; Janikovits, Jonas; von Knebel Doeberitz, Magnus; Kloor, Matthias
2018-01-01
Mismatch repair (MMR)-deficient cancers accumulate multiple insertion/deletion mutations at coding microsatellites (cMS), which give rise to frameshift peptide neoantigens. The high mutational neoantigen load of MMR-deficient cancers is reflected by pronounced anti-tumoral immune responses of the host and high responsiveness towards immune checkpoint blockade. However, immune evasion mechanisms can interfere with the immune response against MMR-deficient tumors. We here performed a comprehensive analysis of immune evasion in MMR-deficient colorectal cancers, focusing on HLA class I-mediated antigen presentation. 72% of MMR-deficient colorectal cancers of the DFCI database harbored alterations affecting genes involved in HLA class I-mediated antigen presentation, and 54% of these mutations were predicted to abrogate function. Mutations affecting the HLA class I transactivator NLRC5 were observed as a potential new immune evasion mechanism in 26% (6% abrogating) of the analyzed tumors. NLRC5 mutations in MMR-deficient cancers were associated with decreased levels of HLA class I antigen expression. In summary, the majority of MMR-deficient cancers display mutations interfering with HLA class I antigen presentation that reflect active immune surveillance and immunoselection during tumor development. Clinical studies focusing on immune checkpoint blockade in MSI cancer should account for the broad variety of immune evasion mechanisms as potential biomarkers of therapy success.
A novel mode of induction of the humoral innate immune response in Drosophila larvae.
Kenmoku, Hiroyuki; Hori, Aki; Kuraishi, Takayuki; Kurata, Shoichiro
2017-03-01
Drosophila adults have been utilized as a genetically tractable model organism to decipher the molecular mechanisms of humoral innate immune responses. In an effort to promote the utility of Drosophila larvae as an additional model system, in this study, we describe a novel aspect of an induction mechanism for innate immunity in these larvae. By using a fine tungsten needle created for manipulating semi-conductor devices, larvae were subjected to septic injury. However, although Toll pathway mutants were susceptible to infection with Gram-positive bacteria as had been shown for Drosophila adults, microbe clearance was not affected in the mutants. In addition, Drosophila larvae were found to be sensitive to mechanical stimuli with respect to the activation of a sterile humoral response. In particular, pinching with forceps to a degree that might cause minor damage to larval tissues could induce the expression of the antifungal peptide gene Drosomycin ; notably, this induction was partially independent of the Toll and immune deficiency pathways. We therefore propose that Drosophila larvae might serve as a useful model to analyze the infectious and non-infectious inflammation that underlies various inflammatory diseases such as ischemia, atherosclerosis and cancer. © 2017. Published by The Company of Biologists Ltd.
A gut feeling: Microbiome-brain-immune interactions modulate social and affective behaviors.
Sylvia, Kristyn E; Demas, Gregory E
2018-03-01
The expression of a wide range of social and affective behaviors, including aggression and investigation, as well as anxiety- and depressive-like behaviors, involves interactions among many different physiological systems, including the neuroendocrine and immune systems. Recent work suggests that the gut microbiome may also play a critical role in modulating behavior and likely functions as an important integrator across physiological systems. Microbes within the gut may communicate with the brain via both neural and humoral pathways, providing numerous avenues of research in the area of the gut-brain axis. We are now just beginning to understand the intricate relationships among the brain, microbiome, and immune system and how they work in concert to influence behavior. The effects of different forms of experience (e.g., changes in diet, immune challenge, and psychological stress) on the brain, gut microbiome, and the immune system have often been studied independently. Though because these systems do not work in isolation, it is essential to shift our focus to the connections among them as we move forward in our investigations of the gut-brain axis, the shaping of behavioral phenotypes, and the possible clinical implications of these interactions. This review summarizes the recent progress the field has made in understanding the important role the gut microbiome plays in the modulation of social and affective behaviors, as well as some of the intricate mechanisms by which the microbiome may be communicating with the brain and immune system. Copyright © 2018 Elsevier Inc. All rights reserved.
Famakin, Bolanle M.
2014-01-01
It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490
Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.
Mack, Madison R; Kim, Brian S
2016-07-19
The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.
Alizadeh, M; Rodriguez-Lecompte, J C; Echeverry, H; Crow, G H; Slominski, B A
2016-04-01
This study evaluated the effect of yeast-derived products on innate and antibody mediated immune response in broiler chickens following immunization with sheep red blood cells (SRBC) and bovine serum albumin (BSA). One-day-old male broiler chickens (Ross-308) were randomly assigned to 6 dietary treatments of 9 replicate cages of 5 birds each per treatment. Dietary treatments consisted of a Control diet without antibiotic, and diets containing 11 mg/kg of virginiamycin, 0.25% of yeast cell wall (YCW), 0.2% of a commercial product Maxi-Gen Plus containing processed yeast and nucleotides, 0.05% of nucleotides, or a diet containing 10% of DDGS. On days 21 and 28 post-hatching, 5 birds per treatment were immunized intramuscularly with both SRBC and BSA. One week after each immunization, blood samples were collected. Serum samples were analyzed by hemagglutination test for antibody response to SRBC, and by ELISA for serum IgM and IgG response to BSA. On d 35, 5 birds per treatment were euthanized and the tissue samples from the cecal tonsils were collected to assess the gene expression of toll-like receptors TLR2b, TLR4, and TLR21, monocyte mannose receptor (MMR), and cytokines IL-10, IL-13, IL-4, IL-12p35, and IFN-γ. The results for gene expression analysis demonstrated that the diet supplemented with YCW increased the expression of TLR2b and T-helper type 2 cytokines IL-10, IL-4, and IL-13 relative to the Control; and the expression of TLR4 and IL-13 was upregulated in the nucleotide-containing diet. However, the diets containing antibiotics or Maxi-Gen Plus downregulated the expression of IFN-γ compared to the control. The primary antibody response to SRBC was not affected by diets. However, the diet containing YCW increased the secondary antibody response to SRBC compared to the antibiotic treatment. Neither primary nor secondary IgG and IgM response against BSA were affected by diets. In conclusion, supplementation of the diet with YCW stimulated Th2 cell
Immune Response in Mussels To Environmental Pollution.
ERIC Educational Resources Information Center
Pryor, Stephen C.; Facher, Evan
1997-01-01
Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)
Effect of rituximab on human in vivo antibody immune responses.
Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana
2011-12-01
B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights
Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.
Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna
2017-12-11
Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.
Hester, Shelly N.; Comstock, Sarah S.; Thorum, Shannon C.; Monaco, Marcia H.; Pence, Brandt D.; Woods, Jeffrey A.
2012-01-01
Infants are susceptible to infections in early life and must rely on their innate immune system for protection. β-Glucans potentiate immune responses. Therefore, we evaluated the influence of purified yeast (1,3/1,6)-β-d-glucan (Wellmune WGP, here referred to as WGP) on the development of the gastrointestinal tract and the intestinal and systemic immune systems in neonatal piglets. Piglets were fed formula containing 0 (control), 1.8, 18, or 90 mg WGP/kg body weight (BW) and were vaccinated against human influenza. Piglets were euthanized at 7 or 21 days of age. Piglet weight and small intestinal length and weight were unaffected by dietary WGP. In addition, WGP did not affect ileal crypt depth, villus height, or ascending colon cuff depth. Immune parameters not affected by WGP supplementation included T cell phenotypes, cytokine gene expression, and cell proliferation. However, vaccination and developmental effects were seen. Overall, the doses of 1.8, 18, and 90 mg/kg BW of dietary WGP had no effect on intestinal or immune development and did not improve the antibody response to vaccination in neonatal piglets. PMID:22815151
Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J
2015-01-01
Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.
Appaiahgari, Mohan Babu; Glass, Roger; Singh, Shakti; Taneja, Sunita; Rongsen-Chandola, Temsunaro; Bhandari, Nita; Mishra, Sukhdev; Vrati, Sudhanshu
2014-02-03
The lower immune response and efficacy of live oral rotavirus (RV) vaccines tested in developing countries may be due in part to high levels of pre-existing RV antibodies transferred to the infant from mother via the placenta. The candidate RV vaccine strain 116E was isolated from a newborn indicating that it might grow well even in the presence of this transplacental rotavirus antibody. Since the immune response to this vaccine among infants in the Indian subcontinent has been greater than that of the commercially licensed vaccines, we questioned whether this might be due to the ability of RV 116E to grow well in infants despite the presence of maternal RV antibody. To this end, we tested pre-immunization sera from Indian infants enrolled in a phase Ia/IIb trial of candidate RV vaccine ORV-116E for transplacental RV IgG to see whether it affected the immune responses and seroconversion to the vaccine. We found that the high titers of transplacental RV IgG diminished the immune responses of infants to ORV-116E vaccine. However, the vaccine was able to overcome the inhibitory effect of this RV IgG in a dose-dependent manner. This report clearly demonstrates the interference of maternal antibody on RV vaccine immunogenicity in infants in a field study as well as the ability of ORV-116E to overcome this interference when used at a higher dose. Copyright © 2013. Published by Elsevier Ltd.
The Role of the Immune Response in the Pathogenesis of Bronchiectasis.
King, Paul T
2018-01-01
Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.
A humoral immune response confers protection against Haemophilus ducreyi infection.
Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H
2003-12-01
Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.
Kangassalo, Katariina; Valtonen, Terhi M; Sorvari, Jouni; Kecko, Sanita; Pölkki, Mari; Krams, Indrikis; Krama, Tatjana; Rantala, Markus J
2018-06-29
Organisms in the wild are likely to face multiple immune challenges as well as additional ecological stressors, yet their interactive effects on immune function are poorly understood. Insects are found to respond to cues of increased infection risk by enhancing their immune capacity. However, such adaptive plasticity in immune function may be limited by physiological and environmental constraints. Here, we investigated the effects of two environmental stressors - poor larval diet and an artificial parasite-like immune challenge at the pupal stage - on adult immune function, growth and development in the greater wax moth (Galleria mellonella). Males whose immune system was activated with an artificial parasite-like immune challenge had weaker immune response - measured as strength of encapsulation response - as adults compared to the control groups, but only when raised in high-nutrition larval diet. Immune activation did not negatively affect adult immune response in males reared in low-nutrition larval diet, indicating that poor larval diet improved the capacity of the insects to respond to repeated immune challenges. Low-nutrition larval diet also had a positive independent effect on immune capacity in females, yet it negatively affected development time and adult body mass in both sexes. As in the nature immune challenges are rarely isolated, and adverse nutritional environment may indicate an elevated risk of infection, resilience to repeated immune challenges as a response to poor nutritional environment could provide a significant fitness advantage. The present study highlights the importance of considering environmental context when investigating effects of immune activation in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric
2015-10-21
Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.
Griffiths, Gareth D; Telford, Gary; Hooi, Doreen S W; Cook, David L; Wilkinson, Lucy J; Green, Christopher A; Pritchard, David I
2005-03-01
Immune regulation, either via the autonomic nervous system or by a proposed "non-neuronal" cholinergic system, suggests that the immune system may be susceptible to perturbation by compounds affecting cholinergic function. Here, the current UK and US nerve agent pre-treatment, pyridostigmine bromide (PB) and the related anti-acetylcholinesterase (AChE) compounds physostigmine (PHY) and BW284c51 were tested for their ability to affect mouse splenocyte function in vitro. In addition, PB, at a dose equivalent to that received during pre-treatment for nerve agent poisoning, was tested for its effect on a T-cell-dependent humoral response to antigen in vivo in the mouse. None of the anti-AChEs tested affected concanavalin A (Con A)-, anti-CD3- or lipopolysaccharide LPS-driven splenocyte proliferation, in vitro, at concentrations expected to give effective nerve agent pre-treatment. However, higher concentrations (>100 microM) particularly of PHY caused some inhibition of the proliferative responses. In vivo, PB or saline was administered via 28-day mini-osmotic pumps to give a 25-40% inhibition of whole blood AChE in the PB-treated animals. During PB or saline administration, primary and secondary doses (i.p.) of sheep red blood cells (SRBC) were given and the humoral response determined by monitoring anti-SRBC IgM and IgG levels. Splenocytes isolated from the experimental animals were also examined for their proliferative and cytokine responses to stimulation. No remarkable effects of PB were seen during the period of AChE inhibition on the humoral immune response. However, a modest elevation in IL-2 and IFN(gamma) in Con A-stimulated lymphocytes was seen in PB-treated animals following pump removal. Overall these data suggest that, in vivo, the SRBC stimulated T-cell-dependent immune response is unaffected by the administration of PB at pre-treatment doses.
On cell resistance and immune response time lag in a model for the HIV infection
NASA Astrophysics Data System (ADS)
Solovey, Guillermo; Peruani, Fernando; Ponce Dawson, Silvina; Maria Zorzenon dos Santos, Rita
2004-11-01
Recently, a cellular automata model has been introduced (Phys. Rev. Lett. 87 (2001) 168102) to describe the spread of the HIV infection among target cells in lymphoid tissues. The model reproduces qualitatively the entire course of the infection displaying, in particular, the two time scales that characterize its dynamics. In this work, we investigate the robustness of the model against changes in three of its parameters. Two of them are related to the resistance of the cells to get infected. The other one describes the time interval necessary to mount specific immune responses. We have observed that an increase of the cell resistance, at any stage of the infection, leads to a reduction of the latency period, i.e., of the time interval between the primary infection and the onset of AIDS. However, during the early stages of the infection, when the cell resistance increase is combined with an increase in the initial concentration of infected cells, the original behavior is recovered. Therefore we find a long and a short latency regime (eight and one year long, respectively) depending on the value of the cell resistance. We have obtained, on the other hand, that changes on the parameter that describes the immune system time lag affects the time interval during which the primary infection occurs. Using different extended versions of the model, we also discuss how the two-time scale dynamics is affected when we include inhomogeneities on the cells properties, as for instance, on the cell resistance or on the time interval to mount specific immune responses.
Vallejo, Alejandro; Monge-Maillo, Begoña; Gutiérrez, Carolina; Norman, Francesca F; López-Vélez, Rogelio; Pérez-Molina, José A
2016-12-01
Symptomatic chronic Chagas disease affects up to 40% of patients infected with Trypanosoma cruzi. The lack of reliable early markers of cure after therapy hinders disease management and clinical trials with new drugs. We performed a study with 18 months of follow-up to compare changes in immune parameters and T. cruzi-specific immune responses as surrogate markers of response to therapy between patients treated with benznidazole and untreated patients. This was a pilot, open-label, randomised clinical trial of treatment with benznidazole versus no treatment in patients with indeterminate chronic T. cruzi infection. In both groups we investigated changes in T-cell activation, T-cell subpopulations, regulatory T-cell counts, IL6, and sCD14 levels, and T. cruzi-specific immune responses (Th1, Th2, and Th17 responses). Fourteen patients were included in the study (seven in each group). Median age was 35 years (P 25-75 31-43), 57% were female, and 93% were Bolivian. Benznidazole was administered at 5mg/kg/day for 60days. Three patients discontinued benznidazole owing to adverse reactions and were not evaluated. At the end of the follow-up period, treated patients showed significantly less immune activation and lower regulatory T-cell counts, with an increased Th17 and Th1 response. This randomised pilot clinical trial administering benznidazole to patients with indeterminate chronic Chagas disease brings about changes in the adaptive immunity, leading to a general decrease in inflammatory status. This apparently beneficial response could act as the basis for monitoring new antiparasitic drugs. Copyright © 2016 Elsevier B.V. All rights reserved.
Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra
2016-06-01
Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.
An Evolutionarily Conserved Innate Immunity Protein Interaction Network*
De Arras, Lesly; Seng, Amara; Lackford, Brad; Keikhaee, Mohammad R.; Bowerman, Bruce; Freedman, Jonathan H.; Schwartz, David A.; Alper, Scott
2013-01-01
The innate immune response plays a critical role in fighting infection; however, innate immunity also can affect the pathogenesis of a variety of diseases, including sepsis, asthma, cancer, and atherosclerosis. To identify novel regulators of innate immunity, we performed comparative genomics RNA interference screens in the nematode Caenorhabditis elegans and mouse macrophages. These screens have uncovered many candidate regulators of the response to lipopolysaccharide (LPS), several of which interact physically in multiple species to form an innate immunity protein interaction network. This protein interaction network contains several proteins in the canonical LPS-responsive TLR4 pathway as well as many novel interacting proteins. Using RNAi and overexpression studies, we show that almost every gene in this network can modulate the innate immune response in mouse cell lines. We validate the importance of this network in innate immunity regulation in vivo using available mutants in C. elegans and mice. PMID:23209288
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381
Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection
2000-01-01
iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT
How might infant and paediatric immune responses influence malaria vaccine efficacy?
Moormann, A M
2009-09-01
Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.
Plant innate immunity – sunny side up?
Stael, Simon; Kmiecik, Przemyslaw; Willems, Patrick; Van Der Kelen, Katrien; Coll, Nuria S.; Teige, Markus; Van Breusegem, Frank
2016-01-01
Reactive oxygen species (ROS)- and calcium- dependent signaling pathways play well-established roles during plant innate immunity. Chloroplasts host major biosynthetic pathways and have central roles in energy production, redox homeostasis, and retrograde signaling. However, the organelle’s importance in immunity has been somehow overlooked. Recent findings suggest that the chloroplast also has an unanticipated function as a hub for ROS- and calcium-signaling that affects immunity responses at an early stage after pathogen attack. In this opinion article, we discuss a chloroplastic calcium-ROS signaling branch of plant innate immunity. We propose that this chloroplastic branch acts as a light-dependent rheostat that, through the production of ROS, influences the severity of the immune response. PMID:25457110
Acquired immunity to amyloodiniosis is associated with an antibody response.
Cobb, C S; Levy, M G; Noga, E J
1998-10-08
The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.
Immunosuppressive activity of tilmicosin on the immune responses in mice.
Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming
2011-06-01
Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.
Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.
Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host
Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response
Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.
2013-01-01
Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Tailoring the Immune Response via Customization of Pathogen Gene Expression
Runco, Lisa M.; Stauft, Charles B.
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769
Ecosystem and immune systems: Hierarchial response provides resilience against invasions
Allen, Craig R.
2001-01-01
Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.
pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.
Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori
2017-11-04
(1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.
Reuben, C; Sundaram, K; Phondke, G P
1979-01-01
The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994
Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.
Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A
2013-04-01
A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.
Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S
2014-01-01
The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157
Palmer, Clovis; Hampartzoumian, Taline; Lloyd, Andrew; Zekry, Amany
2008-08-01
Adipose tissue releases pro-inflammatory and anti-inflammatory mediators, including adiponectin, which elicit a broad range of metabolic and immunological effects. The study aim was to determine in subjects infected with chronic hepatitis C virus (HCV) the effects of total adiponectin and its high-molecular-weight (HMW) and low-molecular-weight isoforms on HCV-specific immune responses. Serum levels of total adiponectin and its isoforms were determined by immunoassay. The ex vivo effect of adiponectin on the HCV-specific T-cell response was examined by interferon gamma (IFN-gamma) enzyme-linked immunosorbent spot and enzyme-linked immunosorbent assay cytokine assays. The role of the mitogen-activated protein kinase (MAPK) signaling pathway in mediating the adiponectin effect on T cells was also evaluated. We found that serum levels of total and HMW adiponectin were significantly decreased in subjects with chronic HCV and increased body mass index (BMI) compared with HCV-infected lean subjects. The presence of an anti-HCV specific immune response was strongly associated with lower BMI (P = 0.004) and higher serum total (P = 0.01) and HMW (P = 0.02) adiponectin. In ex vivo assays, total adiponectin and the HMW adiponectin isoform enhanced HCV-specific IFN-gamma production (P = 0.02 and 0.03, respectively). Adiponectin-R1 receptors were expressed on T cells and monocytes. In depletion experiments, the IFN-gamma response to adiponectin was entirely dependent on the simultaneous presence of both CD4 and CD8 T cells, and to a lesser extent, natural killer cells. Selective inhibition of p38MAPK activity by SB203580 abrogated the IFN-gamma response to adiponectin, whereas extracellular signal-regulated kinase 1/2 inhibition by PD98059 did not affect the response. In chronic HCV, a reciprocal association exists between BMI, adiponectin, and the anti-HCV immune responses, emphasizing the important role played by adiposity in regulating the immune response in HCV infection.
Trowbridge, Amy M; Bowers, M Deane; Monson, Russell K
2016-12-01
Changes in the chemical composition of plant defense compounds during herbivory can impact herbivore resource allocation patterns and thereby herbivore survival, growth, and immune response against endoparasitoid infection. Few studies have investigated folivore responses to changes in plant chemistry that occur under outbreak conditions in mature conifer systems. Using data from an earlier observational field study, we carried out laboratory bioassays to test how variation in monoterpenes in piñon pine trees (Pinus edulis, Pinaceae) during an outbreak affects growth, consumption, and immune response of a specialist herbivore, the Southwestern tiger moth (Lophocampa ingens, Arctiidae). Larvae were fed on artificial diets containing four monoterpenes at concentrations that mimicked those observed in undamaged and herbivore-damaged trees in situ during an outbreak. Damaged trees contained 30% lower total monoterpene concentrations, likely reflecting volatile losses as observed in a previous field study Trowbridge et al. (Ecology 95:1591-1603, Trowbridge et al. 2014). Herbivores reared on diets mimicking terpene concentrations in the needles of damaged trees exhibited an approximately 60% increase in consumption relative to larvae reared on diets characteristic of trees without herbivore damage. Higher consumption was accompanied by a 40% increase in immune response with no change in growth rate. These observations suggest preferential resource allocation towards immunity and/or a strong genetic component that determines growth under these conditions. These outcomes, which favor the herbivore, point to: (i) a potential positive feedback mechanism that may increase L. ingens's chance of escaping parasitism during the early phases of an outbreak; and (ii) the important role of monoterpenes in mediating conifer-folivore interactions specifically for P. edulis, which has suffered large-scale drought-induced mortality events exacerbated by the presence of insects.
NASA Astrophysics Data System (ADS)
Aguilera, Eduardo; Amat, Juan A.
2007-11-01
Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.
Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy
2017-01-01
Objective To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. Design We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis (Pg), Fusobacterium nucleatum and Prevotella intermedia. The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Results Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. Conclusions We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. PMID:26838600
Interference of Aspergillus fumigatus with the immune response.
Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A
2015-03-01
Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.
Zhang, Jie; Liu, Huan; Wei, Bin
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*
Zhang, Jie; Liu, Huan; Wei, Bin
2017-01-01
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566
Walsh, Catherine J; Butawan, Matthew; Yordy, Jennifer; Ball, Ray; Flewelling, Leanne; de Wit, Martine; Bonde, Robert K
2015-04-01
The health of many Florida manatees (Trichechus manatus latirostris) is adversely affected by exposure to blooms of the toxic dinoflagellate, Karenia brevis. K. brevis blooms are common in manatee habitats of Florida's southwestern coast and produce a group of cyclic polyether toxins collectively referred to as red tide toxins, or brevetoxins. Although a large number of manatees exposed to significant levels of red tide toxins die, several manatees are rescued from sublethal exposure and are successfully treated and returned to the wild. Sublethal brevetoxin exposure may potentially impact the manatee immune system. Lymphocyte proliferative responses and a suite of immune function parameters in the plasma were used to evaluate effects of brevetoxin exposure on health of manatees rescued from natural exposure to red tide toxins in their habitat. Blood samples were collected from rescued manatees at Lowry Park Zoo in Tampa, FL and from healthy, unexposed manatees in Crystal River, FL. Peripheral blood leukocytes (PBL) isolated from whole blood were stimulated with T-cell mitogens, ConA and PHA. A suite of plasma parameters, including plasma protein electrophoresis profiles, lysozyme activity, superoxide dismutase (SOD) activity, and reactive oxygen/nitrogen (ROS/RNS) species, was also used to assess manatee health. Significant decreases (p<0.05) in lymphocyte proliferation were observed in ConA and PHA stimulated lymphocytes from rescued animals compared to non-exposed animals. Significant correlations were observed between oxidative stress markers (SOD, ROS/RNS) and plasma brevetoxin concentrations. Sublethal exposure to brevetoxins in the wild impacts some immune function components, and thus, overall health, in the Florida manatee. Copyright © 2015 Elsevier B.V. All rights reserved.
Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes
Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen
2014-01-01
Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463
Antimicrobial autophagy: a conserved innate immune response in Drosophila.
Moy, Ryan H; Cherry, Sara
2013-01-01
Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.
Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses
Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.
2011-01-01
The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979
Immunity to fish rhabdoviruses
Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.
2012-01-01
Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non-virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.
Immunity to fish rhabdoviruses.
Purcell, Maureen K; Laing, Kerry J; Winton, James R
2012-01-01
Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non‑virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.
USDA-ARS?s Scientific Manuscript database
Fermentable oligosaccharides, particularly those found in soybean meal (SBM), may modulate fermentation in the ceca, thus affecting intestinal immune responses to intestinal pathogens. We hypothesized that fermentable oligosaccharides found in SBM would positively impact cecal fermentation and inte...
Simi, S; Peter, Valsa S; Peter, M C Subhash
2017-09-15
Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
Responses of innate immune cells to group A Streptococcus
Fieber, Christina; Kovarik, Pavel
2014-01-01
Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020
Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li
2013-02-18
The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C
2011-10-01
A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease
NASA Astrophysics Data System (ADS)
Sun, Jun; Deem, Michael
2006-03-01
The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.
Biondo, Patricia D; Robbins, Sarah J; Walsh, Jennifer D; McCargar, Linda J; Harber, Vicki J; Field, Catherine J
2008-10-01
Ginseng is a popular herbal remedy that is reputed to increase resistance to stress and improve immune function. Regular exercise results in acute physiologic stress that affects the immune response. This study was conducted to investigate the effects of daily consumption of a standardized ginsenoside-containing North American ginseng (Panax quinquefolius) extract on immune function before, during, and after a moderate-exercise protocol in healthy sedentary men. Ten healthy males were randomized to receive either ginseng (1125 mg.d-1) or placebo for 35 days. After a 3 month washout period, subjects received the opposite treatment for another 35 days. An exercise test and blood collection were performed at the end of each treatment period. Immune parameters and blood hormone levels were measured before, during, and after the exercise stress protocol. Ginseng treatment reduced the peripheral blood concentration of CD8+ T cells and increased mitogen-stimulated T cell production of interleukin-2 ex vivo. Ginseng had no effect on total white blood cell counts; on concentrations of neutrophils, monocytes, or lymphocytes (CD3+, CD4+, CD16+, CD20+); on lymphocyte proliferation; or on neutrophil oxidative burst. Ginseng did not significantly affect exercise-induced changes in plasma concentrations of lactate, insulin, cortisol, or growth hormone. The consumption of ginseng for 5 weeks had a limited effect on the immune response to an acute exercise protocol.
The nature of immune responses to urinary tract infections
Abraham, Soman N.; Miao, Yuxuan
2016-01-01
The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331
The immune system in space and microgravity
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
2002-01-01
Space flight and models that created conditions similar to those that occur during space flight have been shown to affect a variety of immunological responses. These have primarily been cell-mediated immune responses including leukocyte proliferation, cytokine production, and leukocyte subset distribution. The mechanisms and biomedical consequences of these changes remain to be established. Among the possible causes of space flight-induced alterations in immune responses are exposure to microgravity, exposure to stress, exposure to radiation, and many more as yet undetermined causes. This review chronicles the known effects of space flight on the immune system and explores the possible role of stress in contributing to these changes.
RNA Editing, ADAR1, and the Innate Immune Response.
Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy
2017-01-18
RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.
Ubiquitination in the antiviral immune response.
Davis, Meredith E; Gack, Michaela U
2015-05-01
Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.
Chalmers, Lynn; Taylor, John F; Roy, William; Preston, Andrew C; Migaud, Herve; Adams, Alexandra
2017-08-01
Few studies have focussed on the health and immunity of triploid Atlantic salmon and therefore much is still unknown about their response to commercially significant pathogens. This is important if triploid stocks are to be considered for full-scale commercial production. This study aimed to investigate and compare the response of triploid and diploid Atlantic salmon to an experimental challenge with Neoparamoeba perurans, causative agent of amoebic gill disease (AGD). This disease is economically significant for the aquaculture industry. The results indicated that ploidy had no significant effect on gross gill score or gill filaments affected, while infection and time had significant effects. Ploidy, infection and time did not affect complement or anti-protease activities. Ploidy had a significant effect on lysozyme activity at 21 days post-infection (while infection and time did not), although activity was within the ranges previously recorded for salmonids. Stock did not significantly affect any of the parameters measured. Based on the study results, it can be suggested that ploidy does not affect the manifestation or severity of AGD pathology or the serum innate immune response. Additionally, the serum immune response of diploid and triploid Atlantic salmon may not be significantly affected by amoebic gill disease.
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.
Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura
2011-10-13
Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Immune responses of poultry to Newcastle disease virus.
Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J
2013-11-01
Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be
Plant immunity: unravelling the complexity of plant responses to biotic stresses.
Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne
2017-03-01
Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Schindler, Tobias; Kagina, Benjamin M.; Zhang, Jitao David; Lukindo, Tedson; Mpina, Maxmillian; Bang, Peter; Kromann, Ingrid; Hoff, Søren T.; Andersen, Peter; Reither, Klaus; Churchyard, Gavin J.; Certa, Ulrich
2015-01-01
Tuberculosis (TB) remains a global health problem, with vaccination being a necessary strategy for disease containment and elimination. A TB vaccine should be safe and immunogenic as well as efficacious in all affected populations, including HIV-infected individuals. We investigated the induction and maintenance of vaccine-induced memory CD4+ T cells following vaccination with the subunit vaccine H1/IC31. H1/IC31 was inoculated twice on study days 0 and 56 among HIV-infected adults with CD4+ lymphocyte counts of >350 cells/mm3. Whole venous blood stimulation was conducted with the H1 protein, and memory CD4+ T cells were analyzed using intracellular cytokine staining and polychromatic flow cytometry. We identified high responders, intermediate responders, and nonresponders based on detection of interleukin-2 (IL-2), tumor necrosis factor alpha (TNF-α), and gamma interferon (IFN-γ) expressing central (TCM) and effector memory CD4+ T cells (TEM) 182 days after the first immunization. Amplicon-based transcript quantification using next-generation sequencing was performed to identify differentially expressed genes that correlated with vaccine-induced immune responses. Genes implicated in resolution of inflammation discriminated the responders from the nonresponders 3 days after the first inoculation. The volunteers with higher expression levels of genes involved in antiviral innate immunity at baseline showed impaired H1-specific TCM and TEM maintenance 6 months after vaccination. Our study showed that in HIV-infected volunteers, expression levels of genes involved in the antiviral innate immune response affected long-term maintenance of H1/IC31 vaccine-induced cellular immunity. (The clinical trial was registered in the Pan African Clinical Trials Registry [PACTR] with the identifier PACTR201105000289276.) PMID:25924764
Integrated approach reveals diet, APOE genotype and sex affect immune response in APP mice.
Nam, Kyong Nyon; Wolfe, Cody M; Fitz, Nicholas F; Letronne, Florent; Castranio, Emilie L; Mounier, Anais; Schug, Jonathan; Lefterov, Iliya; Koldamova, Radosveta
2018-01-01
Alzheimer's disease (AD) is a multifactorial neurodegenerative disorder that is influenced by genetic and environmental risk factors, such as inheritance of ε4 allele of APOE (APOE4), sex and diet. Here, we examined the effect of high fat diet (HFD) on amyloid pathology and expression profile in brains of AD model mice expressing human APOE isoforms (APP/E3 and APP/E4 mice). APP/E3 and APP/E4 mice were fed HFD or Normal diet for 3months. We found that HFD significantly increased amyloid plaques in male and female APP/E4, but not in APP/E3 mice. To identify differentially expressed genes and gene-networks correlated to diet, APOE isoform and sex, we performed RNA sequencing and applied Weighted Gene Co-expression Network Analysis. We determined that the immune response network with major hubs Tyrobp/DAP12, Csf1r, Tlr2, C1qc and Laptm5 correlated significantly and positively to the phenotype of female APP/E4-HFD mice. Correspondingly, we found that in female APP/E4-HFD mice, microglia coverage around plaques, particularly of larger size, was significantly reduced. This suggests altered containment of the plaque growth and sex-dependent vulnerability in response to diet. The results of our study show concurrent impact of diet, APOE isoform and sex on the brain transcriptome and AD-like phenotype. Copyright © 2017 Elsevier B.V. All rights reserved.
Host Immune Status and Response to Hepatitis E Virus Infection
Krain, Lisa J.; Nelson, Kenrad E.
2014-01-01
SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-01-01
BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-12-01
Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.
Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4
Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna
2017-01-01
Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are
mTOR at the Transmitting and Receiving Ends in Tumor Immunity
Guri, Yakir; Nordmann, Thierry M.; Roszik, Jason
2018-01-01
Cancer is a complex disease and a leading cause of death worldwide. Immunity is critical for cancer control. Cancer cells exhibit high mutational rates and therefore altered self or neo-antigens, eliciting an immune response to promote tumor eradication. Failure to mount a proper immune response leads to cancer progression. mTOR signaling controls cellular metabolism, immune cell differentiation, and effector function. Deregulated mTOR signaling in cancer cells modulates the tumor microenvironment, thereby affecting tumor immunity and possibly promoting carcinogenesis. PMID:29662490
mTOR at the Transmitting and Receiving Ends in Tumor Immunity.
Guri, Yakir; Nordmann, Thierry M; Roszik, Jason
2018-01-01
Cancer is a complex disease and a leading cause of death worldwide. Immunity is critical for cancer control. Cancer cells exhibit high mutational rates and therefore altered self or neo-antigens, eliciting an immune response to promote tumor eradication. Failure to mount a proper immune response leads to cancer progression. mTOR signaling controls cellular metabolism, immune cell differentiation, and effector function. Deregulated mTOR signaling in cancer cells modulates the tumor microenvironment, thereby affecting tumor immunity and possibly promoting carcinogenesis.
Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D
2002-06-21
NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.
Seidavi, Alireza; Dadashbeiki, Mohammad; Alimohammadi-Saraei, Mohammad-Hossein; van den Hoven, René; Payan-Carreira, Rita; Laudadio, Vito; Tufarelli, Vincenzo
2017-02-01
The current study was conducted to analyse the effect of a mixture of probiotic cultures and enzymes (Probio Enzyme, XVET GmbH, Germany) on the immune response and weight of central lymphoid organs and liver in broilers. A total of 270 male chickens were randomly divided into nine groups, with three replicates of 10 birds each. Treatment groups were fed for either 22 or 42 days with different levels of Probio Enzyme 250, 500, 750 and 1000 g/ton, whereas the control group fed a basal diet without Probio Enzyme. To analyse the effects of dietary supplementation on broilers humoral immune response, the antibodies titres for avian influenza (AI) and Newcastle disease virus (NDV) and to the sheep red blood cells (SRBC) challenge were assayed in birds from each experimental unit, along with the assessment of the weight of the main lymphoid organs and liver. The addition of the Probio Enzyme mixture did not significantly affect the titres of the antibodies against AI and NDV at day 42, despite the wide individual variation observed specially on the antibody titres at day 33. Treatments affected the production of IgG after the second challenge with SRBC (P = 0.003), which was transposed to the correspondent total Ig titres (P = 0.044). Conversely, a lower birds' body weight (BW) was found in the majority of treated groups compared to control (P = 0.031). The spleen was the only lymphoid organ showing differences in the absolute and relative weight (P = 0.003 and P = 0.001, respectively). No differences were found in thymus and Bursa of Fabricius weights. In conclusion, broilers treated with Probio Enzyme showed a satisfactory immune response compared with control, despite the wide variation found after the first vaccine challenge against AI. Moreover, the probiotic mixture dose and duration modulated differently the immune response and the spleen weight, unaffecting the central lymphoid organs weight.
Einstein, Mark H
2008-04-01
Human papillomavirus (HPV) is a common infection among women and a necessary cause of cervical cancer. Oncogenic HPV types infecting the anogenital tract have the potential to induce natural immunity, but at present we do not clearly understand the natural history of infection in humans and the mechanisms by which the virus can evade the host immune response. Natural acquired immune responses against HPV may be involved in the clearance of infection, but persistent infection with oncogenic virus types leads to the development of precancerous lesions and cancer. B cell responses are important for viral neutralization, but antibody responses in patients with cervical cancer are poor. Prophylactic vaccines targeting oncogenic virus types associated with cervical cancer have the potential to prevent up to 80% of cervical cancers by targeting HPV types 16 and 18. Clinical data show that prophylactic vaccines are effective in inducing antibody responses and in preventing persistent infection with HPV, as well as the subsequent development of high-grade cervical intraepithelial neoplasia. This article reviews the known data regarding natural immune responses to HPV and those developed by prophylactic vaccination.
2014-01-01
Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively
Dissecting innate immune responses with the tools of systems biology.
Smith, Kelly D; Bolouri, Hamid
2005-02-01
Systems biology strives to derive accurate predictive descriptions of complex systems such as innate immunity. The innate immune system is essential for host defense, yet the resulting inflammatory response must be tightly regulated. Current understanding indicates that this system is controlled by complex regulatory networks, which maintain homoeostasis while accurately distinguishing pathogenic infections from harmless exposures. Recent studies have used high throughput technologies and computational techniques that presage predictive models and will be the foundation of a systems level understanding of innate immunity.
Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.
Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T
2013-11-01
Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response
Buckley, Katherine M.; Rast, Jonathan P.
2017-01-01
The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism. PMID:29109720
Kowalczyk, Aleksandra; Doener, Fatma; Zanzinger, Kai; Noth, Janine; Baumhof, Patrick; Fotin-Mleczek, Mariola; Heidenreich, Regina
2016-07-19
mRNA represents a new platform for the development of therapeutic and prophylactic vaccines with high flexibility with respect to production and application. We have previously shown that our two component self-adjuvanted mRNA-based vaccines (termed RNActive® vaccines) induce balanced immune responses comprising both humoral and cellular effector as well as memory responses. Here, we evaluated the early events upon intradermal application to gain more detailed insights into the underlying mode of action of our mRNA-based vaccine. We showed that the vaccine is taken up in the skin by both non-leukocytic and leukocytic cells, the latter being mostly represented by antigen presenting cells (APCs). mRNA was then transported to the draining lymph nodes (dLNs) by migratory dendritic cells. Moreover, the encoded protein was expressed and efficiently presented by APCs within the dLNs as shown by T cell proliferation and immune cell activation, followed by the induction of the adaptive immunity. Importantly, the immunostimulation was limited to the injection site and lymphoid organs as no proinflammatory cytokines were detected in the sera of the immunized mice indicating a favorable safety profile of the mRNA-based vaccines. Notably, a substantial boostability of the immune responses was observed, indicating that mRNA can be used effectively in repetitive immunization schedules. The evaluation of the immunostimulation following prime and boost vaccination revealed no signs of exhaustion as demonstrated by comparable levels of cytokine production at the injection site and immune cell activation within dLNs. In summary, our data provide mechanistic insight into the mode of action and a rational for the use of mRNA-based vaccines as a promising immunization platform. Copyright © 2016 Elsevier Ltd. All rights reserved.
The ecology of immune state in a wild mammal, Mus musculus domesticus.
Abolins, Stephen; Lazarou, Luke; Weldon, Laura; Hughes, Louise; King, Elizabeth C; Drescher, Paul; Pocock, Michael J O; Hafalla, Julius C R; Riley, Eleanor M; Viney, Mark
2018-04-01
The immune state of wild animals is largely unknown. Knowing this and what affects it is important in understanding how infection and disease affects wild animals. The immune state of wild animals is also important in understanding the biology of their pathogens, which is directly relevant to explaining pathogen spillover among species, including to humans. The paucity of knowledge about wild animals' immune state is in stark contrast to our exquisitely detailed understanding of the immunobiology of laboratory animals. Making an immune response is costly, and many factors (such as age, sex, infection status, and body condition) have individually been shown to constrain or promote immune responses. But, whether or not these factors affect immune responses and immune state in wild animals, their relative importance, and how they interact (or do not) are unknown. Here, we have investigated the immune ecology of wild house mice-the same species as the laboratory mouse-as an example of a wild mammal, characterising their adaptive humoral, adaptive cellular, and innate immune state. Firstly, we show how immune variation is structured among mouse populations, finding that there can be extensive immune discordance among neighbouring populations. Secondly, we identify the principal factors that underlie the immunological differences among mice, showing that body condition promotes and age constrains individuals' immune state, while factors such as microparasite infection and season are comparatively unimportant. By applying a multifactorial analysis to an immune system-wide analysis, our results bring a new and unified understanding of the immunobiology of a wild mammal.
Kim, Ju Hyeon; Min, Jee Sun; Kang, Jae Soon; Kwon, Deok Ho; Yoon, Kyong Sup; Strycharz, Joseph; Koh, Young Ho; Pittendrigh, Barry Robert; Clark, J Marshall; Lee, Si Hyeock
2011-05-01
The differences in the immune response between body lice, Pediculus humanus humanus, and head lice, Pediculus humanus capitis, were investigated initially by measuring the proliferation rates of two model bacteria, a Gram-positive Staphylococcus aureus and a Gram-negative Escherichia coli, following challenge by injection. Body lice showed a significantly reduced immune response compared to head lice particularly to E. coli at the early stage of the immune challenge. Annotation of the body louse genome identified substantially fewer immune-related genes compared with other insects. Nevertheless, all required genetic components of the major immune pathways, except for the immune deficiency (Imd) pathway, are still retained in the body louse genome. Transcriptional profiling of representative genes involved in the humoral immune response, following bacterial challenge, revealed that both body and head lice, regardless of their developmental stages, exhibited an increased immune response to S. aureus but little to E. coli. Head lice, however, exhibited a significantly higher phagocytotic activity against E. coli than body lice, whereas the phagocytosis against S. aureus differed only slightly between body and head lice. These findings suggest that the greater immune response in head lice against E. coli is largely due to enhanced phagocytosis and not due to differences in the humoral immune response. The reduced phagocytotic activity in body lice could be responsible, in part, for their increased vector competence. Copyright © 2011 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Zhihong; China Institute of Veterinary Drug Control, Beijing 100081; Zhang, Quan
Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-Emore » on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.« less
Defective B cell response to T-dependent immunization in lupus-prone mice
Niu, Haitao; Sobel, Eric S.; Morel, Laurence
2009-01-01
Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209
Neutrophil Apoptosis: Relevance to the Innate Immune Response and Inflammatory Disease
Fox, Sarah; Leitch, Andrew E.; Duffin, Rodger; Haslett, Christopher; Rossi, Adriano G.
2010-01-01
Neutrophils are the most abundant cell type involved in the innate immune response. They are rapidly recruited to sites of injury or infection where they engulf and kill invading microorganisms. Neutrophil apoptosis, the process of programmed cell death that prevents the release of neutrophil histotoxic contents, is tightly regulated and limits the destructive capacity of neutrophil products to surrounding tissue. The subsequent recognition and phagocytosis of apoptotic cells by phagocytic cells such as macrophages is central to the successful resolution of an inflammatory response and it is increasingly apparent that the dying neutrophil itself exerts an anti-inflammatory effect through modulation of surrounding cell responses, particularly macrophage inflammatory cytokine release. Apoptosis may be delayed, induced or enhanced by micro-organisms dependent on their immune evasion strategies and the health of the host they encounter. There is now an established field of research aimed at understanding the regulation of apoptosis and its potential as a target for therapeutic intervention in inflammatory and infective diseases. This review focuses on the physiological regulation of neutrophil apoptosis with respect to the innate immune system and highlights recent advances in mechanistic understanding of apoptotic pathways and their therapeutic manipulation in appropriate and excessive innate immune responses. PMID:20375550
Myeloid IKKβ Promotes Antitumor Immunity by Modulating CCL11 and the Innate Immune Response
Yang, Jinming; Hawkins, Oriana E.; Barham, Whitney; Gilchuk, Pavlo; Boothby, Mark; Ayers, Gregory D.; Joyce, Sebastian; Karin, Michael; Yull, Fiona E.; Richmond, Ann
2015-01-01
Myeloid cells are capable of promoting or eradicating tumor cells and the nodal functions that contribute to their different roles are still obscure. Here, we show that mice with myeloid-specific genetic loss of the NF-κB pathway regulatory kinase IKKβ exhibit more rapid growth of cutaneous and lung melanoma tumors. In a BRAFV600E/PTEN−/− allograft model, IKKβ loss in macrophages reduced recruitment of myeloid cells into the tumor, lowered expression of MHC class II molecules, and enhanced production of the chemokine CCL11, thereby negatively regulating dendritic-cell maturation. Elevated serum and tissue levels of CCL11 mediated suppression of dendritic-cell differentiation/maturation within the tumor microenvironment, skewing it toward a Th2 immune response and impairing CD8+ T cell–mediated tumor cell lysis. Depleting macrophages or CD8+ T cells in mice with wild-type IKKβ myeloid cells enhanced tumor growth, where the myeloid cell response was used to mediate antitumor immunity against melanoma tumors (with less dependency on a CD8+ T-cell response). In contrast, myeloid cells deficient in IKKβ were compromised in tumor cell lysis, based on their reduced ability to phagocytize and digest tumor cells. Thus, mice with continuous IKKβ signaling in myeloid-lineage cells (IKKβCA) exhibited enhanced antitumor immunity and reduced melanoma outgrowth. Collectively, our results illuminate new mechanisms through which NF-κB signaling in myeloid cells promotes innate tumor surveillance. PMID:25336190
Immune response varies with rate of dispersal in invasive cane toads (Rhinella marina).
Brown, Gregory P; Shine, Richard
2014-01-01
What level of immunocompetence should an animal maintain while undertaking long-distance dispersal? Immune function (surveillance and response) might be down-regulated during prolonged physical exertion due to energy depletion, and/or to avoid autoimmune reactions arising from damaged tissue. On the other hand, heightened immune vigilance might be favored if the organism encounters novel pathogens as it enters novel environments. We assessed the links between immune defense and long-distance movement in a population of invasive cane toads (Rhinella marina) in Australia. Toads were radio-tracked for seven days to measure their activity levels and were then captured and subjected to a suite of immune assays. Toads that moved further showed decreased bacteria-killing ability in their plasma and decreased phagocytic activity in their whole blood, but a heightened skin-swelling response to phytohemagglutinin. Baseline and post-stress corticosterone levels were unrelated to distance moved. Thus, long-distance movement in cane toads is associated with a dampened response in some systems and enhanced response in another. This pattern suggests that sustained activity is accompanied by trade-offs among immune components rather than an overall down or up-regulation. The finding that high mobility is accompanied by modification of the immune system has important implications for animal invasions.
Lane, Sarah M; Briffa, Mark
2018-02-20
The ability to mitigate the costs of engaging in a fight will depend on an individual's physiological state. However, the experience of fighting itself may, in turn, affect an individual's state, especially if the fight results in injury. Previous studies have found a correlation between immune state and fighting success, but the causal direction of this relationship remains unclear. Does immune state determine fighting success? Or does fighting itself influence subsequent immune state? Using the beadlet anemone, Actinia equina , we disentangled the cause and effect of this relationship, measuring immune response once pre-fight and twice post-fight. Contrary to previous findings, pre-fight immune response did not predict fighting success, but rather predicted whether an individual used its weapons during the fight. Furthermore, weapon use and contest outcome significantly affected post-fight immune response. Individuals that used their weapons maintained a stable immune response following the fight, whereas those that fought non-injuriously did not. Furthermore, although winners suffered a reduction in immune response similar to that of losers immediately post-fight, winners began to recover pre-fight levels within 24 h. Our findings indicate that immune state can influence strategic fighting decisions and, moreover, that fight outcome and the agonistic behaviours expressed can significantly affect subsequent immunity. © 2018. Published by The Company of Biologists Ltd.
Roy, Anirban; Bauer, Stephen M; Lawrence, B Paige
2012-01-01
Bisphenol A (BPA) is used in numerous products, such as plastic bottles and food containers, from which it frequently leaches out and is consumed by humans. There is a growing public concern that BPA exposure may pose a significant threat to human health. Moreover, due to the widespread and constant nature of BPA exposure, not only adults but fetuses and neonates are also exposed to BPA. There is mounting evidence that developmental exposures to chemicals from our environment, including BPA, contribute to diseases late in life; yet, studies of how early life exposures specifically alter the immune system are limited. Herein we report an examination of how maternal exposure to a low, environmentally relevant dose of BPA affects the immune response to infection with influenza A virus. We exposed female mice during pregnancy and through lactation to the oral reference dose for BPA listed by the US Environmental Protection Agency, and comprehensively examined immune parameters directly linked to disease outcomes in adult offspring following infection with influenza A virus. We found that developmental exposure to BPA did not compromise disease-specific adaptive immunity against virus infection, or reduce the host's ability to clear the virus from the infected lung. However, maternal exposure to BPA transiently reduced the extent of infection-associated pulmonary inflammation and anti-viral gene expression in lung tissue. From these observations, we conclude that maternal exposure to BPA slightly modulates innate immunity in adult offspring, but does not impair the anti-viral adaptive immune response, which is critical for virus clearance and survival following influenza virus infection.
T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.
Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua
2018-05-09
B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.
Modulation of Specific and Allergy-Related Immune Responses by Helminths
Daniłowicz-Luebert, Emilia; O'Regan, Noëlle L.; Steinfelder, Svenja; Hartmann, Susanne
2011-01-01
Helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective Th2-type responses and favour long-term persistence. Such evasion mechanisms ensure mutual survival of both the parasite and the host. In this paper, we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection. We discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation. We also examine recent findings on helminth-derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti-inflammatory therapeutics. PMID:22219659
Tetranychus urticae mites do not mount an induced immune response against bacteria
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E.; Zélé, Flore; Riga, Maria; Leitão, Alexandre B.; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara
2017-01-01
The genome of the spider mite Tetranychus urticae, a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae, infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila. Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei, a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae. This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei. We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum. Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. PMID:28592670
Tetranychus urticae mites do not mount an induced immune response against bacteria.
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio
2017-06-14
The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.
Thompson, D L; Honey, P G
1984-07-01
Prepubertal Quarter horse colts were immunized at 6 mo of age with either estrone-17-oxime-bovine serum albumin (n = 4; treated) or with albumin only (n = 5; controls). All colts received booster injections of the appropriate antigen at 8, 10, 12, 16 and 20 mo of age. Blood samples were drawn every 20 d from 6 to 26 mo of age; body weights were determined monthly. Immunization against estrone-albumin resulted in increased binding of [3H]-estradiol in serum within 40 d that was maintained through 24 mo of age. Antisera from treated colts crossreacted equally well with estrone and estradiol and moderately with other estrogens; androgens, progesterone and glucocorticoids all cross-reacted less than .005%. Body weights were not affected by treatment. Concentrations of testosterone were generally higher (P less than .05) in estrogen-immunized colts compared with controls after immunization. Concentrations of luteinizing hormone were not affected by treatment, whereas concentrations of follicle-stimulating hormone were initially increased (P less than .05) in treated colts after immunization. At castration at 27 mo of age, estrogen-immunized colts had greater (P less than .05) testicular and parenchymal weights and produced more (P approximately equal to .055) spermatozoa per horse than did control colts. Seminal characteristics immediately before castration were not affected by treatment. It appears that estrogens are involved in the regulation of several reproductive traits in the colt. Moreover, active immunization against estrogen in the prepubertal colt may be a useful method of increasing testicular size and sperm production rates in the stallion after puberty.
Genomics of immune response to typhoid and cholera vaccines
Majumder, Partha P.
2015-01-01
Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways. PMID:25964454
Pye, Ruth; Patchett, Amanda; McLennan, Elspeth; Thomson, Russell; Carver, Scott; Fox, Samantha; Pemberton, David; Kreiss, Alexandre; Baz Morelli, Adriana; Silva, Anabel; Pearse, Martin J.; Corcoran, Lynn M.; Belov, Katherine; Hogg, Carolyn J.; Woods, Gregory M; Lyons, A. Bruce
2018-01-01
Devil facial tumor disease (DFTD) is renowned for its successful evasion of the host immune system. Down regulation of the major histocompatabilty complex class I molecule (MHC-I) on the DFTD cells is a primary mechanism of immune escape. Immunization trials on captive Tasmanian devils have previously demonstrated that an immune response against DFTD can be induced, and that immune-mediated tumor regression can occur. However, these trials were limited by their small sample sizes. Here, we describe the results of two DFTD immunization trials on cohorts of devils prior to their wild release as part of the Tasmanian Government’s Wild Devil Recovery project. 95% of the devils developed anti-DFTD antibody responses. Given the relatively large sample sizes of the trials (N = 19 and N = 33), these responses are likely to reflect those of the general devil population. DFTD cells manipulated to express MHC-I were used as the antigenic basis of the immunizations in both trials. Although the adjuvant composition and number of immunizations differed between trials, similar anti-DFTD antibody levels were obtained. The first trial comprised DFTD cells and the adjuvant combination of ISCOMATRIX™, polyIC, and CpG with up to four immunizations given at monthly intervals. This compared to the second trial whereby two immunizations comprising DFTD cells and the adjuvant combination ISCOMATRIX™, polyICLC (Hiltonol®) and imiquimod were given a month apart, providing a shorter and, therefore, more practical protocol. Both trials incorporated a booster immunization given up to 5 months after the primary course. A key finding was that devils in the second trial responded more quickly and maintained their antibody levels for longer compared to devils in the first trial. The different adjuvant combination incorporating the RNAase resistant polyICLC and imiquimod used in the second trial is likely to be responsible. The seroconversion in the majority of devils in these anti
Immune response during space flight.
Criswell-Hudak, B S
1991-01-01
The health status of an astronaut prior to and following space flight has been a prime concern of NASA throughout the Apollo series of lunar landings, Skylab, Apollo-Soyuz Test Projects (ASTP), and the new Spacelab-Shuttle missions. Both humoral and cellular immunity has been studied using classical clinical procedures. Serum proteins show fluctuations that can be explained with adaptation to flight. Conversely, cellular immune responses of lymphocytes appear to be depressed in both in vivo as well as in vitro. If this depression in vivo and in vitro is a result of the same cause, then man's adaptation to outer space living will present interesting challenges in the future. Since the cause may be due to reduced gravity, perhaps the designs of the experiments for space flight will offer insights at the cellular levels that will facilitate development of mechanisms for adaptation. Further, if the aging process is viewed as an adaptational concept or model and not as a disease process then perhaps space flight could very easily interact to supply some information on our biological time clocks.
Adaptive Immune Responses following Senecavirus A Infection in Pigs.
Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G
2018-02-01
Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease
Immune response and immunologic memory in medical personnel vaccinated with hepatitis B vaccine.
Kevorkyan, Ani K; Teoharov, Pavel B; Petrova, Nedyalka S; Baltadzhiev, Ivan G; Stoilova, Yordanka D; Angelova, Nevena G; Plachkova, Angelina D
2011-01-01
The occupation-related nature of Hepatitis B viral infection in medical personnel has been well documented in a lot of studies. The only reliable way of prevention of this infection is immunisation with hepatitis B vaccine. To follow-up the primary immune response after immunisation with recombinant vaccine and its duration in adult immunocompetent subjects. One hundred sixty-five health-care workers working at St. George University Hospital, Plovdiv in 2009/2010 were included in the study and allocated to two groups. Group 1 (N1 = 70) was followed up for the primary immune response after immunization; group 2 (N2 = 95) was with documented immunization in 1998/1999 (n = 81) and in 1994/1995 (n = 14). Tests based on ELISA for quantitative determination of anti-HBs in mIU/ml were used. The measurement were performed at the National Reference Laboratory of Viral Hepatitis at the NCIPD, Sofia. Descriptive statistics, non-parametric and parametric tests, qualitative correlation were used to analyse data. Group 1 mean age was 40.3 +/- 2.6 years; anti-HBs concentration of > or = 10 mIU/ ml was found in 92.8%. No association between the immune response and the commonly involved factors such as gender, age, overweight, smoking, etc., was found. In group 2, anti-HBs concentration of > or = 10 mIU/ml was found in 77.9%: it was in 75.3% in those immunized 10 years before, and in 92.9% in those immunized 15 years before (t = 0.24, p > 0.05). A booster dose of the vaccine was received by 15/21 subjects from group 2 (those immunized 10 years before that) with anti-HBs < 10 mIU/ml. After the booster, 9/15 produced anti-HBs in protective concentrations (anamnestic immune response). The actual level of seroprotection among the immunized more than 10 years ago was 92%. This study and the documentation of the primary postvaccinal immunity in high-risk medical personnel will help specify if additional hepatitis B vaccine shots are needed.
Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A
2004-12-01
The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid
Nitzan, S; Shwartsburd, B; Heller, E D
2004-02-01
Photobacterium damselae subsp. piscicida (P. damselae) was grown on various media and the effect of media salinity on certain immune responses of hybrid bass was studied. In Israel, pasteurellosis outbreaks have not been reported at water salinities below 1.38 per thousand. During vaccination experiments the salinity of the medium on which P. damselae is grown, was shown to affect stimulation of the immune system. No correlation was found between antibody response and protection. Bacterial envelopes separated by electrophoresis and subjected to western blot analysis revealed an antibody response against some protein bands. Band sequencing was performed to identify the protein stimulating the immune response. Sequence identity of 80% was seen in 10-amino-acid overlap of the 36-kDa band with a specific gene of alkalophilic Bacillus firmus. A preparation of P. damselae grown in a 2.5% NaCl medium at 25 degrees C is the most effective vaccine against pasteurellosis, providing hybrid bass with quite good protection.
Valdés-Tovar, Marcela; Escobar, Carolina; Solís-Chagoyán, Héctor; Asai, Miguel; Benítez-King, Gloria
2015-03-01
The light-dark cycle is an environmental factor that influences immune physiology, and so, variations of the photoperiod length result in altered immune responsivity. Macrophage physiology comprises a spectrum of functions that goes from host defense to immune down-regulation, in addition to their homeostatic activities. Macrophages also play a key role in the transition from innate to adaptive immune responses. Met-enkephalin (MEnk) has been recognized as a modulator of macrophage physiology acting in an autocrine or paracrine fashion to influence macrophage activation, phenotype polarization and production of cytokines that would enhance lymphocyte activation at early stages of an immune response. Previously it was shown that splenic MEnk tissue content is reduced in rats exposed to constant light. In this work, we explored whether production of Met-enkephalin-containing peptides (MECPs) in cultured splenic macrophages is affected by exposure of rats to a constant light regime. In addition, we explored whether primary immune response was impaired under this condition. We found that in rats, 15 days in constant light was sufficient to disrupt their general activity rhythm. Splenic MEnk content oscillations and levels were also blunted throughout a 24-h period in animals subjected to constant light. In agreement, de novo synthesis of MECPs evaluated through incorporation of (35)S-methionine was reduced in splenic macrophages from rats exposed to constant light. Moreover, MECPs immunocytochemistry showed a decrease in the intracellular content and lack of granule-like deposits in this condition. Furthermore, we found that primary T-dependent antibody response was compromised in rats exposed to constant light. In those animals, pharmacologic treatment with MEnk increased IFN-γ-secreting cells. Also, IL-2 secretion from antigen-stimulated splenocytes was reduced after incubation with naloxone, suggesting that immune-derived opioid peptides and stimulation of opioid
Genes of innate immunity and the biological response to inhaled ozone
Li, Zhuowei; Tighe, Robert M.; Feng, Feifei; Ledford, Julie G.; Hollingsworth, John W.
2013-01-01
Ambient ozone has a significant impact on human health. We have made considerable progress in understanding the fundamental mechanisms that regulate the biological response to ozone. It is increasingly clear that genes of innate immunity play a central role in both infectious and non-infectious lung disease. The biological response to ambient ozone provides a clinically relevant environmental exposure that allows us to better understand the role of innate immunity in non-infectious airways disease. In this brief review, we focus on: (1) specific cell types in the lung modified by ozone; (2) ozone and oxidative stress; (3) the relationship between genes of innate immunity and ozone; (4) the role of extracellular matrix in reactive airways disease; and (5) the effect of ozone on the adaptive immune system. We summarize recent advances in understanding the mechanisms that ozone contributes to environmental airways disease. PMID:23169704
The immune response against Candida spp. and Sporothrix schenckii.
Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M
2014-01-01
Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel
2017-10-27
For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27
Shirkey, B L; Slavin, S; Vistica, B P; Podgor, M J; Gery, I
1997-06-01
Linomide (LS-2616, quinoline-3-carboxamide) has been reported to exert a diverse range of effects on the immune system. On one hand, this drug was found to stimulate the immune system and to enhance activities such as DTH or allograft rejection. On the other hand, linomide was shown to inhibit the induction of experimental autoimmune encephalomyelitis and myasthenia gravis, as well as the development of diabetes in non-obese diabetic (NOD) mice. Here we report the effects of linomide in animals immunized with uveitogenic retinal antigens. Treatment with linomide completely inhibited the development of experimental autoimmune uveoretinitis (EAU) in mice immunized with interphotoreceptor retinoid-binding protein and markedly suppressed EAU in rats immunized with S-antigen (S-Ag). In addition, linomide-treated rats exhibited reduced antibody production and lymphocyte proliferative response to S-Ag. In contrast to these suppressive activities, linomide treatment did not affect the development of adoptively transferred EAU in rats and moderately enhanced the DTH reactions to S-Ag in immunized rats in which EAU and other immune responses to this antigen were suppressed.
Pathogenesis of graft-versus-host disease: innate immunity amplifying acute alloimmune responses.
Maeda, Yoshinobu
2013-09-01
In addition to reduced-intensity conditioning, which has expanded the eligibility for hematopoietic cell transplantation (HCT) to older patients, increased availability of alternative donors, including HLA-mismatched unrelated donors, has increased access to allogeneic HCT for more patients. However, acute graft-versus-host disease (GVHD) remains a lethal complication, even in HLA-matched donor-recipient pairs. The pathophysiology of GVHD depends on aspects of adaptive immunity and interactions between donor T-cells and host dendritic cells (DCs). Recent work has revealed that the role of other immune cells and endothelial cells and components of the innate immune response are also important. Tissue damage caused by the conditioning regimen leads to the release of exogenous and endogenous "danger signals". Exogenous danger signals called pathogen-associated molecular patterns and endogenous noninfectious molecules known as damage-associated molecular patterns (DAMPs) are responsible for initiating or amplifying acute GVHD by enhancing DC maturation and alloreactive T-cell responses. A significant association of innate immune receptor polymorphisms with outcomes, including GVHD severity, was observed in patients receiving allogeneic HCT. Understanding of the role of innate immunity in acute GVHD might offer new therapeutic approaches.
Walsh, Kevin B; Teijaro, John R; Zuniga, Elina I; Welch, Megan J; Fremgen, Daniel M; Blackburn, Shawn D; von Tiehl, Karl F; Wherry, E John; Flavell, Richard A; Oldstone, Michael B A
2012-06-14
TLR7 is an innate signaling receptor that recognizes single-stranded viral RNA and is activated by viruses that cause persistent infections. We show that TLR7 signaling dictates either clearance or establishment of life-long chronic infection by lymphocytic choriomeningitis virus (LCMV) Cl 13 but does not affect clearance of the acute LCMV Armstrong 53b strain. TLR7(-/-) mice infected with LCMV Cl 13 remained viremic throughout life from defects in the adaptive antiviral immune response-notably, diminished T cell function, exacerbated T cell exhaustion, decreased plasma cell maturation, and negligible antiviral antibody production. Adoptive transfer of TLR7(+/+) LCMV immune memory cells that enhanced clearance of persistent LCMV Cl 13 infection in TLR7(+/+) mice failed to purge LCMV Cl 13 infection in TLR7(-/-) mice, demonstrating that a TLR7-deficient environment renders antiviral responses ineffective. Therefore, methods that promote TLR7 signaling are promising treatment strategies for chronic viral infections. Copyright © 2012 Elsevier Inc. All rights reserved.
Gorantala, Jyotsna; Grover, Sonam; Rahi, Amit; Chaudhary, Prerna; Rajwanshi, Ravi; Sarin, Neera Bhalla; Bhatnagar, Rakesh
2014-04-20
In concern with frequent recurrence of anthrax in endemic areas and inadvertent use of its spores as biological weapon, the development of an effective anthrax vaccine suitable for both human and veterinary needs is highly desirable. A simple oral delivery through expression in plant system could offer promising alternative to the current methods that rely on injectable vaccines extracted from bacterial sources. In the present study, we have expressed protective antigen (PA) gene in Indian mustard by Agrobacterium-mediated transformation and in tobacco by plastid transformation. Putative transgenic lines were verified for the presence of transgene and its expression by molecular analysis. PA expressed in transgenic lines was biologically active as evidenced by macrophage lysis assay. Intraperitoneal (i.p.) and oral immunization with plant PA in murine model indicated high serum PA specific IgG and IgA antibody titers. PA specific mucosal immune response was noted in orally immunized groups. Further, antibodies indicated lethal toxin neutralizing potential in-vitro and conferred protection against in-vivo toxin challenge. Oral immunization experiments demonstrated generation of immunoprotective response in mice. Thus, our study examines the feasibility of oral PA vaccine expressed in an edible plant system against anthrax. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
Ch Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P
2016-10-01
The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates.
Friends and foes of tuberculosis: modulation of protective immunity.
Brighenti, Susanna; Joosten, Simone A
2018-05-27
Protective immunity in tuberculosis (TB) is subject of debate in the TB research community, as this is key to fully understand TB pathogenesis and to develop new promising tools for TB diagnosis and prognosis as well as a more efficient TB vaccine. IFN-γ producing CD4 + T cells are key in TB control, but may not be sufficient to provide protection. Additional subsets have been identified that contribute to protection such as multifunctional and cytolytic T cell subsets, including classical and non-classical T cells as well as novel innate immune cell subsets resulting from trained immunity. However, to define protective immune responses against TB, the complexity of balancing TB immunity also has to be considered. In this review, insights in effector cell immunity and how this is modulated by regulatory cells, associated comorbidities and the host microbiome is discussed. We systematically map how different suppressive immune cell subsets may affect effector cell responses at the local site of infection. We also dissect how common co-morbidities such as HIV, helminthes and diabetes may bias protective TB immunity towards pathogenic and regulatory responses. Finally, also the composition and diversity of the microbiome in the lung and gut could affect host TB immunity. Understanding these various aspects of the immunological balance in the human host is fundamental to prevent TB infection and disease. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Berg, Michael G; Adams, Robert J; Gambhira, Ratish; Siracusa, Mark C; Scott, Alan L; Roden, Richard B S; Ketner, Gary
2014-09-01
Immunization with human papillomavirus (HPV) L1 virus-like particles (VLPs) prevents infection with HPV. However, the expense and logistical demands of current VLP vaccines will limit their widespread use in resource-limited settings, where most HPV-induced cervical cancer occurs. Live oral adenovirus vaccines have properties that are well-suited for use in such settings. We have described a live recombinant adenovirus vaccine prototype that produces abundant HPV16 L1 protein from the adenovirus major late transcriptional unit and directs the assembly of HPV16 VLPs in tissue culture. Recombinant-derived VLPs potently elicit neutralizing antibodies in mice. Here, we characterize the immune response to the recombinant after dual oral and intranasal immunization of pigtail macaques, in which the virus replicates as it would in immunized humans. The immunization of macaques induced vigorous humoral responses to adenovirus capsid and nonstructural proteins, although, surprisingly, not against HPV L1. In contrast, immunization elicited strong T-cell responses to HPV VLPs as well as adenovirus virions. T-cell responses arose immediately after the primary immunization and were boosted by a second immunization with recombinant virus. T-cell immunity contributes to protection against a wide variety of pathogens, including many viruses. The induction of a strong cellular response by the recombinant indicates that live adenovirus recombinants have potential as vaccines for those agents. These studies encourage and will inform the continued development of viable recombinant adenovirus vaccines. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Immune activation alters cellular and humoral responses to yellow fever 17D vaccine.
Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S; Rowe, Dawne K; Smith, Michaela J; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie; Gaucher, Denis
2014-07-01
Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. We showed that YF-17D-induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D-neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Registration is not required for observational studies. This study was funded by Canada's Global Health Research Initiative, Defense Threat Reduction Agency, National Institute of Allergy and Infectious Diseases
Immune activation alters cellular and humoral responses to yellow fever 17D vaccine
Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S.; Rowe, Dawne K.; Smith, Michaela J.; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H.; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K.; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie
2014-01-01
Background. Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. Methods. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. Results. We showed that YF-17D–induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D–neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Conclusion. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Trial registration. Registration is not required for observational studies. Funding. This study was funded by Canada’s Global Health Research Initiative, Defense
Neonatal immune challenge does not affect body weight regulation in rats.
Spencer, Sarah J; Mouihate, Abdeslam; Galic, Michael A; Ellis, Shaun L; Pittman, Quentin J
2007-08-01
The perinatal environment plays a crucial role in programming many aspects of adult physiology. Myriad stressors during pregnancy, from maternal immune challenge to nutritional deficiency, can alter long-term body weight set points of the offspring. In light of the increasing concern over body weight issues, such as obesity and anorexia, in modern societies and accumulating evidence that developmental stressors have long-lasting effects on other aspects of physiology (e.g., fever, pain), we explored the role of immune system activation during neonatal development and its impact on body weight regulation in adulthood. Here we present a thorough evaluation of the effects of immune system activation (LPS, 100 microg/kg ip) at postnatal days 3, 7, or 14 on long-term body weight, adiposity, and body weight regulation after a further LPS injection (50 microg/kg ip) or fasting and basal and LPS-induced circulating levels of the appetite-regulating proinflammatory cytokine leptin. We show that neonatal exposure to LPS at various times during the neonatal period has no long-term effects on growth, body weight, or adiposity. We also observed no effects on body weight regulation in response to a short fasting period or a further exposure to LPS. Despite reductions in circulating leptin levels in response to LPS during the neonatal period, no long-term effects on leptin were seen. These results convincingly demonstrate that adult body weight and weight regulation are, unlike many other aspects of adult physiology, resistant to programming by a febrile-dose neonatal immune challenge.
Innate and adaptive immune responses to cell death
Rock, Kenneth L.; Lai, Jiann-Jyh; Kono, Hajime
2011-01-01
Summary The immune system plays an essential role in protecting the host against infections and to accomplish this task has evolved mechanisms to recognize microbes and destroy them. In addition, it monitors the health of cells and responds to ones that have been injured and die, even if this occurs under sterile conditions. This process is initiated when dying cells expose intracellular molecules that can be recognized by cells of the innate immune system. As a consequence of this recognition, dendritic cells are activated in ways that help to promote T-cell responses to antigens associated with the dying cells. In addition, macrophages are stimulated to produce the cytokine interleukin-1 that then acts on radioresistant parenchymal cells in the host in ways that drive a robust inflammatory response. In addition to dead cells, a number of other sterile particles and altered physiological states can similarly stimulate an inflammatory response and do so through common pathways involving the inflammasome and interleukin-1. These pathways underlie the pathogenesis of a number of diseases. PMID:21884177
Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection
Duan, Susu; Thomas, Paul G.
2016-01-01
Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022
Genetics of immune recognition and response in Drosophila host defense.
Ligoxygakis, Petros
2013-01-01
Due to the evolutionary conservation of innate immune mechanisms, Drosophila has been extensively used as a model for the dissection in genetic terms of innate host immunity to infection. Genetic screening in fruit flies has set the stage for the pathways and systems required for responding to immune challenge and the dynamics of the progression of bacterial and fungal infection. In addition, fruit flies have been used as infection models to dissect host-pathogen interactions from both sides of this equation. This chapter describes our current understanding of the genetics of the fruit fly immune response and summarizes the most important findings in this area during the past decade. © 2013 Elsevier Inc. All rights reserved.
Bombeiro, André L.; Santini, Júlio C.; Thomé, Rodolfo; Ferreira, Elisângela R. L.; Nunes, Sérgio L. O.; Moreira, Bárbara M.; Bonet, Ivan J. M.; Sartori, Cesar R.; Verinaud, Liana; Oliveira, Alexandre L. R.
2016-01-01
Injuries to peripheral nerves cause loss of motor and sensory function, greatly affecting life quality. Successful repair of the lesioned nerve requires efficient cell debris removal, followed by axon regeneration and reinnervation of target organs. Such process is orchestrated by several cellular and molecular events in which glial and immune cells actively participate. It is known that tissue clearance is largely improved by macrophages, which activation is potentiated by cells and molecules of the acquired immune system, such as T helper lymphocytes and antibodies, respectively. In the present work, we evaluated the contribution of lymphocytes in the regenerative process of crushed sciatic nerves of immunocompetent (wild-type, WT) and T and B-deficient (RAG-KO) mice. In Knockout animals, we found increased amount of macrophages under basal conditions and during the initial phase of the regenerative process, that was evaluated at 2, 4, and 8 weeks after lesion (wal). That parallels with faster axonal regeneration evidenced by the quantification of neurofilament and a growth associated protein immunolabeling. The motor function, evaluated by the sciatic function index, was fully recovered in both mouse strains within 4 wal, either in a progressive fashion, as observed for RAG-KO mice, or presenting a subtle regression, as seen in WT mice between 2 and 3 wal. Interestingly, boosting the immune response by early adoptive transference of activated WT lymphocytes at 3 days after lesion improved motor recovery in WT and RAG-KO mice, which was not ameliorated when cells were transferred at 2 wal. When monitoring lymphocytes by in vivo imaging, in both mouse strains, cells migrated to the lesion site shortly after transference, remaining in the injured limb up to its complete motor recovery. Moreover, a first peak of hyperalgesia, determined by von-Frey test, was coincident with increased lymphocyte infiltration in the damaged paw. Overall, the present results suggest
Pomorska-Mól, Małgorzata; Czyżewska-Dors, Ewelina; Kwit, Krzysztof; Rachubik, Jarosław; Lipowski, Andrzej; Pejsak, Zygmunt
2015-06-01
The effect of treatment with enrofloxacin was studied on the postvaccinal immune response in pigs. Forty pigs were used (control not vaccinated (C), control vaccinated (CV), vaccinated, received enrofloxacin (ENRO)). From day -1 to day 3 pigs from ENRO group received enrofloxacin at the recommended dose. Pigs from ENRO and CV groups were vaccinated twice against Aujeszky's disease virus (ADV). There was a significant delay in the production of humoral response of enrofloxacin dosed pigs when compared with CV group. Moreover, in ENRO group the significant decrease in IFN-γ production and significantly lower values of stimulation index after ADV restimulation was noted, as compared with CV group. The secretion of IL-6, IL-10 and TNF-α by PBMC after recall stimulation was also affected in ENRO group. The results indicate that enrofloxacin, in addition to its antimicrobial properties, possess significant immunomodulatory effects and may alter the immune response to vaccines. Copyright © 2015 Elsevier Ltd. All rights reserved.
GENETIC CONTROL OF THE IMMUNE RESPONSE
Lonai, Peter; McDevitt, Hugh O.
1974-01-01
In vitro antigen-induced tritiated thymidine uptake has been used to study the response of sensitized lymphocytes to (T,G)-A--L, (H,G)-A--L, and (Phe,G)-A--L in responder and nonresponder strains of mice. The reaction is T-cell and macrophage dependent. Highly purified T cells (91% Thy 1.2 positive) are also responsive, suggesting that this in vitro lymphocyte transformation system is not B-cell dependent. Lymphocytes from high and low responder mice stimulated in vitro react as responders and nonresponders in a pattern identical to that seen with in vivo immunization. Stimulation occurs only if soluble antigen is added at physiological temperatures; antigen exposure at 4°C followed by washing and incubation at 37°C fails to induce lymphocyte transformation. Stimulation is specific for the immunizing antigen and does not exhibit the serologic cross-reactivity which is characteristic of these three antigens and their respective antisera. The reaction can be inhibited by anti-H-2 sera but not by anti-immunoglobulin sera. The anti-immunoglobulin sera did, however, inhibit lipopolysaccharide or pokeweed mitogen stimulation. These results suggest that the Ir-1A gene(s) are expressed in T cells, and that there are fundamental physiologic differences between T- and B-cell antigen recognition. PMID:4547782
Gopalraj, Jeyanthi B P; Clarke, Francoise C; Donkin, Edward F
2013-01-01
Changes in serum gamma globulin levels, numbers of replete female ticks and engorged tick mass were used as parameters to monitor the acquired immune response (antibody mediated immune response) elicited by Rhipicephalus appendiculatus adult tick infestations. Three consecutive Rhipicephalus appendiculatus adult tick infestations were applied to South African Indigenous goats (Nguni), Saanen goats and cross-bred goats (Saanen goats crossed with South African Indigenous goats [Nguni]) under laboratory conditions. During the three consecutive Rhipicephalus appendiculatus adult tick infestations the serum gamma globulin levels increased in all three breeds, whilst the mean replete female tick numbers and engorged tick mass decreased. Even though all three goat breeds exhibited an acquired immune response, the South African Indigenous goats (Nguni) response was significantly higher than that of the Saanen and cross-bred goats. However, the acquired immune response elicited by Saanen goats was significantly lower when compared with cross-bred goats.
Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis.
Gao, Bo; Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-Hua; Xue, Dongbo
2017-01-01
Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including "immune response" as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma.
Behavioural fever is a synergic signal amplifying the innate immune response.
Boltaña, Sebastian; Rey, Sonia; Roher, Nerea; Vargas, Reynaldo; Huerta, Mario; Huntingford, Felicity Anne; Goetz, Frederick William; Moore, Janice; Garcia-Valtanen, Pablo; Estepa, Amparo; Mackenzie, S
2013-09-07
Behavioural fever, defined as an acute change in thermal preference driven by pathogen recognition, has been reported in a variety of invertebrates and ectothermic vertebrates. It has been suggested, but so far not confirmed, that such changes in thermal regime favour the immune response and thus promote survival. Here, we show that zebrafish display behavioural fever that acts to promote extensive and highly specific temperature-dependent changes in the brain transcriptome. The observed coupling of the immune response to fever acts at the gene-environment level to promote a robust, highly specific time-dependent anti-viral response that, under viral infection, increases survival. Fish that are not offered a choice of temperatures and that therefore cannot express behavioural fever show decreased survival under viral challenge. This phenomenon provides an underlying explanation for the varied functional responses observed during systemic fever. Given the effects of behavioural fever on survival and the fact that it exists across considerable phylogenetic space, such immunity-environment interactions are likely to be under strong positive selection.
Jung, Bock-Gie; Lee, Jin-A; Lee, Bong-Joo
2012-12-01
It has been considered that drinking oxygenated water improves oxygen availability, which may increase vitality and improve immune functions. The present study evaluated the effects of oxygenated drinking water on immune function in pigs. Continuous drinking of oxygenated water markedly increased peripheral blood mononuclear cell proliferation, interleukin-1β expression level and the CD4(+):CD8(+) cell ratio in pigs. During Salmonella Typhimurium infection, total leukocytes and relative cytokines expression levels were significantly increased in pigs consuming oxygenated water compared with pigs consuming tap water. These findings suggest that oxygenated drinking water enhances immune activity in pigs and increases immune responses of pigs during S. Typhimurium Infection.
Spore load and immune response of honey bees naturally infected by Nosema ceranae.
Li, Wenfeng; Evans, Jay D; Li, Jianghong; Su, Songkun; Hamilton, Michele; Chen, Yanping
2017-12-01
Nosema ceranae causes widespread infection in adult workers of European honey bees, Apis mellifera, and has often been linked to honey bee colony losses worldwide. Previous investigations of honey bee immune response to N. ceranae infection were largely based on laboratory experiment, however, little is known about the immune response of honey bees that are naturally infected by N. ceranae. Here, we compared the infection levels of N. ceranae in three different categories of adult bees (emergent bees, nurses, and foragers) and detected the host immune response to the N. ceranae infection under natural conditions. Our studies showed that the Nosema spore load and infection prevalence varied among the different types of adult workers, and both of them increased as honey bees aged: No infection was detected in emergent bees, nurses had a medium spore load and prevalence, while foragers were with the highest Nosema infection level and prevalence. Quantification of the mRNA levels of antimicrobial peptides (abaecin, apidaecin, defensin-1, defensin-2, and hymenoptaecin) and microbial recognition proteins (PGRP-S1, PGRP-S2, PGRP-S3, PGRP-LC, GNBP1-1, and GNBP1-2) confirmed the involvement of the Toll and/or Imd immune pathways in the host response to N. ceranae infection, and revealed an activation of host immune response by N. ceranae infection under natural conditions. Additionally, the levels of immune response were positively correlated with the Nosema spore loads in the infected bees. The information gained from this study will be relevant to the predictive modeling of honey bee disease dynamics for Nosema disease prevention and management.
Nowak, Barbara; Valdenegro-Vega, Victoria; Crosbie, Philip; Bridle, Andrew
2014-04-01
Amoebic infections in fish are most likely underestimated and sometimes overlooked due to the challenges associated with their diagnosis. Amoebic diseases reported in fish affect either gills or internal organs or may be systemic. Host response ranges from hyperplastic response in gill infections to inflammation (including granuloma formation) in internal organs. This review focuses on the immune response of Atlantic salmon to Neoparamoeba perurans, the causative agent of Amoebic Gill Disease (AGD). Copyright © 2013 Elsevier Ltd. All rights reserved.
Seasonal changes in the relationship between ornamentation and immune response in red jungle fowl
Zuk, M.; Johnsen, T. S.
1998-01-01
Resistance to disease is frequently suggested to be important in mate choice, but information about how immune status can be conveyed is lacking. During the breeding season, male red jungle fowl with large combs, a sexually selected trait, have lower levels of lymphocytes, but greater cell-mediated immunity, indicated by a cutaneous hypersensitivity response. Before the breeding season, however, both cell-mediated immunity and proportion of lymphocytes are positively correlated with comb length. Cell-mediated immunity is particularly important to jungle fowl during the breeding season, because the likelihood of injury during sexual competition is high and cell-mediated immunity is essential for healing wounds and resisting infection. This seasonal change in one aspect of immunity but not another suggests that the birds adaptively maintain certain immune system abilities, and that it can be misleading to use a single aspect of immune response in evaluating immunocompetence.