Science.gov

Sample records for affect transcriptional regulation

  1. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    SciTech Connect

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-04-23

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic {beta}-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  2. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-01

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming.

  3. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-01

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming. PMID:25384038

  4. DNA Methylation Affects the SP1-regulated Transcription of FOXF2 in Breast Cancer Cells.

    PubMed

    Tian, Hong-Pan; Lun, Shu-Min; Huang, Huan-Jing; He, Rui; Kong, Peng-Zhou; Wang, Qing-Shan; Li, Xiao-Qing; Feng, Yu-Mei

    2015-07-31

    FOXF2 (forkhead box F2) is a mesenchyme-specific transcription factor that plays a critical role in tissue homeostasis through the maintenance of epithelial polarity. In a previous study, we demonstrated that FOXF2 is specifically expressed in basal-like breast cancer (BLBC) cells and functions as an epithelial-mesenchymal transition suppressor. FOXF2 deficiency enhances the metastatic ability of BLBC cells through activation of the epithelial-mesenchymal transition program, but reduces cell proliferation. In this study, we demonstrate that CpG island methylation of the FOXF2 proximal promoter region is involved in the regulatory mechanism of the subtype-specific expression of FOXF2 in breast cancer cells. DNMT1, DNMT3A, and DNMT3B commonly or individually contributed to this DNA methylation in different breast cancer cells. SP1 regulated the transcriptional activity of FOXF2 through direct binding to the proximal promoter region, whereas this binding was abrogated through DNA methylation. FOXF2 mediated the SP1-regulated suppression of progression and promotion of proliferation of non-methylated BLBC cells. Thus, we conclude that the subtype-specific expression and function of FOXF2 in breast cancer cells are regulated through the combined effects of DNA methylation and SP1 transcriptional regulation.

  5. Transcriptional regulation differs in affected facioscapulohumeral muscular dystrophy patients compared to asymptomatic related carriers

    PubMed Central

    Arashiro, Patricia; Eisenberg, Iris; Kho, Alvin T.; Cerqueira, Antonia M. P.; Canovas, Marta; Silva, Helga C. A.; Pavanello, Rita C. M.; Verjovski-Almeida, Sergio; Kunkel, Louis M.; Zatz, Mayana

    2009-01-01

    Facioscapulohumeral muscular dystrophy (FSHD) is a progressive muscle disorder that has been associated with a contraction of 3.3-kb repeats on chromosome 4q35. FSHD is characterized by a wide clinical inter- and intrafamilial variability, ranging from wheelchair-bound patients to asymptomatic carriers. Our study is unique in comparing the gene expression profiles from related affected, asymptomatic carrier, and control individuals. Our results suggest that the expression of genes on chromosome 4q is altered in affected and asymptomatic individuals. Remarkably, the changes seen in asymptomatic samples are largely in products of genes encoding several chemokines, whereas the changes seen in affected samples are largely in genes governing the synthesis of GPI-linked proteins and histone acetylation. Besides this, the affected patient and related asymptomatic carrier share the 4qA161 haplotype. Thus, these polymorphisms by themselves do not explain the pathogenicity of the contracted allele. Interestingly, our results also suggest that the miRNAs might mediate the regulatory network in FSHD. Together, our results support the previous evidence that FSHD may be caused by transcriptional dysregulation of multiple genes, in cis and in trans, and suggest some factors potentially important for FSHD pathogenesis. The study of the gene expression profiles from asymptomatic carriers and related affected patients is a unique approach to try to enhance our understanding of the missing link between the contraction in D4Z4 repeats and muscle disease, while minimizing the effects of differences resulting from genetic background. PMID:19339494

  6. Sphingolipids regulate telomere clustering by affecting the transcription of genes involved in telomere homeostasis.

    PubMed

    Ikeda, Atsuko; Muneoka, Tetsuya; Murakami, Suguru; Hirota, Ayaka; Yabuki, Yukari; Karashima, Takefumi; Nakazono, Kota; Tsuruno, Masahiro; Pichler, Harald; Shirahige, Katsuhiko; Kodama, Yukiko; Shimamoto, Toshi; Mizuta, Keiko; Funato, Kouichi

    2015-07-15

    In eukaryotic organisms, including mammals, nematodes and yeasts, the ends of chromosomes, telomeres are clustered at the nuclear periphery. Telomere clustering is assumed to be functionally important because proper organization of chromosomes is necessary for proper genome function and stability. However, the mechanisms and physiological roles of telomere clustering remain poorly understood. In this study, we demonstrate a role for sphingolipids in telomere clustering in the budding yeast Saccharomyces cerevisiae. Because abnormal sphingolipid metabolism causes downregulation of expression levels of genes involved in telomere organization, sphingolipids appear to control telomere clustering at the transcriptional level. In addition, the data presented here provide evidence that telomere clustering is required to protect chromosome ends from DNA-damage checkpoint signaling. As sphingolipids are found in all eukaryotes, we speculate that sphingolipid-based regulation of telomere clustering and the protective role of telomere clusters in maintaining genome stability might be conserved in eukaryotes.

  7. Copy number variants in patients with intellectual disability affect the regulation of ARX transcription factor gene.

    PubMed

    Ishibashi, Minaka; Manning, Elizabeth; Shoubridge, Cheryl; Krecsmarik, Monika; Hawkins, Thomas A; Giacomotto, Jean; Zhao, Ting; Mueller, Thomas; Bader, Patricia I; Cheung, Sau W; Stankiewicz, Pawel; Bain, Nicole L; Hackett, Anna; Reddy, Chilamakuri C S; Mechaly, Alejandro S; Peers, Bernard; Wilson, Stephen W; Lenhard, Boris; Bally-Cuif, Laure; Gecz, Jozef; Becker, Thomas S; Rinkwitz, Silke

    2015-11-01

    Protein-coding mutations in the transcription factor-encoding gene ARX cause various forms of intellectual disability (ID) and epilepsy. In contrast, variations in surrounding non-coding sequences are correlated with milder forms of non-syndromic ID and autism and had suggested the importance of ARX gene regulation in the etiology of these disorders. We compile data on several novel and some already identified patients with or without ID that carry duplications of ARX genomic region and consider likely genetic mechanisms underlying the neurodevelopmental defects. We establish the long-range regulatory domain of ARX and identify its brain region-specific autoregulation. We conclude that neurodevelopmental disturbances in the patients may not simply arise from increased dosage due to ARX duplication. This is further exemplified by a small duplication involving a non-functional ARX copy, but with duplicated enhancers. ARX enhancers are located within a 504-kb region and regulate expression specifically in the forebrain in developing and adult zebrafish. Transgenic enhancer-reporter lines were used as in vivo tools to delineate a brain region-specific negative and positive autoregulation of ARX. We find autorepression of ARX in the telencephalon and autoactivation in the ventral thalamus. Fluorescently labeled brain regions in the transgenic lines facilitated the identification of neuronal outgrowth and pathfinding disturbances in the ventral thalamus and telencephalon that occur when arxa dosage is diminished. In summary, we have established a model for how breakpoints in long-range gene regulation alter the expression levels of a target gene brain region-specifically, and how this can cause subtle neuronal phenotypes relating to the etiology of associated neuropsychiatric disease.

  8. Aspergillus asexual reproduction and sexual reproduction are differentially affected by transcriptional and translational mechanisms regulating stunted gene expression.

    PubMed Central

    Wu, J; Miller, B L

    1997-01-01

    The Stunted protein (StuAp) is a member of a family of transcription factors that regulate fungal development and cell cycle progression. Regulated stuA gene expression is required for correct cell pattern formation during asexual reproduction (conidiation) and for initiation of the sexual reproductive cycle in Aspergillus nidulans. Transcriptional initiation from two different promoters yields overlapping mRNAs (stuA alpha and stuAbeta) that upon translation yield the same protein. Here we show that multiple regulatory mechanisms interact to control (i) developmental competence-dependent expression of both transcripts and (ii) induction-dependent expression of stuA alpha, but not stuAbeta, by the conidiation-specific Bristle (BrlAp) transcriptional activator. Quantitative levels of both mRNAs are further modulated by (i) an activator(s) located at a far-upstream upstream activation sequence, (ii) feedback regulation by StuAp, and (iii) positive translational regulation that requires the peptide product of a micro-open reading frame unique to the stuA alpha mRNA 5' untranslated region. Gradients in stuA alpha expression were most important for correct cell and tissue type development. Threshold requirements were as follows: metula-phialide differentiation < ascosporogenesis < cleistothecial shell-Hülle cell differentiation. Altered stuA expression affected conidiophore morphology and conidial yields quantitatively but did not alter the temporal development of cell types or conidiophore density. By contrast, the sexual cycle showed both temporal delay and quantitative reduction in the number of cleistothecial initials but normal morphogenesis of tissue types. PMID:9315680

  9. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement

    PubMed Central

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-01-01

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K+ (K+in) channels and reduced K+in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K+in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K+in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  10. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement.

    PubMed

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-Ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-04-12

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K(+) (K(+) in) channels and reduced K(+) in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K(+) in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K(+) in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  11. Transcriptional Regulation of Hepatic Lipogenesis

    PubMed Central

    Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook

    2016-01-01

    Fatty acid and fat synthesis in liver is a highly regulated metabolic pathway critical for energy distribution. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcription level. Transcription factors, such as USF, SREBP-1c, LXR and ChREBP play critical roles in this process. Recently, insights have been gained into how various signaling pathways regulate these transcription factors. After feeding, high blood glucose and insulin induce lipogenic genes through several pathways, including DNA-PK, aPKC and Akt-mTOR. Various transcription factors and coregulators undergo specific modifications, such as phosphorylation, acetylation, or ubiquitination, which affect their function, stability, or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance. PMID:26490400

  12. Phosphorylation Affects DNA-Binding of the Senescence-Regulating bZIP Transcription Factor GBF1

    PubMed Central

    Smykowski, Anja; Fischer, Stefan M.; Zentgraf, Ulrike

    2015-01-01

    Massive changes in the transcriptome of Arabidopsis thaliana during onset and progression of leaf senescence imply a central role for transcription factors. While many transcription factors are themselves up- or down-regulated during senescence, the bZIP transcription factor G-box-binding factor 1 (GBF1/bZIP41) is constitutively expressed in Arabidopsis leaf tissue but at the same time triggers the onset of leaf senescence, suggesting posttranscriptional mechanisms for senescence-specific GBF1 activation. Here we show that GBF1 is phosphorylated by the threonine/serine CASEIN KINASE II (CKII) in vitro and that CKII phosphorylation had a negative effect on GBF1 DNA-binding to G-boxes of two direct target genes, CATALASE2 and RBSCS1a. Phosphorylation mimicry at three serine positions in the basic region of GBF1 also had a negative effect on DNA-binding. Kinase assays revealed that CKII phosphorylates at least one serine in the basic domain but has additional phosphorylation sites outside this domain. Two different ckII α subunit1 and one α subunit2 T-DNA insertion lines showed no visible senescence phenotype, but in all lines the expression of the senescence marker gene SAG12 was remarkably diminished. A model is presented suggesting that senescence-specific GBF1 activation might be achieved by lowering the phosphorylation of GBF1 by CKII. PMID:27135347

  13. Regulation of transcription of the RNA splicing factor hSlu7 by Elk-1 and Sp1 affects alternative splicing

    PubMed Central

    Alberstein, Moti; Amit, Maayan; Vaknin, Keren; O'Donnell, Amanda; Farhy, Chen; Lerenthal, Yaniv; Shomron, Noam; Shaham, Ohad; Sharrocks, Andrew D.; Ashery-Padan, Ruth; Ast, Gil

    2007-01-01

    Alternative splicing plays a major role in transcriptome diversity and plasticity, but it is largely unknown how tissue-specific and embryogenesis-specific alternative splicing is regulated. The highly conserved splicing factor Slu7 is involved in 3′ splice site selection and also regulates alternative splicing. We show that Slu7 has a unique spatial pattern of expression among human and mouse embryonic and adult tissues. We identified several functional Ets binding sites and GC-boxes in the human Slu7 (hSlu7) promoter region. The Ets and GC-box binding transcription factors, Elk-1 and Sp1, respectively, exerted opposite effects on hSlu7 transcription: Sp1 protein enhances and Elk-1 protein represses transcription in a dose-dependent manner. Sp1 protein bound to the hSlu7 promoter in vivo, and depletion of Sp1 by RNA interference (RNAi) repressed hSlu7 expression. Elk-1 protein bound to the hSlu7 promoter in vivo, and depletion of Elk-1 by RNAi caused an increase in the endogenous level of hSlu7 mRNA. Further, depletion of either Sp1 or Elk-1 affected alternative splicing. Our results provide indications of a complex transcription regulation mechanism that controls the spatial and temporal expression of Slu7, presumably allowing regulation of tissue-specific alternative splicing events. PMID:17804646

  14. MADS-box transcription factor OsMADS25 regulates root development through affection of nitrate accumulation in rice.

    PubMed

    Yu, Chunyan; Liu, Yihua; Zhang, Aidong; Su, Sha; Yan, An; Huang, Linli; Ali, Imran; Liu, Yu; Forde, Brian G; Gan, Yinbo

    2015-01-01

    MADS-box transcription factors are vital regulators participating in plant growth and development process and the functions of most of them are still unknown. ANR1 was reported to play a key role in controlling lateral root development through nitrate signal in Arabidopsis. OsMADS25 is one of five ANR1-like genes in Oryza Sativa and belongs to the ANR1 clade. Here we have investigated the role of OsMADS25 in the plant's responses to external nitrate in Oryza Sativa. Our results showed that OsMADS25 protein was found in the nucleus as well as in the cytoplasm. Over-expression of OsMADS25 significantly promoted lateral and primary root growth as well as shoot growth in a nitrate-dependent manner in Arabidopsis. OsMADS25 overexpression in transgenic rice resulted in significantly increased primary root length, lateral root number, lateral root length and shoot fresh weight in the presence of nitrate. Down-regulation of OsMADS25 in transgenic rice exhibited significantly reduced shoot and root growth in the presence of nitrate. Furthermore, over-expression of OsMADS25 in transgenic rice promoted nitrate accumulation and significantly increased the expressions of nitrate transporter genes at high rates of nitrate supply while down-regulation of OsMADS25 produced the opposite effect. Taken together, our findings suggest that OsMADS25 is a positive regulator control lateral and primary root development in rice.

  15. Centrosomal Protein DZIP1 Regulates Hedgehog Signaling by Promoting Cytoplasmic Retention of Transcription Factor GLI3 and Affecting Ciliogenesis*

    PubMed Central

    Wang, Chengbing; Low, Wee-Chuang; Liu, Aimin; Wang, Baolin

    2013-01-01

    The primary cilium is required for Hedgehog signaling. So far, all known ciliogenic proteins regulate Hedgehog signaling through their role in ciliogenesis. Here we show that the mouse DZIP1 regulates Hedgehog signaling through two mechanisms. First, DZIP1 interacts with GLI3, a transcriptional regulator for Hedgehog signaling, and prevents GLI3 from entering the nucleus. Second, DZIP1 is required for ciliogenesis. We show that DZIP1 colocalizes and interacts with CEP164, a protein localizing at appendages of the mother centrioles, and IFT88, a component of the intraflagellar transport (IFT) machinery. Functionally, both CEP164 and Ninein appendage proteins fail to localize to ciliary appendages in Dzip1 mutant cells; IFT components are not recruited to the basal body of cilia. Importantly, the accumulation of GLI3 in the nucleus is independent of loss of primary cilia in Dzip1 mutant cells. Therefore, DZIP1 is the first known ciliogenic protein that regulates Hedgehog signaling through a dual mechanism and that biochemically links IFT machinery with Hedgehog pathway components. PMID:23955340

  16. Mutations That Affect Transcription and Cyclic Amp-Crp Regulation of the Adenylate Cyclase Gene (Cya) of Salmonella Typhimurium

    PubMed Central

    Fandl, J. P.; Thorner, L. K.; Artz, S. W.

    1990-01-01

    We studied the expression of the cya promoter(s) in cya-lac fusion strains of Salmonella typhimurium and demonstrated cAMP receptor protein (CRP)-dependent repression by cAMP. Expression of cya was reduced about fourfold in cultures grown in acetate minimal medium as compared to cultures grown in glucose-6-phosphate minimal medium. Expression of cya was also reduced about fourfold by addition of 5 mM cAMP to cultures grown in glucose minimal medium. We constructed in vitro deletion and insertion mutations altering a major cya promoter (P2) and a putative CRP binding site overlapping P2. These mutations were recombined into the chromosome by allele replacement with M13mp::cya recombinant phages and the regulation of the mutant promoters was analyzed. A 4-bp deletion of the CRP binding site and a 4-bp insertion in this site nearly eliminated repression by cAMP. A mutant with the P2 promoter and the CRP binding site both deleted exhibited an 80% reduction in cya expression; the 20% residual expression was insensitive to cAMP repression. This mutant retained a Cya(+) phenotype. Taken together, the results establish that the cya gene is transcribed from multiple promoters one of which, P2, is negatively regulated by the cAMP-CRP complex. Correction for the contribution to transcription by the cAMP-CRP nonregulated cya promoters indicates that the P2 promoter is repressed at least eightfold by cAMP-CRP. PMID:2168849

  17. RNA-guided transcriptional regulation

    DOEpatents

    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.

    2016-02-23

    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  18. Transcriptional Mechanisms Regulating Ca2+ Homeostasis

    PubMed Central

    Ritchie, Michael F.; Zhou, Yandong; Soboloff, Jonathan

    2011-01-01

    Ca2+ is a dynamic cellular secondary messenger which mediates a vast array of cellular responses. Control over these processes is achieved via an extensive combination of pumps and channels which regulate the concentration of Ca2+ within not only the cytosol but also all intracellular compartments. Precisely how these pumps and channels are regulated is only partially understood, however, recent investigations have identified members of the Early Growth Response (EGR) family of zinc finger transcription factors as critical players in this process. The roles of several other transcription factors in control of Ca2+ homeostasis have also been demonstrated, including Wilms Tumor Suppressor 1 (WT1), Nuclear Factor of Activated T cells (NFAT) and c-myc. In this review, we will discuss not only how these transcription factors regulate the expression of the major proteins involved in control of Ca2+ homeostasis, but also how this transcriptional remodeling of Ca2+ homeostasis affects Ca2+ dynamics and cellular responses. PMID:21074851

  19. Transcriptional Regulation: a Genomic Overview

    PubMed Central

    Riechmann, José Luis

    2002-01-01

    The availability of the Arabidopsis thaliana genome sequence allows a comprehensive analysis of transcriptional regulation in plants using novel genomic approaches and methodologies. Such a genomic view of transcription first necessitates the compilation of lists of elements. Transcription factors are the most numerous of the different types of proteins involved in transcription in eukaryotes, and the Arabidopsis genome codes for more than 1,500 of them, or approximately 6% of its total number of genes. A genome-wide comparison of transcription factors across the three eukaryotic kingdoms reveals the evolutionary generation of diversity in the components of the regulatory machinery of transcription. However, as illustrated by Arabidopsis, transcription in plants follows similar basic principles and logic to those in animals and fungi. A global view and understanding of transcription at a cellular and organismal level requires the characterization of the Arabidopsis transcriptome and promoterome, as well as of the interactome, the localizome, and the phenome of the proteins involved in transcription. PMID:22303220

  20. Transcriptional regulation of tenascin genes

    PubMed Central

    Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias

    2015-01-01

    Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an “oncofetal” protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

  1. Human I-mfa domain proteins specifically interact with KSHV LANA and affect its regulation of Wnt signaling-dependent transcription

    SciTech Connect

    Kusano, Shuichi; Eizuru, Yoshito

    2010-06-04

    Kaposi's sarcoma-associated herpes virus (KSHV)-encoded latency-associated nuclear antigen (LANA) protein has been reported to interact with glycogen synthase kinase 3{beta} (GSK-3{beta}) and to negatively regulate its activity, leading to stimulation of GSK-3{beta}-dependent {beta}-catenin degradation. We show here that the I-mfa domain proteins, HIC (human I-mfa domain-containing protein) and I-mfa (inhibitor of MyoD family a), interacted in vivo with LANA through their C-terminal I-mfa domains. This interaction affected the intracellular localization of HIC, inhibited the LANA-dependent transactivation of a {beta}-catenin-regulated reporter construct, and decreased the level of the LANA.GSK-3{beta} complex. These data reveal for the first time that I-mfa domain proteins interact with LANA and negatively regulate LANA-mediated activation of Wnt signaling-dependent transcription by inhibiting the formation of the LANA.GSK-3{beta} complex.

  2. Involvement of S100A14 protein in cell invasion by affecting expression and function of matrix metalloproteinase (MMP)-2 via p53-dependent transcriptional regulation.

    PubMed

    Chen, Hongyan; Yuan, Yi; Zhang, Chunpeng; Luo, Aiping; Ding, Fang; Ma, Jianlin; Yang, Shouhui; Tian, Yanyan; Tong, Tong; Zhan, Qimin; Liu, Zhihua

    2012-05-18

    S100 proteins have been implicated in tumorigenesis and metastasis. As a member of S100 proteins, the role of S100A14 in carcinogenesis has not been fully understood. Here, we showed that ectopic overexpression of S100A14 promotes motility and invasiveness of esophageal squamous cell carcinoma cells. We investigated the underlying mechanisms and found that the expression of matrix metalloproteinase (MMP)-2 is obviously increased after S100A14 gene overexpression. Inhibition of MMP2 by a specific MMP2 inhibitor at least partly reversed the invasive phenotype of cells overexpressing S100A14. By serendipity, we found that S100A14 could affect p53 transactivity and stability. Thus, we further investigated whether the effect of MMP2 by S100A14 is dependent on p53. A series of biochemical assays showed that S100A14 requires functional p53 to affect MMP2 transcription, and p53 potently transrepresses the expression of MMP2. Finally, RT-quantitative PCR analysis of human breast cancer specimens showed a significant correlation between S100A14 mRNA expression and MMP2 mRNA expression in cases with wild-type p53 but not in cases with mutant p53. Collectively, our data strongly suggest that S100A14 promotes cell motility and invasiveness by regulating the expression and function of MMP2 in a p53-dependent manner. PMID:22451655

  3. RNA polymerase and the regulation of transcription

    SciTech Connect

    Reznikoff, W.S.; Gross, C.A.; Burgess, R.R.; Record, M.T.; Dahlberg, J.E.; Wickens, M.P.

    1987-01-01

    This book consists of eight sections, each containing several papers. The section titles are: RNA Polymerases; Transcription Initiation - Bacterial; Regulation of Bacterial Transcription Initiation; Stable RNA Synthesis in Eukaryotes: Chromatin Structure; Promoters; Enhancers; and the Global Control of Eukaryotic Transcription; Specific Eukaryotic Transcription Factors; Termination of Transcription; and Short Communications.

  4. Nascent transcription affected by RNA polymerase IV in Zea mays.

    PubMed

    Erhard, Karl F; Talbot, Joy-El R B; Deans, Natalie C; McClish, Allison E; Hollick, Jay B

    2015-04-01

    All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3'-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance.

  5. Nascent Transcription Affected by RNA Polymerase IV in Zea mays

    PubMed Central

    Erhard, Karl F.; Talbot, Joy-El R. B.; Deans, Natalie C.; McClish, Allison E.; Hollick, Jay B.

    2015-01-01

    All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3ʹ-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance. PMID:25653306

  6. Informational requirements for transcriptional regulation.

    PubMed

    O'Neill, Patrick K; Forder, Robert; Erill, Ivan

    2014-05-01

    Transcription factors (TFs) regulate transcription by binding to specific sites in promoter regions. Information theory provides a useful mathematical framework to analyze the binding motifs associated with TFs but imposes several assumptions that limit their applicability to specific regulatory scenarios. Explicit simulations of the co-evolution of TFs and their binding motifs allow the study of the evolution of regulatory networks with a high degree of realism. In this work we analyze the impact of differential regulatory demands on the information content of TF-binding motifs by means of evolutionary simulations. We generalize a predictive index based on information theory, and we validate its applicability to regulatory scenarios in which the TF binds significantly to the genomic background. Our results show a logarithmic dependence of the evolved information content on the occupancy of target sites and indicate that TFs may actively exploit pseudo-sites to modulate their occupancy of target sites. In regulatory networks with differentially regulated targets, we observe that information content in TF-binding motifs is dictated primarily by the fraction of total probability mass that the TF assigns to its target sites, and we provide a predictive index to estimate the amount of information associated with arbitrarily complex regulatory systems. We observe that complex regulatory patterns can exert additional demands on evolved information content, but, given a total occupancy for target sites, we do not find conclusive evidence that this effect is because of the range of required binding affinities. PMID:24689750

  7. Transcriptional Regulation and its Misregulation in Disease

    PubMed Central

    Lee, Tong Ihn; Young, Richard A.

    2013-01-01

    The gene expression programs that establish and maintain specific cell states in humans are controlled by thousands of transcription factors, cofactors and chromatin regulators. Misregulation of these gene expression programs can cause a broad range of diseases. Here we review recent advances in our understanding of transcriptional regulation and discuss how these have provided new insights into transcriptional misregulation in disease. PMID:23498934

  8. Expression pattern of cellulolytic and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1 are affected by carbon source in Trichoderma reesei.

    PubMed

    Castro, Lilian dos Santos; Antoniêto, Amanda Cristina Campos; Pedersoli, Wellington Ramos; Silva-Rocha, Rafael; Persinoti, Gabriela F; Silva, Roberto Nascimento

    2014-03-01

    Trichoderma reesei is the most important fungus for the industrial production of enzymes to biomass deconstruction. Most of the genes encoding cellulases and hemicellulases are regulated by the transcription factors CRE1 and XYR1. In this work, the regulation of 22 genes of cellulases and xylanases by these transcription factors was investigated under three different carbon sources. Analysis of gene expression and enzymatic profiles of CMCase, β-glucosidase, and xylanases showed different regulation that was depended of the carbon source in both Δxyr1 and Δcre1 mutants. In the presence of glucose, the majority of genes evaluated (82%) showed increased expression levels in the Δcre1 mutant compared to the parental QM9414 strain. In the Δxyr1 mutant, it was observed that expression of cellulase and xylanase genes was reduced compared to the parental QM9414 strain, when cultured in the presence of cellulose or sophorose. Interesting, in the presence of glucose, approximately 60% of the analyzed genes had increased expression in the Δxyr1 mutant compared to parental strain. Furthermore, no correlation between gene expression and the number of putative binding sites of XYR1 and CRE1 to promoter region of cellulolytic and xylanolytic studied genes was observed. Therefore, these results demonstrated that the regulation of cellulase and xylanase by the transcription factors CRE1 and XYR1 is influenced by different carbon sources.

  9. Respiratory gases and the regulation of transcription.

    PubMed

    Cummins, Eoin P; Keogh, Ciara E

    2016-08-01

    What is the topic of this review? This review highlights the transcriptional consequences for decreased cellular O2 levels (hypoxia) and increased cellular CO2 levels (hypercapnia). What advances does it highlight? We discuss recent advances in our understanding of the cellular response to hypoxia and consider the potential cross-talk between O2 - and CO2 -dependent transcriptional regulation. Oxygen and carbon dioxide are the substrate and product of aerobic metabolism, respectively. Thus, the levels of these physiological gases are inextricably linked in physiological and pathophysiological conditions. Increased mitochondrial consumption of O2 (to produce ATP) will produce more CO2 . Furthermore, in lung pathologies such as chronic obstructive pulmonary disease, sleep apnoea and central hypoventilation syndrome, hypoxia and hypercapnia are co-incident. Acute responses to hypoxia involve carotid body-mediated changes in the rate and depth of breathing. Chronic adaptation to hypoxia involves a multitude of changes on a transcriptional level, which simultaneously increases oxygen utilization (via hypoxia-inducible factor and others), while suppressing superfluous energy-demanding processes. Acute responses to CO2 affect breathing primarily via central chemoreceptors. The nature of hypercapnia-dependent transcriptional regulation is an emerging area of research, but at present the mechanisms underpinning this response are not fully characterized and understood. Thus, given the juxtaposition of hypoxia and hypercapnia in health and disease, this manuscript reviews the current evidence for transcriptional responses to hypoxia and hypercapnia. Finally, we discuss the potential cross-talk between hypoxia and hypercapnia on a transcriptional level. PMID:27474261

  10. Transcription factor CecR (YbiH) regulates a set of genes affecting the sensitivity of Escherichia coli against cefoperazone and chloramphenicol.

    PubMed

    Yamanaka, Yuki; Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2016-07-01

    Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening was performed for identification of the binding site of YbiH, an as yet uncharacterized TetR-family transcription factor, on the Escherichia coli genome. YbiH was found to be a unique single-target regulator that binds in vitro within the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses indicated one clear binding site of YbiH, including a complete palindromic sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of the ybiH operon and activation of the rhlE operon by YbiH. After phenotype microarray screening, YbiH was indicated to confer resistance to chloramphenicol and cefazoline (a first-generation cephalosporin). A systematic survey of the participation of each of the predicted YbiH-regulated genes in the antibiotic sensitivity indicated involvement of the YbhFSR ABC-type transporter in the sensitivity to cefoperazone (a third-generation cephalosporin) and of the membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken together with the growth test in the presence of these two antibiotics and in vitro transcription assay, it was concluded that the hitherto uncharacterized YbiH regulates transcription of both the bidirectional transcription units, the ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the control of sensitivity to cefoperazone and chloramphenicol. We thus propose to rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity). PMID:27112147

  11. Nickel-responsive transcriptional regulators.

    PubMed

    Musiani, Francesco; Zambelli, Barbara; Bazzani, Micaela; Mazzei, Luca; Ciurli, Stefano

    2015-09-01

    Nickel is an essential micronutrient for a large number of living organisms, but it is also a toxic metal ion when it accumulates beyond the sustainable level as it may result if and when its cellular trafficking is not properly governed. Therefore, the homeostasis and metabolism of nickel is tightly regulated through metal-specific protein networks that respond to the available Ni(II) concentration. These are directed by specific nickel sensors, able to couple Ni(II) binding to a change in their DNA binding affinity and/or specificity, thus translating the cellular level of Ni(II) into a modification of the expression of the proteins devoted to modulating nickel uptake, efflux and cellular utilization. This review describes the Ni(II)-dependent transcriptional regulators discovered so far, focusing on their structural features, metal coordination modes and metal binding thermodynamics. Understanding these properties is essential to comprehend how these sensors correlate nickel availability to metal coordination and functional responses. A broad and comparative study, described here, reveals some general traits that characterize the binding stoichiometry and Ni(II) affinity of these metallo-sensors.

  12. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  13. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits

    PubMed Central

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-01-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. ‘Superficial scald’ of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  14. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  15. Transcriptional Regulation of Heart Development in Zebrafish

    PubMed Central

    Lu, Fei; Langenbacher, Adam D.; Chen, Jau-Nian

    2016-01-01

    Cardiac transcription factors orchestrate the complex cellular and molecular events required to produce a functioning heart. Misregulation of the cardiac transcription program leads to embryonic developmental defects and is associated with human congenital heart diseases. Recent studies have expanded our understanding of the regulation of cardiac gene expression at an additional layer, involving the coordination of epigenetic and transcriptional regulators. In this review, we highlight and discuss discoveries made possible by the genetic and embryological tools available in the zebrafish model organism, with a focus on the novel functions of cardiac transcription factors and epigenetic and transcriptional regulatory proteins during cardiogenesis. PMID:27148546

  16. Silencing of molt-regulating transcription factor gene, CiHR3, affects growth and development of sugarcane stem borer, Chilo infuscatellus.

    PubMed

    Zhang, Yu-liang; Zhang, Shu-zhen; Kulye, Mahesh; Wu, Su-ran; Yu, Nai-tong; Wang, Jian-hua; Zeng, Hong-mei; Liu, Zhi-xin

    2012-01-01

    RNA interference (RNAi) is a technology for conducting functional genomic studies and a potential tool for crop protection against insect pests. Development of reliable methods for production and delivery of double-stranded RNA (dsRNA) is the major challenge for efficient pest control. In this study, Chilo infuscatellus Snellen (Crambidae: Lepidoptera) was fed with CiHR3 dsRNA expressed in bacteria or synthesized in vitro. The dsRNA ingested by C. infuscatellus successfully triggered silencing of the molt-regulating transcription factor CiHR3, an important gene for insect growth and development, and caused significant abnormalities and weight loss in insects within seven days of treatment. This study is an ideal example of feeding-based RNAi mediated by dsRNA expressed in bacteria or synthesized in vitro. The results also suggested that feeding-based RNA interference is a potential method for the management of C. infuscatellus. PMID:23427912

  17. Suppressor of cytokine signaling 2 (SOCS2) negatively regulates the expression of antimicrobial peptides by affecting the Stat transcriptional activity in shrimp Marsupenaeus japonicus.

    PubMed

    Sun, Jie-Jie; Lan, Jiang-Feng; Xu, Ji-Dong; Niu, Guo-Juan; Wang, Jin-Xing

    2016-09-01

    The suppressor of cytokine signaling (SOCS) family is a kind of negative regulators in the Janus kinase/signal transducer and activator of transcription (Jak/Stat) pathway in mammals and Drosophila. In kuruma shrimp, Marsupenaeus japonicus, SOCS2 is identified and its expression can be stimulated by peptidoglycan and polycytidylic acid. However, if SOCS2 participates in regulating Jak/Stat pathway in shrimp still needs further study. In this study, SOCS2 with Src homology 2 domain and SOCS box was identified in kuruma shrimp, M. japonicus. SOCS2 existed in hemocytes, heart, hepatopancreas, gills, stomach, and intestine, the expression of SOCS2 was upregulated significantly in the hemocytes and intestine of shrimp challenged with Vibrio anguillarum at 6 h. To analyze SOCS2 function in shrimp immunity, bacterial clearance and survival rate were analyzed after knockdown of SOCS2 in shrimp challenged with V. anguillarum. Results showed that bacterial clearance increased, and the survival rate improved significantly comparing with controls. The SOCS2 was expressed in Escherichia coli and the recombinant SOCS2 was injected into shrimp, and Stat phosphorylation and translocation were analyzed. The result showed that "overexpression" of SOCS2 declined Stat phosphorylation level and inhibited Stat translocation into the nucleus. After knockdown of SOCS2 in shrimp prior to V. anguillarum infection, the expression level of antimicrobial peptides, including anti-lipopolysaccharide factors C1, C2 and D1, and Crustin I was upregulated significantly, and the expression of the AMPs was declined after recombinant SOCS2 injection. The SOCS2 expression was also decreased in Stat-knockdown shrimp challenged by V. anguillarum at 6 and 12 h. Therefore, SOCS2 negatively regulates the AMP expression by inhibiting Stat phosphorylation and translocation into nucleus in shrimp, meanwhile, SOCS2 expression was also regulated by Jak/Stat pathway.

  18. Suppressor of cytokine signaling 2 (SOCS2) negatively regulates the expression of antimicrobial peptides by affecting the Stat transcriptional activity in shrimp Marsupenaeus japonicus.

    PubMed

    Sun, Jie-Jie; Lan, Jiang-Feng; Xu, Ji-Dong; Niu, Guo-Juan; Wang, Jin-Xing

    2016-09-01

    The suppressor of cytokine signaling (SOCS) family is a kind of negative regulators in the Janus kinase/signal transducer and activator of transcription (Jak/Stat) pathway in mammals and Drosophila. In kuruma shrimp, Marsupenaeus japonicus, SOCS2 is identified and its expression can be stimulated by peptidoglycan and polycytidylic acid. However, if SOCS2 participates in regulating Jak/Stat pathway in shrimp still needs further study. In this study, SOCS2 with Src homology 2 domain and SOCS box was identified in kuruma shrimp, M. japonicus. SOCS2 existed in hemocytes, heart, hepatopancreas, gills, stomach, and intestine, the expression of SOCS2 was upregulated significantly in the hemocytes and intestine of shrimp challenged with Vibrio anguillarum at 6 h. To analyze SOCS2 function in shrimp immunity, bacterial clearance and survival rate were analyzed after knockdown of SOCS2 in shrimp challenged with V. anguillarum. Results showed that bacterial clearance increased, and the survival rate improved significantly comparing with controls. The SOCS2 was expressed in Escherichia coli and the recombinant SOCS2 was injected into shrimp, and Stat phosphorylation and translocation were analyzed. The result showed that "overexpression" of SOCS2 declined Stat phosphorylation level and inhibited Stat translocation into the nucleus. After knockdown of SOCS2 in shrimp prior to V. anguillarum infection, the expression level of antimicrobial peptides, including anti-lipopolysaccharide factors C1, C2 and D1, and Crustin I was upregulated significantly, and the expression of the AMPs was declined after recombinant SOCS2 injection. The SOCS2 expression was also decreased in Stat-knockdown shrimp challenged by V. anguillarum at 6 and 12 h. Therefore, SOCS2 negatively regulates the AMP expression by inhibiting Stat phosphorylation and translocation into nucleus in shrimp, meanwhile, SOCS2 expression was also regulated by Jak/Stat pathway. PMID:27492125

  19. The Shwachman-Bodian-Diamond syndrome associated protein interacts with HsNip7 and its down-regulation affects gene expression at the transcriptional and translational levels

    SciTech Connect

    Hesling, Cedric; Oliveira, Carla C.; Castilho, Beatriz A.; Zanchin, Nilson I.T.

    2007-12-10

    The Shwachman-Bodian-Diamond syndrome (SDS) is an autosomal disorder with pleiotropic phenotypes including pancreatic, skeletal and bone marrow deficiencies and predisposition to hematological dysfunctions. SDS has been associated to mutations in the SBDS gene, encoding a highly conserved protein that was shown to function in ribosome biogenesis in yeast. In this work, we show that SBDS is found in complexes containing the human Nip7 ortholog. Analysis of pre-rRNA processing in a stable SBDS knock-down HEK293-derivative cell line revealed accumulation of a small RNA which is a further indication of SBDS involvement in rRNA biosynthesis. Global transcription and polysome-bound mRNA profiling revealed that SBDS knock-down affects expression of critical genes involved in brain development and function, bone morphogenesis, blood cell proliferation and differentiation, and cell adhesion. Expression of a group of growth and signal transduction factors and of DNA damage response genes is also affected. In SBDS knock-down cells, 34 mRNAs showed decreased and 55 mRNAs showed increased association to polysomes, among which is a group encoding proteins involved in alternative splicing and RNA modification. These results indicate that SBDS is required for accurate expression of genes important for proper brain, skeletal, and blood cell development.

  20. Affect and Self-Regulation

    ERIC Educational Resources Information Center

    Malmivuori, Marja-Liisa

    2006-01-01

    This paper presents affect as an essential aspect of students' self-reflection and self-regulation. The introduced concepts of self-system and self-system process stress the importance of self-appraisals of personal competence and agency in affective responses and self-regulation in problem solving. Students are viewed as agents who constantly…

  1. Transcriptional and post-transcriptional regulation of a NAC1 transcription factor in Medicago truncatula roots.

    PubMed

    D'haeseleer, Katrien; Den Herder, Griet; Laffont, Carole; Plet, Julie; Mortier, Virginie; Lelandais-Brière, Christine; De Bodt, Stefanie; De Keyser, Annick; Crespi, Martin; Holsters, Marcelle; Frugier, Florian; Goormachtig, Sofie

    2011-08-01

    • Legume roots develop two types of lateral organs, lateral roots and nodules. Nodules develop as a result of a symbiotic interaction with rhizobia and provide a niche for the bacteria to fix atmospheric nitrogen for the plant. • The Arabidopsis NAC1 transcription factor is involved in lateral root formation, and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. We analyzed in Medicago truncatula the role of the closest NAC1 homolog in lateral root formation and in nodulation. • MtNAC1 shows a different expression pattern in response to auxin than its Arabidopsis homolog and no changes in lateral root number or nodulation were observed in plants affected in MtNAC1 expression. In addition, no interaction was found with SINA E3 ligases, suggesting that post-translational regulation of MtNAC1 does not occur in M. truncatula. Similar to what was found in Arabidopsis, a conserved miR164 target site was retrieved in MtNAC1, which reduced protein accumulation of a GFP-miR164 sensor. Furthermore, miR164 and MtNAC1 show an overlapping expression pattern in symbiotic nodules, and overexpression of this miRNA led to a reduction in nodule number. • This work suggests that regulatory pathways controlling a conserved transcription factor are complex and divergent between M. truncatula and Arabidopsis.

  2. Mechanisms of mutational robustness in transcriptional regulation

    PubMed Central

    Payne, Joshua L.; Wagner, Andreas

    2015-01-01

    Robustness is the invariance of a phenotype in the face of environmental or genetic change. The phenotypes produced by transcriptional regulatory circuits are gene expression patterns that are to some extent robust to mutations. Here we review several causes of this robustness. They include robustness of individual transcription factor binding sites, homotypic clusters of such sites, redundant enhancers, transcription factors, redundant transcription factors, and the wiring of transcriptional regulatory circuits. Such robustness can either be an adaptation by itself, a byproduct of other adaptations, or the result of biophysical principles and non-adaptive forces of genome evolution. The potential consequences of such robustness include complex regulatory network topologies that arise through neutral evolution, as well as cryptic variation, i.e., genotypic divergence without phenotypic divergence. On the longest evolutionary timescales, the robustness of transcriptional regulation has helped shape life as we know it, by facilitating evolutionary innovations that helped organisms such as flowering plants and vertebrates diversify. PMID:26579194

  3. Catching transcriptional regulation by thermostatistical modeling

    NASA Astrophysics Data System (ADS)

    Frank, Till D.; Cheong, Alex; Okada-Hatakeyama, Mariko; Kholodenko, Boris N.

    2012-08-01

    Gene expression is frequently regulated by multiple transcription factors (TFs). Thermostatistical methods allow for a quantitative description of interactions between TFs, RNA polymerase and DNA, and their impact on the transcription rates. We illustrate three different scales of the thermostatistical approach: the microscale of TF molecules, the mesoscale of promoter energy levels and the macroscale of transcriptionally active and inactive cells in a cell population. We demonstrate versatility of combinatorial transcriptional activation by exemplifying logic functions, such as AND and OR gates. We discuss a metric for cell-to-cell transcriptional activation variability known as Fermi entropy. Suitability of thermostatistical modeling is illustrated by describing the experimental data on transcriptional induction of NFκB and the c-Fos protein.

  4. Transcriptional regulation by CHIP/LDB complexes.

    PubMed

    Bronstein, Revital; Levkovitz, Liron; Yosef, Nir; Yanku, Michaela; Ruppin, Eytan; Sharan, Roded; Westphal, Heiner; Oliver, Brian; Segal, Daniel

    2010-08-12

    It is increasingly clear that transcription factors play versatile roles in turning genes "on" or "off" depending on cellular context via the various transcription complexes they form. This poses a major challenge in unraveling combinatorial transcription complex codes. Here we use the powerful genetics of Drosophila combined with microarray and bioinformatics analyses to tackle this challenge. The nuclear adaptor CHIP/LDB is a major developmental regulator capable of forming tissue-specific transcription complexes with various types of transcription factors and cofactors, making it a valuable model to study the intricacies of gene regulation. To date only few CHIP/LDB complexes target genes have been identified, and possible tissue-dependent crosstalk between these complexes has not been rigorously explored. SSDP proteins protect CHIP/LDB complexes from proteasome dependent degradation and are rate-limiting cofactors for these complexes. By using mutations in SSDP, we identified 189 down-stream targets of CHIP/LDB and show that these genes are enriched for the binding sites of APTEROUS (AP) and PANNIER (PNR), two well studied transcription factors associated with CHIP/LDB complexes. We performed extensive genetic screens and identified target genes that genetically interact with components of CHIP/LDB complexes in directing the development of the wings (28 genes) and thoracic bristles (23 genes). Moreover, by in vivo RNAi silencing we uncovered novel roles for two of the target genes, xbp1 and Gs-alpha, in early development of these structures. Taken together, our results suggest that loss of SSDP disrupts the normal balance between the CHIP-AP and the CHIP-PNR transcription complexes, resulting in down-regulation of CHIP-AP target genes and the concomitant up-regulation of CHIP-PNR target genes. Understanding the combinatorial nature of transcription complexes as presented here is crucial to the study of transcription regulation of gene batteries required for

  5. Identifying Novel Transcriptional Regulators with Circadian Expression

    PubMed Central

    Schick, Sandra; Thakurela, Sudhir; Fournier, David; Hampel, Mareike Hildegard

    2015-01-01

    Organisms adapt their physiology and behavior to the 24-h day-night cycle to which they are exposed. On a cellular level, this is regulated by intrinsic transcriptional-translational feedback loops that are important for maintaining the circadian rhythm. These loops are organized by members of the core clock network, which further regulate transcription of downstream genes, resulting in their circadian expression. Despite progress in understanding circadian gene expression, only a few players involved in circadian transcriptional regulation, including transcription factors, epigenetic regulators, and long noncoding RNAs, are known. Aiming to discover such genes, we performed a high-coverage transcriptome analysis of a circadian time course in murine fibroblast cells. In combination with a newly developed algorithm, we identified many transcription factors, epigenetic regulators, and long intergenic noncoding RNAs that are cyclically expressed. In addition, a number of these genes also showed circadian expression in mouse tissues. Furthermore, the knockdown of one such factor, Zfp28, influenced the core clock network. Mathematical modeling was able to predict putative regulator-effector interactions between the identified circadian genes and may help for investigations into the gene regulatory networks underlying circadian rhythms. PMID:26644408

  6. Transcriptional Regulation and Macrophage Differentiation.

    PubMed

    Hume, David A; Summers, Kim M; Rehli, Michael

    2016-06-01

    Monocytes and macrophages are professional phagocytes that occupy specific niches in every tissue of the body. Their survival, proliferation, and differentiation are controlled by signals from the macrophage colony-stimulating factor receptor (CSF-1R) and its two ligands, CSF-1 and interleukin-34. In this review, we address the developmental and transcriptional relationships between hematopoietic progenitor cells, blood monocytes, and tissue macrophages as well as the distinctions from dendritic cells. A huge repertoire of receptors allows monocytes, tissue-resident macrophages, or pathology-associated macrophages to adapt to specific microenvironments. These processes create a broad spectrum of macrophages with different functions and individual effector capacities. The production of large transcriptomic data sets in mouse, human, and other species provides new insights into the mechanisms that underlie macrophage functional plasticity. PMID:27337479

  7. Regulation of the MicroRNA 200b (miRNA-200b) by Transcriptional Regulators PEA3 and ELK-1 Protein Affects Expression of Pin1 Protein to Control Anoikis*

    PubMed Central

    Zhang, Xusen; Zhang, Bailin; Gao, Jidong; Wang, Xiang; Liu, Zhihua

    2013-01-01

    MicroRNA (miRNA) 200s regulate E-cadherin by directly targeting ZEB1/ZEB2, which are transcriptional repressors of E-cadherin. Decreased expression of E-cadherin results in cancer cells losing interaction with the extracellular matrix and detaching from the primary tumor. Normally, cells will undergo anoikis after losing interaction with the extracellular matrix. Cancer cells must, therefore, possess the ability to resist anoikis during the process of metastasis. Here we show that miRNA-200b regulates anoikis by directly targeting the 3′ UTR of Pin1 mRNA and regulating Pin1 expression at the translational level. We found that down-regulation of miRNA-200b promotes cancer cells survival during metastasis, and the homeless state of these cells resulted in decreased expression of miRNA-200b in the MCF-7 cell line. We also found that expression of miRNA-200b is down-regulated in human breast cancer during lymph node metastasis, which has a significant negative correlation with Pin1 expression. Two members of the ETS (E-26) family (PEA3 and ELK-1) regulate the expression of miRNA-200b. PEA3 promotes the expression of miRNA-200b, and ELK-1 is a transcriptional repressor of miRNA-200b. In addition, miRNA-200b regulates the activity of PEA3 and ELK-1 via the Pin1-pERK pathway and forms self-regulated feedback loops. This study characterizes the role of miRNA-200b in the regulation of anoikis and demonstrates the regulation of its own expression in the process of metastasis. PMID:24072701

  8. Regulation of Transcription by Long Noncoding RNAs

    PubMed Central

    Bonasio, Roberto; Shiekhattar, Ramin

    2014-01-01

    Over the past decade there has been a greater understanding of genomic complexity in eukaryotes ushered in by the immense technological advances in high-throughput sequencing of DNA and its corresponding RNA transcripts. This has resulted in the realization that beyond protein-coding genes, there are a large number of transcripts that do not encode for proteins and, therefore, may perform their function through RNA sequences and/or through secondary and tertiary structural determinants. This review is focused on the latest findings on a class of noncoding RNAs that are relatively large (>200 nucleotides), display nuclear localization, and use different strategies to regulate transcription. These are exciting times for discovering the biological scope and the mechanism of action for these RNA molecules, which have roles in dosage compensation, imprinting, enhancer function, and transcriptional regulation, with a great impact on development and disease. PMID:25251851

  9. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

    PubMed Central

    De la Cruz, Miguel A.; Pérez-Morales, Deyanira; Palacios, Irene J.; Fernández-Mora, Marcos; Calva, Edmundo; Bustamante, Víctor H.

    2015-01-01

    Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella. PMID:26300871

  10. The evolution of transcriptional regulation in eukaryotes

    NASA Technical Reports Server (NTRS)

    Wray, Gregory A.; Hahn, Matthew W.; Abouheif, Ehab; Balhoff, James P.; Pizer, Margaret; Rockman, Matthew V.; Romano, Laura A.

    2003-01-01

    Gene expression is central to the genotype-phenotype relationship in all organisms, and it is an important component of the genetic basis for evolutionary change in diverse aspects of phenotype. However, the evolution of transcriptional regulation remains understudied and poorly understood. Here we review the evolutionary dynamics of promoter, or cis-regulatory, sequences and the evolutionary mechanisms that shape them. Existing evidence indicates that populations harbor extensive genetic variation in promoter sequences, that a substantial fraction of this variation has consequences for both biochemical and organismal phenotype, and that some of this functional variation is sorted by selection. As with protein-coding sequences, rates and patterns of promoter sequence evolution differ considerably among loci and among clades for reasons that are not well understood. Studying the evolution of transcriptional regulation poses empirical and conceptual challenges beyond those typically encountered in analyses of coding sequence evolution: promoter organization is much less regular than that of coding sequences, and sequences required for the transcription of each locus reside at multiple other loci in the genome. Because of the strong context-dependence of transcriptional regulation, sequence inspection alone provides limited information about promoter function. Understanding the functional consequences of sequence differences among promoters generally requires biochemical and in vivo functional assays. Despite these challenges, important insights have already been gained into the evolution of transcriptional regulation, and the pace of discovery is accelerating.

  11. Transcriptional Regulation by the Numbers

    NASA Astrophysics Data System (ADS)

    Garcia, Hernan; Bintu, Lacramioara; Phillips, Rob

    2005-03-01

    The study of gene regulation and expression is becoming ever more quantitative. In particular, with increasing regularity the expression of genes is characterized quantitatively with respect to how much, when and where. The key argument of the present work is that such quantitative data demands quantitative models. We examine a class of models (``thermodynamic models'') which exploit the tools of statistical mechanics to compute the probability that RNA polymerase will be found at the appropriate promoter. Recent arguments have suggested that in some instances, the action of activators can be thought of strictly as agents of recruitment which increase the probability that RNA polymerase will be found at the promoter of interest. We develop an allied mathematical framework which describes the interactions of repressors, activators, helper molecules and RNA polymerase and culminates in an expression for the probability of RNA polymerase binding at the promoter of interest as a function of the concentrations of all of these regulatory agents. These ideas are applied to several case studies which illuminate the general formalism and shed light on the role of DNA looping.

  12. The A2 gene of alcelaphine herpesvirus-1 is a transcriptional regulator affecting cytotoxicity in virus-infected T cells but is not required for malignant catarrhal fever induction in rabbits.

    PubMed

    Parameswaran, Nevi; Dewals, Benjamin G; Giles, Tom C; Deppmann, Christopher; Blythe, Martin; Vanderplasschen, Alain; Emes, Richard D; Haig, David

    2014-08-01

    Alcelaphine herpesvirus-1 (AlHV-1) causes malignant catarrhal fever (MCF). The A2 gene of AlHV-1 is a member of the bZIP transcription factor family. We wished to determine whether A2 is a virulence gene or not and whether it is involved in pathogenesis by interference with host transcription pathways. An A2 gene knockout (A2ΔAlHV-1) virus, revertant (A2revAlHV-1) virus, and wild-type virus (wtAlHV-1) were used to infect three groups of rabbits. A2ΔAlHV-1-infected rabbits succumbed to MCF, albeit with a delayed onset compared to the control groups, so A2 is not a critical virulence factor. Differential gene transcription analysis by RNAseq and qRT-PCR validation of a selection of these was performed in infected large granular lymphocyte (LGL) T cells obtained in culture from the MCF-affected animals. A2 was involved in the transcriptional regulation of immunological, cell cycle and apoptosis pathways. In particular, there was a bias towards γδ T cell receptor (TCR) expression and downregulation of αβ TCR. TCR signalling, apoptosis, cell cycle, IFN-γ and NFAT pathways were affected. Of particular interest was partial inhibition of the cytotoxicity-associated pathways involving perforin and the granzymes A and B in the A2ΔAlHV-1-infected LGLs compared to controls. In functional assays, A2ΔAlHV-1-infected LGLs were significantly less cytotoxic than wtAlHV-1- and A2revAlHV-1-infected LGLs using rabbit corneal epithelial cells (SIRC) as targets. This implies that A2 is involved in a pathway enhancing the expression of LGL cytotoxicity. This is important as virus-infected T cell cytotoxicity in vivo has been suggested as a potential mechanism of disease induction in MCF.

  13. The A2 gene of alcelaphine herpesvirus-1 is a transcriptional regulator affecting cytotoxicity in virus-infected T cells but is not required for malignant catarrhal fever induction in rabbits.

    PubMed

    Parameswaran, Nevi; Dewals, Benjamin G; Giles, Tom C; Deppmann, Christopher; Blythe, Martin; Vanderplasschen, Alain; Emes, Richard D; Haig, David

    2014-08-01

    Alcelaphine herpesvirus-1 (AlHV-1) causes malignant catarrhal fever (MCF). The A2 gene of AlHV-1 is a member of the bZIP transcription factor family. We wished to determine whether A2 is a virulence gene or not and whether it is involved in pathogenesis by interference with host transcription pathways. An A2 gene knockout (A2ΔAlHV-1) virus, revertant (A2revAlHV-1) virus, and wild-type virus (wtAlHV-1) were used to infect three groups of rabbits. A2ΔAlHV-1-infected rabbits succumbed to MCF, albeit with a delayed onset compared to the control groups, so A2 is not a critical virulence factor. Differential gene transcription analysis by RNAseq and qRT-PCR validation of a selection of these was performed in infected large granular lymphocyte (LGL) T cells obtained in culture from the MCF-affected animals. A2 was involved in the transcriptional regulation of immunological, cell cycle and apoptosis pathways. In particular, there was a bias towards γδ T cell receptor (TCR) expression and downregulation of αβ TCR. TCR signalling, apoptosis, cell cycle, IFN-γ and NFAT pathways were affected. Of particular interest was partial inhibition of the cytotoxicity-associated pathways involving perforin and the granzymes A and B in the A2ΔAlHV-1-infected LGLs compared to controls. In functional assays, A2ΔAlHV-1-infected LGLs were significantly less cytotoxic than wtAlHV-1- and A2revAlHV-1-infected LGLs using rabbit corneal epithelial cells (SIRC) as targets. This implies that A2 is involved in a pathway enhancing the expression of LGL cytotoxicity. This is important as virus-infected T cell cytotoxicity in vivo has been suggested as a potential mechanism of disease induction in MCF. PMID:24732177

  14. Regulation of gene transcription by Polycomb proteins

    PubMed Central

    Aranda, Sergi; Mas, Gloria; Di Croce, Luciano

    2015-01-01

    The Polycomb group (PcG) of proteins defines a subset of factors that physically associate and function to maintain the positional identity of cells from the embryo to adult stages. PcG has long been considered a paradigmatic model for epigenetic maintenance of gene transcription programs. Despite intensive research efforts to unveil the molecular mechanisms of action of PcG proteins, several fundamental questions remain unresolved: How many different PcG complexes exist in mammalian cells? How are PcG complexes targeted to specific loci? How does PcG regulate transcription? In this review, we discuss the diversity of PcG complexes in mammalian cells, examine newly identified modes of recruitment to chromatin, and highlight the latest insights into the molecular mechanisms underlying the function of PcGs in transcription regulation and three-dimensional chromatin conformation. PMID:26665172

  15. Transcriptional regulation of xenobiotic detoxification in Drosophila

    PubMed Central

    Misra, Jyoti R.; Horner, Michael A.; Lam, Geanette; Thummel, Carl S.

    2011-01-01

    Living organisms, from bacteria to humans, display a coordinated transcriptional response to xenobiotic exposure, inducing enzymes and transporters that facilitate detoxification. Several transcription factors have been identified in vertebrates that contribute to this regulatory response. In contrast, little is known about this pathway in insects. Here we show that the Drosophila Nrf2 (NF-E2-related factor 2) ortholog CncC (cap ‘n’ collar isoform-C) is a central regulator of xenobiotic detoxification responses. A binding site for CncC and its heterodimer partner Maf (muscle aponeurosis fibromatosis) is sufficient and necessary for robust transcriptional responses to three xenobiotic compounds: phenobarbital (PB), chlorpromazine, and caffeine. Genetic manipulations that alter the levels of CncC or its negative regulator, Keap1 (Kelch-like ECH-associated protein 1), lead to predictable changes in xenobiotic-inducible gene expression. Transcriptional profiling studies reveal that more than half of the genes regulated by PB are also controlled by CncC. Consistent with these effects on detoxification gene expression, activation of the CncC/Keap1 pathway in Drosophila is sufficient to confer resistance to the lethal effects of the pesticide malathion. These studies establish a molecular mechanism for the regulation of xenobiotic detoxification in Drosophila and have implications for controlling insect populations and the spread of insect-borne human diseases. PMID:21896655

  16. Regulation by transcription factors in bacteria: beyond description.

    PubMed

    Balleza, Enrique; López-Bojorquez, Lucia N; Martínez-Antonio, Agustino; Resendis-Antonio, Osbaldo; Lozada-Chávez, Irma; Balderas-Martínez, Yalbi I; Encarnación, Sergio; Collado-Vides, Julio

    2009-01-01

    Transcription is an essential step in gene expression and its understanding has been one of the major interests in molecular and cellular biology. By precisely tuning gene expression, transcriptional regulation determines the molecular machinery for developmental plasticity, homeostasis and adaptation. In this review, we transmit the main ideas or concepts behind regulation by transcription factors and give just enough examples to sustain these main ideas, thus avoiding a classical ennumeration of facts. We review recent concepts and developments: cis elements and trans regulatory factors, chromosome organization and structure, transcriptional regulatory networks (TRNs) and transcriptomics. We also summarize new important discoveries that will probably affect the direction of research in gene regulation: epigenetics and stochasticity in transcriptional regulation, synthetic circuits and plasticity and evolution of TRNs. Many of the new discoveries in gene regulation are not extensively tested with wetlab approaches. Consequently, we review this broad area in Inference of TRNs and Dynamical Models of TRNs. Finally, we have stepped backwards to trace the origins of these modern concepts, synthesizing their history in a timeline schema. PMID:19076632

  17. Regulation by transcription factors in bacteria: beyond description

    PubMed Central

    Balleza, Enrique; López-Bojorquez, Lucia N; Martínez-Antonio, Agustino; Resendis-Antonio, Osbaldo; Lozada-Chávez, Irma; Balderas-Martínez, Yalbi I; Encarnación, Sergio; Collado-Vides, Julio

    2009-01-01

    Transcription is an essential step in gene expression and its understanding has been one of the major interests in molecular and cellular biology. By precisely tuning gene expression, transcriptional regulation determines the molecular machinery for developmental plasticity, homeostasis and adaptation. In this review, we transmit the main ideas or concepts behind regulation by transcription factors and give just enough examples to sustain these main ideas, thus avoiding a classical ennumeration of facts. We review recent concepts and developments: cis elements and trans regulatory factors, chromosome organization and structure, transcriptional regulatory networks (TRNs) and transcriptomics. We also summarize new important discoveries that will probably affect the direction of research in gene regulation: epigenetics and stochasticity in transcriptional regulation, synthetic circuits and plasticity and evolution of TRNs. Many of the new discoveries in gene regulation are not extensively tested with wetlab approaches. Consequently, we review this broad area in Inference of TRNs and Dynamical Models of TRNs. Finally, we have stepped backwards to trace the origins of these modern concepts, synthesizing their history in a timeline schema. PMID:19076632

  18. Regulation of specialized metabolism by WRKY transcription factors.

    PubMed

    Schluttenhofer, Craig; Yuan, Ling

    2015-02-01

    WRKY transcription factors (TFs) are well known for regulating plant abiotic and biotic stress tolerance. However, much less is known about how WRKY TFs affect plant-specialized metabolism. Analysis of WRKY TFs regulating the production of specialized metabolites emphasizes the values of the family outside of traditionally accepted roles in stress tolerance. WRKYs with conserved roles across plant species seem to be essential in regulating specialized metabolism. Overall, the WRKY family plays an essential role in regulating the biosynthesis of important pharmaceutical, aromatherapy, biofuel, and industrial components, warranting considerable attention in the forthcoming years.

  19. Regulation of specialized metabolism by WRKY transcription factors.

    PubMed

    Schluttenhofer, Craig; Yuan, Ling

    2015-02-01

    WRKY transcription factors (TFs) are well known for regulating plant abiotic and biotic stress tolerance. However, much less is known about how WRKY TFs affect plant-specialized metabolism. Analysis of WRKY TFs regulating the production of specialized metabolites emphasizes the values of the family outside of traditionally accepted roles in stress tolerance. WRKYs with conserved roles across plant species seem to be essential in regulating specialized metabolism. Overall, the WRKY family plays an essential role in regulating the biosynthesis of important pharmaceutical, aromatherapy, biofuel, and industrial components, warranting considerable attention in the forthcoming years. PMID:25501946

  20. Transcriptional and epigenetic regulation of autophagy in aging.

    PubMed

    Lapierre, Louis R; Kumsta, Caroline; Sandri, Marco; Ballabio, Andrea; Hansen, Malene

    2015-01-01

    Macroautophagy is a major intracellular degradation process recognized as playing a central role in cell survival and longevity. This multistep process is extensively regulated at several levels, including post-translationally through the action of conserved longevity factors such as the nutrient sensor TOR. More recently, transcriptional regulation of autophagy genes has emerged as an important mechanism for ensuring the somatic maintenance and homeostasis necessary for a long life span. Autophagy is increased in many long-lived model organisms and contributes significantly to their longevity. In turn, conserved transcription factors, particularly the helix-loop-helix transcription factor TFEB and the forkhead transcription factor FOXO, control the expression of many autophagy-related genes and are important for life-span extension. In this review, we discuss recent progress in understanding the contribution of these transcription factors to macroautophagy regulation in the context of aging. We also review current research on epigenetic changes, such as histone modification by the deacetylase SIRT1, that influence autophagy-related gene expression and additionally affect aging. Understanding the molecular regulation of macroautophagy in relation to aging may offer new avenues for the treatment of age-related diseases.

  1. Transcriptional regulation of drought response: a tortuous network of transcriptional factors.

    PubMed

    Singh, Dhriti; Laxmi, Ashverya

    2015-01-01

    Drought is one of the leading factors responsible for the reduction in crop yield worldwide. Due to climate change, in future, more areas are going to be affected by drought and for prolonged periods. Therefore, understanding the mechanisms underlying the drought response is one of the major scientific concerns for improving crop yield. Plants deploy diverse strategies and mechanisms to respond and tolerate drought stress. Expression of numerous genes is modulated in different plants under drought stress that help them to optimize their growth and development. Plant hormone abscisic acid (ABA) plays a major role in plant response and tolerance by regulating the expression of many genes under drought stress. Transcription factors being the major regulator of gene expression play a crucial role in stress response. ABA regulates the expression of most of the target genes through ABA-responsive element (ABRE) binding protein/ABRE binding factor (AREB/ABF) transcription factors. Genes regulated by AREB/ABFs constitute a regulon termed as AREB/ABF regulon. In addition to this, drought responsive genes are also regulated by ABA-independent mechanisms. In ABA-independent regulation, dehydration-responsive element binding protein (DREB), NAM, ATAF, and CUC regulons play an important role by regulating many drought-responsive genes. Apart from these major regulons, MYB/MYC, WRKY, and nuclear factor-Y (NF-Y) transcription factors are also involved in drought response and tolerance. Our understanding about transcriptional regulation of drought is still evolving. Recent reports have suggested the existence of crosstalk between different transcription factors operating under drought stress. In this article, we have reviewed various regulons working under drought stress and their crosstalk with each other. PMID:26579147

  2. Transcriptional regulation of drought response: a tortuous network of transcriptional factors

    PubMed Central

    Singh, Dhriti; Laxmi, Ashverya

    2015-01-01

    Drought is one of the leading factors responsible for the reduction in crop yield worldwide. Due to climate change, in future, more areas are going to be affected by drought and for prolonged periods. Therefore, understanding the mechanisms underlying the drought response is one of the major scientific concerns for improving crop yield. Plants deploy diverse strategies and mechanisms to respond and tolerate drought stress. Expression of numerous genes is modulated in different plants under drought stress that help them to optimize their growth and development. Plant hormone abscisic acid (ABA) plays a major role in plant response and tolerance by regulating the expression of many genes under drought stress. Transcription factors being the major regulator of gene expression play a crucial role in stress response. ABA regulates the expression of most of the target genes through ABA-responsive element (ABRE) binding protein/ABRE binding factor (AREB/ABF) transcription factors. Genes regulated by AREB/ABFs constitute a regulon termed as AREB/ABF regulon. In addition to this, drought responsive genes are also regulated by ABA-independent mechanisms. In ABA-independent regulation, dehydration-responsive element binding protein (DREB), NAM, ATAF, and CUC regulons play an important role by regulating many drought-responsive genes. Apart from these major regulons, MYB/MYC, WRKY, and nuclear factor-Y (NF-Y) transcription factors are also involved in drought response and tolerance. Our understanding about transcriptional regulation of drought is still evolving. Recent reports have suggested the existence of crosstalk between different transcription factors operating under drought stress. In this article, we have reviewed various regulons working under drought stress and their crosstalk with each other. PMID:26579147

  3. Combinatorial Transcription Control in Gene Regulation

    NASA Astrophysics Data System (ADS)

    Hwa, Terence; Buchler, Nicolas E.; Gerland, Ulrich

    2003-03-01

    We develop a simple thermodynamic model for the regulation of gene transcription and explore the limits of combinatorial control. Our model is based on the ``regulated recruitment'' mechanism [M. Ptashne and A. Gann, Nature 386 (1997) 569], assuming weak contact interaction between the regulatory proteins together with specific protein-DNA interactions. We further assume "programmability" in the strengths of these interactions within a biophysically allowed range [U. Gerland, J.D. Moroz, and T.Hwa, PNAS 99 (2002) 12015], through the choices and the locations of the protein-binding DNA sequences in the regulatory region. Within our thermodynamic model, we demonstrate the implementability of various binary logic functions (including XOR) by computing the degree of gene transcription (output) for all combinations of regulatory protein concentrations (input).

  4. Oxytocin Regulates Stress-Induced Crf Gene Transcription through CREB-Regulated Transcription Coactivator 3

    PubMed Central

    Jurek, Benjamin; Slattery, David A.; Hiraoka, Yuichi; Liu, Ying; Nishimori, Katsuhiko; Aguilera, Greti; van den Burg, Erwin H.

    2015-01-01

    The major regulator of the neuroendocrine stress response in the brain is corticotropin releasing factor (CRF), whose transcription is controlled by CREB and its cofactors CRTC2/3 (TORC2/3). Phosphorylated CRTCs are sequestered in the cytoplasm, but rapidly dephosphorylated and translocated into the nucleus following a stressful stimulus. As the stress response is attenuated by oxytocin (OT), we tested whether OT interferes with CRTC translocation and, thereby, Crf expression. OT (1 nmol, i.c.v.) delayed the stress-induced increase of nuclear CRTC3 and Crf hnRNA levels in the paraventricular nucleus of male rats and mice, but did not affect either parameter in the absence of the stressor. The increase in Crf hnRNA levels at later time points was parallel to elevated nuclear CRTC2/3 levels. A direct effect of Thr4 Gly7-OT (TGOT) on CRTC3 translocation and Crf expression was found in rat primary hypothalamic neurons, amygdaloid (Ar-5), hypothalamic (H32), and human neuroblastoma (Be(2)M17) cell lines. CRTC3, but not CRCT2, knockdown using siRNA in Be(2)M17 cells prevented the effect of TGOT on Crf hnRNA levels. Chromatin-immunoprecipitation demonstrated that TGOT reduced CRTC3, but not CRTC2, binding to the Crf promoter after 10 min of forskolin stimulation. Together, the results indicate that OT modulates CRTC3 translocation, the binding of CRTC3 to the Crf promoter and, ultimately, transcription of the Crf gene. SIGNIFICANCE STATEMENT The neuropeptide oxytocin has been proposed to reduce hypothalamic-pituitary-adrenal (HPA) axis activation during stress. The underlying mechanisms are, however, elusive. In this study we show that activation of the oxytocin receptor in the paraventricular nucleus delays transcription of the gene encoding corticotropin releasing factor (Crf), the main regulator of the stress response. It does so by sequestering the coactivator of the transcription factor CREB, CRTC3, in the cytosol, resulting in reduced binding of CRTC3 to the Crf

  5. The Mediator complex and transcription regulation

    PubMed Central

    Poss, Zachary C.; Ebmeier, Christopher C.

    2013-01-01

    The Mediator complex is a multi-subunit assembly that appears to be required for regulating expression of most RNA polymerase II (pol II) transcripts, which include protein-coding and most non-coding RNA genes. Mediator and pol II function within the pre-initiation complex (PIC), which consists of Mediator, pol II, TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH and is approximately 4.0 MDa in size. Mediator serves as a central scaffold within the PIC and helps regulate pol II activity in ways that remain poorly understood. Mediator is also generally targeted by sequence-specific, DNA-binding transcription factors (TFs) that work to control gene expression programs in response to developmental or environmental cues. At a basic level, Mediator functions by relaying signals from TFs directly to the pol II enzyme, thereby facilitating TF-dependent regulation of gene expression. Thus, Mediator is essential for converting biological inputs (communicated by TFs) to physiological responses (via changes in gene expression). In this review, we summarize an expansive body of research on the Mediator complex, with an emphasis on yeast and mammalian complexes. We focus on the basics that underlie Mediator function, such as its structure and subunit composition, and describe its broad regulatory influence on gene expression, ranging from chromatin architecture to transcription initiation and elongation, to mRNA processing. We also describe factors that influence Mediator structure and activity, including TFs, non-coding RNAs and the CDK8 module. PMID:24088064

  6. Evolution of a transcriptional regulator from a transmembrane nucleoporin

    PubMed Central

    Franks, Tobias M.; Benner, Chris; Narvaiza, Iñigo; Marchetto, Maria C.N.; Young, Janet M.; Malik, Harmit S.; Gage, Fred H.; Hetzer, Martin W.

    2016-01-01

    Nuclear pore complexes (NPCs) emerged as nuclear transport channels in eukaryotic cells ∼1.5 billion years ago. While the primary role of NPCs is to regulate nucleo–cytoplasmic transport, recent research suggests that certain NPC proteins have additionally acquired the role of affecting gene expression at the nuclear periphery and in the nucleoplasm in metazoans. Here we identify a widely expressed variant of the transmembrane nucleoporin (Nup) Pom121 (named sPom121, for “soluble Pom121”) that arose by genomic rearrangement before the divergence of hominoids. sPom121 lacks the nuclear membrane-anchoring domain and thus does not localize to the NPC. Instead, sPom121 colocalizes and interacts with nucleoplasmic Nup98, a previously identified transcriptional regulator, at gene promoters to control transcription of its target genes in human cells. Interestingly, sPom121 transcripts appear independently in several mammalian species, suggesting convergent innovation of Nup-mediated transcription regulation during mammalian evolution. Our findings implicate alternate transcription initiation as a mechanism to increase the functional diversity of NPC components. PMID:27198230

  7. Evolution of a transcriptional regulator from a transmembrane nucleoporin.

    PubMed

    Franks, Tobias M; Benner, Chris; Narvaiza, Iñigo; Marchetto, Maria C N; Young, Janet M; Malik, Harmit S; Gage, Fred H; Hetzer, Martin W

    2016-05-15

    Nuclear pore complexes (NPCs) emerged as nuclear transport channels in eukaryotic cells ∼1.5 billion years ago. While the primary role of NPCs is to regulate nucleo-cytoplasmic transport, recent research suggests that certain NPC proteins have additionally acquired the role of affecting gene expression at the nuclear periphery and in the nucleoplasm in metazoans. Here we identify a widely expressed variant of the transmembrane nucleoporin (Nup) Pom121 (named sPom121, for "soluble Pom121") that arose by genomic rearrangement before the divergence of hominoids. sPom121 lacks the nuclear membrane-anchoring domain and thus does not localize to the NPC. Instead, sPom121 colocalizes and interacts with nucleoplasmic Nup98, a previously identified transcriptional regulator, at gene promoters to control transcription of its target genes in human cells. Interestingly, sPom121 transcripts appear independently in several mammalian species, suggesting convergent innovation of Nup-mediated transcription regulation during mammalian evolution. Our findings implicate alternate transcription initiation as a mechanism to increase the functional diversity of NPC components. PMID:27198230

  8. Information flow and optimization in transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Tkacik, Gasper

    2008-03-01

    In the simplest view of transcriptional regulation, the expression of a gene is turned on or off by the changes in the concentration of a transcription factor (TF). Here we analyze transcriptional regulatory elements with the tools of information theory. Recent data on noise levels in gene expression are used to show that it should be possible to transmit much more than just one regulatory bit. Realizing this optimal information capacity would require that the dynamic range of TF concentrations used by the cell, the input/output relation of the regulatory module, and the noise levels of binding and transcription satisfy certain matching relations. This parameter-free prediction is in good agreement with recent experiments on the Bicoid/Hunchback system in the early Drosophila embryo, and this system achieves around 90% of its theoretical maximum information transmission. The dependence of information capacity on parameters that govern gene expression for simple, single-input / single-output, genetic regulatory elements is systematically examined and the extensions of the work to genetic circuits consisting of several interacting elements are presented.

  9. Ultraviolet B Regulation of Transcription Factor Families

    PubMed Central

    Cooper, S.J.; Bowden, G.T.

    2008-01-01

    Prolonged and repeated exposure of the skin to ultraviolet light (UV) leads not only to aging of the skin but also increases the incidence of non-melanoma skin cancer (NMSC). Damage of cells induced by ultraviolet B (UVB) light both at the DNA level and molecular level initiates the activation of transcription factor pathways, which in turn regulate the expression of a number of genes termed the “UV response genes”. Two such transcription factor families that are activated in this way are those of the nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) families. These two transcription factor families have been identified to be involved in the processes of cell proliferation, cell differentiation and cell survival and therefore play important roles in tumorigenesis. The study of these two transcription factor pathways and the cross-talk between them in response to UVB exposure may help with the development of new chemopreventive strategies for the prevention of UVB-induced skin carcinogenesis. PMID:17979627

  10. Peroxide-Sensing Transcriptional Regulators in Bacteria

    PubMed Central

    Mongkolsuk, Skorn

    2012-01-01

    The ability to maintain intracellular concentrations of toxic reactive oxygen species (ROS) within safe limits is essential for all aerobic life forms. In bacteria, as well as other organisms, ROS are produced during the normal course of aerobic metabolism, necessitating the constitutive expression of ROS scavenging systems. However, bacteria can also experience transient high-level exposure to ROS derived either from external sources, such as the host defense response, or as a secondary effect of other seemingly unrelated environmental stresses. Consequently, transcriptional regulators have evolved to sense the levels of ROS and coordinate the appropriate oxidative stress response. Three well-studied examples of these are the peroxide responsive regulators OxyR, PerR, and OhrR. OxyR and PerR are sensors of primarily H2O2, while OhrR senses organic peroxide (ROOH) and sodium hypochlorite (NaOCl). OxyR and OhrR sense oxidants by means of the reversible oxidation of specific cysteine residues. In contrast, PerR senses H2O2 via the Fe-catalyzed oxidation of histidine residues. These transcription regulators also influence complex biological phenomena, such as biofilm formation, the evasion of host immune responses, and antibiotic resistance via the direct regulation of specific proteins. PMID:22797754

  11. Post-Transcriptional Regulation of Interferons and Their Signaling Pathways

    PubMed Central

    2014-01-01

    Interferons (IFNs) are low molecular weight cell-derived proteins that include the type I, II, and III IFN families. IFNs are critical for an optimal immune response during microbial infections while dysregulated expression can lead to autoimmune diseases. Given its role in disease, it is important to understand cellular mechanisms of IFN regulation. 3′ untranslated regions (3′ UTRs) have emerged as potent regulators of mRNA and protein dosage and are controlled through multiple regulatory elements including adenylate uridylate (AU)-rich elements (AREs) and microRNA (miRNA) recognition elements. These AREs are targeted by RNA-binding proteins (ARE-BPs) for degradation and/or stabilization through an ARE-mediated decay process. miRNA are endogenous, single-stranded RNA molecules ∼22 nucleotides in length that regulate mRNA translation through the miRNA-induced silencing complex. IFN transcripts, like other labile mRNAs, harbor AREs in their 3′ UTRs that dictate the turnover of mRNA. This review is a survey of the literature related to IFN regulation by miRNA, ARE-BPs, and how these complexes interact dynamically on the 3′ UTR. Additionally, downstream effects of these post-transcriptional regulators on the immune response will be discussed. Review topics include past studies, current understanding, and future challenges in the study of post-transcriptional regulation affecting IFN responses. PMID:24702117

  12. Methylation Affects Transposition and Splicing of a Large CACTA Transposon from a MYB Transcription Factor Regulating Anthocyanin Synthase Genes in Soybean Seed Coats

    PubMed Central

    Zabala, Gracia; Vodkin, Lila O.

    2014-01-01

    We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-rm is homozygous for a mutable allele (rm) that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-rm line had a 13 kb CACTA subfamily transposon insertion (designated TgmR*) at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3) to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-rm progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element. PMID:25369033

  13. Notch signaling affects biliary fibrosis via transcriptional regulation of RBP-jκ in an animal model of chronic liver disease

    PubMed Central

    Lee, Sun-Jae; Kim, Kyung-Hyun; Pak, Sok Cheon; Kang, Yu-Na; Yoon, Ghil-Suk; Park, Kwan-Kyu

    2015-01-01

    Liver repair in patients with a chronic liver disease requires the orchestrated action of epithelial, mesenchymal, and inflammatory cells. Notch components are expressed in both the epithelial and mesenchymal compartments of the adult liver and are differentially regulated after injury. However, the functional role of Notch signaling in regulating epithelial/mesenchymal cross-talk during fibrogenic pathologic repair remains unknown. The aim of this study was to investigate how proliferation of the bile duct influences biliary fibrosis and to recognize the effect of inhibiting Notch signaling in biliary fibrotic tissue of the injured liver. We designed a synthetic decoy oligodeoxynucleotide (ODN) for recombination signal binding protein immunoglobulin kappa J (RBP-jκ), which is a common DNA-binding partner of Notch receptors. The effect of blocking RBP-jκ on fibrogenesis was assessed in the 3,5-Diethoxycarbonyl-1,4-dihydrocollidine (DDC) diet mouse model. We observed the reduced fibrosis and decreased expression of associated signaling molecules after the RBP-jκ decoy ODN treatment. These data demonstrate that Notch signaling may play an important role in progression of ductular reaction and fibrosis. Further studies are required to unveil how ductular cells interact with other liver cell types, such as hepatic stellate cells or Kupffer cells,in patients with cholestatic liver diseases based on Notch signaling. These results suggest that controlling the ductular reaction using a synthetic ring type decoy RBP-jκ ODN will help develop a novel therapeutic approach targeting biliary fibrosis in patients with chronic liver diseases. PMID:26722458

  14. Transcriptional regulation of cranial sensory placode development

    PubMed Central

    Moody, Sally A.; LaMantia, Anthony-Samuel

    2015-01-01

    Cranial sensory placodes derive from discrete patches of the head ectoderm, and give rise to numerous sensory structures. During gastrulation, a specialized “neural border zone” forms around the neural plate in response to interactions between the neural and non-neural ectoderm and signals from adjacent mesodermal and/or endodermal tissues. This zone subsequently gives rise to two distinct precursor populations of the peripheral nervous system: the neural crest and the pre-placodal ectoderm (PPE). The PPE is a common field from which all cranial sensory placodes arise (adenohypophyseal, olfactory, lens, trigeminal, epibranchial, otic). Members of the Six family of transcription factors are major regulators of PPE specification, in partnership with co-factor proteins such as Eya. Six gene activity also maintains tissue boundaries between the PPE, neural crest and epidermis by repressing genes that specify the fates of those adjacent ectodermally-derived domains. As the embryo acquires anterior-posterior identity, the PPE becomes transcriptionally regionalized, and it subsequently subdivides into specific placodes with distinct developmental fates in response to signaling from adjacent tissues. Each placode is characterized by a unique transcriptional program that leads to the differentiation of highly specialized cells, such as neurosecretory cells, somatic sensory receptor cells, chemosensory neurons, peripheral glia and supporting cells. In this review, we summarize the transcriptional and signaling factors that regulate key steps of placode development, influence subsequent sensory neuron specification, and discuss what is known about mutations in some of the essential PPE genes that underlie human congenital syndromes. PMID:25662264

  15. Transcriptional regulation of topology modulators and transcription regulators of Mycobacterium tuberculosis.

    PubMed

    Ghosh, Soumitra; Padmanabhan, Bhavna; Godbole, Adwait Anand; Tare, Priyanka; Ahmed, Wareed; Vasu, Kommireddy; China, Arnab; Kumar, Rupesh; Mitra, Anirban; Nagaraja, Valakunja

    2016-07-01

    Mycobacterium tuberculosis (Mtb) is a formidable pathogen which has the ability to survive the hostile environment of the host by evading the host defense system. The re-configuration of its transcriptional and metabolic process allows the pathogen to confront the adverse environment within the host macrophages. The factors that assist the transcription and modulate the DNA topology would have to play a key role in the regulation of global gene expression of the organism. How transcription of these essential housekeeping genes alters in response to growth conditions and environmental stress has not been addressed together in a set of experimental conditions in Mtb. Now, we have mapped the transcription start sites (TSS) and promoters of several genes that play a central role in the regulation of DNA topology and transcription in Mtb. Using in vivo reporter assays, we validated the activity of the identified promoter elements in different growth conditions. The variation in transcript abundance of these essential genes was also analyzed in growth phase-dependent manner. These data provide the first glimpse into the specific adaptive changes in the expression of genes involved in transcription and DNA topology modulation in Mtb.

  16. Transcriptional and posttranscriptional regulation of cyanobacterial photosynthesis.

    PubMed

    Wilde, Annegret; Hihara, Yukako

    2016-03-01

    Cyanobacteria are well established model organisms for the study of oxygenic photosynthesis, nitrogen metabolism, toxin biosynthesis, and salt acclimation. However, in comparison to other model bacteria little is known about regulatory networks, which allow cyanobacteria to acclimate to changing environmental conditions. The current work has begun to illuminate how transcription factors modulate expression of different photosynthetic regulons. During the past few years, the research on other regulatory principles like RNA-based regulation showed the importance of non-protein regulators for bacterial lifestyle. Investigations on modulation of photosynthetic components should elucidate the contributions of all factors within the context of a larger regulatory network. Here, we focus on regulation of photosynthetic processes including transcriptional and posttranscriptional mechanisms, citing examples from a limited number of cyanobacterial species. Though, the general idea holds true for most species, important differences exist between various organisms, illustrating diversity of acclimation strategies in the very heterogeneous cyanobacterial clade. This article is part of a Special Issue entitled Organization and dynamics of bioenergetic systems in bacteria, edited by Prof Conrad Mullineaux.

  17. Transcriptional regulation of plant phosphate transporters

    PubMed Central

    Muchhal, Umesh S.; Raghothama, K. G.

    1999-01-01

    Phosphorus is acquired by plant roots primarily via the high-affinity inorganic phosphate (Pi) transporters. The transcripts for Pi transporters are highly inducible upon Pi starvation, which also results in enhanced Pi uptake when Pi is resupplied. Using antibodies specific to one of the tomato Pi transporters (encoded by LePT1), we show that an increase in the LePT1 transcript under Pi starvation leads to a concurrent increase in the transporter protein, suggesting a transcriptional regulation for Pi acquisition. LePT1 protein accumulates rapidly in tomato roots in response to Pi starvation. The level of transporter protein accumulation depends on the Pi concentration in the medium, and it is reversible upon resupply of Pi. LePT1 protein accumulates all along the roots under Pi starvation and is localized primarily in the plasma membranes. These results clearly demonstrate that plants increase their capacity for Pi uptake during Pi starvation by synthesis of additional transporter molecules. PMID:10318976

  18. IKAROS: a multifunctional regulator of the polymerase II transcription cycle.

    PubMed

    Bottardi, Stefania; Mavoungou, Lionel; Milot, Eric

    2015-09-01

    Transcription factors are important determinants of lineage specification during hematopoiesis. They favor recruitment of cofactors involved in epigenetic regulation, thereby defining patterns of gene expression in a development- and lineage-specific manner. Additionally, transcription factors can facilitate transcription preinitiation complex (PIC) formation and assembly on chromatin. Interestingly, a few lineage-specific transcription factors, including IKAROS, also regulate transcription elongation. IKAROS is a tumor suppressor frequently inactivated in leukemia and associated with a poor prognosis. It forms a complex with the nucleosome remodeling and deacetylase (NuRD) complex and the positive transcription elongation factor b (P-TEFb), which is required for productive transcription elongation. It has also been reported that IKAROS interacts with factors involved in transcription termination. Here we review these and other recent findings that establish IKAROS as the first transcription factor found to act as a multifunctional regulator of the transcription cycle in hematopoietic cells.

  19. Approaches to characterizing Entamoeba histolytica transcriptional regulation.

    PubMed

    Pearson, Richard J; Singh, Upinder

    2010-12-01

    Entamoeba histolytica causes an estimated 100,000 deaths per year and is one of the leading causes of death among parasitic infections. Studies using E. histolytica-specific polymerase chain reaction identified that 13.8% of adults in a rural Mexican community and 11.2% of adults in central Vietnam are asymptomatically colonized. Such high incidents of asymptomatic infection suggest that only a minority of infections proceed to invasive disease. Understanding the mechanisms that underpin variable disease outcome will be critical in developing therapeutic strategies. In recent years there have been a plethora of gene expression profiling data documenting the transcriptome differences between virulent and non-virulent strains of E. histolytica as well as changes induced by external environmental changes or stimuli. While these studies have successfully identified co-regulated genes and potential virulence factors, there is still little known about the transcriptional mechanisms that induce the changes observed in this non-model organism. In this review, we have looked at how molecular technological advances have shaped our understanding of transcriptional regulation in amoeba and what we may expect from the application of powerful new techniques. PMID:20812994

  20. Asymmetric Regulation of Peripheral Genes by Two Transcriptional Regulatory Networks

    PubMed Central

    Li, Jing-Ru; Suzuki, Takahiro; Nishimura, Hajime; Kishima, Mami; Maeda, Shiori; Suzuki, Harukazu

    2016-01-01

    Transcriptional regulatory network (TRN) reconstitution and deconstruction occur simultaneously during reprogramming; however, it remains unclear how the starting and targeting TRNs regulate the induction and suppression of peripheral genes. Here we analyzed the regulation using direct cell reprogramming from human dermal fibroblasts to monocytes as the platform. We simultaneously deconstructed fibroblastic TRN and reconstituted monocytic TRN; monocytic and fibroblastic gene expression were analyzed in comparison with that of fibroblastic TRN deconstruction only or monocytic TRN reconstitution only. Global gene expression analysis showed cross-regulation of TRNs. Detailed analysis revealed that knocking down fibroblastic TRN positively affected half of the upregulated monocytic genes, indicating that intrinsic fibroblastic TRN interfered with the expression of induced genes. In contrast, reconstitution of monocytic TRN showed neutral effects on the majority of fibroblastic gene downregulation. This study provides an explicit example that demonstrates how two networks together regulate gene expression during cell reprogramming processes and contributes to the elaborate exploration of TRNs. PMID:27483142

  1. Regulation of His4 Expression by the Saccharomyces Cerevisiae Sin4 Transcriptional Regulator

    PubMed Central

    Jiang, Y. W.; Stillman, D. J.

    1995-01-01

    The yeast SIN4 gene functions in the transcriptional activation and repression of diverse yeast genes. Previous experiments suggest a sin4 mutation affects chromatin structure and thus alters transcriptional regulation. In this report we show that SIN4 is required for full expression of the HIS4, Ty1, and MATα genes, in addition to the previously described SIN4-dependence of CTS1 expression. All of these genes contain within their promoters a binding site for the Rap1p transcriptional regulator. However, SIN4 does not play a direct role either in transcriptional activation or repression by Rap1p. The HIS4 gene can be activated by either of two pathways, the basal or the inducible pathway, and experiments are described that show that a sin4 mutation affects both pathways. It was shown previously that mutation of the Rap1p binding site in the HIS4 promoter causes a similar effect on HIS4 expression and that this promoter mutation also causes a change in chromatin structure. The SNF2/SWI2 gene is also required for full HIS4 expression, and we show that a sin4 snf2 double mutant is not synergistic compared to either single mutant. We show that nucleosomes are positioned at the HIS4 promoter and that this positioning is disrupted in a snf2 mutant but not in a sin4 mutant. These findings suggest that SIN4 plays a distinct role in transcriptional regulation. PMID:7635278

  2. Transcriptional regulation of pyruvate dehydrogenase kinase.

    PubMed

    Jeong, Ji Yun; Jeoung, Nam Ho; Park, Keun-Gyu; Lee, In-Kyu

    2012-10-01

    The pyruvate dehydrogenase complex (PDC) activity is crucial to maintains blood glucose and ATP levels, which largely depends on the phosphorylation status by pyruvate dehydrogenase kinase (PDK) isoenzymes. Although it has been reported that PDC is phosphorylated and inactivated by PDK2 and PDK4 in metabolically active tissues including liver, skeletal muscle, heart, and kidney during starvation and diabetes, the precise mechanisms by which expression of PDK2 and PDK4 are transcriptionally regulated still remains unclear. Insulin represses the expression of PDK2 and PDK4 via phosphorylation of FOXO through PI3K/Akt signaling pathway. Several nuclear hormone receptors activated due to fasting or increased fat supply, including peroxisome proliferator-activated receptors, glucocorticoid receptors, estrogen-related receptors, and thyroid hormone receptors, also participate in the up-regulation of PDK2 and PDK4; however, the endogenous ligands that bind those nuclear receptors have not been identified. It has been recently suggested that growth hormone, adiponectin, epinephrine, and rosiglitazone also control the expression of PDK4 in tissue-specific manners. In this review, we discuss several factors involved in the expressional regulation of PDK2 and PDK4, and introduce current studies aimed at providing a better understanding of the molecular mechanisms that underlie the development of metabolic diseases such as diabetes. PMID:23130316

  3. Post-transcriptional regulation in budding yeast meiosis.

    PubMed

    Jin, Liang; Neiman, Aaron M

    2016-05-01

    The precise regulation of gene expression is essential for developmental processes in eukaryotic organisms. As an important post-transcriptional regulatory point, translational control is complementary to transcriptional regulation. Sporulation in the budding yeast Saccharomyces cerevisiae is a developmental process controlled by a well-studied transcriptional cascade that drives the cell through the events of DNA replication, meiotic chromosome segregation, and spore assembly. Recent studies have revealed that as cells begin the meiotic divisions, translational regulation of gene expression fine tunes this transcriptional cascade. The significance and mechanisms of this translational regulation are beginning to emerge. These studies may also provide insights into translational regulation in germ cell development of multicellular organisms.

  4. Coordinated Evolution of Transcriptional and Post-Transcriptional Regulation for Mitochondrial Functions in Yeast Strains

    PubMed Central

    Guo, Xiaoxian; Li, Hongye; Gu, Zhenglong

    2016-01-01

    Evolution of gene regulation has been proposed to play an important role in environmental adaptation. Exploring mechanisms underlying coordinated evolutionary changes at various levels of gene regulation could shed new light on how organism adapt in nature. In this study, we focused on regulatory differences between a laboratory Saccharomyces cerevisiae strain BY4742 and a pathogenic S. cerevisiae strain, YJM789. The two strains diverge in many features, including growth rate, morphology, high temperature tolerance, and pathogenicity. Our RNA-Seq and ribosomal footprint profiling data showed that gene expression differences are pervasive, and genes functioning in mitochondria are mostly divergent between the two strains at both transcriptional and translational levels. Combining functional genomics data from other yeast strains, we further demonstrated that significant divergence of expression for genes functioning in the electron transport chain (ETC) was likely caused by differential expression of a transcriptional factor, HAP4, and that post-transcriptional regulation mediated by an RNA-binding protein, PUF3, likely led to expression divergence for genes involved in mitochondrial translation. We also explored mito-nuclear interactions via mitochondrial DNA replacement between strains. Although the two mitochondrial genomes harbor substantial sequence divergence, neither growth nor gene expression were affected by mitochondrial DNA replacement in both fermentative and respiratory growth media, indicating compatible mitochondrial and nuclear genomes between these two strains in the tested conditions. Collectively, we used mitochondrial functions as an example to demonstrate for the first time that evolution at both transcriptional and post-transcriptional levels could lead to coordinated regulatory changes underlying strain specific functional variations. PMID:27077367

  5. Transcriptional Regulation of Mononuclear Phagocyte Development

    PubMed Central

    Tussiwand, Roxane; Gautier, Emmanuel L.

    2015-01-01

    Mononuclear phagocytes (MP) are a quite unique subset of hematopoietic cells, which comprise dendritic cells (DC), monocytes as well as monocyte-derived and tissue-resident macrophages. These cells are extremely diverse with regard to their origin, their phenotype as well as their function. Developmentally, DC and monocytes are constantly replenished from a bone marrow hematopoietic progenitor. The ontogeny of macrophages is more complex and is temporally linked and specified by the organ where they reside, occurring early during embryonic or perinatal life. The functional heterogeneity of MPs is certainly a consequence of the tissue of residence and also reflects the diverse ontogeny of the subsets. In this review, we will highlight the developmental pathways of murine MP, with a particular emphasis on the transcriptional factors that regulate their development and function. Finally, we will discuss and point out open questions in the field. PMID:26539196

  6. Method to determine transcriptional regulation pathways in organisms

    SciTech Connect

    Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah

    2012-11-06

    The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.

  7. The transcription factor Zeb2 regulates signaling in mast cells.

    PubMed

    Barbu, Emilia Alina; Zhang, Juan; Berenstein, Elsa H; Groves, Jacqueline R; Parks, Lauren M; Siraganian, Reuben P

    2012-06-15

    Mast cell activation results in the release of stored and newly synthesized inflammatory mediators. We found that Zeb2 (also named Sip1, Zfhx1b), a zinc finger transcription factor, regulates both early and late mast cell responses. Transfection with small interfering RNA (siRNA) reduced Zeb2 expression and resulted in decreased FcεRI-mediated degranulation, with a parallel reduction in receptor-induced activation of NFAT and NF-κB transcription factors, but an enhanced response to the LPS-mediated activation of NF-κB. There was variable and less of a decrease in the Ag-mediated release of the cytokines TNF-α, IL-13, and CCL-4. This suggests that low Zeb2 expression differentially regulates signaling pathways in mast cells. Multiple phosphorylation events were impaired that affected molecules both at early and late events in the signaling pathway. The Zeb2 siRNA-treated mast cells had altered cell cycle progression, as well as decreased expression of several molecules including cell surface FcεRI and its β subunit, Gab2, phospholipase-Cγ1, and phospholipase-Cγ2, all of which are required for receptor-induced signal transduction. The results indicate that the transcription factor Zeb2 controls the expression of molecules thereby regulating signaling in mast cells.

  8. WRKY Transcription Factors: Molecular Regulation and Stress Responses in Plants

    PubMed Central

    Phukan, Ujjal J.; Jeena, Gajendra S.; Shukla, Rakesh K.

    2016-01-01

    Plants in their natural habitat have to face multiple stresses simultaneously. Evolutionary adaptation of developmental, physiological, and biochemical parameters give advantage over a single window of stress but not multiple. On the other hand transcription factors like WRKY can regulate diverse responses through a complicated network of genes. So molecular orchestration of WRKYs in plant may provide the most anticipated outcome of simultaneous multiple responses. Activation or repression through W-box and W-box like sequences is regulated at transcriptional, translational, and domain level. Because of the tight regulation involved in specific recognition and binding of WRKYs to downstream promoters, they have become promising candidate for crop improvement. Epigenetic, retrograde and proteasome mediated regulation enable WRKYs to attain the dynamic cellular homeostatic reprograming. Overexpression of several WRKYs face the paradox of having several beneficial affects but with some unwanted traits. These overexpression-associated undesirable phenotypes need to be identified and removed for proper growth, development and yeild. Taken together, we have highlighted the diverse regulation and multiple stress response of WRKYs in plants along with the future prospects in this field of research. PMID:27375634

  9. Transcriptional regulation of glial cell specification.

    PubMed

    Ragone, Gianluca; Van De Bor, Véronique; Sorrentino, Sandro; Kammerer, Martial; Galy, Anne; Schenck, Annette; Bernardoni, Roberto; Miller, Alita A; Roy, Nivedita; Giangrande, Angela

    2003-03-01

    Neuronal differentiation relies on proneural factors that also integrate positional information and contribute to the specification of the neuronal type. The molecular pathway triggering glial specification is not understood yet. In Drosophila, all lateral glial precursors and glial-promoting activity have been identified, which provides us with a unique opportunity to dissect the regulatory pathways controlling glial differentiation and specification. Although glial lineages are very heterogeneous with respect to position, time of differentiation, and lineage tree, they all express and require two homologous genes, glial cell deficient/glial cell missing (glide/gcm) and glide2, that act in concert, with glide/gcm constituting the major glial-promoting factor. Here, we show that glial specification resides in glide/gcm transcriptional regulation. The glide/gcm promoter contains lineage-specific elements as well as quantitative and turmoil elements scattered throughout several kilobases. Interestingly, there is no correlation between a specific regulatory element and the type of glial lineage. Thus, the glial-promoting factor acts as a naive switch-on button that triggers gliogenesis in response to multiple pathways converging onto its promoter. Both negative and positive regulation are required to control glide/gcm expression, indicating that gliogenesis is actively repressed in some neural lineages. PMID:12618139

  10. A WRKY Transcription Factor Regulates Fe Translocation under Fe Deficiency.

    PubMed

    Yan, Jing Ying; Li, Chun Xiao; Sun, Li; Ren, Jiang Yuan; Li, Gui Xin; Ding, Zhong Jie; Zheng, Shao Jian

    2016-07-01

    Iron (Fe) deficiency affects plant growth and development, leading to reduction of crop yields and quality. Although the regulation of Fe uptake under Fe deficiency has been well studied in the past decade, the regulatory mechanism of Fe translocation inside the plants remains unknown. Here, we show that a WRKY transcription factor WRKY46 is involved in response to Fe deficiency. Lack of WRKY46 (wrky46-1 and wrky46-2 loss-of-function mutants) significantly affects Fe translocation from root to shoot and thus causes obvious chlorosis on the new leaves under Fe deficiency. Gene expression analysis reveals that expression of a nodulin-like gene (VACUOLAR IRON TRANSPORTER1-LIKE1 [VITL1]) is dramatically increased in wrky46-1 mutant. VITL1 expression is inhibited by Fe deficiency, while the expression of WRKY46 is induced in the root stele. Moreover, down-regulation of VITL1 expression can restore the chlorosis phenotype on wrky46-1 under Fe deficiency. Further yeast one-hybrid and chromatin immunoprecipitation experiments indicate that WRKY46 is capable of binding to the specific W-boxes present in the VITL1 promoter. In summary, our results demonstrate that WRKY46 plays an important role in the control of root-to-shoot Fe translocation under Fe deficiency condition via direct regulation of VITL1 transcript levels. PMID:27208259

  11. Statins and transcriptional regulation: The FXR connection

    SciTech Connect

    Habeos, Ioannis; Ziros, Panos G.; Psyrogiannis, Agathoklis; Vagenakis, Apostolos G.; Papavassiliou, Athanasios G. . E-mail: papavas@med.upatras.gr

    2005-08-26

    Farnesoid X receptor (FXR) is a nuclear receptor involved in lipoprotein as well as glucose metabolism. Statins are widely used hypolipidemic agents with many pleiotropic actions. It is known that statins affect other nuclear hormone receptors, but no reports are available on the effect of these drugs on FXR. Employing an animal model (Syrian hamsters), we hereby present evidence to demonstrate that Simvastatin, a broadly prescribed statin, decreases the expression of FXR at both the RNA and protein levels and down-regulates its DNA-binding activity. This novel property may have important implications on the mode statins influence on lipoprotein and carbohydrate homeostasis in the organism.

  12. Transcriptional Regulation of the Pancreatic Islet: Implications for Islet Function

    PubMed Central

    Stitzel, Michael L.; Kycia, Ina; Kursawe, Romy; Ucar, Duygu

    2015-01-01

    Islets of Langerhans contain multiple hormone-producing endocrine cells controlling glucose homeostasis. Transcription establishes and maintains islet cellular fates and identities. Genetic and environmental disruption of islet transcription triggers cellular dysfunction and disease. Early transcriptional regulation studies of specific islet genes, including insulin (INS) and the transcription factor PDX1, identified the first cis-regulatory DNA sequences and trans-acting factors governing islet function. Here, we review how human islet “omics” studies are reshaping our understanding of transcriptional regulation in islet (dys)function and diabetes. First, we highlight the expansion of islet transcript number, form, and function and of DNA transcriptional regulatory elements controlling their production. Next, we cover islet transcriptional effects of genetic and environmental perturbation. Finally, we discuss how these studies’ emerging insights should empower our diabetes research community to build mechanistic understanding of diabetes pathophysiology and to equip clinicians with tailored, precision medicine options to prevent and treat islet dysfunction and diabetes. PMID:26272056

  13. L-type Calcium Channel Auto-Regulation of Transcription

    PubMed Central

    Satin, Jonathan; Schroder, Elizabeth A.; Crump, Shawn M.

    2011-01-01

    L-type calcium channels (LTCC) impact the function of nearly all excitable cells. The classical LTCC function is to mediate trans-sarcolemmal Ca2+ flux. This review focuses on the contribution of a mobile segment of the LTCC that regulates ion channel function, and also serves as a regulator of transcription in the nucleus. Specifically we highlight recent work demonstrating an auto-feedback regulatory pathway whereby the LTCC transcription factor regulates the LTCC. Also discussed is acute and long-term regulation of function by the LTCC-transcription regulator. PMID:21295347

  14. The Lrp family of transcription regulators in archaea.

    PubMed

    Peeters, Eveline; Charlier, Daniel

    2010-11-30

    Archaea possess a eukaryotic-type basal transcription apparatus that is regulated by bacteria-like transcription regulators. A universal and abundant family of transcription regulators are the bacterial/archaeal Lrp-like regulators. The Lrp family is one of the best studied regulator families in archaea, illustrated by investigations of proteins from the archaeal model organisms: Sulfolobus, Pyrococcus, Methanocaldococcus, and Halobacterium. These regulators are extremely versatile in their DNA-binding properties, response to effector molecules, and molecular regulatory mechanisms. Besides being involved in the regulation of the amino acid metabolism, they also regulate central metabolic processes. It appears that these regulatory proteins are also involved in large regulatory networks, because of hierarchical regulations and the possible combinatorial use of different Lrp-like proteins. Here, we discuss the recent developments in our understanding of this important class of regulators.

  15. The Role of Notch Receptors in Transcriptional Regulation

    PubMed Central

    WANG, HONGFANG; ZANG, CHONGZHI; LIU, X. SHIRLEY; ASTER, JON C.

    2015-01-01

    Notch signaling has pleiotropic context-specific functions that have essential roles in many processes, including embryonic development and maintenance and homeostasis of adult tissues. Aberrant Notch signaling (both hyper- and hypoactive) is implicated in a number of human developmental disorders and many cancers. Notch receptor signaling is mediated by tightly regulated proteolytic cleavages that lead to the assembly of a nuclear Notch transcription complex, which drives the expression of downstream target genes and thereby executes Notch’s functions. Thus, understanding regulation of gene expression by Notch is central to deciphering how Notch carries out its many activities. Here, we summarize the recent findings pertaining to the complex interplay between the Notch transcriptional complex and interacting factors involved in transcriptional regulation, including co-activators, cooperating transcription factors, and chromatin regulators, and discuss emerging data pertaining to the role of Notch-regulated noncoding RNAs in transcription. PMID:25418913

  16. Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria.

    PubMed

    Troxell, Bryan; Hassan, Hosni M

    2013-01-01

    In the ancient anaerobic environment, ferrous iron (Fe(2+)) was one of the first metal cofactors. Oxygenation of the ancient world challenged bacteria to acquire the insoluble ferric iron (Fe(3+)) and later to defend against reactive oxygen species (ROS) generated by the Fenton chemistry. To acquire Fe(3+), bacteria produce low-molecular weight compounds, known as siderophores, which have extremely high affinity for Fe(3+). However, during infection the host restricts iron from pathogens by producing iron- and siderophore-chelating proteins, by exporting iron from intracellular pathogen-containing compartments, and by limiting absorption of dietary iron. Ferric Uptake Regulator (Fur) is a transcription factor which utilizes Fe(2+) as a corepressor and represses siderophore synthesis in pathogens. Fur, directly or indirectly, controls expression of enzymes that protect against ROS damage. Thus, the challenges of iron homeostasis and defense against ROS are addressed via Fur. Although the role of Fur as a repressor is well-documented, emerging evidence demonstrates that Fur can function as an activator. Fur activation can occur through three distinct mechanisms (1) indirectly via small RNAs, (2) binding at cis regulatory elements that enhance recruitment of the RNA polymerase holoenzyme (RNAP), and (3) functioning as an antirepressor by removing or blocking DNA binding of a repressor of transcription. In addition, Fur homologs control defense against peroxide stress (PerR) and control uptake of other metals such as zinc (Zur) and manganese (Mur) in pathogenic bacteria. Fur family members are important for virulence within bacterial pathogens since mutants of fur, perR, or zur exhibit reduced virulence within numerous animal and plant models of infection. This review focuses on the breadth of Fur regulation in pathogenic bacteria.

  17. HnRNP-like proteins as post-transcriptional regulators.

    PubMed

    Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

    2014-10-01

    Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses.

  18. HnRNP-like proteins as post-transcriptional regulators.

    PubMed

    Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

    2014-10-01

    Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. PMID:25219311

  19. Methylation of an intragenic alternative promoter regulates transcription of GARP.

    PubMed

    Haupt, Sonja; Söntgerath, Viktoria Sophie Apollonia; Leipe, Jan; Schulze-Koops, Hendrik; Skapenko, Alla

    2016-02-01

    Alternative promoter usage has been proposed as a mechanism regulating transcriptional and translational diversity in highly elaborated systems like the immune system in humans. Here, we report that transcription of human glycoprotein A repetitions predominant (GARP) in regulatory CD4 T cells (Tregs) is tightly regulated by two alternative promoters. An intragenic promoter contains several CpGs and acts as a weak promoter that is demethylated and initiates transcription Treg-specifically. The strong up-stream promoter containing a CpG-island is, in contrast, fully demethylated throughout tissues. Transcriptional activity of the strong promoter was surprisingly down-regulated upon demethylation of the weak promoter. This demethylation-induced transcriptional attenuation regulated the magnitude of GARP expression and correlated with disease activity in rheumatoid arthritis. Treg-specific GARP transcription was initiated by synergistic interaction of forkhead box protein 3 (Foxp3) with nuclear factor of activated T cells (NFAT) and was underpinned by permissive chromatin remodeling caused by release of the H3K4 demethylase, PLU-1. Our findings describe a novel function of alternative promoters in regulating the extent of transcription. Moreover, since GARP functions as a transporter of transforming growth factor β (TGFβ), a cytokine with broad pleiotropic traits, GARP transcriptional attenuation by alternative promoters might provide a mechanism regulating peripheral TGFβ to avoid unwanted harmful effects.

  20. Transcription factor networks regulating hepatic fatty acid metabolism.

    PubMed

    Karagianni, Panagiota; Talianidis, Iannis

    2015-01-01

    Tight regulation of lipid levels is critical for cellular and organismal homeostasis, not only in terms of energy utilization and storage, but also to prevent potential toxicity. The liver utilizes a set of hepatic transcription factors to regulate the expression of genes implicated in all aspects of lipid metabolism including catabolism, transport, and synthesis. In this article, we will review the main transcriptional mechanisms regulating the expression of genes involved in hepatic lipid metabolism. The principal regulatory pathways are composed of simple modules of transcription factor crosstalks, which correspond to building blocks of more complex regulatory networks. These transcriptional networks contribute to the regulation of proper lipid homeostasis in parallel to posttranslational mechanisms and end product-mediated modulation of lipid metabolizing enzymes. This article is part of a Special Issue entitled Linking transcription to physiology in lipodomics.

  1. Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.

    PubMed

    Campbell, Christopher T; Kolesar, Jill E; Kaufman, Brett A

    2012-01-01

    Mitochondrial transcription factor A (mtTFA, mtTF1, TFAM) is an essential protein that binds mitochondrial DNA (mtDNA) with and without sequence specificity to regulate both mitochondrial transcription initiation and mtDNA copy number. The abundance of mtDNA generally reflects TFAM protein levels; however, the precise mechanism(s) by which this occurs remains a matter of debate. Data suggest that the usage of mitochondrial promoters is regulated by TFAM dosage, allowing TFAM to affect both gene expression and RNA priming for first strand mtDNA replication. Additionally, TFAM has a non-specific DNA binding activity that is both cooperative and high affinity. TFAM can compact plasmid DNA in vitro, suggesting a structural role for the non-specific DNA binding activity in genome packaging. This review summarizes TFAM-mtDNA interactions and describes an emerging view of TFAM as a multipurpose coordinator of mtDNA transactions, with direct consequences for the maintenance of gene expression and genome copy number. This article is part of a Special Issue entitled: Mitochondrial Gene Expression. PMID:22465614

  2. A Genome-wide Screen for Neurospora crassa Transcription Factors Regulating Glycogen Metabolism*

    PubMed Central

    Gonçalves, Rodrigo Duarte; Cupertino, Fernanda Barbosa; Freitas, Fernanda Zanolli; Luchessi, Augusto Ducati; Bertolini, Maria Célia

    2011-01-01

    Transcription factors play a key role in transcription regulation as they recognize and directly bind to defined sites in promoter regions of target genes, and thus modulate differential expression. The overall process is extremely dynamic, as they have to move through the nucleus and transiently bind to chromatin in order to regulate gene transcription. To identify transcription factors that affect glycogen accumulation in Neurospora crassa, we performed a systematic screen of a deletion strains set generated by the Neurospora Knockout Project and available at the Fungal Genetics Stock Center. In a wild-type strain of N. crassa, glycogen content reaches a maximal level at the end of the exponential growth phase, but upon heat stress the glycogen content rapidly drops. The gene encoding glycogen synthase (gsn) is transcriptionally down-regulated when the mycelium is exposed to the same stress condition. We identified 17 deleted strains having glycogen accumulation profiles different from that of the wild-type strain under both normal growth and heat stress conditions. Most of the transcription factors identified were annotated as hypothetical protein, however some of them, such as the PacC, XlnR, and NIT2 proteins, were biochemically well-characterized either in N. crassa or in other fungi. The identification of some of the transcription factors was coincident with the presence of DNA-binding motifs specific for the transcription factors in the gsn 5′-flanking region, and some of these DNA-binding motifs were demonstrated to be functional by Electrophoretic Mobility Shift Assay (EMSA) experiments. Strains knocked-out in these transcription factors presented impairment in the regulation of gsn expression, suggesting that the transcription factors regulate glycogen accumulation by directly regulating gsn gene expression. Five selected mutant strains showed defects in cell cycle progression, and two transcription factors were light-regulated. The results indicate

  3. The Affective Regulation of Cognitive Priming

    PubMed Central

    Storbeck, Justin; Clore, Gerald L.

    2008-01-01

    Semantic and affective priming are classic effects observed in cognitive and social psychology, respectively. We discovered that affect regulates such priming effects. In Experiment 1, positive and negative moods were induced prior to one of three priming tasks; evaluation, categorization, or lexical decision. As predicted, positive affect led to both affective priming (evaluation task) and semantic priming (category and lexical decision tasks). However, negative affect inhibited such effects. In Experiment 2, participants in their natural affective state completed the same priming tasks as in Experiment 1. As expected, affective priming (evaluation task) and category priming (categorization and lexical decision tasks) were observed in such resting affective states. Hence, we conclude that negative affect inhibits semantic and affective priming. These results support recent theoretical models, which suggest that positive affect promotes associations among strong and weak concepts, and that negative affect impairs such associations (Kuhl, 2000; Clore & Storbeck, 2006). PMID:18410195

  4. Transcriptional regulation of IL-2 in health and autoimmunity

    PubMed Central

    Crispín, José C.; Tsokos, George C.

    2009-01-01

    The regulation of IL-2 production is central to our understanding of the immune system. Key during T cell activation, it also plays an essential role in the regulation of the immune response. This review discusses the function of recently described factors that modulate transcription and chromatin remodeling at the IL2 promoter. Also, it addresses the role of FoxP3 as a transcriptional regulator in conventional T cells and regulatory T cells, and the mechanisms whereby CD28 stabilizes IL2 transcription and translation. Finally, the alterations that prevent T cells from SLE patients from producing normal amounts of IL-2 upon stimulation are described. PMID:18723131

  5. Transcriptional Regulation in Saccharomyces cerevisiae: Transcription Factor Regulation and Function, Mechanisms of Initiation, and Roles of Activators and Coactivators

    PubMed Central

    Hahn, Steven; Young, Elton T.

    2011-01-01

    Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422

  6. Using targeted chromatin regulators to engineer combinatorial and spatial transcriptional regulation.

    PubMed

    Keung, Albert J; Bashor, Caleb J; Kiriakov, Szilvia; Collins, James J; Khalil, Ahmad S

    2014-07-01

    The transcription of genomic information in eukaryotes is regulated in large part by chromatin. How a diverse array of chromatin regulator (CR) proteins with different functions and genomic localization patterns coordinates chromatin activity to control transcription remains unclear. Here, we take a synthetic biology approach to decipher the complexity of chromatin regulation by studying emergent transcriptional behaviors from engineered combinatorial, spatial, and temporal patterns of individual CRs. We fuse 223 yeast CRs to programmable zinc finger proteins. Site-specific and combinatorial recruitment of CRs to distinct intralocus locations reveals a range of transcriptional logic and behaviors, including synergistic activation, long-range and spatial regulation, and gene expression memory. Comparing these transcriptional behaviors with annotated CR complex and function terms provides design principles for the engineering of transcriptional regulation. This work presents a bottom-up approach to investigating chromatin-mediated transcriptional regulation and introduces chromatin-based components and systems for synthetic biology and cellular engineering.

  7. The transcriptional repressor Hes1 attenuates inflammation by regulating transcription elongation.

    PubMed

    Shang, Yingli; Coppo, Maddalena; He, Teng; Ning, Fei; Yu, Li; Kang, Lan; Zhang, Bin; Ju, Chanyang; Qiao, Yu; Zhao, Baohong; Gessler, Manfred; Rogatsky, Inez; Hu, Xiaoyu

    2016-08-01

    Most of the known regulatory mechanisms that curb inflammatory gene expression target pre-transcription-initiation steps, and evidence for post-initiation regulation of inflammatory gene expression remains scarce. We found that the transcriptional repressor Hes1 suppressed production of CXCL1, a chemokine that is crucial for recruiting neutrophils. Hes1 negatively regulated neutrophil recruitment in vivo in a manner that was dependent on macrophage-produced CXCL1, and it attenuated the severity of inflammatory arthritis. Mechanistically, inhibition of Cxcl1 expression by Hes1 did not involve modification of transcription initiation. Instead, Hes1 inhibited signal-induced recruitment of the positive transcription-elongation complex P-TEFb and thereby prevented phosphorylation of RNA polymerase II at Ser2 and productive elongation. Thus, our results identify Hes1 as a homeostatic suppressor of inflammatory responses that exerts its suppressive function by regulating transcription elongation.

  8. Effects of the lifestyle habits in breast cancer transcriptional regulation.

    PubMed

    Pérez-Solis, Marco Allán; Maya-Nuñez, Guadalupe; Casas-González, Patricia; Olivares, Aleida; Aguilar-Rojas, Arturo

    2016-01-01

    Through research carried out in the last 25 years about the breast cancer etiology, it has been possible to estimate that less than 10 % of patients who are diagnosed with the condition are carriers of some germline or somatic mutation. The clinical reports of breast cancer patients with healthy twins and the development of disease in women without high penetrance mutations detected, warn the participation more factors in the transformation process. The high incidence of mammary adenocarcinoma in the modern woman and the urgent need for new methods of prevention and early detection have demanded more information about the role that environment and lifestyle have on the transformation of mammary gland epithelial cells. Obesity, alcoholism and smoking are factors that have shown a close correlation with the risk of developing breast cancer. And although these conditions affect different cell regulation levels, the study of its effects in the mechanisms of transcriptional and epigenetic regulation is considered critical for a better understanding of the loss of identity of epithelial cells during carcinogenesis of this tissue. The main objective of this review was to establish the importance of changes occurring to transcriptional level in the mammary gland as a consequence of acute or chronic exposure to harmful products such as obesity-causing foods, ethanol and cigarette smoke components. At analyze the main studies related to topic, it has concluded that the understanding of effects caused by the lifestyle factors in performance of the transcriptional mechanisms that determine gene expression of the mammary gland epithelial cells, may help explain the development of this disease in women without genetic propensity and different phenotypic manifestations of this cancer type.

  9. Dietary polyunsaturated fatty acid regulation of gene transcription.

    PubMed

    Clarke, S D; Jump, D B

    1994-01-01

    We have known for nearly 30 years that dietary polyenoic (n-6) and (n-3) fatty acids potentially inhibit hepatic fatty acid biosynthesis. The teleological explanation for this unique action of PUFAs resides in their ability to suppress the synthesis of (n-9) fatty acids. By inhibiting fatty acid biosynthesis, dietary PUFAs reduce the availability of substrate for delta 9 desaturase (7, 22, 34, 36) and in turn reduce the availability of (n-9) fatty acids for incorporation into plasma membranes. In this way, essential biological processes dependent on essential fatty acids (e.g. reproduction and trans-dermal water loss) continue to operate normally. Therefore, if essential fatty acid intake did not regulate (n-9) fatty acid synthesis, the survival of the organism would be threatened. During the past 20 years, we have gradually elucidated the cellular and molecular mechanisms by which dietary PUFAs modulate fatty acid biosynthesis and (n-9) fatty acid availability. Central to this mechanism has been our ability to determine that dietary PUFAs regulate the transcription of genes coding for lipogenic enzymes (12, 40). The potential mechanisms by which PUFAs govern gene transcription are numerous, and it is unlikely that any one mechanism can fully elucidate the nuclear actions of PUFA. The difficulty in providing a unifying hypothesis at this time stems from: (a) the many metabolic routes taken by PUFAs upon entering the hepatocyte (Figure 1); and (b) the lack of identity of a specific PUFA-regulated trans-acting factor. However, the studies described above indicate that macronutrients, like PUFA, are not only utilized as fuel and structural components of cells, but also serve as important mediators of gene expression (12, 14, 40). As regulators of gene expression, PUFAs (or metabolites) are thought to affect the activity of transcription factors, which in turn target key cis-linked elements associated with specific genes. Whether this targeting involves DNA

  10. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  11. Express yourself: Transcriptional regulation of plant innate immunity.

    PubMed

    Garner, Christopher M; Kim, Sang Hee; Spears, Benjamin J; Gassmann, Walter

    2016-08-01

    The plant immune system is a complex network of components that function together to sense the presence and activity of potential biotic threats, and integrate these signals into an appropriate output, namely the transcription of genes that activate an immune response that is commensurate with the perceived threat. Given the variety of biotic threats a plant must face the immune response must be plastic, but because an immune response is costly to the plant in terms of energy expenditure and development it must also be under tight control. To meet these needs transcriptional control is exercised at multiple levels. In this article we will review some of the latest developments in understanding how the plant immune response is regulated at the level of transcription. New roles are being discovered for the long-studied WRKY and TGA transcription factor families, while additional critical defense functions are being attributed to TCPs and other transcription factors. Dynamically controlling access to DNA through post-translational modification of histones is emerging as an essential component of priming, maintaining, attenuating, and repressing transcription in response to biotic stress. Unsurprisingly, the plant's transcriptional response is targeted by pathogen effectors, and in turn resistance proteins stand guard over and participate in transcriptional regulation. Together, these multiple layers lead to the observed complexity of the plant transcriptional immune response, with different transcription factors or chromatin components playing a prominent role depending on the plant-pathogen interaction being studied. PMID:27174437

  12. Express yourself: Transcriptional regulation of plant innate immunity.

    PubMed

    Garner, Christopher M; Kim, Sang Hee; Spears, Benjamin J; Gassmann, Walter

    2016-08-01

    The plant immune system is a complex network of components that function together to sense the presence and activity of potential biotic threats, and integrate these signals into an appropriate output, namely the transcription of genes that activate an immune response that is commensurate with the perceived threat. Given the variety of biotic threats a plant must face the immune response must be plastic, but because an immune response is costly to the plant in terms of energy expenditure and development it must also be under tight control. To meet these needs transcriptional control is exercised at multiple levels. In this article we will review some of the latest developments in understanding how the plant immune response is regulated at the level of transcription. New roles are being discovered for the long-studied WRKY and TGA transcription factor families, while additional critical defense functions are being attributed to TCPs and other transcription factors. Dynamically controlling access to DNA through post-translational modification of histones is emerging as an essential component of priming, maintaining, attenuating, and repressing transcription in response to biotic stress. Unsurprisingly, the plant's transcriptional response is targeted by pathogen effectors, and in turn resistance proteins stand guard over and participate in transcriptional regulation. Together, these multiple layers lead to the observed complexity of the plant transcriptional immune response, with different transcription factors or chromatin components playing a prominent role depending on the plant-pathogen interaction being studied.

  13. Transcriptional Timers Regulating Mitosis in Early Drosophila Embryos.

    PubMed

    Momen-Roknabadi, Amir; Di Talia, Stefano; Wieschaus, Eric

    2016-09-13

    The development of an embryo requires precise spatiotemporal regulation of cellular processes. During Drosophila gastrulation, a precise temporal pattern of cell division is encoded through transcriptional regulation of cdc25(string) in 25 distinct mitotic domains. Using a genetic screen, we demonstrate that the same transcription factors that regulate the spatial pattern of cdc25(string) transcription encode its temporal activation. We identify buttonhead and empty spiracles as the major activators of cdc25(string) expression in mitotic domain 2. The effect of these activators is balanced through repression by hairy, sloppy paired 1, and huckebein. Within the mitotic domain, temporal precision of mitosis is robust and unaffected by changing dosage of rate-limiting transcriptional factors. However, precision can be disrupted by altering the levels of the two activators or two repressors. We propose that the additive and balanced action of activators and repressors is a general strategy for precise temporal regulation of cellular transitions during development. PMID:27626650

  14. The anorexigenic peptide cocaine-and-amphetamine-regulated transcript modulates rem-sleep in rats.

    PubMed

    Méndez-Díaz, M; Domínguez Martín, E; Pérez Morales, M; Ruiz-Contreras, A E; Navarro, L; Prospéro-García, O

    2009-12-01

    It is known that the sleep-waking cycle is modulated by several molecules that may also regulate food intake, among them several neuropeptides. The cocaine-and-amphetamine-regulated transcript has been studied in relation to food ingestion, but it seems to have several other functions that may include sleep regulation. In this context, we studied the effect of the intracerebroventricular administration of the cocaine-and-amphetamine-regulated transcript (0.15, 0.3, 0.6, 0.9nmol) on the sleep-waking cycle (12-h recordings), as well as its effect on food intake in rats. Additionally, we analyzed the neuronal activity as measured by c-Fos expression induced by the cocaine-and-amphetamine-regulated transcript in neurons of nuclei involved in the regulation of sleep and feeding behavior. Our main finding is that 0.3nmol of the cocaine-and-amphetamine-regulated transcript increases rapid-eye-movement sleep. In addition, our results further support that this neuropeptide triggers satiety; c-Fos expression suggested that the cocaine-and-amphetamine-regulated transcript activates specific hypothalamic nuclei without affecting other brain structures known to be involved in sleep regulation. These data further support the notion that a few neuropeptides are involved in the regulation of both the sleep-waking and the hunger-satiety cycles.

  15. Affect regulation: holding, containing and mirroring.

    PubMed

    Pedersen, Signe Holm; Poulsen, Stig; Lunn, Susanne

    2014-10-01

    Gergely and colleagues' state that their "Social Biofeedback Theory of Parental Affect Mirroring" can be seen as a kind of operationalization of the classical psychoanalytic concepts of holding, containing and mirroring. This article examines to what extent the social biofeedback theory of parental affect mirroring may be understood as a specification of these concepts. It is argued that despite similarities at a descriptive level the concepts are embedded in theories with different ideas of subjectivity. Hence an understanding of the concept of affect regulation as a concretization and specification of the classical concepts dilutes the complexity of both the concept of affect regulation and of the classical concepts. PMID:25351730

  16. Mutations in the CRE pocket of bacterial RNA polymerase affect multiple steps of transcription.

    PubMed

    Petushkov, Ivan; Pupov, Danil; Bass, Irina; Kulbachinskiy, Andrey

    2015-07-13

    During transcription, the catalytic core of RNA polymerase (RNAP) must interact with the DNA template with low-sequence specificity to ensure efficient enzyme translocation and RNA extension. Unexpectedly, recent structural studies of bacterial promoter complexes revealed specific interactions between the nontemplate DNA strand at the downstream edge of the transcription bubble (CRE, core recognition element) and a protein pocket formed by core RNAP (CRE pocket). We investigated the roles of these interactions in transcription by analyzing point amino acid substitutions and deletions in Escherichia coli RNAP. The mutations affected multiple steps of transcription, including promoter recognition, RNA elongation and termination. In particular, we showed that interactions of the CRE pocket with a nontemplate guanine immediately downstream of the active center stimulate RNA-hairpin-dependent transcription pausing but not other types of pausing. Thus, conformational changes of the elongation complex induced by nascent RNA can modulate CRE effects on transcription. The results highlight the roles of specific core RNAP-DNA interactions at different steps of RNA synthesis and suggest their importance for transcription regulation in various organisms.

  17. Mutations in the CRE pocket of bacterial RNA polymerase affect multiple steps of transcription

    PubMed Central

    Petushkov, Ivan; Pupov, Danil; Bass, Irina; Kulbachinskiy, Andrey

    2015-01-01

    During transcription, the catalytic core of RNA polymerase (RNAP) must interact with the DNA template with low-sequence specificity to ensure efficient enzyme translocation and RNA extension. Unexpectedly, recent structural studies of bacterial promoter complexes revealed specific interactions between the nontemplate DNA strand at the downstream edge of the transcription bubble (CRE, core recognition element) and a protein pocket formed by core RNAP (CRE pocket). We investigated the roles of these interactions in transcription by analyzing point amino acid substitutions and deletions in Escherichia coli RNAP. The mutations affected multiple steps of transcription, including promoter recognition, RNA elongation and termination. In particular, we showed that interactions of the CRE pocket with a nontemplate guanine immediately downstream of the active center stimulate RNA-hairpin-dependent transcription pausing but not other types of pausing. Thus, conformational changes of the elongation complex induced by nascent RNA can modulate CRE effects on transcription. The results highlight the roles of specific core RNAP–DNA interactions at different steps of RNA synthesis and suggest their importance for transcription regulation in various organisms. PMID:25990734

  18. Divergence of the yeast transcription factor FZF1 affects sulfite resistance.

    PubMed

    Engle, Elizabeth K; Fay, Justin C

    2012-01-01

    Changes in gene expression are commonly observed during evolution. However, the phenotypic consequences of expression divergence are frequently unknown and difficult to measure. Transcriptional regulators provide a mechanism by which phenotypic divergence can occur through multiple, coordinated changes in gene expression during development or in response to environmental changes. Yet, some changes in transcriptional regulators may be constrained by their pleiotropic effects on gene expression. Here, we use a genome-wide screen for promoters that are likely to have diverged in function and identify a yeast transcription factor, FZF1, that has evolved substantial differences in its ability to confer resistance to sulfites. Chimeric alleles from four Saccharomyces species show that divergence in FZF1 activity is due to changes in both its coding and upstream noncoding sequence. Between the two closest species, noncoding changes affect the expression of FZF1, whereas coding changes affect the expression of SSU1, a sulfite efflux pump activated by FZF1. Both coding and noncoding changes also affect the expression of many other genes. Our results show how divergence in the coding and promoter region of a transcription factor alters the response to an environmental stress.

  19. Transcription elongation regulator 1 (TCERG1) regulates competent RNA polymerase II-mediated elongation of HIV-1 transcription and facilitates efficient viral replication

    PubMed Central

    2013-01-01

    Background Control of RNA polymerase II (RNAPII) release from pausing has been proposed as a checkpoint mechanism to ensure optimal RNAPII activity, especially in large, highly regulated genes. HIV-1 gene expression is highly regulated at the level of elongation, which includes transcriptional pausing that is mediated by both viral and cellular factors. Here, we present evidence for a specific role of the elongation-related factor TCERG1 in regulating the extent of HIV-1 elongation and viral replication in vivo. Results We show that TCERG1 depletion diminishes the basal and viral Tat-activated transcription from the HIV-1 LTR. In support of a role for an elongation mechanism in the transcriptional control of HIV-1, we found that TCERG1 modifies the levels of pre-mRNAs generated at distal regions of HIV-1. Most importantly, TCERG1 directly affects the elongation rate of RNAPII transcription in vivo. Furthermore, our data demonstrate that TCERG1 regulates HIV-1 transcription by increasing the rate of RNAPII elongation through the phosphorylation of serine 2 within the carboxyl-terminal domain (CTD) of RNAPII and suggest a mechanism for the involvement of TCERG1 in relieving pausing. Finally, we show that TCERG1 is required for HIV-1 replication. Conclusions Our study reveals that TCERG1 regulates HIV-1 transcriptional elongation by increasing the elongation rate of RNAPII and phosphorylation of Ser 2 within the CTD. Based on our data, we propose a general mechanism for TCERG1 acting on genes that are regulated at the level of elongation by increasing the rate of RNAPII transcription through the phosphorylation of Ser2. In the case of HIV-1, our evidence provides the basis for further investigation of TCERG1 as a potential therapeutic target for the inhibition of HIV-1 replication PMID:24165037

  20. Genome-wide transcription factor binding: beyond direct target regulation.

    PubMed

    MacQuarrie, Kyle L; Fong, Abraham P; Morse, Randall H; Tapscott, Stephen J

    2011-04-01

    The binding of transcription factors to specific DNA target sequences is the fundamental basis of gene regulatory networks. Chromatin immunoprecipitation combined with DNA tiling arrays or high-throughput sequencing (ChIP-chip and ChIP-seq, respectively) has been used in many recent studies that detail the binding sites of various transcription factors. Surprisingly, data from a variety of model organisms and tissues have demonstrated that transcription factors vary greatly in their number of genomic binding sites, and that binding events can significantly exceed the number of known or possible direct gene targets. Thus, current understanding of transcription factor function must expand to encompass what role, if any, binding might have outside of direct transcriptional target regulation. In this review, we discuss the biological significance of genome-wide binding of transcription factors and present models that can account for this phenomenon.

  1. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  2. Mutations in Transcriptional Regulators Allow Selective Engineering of Signal Integration Logic

    PubMed Central

    2014-01-01

    ABSTRACT Bacterial cells monitor their environment by sensing a set of signals. Typically, these environmental signals affect promoter activities by altering the activity of transcription regulatory proteins. Promoters are often regulated by more than one regulatory protein, and in these cases the relevant signals are integrated by certain logic. In this work, we study how single amino acid substitutions in a regulatory protein (GalR) affect transcriptional regulation and signal integration logic at a set of engineered promoters. Our results suggest that point mutations in regulatory genes allow independent evolution of regulatory logic at different promoters. PMID:24961691

  3. Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.

    PubMed

    Shelton, Dale; Stranne, Maria; Mikkelsen, Lisbeth; Pakseresht, Nima; Welham, Tracey; Hiraka, Hideki; Tabata, Satoshi; Sato, Shusei; Paquette, Suzanne; Wang, Trevor L; Martin, Cathie; Bailey, Paul

    2012-06-01

    Isoflavonoids are a class of phenylpropanoids made by legumes, and consumption of dietary isoflavonoids confers benefits to human health. Our aim is to understand the regulation of isoflavonoid biosynthesis. Many studies have shown the importance of transcription factors in regulating the transcription of one or more genes encoding enzymes in phenylpropanoid metabolism. In this study, we coupled bioinformatics and coexpression analysis to identify candidate genes encoding transcription factors involved in regulating isoflavonoid biosynthesis in Lotus (Lotus japonicus). Genes encoding proteins belonging to 39 of the main transcription factor families were examined by microarray analysis of RNA from leaf tissue that had been elicited with glutathione. Phylogenetic analyses of each transcription factor family were used to identify subgroups of proteins that were specific to L. japonicus or closely related to known regulators of the phenylpropanoid pathway in other species. R2R3MYB subgroup 2 genes showed increased expression after treatment with glutathione. One member of this subgroup, LjMYB14, was constitutively overexpressed in L. japonicus and induced the expression of at least 12 genes that encoded enzymes in the general phenylpropanoid and isoflavonoid pathways. A distinct set of six R2R3MYB subgroup 2-like genes was identified. We suggest that these subgroup 2 sister group proteins and those belonging to the main subgroup 2 have roles in inducing isoflavonoid biosynthesis. The induction of isoflavonoid production in L. japonicus also involves the coordinated down-regulation of competing biosynthetic pathways by changing the expression of other transcription factors. PMID:22529285

  4. Transcriptional Regulation by Trithorax-Group Proteins

    PubMed Central

    Kingston, Robert E.; Tamkun, John W.

    2014-01-01

    The trithorax group of genes (trxG) was identified in mutational screens that examined developmental phenotypes and suppression of Polycomb mutant phenotypes. The protein products of these genes are primarily involved in gene activation, although some can also have repressive effects. There is no central function for these proteins. Some move nucleosomes about on the genome in an ATP-dependent manner, some covalently modify histones such as methylating lysine 4 of histone H3, and some directly interact with the transcription machinery or are a part of that machinery. It is interesting to consider why these specific members of large families of functionally related proteins have strong developmental phenotypes. PMID:25274705

  5. Translin and Trax differentially regulate telomere-associated transcript homeostasis

    PubMed Central

    Alshehri, Zafer; Thallinger, Gerhard G.; Wakeman, Jane A.; McFarlane, Ramsay J.

    2016-01-01

    Translin and Trax proteins are highly conserved nucleic acid binding proteins that have been implicated in RNA regulation in a range of biological processes including tRNA processing, RNA interference, microRNA degradation during oncogenesis, spermatogenesis and neuronal regulation. Here, we explore the function of this paralogue pair of proteins in the fission yeast. Using transcript analysis we demonstrate a reciprocal mechanism for control of telomere-associated transcripts. Mutation of tfx1+ (Trax) elevates transcript levels from silenced sub-telomeric regions of the genome, but not other silenced regions, such as the peri-centromeric heterochromatin. In the case of some sub-telomeric transcripts, but not all, this elevation is dependent on the Trax paralogue, Tsn1 (Translin). In a reciprocal fashion, Tsn1 (Translin) serves to repress levels of transcripts (TERRAs) from the telomeric repeats, whereas Tfx1 serves to maintain these elevated levels. This reveals a novel mechanism for the regulation of telomeric transcripts. We extend this to demonstrate that human Translin and Trax also control telomere-associated transcript levels in human cells in a telomere-specific fashion. PMID:27183912

  6. Genetic Regulation of Transcriptional Variation in Natural Arabidopsis thaliana Accessions

    PubMed Central

    Zan, Yanjun; Shen, Xia; Forsberg, Simon K. G.; Carlborg, Örjan

    2016-01-01

    An increased knowledge of the genetic regulation of expression in Arabidopsis thaliana is likely to provide important insights about the basis of the plant’s extensive phenotypic variation. Here, we reanalyzed two publicly available datasets with genome-wide data on genetic and transcript variation in large collections of natural A. thaliana accessions. Transcripts from more than half of all genes were detected in the leaves of all accessions, and from nearly all annotated genes in at least one accession. Thousands of genes had high transcript levels in some accessions, but no transcripts at all in others, and this pattern was correlated with the genome-wide genotype. In total, 2669 eQTL were mapped in the largest population, and 717 of them were replicated in the other population. A total of 646 cis-eQTL-regulated genes that lacked detectable transcripts in some accessions was found, and for 159 of these we identified one, or several, common structural variants in the populations that were shown to be likely contributors to the lack of detectable RNA transcripts for these genes. This study thus provides new insights into the overall genetic regulation of global gene expression diversity in the leaf of natural A. thaliana accessions. Further, it also shows that strong cis-acting polymorphisms, many of which are likely to be structural variations, make important contributions to the transcriptional variation in the worldwide A. thaliana population. PMID:27226169

  7. Exporting licensing regulations affecting US geothermal firms

    SciTech Connect

    Not Available

    1988-08-01

    This document presents a brief introduction and overview of the Department of Commerce's Export Administration Regulations which might affect potential US geothermal goods exporters. It is intended to make US geothermal firms officials aware of the existence of such regulations and to provide them with references, contacts and phone numbers where they can obtain specific and detailed information and assistance. It must be stressed however, that the ultimate responsibility for complying with the above mentioned regulations lies with the exporter who must consult the complete version of the regulations.

  8. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  9. Transcriptional Regulation by Pho23 Modulates the Frequency of Autophagosome Formation

    PubMed Central

    Jin, Meiyan; He, Ding; Backues, Steven K.; Freeberg, Mallory A.; Liu, Xu; Kim, John K.; Klionsky, Daniel J.

    2014-01-01

    Summary Background Autophagy as a conserved lysosomal/vacuolar degradation and recycling pathway is important in normal development and physiology, and defects in this process are linked to many kinds of disease. Because too much or too little autophagy can be detrimental, the process must be tightly regulated both temporally and in magnitude. Two parameters that affect this regulation are the size and the number of autophagosomes; however, although we know that the amount of Atg8 affects the size of autophagosomes, the mechanism for regulating their number has not been elucidated. The transcriptional induction and repression of the autophagy-related (ATG) genes is one crucial aspect of autophagy regulation, but the transcriptional regulators that modulate autophagy are not well characterized. Results We detected increased expression levels of ATG genes, and elevated autophagy activity, in cells lacking the transcriptional regulator Pho23. Using transmission electron microscopy, we found that PHO23 null mutant cells contain significantly more autophagosomes than the wild-type. By RNA sequencing transcriptome profiling, we identified ATG9 as one of the key targets of Pho23, and our studies with strains expressing modulated levels of Atg9 show that the amount of this protein directly correlates with the frequency of autophagosome formation and the level of autophagy activity. Conclusions Our results identified Pho23 as a master transcriptional repressor for autophagy that regulates the frequency of autophagosome formation through its negative regulation of ATG9. PMID:24881874

  10. A Chromatin-Focused siRNA Screen for Regulators of p53-Dependent Transcription

    PubMed Central

    Sammons, Morgan A.; Zhu, Jiajun; Berger, Shelley L.

    2016-01-01

    The protein product of the Homo sapiens TP53 gene is a transcription factor (p53) that regulates the expression of genes critical for the response to DNA damage and tumor suppression, including genes involved in cell cycle arrest, apoptosis, DNA repair, metabolism, and a number of other tumorigenesis-related pathways. Differential transcriptional regulation of these genes is believed to alter the balance between two p53-dependent cell fates: cell cycle arrest or apoptosis. A number of previously identified p53 cofactors covalently modify and alter the function of both the p53 protein and histone proteins. Both gain- and loss-of-function mutations in chromatin modifiers have been strongly implicated in cancer development; thus, we sought to identify novel chromatin regulatory proteins that affect p53-dependent transcription and the balance between the expression of pro-cell cycle arrest and proapoptotic genes. We utilized an siRNA library designed against predicted chromatin regulatory proteins, and identified known and novel chromatin-related factors that affect both global p53-dependent transcription and gene-specific regulators of p53 transcriptional activation. The results from this screen will serve as a comprehensive resource for those interested in further characterizing chromatin and epigenetic factors that regulate p53 transcription. PMID:27334938

  11. A Chromatin-Focused siRNA Screen for Regulators of p53-Dependent Transcription.

    PubMed

    Sammons, Morgan A; Zhu, Jiajun; Berger, Shelley L

    2016-08-09

    The protein product of the Homo sapiens TP53 gene is a transcription factor (p53) that regulates the expression of genes critical for the response to DNA damage and tumor suppression, including genes involved in cell cycle arrest, apoptosis, DNA repair, metabolism, and a number of other tumorigenesis-related pathways. Differential transcriptional regulation of these genes is believed to alter the balance between two p53-dependent cell fates: cell cycle arrest or apoptosis. A number of previously identified p53 cofactors covalently modify and alter the function of both the p53 protein and histone proteins. Both gain- and loss-of-function mutations in chromatin modifiers have been strongly implicated in cancer development; thus, we sought to identify novel chromatin regulatory proteins that affect p53-dependent transcription and the balance between the expression of pro-cell cycle arrest and proapoptotic genes. We utilized an siRNA library designed against predicted chromatin regulatory proteins, and identified known and novel chromatin-related factors that affect both global p53-dependent transcription and gene-specific regulators of p53 transcriptional activation. The results from this screen will serve as a comprehensive resource for those interested in further characterizing chromatin and epigenetic factors that regulate p53 transcription.

  12. The bile acid sensor FXR regulates insulin transcription and secretion.

    PubMed

    Renga, Barbara; Mencarelli, Andrea; Vavassori, Piero; Brancaleone, Vincenzo; Fiorucci, Stefano

    2010-03-01

    Farnesoid X Receptor plays an important role in maintaining bile acid, cholesterol homeostasis and glucose metabolism. Here we investigated whether FXR is expressed by pancreatic beta-cells and regulates insulin signaling in pancreatic beta-cell line and human islets. We found that FXR activation induces positive regulatory effects on glucose-induced insulin transcription and secretion by genomic and non-genomic activities. Genomic effects of FXR activation relay on the induction of the glucose regulated transcription factor KLF11. Indeed, results from silencing experiments of KLF11 demonstrate that this transcription factor is essential for FXR activity on glucose-induced insulin gene transcription. In addition FXR regulates insulin secretion by non-genomic effects. Thus, activation of FXR in betaTC6 cells increases Akt phosphorylation and translocation of the glucose transporter GLUT2 at plasma membrane, increasing the glucose uptake by these cells. In vivo experiments on Non Obese Diabetic (NOD) mice demonstrated that FXR activation delays development of signs of diabetes, hyperglycemia and glycosuria, by enhancing insulin secretion and by stimulating glucose uptake by the liver. These data established that an FXR-KLF11 regulated pathway has an essential role in the regulation of insulin transcription and secretion induced by glucose.

  13. Initiation and regulation of paramyxovirus transcription and replication.

    PubMed

    Noton, Sarah L; Fearns, Rachel

    2015-05-01

    The paramyxovirus family has a genome consisting of a single strand of negative sense RNA. This genome acts as a template for two distinct processes: transcription to generate subgenomic, capped and polyadenylated mRNAs, and genome replication. These viruses only encode one polymerase. Thus, an intriguing question is, how does the viral polymerase initiate and become committed to either transcription or replication? By answering this we can begin to understand how these two processes are regulated. In this review article, we present recent findings from studies on the paramyxovirus, respiratory syncytial virus, which show how its polymerase is able to initiate transcription and replication from a single promoter. We discuss how these findings apply to other paramyxoviruses. Then, we examine how trans-acting proteins and promoter secondary structure might serve to regulate transcription and replication during different phases of the paramyxovirus replication cycle.

  14. Transcription is regulated by NusA:NusG interaction

    PubMed Central

    Strauß, Martin; Vitiello, Christal; Schweimer, Kristian; Gottesman, Max; Rösch, Paul; Knauer, Stefan H.

    2016-01-01

    NusA and NusG are major regulators of bacterial transcription elongation, which act either in concert or antagonistically. Both bind to RNA polymerase (RNAP), regulating pausing as well as intrinsic and Rho-dependent termination. Here, we demonstrate by nuclear magnetic resonance spectroscopy that the Escherichia coli NusG amino-terminal domain forms a complex with the acidic repeat domain 2 (AR2) of NusA. The interaction surface of either transcription factor overlaps with the respective binding site for RNAP. We show that NusA-AR2 is able to remove NusG from RNAP. Our in vivo and in vitro results suggest that interaction between NusA and NusG could play various regulatory roles during transcription, including recruitment of NusG to RNAP, resynchronization of transcription:translation coupling, and modulation of termination efficiency. PMID:27174929

  15. Quantitative regulation of FLC via coordinated transcriptional initiation and elongation

    PubMed Central

    Wu, Zhe; Ietswaart, Robert; Liu, Fuquan; Yang, Hongchun; Howard, Martin; Dean, Caroline

    2016-01-01

    The basis of quantitative regulation of gene expression is still poorly understood. In Arabidopsis thaliana, quantitative variation in expression of FLOWERING LOCUS C (FLC) influences the timing of flowering. In ambient temperatures, FLC expression is quantitatively modulated by a chromatin silencing mechanism involving alternative polyadenylation of antisense transcripts. Investigation of this mechanism unexpectedly showed that RNA polymerase II (Pol II) occupancy changes at FLC did not reflect RNA fold changes. Mathematical modeling of these transcriptional dynamics predicted a tight coordination of transcriptional initiation and elongation. This prediction was validated by detailed measurements of total and chromatin-bound FLC intronic RNA, a methodology appropriate for analyzing elongation rate changes in a range of organisms. Transcription initiation was found to vary ∼25-fold with elongation rate varying ∼8- to 12-fold. Premature sense transcript termination contributed very little to expression differences. This quantitative variation in transcription was coincident with variation in H3K36me3 and H3K4me2 over the FLC gene body. We propose different chromatin states coordinately influence transcriptional initiation and elongation rates and that this coordination is likely to be a general feature of quantitative gene regulation in a chromatin context. PMID:26699513

  16. Ste12 and Mcm1 regulate cell cycle-dependent transcription of FAR1.

    PubMed Central

    Oehlen, L J; McKinney, J D; Cross, F R

    1996-01-01

    The transcripts of many genes involved in Saccharomyces cerevisiae mating were found to fluctuate during the cell cycle. In the absence of a functional Ste12 transcription factor, both the levels and the cell cycle pattern of expression of these genes were affected. FUS1 and AGA1 levels, which are maximally expressed only in G1-phase cells, were strongly reduced in ste12- cells. The cell cycle transcription pattern for FAR1 was changed in ste12- cells: the gene was still significantly expressed in G2/M, but transcript levels were strongly reduced in G1 phase, resulting in a lack of Far1 protein accumulation. G2/M transcription of FAR1 was dependent on the transcription factor Mcm1, and expression of a gene with Mcm1 fused to a strong transcriptional activation domain resulted in increased levels of FAR1 transcription. The pattern of cell cycle-regulated transcription of FAR1 could involve combinatorial control of Ste12 and Mcm1. Forced G1 expression of FAR1 from the GAL1 promoter resorted the ability to arrest in response to pheromone in ste12-cells. This indicates that transcription of FAR1 in the G1 phase is essential for accumulation of the protein and for pheromone-induced cell cycle arrest. PMID:8649392

  17. Functional evidence of post-transcriptional regulation by pseudogenes.

    PubMed

    Muro, Enrique M; Mah, Nancy; Andrade-Navarro, Miguel A

    2011-11-01

    Pseudogenes have been mainly considered as functionless evolutionary relics since their discovery in 1977. However, multiple mechanisms of pseudogene functionality have been proposed both at the transcriptional and post-transcriptional level. This review focuses on the role of pseudogenes as post-transcriptional regulators. Two lines of research have recently presented strong evidence of their potential function as post-transcriptional regulators of the corresponding parental genes from which they originate. First, pseudogene genomic sequences can encode siRNAs. Second, pseudogene transcripts can act as indirect post-transcriptional regulators decoying ncRNA, in particular miRNAs that target the parental gene. This has been demonstrated for PTEN and KRAS, two genes involved in tumorigenesis. The role of pseudogenes in disease has not been proven and seems to be the next research landmark. In this review, we chronicle the events following the initial discovery of the 'useless' pseudogene to its breakthrough as a functional molecule with hitherto unbeknownst potential to influence human disease.

  18. Navigating the transcriptional roadmap regulating plant secondary cell wall deposition

    PubMed Central

    Hussey, Steven G.; Mizrachi, Eshchar; Creux, Nicky M.; Myburg, Alexander A.

    2013-01-01

    The current status of lignocellulosic biomass as an invaluable resource in industry, agriculture, and health has spurred increased interest in understanding the transcriptional regulation of secondary cell wall (SCW) biosynthesis. The last decade of research has revealed an extensive network of NAC, MYB and other families of transcription factors regulating Arabidopsis SCW biosynthesis, and numerous studies have explored SCW-related transcription factors in other dicots and monocots. Whilst the general structure of the Arabidopsis network has been a topic of several reviews, they have not comprehensively represented the detailed protein–DNA and protein–protein interactions described in the literature, and an understanding of network dynamics and functionality has not yet been achieved for SCW formation. Furthermore the methodologies employed in studies of SCW transcriptional regulation have not received much attention, especially in the case of non-model organisms. In this review, we have reconstructed the most exhaustive literature-based network representations to date of SCW transcriptional regulation in Arabidopsis. We include a manipulable Cytoscape representation of the Arabidopsis SCW transcriptional network to aid in future studies, along with a list of supporting literature for each documented interaction. Amongst other topics, we discuss the various components of the network, its evolutionary conservation in plants, putative modules and dynamic mechanisms that may influence network function, and the approaches that have been employed in network inference. Future research should aim to better understand network function and its response to dynamic perturbations, whilst the development and application of genome-wide approaches such as ChIP-seq and systems genetics are in progress for the study of SCW transcriptional regulation in non-model organisms. PMID:24009617

  19. A synthetic oscillatory network of transcriptional regulators

    NASA Astrophysics Data System (ADS)

    Elowitz, Michael B.; Leibler, Stanislas

    2000-01-01

    Networks of interacting biomolecules carry out many essential functions in living cells, but the `design principles' underlying the functioning of such intracellular networks remain poorly understood, despite intensive efforts including quantitative analysis of relatively simple systems. Here we present a complementary approach to this problem: the design and construction of a synthetic network to implement a particular function. We used three transcriptional repressor systems that are not part of any natural biological clock to build an oscillating network, termed the repressilator, in Escherichia coli. The network periodically induces the synthesis of green fluorescent protein as a readout of its state in individual cells. The resulting oscillations, with typical periods of hours, are slower than the cell-division cycle, so the state of the oscillator has to be transmitted from generation to generation. This artificial clock displays noisy behaviour, possibly because of stochastic fluctuations of its components. Such `rational network design' may lead both to the engineering of new cellular behaviours and to an improved understanding of naturally occurring networks.

  20. Transcriptional regulation of dendritic cell diversity.

    PubMed

    Chopin, Michaël; Allan, Rhys S; Belz, Gabrielle T

    2012-01-01

    Dendritic cells (DCs) are specialized antigen presenting cells that are exquisitely adapted to sense pathogens and induce the development of adaptive immune responses. They form a complex network of phenotypically and functionally distinct subsets. Within this network, individual DC subsets display highly specific roles in local immunosurveillance, migration, and antigen presentation. This division of labor amongst DCs offers great potential to tune the immune response by harnessing subset-specific attributes of DCs in the clinical setting. Until recently, our understanding of DC subsets has been limited and paralleled by poor clinical translation and efficacy. We have now begun to unravel how different DC subsets develop within a complex multilayered system. These findings open up exciting possibilities for targeted manipulation of DC subsets. Furthermore, ground-breaking developments overcoming a major translational obstacle - identification of similar DC populations in mouse and man - now sets the stage for significant advances in the field. Here we explore the determinants that underpin cellular and transcriptional heterogeneity within the DC network, how these influence DC distribution and localization at steady-state, and the capacity of DCs to present antigens via direct or cross-presentation during pathogen infection.

  1. Simian virus 40 T antigen can regulate p53-mediated transcription independent of binding p53.

    PubMed Central

    Rushton, J J; Jiang, D; Srinivasan, A; Pipas, J M; Robbins, P D

    1997-01-01

    A simian virus 40 (SV40) T-antigen mutant containing only the N-terminal 136 amino acids, able to bind to Rb and p300 but not p53, partially inhibited p53-mediated transcription without affecting the ability of p53 to bind DNA. These results suggest that SV40 T antigen can regulate p53-mediated transcription either directly through protein-protein association or indirectly through interaction with factors which may function to confer p53-mediated transcription. PMID:9188637

  2. How the ubiquitin proteasome system regulates the regulators of transcription.

    PubMed

    Ee, Gary; Lehming, Norbert

    2012-01-01

    The ubiquitin proteasome system plays an important role in transcription. Monoubiquitination of activators is believed to aid their function, while the 26S proteasomal degradation of repressors is believed to restrict their function. What remains controversial is the question of whether the degradation of activators aids or restricts their function.

  3. Transcriptional and Chromatin Regulation during Fasting - The Genomic Era.

    PubMed

    Goldstein, Ido; Hager, Gordon L

    2015-12-01

    An elaborate metabolic response to fasting is orchestrated by the liver and is heavily reliant on transcriptional regulation. In response to hormones (glucagon, glucocorticoids) many transcription factors (TFs) are activated and regulate various genes involved in metabolic pathways aimed at restoring homeostasis: gluconeogenesis, fatty acid oxidation, ketogenesis, and amino acid shuttling. We summarize recent discoveries regarding fasting-related TFs with an emphasis on genome-wide binding patterns. Collectively, the findings we discuss reveal a large degree of cooperation between TFs during fasting that occurs at motif-rich DNA sites bound by a combination of TFs. These new findings implicate transcriptional and chromatin regulation as major determinants of the response to fasting and unravels the complex, multi-TF nature of this response.

  4. Post-Transcriptional Regulation of Gene Expression in Yersinia Species

    PubMed Central

    Schiano, Chelsea A.; Lathem, Wyndham W.

    2012-01-01

    Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host. PMID:23162797

  5. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway. PMID:24389954

  6. Transcriptional regulation of chemokine expression in ovarian cancer.

    PubMed

    Singha, Bipradeb; Gatla, Himavanth R; Vancurova, Ivana

    2015-01-01

    The increased expression of pro-inflammatory and pro-angiogenic chemokines contributes to ovarian cancer progression through the induction of tumor cell proliferation, survival, angiogenesis, and metastasis. The substantial potential of these chemokines to facilitate the progression and metastasis of ovarian cancer underscores the need for their stringent transcriptional regulation. In this Review, we highlight the key mechanisms that regulate the transcription of pro-inflammatory chemokines in ovarian cancer cells, and that have important roles in controlling ovarian cancer progression. We further discuss the potential mechanisms underlying the increased chemokine expression in drug resistance, along with our perspective for future studies. PMID:25790431

  7. Transcriptional regulation of chemokine expression in ovarian cancer.

    PubMed

    Singha, Bipradeb; Gatla, Himavanth R; Vancurova, Ivana

    2015-01-01

    The increased expression of pro-inflammatory and pro-angiogenic chemokines contributes to ovarian cancer progression through the induction of tumor cell proliferation, survival, angiogenesis, and metastasis. The substantial potential of these chemokines to facilitate the progression and metastasis of ovarian cancer underscores the need for their stringent transcriptional regulation. In this Review, we highlight the key mechanisms that regulate the transcription of pro-inflammatory chemokines in ovarian cancer cells, and that have important roles in controlling ovarian cancer progression. We further discuss the potential mechanisms underlying the increased chemokine expression in drug resistance, along with our perspective for future studies.

  8. Transcriptional and post-transcriptional regulation of chloroplast gene expression in Petunia hybrida.

    PubMed

    van Grinsven, M Q; Gielen, J J; Zethof, J L; Nijkamp, H J; Kool, A J

    1986-11-01

    To study the control of differential gene expression during plastid biogenesis in Petunia hybrida, we have investigated the in vivo translation and transcription of the rbc L gene, coding for the large subunit of ribulose bisphosphate carboxylase (LSU), and the psa A gene, coding for P700 chlorophyll-a apoprotein (AP700). Differential expression of these plastid-encoded genes was studied in two developmentally different plastid systems, proplastid-like organelles from the green cell suspension AK2401 and mature chloroplasts from green leaves. In vivo translation of rbc L and psa A transcripts was analysed using specific antibodies. Specific transcript levels were analysed using internal fragments of the rbc L and psa A genes. A standardization procedure was used so that a direct correlation could be made between the amount of products and gene copy number. In Petunia hybrida the amount of LSU polypeptides present in both plastid types does not correspond to the amount of specific mRNA for the gene. Although the rbc L transcripts are present in both plastid types, the LSU protein is only present in green leaf plastids and not in cell culture plastids. In vitro translation of isolated rbc L transcripts give similar results, thereby suggesting that differences in the primary structure of the transcripts are responsible for the observed discrepancy. In contrast to this, the amount of AP700 polypeptides does correspond to the amount of the psa A transcripts. Therefore, our results indicate that the expression of chloroplast genes during plastid biogenesis takes place on at least two different levels: expression of the rbc L gene is regulated post-transcriptionally while expression of the psa A gene is regulated at the transcriptional level.

  9. Acetylation of RNA Polymerase II Regulates Growth-Factor-Induced Gene Transcription in Mammalian Cells

    PubMed Central

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A.; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S.; Capra, John A.; Schnölzer, Martina; Cole, Philip A.; Geyer, Matthias; Bruneau, Benoit G.; Adelman, Karen; Ott, Melanie

    2014-01-01

    SUMMARY Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes. PMID:24207025

  10. New Regulations Affect School Debt Financing.

    ERIC Educational Resources Information Center

    Olson, Carol Duane

    1993-01-01

    Provides an overview of changes in Treasury Regulations as they affect school debt financing, including bond and note construction and acquisition issues, other types of equipment and property financing, as well as tax and revenue anticipation notes for working capital needs. (MLF)

  11. Amino Acid Supplementation Affects Imprinted Gene Transcription Patterns in Parthenogenetic Porcine Blastocysts

    PubMed Central

    Park, Chi-Hun; Jeong, Young-Hee; Jeong, Yeun-Ik; Kwon, Jeong-Woo; Shin, Taeyoung; Hyun, Sang-Hwan; Jeung, Eui-Bae; Kim, Nam-Hyung; Seo, Sang-Kyo; Lee, Chang-Kyu; Hwang, Woo-Suk

    2014-01-01

    To determine whether exogenous amino acids affect gene transcription patterns in parthenogenetic porcine embryos, we investigated the effects of amino acid mixtures in culture medium. Parthenogenetic embryos were cultured in PZM3 medium under four experimental conditions: 1) control (no amino acids except L-glutamine and taurine); 2) nonessential amino acids (NEAA); 3) essential amino acids (EAA); and 4) NEAA and EAA. The rate of development of embryos to the four-cell stage was not affected by treatment. However, fewer (P<0.05) embryos cultured with EAA (12.8%) reached the blastocyst stage as compared with the control group (25.6%) and NEAA group (30.3%). Based on these findings, we identified genes with altered expression in parthenogenetic embryos exposed to medium with or without EAAs. The results indicated that EAA influenced gene expression patterns, particularly those of imprinted genes (e.g., H19, IGF2R, PEG1, XIST). However, NEAAs did not affect impaired imprinted gene expressions induced by EAA. The results also showed that mechanistic target of rapamycin (MTOR) mRNA expression was significantly increased by EAA alone as compared with control cultures, and that the combined treatment with NEAA and EAA did not differ significantly from those of control cultures. Our results revealed that gene transcription levels in porcine embryos changed differentially depending on the presence of EAA or NEAA. However, the changes in the H19 mRNA observed in the parthenogenetic blastocysts expression level was not related to the DNA methylation status in the IGF2/H19 domain. The addition of exogenous amino acid mixtures affected not only early embryonic development, but also gene transcription levels, particularly those of imprinted genes. However, this study did not reveal how amino acids affect expression of imprinted genes under the culture conditions used. Further studies are thus required to fully evaluate how amino acids affect transcriptional regulation in porcine

  12. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  13. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  14. Transcriptional Regulation of the p16 Tumor Suppressor Gene.

    PubMed

    Kotake, Yojiro; Naemura, Madoka; Murasaki, Chihiro; Inoue, Yasutoshi; Okamoto, Haruna

    2015-08-01

    The p16 tumor suppressor gene encodes a specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 and is found altered in a wide range of human cancers. p16 plays a pivotal role in tumor suppressor networks through inducing cellular senescence that acts as a barrier to cellular transformation by oncogenic signals. p16 protein is relatively stable and its expression is primary regulated by transcriptional control. Polycomb group (PcG) proteins associate with the p16 locus in a long non-coding RNA, ANRIL-dependent manner, leading to repression of p16 transcription. YB1, a transcription factor, also represses the p16 transcription through direct association with its promoter region. Conversely, the transcription factors Ets1/2 and histone H3K4 methyltransferase MLL1 directly bind to the p16 locus and mediate p16 induction during replicative and premature senescence. In the present review, we discuss the molecular mechanisms by which these factors regulate p16 transcription.

  15. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  16. Transcriptional regulators of Na,K-ATPase subunits

    PubMed Central

    Li, Zhiqin; Langhans, Sigrid A.

    2015-01-01

    The Na,K-ATPase classically serves as an ion pump creating an electrochemical gradient across the plasma membrane that is essential for transepithelial transport, nutrient uptake and membrane potential. In addition, Na,K-ATPase also functions as a receptor, a signal transducer and a cell adhesion molecule. With such diverse roles, it is understandable that the Na,K-ATPase subunits, the catalytic α-subunit, the β-subunit and the FXYD proteins, are controlled extensively during development and to accommodate physiological needs. The spatial and temporal expression of Na,K-ATPase is partially regulated at the transcriptional level. Numerous transcription factors, hormones, growth factors, lipids, and extracellular stimuli modulate the transcription of the Na,K-ATPase subunits. Moreover, epigenetic mechanisms also contribute to the regulation of Na,K-ATPase expression. With the ever growing knowledge about diseases associated with the malfunction of Na,K-ATPase, this review aims at summarizing the best-characterized transcription regulators that modulate Na,K-ATPase subunit levels. As abnormal expression of Na,K-ATPase subunits has been observed in many carcinoma, we will also discuss transcription factors that are associated with epithelial-mesenchymal transition, a crucial step in the progression of many tumors to malignant disease. PMID:26579519

  17. Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver

    PubMed Central

    Atger, Florian; Gobet, Cédric; Marquis, Julien; Martin, Eva; Wang, Jingkui; Weger, Benjamin; Lefebvre, Grégory; Descombes, Patrick; Naef, Felix; Gachon, Frédéric

    2015-01-01

    Diurnal oscillations of gene expression are a hallmark of rhythmic physiology across most living organisms. Such oscillations are controlled by the interplay between the circadian clock and feeding rhythms. Although rhythmic mRNA accumulation has been extensively studied, comparatively less is known about their transcription and translation. Here, we quantified simultaneously temporal transcription, accumulation, and translation of mouse liver mRNAs under physiological light–dark conditions and ad libitum or night-restricted feeding in WT and brain and muscle Arnt-like 1 (Bmal1)-deficient animals. We found that rhythmic transcription predominantly drives rhythmic mRNA accumulation and translation for a majority of genes. Comparison of wild-type and Bmal1 KO mice shows that circadian clock and feeding rhythms have broad impact on rhythmic gene expression, Bmal1 deletion affecting surprisingly both transcriptional and posttranscriptional levels. Translation efficiency is differentially regulated during the diurnal cycle for genes with 5′-Terminal Oligo Pyrimidine tract (5′-TOP) sequences and for genes involved in mitochondrial activity, many harboring a Translation Initiator of Short 5′-UTR (TISU) motif. The increased translation efficiency of 5′-TOP and TISU genes is mainly driven by feeding rhythms but Bmal1 deletion also affects amplitude and phase of translation, including TISU genes. Together this study emphasizes the complex interconnections between circadian and feeding rhythms at several steps ultimately determining rhythmic gene expression and translation. PMID:26554015

  18. Contribution of nuclear actin to transcription regulation.

    PubMed

    Yamazaki, Shota; Yamamoto, Koji; Harata, Masahiko

    2015-06-01

    Actin, an integral component of the cytoskeleton, plays crucial roles in a variety of cell functions, including cell migration, adhesion, polarity and shape change. Studies performed during the last couple of decades have revealed that the actin also exists in the nucleus. However, the function and properties of nuclear actin remained elusive so far. Recently, we showed that an actin tagged with EYFP and fused with a nuclear localization signal (EYFP-NLS-actin) formed visible filamentous (F)-actin bundles in cells. To obtain further details about the individual genes that are affected by the nuclear actin, we have used the microarray analysis to determine the changes in the expression levels of RNAs in HeLa cells as a result of EYFP-NLS-actin expression. Our results suggest that the nuclear actin plays a role in the activation of genes rather than their repression. The data has been deposited in the Gene Expression Omnibus (GEO) database under the accession number GSE59799.

  19. Stochastic models of gene expression and post-transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Pendar, Hodjat; Kulkarni, Rahul; Jia, Tao

    2011-10-01

    The intrinsic stochasticity of gene expression can give rise to phenotypic heterogeneity in a population of genetically identical cells. Correspondingly, there is considerable interest in understanding how different molecular mechanisms impact the 'noise' in gene expression. Of particular interest are post-transcriptional regulatory mechanisms involving genes called small RNAs, which control important processes such as development and cancer. We propose and analyze general stochastic models of gene expression and derive exact analytical expressions quantifying the noise in protein distributions [1]. Focusing on specific regulatory mechanisms, we analyze a general model for post-transcriptional regulation of stochastic gene expression [2]. The results obtained provide new insights into the role of post-transcriptional regulation in controlling the noise in gene expression. [4pt] [1] T. Jia and R. V. Kulkarni, Phys. Rev. Lett.,106, 058102 (2011) [0pt] [2] T. Jia and R. V. Kulkarni, Phys. Rev. Lett., 105, 018101 (2010)

  20. Non-Equilibrium Hyperbolic Transport in Transcriptional Regulation

    PubMed Central

    Hernández-Lemus, Enrique; Correa-Rodríguez, María D.

    2011-01-01

    In this work we studied memory and irreversible transport phenomena in a non-equilibrium thermodynamical model for genomic transcriptional regulation. Transcriptional regulation possess an extremely complex phenomenology, and it is, of course, of foremost importance in organismal cell development and in the pathogenesis of complex diseases. A better understanding of the way in which these processes occur is mandatory to optimize the construction of gene regulatory networks, but also to connect these networks with multi-scale phenomena (e.g. metabolism, signalling pathways, etc.) under an integrative Systems Biology-like vision. In this paper we analyzed three simple mechanisms of genetic stimulation: an instant pulse, a periodic biochemical signal and a saturation process with sigmoidal kinetics and from these we derived the system's thermodynamical response, in the form of, for example, anomalous transcriptional bursts. PMID:21754990

  1. Nutritional conditions regulate transcriptional activity of SF-1 by controlling sumoylation and ubiquitination

    PubMed Central

    Lee, Jiwon; Yang, Dong Joo; Lee, Syann; Hammer, Gary D.; Kim, Ki Woo; Elmquist, Joel K.

    2016-01-01

    Steroidogenic factor 1 (SF-1) is a transcription factor expressed in the ventral medial nucleus of the hypothalamus that regulates energy homeostasis. However, the molecular mechanisms of SF-1 in the control of energy balance are largely unknown. Here, we show that nutritional conditions, such as the presence or absence of serum, affect SF-1 action. Serum starvation significantly decreased hypothalamic SF-1 levels by promoting ubiquitin-dependent degradation, and sumoylation was required for this process. SF-1 transcriptional activity was also differentially regulated by nutritional status. Under normal conditions, the transcriptional activity of hypothalamic SF-1 was activated by SUMO, but this was attenuated during starvation. Taken together, these results indicate that sumoylation and ubiquitination play crucial roles in the regulation of SF-1 function and that these effects are dependent on nutritional conditions, further supporting the importance of SF-1 in the control of energy homeostasis. PMID:26750456

  2. Transcriptionally Regulated Cell Adhesion Network Dictates Distal Tip Cell Directionality

    PubMed Central

    Wong, Ming-Ching; Kennedy, William P.; Schwarzbauer, Jean E.

    2015-01-01

    Background The mechanisms that govern directional changes in cell migration are poorly understood. The migratory paths of two distal tip cells (DTC) determine the U-shape of the C. elegans hermaphroditic gonad. The morphogenesis of this organ provides a model system to identify genes necessary for the DTCs to execute two stereotyped turns. Results Using candidate genes for RNAi knockdown in a DTC-specific strain, we identified two transcriptional regulators required for DTC turning: cbp-1, the CBP/p300 transcriptional coactivator homologue, and let-607, a CREBH transcription factor homologue. Further screening of potential target genes uncovered a network of integrin adhesion-related genes that have roles in turning and are dependent on cbp-1 and let-607 for expression. These genes include src-1/Src kinase, tln-1/talin, pat-2/α integrin and nmy-2, a nonmuscle myosin heavy chain. Conclusions Transcriptional regulation by means of cbp-1 and let-607 is crucial for determining directional changes during DTC migration. These regulators coordinate a gene network that is necessary for integrin-mediated adhesion. Overall, these results suggest that directional changes in cell migration rely on the precise gene regulation of adhesion. PMID:24811939

  3. Endothelial Gata5 transcription factor regulates blood pressure

    PubMed Central

    Messaoudi, Smail; He, Ying; Gutsol, Alex; Wight, Andrew; Hébert, Richard L.; Vilmundarson, Ragnar O.; Makrigiannis, Andrew P.; Chalmers, John; Hamet, Pavel; Tremblay, Johanne; McPherson, Ruth; Stewart, Alexandre F. R.; Touyz, Rhian M.; Nemer, Mona

    2015-01-01

    Despite its high prevalence and economic burden, the aetiology of human hypertension remains incompletely understood. Here we identify the transcription factor GATA5, as a new regulator of blood pressure (BP). GATA5 is expressed in microvascular endothelial cells and its genetic inactivation in mice (Gata5-null) leads to vascular endothelial dysfunction and hypertension. Endothelial-specific inactivation of Gata5 mimics the hypertensive phenotype of the Gata5-null mice, suggestive of an important role for GATA5 in endothelial homeostasis. Transcriptomic analysis of human microvascular endothelial cells with GATA5 knockdown reveals that GATA5 affects several genes and pathways critical for proper endothelial function, such as PKA and nitric oxide pathways. Consistent with a role in human hypertension, we report genetic association of variants at the GATA5 locus with hypertension traits in two large independent cohorts. Our results unveil an unsuspected link between GATA5 and a prominent human condition, and provide a new animal model for hypertension. PMID:26617239

  4. Complex transcriptional and post-transcriptional regulation of an enzyme for Lipopolysaccharide modification

    PubMed Central

    Moon, Kyung; Six, David A.; Lee, Hyun-Jung; Raetz, Christian R.H.; Gottesman, Susan

    2013-01-01

    Summary The PhoQ/PhoP two-component system activates many genes for lipopolysaccharide (LPS) modification when cells are grown at low Mg2+ concentrations. An additional target of PhoQ and PhoP is MgrR, an Hfq-dependent small RNA that negatively regulates expression of eptB, also encoding a protein that carries out LPS modification. Examination of LPS confirmed that MgrR effectively silences EptB; the phosphoethanolamine modification associated with EptB is found in ΔmgrR::kan but not mgrR+ cells. Sigma E has been reported to positively regulate eptB, although the eptB promoter does not have the expected Sigma E recognition motifs. The effects of Sigma E and deletion of mgrR on levels of eptB mRNA were independent, and the same 5′ end was found in both cases. In vitro transcription and the behavior of transcriptional and translational fusions demonstrate that Sigma E acts directly at the level of transcription initiation for eptB, from the same start point as Sigma 70. The results suggest that when Sigma E is active, synthesis of eptB transcript outstrips MgrR-dependent degradation; presumably the modification of LPS is important under these conditions. Adding to the complexity of eptB regulation is a second sRNA, ArcZ, which also directly and negatively regulates eptB. PMID:23659637

  5. The physical size of transcription factors is key to transcriptional regulation in chromatin domains

    NASA Astrophysics Data System (ADS)

    Maeshima, Kazuhiro; Kaizu, Kazunari; Tamura, Sachiko; Nozaki, Tadasu; Kokubo, Tetsuro; Takahashi, Koichi

    2015-02-01

    Genetic information, which is stored in the long strand of genomic DNA as chromatin, must be scanned and read out by various transcription factors. First, gene-specific transcription factors, which are relatively small (˜50 kDa), scan the genome and bind regulatory elements. Such factors then recruit general transcription factors, Mediators, RNA polymerases, nucleosome remodellers, and histone modifiers, most of which are large protein complexes of 1-3 MDa in size. Here, we propose a new model for the functional significance of the size of transcription factors (or complexes) for gene regulation of chromatin domains. Recent findings suggest that chromatin consists of irregularly folded nucleosome fibres (10 nm fibres) and forms numerous condensed domains (e.g., topologically associating domains). Although the flexibility and dynamics of chromatin allow repositioning of genes within the condensed domains, the size exclusion effect of the domain may limit accessibility of DNA sequences by transcription factors. We used Monte Carlo computer simulations to determine the physical size limit of transcription factors that can enter condensed chromatin domains. Small gene-specific transcription factors can penetrate into the chromatin domains and search their target sequences, whereas large transcription complexes cannot enter the domain. Due to this property, once a large complex binds its target site via gene-specific factors it can act as a ‘buoy’ to keep the target region on the surface of the condensed domain and maintain transcriptional competency. This size-dependent specialization of target-scanning and surface-tethering functions could provide novel insight into the mechanisms of various DNA transactions, such as DNA replication and repair/recombination.

  6. Adhesive interactions regulate transcriptional diversity in malignant B cells.

    PubMed

    Nadav-Dagan, Liat; Shay, Tal; Dezorella, Nili; Naparstek, Elizabeth; Domany, Eytan; Katz, Ben-Zion; Geiger, Benjamin

    2010-04-01

    The genetic profiling of B-cell malignancies is rapidly expanding, providing important information on the tumorigenic potential, response to treatment, and clinical outcome of these diseases. However, the relative contributions of inherent gene expression versus microenvironmental effects are poorly understood. The regulation of gene expression programs by means of adhesive interactions was studied here in ARH-77 human malignant B-cell variants, derived from the same cell line by selective adhesion to a fibronectin matrix. The populations included cells that adhere to fibronectin and are highly tumorigenic (designated "type A" cells) and cells that fail to adhere to fibronectin and fail to develop tumors in vivo ("type F" cells). To identify genes directly affected by cell adhesion to fibronectin, type A cells deprived of an adhesive substrate (designated "AF cells") were also examined. Bioinformatic analyses revealed a remarkable correlation between cell adhesion and both B-cell differentiation state and the expression of multiple myeloma (MM)-associated genes. The highly adherent type A cells expressed higher levels of NFkappaB-regulated genes, many of them associated with MM. Moreover, we found that the transcription of several MM-related proto-oncogenes is stimulated by adhesion to fibronectin. In contrast, type F cells, which display poor adhesive and tumorigenic properties, expressed genes associated with higher levels of B-cell differentiation. Our findings indicate that B-cell differentiation, as manifested by gene expression profiles, is attenuated by cell adhesion to fibronectin, leading to upregulation of specific genes known to be associated with the pathogenesis of MM.

  7. Transcription Factor Tfe3 Directly Regulates Pgc-1alpha in Muscle.

    PubMed

    Salma, Nunciada; Song, Jun S; Arany, Zoltan; Fisher, David E

    2015-10-01

    The microphthalmia (MiT) family of transcription factors is an important mediator of metabolism. Family members Mitf and Tfeb directly regulate the expression of the master regulator of metabolism, peroxisome-proliferator activated receptor gamma coactivator-1 alpha (Pgc-1alpha), in melanomas and in the liver, respectively. Pgc-1alpha is enriched in tissues with high oxidative capacity and plays an important role in the regulation of mitochondrial biogenesis and cellular metabolism. In skeletal muscle, Pgc-1alpha affects many aspects of muscle functionally such as endurance, fiber-type switching, and insulin sensitivity. Tfe3 also regulates muscle metabolic genes that enhance insulin sensitivity in skeletal muscle. Tfe3 has not yet been shown to regulate Pgc-1alpha expression. Our results reported here show that Tfe3 directly regulates Pgc-1alpha expression in myotubes. Tfe3 ectopic expression induces Pgc-1alpha, and Tfe3 silencing suppresses Pgc-1alpha expression. This regulation is direct, as shown by Tfe3's binding to E-boxes on the Pgc-1alpha proximal promoter. We conclude that Tfe3 is a critical transcription factor that regulates Pgc-1alpha gene expression in myotubes. Since Pgc-1alpha coactivates numerous biological programs in diverse tissues, the regulation of its expression by upstream transcription factors such Tfe3 implies potential opportunities for the treatment of diseases where modulation of Pgc-1alpha expression may have important clinical outcomes.

  8. The Leucine-rich Pentatricopeptide-Repeat Containing Protein Regulates Mitochondrial Transcription

    PubMed Central

    Sondheimer, Neal; Fang, Ji-Kang; Polyak, Erzsebet; Falk, Marni; Avadhani, Narayan G.

    2010-01-01

    Mitochondrial function depends upon the coordinated expression of the mitochondrial and nuclear genomes. Although the basal factors that carry out the process of mitochondrial transcription are known, the regulation of this process is incompletely understood. To further our understanding of mitochondrial gene regulation we identified proteins that bound to the previously described point of termination for the major mRNA-coding transcript H2. One was the leucine-rich pentatricopeptide-repeat containing protein (LRPPRC), which has been linked to the French-Canadian variant of Leigh syndrome. Cells with reduced expression of LRPPRC had a reduction in oxygen consumption. The expression of mitochondrial mRNA and tRNA was dependent upon LRPPRC levels, but reductions in LRPPRC did not affect the expression of mitochondrial rRNA. Reduction of LRPPRC levels interfered with mitochondrial transcription in vitro but did not affect the stability of mitochondrial mRNAs or alter the expression of nuclear genes responsible for mitochondrial transcription in vivo. These findings demonstrate the control of mitochondrial mRNA synthesis by a protein that has an established role in regulating nuclear transcription, and a link to mitochondrial disease. PMID:20677761

  9. Lineage specific transcriptional regulation of DICER by MITF in melanocytes

    PubMed Central

    Levy, Carmit; Khaled, Mehdi; Robinson, Kathleen C.; Veguilla, Rosa A.; Chen, Po-Hao; Yokoyama, Satoru; Makino, Eiichi; Lu, Jun; Larue, Lionel; Beermann, Friedrich; Chin, Lynda; Bosenberg, Marcus; Song, Jun. S.; Fisher, David E.

    2010-01-01

    Summary DICER is a central regulator of microRNA maturation. However little is known about mechanisms regulating its expression in development or disease. While profiling miRNA expression in differentiating melanocytes, two populations were observed: some upregulated at the pre-miRNA stage, and others upregulated as “mature” miRNAs (with stable pre-miRNA levels). Conversion of pre-miRNAs to fully processed miRNAs appeared to be dependent upon stimulation of DICER expression—an event found to occur via direct transcriptional targeting of DICER by the melanocyte master transcriptional regulator MITF. MITF binds and activates a conserved regulatory element upstream of DICER’s transcriptional start site upon melanocyte differentiation. Targeted KO of DICER is lethal to melanocytes, at least partly via DICER-dependent processing of the pre-miRNA-17~92 cluster thus targeting BIM, a known pro-apoptotic regulator of melanocyte survival. These observations highlight a central mechanism underlying miRNA regulation which could exist for other cell types during development. PMID:20550935

  10. Circadian rhythms and post-transcriptional regulation in higher plants.

    PubMed

    Romanowski, Andrés; Yanovsky, Marcelo J

    2015-01-01

    The circadian clock of plants allows them to cope with daily changes in their environment. This is accomplished by the rhythmic regulation of gene expression, in a process that involves many regulatory steps. One of the key steps involved at the RNA level is post-transcriptional regulation, which ensures a correct control on the different amounts and types of mRNA that will ultimately define the current physiological state of the plant cell. Recent advances in the study of the processes of regulation of pre-mRNA processing, RNA turn-over and surveillance, regulation of translation, function of lncRNAs, biogenesis and function of small RNAs, and the development of bioinformatics tools have helped to vastly expand our understanding of how this regulatory step performs its role. In this work we review the current progress in circadian regulation at the post-transcriptional level research in plants. It is the continuous interaction of all the information flow control post-transcriptional processes that allow a plant to precisely time and predict daily environmental changes. PMID:26124767

  11. Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation

    PubMed Central

    van Hijum, Sacha A. F. T.; Medema, Marnix H.; Kuipers, Oscar P.

    2009-01-01

    Summary: A major part of organismal complexity and versatility of prokaryotes resides in their ability to fine-tune gene expression to adequately respond to internal and external stimuli. Evolution has been very innovative in creating intricate mechanisms by which different regulatory signals operate and interact at promoters to drive gene expression. The regulation of target gene expression by transcription factors (TFs) is governed by control logic brought about by the interaction of regulators with TF binding sites (TFBSs) in cis-regulatory regions. A factor that in large part determines the strength of the response of a target to a given TF is motif stringency, the extent to which the TFBS fits the optimal TFBS sequence for a given TF. Advances in high-throughput technologies and computational genomics allow reconstruction of transcriptional regulatory networks in silico. To optimize the prediction of transcriptional regulatory networks, i.e., to separate direct regulation from indirect regulation, a thorough understanding of the control logic underlying the regulation of gene expression is required. This review summarizes the state of the art of the elements that determine the functionality of TFBSs by focusing on the molecular biological mechanisms and evolutionary origins of cis-regulatory regions. PMID:19721087

  12. Transcriptional and Post-Transcriptional Regulation of Nucleotide Excision Repair Genes in Human Cells

    PubMed Central

    Lefkofsky, Hailey B.; Veloso, Artur; Ljungman, Mats

    2014-01-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  13. NFAT5 regulates transcription of the mouse telomerase reverse transcriptase gene

    SciTech Connect

    Fujiki, Tsukasa; Udono, Miyako; Kotake, Yojiro; Yamashita, Makiko; Shirahata, Sanetaka; Katakura, Yoshinori

    2010-12-10

    We aimed to clarify the transcription-regulation mechanisms of the mouse telomerase reverse transcriptase gene (mTERT). First, we searched for the promoter region required for transcriptional activation of mTERT and identified an enhancer cis-element (named mTERT-EE) located between - 200 and - 179 bp of the mouse TERT gene (mTERT). EMSA results suggested that nuclear factor of activated T cells (NFAT) member proteins bind to mTERT-EE. We then identified NFAT5 as the factor binding to mTERT-EE and found that it activates the transcription of the mTERT core promoter. The results that siRNA directed against NFAT5 significantly reduced mTERT expression and mTERT core promoter activity and that the expressions of NFAT5 and mTERT were well correlated in various mouse tissues except liver suggest that NFAT5 dominantly and directly regulates mTERT expression. To clarify their functionality further, we investigated the effect of hypertonic stress, a known stimulus affecting the expression and transcriptional activity of NFAT5, on mTERT expression. The result indicated that hypertonic stress activates mTERT transcription via the activation and recruitment of NFAT5 to the mTERT promoter. These results provide useful information about the transcription-regulation mechanisms of mTERT.

  14. Nongenic transcription, gene regulation and action at a distance.

    PubMed

    Cook, Peter R

    2003-11-15

    In eukaryotes, motifs such as silencers, enhancers and locus control regions act over thousands of base pairs to regulate adjacent genes; insulators limit such effects, and barriers confine repressive heterochromatin to particular chromosomal segments. Recent results show that many of these motifs are nongenic transcription units, and two of them directly contact their targets lying further down the chromosome to loop the intervening DNA: the barriers (scs and scs') flanking the 87A7 heat-shock locus in the fly contact each other, and a locus control region touches the beta-globin gene in the mouse. I hypothesize that the act of transcription underlies the function of these regulators; active polymerizing complexes tend to cluster into 'factories' and this facilitates molecular contact between the transcribed regulator and its distant (and transcribed) target. PMID:14576342

  15. Post-transcriptional Regulation of Immunological Responses through Riboclustering.

    PubMed

    Ganguly, Koelina; Giddaluru, Jeevan; August, Avery; Khan, Nooruddin

    2016-01-01

    Immunological programing of immune cells varies in response to changing environmental signals. This process is facilitated by modifiers that regulate the translational fate of mRNAs encoding various immune mediators, including cytokines and chemokines, which in turn determine the rapid activation, tolerance, and plasticity of the immune system. RNA-binding proteins (RBPs) recruited by the specific sequence elements in mRNA transcripts are one such modifiers. These RBPs form RBP-RNA complexes known as "riboclusters." These riboclusters serve as RNA sorting machinery, where depending upon the composition of the ribocluster, translation, degradation, or storage of mRNA is controlled. Recent findings suggest that this regulation of mRNA homeostasis is critical for controlling the immune response. Here, we present the current knowledge of the ribocluster-mediated post-transcriptional regulation of immune mediators and highlight recent findings regarding their implications for the pathogenesis of acute or chronic inflammatory diseases. PMID:27199986

  16. Post-transcriptional Regulation of Immunological Responses through Riboclustering

    PubMed Central

    Ganguly, Koelina; Giddaluru, Jeevan; August, Avery; Khan, Nooruddin

    2016-01-01

    Immunological programing of immune cells varies in response to changing environmental signals. This process is facilitated by modifiers that regulate the translational fate of mRNAs encoding various immune mediators, including cytokines and chemokines, which in turn determine the rapid activation, tolerance, and plasticity of the immune system. RNA-binding proteins (RBPs) recruited by the specific sequence elements in mRNA transcripts are one such modifiers. These RBPs form RBP–RNA complexes known as “riboclusters.” These riboclusters serve as RNA sorting machinery, where depending upon the composition of the ribocluster, translation, degradation, or storage of mRNA is controlled. Recent findings suggest that this regulation of mRNA homeostasis is critical for controlling the immune response. Here, we present the current knowledge of the ribocluster-mediated post-transcriptional regulation of immune mediators and highlight recent findings regarding their implications for the pathogenesis of acute or chronic inflammatory diseases. PMID:27199986

  17. Expression profiling of muscle reveals transcripts differentially expressed in muscle that affect water-holding capacity of pork.

    PubMed

    Ponsuksili, Siriluck; Murani, Eduard; Phatsara, Chirawath; Jonas, Elisabeth; Walz, Christina; Schwerin, Manfred; Schellander, Karl; Wimmers, Klaus

    2008-11-12

    To identify biological processes as well as molecular markers for drip loss, a parameter for water holding capacity of meat, the M. longissimus dorsi transcriptomes of six divergent sib pairs were analyzed using Affymetrix Porcine Genome Array. Functional categories of differentially regulated transcripts were determined by single-gene analysis and gene set analysis. The transcripts being up-regulated at high drip loss belong to groups of genes functionally categorized as genes of membrane proteins, signal transduction, cell communication, response to stimulus, and cytoskeleton. Among genes down-regulated with high drip loss, functional groups of oxidoreductase activity, lipid metabolism, and electron transport were identified. Differential regulation of the abundance of transcripts of these biological networks in live muscle affect mortem biochemical processes of meat maturation. Knowledge of this functional link is indicative for the identification of candidate genes for improvement of meat quality. PMID:18922009

  18. Transcriptional regulation of protein complexes within and across species.

    PubMed

    Tan, Kai; Shlomi, Tomer; Feizi, Hoda; Ideker, Trey; Sharan, Roded

    2007-01-23

    Yeast two-hybrid and coimmunoprecipitation experiments have defined large-scale protein-protein interaction networks for many model species. Separately, systematic chromatin immunoprecipitation experiments have enabled the assembly of large networks of transcriptional regulatory interactions. To investigate the functional interplay between these two interaction types, we combined both within a probabilistic framework that models the cell as a network of transcription factors regulating protein complexes. This framework identified 72 putative coregulated complexes in yeast and allowed the prediction of 120 previously uncharacterized transcriptional interactions. Several predictions were tested by new microarray profiles, yielding a confirmation rate (58%) comparable with that of direct immunoprecipitation experiments. Furthermore, we extended our framework to a cross-species setting, identifying 24 coregulated complexes that were conserved between yeast and fly. Analyses of these conserved complexes revealed different conservation levels of their regulators and provided suggestive evidence that protein-protein interaction networks may evolve more slowly than transcriptional interaction networks. Our results demonstrate how multiple molecular interaction types can be integrated toward a global wiring diagram of the cell, and they provide insights into the evolutionary dynamics of protein complex regulation.

  19. Transcriptional regulation in yeast during diauxic shift and stationary phase.

    PubMed

    Galdieri, Luciano; Mehrotra, Swati; Yu, Sean; Vancura, Ales

    2010-12-01

    The preferred source of carbon and energy for yeast cells is glucose. When yeast cells are grown in liquid cultures, they metabolize glucose predominantly by glycolysis, releasing ethanol in the medium. When glucose becomes limiting, the cells enter diauxic shift characterized by decreased growth rate and by switching metabolism from glycolysis to aerobic utilization of ethanol. When ethanol is depleted from the medium, cells enter quiescent or stationary phase G(0). Cells in diauxic shift and stationary phase are stressed by the lack of nutrients and by accumulation of toxic metabolites, primarily from the oxidative metabolism, and are differentiated in ways that allow them to maintain viability for extended periods of time. The transition of yeast cells from exponential phase to quiescence is regulated by protein kinase A, TOR, Snf1p, and Rim15p pathways that signal changes in availability of nutrients, converge on transcriptional factors Msn2p, Msn4p, and Gis1p, and elicit extensive reprogramming of the transcription machinery. However, the events in transcriptional regulation during diauxic shift and quiescence are incompletely understood. Because cells from multicellular eukaryotic organisms spend most of their life in G(0) phase, understanding transcriptional regulation in quiescence will inform other fields, such as cancer, development, and aging.

  20. Glutamate-dependent transcriptional regulation of GLAST: role of PKC.

    PubMed

    López-Bayghen, Esther; Ortega, Arturo

    2004-10-01

    The Na+-dependent glutamate/aspartate transporter GLAST plays a major role in the removal of glutamate from the synaptic cleft. Short-term, as well as long-term changes in transporter activity are triggered by glutamate. An important locus of regulation is the density of transporter molecules present at the plasma membrane. A substrate-dependent change in the translocation rate of the transporter molecules accounts for the short-term effect, whereas the long-term modulation apparently involves transcriptional regulation. Using cultured chick cerebellar Bergmann glial cells, we report here that glutamate receptors activation mediate a substantial reduction in the transcriptional activity of the chglast promoter through the Ca2+/diacylglicerol-dependent protein kinase (PKC) signaling cascade. Overexpression of constitutive active PKC isoforms of mimic the glutamate effect. Accordingly, increased levels of c-Jun or c-Fos, but not Jun-B, Jun-D or Fos-B, lower the chglast promoter activity. Serial deletions and electrophorectic mobility shift assays were used to define a specific region within the 5' proximal region of the chglast promoter, associated with transcriptional repression. A putative glutamate response element could be defined in the proximal promoter stretch more likely between nts -40 and -78. These results demonstrate that GLAST is under glutamate-dependent transcriptional control through PKC, and support the notion of a pivotal role of this neurotransmitter in the regulation of its own removal from the synaptic cleft, thereby modulating, mainly in the long term, glutamatergic transmission.

  1. E2F transcription factor 1 regulates cellular and organismal senescence by inhibiting Forkhead box O transcription factors.

    PubMed

    Xie, Qi; Peng, Shengyi; Tao, Li; Ruan, Haihe; Yang, Yanglu; Li, Tie-Mei; Adams, Ursula; Meng, Songshu; Bi, Xiaolin; Dong, Meng-Qiu; Yuan, Zengqiang

    2014-12-01

    E2F1 and FOXO3 are two transcription factors that have been shown to participate in cellular senescence. Previous report reveals that E2F1 enhanced cellular senescence in human fibroblast cells, while FOXO transcription factors play against senescence by regulation reactive oxygen species scavenging proteins. However, their functional interplay has been unclear. Here we use E2F1 knock-out murine Embryonic fibroblasts (MEFs), knockdown RNAi constructs, and ectopic expression of E2F1 to show that it functions by negatively regulating FOXO3. E2F1 attenuates FOXO3-mediated expression of MnSOD and Catalase without affecting FOXO3 protein stability, subcellular localization, or phosphorylation by Akt. We mapped the interaction between E2F1 and FOXO3 to a region including the DNA binding domain of E2F1 and the C-terminal transcription-activation domain of FOXO3. We propose that E2F1 inhibits FOXO3-dependent transcription by directly binding FOXO3 in the nucleus and preventing activation of its target genes. Moreover, knockdown of the Caenorhabditis elegans E2F1 ortholog efl-1 significantly extends lifespan in a manner that requires the activity of the C. elegans FOXO gene daf-16. We conclude that there is an evolutionarily conserved signaling connection between E2F1 and FOXO3, which regulates cellular senescence and aging by regulating the activity of FOXO3. We speculate that drugs and/or therapies that inhibit this physical interaction might be good candidates for reducing cellular senescence and increasing longevity.

  2. E2F transcription factor 1 regulates cellular and organismal senescence by inhibiting Forkhead box O transcription factors.

    PubMed

    Xie, Qi; Peng, Shengyi; Tao, Li; Ruan, Haihe; Yang, Yanglu; Li, Tie-Mei; Adams, Ursula; Meng, Songshu; Bi, Xiaolin; Dong, Meng-Qiu; Yuan, Zengqiang

    2014-12-01

    E2F1 and FOXO3 are two transcription factors that have been shown to participate in cellular senescence. Previous report reveals that E2F1 enhanced cellular senescence in human fibroblast cells, while FOXO transcription factors play against senescence by regulation reactive oxygen species scavenging proteins. However, their functional interplay has been unclear. Here we use E2F1 knock-out murine Embryonic fibroblasts (MEFs), knockdown RNAi constructs, and ectopic expression of E2F1 to show that it functions by negatively regulating FOXO3. E2F1 attenuates FOXO3-mediated expression of MnSOD and Catalase without affecting FOXO3 protein stability, subcellular localization, or phosphorylation by Akt. We mapped the interaction between E2F1 and FOXO3 to a region including the DNA binding domain of E2F1 and the C-terminal transcription-activation domain of FOXO3. We propose that E2F1 inhibits FOXO3-dependent transcription by directly binding FOXO3 in the nucleus and preventing activation of its target genes. Moreover, knockdown of the Caenorhabditis elegans E2F1 ortholog efl-1 significantly extends lifespan in a manner that requires the activity of the C. elegans FOXO gene daf-16. We conclude that there is an evolutionarily conserved signaling connection between E2F1 and FOXO3, which regulates cellular senescence and aging by regulating the activity of FOXO3. We speculate that drugs and/or therapies that inhibit this physical interaction might be good candidates for reducing cellular senescence and increasing longevity. PMID:25344604

  3. E2F Transcription Factor 1 Regulates Cellular and Organismal Senescence by Inhibiting Forkhead Box O Transcription Factors*

    PubMed Central

    Xie, Qi; Peng, Shengyi; Tao, Li; Ruan, Haihe; Yang, Yanglu; Li, Tie-Mei; Adams, Ursula; Meng, Songshu; Bi, Xiaolin; Dong, Meng-Qiu; Yuan, Zengqiang

    2014-01-01

    E2F1 and FOXO3 are two transcription factors that have been shown to participate in cellular senescence. Previous report reveals that E2F1 enhanced cellular senescence in human fibroblast cells, while FOXO transcription factors play against senescence by regulation reactive oxygen species scavenging proteins. However, their functional interplay has been unclear. Here we use E2F1 knock-out murine Embryonic fibroblasts (MEFs), knockdown RNAi constructs, and ectopic expression of E2F1 to show that it functions by negatively regulating FOXO3. E2F1 attenuates FOXO3-mediated expression of MnSOD and Catalase without affecting FOXO3 protein stability, subcellular localization, or phosphorylation by Akt. We mapped the interaction between E2F1 and FOXO3 to a region including the DNA binding domain of E2F1 and the C-terminal transcription-activation domain of FOXO3. We propose that E2F1 inhibits FOXO3-dependent transcription by directly binding FOXO3 in the nucleus and preventing activation of its target genes. Moreover, knockdown of the Caenorhabditis elegans E2F1 ortholog efl-1 significantly extends lifespan in a manner that requires the activity of the C. elegans FOXO gene daf-16. We conclude that there is an evolutionarily conserved signaling connection between E2F1 and FOXO3, which regulates cellular senescence and aging by regulating the activity of FOXO3. We speculate that drugs and/or therapies that inhibit this physical interaction might be good candidates for reducing cellular senescence and increasing longevity. PMID:25344604

  4. Multiple MAPK cascades regulate the transcription of IME1, the master transcriptional activator of meiosis in Saccharomyces cerevisiae.

    PubMed

    Kahana-Edwin, Smadar; Stark, Michal; Kassir, Yona

    2013-01-01

    The choice between alternative developmental pathways is primarily controlled at the level of transcription. Induction of meiosis in budding yeasts in response to nutrient levels provides a system to investigate the molecular basis of cellular decision-making. In Saccharomyces cerevisiae, entry into meiosis depends on multiple signals converging upon IME1, the master transcriptional activator of meiosis. Here we studied the regulation of the cis-acting regulatory element Upstream Activation Signal (UAS)ru, which resides within the IME1 promoter. Guided by our previous data acquired using a powerful high-throughput screening system, here we provide evidence that UASru is regulated by multiple stimuli that trigger distinct signal transduction pathways as follows: (i) The glucose signal inhibited UASru activity through the cyclic AMP (cAMP/protein kinase A (PKA) pathway, targeting the transcription factors (TFs), Com2 and Sko1; (ii) high osmolarity activated UASru through the Hog1/mitogen-activated protein kinase (MAPK) pathway and its corresponding TF Sko1; (iii) elevated temperature increased the activity of UASru through the cell wall integrity pathway and the TFs Swi4/Mpk1 and Swi4/Mlp1; (iv) the nitrogen source repressed UASru activity through Sum1; and (v) the absence of a nitrogen source was detected and transmitted to UASru by the Kss1 and Fus3 MAPK pathways through their respective downstream TFs, Ste12/Tec1 and Ste12/Ste12 as well as by their regulators Dig1/2. These signaling events were specific to UASru; they did not affect the mating and filamentation response elements that are regulated by MAPK pathways. The complex regulation of UASru through all the known vegetative MAPK pathways is unique to S. cerevisiae and is specific for IME1, likely because it is the master regulator of gametogenesis. PMID:24236068

  5. Multiple MAPK Cascades Regulate the Transcription of IME1, the Master Transcriptional Activator of Meiosis in Saccharomyces cerevisiae

    PubMed Central

    Kahana-Edwin, Smadar; Stark, Michal; Kassir, Yona

    2013-01-01

    The choice between alternative developmental pathways is primarily controlled at the level of transcription. Induction of meiosis in budding yeasts in response to nutrient levels provides a system to investigate the molecular basis of cellular decision-making. In Saccharomyces cerevisiae, entry into meiosis depends on multiple signals converging upon IME1, the master transcriptional activator of meiosis. Here we studied the regulation of the cis-acting regulatory element Upstream Activation Signal (UAS)ru, which resides within the IME1 promoter. Guided by our previous data acquired using a powerful high-throughput screening system, here we provide evidence that UASru is regulated by multiple stimuli that trigger distinct signal transduction pathways as follows: (i) The glucose signal inhibited UASru activity through the cyclic AMP (cAMP/protein kinase A (PKA) pathway, targeting the transcription factors (TFs), Com2 and Sko1; (ii) high osmolarity activated UASru through the Hog1/mitogen-activated protein kinase (MAPK) pathway and its corresponding TF Sko1; (iii) elevated temperature increased the activity of UASru through the cell wall integrity pathway and the TFs Swi4/Mpk1 and Swi4/Mlp1; (iv) the nitrogen source repressed UASru activity through Sum1; and (v) the absence of a nitrogen source was detected and transmitted to UASru by the Kss1 and Fus3 MAPK pathways through their respective downstream TFs, Ste12/Tec1 and Ste12/Ste12 as well as by their regulators Dig1/2. These signaling events were specific to UASru; they did not affect the mating and filamentation response elements that are regulated by MAPK pathways. The complex regulation of UASru through all the known vegetative MAPK pathways is unique to S. cerevisiae and is specific for IME1, likely because it is the master regulator of gametogenesis. PMID:24236068

  6. The Modifier of Transcription 1 (Mot1) ATPase and Spt16 Histone Chaperone Co-regulate Transcription through Preinitiation Complex Assembly and Nucleosome Organization.

    PubMed

    True, Jason D; Muldoon, Joseph J; Carver, Melissa N; Poorey, Kunal; Shetty, Savera J; Bekiranov, Stefan; Auble, David T

    2016-07-15

    Modifier of transcription 1 (Mot1) is a conserved and essential Swi2/Snf2 ATPase that can remove TATA-binding protein (TBP) from DNA using ATP hydrolysis and in so doing exerts global effects on transcription. Spt16 is also essential and functions globally in transcriptional regulation as a component of the facilitates chromatin transcription (FACT) histone chaperone complex. Here we demonstrate that Mot1 and Spt16 regulate a largely overlapping set of genes in Saccharomyces cerevisiae. As expected, Mot1 was found to control TBP levels at co-regulated promoters. In contrast, Spt16 did not affect TBP recruitment. On a global scale, Spt16 was required for Mot1 promoter localization, and Mot1 also affected Spt16 localization to genes. Interestingly, we found that Mot1 has an unanticipated role in establishing or maintaining the occupancy and positioning of nucleosomes at the 5' ends of genes. Spt16 has a broad role in regulating chromatin organization in gene bodies, including those nucleosomes affected by Mot1. These results suggest that the large scale overlap in Mot1 and Spt16 function arises from a combination of both their unique and shared functions in transcription complex assembly and chromatin structure regulation. PMID:27226635

  7. Stochastic Proofreading Mechanism Alleviates Crosstalk in Transcriptional Regulation

    NASA Astrophysics Data System (ADS)

    Cepeda-Humerez, Sarah A.; Rieckh, Georg; Tkačik, Gašper

    2015-12-01

    Gene expression is controlled primarily by interactions between transcription factor proteins (TFs) and the regulatory DNA sequence, a process that can be captured well by thermodynamic models of regulation. These models, however, neglect regulatory crosstalk: the possibility that noncognate TFs could initiate transcription, with potentially disastrous effects for the cell. Here, we estimate the importance of crosstalk, suggest that its avoidance strongly constrains equilibrium models of TF binding, and propose an alternative nonequilibrium scheme that implements kinetic proofreading to suppress erroneous initiation. This proposal is consistent with the observed covalent modifications of the transcriptional apparatus and predicts increased noise in gene expression as a trade-off for improved specificity. Using information theory, we quantify this trade-off to find when optimal proofreading architectures are favored over their equilibrium counterparts. Such architectures exhibit significant super-Poisson noise at low expression in steady state.

  8. Stochastic Proofreading Mechanism Alleviates Crosstalk in Transcriptional Regulation.

    PubMed

    Cepeda-Humerez, Sarah A; Rieckh, Georg; Tkačik, Gašper

    2015-12-11

    Gene expression is controlled primarily by interactions between transcription factor proteins (TFs) and the regulatory DNA sequence, a process that can be captured well by thermodynamic models of regulation. These models, however, neglect regulatory crosstalk: the possibility that noncognate TFs could initiate transcription, with potentially disastrous effects for the cell. Here, we estimate the importance of crosstalk, suggest that its avoidance strongly constrains equilibrium models of TF binding, and propose an alternative nonequilibrium scheme that implements kinetic proofreading to suppress erroneous initiation. This proposal is consistent with the observed covalent modifications of the transcriptional apparatus and predicts increased noise in gene expression as a trade-off for improved specificity. Using information theory, we quantify this trade-off to find when optimal proofreading architectures are favored over their equilibrium counterparts. Such architectures exhibit significant super-Poisson noise at low expression in steady state. PMID:26705657

  9. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  10. Transcriptional profiling of XdrA, a new regulator of spa transcription in Staphylococcus aureus.

    PubMed

    McCallum, N; Hinds, J; Ender, M; Berger-Bächi, B; Stutzmann Meier, P

    2010-10-01

    Transcription of spa, encoding the virulence factor protein A in Staphylococcus aureus, is tightly controlled by a complex regulatory network, ensuring its temporal expression over growth and at appropriate stages of the infection process. Transcriptomic profiling of XdrA, a DNA-binding protein that is conserved in all S. aureus genomes and shares similarity with the XRE family of helix-turn-helix, antitoxin-like proteins, revealed it to be a previously unidentified activator of spa transcription. To assess how XdrA fits into the complex web of spa regulation, a series of regulatory mutants were constructed; consisting of single, double, triple, and quadruple mutants lacking XdrA and/or the three key regulators previously shown to influence spa transcription directly (SarS, SarA, and RNAIII). A series of lacZ reporter gene fusions containing nested deletions of the spa promoter identified regions influenced by XdrA and the other three regulators. XdrA had almost as strong an activating effect on spa as SarS and acted on the same spa operator regions as SarS, or closely overlapping regions. All data from microarrays, Northern and Western blot analyses, and reporter gene fusion experiments indicated that XdrA is a major activator of spa expression that appears to act directly on the spa promoter and not through previously characterized regulators.

  11. Phenylacetic acid catabolism and its transcriptional regulation in Corynebacterium glutamicum.

    PubMed

    Chen, Xi; Kohl, Thomas A; Rückert, Christian; Rodionov, Dmitry A; Li, Ling-Hao; Ding, Jiu-Yuan; Kalinowski, Jörn; Liu, Shuang-Jiang

    2012-08-01

    The industrially important organism Corynebacterium glutamicum has been characterized in recent years for its robust ability to assimilate aromatic compounds. In this study, C. glutamicum strain AS 1.542 was investigated for its ability to catabolize phenylacetic acid (PAA). The paa genes were identified; they are organized as a continuous paa gene cluster. The type strain of C. glutamicum, ATCC 13032, is not able to catabolize PAA, but the recombinant strain ATCC 13032/pEC-K18mob2::paa gained the ability to grow on PAA. The paaR gene, encoding a TetR family transcription regulator, was studied in detail. Disruption of paaR in strain AS 1.542 resulted in transcriptional increases of all paa genes. Transcription start sites and putative promoter regions were determined. An imperfect palindromic motif (5'-ACTNACCGNNCGNNCGGTNAGT-3'; 22 bp) was identified in the upstream regions of paa genes. Electrophoretic mobility shift assays (EMSA) demonstrated specific binding of PaaR to this motif, and phenylacetyl coenzyme A (PA-CoA) blocked binding. It was concluded that PaaR is the negative regulator of PAA degradation and that PA-CoA is the PaaR effector. In addition, GlxR binding sites were found, and binding to GlxR was confirmed. Therefore, PAA catabolism in C. glutamicum is regulated by the pathway-specific repressor PaaR, and also likely by the global transcription regulator GlxR. By comparative genomic analysis, we reconstructed orthologous PaaR regulons in 57 species, including species of Actinobacteria, Proteobacteria, and Flavobacteria, that carry PAA utilization genes and operate by conserved binding motifs, suggesting that PaaR-like regulation might commonly exist in these bacteria.

  12. Interactions of cellular proteins involved in the transcriptional regulation of the human immunodeficiency virus.

    PubMed Central

    Garcia, J A; Wu, F K; Mitsuyasu, R; Gaynor, R B

    1987-01-01

    The human immunodeficiency virus (HIV) is a human retrovirus which is the etiologic agent of the acquired immunodeficiency syndrome. To study the cellular factors involved in the transcriptional regulation of this virus, we performed DNase I footprinting of the viral LTR using partially purified HeLa cell extracts. Five regions of the viral LTR appear critical for DNA binding of cellular proteins. These include the negative regulatory, enhancer, SP1, TATA and untranslated regions. Deletion mutagenesis of these binding domains has significant effects on the basal level of transcription and the ability to be induced by the viral tat protein. Mutations of either the negative regulatory or untranslated regions affect factor binding to the enhancer region. In addition, oligonucleotides complementary to several of the binding domains specifically compete for factor binding. These results suggest that interactions between several distinct cellular proteins are required for HIV transcriptional regulation. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 6. PMID:3428273

  13. Interactions of cellular proteins involved in the transcriptional regulation of the human immunodeficiency virus.

    PubMed

    Garcia, J A; Wu, F K; Mitsuyasu, R; Gaynor, R B

    1987-12-01

    The human immunodeficiency virus (HIV) is a human retrovirus which is the etiologic agent of the acquired immunodeficiency syndrome. To study the cellular factors involved in the transcriptional regulation of this virus, we performed DNase I footprinting of the viral LTR using partially purified HeLa cell extracts. Five regions of the viral LTR appear critical for DNA binding of cellular proteins. These include the negative regulatory, enhancer, SP1, TATA and untranslated regions. Deletion mutagenesis of these binding domains has significant effects on the basal level of transcription and the ability to be induced by the viral tat protein. Mutations of either the negative regulatory or untranslated regions affect factor binding to the enhancer region. In addition, oligonucleotides complementary to several of the binding domains specifically compete for factor binding. These results suggest that interactions between several distinct cellular proteins are required for HIV transcriptional regulation.

  14. Cyclin-Dependent Kinase Regulation of Diurnal Transcription in Chlamydomonas

    PubMed Central

    Cross, Frederick R.

    2015-01-01

    We analyzed global transcriptome changes during synchronized cell division in the green alga Chlamydomonas reinhardtii. The Chlamydomonas cell cycle consists of a long G1 phase, followed by an S/M phase with multiple rapid, alternating rounds of DNA replication and segregation. We found that the S/M period is associated with strong induction of ∼2300 genes, many with conserved roles in DNA replication or cell division. Other genes, including many involved in photosynthesis, are reciprocally downregulated in S/M, suggesting a gene expression split correlating with the temporal separation between G1 and S/M. The Chlamydomonas cell cycle is synchronized by light-dark cycles, so in principle, these transcriptional changes could be directly responsive to light or to metabolic cues. Alternatively, cell-cycle-periodic transcription may be directly regulated by cyclin-dependent kinases. To distinguish between these possibilities, we analyzed transcriptional profiles of mutants in the kinases CDKA and CDKB, as well as other mutants with distinct cell cycle blocks. Initial cell-cycle-periodic expression changes are largely CDK independent, but later regulation (induction and repression) is under differential control by CDKA and CDKB. Deviation from the wild-type transcriptional program in diverse cell cycle mutants will be an informative phenotype for further characterization of the Chlamydomonas cell cycle. PMID:26475866

  15. Changing Faces of Transcriptional Regulation Reflected by Zic3.

    PubMed

    Winata, Cecilia Lanny; Kondrychyn, Igor; Korzh, Vladimir

    2015-04-01

    The advent of genomics in the study of developmental mechanisms has brought a trove of information on gene datasets and regulation during development, where the Zic family of zinc-finger proteins plays an important role. Genomic analysis of the modes of action of Zic3 in pluripotent cells demonstrated its requirement for maintenance of stem cells pluripotency upon binding to the proximal regulatory regions (promoters) of genes associated with cell pluripotency (Nanog, Sox2, Oct4, etc.) as well as cell cycle, proliferation, oncogenesis and early embryogenesis. In contrast, during gastrulation and neurulation Zic3 acts by binding the distal regulatory regions (enhancers, etc) associated with control of gene transcription in the Nodal and Wnt signaling pathways, including genes that act to break body symmetry. This illustrates a general role of Zic3 as a transcriptional regulator that acts not only alone, but in many instances in conjunction with other transcription factors. The latter is done by binding to adjacent sites in the context of multi-transcription factor complexes associated with regulatory elements.

  16. Transcriptional regulation using the Q system in transgenic zebrafish.

    PubMed

    Ghosh, A; Halpern, M E

    2016-01-01

    Methods to label cell populations selectively or to modify their gene expression are critical tools in the study of developmental or physiological processes in vivo. A variety of approaches have been applied to the zebrafish model, capitalizing on Tol2 transposition to generate transgenic lines with high efficiency. Here we describe the adoption of the Q system of Neurospora crassa, which includes the QF transcription factor and the upstream activating sequence (QUAS) to which it binds. These components function as a bipartite regulatory system similar to that of yeast Gal4/UAS, producing robust expression in transient assays of zebrafish embryos injected with plasmids and in stable transgenic lines. An important advantage, however, is that QUAS-regulated transgenes appear far less susceptible to transcriptional silencing even after seven generations. This chapter describes some of the Q system reagents that have been developed for zebrafish, as well as the use of the QF transcription factor for isolation of tissue-specific driver lines from gene/enhancer trap screens. Additional strategies successfully implemented in invertebrate models, such as a truncated QF transcription factor (QF2) or the reassembly of a split QF, are also discussed. The provided information, and available Gateway-based vectors, should enable those working with the zebrafish model to implement the Q system with minimal effort or to use it in combination with Gal4, Cre, or other regulatory systems for further refinement of transcriptional control. PMID:27443927

  17. Analysis of Genomic Sequence Motifs for Deciphering Transcription Factor Binding and Transcriptional Regulation in Eukaryotic Cells

    PubMed Central

    Boeva, Valentina

    2016-01-01

    Eukaryotic genomes contain a variety of structured patterns: repetitive elements, binding sites of DNA and RNA associated proteins, splice sites, and so on. Often, these structured patterns can be formalized as motifs and described using a proper mathematical model such as position weight matrix and IUPAC consensus. Two key tasks are typically carried out for motifs in the context of the analysis of genomic sequences. These are: identification in a set of DNA regions of over-represented motifs from a particular motif database, and de novo discovery of over-represented motifs. Here we describe existing methodology to perform these two tasks for motifs characterizing transcription factor binding. When applied to the output of ChIP-seq and ChIP-exo experiments, or to promoter regions of co-modulated genes, motif analysis techniques allow for the prediction of transcription factor binding events and enable identification of transcriptional regulators and co-regulators. The usefulness of motif analysis is further exemplified in this review by how motif discovery improves peak calling in ChIP-seq and ChIP-exo experiments and, when coupled with information on gene expression, allows insights into physical mechanisms of transcriptional modulation. PMID:26941778

  18. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  19. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases.

  20. Analysis of Genomic Sequence Motifs for Deciphering Transcription Factor Binding and Transcriptional Regulation in Eukaryotic Cells.

    PubMed

    Boeva, Valentina

    2016-01-01

    Eukaryotic genomes contain a variety of structured patterns: repetitive elements, binding sites of DNA and RNA associated proteins, splice sites, and so on. Often, these structured patterns can be formalized as motifs and described using a proper mathematical model such as position weight matrix and IUPAC consensus. Two key tasks are typically carried out for motifs in the context of the analysis of genomic sequences. These are: identification in a set of DNA regions of over-represented motifs from a particular motif database, and de novo discovery of over-represented motifs. Here we describe existing methodology to perform these two tasks for motifs characterizing transcription factor binding. When applied to the output of ChIP-seq and ChIP-exo experiments, or to promoter regions of co-modulated genes, motif analysis techniques allow for the prediction of transcription factor binding events and enable identification of transcriptional regulators and co-regulators. The usefulness of motif analysis is further exemplified in this review by how motif discovery improves peak calling in ChIP-seq and ChIP-exo experiments and, when coupled with information on gene expression, allows insights into physical mechanisms of transcriptional modulation.

  1. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor

    PubMed Central

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light–oxygen–voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na+-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na+ currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  2. Mutational analysis of the redox-sensitive transcriptional regulator OxyR: regions important for oxidation and transcriptional activation.

    PubMed Central

    Kullik, I; Toledano, M B; Tartaglia, L A; Storz, G

    1995-01-01

    OxyR is a redox-sensitive transcriptional regulator of the LysR family which activates the expression of genes important for the defense against hydrogen peroxide in Escherichia coli and Samonella typhimurium. OxyR is sensitive to oxidation and reduction, and only oxidized OxyR is able to activate transcription of its target genes. Using site-directed mutagenesis, we found that one cysteine residue (C-199) is critical for the redox sensitivity of OxyR, and a C-199-->S mutation appears to lock the OxyR protein in the reduced form. We also used a random mutagenesis approach to isolate eight constitutively active mutants. All of the mutations are located in the C-terminal half of the protein, and four of the mutations map near the critical C-199 residue. In vivo as well as in vitro transcription experiments showed that the constitutive mutant proteins were able to activate transcription under both oxidizing and reducing conditions, and DNase I footprints showed that this activation is due to the ability of the mutant proteins to induce cooperative binding of RNA polymerase. Unexpectedly, RNA polymerase was also found to reciprocally affect OxyR binding. PMID:7868602

  3. Global transcriptional regulator TrmB family members in prokaryotes.

    PubMed

    Kim, Minwook; Park, Soyoung; Lee, Sung-Jae

    2016-10-01

    Members of the TrmB family act as global transcriptional regulators for the activation or repression of sugar ABC transporters and central sugar metabolic pathways, including glycolytic, gluconeogenic, and other metabolic pathways, and also as chromosomal stabilizers in archaea. As a relatively newly classified transcriptional regulator family, there is limited experimental evidence for their role in Thermococcales, halophilic archaeon Halobacterium salinarum NRC1, and crenarchaea Sulfolobus strains, despite being one of the extending protein families in archaea. Recently, the protein structures of Pyrococcus furiosus TrmB and TrmBL2 were solved, and the transcriptomic data uncovered by microarray and ChIP-Seq were published. In the present review, recent evidence of the functional roles of TrmB family members in archaea is explained and extended to bacteria. PMID:27687225

  4. Global transcriptional regulator TrmB family members in prokaryotes.

    PubMed

    Kim, Minwook; Park, Soyoung; Lee, Sung-Jae

    2016-10-01

    Members of the TrmB family act as global transcriptional regulators for the activation or repression of sugar ABC transporters and central sugar metabolic pathways, including glycolytic, gluconeogenic, and other metabolic pathways, and also as chromosomal stabilizers in archaea. As a relatively newly classified transcriptional regulator family, there is limited experimental evidence for their role in Thermococcales, halophilic archaeon Halobacterium salinarum NRC1, and crenarchaea Sulfolobus strains, despite being one of the extending protein families in archaea. Recently, the protein structures of Pyrococcus furiosus TrmB and TrmBL2 were solved, and the transcriptomic data uncovered by microarray and ChIP-Seq were published. In the present review, recent evidence of the functional roles of TrmB family members in archaea is explained and extended to bacteria.

  5. Identification of E2F1 as a positive transcriptional regulator for {delta}-catenin

    SciTech Connect

    Kim, Kwonseop; Oh, Minsoo; Ki, Hyunkyoung; Wang Tao; Bareiss, Sonja; Fini, M. Elizabeth.; Li Dawei; Lu Qun

    2008-05-02

    {delta}-Catenin is upregulated in human carcinomas. However, little is known about the potential transcriptional factors that regulate {delta}-catenin expression in cancer. Using a human {delta}-catenin reporter system, we have screened several nuclear signaling modulators to test whether they can affect {delta}-catenin transcription. Among {beta}-catenin/LEF-1, Notch1, and E2F1, E2F1 dramatically increased {delta}-catenin-luciferase activities while {beta}-catenin/LEF-1 induced only a marginal increase. Rb suppressed the upregulation of {delta}-catenin-luciferase activities induced by E2F1 but did not interact with {delta}-catenin. RT-PCR and Western blot analyses in 4 different prostate cancer cell lines revealed that regulation of {delta}-catenin expression is controlled mainly at the transcriptional level. Interestingly, the effects of E2F1 on {delta}-catenin expression were observed only in human cancer cells expressing abundant endogenous {delta}-catenin. These studies identify E2F1 as a positive transcriptional regulator for {delta}-catenin, but further suggest the presence of strong negative regulator(s) for {delta}-catenin in prostate cancer cells with minimal endogenous {delta}-catenin expression.

  6. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation

    PubMed Central

    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim Ø.; Usheva, Anny

    2010-01-01

    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA contacts. We use this effect to establish the separate contributions of transcription factor binding and DNA dynamics to transcriptional activity. Our results argue against a purely ‘transcription factor-centric’ view of transcription initiation, suggesting that both DNA dynamics and transcription factor binding are necessary conditions for transcription initiation. PMID:20019064

  7. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus.

    PubMed

    Khoroshkin, Matvei S; Leyn, Semen A; Van Sinderen, Douwe; Rodionov, Dmitry A

    2016-01-01

    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics.

  8. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus

    PubMed Central

    Khoroshkin, Matvei S.; Leyn, Semen A.; Van Sinderen, Douwe; Rodionov, Dmitry A.

    2016-01-01

    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics. PMID:26903998

  9. Hydrogen peroxide sensing, signaling and regulation of transcription factors

    PubMed Central

    Marinho, H. Susana; Real, Carla; Cyrne, Luísa; Soares, Helena; Antunes, Fernando

    2014-01-01

    The regulatory mechanisms by which hydrogen peroxide (H2O2) modulates the activity of transcription factors in bacteria (OxyR and PerR), lower eukaryotes (Yap1, Maf1, Hsf1 and Msn2/4) and mammalian cells (AP-1, NRF2, CREB, HSF1, HIF-1, TP53, NF-κB, NOTCH, SP1 and SCREB-1) are reviewed. The complexity of regulatory networks increases throughout the phylogenetic tree, reaching a high level of complexity in mammalians. Multiple H2O2 sensors and pathways are triggered converging in the regulation of transcription factors at several levels: (1) synthesis of the transcription factor by upregulating transcription or increasing both mRNA stability and translation; (ii) stability of the transcription factor by decreasing its association with the ubiquitin E3 ligase complex or by inhibiting this complex; (iii) cytoplasm–nuclear traffic by exposing/masking nuclear localization signals, or by releasing the transcription factor from partners or from membrane anchors; and (iv) DNA binding and nuclear transactivation by modulating transcription factor affinity towards DNA, co-activators or repressors, and by targeting specific regions of chromatin to activate individual genes. We also discuss how H2O2 biological specificity results from diverse thiol protein sensors, with different reactivity of their sulfhydryl groups towards H2O2, being activated by different concentrations and times of exposure to H2O2. The specific regulation of local H2O2 concentrations is also crucial and results from H2O2 localized production and removal controlled by signals. Finally, we formulate equations to extract from typical experiments quantitative data concerning H2O2 reactivity with sensor molecules. Rate constants of 140 M−1 s−1 and ≥1.3 × 103 M−1 s−1 were estimated, respectively, for the reaction of H2O2 with KEAP1 and with an unknown target that mediates NRF2 protein synthesis. In conclusion, the multitude of H2O2 targets and mechanisms provides an opportunity for highly

  10. Autopalmitoylation of TEAD Proteins Regulates Transcriptional Output of Hippo Pathway

    PubMed Central

    Chan, PuiYee; Han, Xiao; Zheng, Baohui; DeRan, Michael; Yu, Jianzhong; Jarugumilli, Gopala K.; Deng, Hua; Pan, Duojia; Luo, Xuelian; Wu, Xu

    2016-01-01

    TEA domain (TEAD) transcription factors bind to the co-activator YAP/TAZ, and regulate the transcriptional output of Hippo pathway, playing critical roles in organ size control and tumorigenesis. Protein S-palmitoylation attaches fatty acid (palmitate) to cysteine residues, and regulates protein trafficking, membrane localization and signaling activities. Using activity-based chemical probes, we discovered that human TEADs possess intrinsic palmitoylating enzyme-like activities, and undergo autopalmitoylation at evolutionarily conserved cysteine residues under physiological conditions. We determined the crystal structures of lipid-bound TEADs, and found that the lipid chain of palmitate inserts into a conserved deep hydrophobic pocket. Strikingly, palmitoylation is required for TEAD’s binding to YAP/TAZ, but dispensable for the binding to Vgll4 tumor suppressor. In addition, palmitoylation does not alter TEAD’s localization. Moreover, TEAD palmitoylation-deficient mutants impaired TAZ-mediated muscle differentiation in vitro, and Yorkie-mediated tissue overgrowth in Drosophila in vivo. Our study directly linked autopalmitoylation to the transcriptional regulation of Hippo pathway. PMID:26900866

  11. Transcriptional Regulation of the Streptococcus salivarius 57.I Urease Operon

    PubMed Central

    Chen, Yi-Ywan M.; Weaver, Cheryl A.; Mendelsohn, David R.; Burne, Robert A.

    1998-01-01

    The Streptococcus salivarius 57.I ure cluster was organized as an operon, beginning with ureI, followed by ureABC (structural genes) and ureEFGD (accessory genes). Northern analyses revealed transcripts encompassing structural genes and transcripts containing the entire operon. A ς70-like promoter could be mapped 5′ to ureI (PureI) by primer extension analysis. The intensity of the signal increased when cells were grown at an acidic pH and was further enhanced by excess carbohydrate. To determine the function(s) of two inverted repeats located 5′ to PureI, transcriptional fusions of the full-length promoter region (PureI), or a deletion derivative (PureIΔ100), and a promoterless chloramphenicol acetyltransferase (CAT) gene were constructed and integrated into the chromosome to generate strains PureICAT and PureIΔ100CAT, respectively. CAT specific activities of PureICAT were repressed at pH 7.0 and induced at pH 5.5 and by excess carbohydrate. In PureIΔ100CAT, CAT activity was 60-fold higher than in PureICAT at pH 7.0 and pH induction was nearly eliminated, indicating that expression was negatively regulated. Thus, it was concluded that PureI was the predominant, regulated promoter and that regulation was governed by a mechanism differing markedly from other known mechanisms for bacterial urease expression. PMID:9791132

  12. Role of Sam68 in post-transcriptional gene regulation.

    PubMed

    Sánchez-Jiménez, Flora; Sánchez-Margalet, Víctor

    2013-11-28

    The STAR family of proteins links signaling pathways to various aspects of post-transcriptional regulation and processing of RNAs. Sam68 belongs to this class of heteronuclear ribonucleoprotein particle K (hnRNP K) homology (KH) single domain-containing family of RNA-binding proteins that also contains some domains predicted to bind critical components in signal transduction pathways. In response to phosphorylation and other post-transcriptional modifications, Sam68 has been shown to have the ability to link signal transduction pathways to downstream effects regulating RNA metabolism, including transcription, alternative splicing or RNA transport. In addition to its function as a docking protein in some signaling pathways, this prototypic STAR protein has been identified to have a nuclear localization and to take part in the formation of both nuclear and cytosolic multi-molecular complexes such as Sam68 nuclear bodies and stress granules. Coupling with other proteins and RNA targets, Sam68 may play a role in the regulation of differential expression and mRNA processing and translation according to internal and external signals, thus mediating important physiological functions, such as cell death, proliferation or cell differentiation.

  13. Role of Sam68 in Post-Transcriptional Gene Regulation

    PubMed Central

    Sánchez-Jiménez, Flora; Sánchez-Margalet, Víctor

    2013-01-01

    The STAR family of proteins links signaling pathways to various aspects of post-transcriptional regulation and processing of RNAs. Sam68 belongs to this class of heteronuclear ribonucleoprotein particle K (hnRNP K) homology (KH) single domain-containing family of RNA-binding proteins that also contains some domains predicted to bind critical components in signal transduction pathways. In response to phosphorylation and other post-transcriptional modifications, Sam68 has been shown to have the ability to link signal transduction pathways to downstream effects regulating RNA metabolism, including transcription, alternative splicing or RNA transport. In addition to its function as a docking protein in some signaling pathways, this prototypic STAR protein has been identified to have a nuclear localization and to take part in the formation of both nuclear and cytosolic multi-molecular complexes such as Sam68 nuclear bodies and stress granules. Coupling with other proteins and RNA targets, Sam68 may play a role in the regulation of differential expression and mRNA processing and translation according to internal and external signals, thus mediating important physiological functions, such as cell death, proliferation or cell differentiation. PMID:24287914

  14. Transcriptionally and post-transcriptionally regulated microRNAs in heat stress response in barley

    PubMed Central

    Kruszka, Katarzyna; Pacak, Andrzej; Swida-Barteczka, Aleksandra; Nuc, Przemyslaw; Alaba, Sylwia; Wroblewska, Zuzanna; Karlowski, Wojciech; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

    2014-01-01

    Heat stress is one of the major abiotic factors that can induce severe plant damage, leading to a decrease in crop plant productivity. Despite barley being a cereal of great economic importance, few data are available concerning its thermotolerance mechanisms. In this work microRNAs (miRNAs) involved in heat stress response in barley were investigated. The level of selected barley mature miRNAs was examined by hybridization. Quantitative real-time PCR (RT-qPCR) was used to monitor the changes in the expression profiles of primary miRNA (pri-miRNA) precursors, as well as novel and conserved target genes during heat stress. The miRNA-mediated cleavage sites in the target transcripts were confirmed by degradome analysis and the 5’ RACE (rapid amplification of cDNA ends) approach. Four barley miRNAs (miR160a, 166a, 167h, and 5175a) were found which are heat stress up-regulated at the level of both mature miRNAs and precursor pri-miRNAs. Moreover, the splicing of introns hosting miR160a and miR5175a is also heat induced. The results demonstrate transcriptional and post-transcriptional regulation of heat-responsive miRNAs in barley. The observed induction of miRNA expression is correlated with the down-regulation of the expression level of their experimentally identified new and conservative target genes. PMID:25183744

  15. Transcriptionally and post-transcriptionally regulated microRNAs in heat stress response in barley.

    PubMed

    Kruszka, Katarzyna; Pacak, Andrzej; Swida-Barteczka, Aleksandra; Nuc, Przemyslaw; Alaba, Sylwia; Wroblewska, Zuzanna; Karlowski, Wojciech; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

    2014-11-01

    Heat stress is one of the major abiotic factors that can induce severe plant damage, leading to a decrease in crop plant productivity. Despite barley being a cereal of great economic importance, few data are available concerning its thermotolerance mechanisms. In this work microRNAs (miRNAs) involved in heat stress response in barley were investigated. The level of selected barley mature miRNAs was examined by hybridization. Quantitative real-time PCR (RT-qPCR) was used to monitor the changes in the expression profiles of primary miRNA (pri-miRNA) precursors, as well as novel and conserved target genes during heat stress. The miRNA-mediated cleavage sites in the target transcripts were confirmed by degradome analysis and the 5' RACE (rapid amplification of cDNA ends) approach. Four barley miRNAs (miR160a, 166a, 167h, and 5175a) were found which are heat stress up-regulated at the level of both mature miRNAs and precursor pri-miRNAs. Moreover, the splicing of introns hosting miR160a and miR5175a is also heat induced. The results demonstrate transcriptional and post-transcriptional regulation of heat-responsive miRNAs in barley. The observed induction of miRNA expression is correlated with the down-regulation of the expression level of their experimentally identified new and conservative target genes.

  16. Transcriptional regulation of secretory capacity by bZip transcription factors

    PubMed Central

    FOX, Rebecca M.

    2015-01-01

    Cells of specialized secretory organs expand their secretory pathways to accommodate the increased protein load necessary for their function. The endoplasmic reticulum (ER), the Golgi apparatus and the secretory vesicles, expand not only the membrane components but also the protein machinery required for increased protein production and transport. Increased protein load causes an ER stress response akin to the Unfolded Protein Response (UPR). Recent work has implicated several bZip transcription factors in the regulation of protein components of the early secretory pathway necessary to alleviate this stress. Here, we highlight eight bZip transcription factors in regulating secretory pathway component genes. These include components of the three canonical branches of the UPR–ATF4, XBP1, and ATF6, as well as the five members of the Creb3 family of transcription factors. We review findings from both invertebrate and vertebrate model systems suggesting that all of these proteins increase secretory capacity in response to increased protein load. Finally, we propose that the Creb3 family of factors may have a dual role in secretory cell differentiation by also regulating the pathways necessary for cell cycle exit during terminal differentiation. PMID:25821458

  17. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs.

  18. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  19. Harnessing the master transcriptional repressor REST to reciprocally regulate neurogenesis

    PubMed Central

    Nesti, Edmund

    2015-01-01

    Neurogenesis begins in embryonic development and continues at a reduced rate into adulthood in vertebrate species, yet the signaling cascades regulating this process remain poorly understood. Plasma membrane-initiated signaling cascades regulate neurogenesis via downstream pathways including components of the transcriptional machinery. A nuclear factor that temporally regulates neurogenesis by repressing neuronal differentiation is the repressor element 1 (RE1) silencing transcription (REST) factor. We have recently discovered a regulatory site on REST that serves as a molecular switch for neuronal differentiation. Specifically, C-terminal domain small phosphatase 1, CTDSP1, present in non-neuronal cells, maintains REST activity by dephosphorylating this site. Reciprocally, extracellular signal-regulated kinase, ERK, activated by growth factor signaling in neural progenitors, and peptidylprolyl cis/trans isomerase Pin1, decrease REST activity through phosphorylation-dependent degradation. Our findings further resolve the mechanism for temporal regulation of REST and terminal neuronal differentiation. They also provide new potential therapeutic targets to enhance neuronal regeneration after injury. PMID:27535341

  20. Dynamic Metabolite Profiling in an Archaeon Connects Transcriptional Regulation to Metabolic Consequences

    PubMed Central

    Todor, Horia; Gooding, Jessica; Ilkayeva, Olga R.; Schmid, Amy K.

    2015-01-01

    Previous work demonstrated that the TrmB transcription factor is responsible for regulating the expression of many enzyme-coding genes in the hypersaline-adapted archaeon Halobacterium salinarum via a direct interaction with a cis-regulatory sequence in their promoters. This interaction is abolished in the presence of glucose. Although much is known about the effects of TrmB at the transcriptional level, it remains unclear whether and to what extent changes in mRNA levels directly affect metabolite levels. In order to address this question, here we performed a high-resolution metabolite profiling time course during a change in nutrients using a combination of targeted and untargeted methods in wild-type and ΔtrmB strain backgrounds. We found that TrmB-mediated transcriptional changes resulted in widespread and significant changes to metabolite levels across the metabolic network. Additionally, the pattern of growth complementation using various purines suggests that the mis-regulation of gluconeogenesis in the ΔtrmB mutant strain in the absence of glucose results in low phosphoribosylpyrophosphate (PRPP) levels. We confirmed these low PRPP levels using a quantitative mass spectrometric technique and found that they are associated with a metabolic block in de novo purine synthesis, which is partially responsible for the growth defect of the ΔtrmB mutant strain in the absence of glucose. In conclusion, we show how transcriptional regulation of metabolism affects metabolite levels and ultimately, phenotypes. PMID:26284786

  1. Dynamic Metabolite Profiling in an Archaeon Connects Transcriptional Regulation to Metabolic Consequences.

    PubMed

    Todor, Horia; Gooding, Jessica; Ilkayeva, Olga R; Schmid, Amy K

    2015-01-01

    Previous work demonstrated that the TrmB transcription factor is responsible for regulating the expression of many enzyme-coding genes in the hypersaline-adapted archaeon Halobacterium salinarum via a direct interaction with a cis-regulatory sequence in their promoters. This interaction is abolished in the presence of glucose. Although much is known about the effects of TrmB at the transcriptional level, it remains unclear whether and to what extent changes in mRNA levels directly affect metabolite levels. In order to address this question, here we performed a high-resolution metabolite profiling time course during a change in nutrients using a combination of targeted and untargeted methods in wild-type and ΔtrmB strain backgrounds. We found that TrmB-mediated transcriptional changes resulted in widespread and significant changes to metabolite levels across the metabolic network. Additionally, the pattern of growth complementation using various purines suggests that the mis-regulation of gluconeogenesis in the ΔtrmB mutant strain in the absence of glucose results in low phosphoribosylpyrophosphate (PRPP) levels. We confirmed these low PRPP levels using a quantitative mass spectrometric technique and found that they are associated with a metabolic block in de novo purine synthesis, which is partially responsible for the growth defect of the ΔtrmB mutant strain in the absence of glucose. In conclusion, we show how transcriptional regulation of metabolism affects metabolite levels and ultimately, phenotypes.

  2. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene

    PubMed Central

    Zhou, Jiawei

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  3. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene.

    PubMed

    Li, Yan; Wang, Lei; Zhou, Jiawei; Li, Fenge

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (-418 bp to -3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  4. Transcriptional regulation of genes related to progesterone production.

    PubMed

    Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru

    2015-01-01

    Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production. PMID:26135521

  5. Transcriptional and post-transcriptional regulation of tyrosine hydroxylase gene by protein kinase C.

    PubMed Central

    Vyas, S; Faucon Biguet, N; Mallet, J

    1990-01-01

    The role played by protein kinase C (PKC) in TH gene regulation was investigated at transcriptional and post-transcriptional levels using PC12 cells. The cells were treated with the phorbol ester TPA, which not only activates PKC but also causes down-regulation. PKC levels were monitored by [3H]PDBU binding assay and by using an anti-PKC antibody that detected intact PKC (79 kd) as well as its catalytic and regulatory domains. The [3H]PDBU binding to the membrane-associated PKC increased within 15-30 min of TPA treatment; thereafter total cellular [3H]PDBU binding decreased to a minimum of 20% of the control at 8 h. The rate of decrease in binding was greater than the decrease in the intensity of the staining of PKC holo enzyme visualized by anti-PKC antibody. TH mRNA levels, measured over the same time period, rose within 15 min of TPA treatment to peak at 4 h and subsequently declined below control level, paralleling the depletion of PKC. If cells depleted of PKC were reincubated in the normal medium, a recovery in PKC level was seen and, in parallel, TH mRNA levels increased to above control level. Furthermore, if down-regulation of PKC was prevented by incubating the cells with the protease inhibitor leupeptin, a decrease beyond control level in TH mRNA was not observed. TPA rapidly induced TH gene transcription; a maximal increase of two-fold was observed at 15 min, but the transcriptional rate then declined although it did not decrease beyond control values after 8 and 24 h of TPA treatment.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig.2 Fig.3 Fig.6 PMID:1976513

  6. Arsenic trioxide-mediated growth inhibition in gallbladder carcinoma cells via down-regulation of Cyclin D1 transcription mediated by Sp1 transcription factor

    SciTech Connect

    Ai, Zhilong; Lu, Weiqi; Ton, Saixiong; Liu, Houbao; Sou, Tao; Shen, Zhenbin; Qin, Xinyu . E-mail: smc_jjh@yahoo.com.cn

    2007-08-31

    Gallbladder carcinoma (GBC), an aggressive and mostly lethal malignancy, is known to be resistant to a number of drug stimuli. Here, we demonstrated that arsenic trioxide inhibited the proliferation of gallbladder carcinoma in vivo and in vitro as well as the transcription of cell cycle-related protein Cyclin D1. And, Cyclin D1 overexpression inhibited the negative role of arsenic trioxide in cell cycle progression. We further explored the mechanisms by which arsenic trioxide affected Cyclin D1 transcription and found that the Sp1 transcription factor was down-regulated by arsenic trioxide, with a corresponding decrease in Cyclin D1 promoter activity. Taken together, these results suggested that arsenic trioxide inhibited gallbladder carcinoma cell proliferation via down-regulation of Cyclin D1 transcription in a Sp1-dependent manner, which provided a new mechanism of arsenic trioxide-involved cell proliferation and may have important therapeutic implications in gallbladder carcinoma patients.

  7. Phosphorylation Regulates Functions of ZEB1 Transcription Factor.

    PubMed

    Llorens, M Candelaria; Lorenzatti, Guadalupe; Cavallo, Natalia L; Vaglienti, Maria V; Perrone, Ana P; Carenbauer, Anne L; Darling, Douglas S; Cabanillas, Ana M

    2016-10-01

    ZEB1 transcription factor is important in both development and disease, including many TGFβ-induced responses, and the epithelial-to-mesenchymal transition (EMT) by which many tumors undergo metastasis. ZEB1 is differentially phosphorylated in different cell types; however the role of phosphorylation in ZEB1 activity is unknown. Luciferase reporter studies and electrophoresis mobility shift assays (EMSA) show that a decrease in phosphorylation of ZEB1 increases both DNA-binding and transcriptional repression of ZEB1 target genes. Functional analysis of ZEB1 phosphorylation site mutants near the second zinc finger domain (termed ZD2) show that increased phosphorylation (due to either PMA plus ionomycin, or IGF-1) can inhibit transcriptional repression by either a ZEB1-ZD2 domain clone, or full-length ZEB1. This approach identifies phosphosites that have a substantial effect regulating the transcriptional and DNA-binding activity of ZEB1. Immunoprecipitation with anti-ZEB1 antibodies followed by western analysis with a phospho-Threonine-Proline-specific antibody indicates that the ERK consensus site at Thr-867 is phosphorylated in ZEB1. In addition to disrupting in vitro DNA-binding measured by EMSA, IGF-1-induced MEK/ERK phosphorylation is sufficient to disrupt nuclear localization of GFP-ZEB1 fusion clones. These data suggest that phosphorylation of ZEB1 integrates TGFβ signaling with other signaling pathways such as IGF-1. J. Cell. Physiol. 231: 2205-2217, 2016. © 2016 Wiley Periodicals, Inc. PMID:26868487

  8. Phosphorylation Regulates Functions of ZEB1 Transcription Factor.

    PubMed

    Llorens, M Candelaria; Lorenzatti, Guadalupe; Cavallo, Natalia L; Vaglienti, Maria V; Perrone, Ana P; Carenbauer, Anne L; Darling, Douglas S; Cabanillas, Ana M

    2016-10-01

    ZEB1 transcription factor is important in both development and disease, including many TGFβ-induced responses, and the epithelial-to-mesenchymal transition (EMT) by which many tumors undergo metastasis. ZEB1 is differentially phosphorylated in different cell types; however the role of phosphorylation in ZEB1 activity is unknown. Luciferase reporter studies and electrophoresis mobility shift assays (EMSA) show that a decrease in phosphorylation of ZEB1 increases both DNA-binding and transcriptional repression of ZEB1 target genes. Functional analysis of ZEB1 phosphorylation site mutants near the second zinc finger domain (termed ZD2) show that increased phosphorylation (due to either PMA plus ionomycin, or IGF-1) can inhibit transcriptional repression by either a ZEB1-ZD2 domain clone, or full-length ZEB1. This approach identifies phosphosites that have a substantial effect regulating the transcriptional and DNA-binding activity of ZEB1. Immunoprecipitation with anti-ZEB1 antibodies followed by western analysis with a phospho-Threonine-Proline-specific antibody indicates that the ERK consensus site at Thr-867 is phosphorylated in ZEB1. In addition to disrupting in vitro DNA-binding measured by EMSA, IGF-1-induced MEK/ERK phosphorylation is sufficient to disrupt nuclear localization of GFP-ZEB1 fusion clones. These data suggest that phosphorylation of ZEB1 integrates TGFβ signaling with other signaling pathways such as IGF-1. J. Cell. Physiol. 231: 2205-2217, 2016. © 2016 Wiley Periodicals, Inc.

  9. Signaling and transcriptional regulation in osteoblast commitment and differentiation

    PubMed Central

    Huang, Wei; Yang, Shuying; Shao, Jianzhong; Li, Yi-Ping

    2013-01-01

    The major event that triggers osteogenesis is the transition of mesenchymal stem cells into bone forming, differentiating osteoblast cells. Osteoblast differentiation is the primary component of bone formation, exemplified by the synthesis, deposition and mineralization of extracellular matrix. Although not well understood, osteoblast differentiation from mesenchymal stem cells is a well-orchestrated process. Recent advances in molecular and genetic studies using gene targeting in mouse enable a better understanding of the multiple factors and signaling networks that control the differentiation process at a molecular level. Osteoblast commitment and differentiation are controlled by complex activities involving signal transduction and transcriptional regulation of gene expression. We review Wnt signaling pathway and Runx2 regulation network, which are critical for osteoblast differentiation. Many other factors and signaling pathways have been implicated in regulation of osteoblast differentiation in a network manner, such as the factors Osterix, ATF4, and SATB2 and the TGF-beta, Hedgehog, FGF, ephrin, and sympathetic signaling pathways. This review summarizes the recent advances in the studies of signaling transduction pathways and transcriptional regulation of osteoblast cell lineage commitment and differentiation. The knowledge of osteoblast commitment and differentiation should be applied towards the development of new diagnostic and therapeutic alternatives for human bone diseases. PMID:17485283

  10. Sperm is epigenetically programmed to regulate gene transcription in embryos.

    PubMed

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M; Zegerman, Philip; Bradshaw, Charles R; Peters, Antoine H F M; Gurdon, John B; Jullien, Jerome

    2016-08-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  11. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  12. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses

    PubMed Central

    Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Luo, De-Xu; Gong, Zhen-Hui; Lu, Ming-Hui

    2016-01-01

    Abiotic stresses such as high temperature, salinity, and drought adversely affect the survival, growth, and reproduction of plants. Plants respond to such unfavorable changes through developmental, physiological, and biochemical ways, and these responses require expression of stress-responsive genes, which are regulated by a network of transcription factors (TFs), including heat stress transcription factors (HSFs). HSFs play a crucial role in plants response to several abiotic stresses by regulating the expression of stress-responsive genes, such as heat shock proteins (Hsps). In this review, we describe the conserved structure of plant HSFs, the identification of HSF gene families from various plant species, their expression profiling under abiotic stress conditions, regulation at different levels and function in abiotic stresses. Despite plant HSFs share highly conserved structure, their remarkable diversification across plants reflects their numerous functions as well as their integration into the complex stress signaling and response networks, which can be employed in crop improvement strategies via biotechnological intervention. PMID:26904076

  13. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses.

    PubMed

    Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Luo, De-Xu; Gong, Zhen-Hui; Lu, Ming-Hui

    2016-01-01

    Abiotic stresses such as high temperature, salinity, and drought adversely affect the survival, growth, and reproduction of plants. Plants respond to such unfavorable changes through developmental, physiological, and biochemical ways, and these responses require expression of stress-responsive genes, which are regulated by a network of transcription factors (TFs), including heat stress transcription factors (HSFs). HSFs play a crucial role in plants response to several abiotic stresses by regulating the expression of stress-responsive genes, such as heat shock proteins (Hsps). In this review, we describe the conserved structure of plant HSFs, the identification of HSF gene families from various plant species, their expression profiling under abiotic stress conditions, regulation at different levels and function in abiotic stresses. Despite plant HSFs share highly conserved structure, their remarkable diversification across plants reflects their numerous functions as well as their integration into the complex stress signaling and response networks, which can be employed in crop improvement strategies via biotechnological intervention.

  14. Model-based redesign of global transcription regulation

    PubMed Central

    Carrera, Javier; Rodrigo, Guillermo; Jaramillo, Alfonso

    2009-01-01

    Synthetic biology aims to the design or redesign of biological systems. In particular, one possible goal could be the rewiring of the transcription regulation network by exchanging the endogenous promoters. To achieve this objective, we have adapted current methods to the inference of a model based on ordinary differential equations that is able to predict the network response after a major change in its topology. Our procedure utilizes microarray data for training. We have experimentally validated our inferred global regulatory model in Escherichia coli by predicting transcriptomic profiles under new perturbations. We have also tested our methodology in silico by providing accurate predictions of the underlying networks from expression data generated with artificial genomes. In addition, we have shown the predictive power of our methodology by obtaining the gene profile in experimental redesigns of the E. coli genome, where rewiring the transcriptional network by means of knockouts of master regulators or by upregulating transcription factors controlled by different promoters. Our approach is compatible with most network inference methods, allowing to explore computationally future genome-wide redesign experiments in synthetic biology. PMID:19188257

  15. TOR-dependent post-transcriptional regulation of autophagy.

    PubMed

    Hu, Guowu; McQuiston, Travis; Bernard, Amélie; Park, Yoon-Dong; Qiu, Jin; Vural, Ali; Zhang, Nannan; Waterman, Scott R; Blewett, Nathan H; Myers, Timothy G; Maraia, Richard J; Kehrl, John H; Uzel, Gulbu; Klionsky, Daniel J; Williamson, Peter R

    2015-01-01

    Regulation of autophagy is required to maintain cellular equilibrium and prevent disease. While extensive study of post-translational mechanisms has yielded important insights into autophagy induction, less is known about post-transcriptional mechanisms that could potentiate homeostatic control. In our study, we showed that the RNA-binding protein, Dhh1 in Saccharomyces cerevisiae and Vad1 in the pathogenic yeast Cryptococcus neoformans is involved in recruitment and degradation of key autophagy mRNAs. In addition, phosphorylation of the decapping protein Dcp2 by the target of rapamycin (TOR), facilitates decapping and degradation of autophagy-related mRNAs, resulting in repression of autophagy under nutrient-replete conditions. The post-transcriptional regulatory process is conserved in both mouse and human cells and plays a role in autophagy-related modulation of the inflammasome product IL1B. These results were then applied to provide mechanistic insight into autoimmunity of a patient with a PIK3CD/p110δ gain-of-function mutation. These results thus identify an important new post-transcriptional mechanism of autophagy regulation that is highly conserved between yeast and mammals.

  16. In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

    PubMed Central

    Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

    2008-01-01

    Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

  17. Redox regulation of FoxO transcription factors

    PubMed Central

    Klotz, Lars-Oliver; Sánchez-Ramos, Cristina; Prieto-Arroyo, Ignacio; Urbánek, Pavel; Steinbrenner, Holger; Monsalve, Maria

    2015-01-01

    Transcription factors of the forkhead box, class O (FoxO) family are important regulators of the cellular stress response and promote the cellular antioxidant defense. On one hand, FoxOs stimulate the transcription of genes coding for antioxidant proteins located in different subcellular compartments, such as in mitochondria (i.e. superoxide dismutase-2, peroxiredoxins 3 and 5) and peroxisomes (catalase), as well as for antioxidant proteins found extracellularly in plasma (e.g., selenoprotein P and ceruloplasmin). On the other hand, reactive oxygen species (ROS) as well as other stressful stimuli that elicit the formation of ROS, may modulate FoxO activity at multiple levels, including posttranslational modifications of FoxOs (such as phosphorylation and acetylation), interaction with coregulators, alterations in FoxO subcellular localization, protein synthesis and stability. Moreover, transcriptional and posttranscriptional control of the expression of genes coding for FoxOs is sensitive to ROS. Here, we review these aspects of FoxO biology focusing on redox regulation of FoxO signaling, and with emphasis on the interplay between ROS and FoxOs under various physiological and pathophysiological conditions. Of particular interest are the dual role played by FoxOs in cancer development and their key role in whole body nutrient homeostasis, modulating metabolic adaptations and/or disturbances in response to low vs. high nutrient intake. Examples discussed here include calorie restriction and starvation as well as adipogenesis, obesity and type 2 diabetes. PMID:26184557

  18. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds

    PubMed Central

    Chai, Zhenguang; Guo, Wenzhu; Chen, Rumei; Wang, Lei; Zhao, Jun; Lang, Zhihong; Fan, Yunliu; Zhao, Jiuran; Zhang, Chunyi

    2015-01-01

    Background Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it’s a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively. Results The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis. Conclusions In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs. PMID:26469520

  19. The regulation of mitochondrial transcription factor A (Tfam) expression during skeletal muscle cell differentiation.

    PubMed

    Collu-Marchese, Melania; Shuen, Michael; Pauly, Marion; Saleem, Ayesha; Hood, David A

    2015-01-01

    The ATP demand required for muscle development is accommodated by elevations in mitochondrial biogenesis, through the co-ordinated activities of the nuclear and mitochondrial genomes. The most important transcriptional activator of the mitochondrial genome is mitochondrial transcription factor A (Tfam); however, the regulation of Tfam expression during muscle differentiation is not known. Thus, we measured Tfam mRNA levels, mRNA stability, protein expression and localization and Tfam transcription during the progression of muscle differentiation. Parallel 2-fold increases in Tfam protein and mRNA were observed, corresponding with 2-3-fold increases in mitochondrial content. Transcriptional activity of a 2051 bp promoter increased during this differentiation period and this was accompanied by a 3-fold greater Tfam mRNA stabilization. Interestingly, truncations of the promoter at 1706 bp, 978 bp and 393 bp promoter all exhibited 2-3-fold higher transcriptional activity than the 2051 bp construct, indicating the presence of negative regulatory elements within the distal 350 bp of the promoter. Activation of AMP kinase augmented Tfam transcription within the proximal promoter, suggesting the presence of binding sites for transcription factors that are responsive to cellular energy state. During differentiation, the accumulating Tfam protein was progressively distributed to the mitochondrial matrix where it augmented the expression of mtDNA and COX (cytochrome c oxidase) subunit I, an mtDNA gene product. Our data suggest that, during muscle differentiation, Tfam protein levels are regulated by the availability of Tfam mRNA, which is controlled by both transcription and mRNA stability. Changes in energy state and Tfam localization also affect Tfam expression and action in differentiating myotubes.

  20. The regulation of mitochondrial transcription factor A (Tfam) expression during skeletal muscle cell differentiation

    PubMed Central

    Collu-Marchese, Melania; Shuen, Michael; Pauly, Marion; Saleem, Ayesha; Hood, David A.

    2015-01-01

    The ATP demand required for muscle development is accommodated by elevations in mitochondrial biogenesis, through the co-ordinated activities of the nuclear and mitochondrial genomes. The most important transcriptional activator of the mitochondrial genome is mitochondrial transcription factor A (Tfam); however, the regulation of Tfam expression during muscle differentiation is not known. Thus, we measured Tfam mRNA levels, mRNA stability, protein expression and localization and Tfam transcription during the progression of muscle differentiation. Parallel 2-fold increases in Tfam protein and mRNA were observed, corresponding with 2–3-fold increases in mitochondrial content. Transcriptional activity of a 2051 bp promoter increased during this differentiation period and this was accompanied by a 3-fold greater Tfam mRNA stabilization. Interestingly, truncations of the promoter at 1706 bp, 978 bp and 393 bp promoter all exhibited 2–3-fold higher transcriptional activity than the 2051 bp construct, indicating the presence of negative regulatory elements within the distal 350 bp of the promoter. Activation of AMP kinase augmented Tfam transcription within the proximal promoter, suggesting the presence of binding sites for transcription factors that are responsive to cellular energy state. During differentiation, the accumulating Tfam protein was progressively distributed to the mitochondrial matrix where it augmented the expression of mtDNA and COX (cytochrome c oxidase) subunit I, an mtDNA gene product. Our data suggest that, during muscle differentiation, Tfam protein levels are regulated by the availability of Tfam mRNA, which is controlled by both transcription and mRNA stability. Changes in energy state and Tfam localization also affect Tfam expression and action in differentiating myotubes. PMID:26182383

  1. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    PubMed Central

    2011-01-01

    Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r) RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla); tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK)-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (p)ppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate. PMID:21251259

  2. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  3. Transcription Regulation and Membrane Stress Management in Enterobacterial Pathogens.

    PubMed

    Zhang, Nan; Jovanovic, Goran; McDonald, Christopher; Ces, Oscar; Zhang, Xiaodong; Buck, Martin

    2016-01-01

    Transcription regulation in a temporal and conditional manner underpins the lifecycle of enterobacterial pathogens. Upon exposure to a wide array of environmental cues, these pathogens modulate their gene expression via the RNA polymerase and associated sigma factors. Different sigma factors, either involved in general 'house-keeping' or specific responses, guide the RNA polymerase to their cognate promoter DNAs. The major alternative sigma54 factor when activated helps pathogens manage stresses and proliferate in their ecological niches. In this chapter, we review the function and regulation of the sigma54-dependent Phage shock protein (Psp) system-a major stress response when Gram-negative pathogens encounter damages to their inner membranes. We discuss the recent development on mechanisms of gene regulation, signal transduction and stress mitigation in light of different biophysical and biochemical approaches.

  4. Transcription Regulation and Membrane Stress Management in Enterobacterial Pathogens.

    PubMed

    Zhang, Nan; Jovanovic, Goran; McDonald, Christopher; Ces, Oscar; Zhang, Xiaodong; Buck, Martin

    2016-01-01

    Transcription regulation in a temporal and conditional manner underpins the lifecycle of enterobacterial pathogens. Upon exposure to a wide array of environmental cues, these pathogens modulate their gene expression via the RNA polymerase and associated sigma factors. Different sigma factors, either involved in general 'house-keeping' or specific responses, guide the RNA polymerase to their cognate promoter DNAs. The major alternative sigma54 factor when activated helps pathogens manage stresses and proliferate in their ecological niches. In this chapter, we review the function and regulation of the sigma54-dependent Phage shock protein (Psp) system-a major stress response when Gram-negative pathogens encounter damages to their inner membranes. We discuss the recent development on mechanisms of gene regulation, signal transduction and stress mitigation in light of different biophysical and biochemical approaches. PMID:27193545

  5. Regulation of mammalian transcription and splicing by Nuclear RNAi.

    PubMed

    Kalantari, Roya; Chiang, Cheng-Ming; Corey, David R

    2016-01-29

    RNA interference (RNAi) is well known as a mechanism for controlling mammalian mRNA translation in the cytoplasm, but what would be the consequences if it also functions in cell nuclei? Although RNAi has also been found in nuclei of plants, yeast, and other organisms, there has been relatively little progress towards understanding the potential involvement of mammalian RNAi factors in nuclear processes including transcription and splicing. This review summarizes evidence for mammalian RNAi factors in cell nuclei and mechanisms that might contribute to the control of gene expression. When RNAi factors bind small RNAs, they form ribonucleoprotein complexes that can be selective for target sequences within different classes of nuclear RNA substrates. The versatility of nuclear RNAi may supply a previously underappreciated layer of regulation to transcription, splicing, and other nuclear processes.

  6. Regulating IL-9 transcription in T helper cells

    PubMed Central

    Perumal, Narayanan B.; Kaplan, Mark H.

    2011-01-01

    T helper cells are critical for the development of immunity to infections and inflammatory disease. The acquisition of specific cytokine-secreting profiles, primed by the cytokine microenvironment, is required for effector function of Th cells. The most recent addition to the growing list of effector subsets are Th9 cells that secrete IL-9. In this article we propose a model for the transcriptional regulation of the Il9 gene in IL-9-expressing T cells and the relatedness of this subset to other Th phenotypes. We suggest that transcription factors restricted to certain Th subsets, and common among several subsets, may play a role in the plasticity of Th9 cells. PMID:21371941

  7. Nucleotide Excision Repair and Transcriptional Regulation: TFIIH and Beyond.

    PubMed

    Compe, Emmanuel; Egly, Jean-Marc

    2016-06-01

    Transcription factor IIH (TFIIH) is a multiprotein complex involved in both transcription and DNA repair, revealing a striking functional link between these two processes. Some of its subunits also belong to complexes involved in other cellular processes, such as chromosome segregation and cell cycle regulation, emphasizing the multitasking capabilities of this factor. This review aims to depict the structure of TFIIH and to dissect the roles of its subunits in different cellular mechanisms. Our understanding of the biochemistry of TFIIH has greatly benefited from studies focused on diseases related to TFIIH mutations. We address the etiology of these disorders and underline the fact that TFIIH can be considered a promising target for therapeutic strategies. PMID:27294439

  8. Regulation of mammalian transcription and splicing by Nuclear RNAi

    PubMed Central

    Kalantari, Roya; Chiang, Cheng-Ming; Corey, David R.

    2016-01-01

    RNA interference (RNAi) is well known as a mechanism for controlling mammalian mRNA translation in the cytoplasm, but what would be the consequences if it also functions in cell nuclei? Although RNAi has also been found in nuclei of plants, yeast, and other organisms, there has been relatively little progress towards understanding the potential involvement of mammalian RNAi factors in nuclear processes including transcription and splicing. This review summarizes evidence for mammalian RNAi factors in cell nuclei and mechanisms that might contribute to the control of gene expression. When RNAi factors bind small RNAs, they form ribonucleoprotein complexes that can be selective for target sequences within different classes of nuclear RNA substrates. The versatility of nuclear RNAi may supply a previously underappreciated layer of regulation to transcription, splicing, and other nuclear processes. PMID:26612865

  9. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation

    PubMed Central

    Cavazza, Alessia; Miccio, Annarita; Romano, Oriana; Petiti, Luca; Malagoli Tagliazucchi, Guidantonio; Peano, Clelia; Severgnini, Marco; Rizzi, Ermanno; De Bellis, Gianluca; Bicciato, Silvio; Mavilio, Fulvio

    2016-01-01

    Summary Human skin is maintained by the differentiation and maturation of interfollicular stem and progenitors cells. We used DeepCAGE, genome-wide profiling of histone modifications and retroviral integration analysis, to map transcripts, promoters, enhancers, and super-enhancers (SEs) in prospectively isolated keratinocytes and transit-amplifying progenitors, and retrospectively defined keratinocyte stem cells. We show that >95% of the active promoters are in common and differentially regulated in progenitors and differentiated keratinocytes, while approximately half of the enhancers and SEs are stage specific and account for most of the epigenetic changes occurring during differentiation. Transcription factor (TF) motif identification and correlation with TF binding site maps allowed the identification of TF circuitries acting on enhancers and SEs during differentiation. Overall, our study provides a broad, genome-wide description of chromatin dynamics and differential enhancer and promoter usage during epithelial differentiation, and describes a novel approach to identify active regulatory elements in rare stem cell populations. PMID:27050947

  10. Transcriptional regulator Id2 mediates CD8+ T cell immunity.

    PubMed

    Cannarile, Michael A; Lind, Nicholas A; Rivera, Richard; Sheridan, Alison D; Camfield, Kristin A; Wu, Bei Bei; Cheung, Kitty P; Ding, Zhaoqing; Goldrath, Ananda W

    2006-12-01

    Transcriptional programs that initiate and sustain the proliferation, differentiation and survival of CD8(+) T cells during immune responses are not completely understood. Here we show that inhibitor of DNA binding 2 (Id2), an antagonist of E protein transcription factors, was upregulated in CD8(+) T cells during infection and that expression of Id2 was maintained in memory CD8(+) T cells. Although Id2-deficient naive CD8(+) T cells recognized antigen and proliferated normally early after infection, effector CD8(+) T cells did not accumulate because the cells were highly susceptible to apoptosis. Id2-deficient CD8(+) T cells responding to infection had changes in the expression of genes that influence survival and had altered memory formation. Our data emphasize the importance of Id2 in regulating gene expression by CD8(+) T cells and the magnitude of effector responses, suggesting a mechanism involving Id protein- and E protein-mediated survival and differentiation of mature T cells.

  11. Transcriptional regulation of decreased protein synthesis during skeletal muscle unloading

    NASA Technical Reports Server (NTRS)

    Howard, G.; Steffen, J. M.; Geoghegan, T. E.

    1989-01-01

    The regulatory role of transcriptional alterations in unloaded skeletal muscles was investigated by determining levels of total muscle RNA and mRNA fractions in soleus, gastrocnemius, and extensor digitorum longus (EDL) of rats subjected to whole-body suspension for up to 7 days. After 7 days, total RNA and mRNA contents were lower in soleus and gastrocnemius, compared with controls, but the concentrations of both RNAs per g muscle were unaltered. Alpha-actin mRNA (assessed by dot hybridization) was significantly reduced in soleus after 1, 3, and 7 days of suspension and in gastrocnemius after 3 and 7 days, but was unchanged in EDL. Protein synthesis directed by RNA extracted from soleus and EDL indicated marked alteration in mRNAs coding for several small proteins. Results suggest that altered transcription and availability of specific mRNAs contribute significantly to the regulation of protein synthesis during skeletal muscle unloading.

  12. How microRNA and transcription factor co-regulatory networks affect osteosarcoma cell proliferation.

    PubMed

    Poos, Kathrin; Smida, Jan; Nathrath, Michaela; Maugg, Doris; Baumhoer, Daniel; Korsching, Eberhard

    2013-01-01

    Osteosarcomas (OS) are complex bone tumors with various genomic alterations. These alterations affect the expression and function of several genes due to drastic changes in the underlying gene regulatory network. However, we know little about critical gene regulators and their functional consequences on the pathogenesis of OS. Therefore, we aimed to determine microRNA and transcription factor (TF) co-regulatory networks in OS cell proliferation. Cell proliferation is an essential part in the pathogenesis of OS and deeper understanding of its regulation might help to identify potential therapeutic targets. Based on expression data of OS cell lines divided according to their proliferative activity, we obtained 12 proliferation-related microRNAs and corresponding target genes. Therewith, microRNA and TF co-regulatory networks were generated and analyzed regarding their structure and functional influence. We identified key co-regulators comprising the microRNAs miR-9-5p, miR-138, and miR-214 and the TFs SP1 and MYC in the derived networks. These regulators are implicated in NFKB- and RB1-signaling and focal adhesion processes based on their common or interacting target genes (e.g., CDK6, CTNNB1, E2F4, HES1, ITGA6, NFKB1, NOTCH1, and SIN3A). Thus, we proposed a model of OS cell proliferation which is primarily co-regulated through the interactions of the mentioned microRNA and TF combinations. This study illustrates the benefit of systems biological approaches in the analysis of complex diseases. We integrated experimental data with publicly available information to unravel the coordinated (post)-transcriptional control of microRNAs and TFs to identify potential therapeutic targets in OS. The resulting microRNA and TF co-regulatory networks are publicly available for further exploration to generate or evaluate own hypotheses of the pathogenesis of OS (http://www.complex-systems.uni-muenster.de/co_networks.html).

  13. Concentration and Length Dependence of DNA Looping in Transcriptional Regulation

    PubMed Central

    Han, Lin; Garcia, Hernan G.; Blumberg, Seth; Towles, Kevin B.; Beausang, John F.; Nelson, Philip C.; Phillips, Rob

    2009-01-01

    In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage), to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least) two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping. PMID:19479049

  14. ROMA: an in vitro approach to defining target genes for transcription regulators

    PubMed Central

    MacLellan, Shawn R.; Eiamphungporn, Warawan; Helmann, John D.

    2009-01-01

    We describe an in vitro transcription-based method called ROMA (run-off transcription-microarray analysis) for the genome-wide analysis of transcription regulated by sigma factors and other transcriptional regulators. ROMA uses purified RNA polymerase with and without a regulatory protein to monitor products of transcription from a genomic DNA template. Transcribed RNA is converted to cDNA and hybridized to gene arrays allowing for the identification of genes that are specifically activated by the regulator. We discuss the use of ROMA to define sigma factor regulons in Bacillus subtilis and its broad application to defining regulons for other transcriptional regulators in various species. PMID:18948201

  15. Transcription factor FOXA2-centered transcriptional regulation network in non-small cell lung cancer

    SciTech Connect

    Jang, Sang-Min; An, Joo-Hee; Kim, Chul-Hong; Kim, Jung-Woong Choi, Kyung-Hee

    2015-08-07

    Lung cancer is the leading cause of cancer-mediated death. Although various therapeutic approaches are used for lung cancer treatment, these mainly target the tumor suppressor p53 transcription factor, which is involved in apoptosis and cell cycle arrest. However, p53-targeted therapies have limited application in lung cancer, since p53 is found to be mutated in more than half of lung cancers. In this study, we propose tumor suppressor FOXA2 as an alternative target protein for therapies against lung cancer and reveal a possible FOXA2-centered transcriptional regulation network by identifying new target genes and binding partners of FOXA2 by using various screening techniques. The genes encoding Glu/Asp-rich carboxy-terminal domain 2 (CITED2), nuclear receptor subfamily 0, group B, member 2 (NR0B2), cell adhesion molecule 1 (CADM1) and BCL2-associated X protein (BAX) were identified as putative target genes of FOXA2. Additionally, the proteins including highly similar to heat shock protein HSP 90-beta (HSP90A), heat shock 70 kDa protein 1A variant (HSPA1A), histone deacetylase 1 (HDAC1) and HDAC3 were identified as novel interacting partners of FOXA2. Moreover, we showed that FOXA2-dependent promoter activation of BAX and p21 genes is significantly reduced via physical interactions between the identified binding partners and FOXA2. These results provide opportunities to understand the FOXA2-centered transcriptional regulation network and novel therapeutic targets to modulate this network in p53-deficient lung cancer. - Highlights: • Identification of new target genes of FOXA2. • Identifications of novel interaction proteins of FOXA2. • Construction of FOXA2-centered transcriptional regulatory network in non-small cell lung cancer.

  16. EBE, an AP2/ERF Transcription Factor Highly Expressed in Proliferating Cells, Affects Shoot Architecture in Arabidopsis[W

    PubMed Central

    Mehrnia, Mohammad; Balazadeh, Salma; Zanor, María-Inés; Mueller-Roeber, Bernd

    2013-01-01

    We report about ERF BUD ENHANCER (EBE; At5g61890), a transcription factor that affects cell proliferation as well as axillary bud outgrowth and shoot branching in Arabidopsis (Arabidopsis thaliana). EBE encodes a member of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor superfamily; the gene is strongly expressed in proliferating cells and is rapidly and transiently up-regulated in axillary meristems upon main stem decapitation. Overexpression of EBE promotes cell proliferation in growing calli, while the opposite is observed in EBE-RNAi lines. EBE overexpression also stimulates axillary bud formation and outgrowth, while repressing it results in inhibition of bud growth. Global transcriptome analysis of estradiol-inducible EBE overexpression lines revealed 48 EBE early-responsive genes, of which 14 were up-regulated and 34 were down-regulated. EBE activates several genes involved in cell cycle regulation and dormancy breaking, including D-type cyclin CYCD3;3, transcription regulator DPa, and BRCA1-ASSOCIATED RING DOMAIN1. Among the down-regulated genes were DORMANCY-ASSOCIATED PROTEIN1 (AtDRM1), AtDRM1 homolog, MEDIATOR OF ABA-REGULATED DORMANCY1, and ZINC FINGER HOMEODOMAIN5. Our data indicate that the effect of EBE on shoot branching likely results from an activation of genes involved in cell cycle regulation and dormancy breaking. PMID:23616605

  17. Transcriptional regulation of IGF-I expression in skeletal muscle

    NASA Technical Reports Server (NTRS)

    McCall, G. E.; Allen, D. L.; Haddad, F.; Baldwin, K. M.

    2003-01-01

    The present study investigated the role of transcription in the regulation of insulin-like growth factor (IGF)-I expression in skeletal muscle. RT-PCR was used to determine endogenous expression of IGF-I pre-mRNA and mRNA in control (Con) and functionally overloaded (FO) rat plantaris. The transcriptional activities of five different-length IGF-I promoter fragments controlling transcription of a firefly luciferase (FLuc) reporter gene were tested in vitro by transfection of myoblasts or in vivo during FO by direct gene transfer into the plantaris. Increased endogenous IGF-I gene transcription during 7 days of plantaris FO was evidenced by an approximately 140-160% increase (P < 0.0001) in IGF-I pre-mRNA (a transcriptional marker). IGF-I mRNA expression also increased by approximately 90% (P < 0.0001), and it was correlated (R = 0.93; P < 0.0001) with the pre-mRNA increases. The three longest IGF-I exon 1 promoters induced reporter gene expression in proliferating C2C12 and L6E9 myoblasts. In differentiated L6E9 myotubes, promoter activity increased approximately two- to threefold over myoblasts. Overexpression of calcineurin and MyoD increased the activity of the -852/+192 promoter in C2C12 myotubes by approximately 5- and approximately 18-fold, respectively. However, FO did not induce these exogenous promoter fragments. Nevertheless, the present findings are consistent with the hypothesis that the IGF-I gene is transcriptionally regulated during muscle hypertrophy in vivo as evidenced by the induction of the endogenous IGF-I pre-mRNA during plantaris FO. The exon 1 promoter region of the IGF-I gene is sufficient to direct inducible expression in vitro; however, an in vivo response to FO may require elements outside the -852/+346 region of the exon 1 IGF-I promoter or features inherent to the endogenous IGF-I gene.

  18. Crystal structure of the Mycobacterium tuberculosis transcriptional regulator Rv0302.

    PubMed

    Chou, Tsung-Han; Delmar, Jared A; Wright, Catherine C; Kumar, Nitin; Radhakrishnan, Abhijith; Doh, Julia K; Licon, Meredith H; Bolla, Jani Reddy; Lei, Hsiang-Ting; Rajashankar, Kanagalaghatta R; Su, Chih-Chia; Purdy, Georgiana E; Yu, Edward W

    2015-12-01

    Mycobacterium tuberculosis is a pathogenic bacterial species, which is neither Gram positive nor Gram negative. It has a unique cell wall, making it difficult to kill and conferring resistance to antibiotics that disrupt cell wall biosynthesis. Thus, the mycobacterial cell wall is critical to the virulence of these pathogens. Recent work shows that the mycobacterial membrane protein large (MmpL) family of transporters contributes to cell wall biosynthesis by exporting fatty acids and lipidic elements of the cell wall. The expression of the Mycobacterium tuberculosis MmpL proteins is controlled by a complicated regulatory network system. Here we report crystallographic structures of two forms of the TetR-family transcriptional regulator Rv0302, which participates in regulating the expression of MmpL proteins. The structures reveal a dimeric, two-domain molecule with architecture consistent with the TetR family of regulators. Comparison of the two Rv0302 crystal structures suggests that the conformational changes leading to derepression may be due to a rigid body rotational motion within the dimer interface of the regulator. Using fluorescence polarization and electrophoretic mobility shift assays, we demonstrate the recognition of promoter and intragenic regions of multiple mmpL genes by this protein. In addition, our isothermal titration calorimetry and electrophoretic mobility shift experiments indicate that fatty acids may be the natural ligand of this regulator. Taken together, these experiments provide new perspectives on the regulation of the MmpL family of transporters. PMID:26362239

  19. Structural basis for the transcriptional regulation of membrane lipid homeostasis

    SciTech Connect

    Miller, Darcie J.; Zhang, Yong-Mei; Subramanian, Chitra; Rock, Charles O.; White, Stephen W.

    2010-11-09

    DesT is a transcriptional repressor that regulates the genes that control the unsaturated:saturated fatty acid ratio available for membrane lipid synthesis. DesT bound to unsaturated acyl-CoA has a high affinity for its cognate palindromic DNA-binding site, whereas DesT bound to saturated acyl-CoA does not bind this site. Structural analyses of the DesT-oleoyl-CoA-DNA and DesT-palmitoyl-CoA complexes reveal that acyl chain shape directly influences the packing of hydrophobic core residues within the DesT ligand-binding domain. These changes are propagated to the paired DNA-binding domains via conformational changes to modulate DNA binding. These structural interpretations are supported by the in vitro and in vivo characterization of site-directed mutants. The regulation of DesT by the unsaturated:saturated ratio of acyl chains rather than the concentration of a single ligand is a paradigm for understanding transcriptional regulation of membrane lipid homeostasis.

  20. Comparative genomics of transcriptional regulation of methionine metabolism in Proteobacteria.

    PubMed

    Leyn, Semen A; Suvorova, Inna A; Kholina, Tatiana D; Sherstneva, Sofia S; Novichkov, Pavel S; Gelfand, Mikhail S; Rodionov, Dmitry A

    2014-01-01

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ∼ 200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria. PMID:25411846

  1. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    DOE PAGES

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.

    2014-11-20

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less

  2. Transcriptional regulation of cathelicidin genes in chicken bone marrow cells.

    PubMed

    Lee, Sang In; Jang, Hyun June; Jeon, Mi-hyang; Lee, Mi Ock; Kim, Jeom Sun; Jeon, Ik-Soo; Byun, Sung June

    2016-04-01

    Cathelicidins form a family of vertebrate-specific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription factors (TFs) that bind to the 5'-flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5'-flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.

  3. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    SciTech Connect

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.

    2014-11-20

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.

  4. Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM

    SciTech Connect

    Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim

    2014-07-18

    Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations.

  5. Legislation. Legislation and Regulations Affecting Libraries in 2001; Legislation and Regulations Affecting Publishing in 2001.

    ERIC Educational Resources Information Center

    Sheketoff, Emily; Costabile, Mary R.; Adler, Allan

    2002-01-01

    These two reports discuss federal legislation and regulations that affect libraries and the publishing industry. Topics include funding for federal library and related programs; ESEA (Elementary and Secondary Education Act) reauthorization; E-rate; the USA Patriot Act and other actions after the September terrorist attacks; intellectual property;…

  6. Legislation: Legislation and Regulations Affecting Libraries in 2002; Legislation and Regulations Affecting Publishing in 2002.

    ERIC Educational Resources Information Center

    Sheketoff, Emily; Costabile, Mary R.; Adler, Allan

    2003-01-01

    Reviews legislation and regulations affecting libraries and the publishing industry, including the Museum and Library Services Act; Office of Educational Research and Improvement (OERI); copyright; access to electronic government information; telecommunications and technology; electronic surveillance and privacy, including the USA Patriot Act;…

  7. The cell cycle rallies the transcription cycle: Cdc28/Cdk1 is a cell cycle-regulated transcriptional CDK.

    PubMed

    Chymkowitch, Pierre; Enserink, Jorrit M

    2013-01-01

    In the budding yeast Saccharomyces cerevisiae, the cyclin-dependent kinases (CDKs) Kin28, Bur1 and Ctk1 regulate basal transcription by phosphorylating the carboxyl-terminal domain (CTD) of RNA polymerase II. However, very little is known about the involvement of the cell cycle CDK Cdc28 in the transcription process. We have recently shown that, upon cell cycle entry, Cdc28 kinase activity boosts transcription of a subset of genes by directly stimulating the basal transcription machinery. Here, we discuss the biological significance of this finding and give our view of the kinase-dependent role of Cdc28 in regulation of RNA polymerase II.

  8. Calcium regulates caveolin-1 expression at the transcriptional level

    SciTech Connect

    Yang, Xiao-Yan; Huang, Cheng-Cheng; Kan, Qi-Ming; Li, Yan; Liu, Dan; Zhang, Xue-Cheng; Sato, Toshinori; Yamagata, Sadako; Yamagata, Tatsuya

    2012-09-28

    Highlights: Black-Right-Pointing-Pointer Caveolin-1 expression is regulated by calcium signaling at the transcriptional level. Black-Right-Pointing-Pointer An inhibitor of or siRNA to L-type calcium channel suppressed caveolin-1 expression. Black-Right-Pointing-Pointer Cyclosporine A or an NFAT inhibitor markedly reduced caveolin-1 expression. Black-Right-Pointing-Pointer Caveolin-1 regulation by calcium signaling is observed in several mouse cell lines. -- Abstract: Caveolin-1, an indispensable component of caveolae serving as a transformation suppressor protein, is highly expressed in poorly metastatic mouse osteosarcoma FBJ-S1 cells while highly metastatic FBJ-LL cells express low levels of caveolin-1. Calcium concentration is higher in FBJ-S1 cells than in FBJ-LL cells; therefore, we investigated the possibility that calcium signaling positively regulates caveolin-1 in mouse FBJ-S1 cells. When cells were treated with the calcium channel blocker nifedipine, cyclosporin A (a calcineurin inhibitor), or INCA-6 (a nuclear factor of activated T-cells [NFAT] inhibitor), caveolin-1 expression at the mRNA and protein levels decreased. RNA silencing of voltage-dependent L-type calcium channel subunit alpha-1C resulted in suppression of caveolin-1 expression. This novel caveolin-1 regulation pathway was also identified in mouse NIH 3T3 cells and Lewis lung carcinoma cells. These results indicate that caveolin-1 is positively regulated at the transcriptional level through a novel calcium signaling pathway mediated by L-type calcium channel/Ca{sup 2+}/calcineurin/NFAT.

  9. The molecular clock regulates circadian transcription of tissue factor gene.

    PubMed

    Oishi, Katsutaka; Koyanagi, Satoru; Ohkura, Naoki

    2013-02-01

    Tissue factor (TF) is involved in endotoxin-induced inflammation and mortality. We found that the circadian expression of TF mRNA, which peaked at the day to night transition (activity onset), was damped in the liver of Clock mutant mice. Luciferase reporter and chromatin immunoprecipitation analyses using embryonic fibroblasts derived from wild-type or Clock mutant mice showed that CLOCK is involved in transcription of the TF gene. Furthermore, the results of real-time luciferase reporter experiments revealed that the circadian expression of TF mRNA is regulated by clock molecules through a cell-autonomous mechanism via an E-box element located in the promoter region.

  10. A Putative Transcription Factor MYT2 Regulates Perithecium Size in the Ascomycete Gibberella zeae

    PubMed Central

    Lin, Yang; Son, Hokyoung; Min, Kyunghun; Lee, Jungkwan; Choi, Gyung Ja; Kim, Jin-Cheol; Lee, Yin-Won

    2012-01-01

    The homothallic ascomycete fungus Gibberella zeae is a plant pathogen that is found worldwide, causing Fusarium head blight (FHB) in cereal crops and ear rot of maize. Ascospores formed in fruiting bodies (i.e., perithecia) are hypothesized to be the primary inocula for FHB disease. Perithecium development is a complex cellular differentiation process controlled by many developmentally regulated genes. In this study, we selected a previously reported putative transcription factor containing the Myb DNA-binding domain MYT2 for an in-depth study on sexual development. The deletion of MYT2 resulted in a larger perithecium, while its overexpression resulted in a smaller perithecium when compared to the wild-type strain. These data suggest that MYT2 regulates perithecium size differentiation. MYT2 overexpression affected pleiotropic phenotypes including vegetative growth, conidia production, virulence, and mycotoxin production. Nuclear localization of the MYT2 protein supports its role as a transcriptional regulator. Transcriptional analyses of trichothecene synthetic genes suggest that MYT2 additionally functions as a suppressor for trichothecene production. This is the first study characterizing a transcription factor required for perithecium size differentiation in G. zeae, and it provides a novel angle for understanding sexual development in filamentous fungi. PMID:22649560

  11. Post-transcriptional RNA Regulons Affecting Cell Cycle and Proliferation

    PubMed Central

    Blackinton, Jeff G.

    2014-01-01

    The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

  12. Transcriptional regulation of muscle fatty acid-binding protein.

    PubMed Central

    Carey, J O; Neufer, P D; Farrar, R P; Veerkamp, J H; Dohm, G L

    1994-01-01

    Heart fatty acid-binding protein (H-FABP) is present in a wide variety of tissues but is found in the highest concentration in cardiac and red skeletal muscle. It has been proposed that the expression of H-FABP correlates directly with the fatty acid-oxidative capacity of the tissue. In the present study, the expression of H-FABP was measured in red and white skeletal muscle under two conditions in which fatty acid utilization is known to be increased: streptozotocin-induced diabetes and fasting. Protein concentration, mRNA concentration and transcription rate were measured under both conditions. The level of both protein and mRNA increased approximately 2-fold under each condition. The transcription rate was higher in red skeletal muscle than in white muscle, was increased 2-fold during fasting, but was unchanged by streptozotocin-induced diabetes. In addition to supporting the hypothesis that H-FABP is induced during conditions of increased fatty acid utilization, these findings demonstrate that the regulation of H-FABP expression may or may not be at the level of transcription depending on the stimulus. Images Figure 2 Figure 3 PMID:8141774

  13. Macromolecular Crowding as a Regulator of Gene Transcription

    PubMed Central

    Matsuda, Hiroaki; Putzel, Gregory Garbès; Backman, Vadim; Szleifer, Igal

    2014-01-01

    Studies of macromolecular crowding have shown its important effects on molecular transport and interactions in living cells. Less clear is the effect of crowding when its influence is incorporated into a complex network of interactions. Here, we explore the effects of crowding in the cell nucleus on a model of gene transcription as a network of reactions involving transcription factors, RNA polymerases, and DNA binding sites for these proteins. The novelty of our approach is that we determine the effects of crowding on the rates of these reactions using Brownian dynamics and Monte Carlo simulations, allowing us to integrate molecular-scale information, such as the shapes and sizes of each molecular species, into the rate equations of the model. The steady-state cytoplasmic mRNA concentration shows several regimes with qualitatively different dependences on the volume fraction, ϕ, of crowding agents in the nucleus, including a broad range of parameter values where it depends nonmonotonically on ϕ, with maximum mRNA production occurring at a physiologically relevant value. The extent of this crowding dependence can be modulated by a variety of means, suggesting that the transcriptional output of a gene can be regulated jointly by the local level of macromolecular crowding in the nucleus, together with the local concentrations of polymerases and DNA-binding proteins, as well as other properties of the gene’s physical environment. PMID:24739179

  14. Zinc triggers a complex transcriptional and post-transcriptional regulation of the metal homeostasis gene FRD3 in Arabidopsis relatives

    PubMed Central

    Charlier, Jean-Benoit; Polese, Catherine; Nouet, Cécile; Carnol, Monique; Bosman, Bernard; Krämer, Ute; Motte, Patrick; Hanikenne, Marc

    2015-01-01

    In Arabidopsis thaliana, FRD3 (FERRIC CHELATE REDUCTASE DEFECTIVE 3) plays a central role in metal homeostasis. FRD3 is among a set of metal homeostasis genes that are constitutively highly expressed in roots and shoots of Arabidopsis halleri, a zinc hyperaccumulating and hypertolerant species. Here, we examined the regulation of FRD3 by zinc in both species to shed light on the evolutionary processes underlying the evolution of hyperaccumulation in A. halleri. We combined gene expression studies with the use of β-glucuronidase and green fluorescent protein reporter constructs to compare the expression profile and transcriptional and post-transcriptional regulation of FRD3 in both species. The AtFRD3 and AhFRD3 genes displayed a conserved expression profile. In A. thaliana, alternative transcription initiation sites from two promoters determined transcript variants that were differentially regulated by zinc supply in roots and shoots to favour the most highly translated variant under zinc-excess conditions. In A. halleri, a single transcript variant with higher transcript stability and enhanced translation has been maintained. The FRD3 gene thus undergoes complex transcriptional and post-transcriptional regulation in Arabidopsis relatives. Our study reveals that a diverse set of mechanisms underlie increased gene dosage in the A. halleri lineage and illustrates how an environmental challenge can alter gene regulation. PMID:25900619

  15. Transcriptional modulator ZBED6 affects cell cycle and growth of human colorectal cancer cells.

    PubMed

    Akhtar Ali, Muhammad; Younis, Shady; Wallerman, Ola; Gupta, Rajesh; Andersson, Leif; Sjöblom, Tobias

    2015-06-23

    The transcription factor ZBED6 (zinc finger, BED-type containing 6) is a repressor of IGF2 whose action impacts development, cell proliferation, and growth in placental mammals. In human colorectal cancers, IGF2 overexpression is mutually exclusive with somatic mutations in PI3K signaling components, providing genetic evidence for a role in the PI3K pathway. To understand the role of ZBED6 in tumorigenesis, we engineered and validated somatic cell ZBED6 knock-outs in the human colorectal cancer cell lines RKO and HCT116. Ablation of ZBED6 affected the cell cycle and led to increased growth rate in RKO cells but reduced growth in HCT116 cells. This striking difference was reflected in the transcriptome analyses, which revealed enrichment of cell-cycle-related processes among differentially expressed genes in both cell lines, but the direction of change often differed between the cell lines. ChIP sequencing analyses displayed enrichment of ZBED6 binding at genes up-regulated in ZBED6-knockout clones, consistent with the view that ZBED6 modulates gene expression primarily by repressing transcription. Ten differentially expressed genes were identified as putative direct gene targets, and their down-regulation by ZBED6 was validated experimentally. Eight of these genes were linked to the Wnt, Hippo, TGF-β, EGF receptor, or PI3K pathways, all involved in colorectal cancer development. The results of this study show that the effect of ZBED6 on tumor development depends on the genetic background and the transcriptional state of its target genes.

  16. Transcriptional regulation through glutamate receptors: Involvement of tyrosine kinases.

    PubMed

    López-Bayghen, Esther; Aguirre, Adán; Ortega, Arturo

    2003-12-01

    Glutamate receptors play a key role in neuronal plasticity, learning and memory, and in several neuropathologies. Short-term and long-term changes in synaptic efficacy are triggered by glutamate. Although an enhanced glutamate-dependent tyrosine phosphorylation has been described in several systems, its role in membrane-to-nuclei signaling is unclear. Taking advantage of the fact that the gene encoding the chick kainate-binding protein undergoes a glutamate-dependent transcriptional regulation via an activator protein-1 (AP-1) site, we evaluated the involvement of tyrosine kinases in this process. We describe here the participation of receptor and non-receptor tyrosine kinases in the signaling cascade triggered by glutamate. Our results suggest that in Bergmann glia cells, glutamate receptors transactivate receptor tyrosine kinases, favoring the idea of a complex network of signals activated by this excitatory neurotransmitter that results in regulation of gene expression.

  17. Dynamic regulation of transcription factors by nucleosome remodeling.

    PubMed

    Li, Ming; Hada, Arjan; Sen, Payel; Olufemi, Lola; Hall, Michael A; Smith, Benjamin Y; Forth, Scott; McKnight, Jeffrey N; Patel, Ashok; Bowman, Gregory D; Bartholomew, Blaine; Wang, Michelle D

    2015-06-05

    The chromatin landscape and promoter architecture are dominated by the interplay of nucleosome and transcription factor (TF) binding to crucial DNA sequence elements. However, it remains unclear whether nucleosomes mobilized by chromatin remodelers can influence TFs that are already present on the DNA template. In this study, we investigated the interplay between nucleosome remodeling, by either yeast ISW1a or SWI/SNF, and a bound TF. We found that a TF serves as a major barrier to ISW1a remodeling, and acts as a boundary for nucleosome repositioning. In contrast, SWI/SNF was able to slide a nucleosome past a TF, with concurrent eviction of the TF from the DNA, and the TF did not significantly impact the nucleosome positioning. Our results provide direct evidence for a novel mechanism for both nucleosome positioning regulation by bound TFs and TF regulation via dynamic repositioning of nucleosomes.

  18. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway.

  19. Differences in expression, actions and cocaine regulation of two isoforms for the brain transcriptional regulator NAC1.

    PubMed

    Korutla, L; Wang, P J; Lewis, D M; Neustadter, J H; Stromberg, M F; Mackler, S A

    2002-01-01

    BTB/POZ proteins can influence the cell cycle and contribute to oncogenesis. Many family members are present in the mammalian CNS. Previous work demonstrated elevated NAC1 mRNA levels in the rat nucleus accumbens in response to cocaine. NAC1 acts like other BTB/POZ proteins that regulate transcription but is unusual because of the absence of identifiable DNA binding domains. cDNAs were isolated encoding two NAC1 isoforms differing by only 27 amino acids (the longer isoform contains 514 amino acids). The mRNAs for both isoforms were simultaneously expressed throughout the rat brain and peripheral tissues. Semi-quantitative reverse transcription-polymerase chain reaction analysis revealed that the mRNA of the longer isoform was more abundant than the mRNA of the shorter isoform. Western blot analysis demonstrated a similar unequal distribution between the isoforms in the CNS. The longer isoform was the more abundant of the two NAC1 proteins and the ratio between them differed throughout the rat brain. The shorter isoform was not detected in most of the examined peripheral tissues, suggesting differences from the CNS in post-transcriptional processing. Both isoforms repressed transcription in H293T cells using a Gal4-luciferase reporter system. However, the shorter isoform did not repress transcription as effectively as the longer isoform. Transfection of different ratios for both isoforms, in order to replicate the relative amounts observed throughout the CNS, supported an interaction between the isoforms. The net effect on transcriptional repression was determined by the ratio of the two NAC1 isoforms. Each isoform exhibited the subnuclear localization that is characteristic of many BTB/POZ proteins. A rapid and transient increase in the level of the shorter isoform occurred in the nucleus accumbens 2 h following a single i.p. cocaine injection. We conclude that the two isoforms of NAC1 may differentially affect neuronal functions, including the regulation of

  20. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway. PMID:27491940

  1. Osteogenic transcription factors and proto-oncogene regulate bone sialoprotein gene transcription.

    PubMed

    Takai, Hideki; Mezawa, Masaru; Choe, Jin; Nakayama, Yohei; Ogata, Yorimasa

    2013-09-01

    Runt homeodomain protein 2 (Runx2), distalless 5 (Dlx5) and Smad1 are transcription factors that play critical roles in controlling the differentiation of osteoblasts and mineralization of bone. Proto-oncogene tyrosine-protein kinase, Src, is an enzyme encoded by the Src gene. The normal cellular gene is called cellular-Src (c-Src). Bone sialoprotein (BSP), a protein implicated in the initial mineralization of newly formed bone, is an early phenotypic marker of differentiated osteoblasts. In this study, we used overexpression plasmids with Runx2, Dlx5, Smad1 or c-Src inserts to search for the effects of these transcription factors and proto-oncogene on BSP gene expression using rat osteoblast-like ROS 17/2.8. When we used Runx2, Dlx5 or c-Src overexpression plasmids for the transfection, BSP and Runx2 mRNA levels were increased in ROS 17/2.8 cells. However, overexpression of Smad1 did not induce BSP and Runx2 mRNA. Transient transfection analyses were performed using chimeric constructs of the rat BSP gene promoter linked to a luciferase reporter gene. Transfection of ROS 17/2.8 cells with Runx2, Dlx5 or c-Src overexpression plasmid increased the luciferase activities of the constructs, pLUC3 (-116 to +60), pLUC4 (-425 to +60) and pLUC5 (-801 to +60). However, Smad1 overexpression had no effect on the luciferase activities. These results demonstrate that overexpression of Runx2, Dlx5 or c-Src stimulates BSP transcription, and suggest that Runx2, Dlx5 and c-Src might be crucial transcriptional regulators of mineralization and bone formation.

  2. Molecular basis of RNA polymerase promoter specificity switch revealed through studies of Thermus bacteriophage transcription regulator

    PubMed Central

    Severinov, Konstantin; Minakhin, Leonid; Sekine, Shun-ichi; Lopatina, Anna; Yokoyama, Shigeyuki

    2014-01-01

    Transcription initiation is the central point of gene expression regulation. Understanding of molecular mechanism of transcription regulation requires, ultimately, the structural understanding of consequences of transcription factors binding to DNA-dependent RNA polymerase (RNAP), the enzyme of transcription. We recently determined a structure of a complex between transcription factor gp39 encoded by a Thermus bacteriophage and Thermus RNAP holoenzyme. In this addendum to the original publication, we highlight structural insights that explain the ability of gp39 to act as an RNAP specificity switch which inhibits transcription initiation from a major class of bacterial promoters, while allowing transcription from a minor promoter class to continue. PMID:25105059

  3. Mutations in RNA Polymerase Bridge Helix and Switch Regions Affect Active-Site Networks and Transcript-Assisted Hydrolysis

    PubMed Central

    Zhang, Nan; Schäfer, Jorrit; Sharma, Amit; Rayner, Lucy; Zhang, Xiaodong; Tuma, Roman; Stockley, Peter; Buck, Martin

    2015-01-01

    In bacterial RNA polymerase (RNAP), the bridge helix and switch regions form an intricate network with the catalytic active centre and the main channel. These interactions are important for catalysis, hydrolysis and clamp domain movement. By targeting conserved residues in Escherichia coli RNAP, we are able to show that functions of these regions are differentially required during σ70-dependent and the contrasting σ54-dependent transcription activations and thus potentially underlie the key mechanistic differences between the two transcription paradigms. We further demonstrate that the transcription factor DksA directly regulates σ54-dependent activation both positively and negatively. This finding is consistent with the observed impacts of DksA on σ70-dependent promoters. DksA does not seem to significantly affect RNAP binding to a pre-melted promoter DNA but affects extensively activity at the stage of initial RNA synthesis on σ54-regulated promoters. Strikingly, removal of the σ54 Region I is sufficient to invert the action of DksA (from stimulation to inhibition or vice versa) at two test promoters. The RNAP mutants we generated also show a strong propensity to backtrack. These mutants increase the rate of transcript-hydrolysis cleavage to a level comparable to that seen in the Thermus aquaticus RNAP even in the absence of a non-complementary nucleotide. These novel phenotypes imply an important function of the bridge helix and switch regions as an anti-backtracking ratchet and an RNA hydrolysis regulator. PMID:26365052

  4. Mutations in RNA Polymerase Bridge Helix and Switch Regions Affect Active-Site Networks and Transcript-Assisted Hydrolysis.

    PubMed

    Zhang, Nan; Schäfer, Jorrit; Sharma, Amit; Rayner, Lucy; Zhang, Xiaodong; Tuma, Roman; Stockley, Peter; Buck, Martin

    2015-11-01

    In bacterial RNA polymerase (RNAP), the bridge helix and switch regions form an intricate network with the catalytic active centre and the main channel. These interactions are important for catalysis, hydrolysis and clamp domain movement. By targeting conserved residues in Escherichia coli RNAP, we are able to show that functions of these regions are differentially required during σ(70)-dependent and the contrasting σ(54)-dependent transcription activations and thus potentially underlie the key mechanistic differences between the two transcription paradigms. We further demonstrate that the transcription factor DksA directly regulates σ(54)-dependent activation both positively and negatively. This finding is consistent with the observed impacts of DksA on σ(70)-dependent promoters. DksA does not seem to significantly affect RNAP binding to a pre-melted promoter DNA but affects extensively activity at the stage of initial RNA synthesis on σ(54)-regulated promoters. Strikingly, removal of the σ(54) Region I is sufficient to invert the action of DksA (from stimulation to inhibition or vice versa) at two test promoters. The RNAP mutants we generated also show a strong propensity to backtrack. These mutants increase the rate of transcript-hydrolysis cleavage to a level comparable to that seen in the Thermus aquaticus RNAP even in the absence of a non-complementary nucleotide. These novel phenotypes imply an important function of the bridge helix and switch regions as an anti-backtracking ratchet and an RNA hydrolysis regulator.

  5. Mutations in RNA Polymerase Bridge Helix and Switch Regions Affect Active-Site Networks and Transcript-Assisted Hydrolysis.

    PubMed

    Zhang, Nan; Schäfer, Jorrit; Sharma, Amit; Rayner, Lucy; Zhang, Xiaodong; Tuma, Roman; Stockley, Peter; Buck, Martin

    2015-11-01

    In bacterial RNA polymerase (RNAP), the bridge helix and switch regions form an intricate network with the catalytic active centre and the main channel. These interactions are important for catalysis, hydrolysis and clamp domain movement. By targeting conserved residues in Escherichia coli RNAP, we are able to show that functions of these regions are differentially required during σ(70)-dependent and the contrasting σ(54)-dependent transcription activations and thus potentially underlie the key mechanistic differences between the two transcription paradigms. We further demonstrate that the transcription factor DksA directly regulates σ(54)-dependent activation both positively and negatively. This finding is consistent with the observed impacts of DksA on σ(70)-dependent promoters. DksA does not seem to significantly affect RNAP binding to a pre-melted promoter DNA but affects extensively activity at the stage of initial RNA synthesis on σ(54)-regulated promoters. Strikingly, removal of the σ(54) Region I is sufficient to invert the action of DksA (from stimulation to inhibition or vice versa) at two test promoters. The RNAP mutants we generated also show a strong propensity to backtrack. These mutants increase the rate of transcript-hydrolysis cleavage to a level comparable to that seen in the Thermus aquaticus RNAP even in the absence of a non-complementary nucleotide. These novel phenotypes imply an important function of the bridge helix and switch regions as an anti-backtracking ratchet and an RNA hydrolysis regulator. PMID:26365052

  6. Glutamine Metabolism Regulates the Pluripotency Transcription Factor OCT4

    PubMed Central

    Marsboom, Glenn; Zhang, Guo-Fang; Pohl-Avila, Nicole; Zhang, Yanmin; Yuan, Yang; Kang, Hojin; Hao, Bo; Brunengraber, Henri; Malik, Asrar B.; Rehman, Jalees

    2016-01-01

    SUMMARY The molecular mechanisms underlying the regulation of pluripotency by cellular metabolism in human embryonic stem cells (hESCs) are not fully understood. We found that high levels of glutamine metabolism are essential to prevent degradation of OCT4, a key transcription factor regulating hESC pluripotency. Glutamine withdrawal depletes the endogenous anti-oxidant glutathione, which results in the oxidation of OCT4 cysteine residues required for its DNA binding and enhanced OCT4 degradation. The emergence of the OCT4lo cell population following glutamine withdrawal did not result in greater propensity for cell death. Instead, glutamine withdrawal during vascular differentiation of hESCs generated cells with greater angiogenic capacity, thus indicating that modulating glutamine metabolism enhances the differentiation and functional maturation of cells. These findings demonstrate that the pluripotency transcription factor OCT4 can serve as a metabolic-redox sensor in hESCs and that metabolic cues can act in concert with growth factor signaling to orchestrate stem cell differentiation. PMID:27346346

  7. Glucocorticoid regulation of transcription at an amplified, episomal promoter

    SciTech Connect

    Ostrowski, M.C.; Richard-Foy, H.; Wolford, R.G.; Berard, D.S.; Hager, G.L.

    1983-11-01

    The mouse mammary tumor virus long terminal repeat (MMTV LTR) has been introduced into cultured murine cells, using the 69% transforming fragment of bovine papiloma virus type 1 (BVP). Transformed cells contain up to 200 copies of the chimeric molecules per diploid genome. The restriction endonuclease map of the acquired recombinants, as well as the physical structure of the DNA, indicates that the LTR-BVP molecules present in these cells occur exclusively as unintegrated, extrachromosomal episome. When a 72-base pair direct repeat ''enhancer'' element (derived from the Harvey sarcoma retrovirus) was included in the MMTV LTR-BPV chimeric plasmids, DNA acquired through transfection, with a single exception, was integrated or rearranged or both. Two approaches showed that the MMTV LTR present in the episomal state was capable of supporting glucocorticoid hormone-regulated transcription. The authors have therefore demonstrated the hormone response for the first time in a totally defined primary sequence environment. Significant differences both in the basal level of MMTV-initiated transcription and in the extend of glucocorticoid induction were observed in individual cell lines with similar episomal copy numbers. These phenotypic variations suggest that epigenetic structure is an important component of the mechanism of regulation.

  8. Dynamic Regulation of AP-1 Transcriptional Complexes Directs Trophoblast Differentiation

    PubMed Central

    Kent, Lindsey N.; Rumi, M. A. Karim; Roby, Katherine F.

    2015-01-01

    Placentation is a process that establishes the maternal-fetal interface and is required for successful pregnancy. The epithelial component of the placenta consists of trophoblast cells, which possess the capacity for multilineage differentiation and are responsible for placenta-specific functions. FOS-like antigen 1 (FOSL1), a component of AP-1 transcription factor complexes, contributes to the regulation of placental development. FOSL1 expression is restricted to trophoblast giant cells and invasive trophoblast cells. In the present study, we characterized the FOSL1 regulatory pathway in rat trophoblast cells. Transcriptome profiling in control and FOSL1 knockdown cells identified FOSL1-dependent gene sets linked to endocrine and invasive functions. FOSL1 was shown to occupy AP-1 binding sites within these gene loci, as determined by chromatin immunoprecipitation (ChIP). Complementary in vivo experiments using trophoblast-specific lentiviral delivery of FOSL1 short hairpin RNAs (shRNAs) provided in vivo validation of FOSL1 targets. FOSL1 actions require a dimerization partner. Coimmunoprecipitation, coimmunolocalization, and ChIP analyses showed that FOSL1 interacts with JUNB and, to a lesser extent, JUN in differentiating trophoblast cells. Knockdown of FOSL1 and JUNB expression inhibited both endocrine and invasive properties of trophoblast cells. In summary, FOSL1 recruits JUNB to form AP-1 transcriptional complexes that specifically regulate the endocrine and invasive trophoblast phenotypes. PMID:26149388

  9. A pseudogene long noncoding RNA network regulates PTEN transcription and translation in human cells

    PubMed Central

    Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V.

    2013-01-01

    PTEN is a tumor suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1 encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, alpha and beta. The alpha isoform functions in trans, localizes to the PTEN promoter, and epigenetically modulates PTEN transcription by the recruitment of DNMT3a and EZH2. In contrast, the beta isoform interacts with PTENpg1 through an RNA:RNA pairing interaction, which affects PTEN protein output via changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell cycle arrest and sensitizes cells to doxorubicin, suggesting a biological function for the respective PTENpg1 expressed asRNAs. PMID:23435381

  10. Controlled transcriptional regulation in eukaryotes by a novel transcription factor derived from Escherichia coli purine repressor.

    PubMed

    Yeon, Eun-Hee; Noh, Ju-Young; Kim, Jong-Min; Lee, Min-Young; Yoon, Sarah; Park, Sang-Kyu; Choi, Kang-Yell; Kim, Kyung-Sup

    2004-06-25

    Unlike the DNA-binding domains (DBD) of most eukaryotic transcription factors, Escherichia coli LacI family transcription factors are unable to bind to specific target DNA sequences without a cofactor-binding domain. In the present study, we reconstructed a novel DBD designated as PurHG, which binds constitutively to a 16bp purine repressor operator, by fusion of the purine repressor (PurR) DBD (residues 1-57) and the GAL4 dimerization domain (DD, residues 42-148). Binding of PurHG to DNA requires the dimerization and a hinge helix of PurR DBD. When the PurHG was expressed as a fusion protein in a form of a transcription activator (PurAD) or an artificial nuclear receptor (PurAPR or PurAER) responding to ligand, such as RU486 or beta-estradiol, it could regulate the expression of the reporter genes in NIH3T3 cells. The prerequisite region of the GAL4 DD for DNA-binding was amino acid residues from 42 to 98 in the form of PurAD, while the amino acid residues from 42 to 75 were sufficient for ligand-dependent regulation in the form of PurAPR. These results suggest that the dimerization function of the progesterone ligand-binding domain could be substituted for region 76-98 of the GAL4 DD. In summary, the fusion of the PurR DBD and the GAL4 DD generates fully active DNA-binding protein, PurHG, in vitro and in vivo, and these results provide the direct evidence of structural predictions that the proximate positioning of PurR hinge helical regions is critical for DNA-binding.

  11. Transcription factor FOXA2-centered transcriptional regulation network in non-small cell lung cancer.

    PubMed

    Jang, Sang-Min; An, Joo-Hee; Kim, Chul-Hong; Kim, Jung-Woong; Choi, Kyung-Hee

    2015-08-01

    Lung cancer is the leading cause of cancer-mediated death. Although various therapeutic approaches are used for lung cancer treatment, these mainly target the tumor suppressor p53 transcription factor, which is involved in apoptosis and cell cycle arrest. However, p53-targeted therapies have limited application in lung cancer, since p53 is found to be mutated in more than half of lung cancers. In this study, we propose tumor suppressor FOXA2 as an alternative target protein for therapies against lung cancer and reveal a possible FOXA2-centered transcriptional regulation network by identifying new target genes and binding partners of FOXA2 by using various screening techniques. The genes encoding Glu/Asp-rich carboxy-terminal domain 2 (CITED2), nuclear receptor subfamily 0, group B, member 2 (NR0B2), cell adhesion molecule 1 (CADM1) and BCL2-associated X protein (BAX) were identified as putative target genes of FOXA2. Additionally, the proteins including highly similar to heat shock protein HSP 90-beta (HSP90A), heat shock 70 kDa protein 1A variant (HSPA1A), histone deacetylase 1 (HDAC1) and HDAC3 were identified as novel interacting partners of FOXA2. Moreover, we showed that FOXA2-dependent promoter activation of BAX and p21 genes is significantly reduced via physical interactions between the identified binding partners and FOXA2. These results provide opportunities to understand the FOXA2-centered transcriptional regulation network and novel therapeutic targets to modulate this network in p53-deficient lung cancer.

  12. Post-transcriptional control of GRF transcription factors by microRNA miR396 and GIF co-activator affects leaf size and longevity.

    PubMed

    Debernardi, Juan M; Mecchia, Martin A; Vercruyssen, Liesbeth; Smaczniak, Cezary; Kaufmann, Kerstin; Inze, Dirk; Rodriguez, Ramiro E; Palatnik, Javier F

    2014-08-01

    The growth-regulating factors (GRFs) are plant-specific transcription factors. They form complexes with GRF-interacting factors (GIFs), a small family of transcriptional co-activators. In Arabidopsis thaliana, seven out of the nine GRFs are controlled by microRNA miR396. Analysis of Arabidopsis plants carrying a GRF3 allele insensitive to miR396 revealed a strong boost in the number of cells in leaves, which was further enhanced synergistically by an additional increase of GIF1 levels. Genetic experiments revealed that GRF3 can still increase cell number in gif1 mutants, albeit to a much lesser extent. Genome-wide transcript profiling indicated that the simultaneous increase of GRF3 and GIF1 levels causes additional effects in gene expression compared to either of the transgenes alone. We observed that GIF1 interacts in vivo with GRF3, as well as with chromatin-remodeling complexes, providing a mechanistic explanation for the synergistic activities of a GRF3-GIF1 complex. Interestingly, we found that, in addition to the leaf size, the GRF system also affects the organ longevity. Genetic and molecular analysis revealed that the functions of GRFs in leaf growth and senescence can be uncoupled, demonstrating that the miR396-GRF-GIF network impinges on different stages of leaf development. Our results integrate the post-transcriptional control of the GRF transcription factors with the progression of leaf development.

  13. Fungal Morphology, Iron Homeostasis, and Lipid Metabolism Regulated by a GATA Transcription Factor in Blastomyces dermatitidis

    PubMed Central

    Marty, Amber J.; Broman, Aimee T.; Zarnowski, Robert; Dwyer, Teigan G.; Bond, Laura M.; Lounes-Hadj Sahraoui, Anissa; Fontaine, Joël; Ntambi, James M.; Keleş, Sündüz; Kendziorski, Christina; Gauthier, Gregory M.

    2015-01-01

    In response to temperature, Blastomyces dermatitidis converts between yeast and mold forms. Knowledge of the mechanism(s) underlying this response to temperature remains limited. In B. dermatitidis, we identified a GATA transcription factor, SREB, important for the transition to mold. Null mutants (SREBΔ) fail to fully complete the conversion to mold and cannot properly regulate siderophore biosynthesis. To capture the transcriptional response regulated by SREB early in the phase transition (0–48 hours), gene expression microarrays were used to compare SREB∆ to an isogenic wild type isolate. Analysis of the time course microarray data demonstrated SREB functioned as a transcriptional regulator at 37°C and 22°C. Bioinformatic and biochemical analyses indicated SREB was involved in diverse biological processes including iron homeostasis, biosynthesis of triacylglycerol and ergosterol, and lipid droplet formation. Integration of microarray data, bioinformatics, and chromatin immunoprecipitation identified a subset of genes directly bound and regulated by SREB in vivo in yeast (37°C) and during the phase transition to mold (22°C). This included genes involved with siderophore biosynthesis and uptake, iron homeostasis, and genes unrelated to iron assimilation. Functional analysis suggested that lipid droplets were actively metabolized during the phase transition and lipid metabolism may contribute to filamentous growth at 22°C. Chromatin immunoprecipitation, RNA interference, and overexpression analyses suggested that SREB was in a negative regulatory circuit with the bZIP transcription factor encoded by HAPX. Both SREB and HAPX affected morphogenesis at 22°C; however, large changes in transcript abundance by gene deletion for SREB or strong overexpression for HAPX were required to alter the phase transition. PMID:26114571

  14. Differential regulation of oligodendrocyte markers by glucocorticoids: Post-transcriptional regulation of both proteolipid protein and myelin basic protein and transcriptional regulation of glycerol phosphate dehydrogenase

    SciTech Connect

    Kumar, S.; Cole, R.; Chiappelli, F.; De Vellis, J. )

    1989-09-01

    During neonatal development glucocorticoids potentiate oligodendrocyte differentiation and myelinogenesis by regulating the expression of myelin basic protein, proteolipid protein, and glycerol phosphate dehydrogenase. The actual locus at which hydrocortisone exerts its developmental influence on glial physiology is, however, not well understood. Gycerol phosphate dehydrogenase is glucocorticoid-inducible in oligodendrocytes at all stages of development both in vivo and in vitro. In newborn rat cerebral cultures, between 9 and 15 days in vitro, a 2- to 3-fold increase in myelin basic protein and proteolipid protein mRNA levels occurs in oligodendrocytes within 12 hr of hydrocortisone treatment. Immunostaining demonstrates that this increase in mRNAs is followed by a 2- to 3-fold increase in the protein levels within 24 hr. In vitro transcription assays performed with oligodendrocyte nuclei show an 11-fold increase in the transcriptional activity of glycerol phosphate dehydrogenase in response to hydrocortisone but no increase in transcription of myelin basic protein or proteolipid protein. These results indicate that during early myelinogeneis, glucocorticoids influence the expression of key oligodendroglial markers by different processes: The expression of glycerol phosphate dehydrogenase is regulated at the transcriptional level, whereas the expression of myelin basic protein and proteolipid protein is modulated via a different, yet uncharacterized, mechanism involving post-transcriptional regulation.

  15. Transcriptional Regulation of Endothelial Arginase 2 by HDAC2

    PubMed Central

    Pandey, Deepesh; Sikka, Gautam; Bergman, Yehudit; Kim, Jae Hyung; Ryoo, Sungwoo

    2015-01-01

    Objective Arginase 2 is a critical target in atherosclerosis as it controls endothelial NO, proliferation, fibrosis, and inflammation. Regulators of Arg2 transcription in the endothelium have not been characterized. The goal of the current study is to determine the role of specific HDACs in the regulation of endothelial Arg2 transcription and endothelial function. Approach and Results The HDAC inhibitor, trichostatin A (TSA) increased levels of Arg2 mRNA, protein, and activity in both HAEC and mouse aortic rings. These changes occurred with both time- and dose-dependent patterns, and resulted in Arg2-dependent endothelial dysfunction. TSA and the atherogenic stimulus OxLDL enhanced the activity of common promoter regions of Arg2. HDAC inhibition with TSA also decreased endothelial NO and these effects were blunted by arginase inhibition. Non-selective class I HDAC inhibitors enhanced Arg2 expression, while the only selective inhibitor that increased Arg2 expression was mocetinostat (MGCD) – a selective inhibitor of HDACs 1 and 2. Additionally, mouse aortic rings pre-incubated with MGCD exhibited dysfunctional relaxation. Overexpression of HDAC2 (but not HDAC 1, 3 or 8) cDNA in HAEC suppressed Arg2 expression in a concentration-dependent manner, and siRNA knockdown of HDAC2 enhanced Arg2 expression. Chromatin immunoprecipitation indicated direct binding of HDAC2 to the Arg2 promoter, and HDAC2 overexpression in HAEC blocked OxLDL-mediated activation of the Arg2 promoter. Finally, overexpression of HDAC2 blocked OxLDL-mediated vascular dysfunction. Conclusions HDAC2 is a critical regulator of Arg2 expression and thereby endothelial NO and endothelial function. Overexpression or activation of HDAC2 represents a novel therapy for endothelial dysfunction and atherosclerosis. PMID:24833798

  16. Regulation of the malic enzyme gene malE by the transcriptional regulator MalR in Corynebacterium glutamicum.

    PubMed

    Krause, Jens P; Polen, Tino; Youn, Jung-Won; Emer, Denise; Eikmanns, Bernhard J; Wendisch, Volker F

    2012-06-15

    Corynebacterium glutamicum is a Gram-positive nonpathogenic bacterium that is used for the biotechnological production of amino acids. Here, we investigated the transcriptional control of the malE gene encoding malic enzyme (MalE) in C. glutamicum ATCC 13032, which is known to involve the nitrogen regulator AmtR. Gel shift experiments using purified regulators RamA and RamB revealed binding of these regulators to the malE promoter. In DNA-affinity purification experiments a hitherto uncharacterized transcriptional regulator belonging to the MarR family was found to bind to malE promoter DNA and was designated as MalR. C. glutamicum cells overexpressing malR showed reduced MalE activities in LB medium or in minimal media with acetate, glucose, pyruvate or citrate. Deletion of malR positively affected MalE activities during growth in LB medium and minimal media with pyruvate, glucose or the TCA cycle dicarboxylates l-malate, succinate and fumarate. Transcriptional fusion analysis revealed elevated malE promoter activity in the malR deletion mutant during growth in pyruvate minimal medium suggesting that MalR acts as a repressor of malE. Purified MalR bound malE promoter DNA in gel shift experiments. Two MalR binding sites were identified in the malE promoter by mutational analysis. Thus, MalR contributes to the complex transcriptional control of malE which also involves RamA, RamB and AmtR. PMID:22261175

  17. The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance.

    PubMed

    Jiang, Yanjuan; Yu, Diqiu

    2016-08-01

    Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense. PMID:27268959

  18. The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance.

    PubMed

    Jiang, Yanjuan; Yu, Diqiu

    2016-08-01

    Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense.

  19. Post-transcriptional regulation of gene PA5507 controls PQS concentration in Pseudomonas aeruginosa

    PubMed Central

    Tipton, Kyle A.; Coleman, James P.; Pesci, Everett C.

    2015-01-01

    Summary Pseudomonas aeruginosa can sense and respond to a myriad of environmental signals and utilizes a system of small molecules to communicate through intercellular signaling. The small molecule 2-heptyl-3-hydroxy-4-quinolone (Pseudomonas Quinolone Signal [PQS]) is one of these signals and its synthesis is important for virulence. Previously, we identified an RpiR-type transcriptional regulator, QapR, that positively affects PQS production by repressing the qapR operon. An in-frame deletion of this regulator caused P. aeruginosa to produce a greatly reduced concentration of PQS. Here, we report that QapR translation is linked to the downstream gene PA5507. We found that introduction of a premature stop codon within qapR eliminates transcriptional autorepression of the qapR operon as expected but has no effect on PQS concentration. This was investigated with a series of lacZ reporter fusions which showed that translation of QapR must terminate at, or close to, the native qapR stop codon in order for translation of PA5507 to occur. Also, it was shown that truncation of the 5′ end of the qapR transcript permitted PA5507 translation without translation of QapR. Our findings led us to conclude that PA5507 transcription and translation are both tightly controlled by QapR and this control is important for PQS homeostasis. PMID:25662317

  20. Mechanism of CREB recognition and coactivation by the CREB-regulated transcriptional coactivator CRTC2.

    PubMed

    Luo, Qianyi; Viste, Kristin; Urday-Zaa, Janny Concha; Senthil Kumar, Ganesan; Tsai, Wen-Wei; Talai, Afsaneh; Mayo, Kelly E; Montminy, Marc; Radhakrishnan, Ishwar

    2012-12-18

    Basic leucine zipper (bZip) transcription factors regulate cellular gene expression in response to a variety of extracellular signals and nutrient cues. Although the bZip domain is widely known to play significant roles in DNA binding and dimerization, recent studies point to an additional role for this motif in the recruitment of the transcriptional apparatus. For example, the cAMP response element binding protein (CREB)-regulated transcriptional coactivator (CRTC) family of transcriptional coactivators has been proposed to promote the expression of calcium and cAMP responsive genes, by binding to the CREB bZip in response to extracellular signals. Here we show that the CREB-binding domain (CBD) of CRTC2 folds into a single isolated 28-residue helix that seems to be critical for its interaction with the CREB bZip. The interaction is of micromolar affinity on palindromic and variant half-site cAMP response elements (CREs). The CBD and CREB assemble on the CRE with 2:2:1 stoichiometry, consistent with the presence of one CRTC binding site on each CREB monomer. Indeed, the CBD helix and the solvent-exposed residues in the dimeric CREB bZip coiled-coil form an extended protein-protein interface. Because mutation of relevant bZip residues in this interface disrupts the CRTC interaction without affecting DNA binding, our results illustrate that distinct DNA binding and transactivation functions are encoded within the structural constraints of a canonical bZip domain.

  1. Analysis of wide-domain transcriptional regulation in solid-state cultures of Aspergillus oryzae.

    PubMed

    McKelvey, Shauna M; Murphy, Richard A

    2010-05-01

    Many filamentous fungi secrete considerable quantities of enzymes including protease, cellulase and xylanase, which are of major industrial importance. Over the past few decades, many of these fungal enzymes have been isolated and their relevant genes characterised. Solid-state fermentation (SSF), an ancient technique described as a fermentation process performed on non-soluble material whereby the material acts as a physical support and as a source of nutrients, is widely employed in the production of industrially important enzymes. Control mechanisms governing gene expression in SSF however, have been rarely studied. The influence of carbon and nitrogen sources on the production and transcriptional regulation of hydrolase enzymes secreted by an Aspergillus strain was investigated with the hope of expanding on the relatively small amount of knowledge regarding cellular control of gene expression. This study involved screening a collection of fungal strains for protease, cellulase and xylanase production under SSF conditions. From this, one fungal strain was then chosen for further analysis. Factors affecting the secretion of the hydrolase enzymes were optimised, and following this, the influence of nutritional supplementation on the production and transcriptional regulation of the enzymes was investigated. Real-time PCR techniques were used to assess the relative expression levels of genes encoding hydrolase activities and of the genes encoding regulatory elements such as AreA, PacC and CreA in an effort to identify possible transcriptional regulation mechanisms. The complexity of gene regulation under SSF conditions became apparent during the study, as other factors such as post-transcriptional regulation appeared to play a far greater role than previously imagined.

  2. ETS-4 is a transcriptional regulator of life span in Caenorhabditis elegans.

    PubMed

    Thyagarajan, Bargavi; Blaszczak, Adam G; Chandler, Katherine J; Watts, Jennifer L; Johnson, W Evan; Graves, Barbara J

    2010-09-01

    Aging is a complex phenotype responsive to a plethora of environmental inputs; yet only a limited number of transcriptional regulators are known to influence life span. How the downstream expression programs mediated by these factors (or others) are coordinated into common or distinct set of aging effectors is an addressable question in model organisms, such as C. elegans. Here, we establish the transcription factor ETS-4, an ortholog of vertebrate SPDEF, as a longevity determinant. Adult worms with ets-4 mutations had a significant extension of mean life span. Restoring ETS-4 activity in the intestine, but not neurons, of ets-4 mutant worms rescued life span to wild-type levels. Using RNAi, we demonstrated that ets-4 is required post-developmentally to regulate adult life span; thus uncoupling the role of ETS-4 in aging from potential functions in worm intestinal development. Seventy ETS-4-regulated genes, identified by gene expression profiling of two distinct ets-4 alleles and analyzed by bioinformatics, were enriched for known longevity effectors that function in lipid transport, lipid metabolism, and innate immunity. Putative target genes were enriched for ones that change expression during normal aging, the majority of which are controlled by the GATA factors. Also, some ETS-4-regulated genes function downstream of the FOXO factor, DAF-16 and the insulin/IGF-1 signaling pathway. However, epistasis and phenotypic analyses indicate that ets-4 functioned in parallel to the insulin/IGF-1 receptor, daf-2 and akt-1/2 kinases. Furthermore, ets-4 required daf-16 to modulate aging, suggesting overlap in function at the level of common targets that affect life span. In conclusion, ETS-4 is a new transcriptional regulator of aging, which shares transcriptional targets with GATA and FOXO factors, suggesting that overlapping pathways direct common sets of lifespan-related genes. PMID:20862312

  3. Autoimmune regulator is acetylated by transcription coactivator CBP/p300

    SciTech Connect

    Saare, Mario; Rebane, Ana; Rajashekar, Balaji; Vilo, Jaak; Peterson, Paert

    2012-08-15

    The Autoimmune Regulator (AIRE) is a regulator of transcription in the thymic medulla, where it controls the expression of a large set of peripheral-tissue specific genes. AIRE interacts with the transcriptional coactivator and acetyltransferase CBP and synergistically cooperates with it in transcriptional activation. Here, we aimed to study a possible role of AIRE acetylation in the modulation of its activity. We found that AIRE is acetylated in tissue culture cells and this acetylation is enhanced by overexpression of CBP and the CBP paralog p300. The acetylated lysines were located within nuclear localization signal and SAND domain. AIRE with mutations that mimicked acetylated K243 and K253 in the SAND domain had reduced transactivation activity and accumulated into fewer and larger nuclear bodies, whereas mutations that mimicked the unacetylated lysines were functionally similar to wild-type AIRE. Analogously to CBP, p300 localized to AIRE-containing nuclear bodies, however, the overexpression of p300 did not enhance the transcriptional activation of AIRE-regulated genes. Further studies showed that overexpression of p300 stabilized the AIRE protein. Interestingly, gene expression profiling revealed that AIRE, with mutations mimicking K243/K253 acetylation in SAND, was able to activate gene expression, although the affected genes were different and the activation level was lower from those regulated by wild-type AIRE. Our results suggest that the AIRE acetylation can influence the selection of AIRE activated genes. -- Highlights: Black-Right-Pointing-Pointer AIRE is acetylated by the acetyltransferases p300 and CBP. Black-Right-Pointing-Pointer Acetylation occurs between CARD and SAND domains and within the SAND domain. Black-Right-Pointing-Pointer Acetylation increases the size of AIRE nuclear dots. Black-Right-Pointing-Pointer Acetylation increases AIRE protein stability. Black-Right-Pointing-Pointer AIRE acetylation mimic regulates a different set of AIRE

  4. Analysis of wide-domain transcriptional regulation in solid-state cultures of Aspergillus oryzae.

    PubMed

    McKelvey, Shauna M; Murphy, Richard A

    2010-05-01

    Many filamentous fungi secrete considerable quantities of enzymes including protease, cellulase and xylanase, which are of major industrial importance. Over the past few decades, many of these fungal enzymes have been isolated and their relevant genes characterised. Solid-state fermentation (SSF), an ancient technique described as a fermentation process performed on non-soluble material whereby the material acts as a physical support and as a source of nutrients, is widely employed in the production of industrially important enzymes. Control mechanisms governing gene expression in SSF however, have been rarely studied. The influence of carbon and nitrogen sources on the production and transcriptional regulation of hydrolase enzymes secreted by an Aspergillus strain was investigated with the hope of expanding on the relatively small amount of knowledge regarding cellular control of gene expression. This study involved screening a collection of fungal strains for protease, cellulase and xylanase production under SSF conditions. From this, one fungal strain was then chosen for further analysis. Factors affecting the secretion of the hydrolase enzymes were optimised, and following this, the influence of nutritional supplementation on the production and transcriptional regulation of the enzymes was investigated. Real-time PCR techniques were used to assess the relative expression levels of genes encoding hydrolase activities and of the genes encoding regulatory elements such as AreA, PacC and CreA in an effort to identify possible transcriptional regulation mechanisms. The complexity of gene regulation under SSF conditions became apparent during the study, as other factors such as post-transcriptional regulation appeared to play a far greater role than previously imagined. PMID:20145973

  5. Transcriptional regulation of the carbohydrate utilization network in Thermotoga maritima

    PubMed Central

    Rodionov, Dmitry A.; Rodionova, Irina A.; Li, Xiaoqing; Ravcheev, Dmitry A.; Tarasova, Yekaterina; Portnoy, Vasiliy A.; Zengler, Karsten; Osterman, Andrei L.

    2013-01-01

    Hyperthermophilic bacteria from the Thermotogales lineage can produce hydrogen by fermenting a wide range of carbohydrates. Previous experimental studies identified a large fraction of genes committed to carbohydrate degradation and utilization in the model bacterium Thermotoga maritima. Knowledge of these genes enabled comprehensive reconstruction of biochemical pathways comprising the carbohydrate utilization network. However, transcriptional factors (TFs) and regulatory mechanisms driving this network remained largely unknown. Here, we used an integrated approach based on comparative analysis of genomic and transcriptomic data for the reconstruction of the carbohydrate utilization regulatory networks in 11 Thermotogales genomes. We identified DNA-binding motifs and regulons for 19 orthologous TFs in the Thermotogales. The inferred regulatory network in T. maritima contains 181 genes encoding TFs, sugar catabolic enzymes and ABC-family transporters. In contrast to many previously described bacteria, a transcriptional regulation strategy of Thermotoga does not employ global regulatory factors. The reconstructed regulatory network in T. maritima was validated by gene expression profiling on a panel of mono- and disaccharides and by in vitro DNA-binding assays. The observed upregulation of genes involved in catabolism of pectin, trehalose, cellobiose, arabinose, rhamnose, xylose, glucose, galactose, and ribose showed a strong correlation with the UxaR, TreR, BglR, CelR, AraR, RhaR, XylR, GluR, GalR, and RbsR regulons. Ultimately, this study elucidated the transcriptional regulatory network and mechanisms controlling expression of carbohydrate utilization genes in T. maritima. In addition to improving the functional annotations of associated transporters and catabolic enzymes, this research provides novel insights into the evolution of regulatory networks in Thermotogales. PMID:23986752

  6. Regulation of transcription factors on sexual dimorphism of fig wasps.

    PubMed

    Sun, Bao-Fa; Li, Yong-Xing; Jia, Ling-Yi; Niu, Li-Hua; Murphy, Robert W; Zhang, Peng; He, Shunmin; Huang, Da-Wei

    2015-06-02

    Fig wasps exhibit extreme intraspecific morphological divergence in the wings, compound eyes, antennae, body color, and size. Corresponding to this, behaviors and lifestyles between two sexes are also different: females can emerge from fig and fly to other fig tree to oviposit and pollinate, while males live inside fig for all their lifetime. Genetic regulation may drive these extreme intraspecific morphological and behavioral divergence. Transcription factors (TFs) involved in morphological development and physiological activity may exhibit sex-specific expressions. Herein, we detect 865 TFs by using genomic and transcriptomic data of the fig wasp Ceratosolen solmsi. Analyses of transcriptomic data indicated that up-regulated TFs in females show significant enrichment in development of the wing, eye and antenna in all stages, from larva to adult. Meanwhile, TFs related to the development of a variety of organs display sex-specific patterns of expression in the adults and these may contribute significantly to their sexual dimorphism. In addition, up-regulated TFs in adult males exhibit enrichment in genitalia development and circadian rhythm, which correspond with mating and protandry. This finding is consistent with their sex-specific behaviors. In conclusion, our results strongly indicate that TFs play important roles in the sexual dimorphism of fig wasps.

  7. The aryl hydrocarbon receptor (AHR) transcription factor regulates megakaryocytic polyploidization

    PubMed Central

    Lindsey, Stephan; T. Papoutsakis, Eleftherios

    2012-01-01

    Summary We propose that the aryl hydrocarbon receptor (AHR) is a novel transcriptional regulator of megakaryopoietic polyploidization. Functional evidence was obtained that AHR impacts in vivo megakaryocytic differentiation and maturation; compared to wild-type mice, AHR-null mice had lower platelet counts, fewer numbers of newly synthesized platelets, increased bleeding times and lower-ploidy megakaryocytes (Mks). AHR mRNA increased 3·6-fold during ex vivo megakaryocytic differentiation, but reduced or remained constant during parallel isogenic granulocytic or erythroid differentiation. We interrogated the role of AHR in megakaryopoiesis using a validated Mk model of megakaryopoiesis, the human megakaryoblastic leukaemia CHRF cell line. Upon CHRF Mk differentiation, AHR mRNA and protein levels increased, AHR protein shifted from the cytoplasm to the nucleus and AHR binding to its consensus DNA binding sequence increased. Protein and mRNA levels of the AHR transcriptional target HES1 also increased. Mk differentiation of CHRF cells where AHR or HES1 was knocked-down using RNAi resulted in lower ploidy distributions and cells that were incapable of reaching ploidy classes ≥16n. AHR knockdown also resulted in increased DNA synthesis of lower ploidy cells, without impacting apoptosis. Together, these data support a role for AHR in Mk polyploidization and in vivo platelet function, and warrant further detailed investigations. PMID:21226706

  8. Non-equilibrium thermodynamics analysis of transcriptional regulation kinetics

    NASA Astrophysics Data System (ADS)

    Hernández-Lemus, Enrique; Tovar, Hugo; Mejía, Carmen

    2014-12-01

    Gene expression in eukaryotic cells is an extremely complex and interesting phenomenon whose dynamics are controlled by a large number of subtle physicochemical processes commonly described by means of gene regulatory networks. Such networks consist in a series of coupled chemical reactions, conformational changes, and other biomolecular processes involving the interaction of the DNA molecule itself with a number of proteins usually called transcription factors as well as enzymes and other components. The kinetics behind the functioning of such gene regulatory networks are largely unknown, though its description in terms of non-equilibrium thermodynamics has been discussed recently. In this work we will derive general kinetic equations for a gene regulatory network from a non-equilibrium thermodynamical description and discuss its use in understanding the free energy constrains imposed in the network structure. We also will discuss explicit expressions for the kinetics of a simple model of gene regulation and show that the kinetic role of mRNA decay during the RNA synthesis stage (or transcription) is somehow limited due to the comparatively low values of decay rates. At the level discussed here, this implies a decoupling of the kinetics of mRNA synthesis and degradation a fact that may become quite useful when modeling gene regulatory networks from experimental data on whole genome gene expression.

  9. Disentangling the many layers of eukaryotic transcriptional regulation.

    PubMed

    Lelli, Katherine M; Slattery, Matthew; Mann, Richard S

    2012-01-01

    Regulation of gene expression in eukaryotes is an extremely complex process. In this review, we break down several critical steps, emphasizing new data and techniques that have expanded current gene regulatory models. We begin at the level of DNA sequence where cis-regulatory modules (CRMs) provide important regulatory information in the form of transcription factor (TF) binding sites. In this respect, CRMs function as instructional platforms for the assembly of gene regulatory complexes. We discuss multiple mechanisms controlling complex assembly, including cooperative DNA binding, combinatorial codes, and CRM architecture. The second section of this review places CRM assembly in the context of nucleosomes and condensed chromatin. We discuss how DNA accessibility and histone modifications contribute to TF function. Lastly, new advances in chromosomal mapping techniques have provided increased understanding of intra- and interchromosomal interactions. We discuss how these topological maps influence gene regulatory models.

  10. Transcriptional profiling of the epigenetic regulator Smchd1

    PubMed Central

    Liu, Ruijie; Chen, Kelan; Jansz, Natasha; Blewitt, Marnie E.; Ritchie, Matthew E.

    2015-01-01

    Smchd1 is an epigenetic repressor with important functions in healthy cellular processes and disease. To elucidate its role in transcriptional regulation, we performed two independent genome-wide RNA-sequencing studies comparing wild-type and Smchd1 null samples in neural stem cells and lymphoma cell lines. Using an R-based analysis pipeline that accommodates observational and sample-specific weights in the linear modeling, we identify key genes dysregulated by Smchd1 deletion such as clustered protocadherins in the neural stem cells and imprinted genes in both experiments. Here we provide a detailed description of this analysis, from quality control to read mapping and differential expression analysis. These data sets are publicly available from the Gene Expression Omnibus database (accession numbers GSE64099 and GSE65747). PMID:26981392

  11. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  12. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun

    2015-01-01

    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  13. Sucrose regulation of ADP-glucose pyrophosphorylase subunit genes transcript levels in leaves and fruits

    NASA Technical Reports Server (NTRS)

    Li, Xiangyang; Xing, Jinpeng; Gianfagna, Thomas J.; Janes, Harry W.

    2002-01-01

    ADP-glucose pyrophosphorylase (AGPase, EC2.7.7.27) is a key regulatory enzyme in starch biosynthesis. The enzyme is a heterotetramer with two S and two B subunits. In tomato, there are three multiple forms of the S subunit gene. Agp S1, S2 and B are highly expressed in fruit from 10 to 25 days after anthesis. Agp S3 is only weakly expressed in fruit. Sucrose significantly elevates expression of Agp S1, S2 and B in both leaves and fruits. Agp S1 exhibits the highest degree of regulation by sucrose. In fact, sucrose may be required for Agp S1 expression. For excised leaves incubated in water, no transcripts for Agp S1 could be detected in the absence of sucrose, whereas it took up to 16 h in water before transcripts were no longer detectable for Agp S2 and B. Neither Agp S3 nor the tubulin gene is affected by sucrose, demonstrating that this response is specifically regulated by a carbohydrate metabolic signal, and is not due to a general increase in metabolism caused by sucrose treatment. Truncated versions of the promoter for Agp S1 indicate that a specific region 1.3-3.0 kb upstream from the transcription site is responsible for sucrose sensitivity. This region of the S1 promoter contains several cis-acting elements present in the promoters of other genes that are also regulated by sucrose. c2002 Elsevier Science Ireland Ltd. All rights reserved.

  14. Acetylation of histone H3 at lysine 64 regulates nucleosome dynamics and facilitates transcription.

    PubMed

    Di Cerbo, Vincenzo; Mohn, Fabio; Ryan, Daniel P; Montellier, Emilie; Kacem, Salim; Tropberger, Philipp; Kallis, Eleni; Holzner, Monika; Hoerner, Leslie; Feldmann, Angelika; Richter, Florian Martin; Bannister, Andrew J; Mittler, Gerhard; Michaelis, Jens; Khochbin, Saadi; Feil, Robert; Schuebeler, Dirk; Owen-Hughes, Tom; Daujat, Sylvain; Schneider, Robert

    2014-03-25

    Post-translational modifications of proteins have emerged as a major mechanism for regulating gene expression. However, our understanding of how histone modifications directly affect chromatin function remains limited. In this study, we investigate acetylation of histone H3 at lysine 64 (H3K64ac), a previously uncharacterized acetylation on the lateral surface of the histone octamer. We show that H3K64ac regulates nucleosome stability and facilitates nucleosome eviction and hence gene expression in vivo. In line with this, we demonstrate that H3K64ac is enriched in vivo at the transcriptional start sites of active genes and it defines transcriptionally active chromatin. Moreover, we find that the p300 co-activator acetylates H3K64, and consistent with a transcriptional activation function, H3K64ac opposes its repressive counterpart H3K64me3. Our findings reveal an important role for a histone modification within the nucleosome core as a regulator of chromatin function and they demonstrate that lateral surface modifications can define functionally opposing chromatin states. DOI: http://dx.doi.org/10.7554/eLife.01632.001.

  15. Acetylation of histone H3 at lysine 64 regulates nucleosome dynamics and facilitates transcription

    PubMed Central

    Di Cerbo, Vincenzo; Mohn, Fabio; Ryan, Daniel P; Montellier, Emilie; Kacem, Salim; Tropberger, Philipp; Kallis, Eleni; Holzner, Monika; Hoerner, Leslie; Feldmann, Angelika; Richter, Florian Martin; Bannister, Andrew J; Mittler, Gerhard; Michaelis, Jens; Khochbin, Saadi; Feil, Robert; Schuebeler, Dirk; Owen-Hughes, Tom; Daujat, Sylvain; Schneider, Robert

    2014-01-01

    Post-translational modifications of proteins have emerged as a major mechanism for regulating gene expression. However, our understanding of how histone modifications directly affect chromatin function remains limited. In this study, we investigate acetylation of histone H3 at lysine 64 (H3K64ac), a previously uncharacterized acetylation on the lateral surface of the histone octamer. We show that H3K64ac regulates nucleosome stability and facilitates nucleosome eviction and hence gene expression in vivo. In line with this, we demonstrate that H3K64ac is enriched in vivo at the transcriptional start sites of active genes and it defines transcriptionally active chromatin. Moreover, we find that the p300 co-activator acetylates H3K64, and consistent with a transcriptional activation function, H3K64ac opposes its repressive counterpart H3K64me3. Our findings reveal an important role for a histone modification within the nucleosome core as a regulator of chromatin function and they demonstrate that lateral surface modifications can define functionally opposing chromatin states. DOI: http://dx.doi.org/10.7554/eLife.01632.001 PMID:24668167

  16. Transcription factor ZBED6 mediates IGF2 gene expression by regulating promoter activity and DNA methylation in myoblasts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were up regulated during C2C12 differentiation. The IGF2 expression levels wer...

  17. The Affective Regulation of Social Interaction

    ERIC Educational Resources Information Center

    Clore, Gerald L.; Pappas, Jesse

    2007-01-01

    The recent publication of David Heise's "Expressive Order" (2007) provides an occasion for discussing some of the key ideas in Affect Control Theory. The theory proposes that a few dimensions of affective meaning provide a common basis for interrelating personal identities and social actions. It holds that during interpersonal interactions, social…

  18. Regulation of transcription and activity of Rhizobium etli glutaminase A.

    PubMed

    Huerta-Saquero, Alejandro; Calderón-Flores, Arturo; Díaz-Villaseñor, Andrea; Du Pont, Gisela; Durán, Socorro

    2004-08-01

    The present study determines the regulatory mechanisms that operate on Rhizobium etli glutaminase A. glsA gene expression levels were evaluated under several metabolic conditions by fusions of the glsA gene promoter and the transcriptional reporter cassette uidA2-aad. glsA expression was directly correlated to the glutaminase A activity found under the tested growth conditions, reaching its maximum level in the presence of glutamine and during exponential growth phase. Glutamine induces glsA expression. The influence of allosteric metabolites on glutaminase A activity was also determined. The purified enzyme was inhibited by 2-oxoglutarate and pyruvate, whereas oxaloacetate and glyoxylate modulate it positively. Glutaminase A is not inhibited by glutamate and is activated by ammonium. Glutaminase A participates in an ATP-consuming cycle where glutamine is continually degraded and resynthesized by glutamine synthetase (GS). GS and glutaminase A activities appear simultaneously during bacterial growth under different metabolic conditions and their control mechanisms are not reciprocal. Slight overproduction in glutaminase A expression causes a reduction in growth yield and a dramatic decrease in bacterial growth. We propose a model for regulation of glutaminase A, and discuss its contribution to glutamine cycle regulation. PMID:15279892

  19. Regulation of Memory Formation by the Transcription Factor XBP1.

    PubMed

    Martínez, Gabriela; Vidal, René L; Mardones, Pablo; Serrano, Felipe G; Ardiles, Alvaro O; Wirth, Craig; Valdés, Pamela; Thielen, Peter; Schneider, Bernard L; Kerr, Bredford; Valdés, Jose L; Palacios, Adrian G; Inestrosa, Nibaldo C; Glimcher, Laurie H; Hetz, Claudio

    2016-02-16

    Contextual memory formation relies on the induction of new genes in the hippocampus. A polymorphism in the promoter of the transcription factor XBP1 was identified as a risk factor for Alzheimer's disease and bipolar disorders. XBP1 is a major regulator of the unfolded protein response (UPR), mediating adaptation to endoplasmic reticulum (ER) stress. Using a phenotypic screen, we uncovered an unexpected function of XBP1 in cognition and behavior. Mice lacking XBP1 in the nervous system showed specific impairment of contextual memory formation and long-term potentiation (LTP), whereas neuronal XBP1s overexpression improved performance in memory tasks. Gene expression analysis revealed that XBP1 regulates a group of memory-related genes, highlighting brain-derived neurotrophic factor (BDNF), a key component in memory consolidation. Overexpression of BDNF in the hippocampus reversed the XBP1-deficient phenotype. Our study revealed an unanticipated function of XBP1 in cognitive processes that is apparently unrelated to its role in ER stress.

  20. Regulation of Memory Formation by the Transcription Factor XBP1.

    PubMed

    Martínez, Gabriela; Vidal, René L; Mardones, Pablo; Serrano, Felipe G; Ardiles, Alvaro O; Wirth, Craig; Valdés, Pamela; Thielen, Peter; Schneider, Bernard L; Kerr, Bredford; Valdés, Jose L; Palacios, Adrian G; Inestrosa, Nibaldo C; Glimcher, Laurie H; Hetz, Claudio

    2016-02-16

    Contextual memory formation relies on the induction of new genes in the hippocampus. A polymorphism in the promoter of the transcription factor XBP1 was identified as a risk factor for Alzheimer's disease and bipolar disorders. XBP1 is a major regulator of the unfolded protein response (UPR), mediating adaptation to endoplasmic reticulum (ER) stress. Using a phenotypic screen, we uncovered an unexpected function of XBP1 in cognition and behavior. Mice lacking XBP1 in the nervous system showed specific impairment of contextual memory formation and long-term potentiation (LTP), whereas neuronal XBP1s overexpression improved performance in memory tasks. Gene expression analysis revealed that XBP1 regulates a group of memory-related genes, highlighting brain-derived neurotrophic factor (BDNF), a key component in memory consolidation. Overexpression of BDNF in the hippocampus reversed the XBP1-deficient phenotype. Our study revealed an unanticipated function of XBP1 in cognitive processes that is apparently unrelated to its role in ER stress. PMID:26854229

  1. Regulated nuclear export of the homeodomain transcription factor Prospero.

    PubMed

    Demidenko, Z; Badenhorst, P; Jones, T; Bi, X; Mortin, M A

    2001-04-01

    Subcellular distribution of the Prospero protein is dynamically regulated during Drosophila embryonic nervous system development. Prospero is first detected in neuroblasts where it becomes cortically localized and tethered by the adapter protein, Miranda. After division, Prospero enters the nucleus of daughter ganglion mother cells where it functions as a transcription factor. We have isolated a mutation that removes the C-terminal 30 amino acids from the highly conserved 100 amino acid Prospero domain. Molecular dissection of the homeo- and Prospero domains, and expression of chimeric Prospero proteins in mammalian and insect cultured cells indicates that Prospero contains a nuclear export signal that is masked by the Prospero domain. Nuclear export of Prospero, which is sensitive to the drug leptomycin B, is mediated by Exportin. Mutation of the nuclear export signal-mask in Drosophila embryos prevents Prospero nuclear localization in ganglion mother cells. We propose that a combination of cortical tethering and regulated nuclear export controls Prospero subcellular distribution and function in all higher eukaryotes. PMID:11262236

  2. Ribulokinase and transcriptional regulation of arabinose metabolism in Clostridium acetobutylicum.

    PubMed

    Zhang, Lei; Leyn, Semen A; Gu, Yang; Jiang, Weihong; Rodionov, Dmitry A; Yang, Chen

    2012-03-01

    The transcription factor AraR controls utilization of L-arabinose in Bacillus subtilis. In this study, we combined a comparative genomic reconstruction of AraR regulons in nine Clostridium species with detailed experimental characterization of AraR-mediated regulation in Clostridium acetobutylicum. Based on the reconstructed AraR regulons, a novel ribulokinase, AraK, present in all analyzed Clostridium species was identified, which was a nonorthologous replacement of previously characterized ribulokinases. The predicted function of the araK gene was confirmed by inactivation of the araK gene in C. acetobutylicum and biochemical assays using purified recombinant AraK. In addition to the genes involved in arabinose utilization and arabinoside degradation, extension of the AraR regulon to the pentose phosphate pathway genes in several Clostridium species was revealed. The predicted AraR-binding sites in the C. acetobutylicum genome and the negative effect of L-arabinose on DNA-regulator complex formation were verified by in vitro binding assays. The predicted AraR-controlled genes in C. acetobutylicum were experimentally validated by testing gene expression patterns in both wild-type and araR-inactivated mutant strains during growth in the absence or presence of L-arabinose.

  3. Implicit emotion regulation affects outcome evaluation.

    PubMed

    Yang, Qiwei; Tang, Ping; Gu, Ruolei; Luo, Wenbo; Luo, Yue-jia

    2015-06-01

    Efficient implicit emotion regulation processes, which run without awareness, are important for human well-being. In this study, to investigate the influence of implicit emotion regulation on psychological and electrophysiological responses to gains and losses, participants were required to select between two Chinese four-character idioms to match the meaning of the third one before they performed a monetary gambling task. According to whether their meanings were related to emotion regulation, the idioms fell into two categories. Event-related potentials and self-rating emotional experiences to outcome feedback were recorded during the task. Priming emotion regulation reduced subjective emotional experience to both gains and losses and the amplitudes of the feedback-related negativity, while the P3 component was not influenced. According to these results, we suggest that the application of implicit emotion regulation effectively modulated the subjective emotional experience and the motivational salience of current outcomes without the cost of cognitive resources. This study implicates the potential significance of implicit emotion regulation in decision-making processes. PMID:25332404

  4. Implicit emotion regulation affects outcome evaluation.

    PubMed

    Yang, Qiwei; Tang, Ping; Gu, Ruolei; Luo, Wenbo; Luo, Yue-jia

    2015-06-01

    Efficient implicit emotion regulation processes, which run without awareness, are important for human well-being. In this study, to investigate the influence of implicit emotion regulation on psychological and electrophysiological responses to gains and losses, participants were required to select between two Chinese four-character idioms to match the meaning of the third one before they performed a monetary gambling task. According to whether their meanings were related to emotion regulation, the idioms fell into two categories. Event-related potentials and self-rating emotional experiences to outcome feedback were recorded during the task. Priming emotion regulation reduced subjective emotional experience to both gains and losses and the amplitudes of the feedback-related negativity, while the P3 component was not influenced. According to these results, we suggest that the application of implicit emotion regulation effectively modulated the subjective emotional experience and the motivational salience of current outcomes without the cost of cognitive resources. This study implicates the potential significance of implicit emotion regulation in decision-making processes.

  5. A WRKY Transcription Factor Regulates Fe Translocation under Fe Deficiency1[OPEN

    PubMed Central

    Yan, Jing Ying; Li, Chun Xiao; Sun, Li; Ren, Jiang Yuan; Li, Gui Xin

    2016-01-01

    Iron (Fe) deficiency affects plant growth and development, leading to reduction of crop yields and quality. Although the regulation of Fe uptake under Fe deficiency has been well studied in the past decade, the regulatory mechanism of Fe translocation inside the plants remains unknown. Here, we show that a WRKY transcription factor WRKY46 is involved in response to Fe deficiency. Lack of WRKY46 (wrky46-1 and wrky46-2 loss-of-function mutants) significantly affects Fe translocation from root to shoot and thus causes obvious chlorosis on the new leaves under Fe deficiency. Gene expression analysis reveals that expression of a nodulin-like gene (VACUOLAR IRON TRANSPORTER1-LIKE1 [VITL1]) is dramatically increased in wrky46-1 mutant. VITL1 expression is inhibited by Fe deficiency, while the expression of WRKY46 is induced in the root stele. Moreover, down-regulation of VITL1 expression can restore the chlorosis phenotype on wrky46-1 under Fe deficiency. Further yeast one-hybrid and chromatin immunoprecipitation experiments indicate that WRKY46 is capable of binding to the specific W-boxes present in the VITL1 promoter. In summary, our results demonstrate that WRKY46 plays an important role in the control of root-to-shoot Fe translocation under Fe deficiency condition via direct regulation of VITL1 transcript levels. PMID:27208259

  6. Transcriptional regulation of lycopene metabolism mediated by rootstock during the ripening of grafted watermelons.

    PubMed

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Liu, Peng; Cao, Lei; Huang, Yuan; Zhao, Liqiang; Lv, Huifang; Bie, Zhilong

    2017-01-01

    Rootstocks have comprehensive effects on lycopene accumulation in grafted watermelon fruits. However, little is known about lycopene metabolic regulation in grafted watermelon. To address this problem, parallel changes in lycopene contents and the expression of its metabolic genes were analyzed during the fruit ripening of nongrafted watermelon and watermelon grafted onto bottle gourd, pumpkin, and wild watermelon. Results showed that rootstocks mediated the transcriptional regulations of lycopene accumulation in different ways. Bottle gourd and wild watermelon promoted lycopene accumulation in grafted watermelon fruits by upregulating the biosynthetic genes phytoene synthase (PSY) and ζ-carotene desaturase (ZDS), and downregulating the catabolic genes β-carotene hydroxylase (CHYB), zeaxanthin epoxidase (ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), and carotenoid cleavage dioxygenase (CCD). However, pumpkin did not affect lycopene accumulation by upregulating both biosynthetic and catabolic genes. The rootstock-dependent characteristic of lycopene accumulation in grafted watermelon fruits provided an alternative model for investigating lycopene metabolic regulation. PMID:27507492

  7. Transcriptional regulation of lycopene metabolism mediated by rootstock during the ripening of grafted watermelons.

    PubMed

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Liu, Peng; Cao, Lei; Huang, Yuan; Zhao, Liqiang; Lv, Huifang; Bie, Zhilong

    2017-01-01

    Rootstocks have comprehensive effects on lycopene accumulation in grafted watermelon fruits. However, little is known about lycopene metabolic regulation in grafted watermelon. To address this problem, parallel changes in lycopene contents and the expression of its metabolic genes were analyzed during the fruit ripening of nongrafted watermelon and watermelon grafted onto bottle gourd, pumpkin, and wild watermelon. Results showed that rootstocks mediated the transcriptional regulations of lycopene accumulation in different ways. Bottle gourd and wild watermelon promoted lycopene accumulation in grafted watermelon fruits by upregulating the biosynthetic genes phytoene synthase (PSY) and ζ-carotene desaturase (ZDS), and downregulating the catabolic genes β-carotene hydroxylase (CHYB), zeaxanthin epoxidase (ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), and carotenoid cleavage dioxygenase (CCD). However, pumpkin did not affect lycopene accumulation by upregulating both biosynthetic and catabolic genes. The rootstock-dependent characteristic of lycopene accumulation in grafted watermelon fruits provided an alternative model for investigating lycopene metabolic regulation.

  8. Xist and Tsix Transcription Dynamics Is Regulated by the X-to-Autosome Ratio and Semistable Transcriptional States

    PubMed Central

    Loos, Friedemann; Maduro, Cheryl; Loda, Agnese; Lehmann, Johannes; Kremers, Gert-Jan; ten Berge, Derk; Grootegoed, J. Anton

    2016-01-01

    In female mammals, X chromosome inactivation (XCI) is a key process in the control of gene dosage compensation between X-linked genes and autosomes. Xist and Tsix, two overlapping antisense-transcribed noncoding genes, are central elements of the X inactivation center (Xic) regulating XCI. Xist upregulation results in the coating of the entire X chromosome by Xist RNA in cis, whereas Tsix transcription acts as a negative regulator of Xist. Here, we generated Xist and Tsix reporter mouse embryonic stem (ES) cell lines to study the genetic and dynamic regulation of these genes upon differentiation. Our results revealed mutually antagonistic roles for Tsix on Xist and vice versa and indicate the presence of semistable transcriptional states of the Xic locus predicting the outcome of XCI. These transcriptional states are instructed by the X-to-autosome ratio, directed by regulators of XCI, and can be modulated by tissue culture conditions. PMID:27528619

  9. Gasoline Composition Regulations Affecting LUST Sites

    EPA Science Inventory

    Passage of the Clean Air Act Amendments in 1990 imposed requirements on gasoline composition in the United States. Impacts to ground water are affected by the provisions that required oxygenated additives and limited benzene concentration. Reformulated and oxygenated gasoline w...

  10. Acetylation of the response regulator RcsB controls transcription from a small RNA promoter.

    PubMed

    Hu, Linda I; Chi, Bui Khanh; Kuhn, Misty L; Filippova, Ekaterina V; Walker-Peddakotla, Arti J; Bäsell, Katrin; Becher, Dörte; Anderson, Wayne F; Antelmann, Haike; Wolfe, Alan J

    2013-09-01

    Nε-lysine acetylation was recently discovered on many bacterial proteins that function in diverse cellular processes. Thus, many questions remain unanswered. For example, what mechanisms regulate lysine acetylation? Does acetylation affect physiology? To help answer these questions, we studied the Escherichia coli response regulator and transcription factor RcsB, which is reported to be acetylated in vitro. To characterize RcsB acetylation, we monitored transcription from the rprA promoter, which requires RcsB. The conventional view is that RcsB is activated by phosphorylation through either the Rcs phosphorelay or acetyl phosphate. We affirmed that rprA transcription requires phosphorylated RcsB and showed that acetyl-phosphate (AcP) is a phosphoryl group donor to RcsB. However, a mutant that accumulates AcP (ackA) exhibited a reduction in rprA transcription instead of the predicted increase. rprA transcription also diminished in the cobB mutant, which lacks the only known E. coli protein deacetylase. This suggests the existence of an inhibitory mechanism that involves lysine acetylation, a supposition supported by the observation that RcsB isolated from the ackA or cobB mutant was hyperacetylated. Finally, we used a genetic approach to identify an AckA- and CobB-sensitive lysine (Lys-154) that controls RcsB activity. We propose that acetylation inhibits RcsB activity and that some of this inhibition acts through the acetylation of Lys-154. PMID:23852870

  11. Acetylation of the Response Regulator RcsB Controls Transcription from a Small RNA Promoter

    PubMed Central

    Hu, Linda I.; Chi, Bui Khanh; Kuhn, Misty L.; Filippova, Ekaterina V.; Walker-Peddakotla, Arti J.; Bäsell, Katrin; Becher, Dörte; Anderson, Wayne F.; Antelmann, Haike

    2013-01-01

    Nε-lysine acetylation was recently discovered on many bacterial proteins that function in diverse cellular processes. Thus, many questions remain unanswered. For example, what mechanisms regulate lysine acetylation? Does acetylation affect physiology? To help answer these questions, we studied the Escherichia coli response regulator and transcription factor RcsB, which is reported to be acetylated in vitro. To characterize RcsB acetylation, we monitored transcription from the rprA promoter, which requires RcsB. The conventional view is that RcsB is activated by phosphorylation through either the Rcs phosphorelay or acetyl phosphate. We affirmed that rprA transcription requires phosphorylated RcsB and showed that acetyl-phosphate (AcP) is a phosphoryl group donor to RcsB. However, a mutant that accumulates AcP (ackA) exhibited a reduction in rprA transcription instead of the predicted increase. rprA transcription also diminished in the cobB mutant, which lacks the only known E. coli protein deacetylase. This suggests the existence of an inhibitory mechanism that involves lysine acetylation, a supposition supported by the observation that RcsB isolated from the ackA or cobB mutant was hyperacetylated. Finally, we used a genetic approach to identify an AckA- and CobB-sensitive lysine (Lys-154) that controls RcsB activity. We propose that acetylation inhibits RcsB activity and that some of this inhibition acts through the acetylation of Lys-154. PMID:23852870

  12. NF-Y transcriptionally regulates the Drosophila p53 gene.

    PubMed

    Tue, Nguyen Trong; Yoshioka, Yasuhide; Yamaguchi, Masamitsu

    2011-02-15

    The p53 protein is important in multicellular organisms, where it regulates the cell cycle and thus functions as a tumor suppressor that contributes to preventing cancer. However, molecular regulation of p53 gene expression is not fully understood. NF-YA is a subunit of the NF-Y trimeric complex, a transcription factor that binds to CCAAT motifs in the promoter regions of a variety of genes playing key roles in cell cycle regulation. We have identified four potential Drosophila NF-Y (dNF-Y)-binding sites located in the 5'-flanking region of the Drosophila p53 (dmp53) gene. Chromatin immunoprecipitation analyses using anti-dNF-YA antibodies confirmed that dNF-YA binds specifically to the genomic region containing CCAAT boxes in the dmp53 gene promoter in vivo. Furthermore, the thorax disclosed phenotype of dNF-YA knockdown flies can be enhanced by dmp53 mutation. In addition, the level of dmp53 mRNA was found to be decreased in the dNF-YA knockdown cells and transient expression of the luciferase gene revealed that wild-type dmp53 gene promoter activity is much stronger than mutated promoter activity in S2 cells. The requirement of CCAAT boxes for dmp53 promoter activity was further confirmed by expression of EGFP in various tissues from transgenic flies carrying wild-type and CCAAT box-mutated versions of dmp53 promoter-GFP fusion genes. These results taken together indicate that dNF-Y is necessary for dmp53 gene promoter activity.

  13. Self-regulation and Beyond: Affect Regulation and the Infant–Caregiver Dyad

    PubMed Central

    Taipale, Joona

    2016-01-01

    In the available psychological literature, affect regulation is fundamentally considered in terms of self-regulation, and according to this standard picture, the contribution of other people in our affect regulation has been viewed in terms of socially assisted self-regulation. The present article challenges this standard picture. By focusing on affect regulation as it unfolds in early infancy, it will be argued that instead of being something original and fundamental, self-regulation developmentally emerges from the basis of a further type of affect regulation. While infants’ capacities in recognizing, understanding, and modifying their own affective states are initially immature and undeveloped, affect regulation is initially managed by the other: it is initially the self, and not the other, that plays the role of an assistant in affect regulation. To capture this phenomenon, the concepts of “auto-matic,” “hetero-matic,” and “altero-matic” affect regulation will be introduced and their interrelations elaborated. By showing how the capacity of affective self-regulation, which is characteristic to maturity, is developmentally achieved by internalizing regulative functions that, at the outset of development, are managed by the caregiver, it will be argued that altero-matic affect regulation is an autonomous type of affect regulation and the developmental basis for self-regulation. PMID:27378984

  14. The transcription factor GATA-6 regulates pathological cardiac hypertrophy

    PubMed Central

    van Berlo, Jop H.; Elrod, John W.; van den Hoogenhof, Maarten M.G.; York, Allen J.; Aronow, Bruce J.; Duncan, Stephen A.; Molkentin, Jeffery D.

    2010-01-01

    Rationale The transcriptional code that programs maladaptive cardiac hypertrophy involves the zinc finger-containing DNA binding factor GATA-4. The highly related transcription factor GATA-6 is also expressed in the adult heart, although its role in controlling the hypertrophic program is unknown. Objective To determine the role of GATA-6 in cardiac hypertrophy and homeostasis. Methods and Results Here we performed a cardiomyocyte-specific conditional gene targeting approach for Gata6, as well as a transgenic approach to overexpress GATA-6 in the mouse heart. Deletion of Gata6-loxP with Nkx2.5-cre produced late embryonic lethality with heart defects, while deletion with β-myosin heavy chain-cre (βMHC-cre) produced viable adults with greater than 95% loss of GATA-6 protein in the heart. These later mice were subjected to pressure overload induced hypertrophy for 2 and 6 weeks, which showed a significant reduction in cardiac hypertrophy similar to that observed Gata4 heart-specific deleted mice. Gata6-deleted mice subjected to pressure overload also developed heart failure while control mice maintained proper cardiac function. Gata6-deleted mice also developed less cardiac hypertrophy following 2 weeks of angiotensin II/phenylephrine infusion. Controlled GATA-6 overexpression in the heart induced hypertrophy with aging and predisposed to greater hypertrophy with pressure overload stimulation. Combinatorial deletion of Gata4 and Gata6 from the adult heart resulted in dilated cardiomyopathy and lethality by 16 weeks of age. Mechanistically, deletion of Gata6 from the heart resulted in fundamental changes in the levels of key regulatory genes and myocyte differentiation-specific genes. Conclusions These results indicate that GATA-6 is both necessary and sufficient for regulating the cardiac hypertrophic response and differentiated gene expression, both alone and in coordination with GATA-4. PMID:20705924

  15. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    PubMed Central

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  16. Characterization of VIP1 activity as a transcriptional regulator in vitro and in planta

    PubMed Central

    Lacroix, Benoît; Citovsky, Vitaly

    2013-01-01

    VIP1 (VirE2 interacting protein 1), initially discovered as a host protein involved in Agrobacterium-plant cell DNA transfer, is a transcription factor of the basic leucine-zipper (bZIP) domain family that regulates several defence-related genes in Arabidopsis. We have developed assays to assess VIP1 binding to its DNA target in vitro and transcriptional activation efficiency in planta. Several point mutations in the VIP1 response element VRE affected the VIP1 activity, and a strong correlation between VIP1-VRE binding and transcriptional activation levels was observed. Promoter activation by VIP1 was influenced by bacterial and plant proteins known to interact with VIP1 during Agrobacterium infection, i.e., VirE2, VirF and VIP2. VirF, an F-box protein, strongly decreased VIP1 transcriptional activation ability, but not its binding to VRE in vitro, most likely by triggering proteasomal degradation of VIP1. Finally, activation of a VRE-containing promoter was observed in dividing cells, probably resulting from activation of endogenous VIP1. PMID:23942522

  17. Inflammation-induced up-regulation of hepcidin and down-regulation of ferroportin transcription are dependent on macrophage polarization.

    PubMed

    Agoro, Rafiou; Mura, Catherine

    2016-10-01

    Iron is essential in all organisms. In mammals systemic iron homeostasis relies on hepcidin, a peptide hormone with defensin properties, and its target, the cell iron exporter ferroportin. Hepcidin and ferroportin transcription are both upregulated by high iron levels, but are inversely regulated upon inflammation, leading to hypoferremia. Thus, host iron genes regulation may affect the innate immune responses against infectious microorganisms. Since macrophages, which are crucial innate immune cells, express both hepcidin and ferroportin, we explored in these cells their transcriptional regulation upon inflammation which is not completely understood. Macrophages represent an heterogenous population of immune cells resulting from cytokine and pathogen sensing, indeed macrophages polarized especially into pro-inflammatory M1 and regulatory/anti-inflammatory M2 phenotypes. We found that hepcidin mRNA upregulation depends on M1 polarization and ferroportin mRNA downregulation depends on M2 subtype polarization. All TLR agonists, except TLR2 agonist, polarize to pro-inflammatory macrophages and upregulate hepcidin mRNA expression. Cell pretreatment with IFNγ or inhibitor of PI3K, p38-MAPK and NF-κB pathway involved in M1 polarization prior TLR4 activation, enhanced hepcidin upregulation. Conversely, ferroportin mRNA downregulation upon inflammation was strongly increased by macrophage polarization through TLR2- and 4-PI3K-dependent pathways, or through IL-1β and TNFα priming prior to LPS activation. PMID:27667162

  18. Inflammation-induced up-regulation of hepcidin and down-regulation of ferroportin transcription are dependent on macrophage polarization.

    PubMed

    Agoro, Rafiou; Mura, Catherine

    2016-10-01

    Iron is essential in all organisms. In mammals systemic iron homeostasis relies on hepcidin, a peptide hormone with defensin properties, and its target, the cell iron exporter ferroportin. Hepcidin and ferroportin transcription are both upregulated by high iron levels, but are inversely regulated upon inflammation, leading to hypoferremia. Thus, host iron genes regulation may affect the innate immune responses against infectious microorganisms. Since macrophages, which are crucial innate immune cells, express both hepcidin and ferroportin, we explored in these cells their transcriptional regulation upon inflammation which is not completely understood. Macrophages represent an heterogenous population of immune cells resulting from cytokine and pathogen sensing, indeed macrophages polarized especially into pro-inflammatory M1 and regulatory/anti-inflammatory M2 phenotypes. We found that hepcidin mRNA upregulation depends on M1 polarization and ferroportin mRNA downregulation depends on M2 subtype polarization. All TLR agonists, except TLR2 agonist, polarize to pro-inflammatory macrophages and upregulate hepcidin mRNA expression. Cell pretreatment with IFNγ or inhibitor of PI3K, p38-MAPK and NF-κB pathway involved in M1 polarization prior TLR4 activation, enhanced hepcidin upregulation. Conversely, ferroportin mRNA downregulation upon inflammation was strongly increased by macrophage polarization through TLR2- and 4-PI3K-dependent pathways, or through IL-1β and TNFα priming prior to LPS activation.

  19. Herpes simplex virus type 1 protein IE63 affects the nuclear export of virus intron-containing transcripts.

    PubMed Central

    Phelan, A; Dunlop, J; Clements, J B

    1996-01-01

    Using in situ hybridization labelling methods, we have determined that the herpes simplex virus type 1 immediate-early protein IE63 (ICP27) affects the cellular localization of virus transcripts. Intronless transcripts from the IE63, UL38, and UL44 genes are rapidly exported to and accumulate in the cytoplasm throughout infection, in either the presence or absence of IE63 expression. The intron-containing transcripts from the IE110 and UL15 genes, while initially cytoplasmic, are increasingly retained in the nucleus in distinct clumps as infection proceeds, and the clumps colocalize with the redistributed small nuclear ribonucleoprotein particles. Infections with the IE63 mutant virus 27-lacZ demonstrated that in the absence of IE63 expression, nuclear retention of intron-containing transcripts was lost. The nuclear retention of UL15 transcripts, which demonstrated both nuclear and cytoplasmic label, was not as pronounced as that of the IE110 transcripts, and we propose that this is due to the late expression of UL15. Infections with the mutant virus 110C1, in which both introns of IE110 have been precisely removed (R.D. Everett, J. Gen. Virol. 72:651-659, 1991), demonstrated IE110 transcripts in both the nucleus and the cytoplasm; thus, exon definition sequences which regulate viral RNA transport are present in the IE110 transcript. By in situ hybridization a stable population of polyadenylated RNAs was found to accumulate in the nucleus in spots, most of which were separate from the small nuclear ribonucleoprotein particle clumps. The IE63 protein has an involvement, either direct or indirect, in the regulation of nucleocytoplasmic transport of viral transcripts, a function which contrasts with the recently proposed role of herpes simplex virus type 1 Us11 in promoting the nuclear export of partially spliced or unspliced transcripts (J.-J. Diaz, M. Duc Dodon, N. Schaerer-Uthurraly, D. Simonin, K. Kindbeiter, L. Gazzolo, and J.-J. Madjar, Nature [London] 379

  20. DksA and ppGpp Directly Regulate Transcription of the Escherichia coli Flagellar Cascade

    PubMed Central

    Lemke, Justin J.; Durfee, Tim; Gourse, Richard L.

    2009-01-01

    The components of the Escherichia coli flagella apparatus are synthesized in a three-level transcriptional cascade activated by the master regulator FlhDC. The cascade coordinates the synthesis rates of a large number of gene products with each other and with nutritional conditions. Recent genome-wide studies have reported that flagellar transcription is altered in cells lacking the transcription regulators DksA or ppGpp, but some or all reported effects could be indirect, and some are contradictory. We report here that the activities of promoters at all three levels of the cascade are much higher in strains lacking dksA, resulting in overproduction of flagellin and hyperflagellated cells. In vitro, DksA/ppGpp inhibits the flhDC promoter and the σ70-dependent fliA promoter transcribing the gene for σ28. However, DksA and ppGpp do not affect the σ28-dependent fliA promoter or the σ28-dependent fliC promoter in vitro, suggesting that the dramatic effects on expression of those genes in vivo are mediated indirectly through direct effects of DksA/ppGpp on FlhDC and σ28 expression. We conclude that DksA/ppGpp inhibits expression of the flagellar cascade during stationary phase and following starvation, thereby coordinating flagella and ribosome assembly and preventing expenditure of scarce energy resources on synthesis of two of the cell’s largest macromolecular complexes. PMID:19889089

  1. Dual regulation of the {delta}Np63 transcriptional activity by {delta}Np63 in human nasopharyngeal carcinoma cell

    SciTech Connect

    Chu, W.-K.; Lee, K.-C.; Chow, S.-E.; Chen, J.-K. . E-mail: jkc508@mail.cgu.edu.tw

    2006-04-21

    p63 splicing variants lacking NH{sub 2}-terminal transactivating domain, known as {delta}Np63, are thought to antagonize p53 and p63 functions and are suggested to play roles in keratinocyte differentiation. Here, we show that {delta}Np63 has a dual-regulatory effect on the activity of its own promoter in NPC-076 cell. Down-regulation of the transcriptional activity is observed when {delta}Np63 is present in low levels. In contrast, up-regulation of {delta}Np63 transcriptional activity is observed when {delta}Np63 is expressed at higher levels. The down-regulation effect is abolished when the p53-binding site of the {delta}Np63 promoter is mutated. In sharp contrast, similar mutation does not affect the up-regulation of the {delta}Np63 transcriptional activity under the same experimental conditions. Further study shows that the up-regulation is correlated with the activation of the STAT3, as the blockade of STAT3 nuclear translocation abolishes the up-regulation by {delta}Np63. Thus, {delta}Np63 exerts a bidirectional regulation of the {delta}Np63 transcriptional activity in NPC-076 cell.

  2. The Forkhead Transcription Factor FOXK2 Promotes AP-1-Mediated Transcriptional Regulation

    PubMed Central

    Ji, Zongling; Donaldson, Ian J.; Liu, Jingru; Hayes, Andrew; Zeef, Leo A. H.

    2012-01-01

    The transcriptional control circuitry in eukaryotic cells is complex and is orchestrated by combinatorially acting transcription factors. Forkhead transcription factors often function in concert with heterotypic transcription factors to specify distinct transcriptional programs. Here, we demonstrate that FOXK2 participates in combinatorial transcriptional control with the AP-1 transcription factor. FOXK2 binding regions are widespread throughout the genome and are often coassociated with AP-1 binding motifs. FOXK2 acts to promote AP-1-dependent gene expression changes in response to activation of the AP-1 pathway. In this context, FOXK2 is required for the efficient recruitment of AP-1 to chromatin. Thus, we have uncovered an important new molecular mechanism that controls AP-1-dependent gene expression. PMID:22083952

  3. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.

    PubMed

    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent

    2016-01-15

    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context. PMID:26456102

  4. CTCF regulates NELF, DSIF and P-TEFb recruitment during transcription.

    PubMed

    Laitem, Clélia; Zaborowska, Justyna; Tellier, Michael; Yamaguchi, Yuki; Cao, Qingfu; Egloff, Sylvain; Handa, Hiroshi; Murphy, Shona

    2015-01-01

    CTCF is a versatile transcription factor with well-established roles in chromatin organization and insulator function. Recent findings also implicate CTCF in the control of elongation by RNA polymerase (RNAP) II. Here we show that CTCF knockdown abrogates RNAP II pausing at the early elongation checkpoint of c-myc by affecting recruitment of DRB-sensitivity-inducing factor (DSIF). CTCF knockdown also causes a termination defect on the U2 snRNA genes (U2), by affecting recruitment of negative elongation factor (NELF). In addition, CTCF is required for recruitment of positive elongation factor b (P-TEFb), which phosphorylates NELF, DSIF, and Ser2 of the RNAP II CTD to activate elongation of transcription of c-myc and recognition of the snRNA gene-specific 3' box RNA processing signal. These findings implicate CTCF in a complex network of protein:protein/protein:DNA interactions and assign a key role to CTCF in controlling RNAP II transcription through the elongation checkpoint of the protein-coding c-myc and the termination site of the non-coding U2, by regulating the recruitment and/or activity of key players in these processes.

  5. Transcription factors and regulation of photosynthetic and related metabolism under environmental stresses

    PubMed Central

    Saibo, Nelson J. M.; Lourenço, Tiago; Oliveira, Maria Margarida

    2009-01-01

    Background Environmental conditions, such as water supply, temperature and salinity, strongly affect plant growth and development. Extremes of these conditions (abiotic stresses) adversely affect many different mechanisms associated with plant responses and adaptation to stress: photosynthetic mechanisms, e.g. stomatal control of CO2 diffusion, photosystem II repair, ribulose bisphosphate carboxylase/oxygenase (Rubisco) activity and scavenging of reactive oxygen species (ROS), are susceptible to damage, and photosynthetic efficiency can be greatly decreased. Responses and adaptations require differential gene expression, which is regulated by specific transcription factors (TFs). Scope The role and regulation of several TFs involved in abiotic stress response pathways are considered, with emphasis on new findings regarding expression of genes related to both stomatal and non-stomatal limitations to CO2 photosynthetic assimilation. Conclusions Many TFs, belonging to different families (e.g. MYB, bZIP and DREB), have been related to abiotic stress responses; however, only a few are known to regulate the expression of photosynthesis-related genes in response to stress. Several TFs belonging to the MYB family play an important role in both stomatal and non-stomatal responses by regulation of stomatal numbers and sizes, and metabolic components, respectively. To obtain more insight into this area of potentially large agronomic impact, it is essential to identify and functionally characterize new TFs that mediate the stress responses regulating the expression of genes associated with photosynthesis and related metabolism. PMID:19010801

  6. DNA sequences affecting specific initiation of transcription in vitro from the EIII promoter of adenovirus 2.

    PubMed Central

    Lee, D C; Roeder, R G; Wold, W S

    1982-01-01

    We have identified those sequences affecting the level of specific initiation of transcription in vitro from the EIII promoter of adenovirus 2. Mutants containing deletions in and around the initiation sites were constructed in cloned viral DNA fragments and assayed for their ability to initiate transcription in vitro. Three classes of mutants were studied with deletions in the following regions: -38 to -268, -21 to -71 (which includes the T-A-T-A-A box), and -29 through the cap sites (+1 and +3). Deletions that remove some or all of the area from -28 to several nucleotides downstream from the cap sites essentially abolished specific transcription. Small deletions in the region -30 to -41 reduced transcription to approximately 60% of wild type; larger deletions in the region -35 to -268 reduced transcription to 30-40% of wild type. Deletions beginning from approximately +10 to +25 and extending further downstream reduced transcription to 20-40% of wild type, whereas a deletion beginning at +31 had little or no effect. Our results suggest that the region including the T-A-T-A-A box and extending to the area immediately beyond the cap sites is essential for specific transcription in vitro from the EIII promoter. However, sequences upstream from the T-A-T-A-A box and those downstream from the cap sites appear to significantly modulate the levels of transcription. Images PMID:6275389

  7. Transcription antitermination regulation of the Pseudomonas aeruginosa amidase operon.

    PubMed Central

    Wilson, S A; Wachira, S J; Norman, R A; Pearl, L H; Drew, R E

    1996-01-01

    In vivo titration experiments have demonstrated a direct interaction between the Pseudomonas aeruginosa transcription antiterminator, AmiR, and the mRNA leader sequence of the amidase operon. A region of 39 nucleotides has been identified which is sufficient to partially titrate out the AmiR available for antitermination. Site-directed mutagenesis has shown that the leader open reading frame has no role in the antitermination reaction, and has identified two critical elements at the 5' and 3' ends of the proposed AmiR binding site which are independently essential for antitermination. A T7 promoter/RNA polymerase-driven system shows AmiR-mediated antitermination, demonstrating a lack of promoter/polymerase specificity. Using the operon negative regulator, AmiC, immobilized on a solid support and gel filtration chromatography, an AmiC-AmiR complex has been identified and isolated. Complex stability and molecular weight assayed by gel filtration alter depending on the type of amide bound to AmiC. AmiC-AmiR-anti-inducer is a stable dimer-dimer complex and the addition of the inducer, acetamide, causes a conformational change which alters the complex stability and either this new configuration or dissociated AmiR interacts with the leader mRNA to cause antitermination. Images PMID:8918468

  8. Metabolic Context Regulates Distinct Hypothalamic Transcriptional Responses to Antiaging Interventions

    PubMed Central

    Stranahan, Alexis M.; Martin, Bronwen; Chadwick, Wayne; Park, Sung-Soo; Wang, Liyun; Becker, Kevin G.; WoodIII, William H.; Zhang, Yongqing; Maudsley, Stuart

    2012-01-01

    The hypothalamus is an essential relay in the neural circuitry underlying energy metabolism that needs to continually adapt to changes in the energetic environment. The neuroendocrine control of food intake and energy expenditure is associated with, and likely dependent upon, hypothalamic plasticity. Severe disturbances in energy metabolism, such as those that occur in obesity, are therefore likely to be associated with disruption of hypothalamic transcriptomic plasticity. In this paper, we investigated the effects of two well-characterized antiaging interventions, caloric restriction and voluntary wheel running, in two distinct physiological paradigms, that is, diabetic (db/db) and nondiabetic wild-type (C57/Bl/6) animals to investigate the contextual sensitivity of hypothalamic transcriptomic responses. We found that, both quantitatively and qualitatively, caloric restriction and physical exercise were associated with distinct transcriptional signatures that differed significantly between diabetic and non-diabetic mice. This suggests that challenges to metabolic homeostasis regulate distinct hypothalamic gene sets in diabetic and non-diabetic animals. A greater understanding of how genetic background contributes to hypothalamic response mechanisms could pave the way for the development of more nuanced therapeutics for the treatment of metabolic disorders that occur in diverse physiological backgrounds. PMID:22934110

  9. Transcriptional regulation of cytokine function in airway smooth muscle cells

    PubMed Central

    Clarke, Deborah; Damera, Gautam; Sukkar, Maria B.; Tliba, Omar

    2009-01-01

    The immuno-modulatory properties of airway smooth muscle have become of increasing importance in our understanding of the mechanisms underlying chronic inflammation and structural remodeling of the airway wall in asthma and chronic obstructive pulmonary disease (COPD). ASM cells respond to many cytokines, growth factors and lipid mediators to produce a wide array of immuno-modulatory molecules which may in turn orchestrate and perpetuate the disease process in asthma and COPD. Despite numerous studies of the cellular effects of cytokines on cultured ASM, few have identified intracellular signaling pathways by which cytokines modulate or induce these cellular responses. In this review we provide an overview of the transcriptional mechanisms as well as intracellular signaling pathways regulating cytokine functions in ASM cells. The recent discovery of toll-like receptors in ASM cells represents a significant development in our understanding of the immuno-modulatory capabilities of ASM cells. Thus, we also review emerging evidence of the inflammatory response to toll-like receptor activation in ASM cells. PMID:19393330

  10. Myelin inhibits oligodendroglial maturation and regulates oligodendrocytic transcription factor expression.

    PubMed

    Plemel, Jason R; Manesh, Sohrab B; Sparling, Joseph S; Tetzlaff, Wolfram

    2013-09-01

    Myelin loss is a hallmark of multiple sclerosis (MS) and promoting central nervous system myelin repair has become a major therapeutic target. Despite the presence of oligodendrocytes precursors cells (OPCs) in chronic lesions of MS, remyelination often fails. The mechanism underlying this failure of remyelination remains unknown, but it is hypothesized that environmental cues act to inhibit the maturation/differentiation of oligodendroglia, preventing remyelination. The rate of CNS remyelination is correlated to the speed of phagocytosis of myelin debris, which is present following demyelination and trauma. Thus, myelin debris could inhibit CNS remyelination. Here, we demonstrate that OPCs cultured on myelin were robustly inhibited in their maturation, as characterized by the decreased expression of immature and mature oligodendrocytes markers, the impaired production of myelin gene products, as well as their stalled morphological complexity relative to OPCs cultured on a control substrate. OPCs in contact with myelin stopped proliferating and decreased the expression of OPC markers to a comparable degree as cells grown on a control substrate. The expression of two transcription factors known to prevent OPC differentiation and maturation were increased in cells that were in contact with myelin: inhibitor of differentiation family (ID) members 2 and 4. Overexpression of ID2 and ID4 in OPCs was previously reported to decrease the percentage of cells expressing mature oligodendrocyte markers. However, knockdown of ID2 and/or ID4 in OPCs did not increase oligodendroglial maturation on or off of myelin, suggesting that contact with myelin regulates additional regulatory elements.

  11. Transcriptional regulation of bialaphos biosynthesis in Streptomyces hygroscopicus.

    PubMed Central

    Anzai, H; Murakami, T; Imai, S; Satoh, A; Nagaoka, K; Thompson, C J

    1987-01-01

    A DNA sequence (brpA) which regulates the expression of the genes of the bialaphos biosynthesis pathway (bap) in Streptomyces hygroscopicus was identified and characterized. A newly isolated nonproducing mutant (NP57) had a pleiotropic defect involving at least 6 of the 13 known bap genes; only the step 6 conversion could be detected. NP57 was more sensitive to bialaphos than its parent and had depressed levels of the demethylphosphinothricin acetyltransferase activity (step 10 in the pathway) which confers bialaphos resistance. Sodium dodecyl sulfate-polyacrylamide gel electrophoretic analysis of extracts of this mutant showed that it lacked proteins corresponding to steps 5 and 10. NP57 lacked mRNAs for steps 5, 10, and 13. Bialaphos productivity of NP57 was restored by transformation with a plasmid containing a 5.9-kilobase DNA fragment which was adjacent to the structural gene cluster. Subcloning experiments showed that a 1.3-kilobase fragment from this primary clone restored all the defects of NP57. We conclude that brpA can activate the transcription of the bialaphos resistance gene as well as at least six other bap structural genes. Images PMID:3611020

  12. Analysis of the transcriptional promoter which regulates the latency-related transcript of bovine herpesvirus 1.

    PubMed

    Jones, C; Delhon, G; Bratanich, A; Kutish, G; Rock, D

    1990-03-01

    As a transcriptional promoter in primary cultures of sensory ganglionic neurons, DNA sequences near the 5' terminus of the latency-related (LR) gene of bovine herpesvirus 1 were at least 10 times more efficient than the simian virus 40 early promoter-enhancer. In contrast, as a promoter in bovine, rodent, or monkey cells, the LR promoter was approximately six times less efficient than the simian virus 40 early promoter-enhancer. The LR promoter had strict orientation preferences in neurons and all other mammalian cell lines tested. Removal of a 146-base-pair XhoI fragment from the LR promoter resulted in stimulation of LR promoter activity in bovine cells but not rabbit neurons, monkey fibroblasts, or rodent cells. LR promoter activity in bovine cells is stimulated by bovine herpesvirus 1 lytic infection, suggesting that viral gene products or virus-induced factors positively regulate the expression of the LR gene. A synthetic glucocorticoid, dexamethasone, repressed LR promoter activity in bovine cells. These results imply that a variety of factors can influence the expression of the LR gene during latent infections of neurons as well as during the lytic infection cycle.

  13. The transcription factor AREB1 regulates primary metabolic pathways in tomato fruits

    PubMed Central

    Bastías, Adriana; Osorio, Sonia; Casaretto, José A.

    2014-01-01

    Tomato fruit development is regulated both by the action of plant hormones and by tight genetic control. Recent studies suggest that abscisic acid (ABA) signalling may affect different aspects of fruit maturation. Previously, it was shown that SlAREB1, an ABA-regulated transcription factor involved in stress-induced responses, is expressed in seeds and in fruit tissues in tomato. Here, the role of SlAREB1 in regulating the expression of genes relevant for primary metabolic pathways and affecting the metabolic profile of the fruit was investigated using transgenic tomato lines. Metabolite profiling using gas chromatography–time of flight mass spectrometry (GC-TOF-MS) and non-targeted liquid chromatography–mass spectrometry (LC-MS) was performed on pericarp tissue from fruits harvested at three stages of fruit development. Principal component analysis of the data could distinguish the metabolite profiles of non-transgenic fruits from those that overexpress and down-regulate SlAREB1. Overexpression of SlAREB1 resulted in increased content of organic acids, hexoses, hexose-phosphates, and amino acids in immature green, mature green, and red ripe fruits, and these modifications correlated with the up-regulation of enzyme-encoding genes involved in primary carbohydrate and amino acid metabolism. A non-targeted LC-MS analysis indicated that the composition of secondary metabolites is also affected in transgenic lines. In addition, gene expression data revealed that some genes associated with fruit ripening are also up-regulated in SlAREB1-overexpressing lines compared with wild-type and antisense lines. Taken together, the results suggest that SlAREB1 participates in the regulation of the metabolic programming that takes place during fruit ripening and that may explain part of the role of ABA in fruit development in tomato. PMID:24659489

  14. The transcription factor AREB1 regulates primary metabolic pathways in tomato fruits.

    PubMed

    Bastías, Adriana; Yañez, Mónica; Osorio, Sonia; Arbona, Vicent; Gómez-Cadenas, Aurelio; Fernie, Alisdair R; Casaretto, José A

    2014-06-01

    Tomato fruit development is regulated both by the action of plant hormones and by tight genetic control. Recent studies suggest that abscisic acid (ABA) signalling may affect different aspects of fruit maturation. Previously, it was shown that SlAREB1, an ABA-regulated transcription factor involved in stress-induced responses, is expressed in seeds and in fruit tissues in tomato. Here, the role of SlAREB1 in regulating the expression of genes relevant for primary metabolic pathways and affecting the metabolic profile of the fruit was investigated using transgenic tomato lines. Metabolite profiling using gas chromatography-time of flight mass spectrometry (GC-TOF-MS) and non-targeted liquid chromatography-mass spectrometry (LC-MS) was performed on pericarp tissue from fruits harvested at three stages of fruit development. Principal component analysis of the data could distinguish the metabolite profiles of non-transgenic fruits from those that overexpress and down-regulate SlAREB1. Overexpression of SlAREB1 resulted in increased content of organic acids, hexoses, hexose-phosphates, and amino acids in immature green, mature green, and red ripe fruits, and these modifications correlated with the up-regulation of enzyme-encoding genes involved in primary carbohydrate and amino acid metabolism. A non-targeted LC-MS analysis indicated that the composition of secondary metabolites is also affected in transgenic lines. In addition, gene expression data revealed that some genes associated with fruit ripening are also up-regulated in SlAREB1-overexpressing lines compared with wild-type and antisense lines. Taken together, the results suggest that SlAREB1 participates in the regulation of the metabolic programming that takes place during fruit ripening and that may explain part of the role of ABA in fruit development in tomato.

  15. Transcriptional Regulation in Mammalian Cells by Sequence-Specific DNA Binding Proteins

    NASA Astrophysics Data System (ADS)

    Mitchell, Pamela J.; Tjian, Robert

    1989-07-01

    The cloning of genes encoding mammalian DNA binding transcription factors for RNA polymerase II has provided the opportunity to analyze the structure and function of these proteins. This review summarizes recent studies that define structural domains for DNA binding and transcriptional activation functions in sequence-specific transcription factors. The mechanisms by which these factors may activate transcriptional initiation and by which they may be regulated to achieve differential gene expression are also discussed.

  16. Protein Inhibitors of Activated STAT (Pias1 and Piasy) Differentially Regulate Pituitary Homeobox 2 (PITX2) Transcriptional Activity*

    PubMed Central

    Wang, Jianbo; Sun, Zhao; Zhang, Zichao; Saadi, Irfan; Wang, Jun; Li, Xiao; Gao, Shan; Engle, Jamison J.; Kuburas, Adisa; Fu, Xueyao; Yu, Wenjie; Klein, William H.; Russo, Andrew F.; Amendt, Brad A.

    2013-01-01

    Protein inhibitors of activated STAT (Pias) proteins can act independent of sumoylation to modulate the activity of transcription factors and Pias proteins interacting with transcription factors can either activate or repress their activity. Pias proteins are expressed in many tissues and cells during development and we asked if Pias proteins regulated the pituitary homeobox 2 (PITX2) homeodomain protein, which modulates developmental gene expression. Piasy and Pias1 proteins are expressed during craniofacial/tooth development and directly interact and differentially regulate PITX2 transcriptional activity. Piasy and Pias1 are co-expressed in craniofacial tissues with PITX2. Yeast two-hybrid, co-immunoprecipitation and pulldown experiments demonstrate Piasy and Pias1 interactions with the PITX2 protein. Piasy interacts with the PITX2 C-terminal tail to attenuate its transcriptional activity. In contrast, Pias1 interacts with the PITX2 C-terminal tail to increase PITX2 transcriptional activity. The E3 ligase activity associated with the RING domain in Piasy is not required for the attenuation of PITX2 activity, however, the RING domain of Pias1 is required for enhanced PITX2 transcriptional activity. Bimolecular fluorescence complementation assays reveal PITX2 interactions with Piasy and Pias1 in the nucleus. Piasy represses the synergistic activation of PITX2 with interacting co-factors and Piasy represses Pias1 activation of PITX2 transcriptional activity. In contrast, Pias1 did not affect the synergistic interaction of PITX2 with transcriptional co-factors. Last, we demonstrate that Pias proteins form a complex with PITX2 and Lef-1, and PITX2 and β-catenin. Lef-1, β-catenin, and Pias interactions with PITX2 provide new molecular mechanisms for the regulation of PITX2 transcriptional activity and the activity of Pias proteins. PMID:23515314

  17. Affect regulation and HIV risk among youth in therapeutic schools

    PubMed Central

    Brown, Larry K.; Houck, Christopher; Lescano, Celia; Donenberg, Geri; Tolou-Shams, Marina; Mello, Justin

    2012-01-01

    The acquisition of affect regulation skills is often impaired or delayed in youth with mental health problems but the relationship between affect dysregulation and risk behaviors has not been well studied. Baseline data from adolescents (N =418; ages 13–19) recruited from therapeutic school settings examined the relationship between affect dysregulation, substance use, self-cutting, and sexual risk behavior. Analyses of covariance demonstrated that adolescents who did not use condoms at last sex, ever self-cut, attempted suicide, used alcohol and other drugs and reported less condom use self-efficacy when emotionally aroused were significantly more likely (p < .01) to report greater difficulty with affect regulation than peers who did not exhibit these behaviors. General patterns of difficulty with affect regulation may be linked to HIV risk behavior, including condom use at last sex. HIV prevention strategies for youth in mental health treatment should target affect regulation in relation to multiple risk behaviors. PMID:22669595

  18. Atrophy, hypertrophy, and hypoxemia induce transcriptional regulators of the ubiquitin proteasome system in the rat heart

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle, transcript levels of proteins regulating the ubiquitin proteasome system (UPS) increase with atrophy and decrease with hypertrophy. Whether the same is true for heart muscle is not known. We set out to characterize the transcriptional profile of regulators of the UPS during atrop...

  19. The PhoP transcription factor negatively regulates avermectin biosynthesis in Streptomyces avermitilis.

    PubMed

    Yang, Renjun; Liu, Xingchao; Wen, Ying; Song, Yuan; Chen, Zhi; Li, Jilun

    2015-12-01

    Bacteria sense and respond to the stress of phosphate limitation, anticipating Pi deletion/starvation via the two-component PhoR-PhoP system. The role of the response regulator PhoP in primary metabolism and avermectin biosynthesis in Streptomyces avermitilis was investigated. In response to phosphate starvation, S. avermitilis PhoP, like Streptomyces coelicolor and Streptomyces lividans PhoP, activates the expression of phoRP, phoU, and pstS by binding to the PHO boxes in their promoter regions. Avermectin biosynthesis was significantly increased in ΔphoP deletion mutants. Electrophoretic mobility gel shift assay (EMSA) and DNase I footprinting assays showed that PhoP can bind to a PHO box formed by two direct repeat units of 11 nucleotides located downstream of the transcriptional start site of aveR. By negatively regulating the transcription of aveR, PhoP directly affects avermectin biosynthesis in S. avermitilis. PhoP indirectly affects melanogenesis on Casaminoacids Minimal Medium (MMC) lacking supplemental phosphate. Nitrogen metabolism and some key genes involved in morphological differentiation and antibiotic production in S. avermitilis are also under the control of PhoP.

  20. The PhoP transcription factor negatively regulates avermectin biosynthesis in Streptomyces avermitilis.

    PubMed

    Yang, Renjun; Liu, Xingchao; Wen, Ying; Song, Yuan; Chen, Zhi; Li, Jilun

    2015-12-01

    Bacteria sense and respond to the stress of phosphate limitation, anticipating Pi deletion/starvation via the two-component PhoR-PhoP system. The role of the response regulator PhoP in primary metabolism and avermectin biosynthesis in Streptomyces avermitilis was investigated. In response to phosphate starvation, S. avermitilis PhoP, like Streptomyces coelicolor and Streptomyces lividans PhoP, activates the expression of phoRP, phoU, and pstS by binding to the PHO boxes in their promoter regions. Avermectin biosynthesis was significantly increased in ΔphoP deletion mutants. Electrophoretic mobility gel shift assay (EMSA) and DNase I footprinting assays showed that PhoP can bind to a PHO box formed by two direct repeat units of 11 nucleotides located downstream of the transcriptional start site of aveR. By negatively regulating the transcription of aveR, PhoP directly affects avermectin biosynthesis in S. avermitilis. PhoP indirectly affects melanogenesis on Casaminoacids Minimal Medium (MMC) lacking supplemental phosphate. Nitrogen metabolism and some key genes involved in morphological differentiation and antibiotic production in S. avermitilis are also under the control of PhoP. PMID:26298701

  1. Plant Mediator complex and its critical functions in transcription regulation.

    PubMed

    Yang, Yan; Li, Ling; Qu, Li-Jia

    2016-02-01

    The Mediator complex is an important component of the eukaryotic transcriptional machinery. As an essential link between transcription factors and RNA polymerase II, the Mediator complex transduces diverse signals to genes involved in different pathways. The plant Mediator complex was recently purified and comprises conserved and specific subunits. It functions in concert with transcription factors to modulate various responses. In this review, we summarize the recent advances in understanding the plant Mediator complex and its diverse roles in plant growth, development, defense, non-coding RNA production, response to abiotic stresses, flowering, genomic stability and metabolic homeostasis. In addition, the transcription factors interacting with the Mediator complex are also highlighted.

  2. Prolactin regulates transcription of the ion uptake Na+/Cl- cotransporter (ncc) gene in zebrafish gill

    USGS Publications Warehouse

    Breves, Jason P.; Serizier, Sandy B.; Goffin, Vincent; McCormick, Stephen D.; Karlstrom, Rolf O.

    2013-01-01

    Prolactin (PRL) is a well-known regulator of ion and water transport within osmoregulatory tissues across vertebrate species, yet how PRL acts on some of its target tissues remains poorly understood. Using zebrafish as a model, we show that ionocytes in the gill directly respond to systemic PRL to regulate mechanisms of ion uptake. Ion-poor conditions led to increases in the expression of PRL receptor (prlra), Na+/Cl− cotransporter (ncc; slc12a10.2), Na+/H+ exchanger (nhe3b; slc9a3.2), and epithelial Ca2+ channel (ecac; trpv6) transcripts within the gill. Intraperitoneal injection of ovine PRL (oPRL) increased ncc and prlra transcripts, but did not affect nhe3b or ecac. Consistent with direct PRL action in the gill, addition of oPRL to cultured gill filaments stimulated ncc in a concentration-dependent manner, an effect blocked by a pure human PRL receptor antagonist (Δ1-9-G129R-hPRL). These results suggest that PRL signaling through PRL receptors in the gill regulates the expression of ncc, thereby linking this pituitary hormone with an effector of Cl− uptake in zebrafish for the first time.

  3. Prolactin regulates transcription of the ion uptake Na+/Cl− cotransporter (ncc) gene in zebrafish gill

    PubMed Central

    Breves, Jason P.; Serizier, Sandy B.; Goffin, Vincent; McCormick, Stephen D.; Karlstrom, Rolf O.

    2013-01-01

    Prolactin (PRL) is a well-known regulator of ion and water transport within osmoregulatory tissues across vertebrate species, yet how PRL acts on some of its target tissues remains poorly understood. Using zebrafish as a model, we show that ionocytes in the gill directly respond to systemic PRL to regulate mechanisms of ion uptake. Ion-poor conditions led to increases in the expression of PRL receptor (prlra), Na+/Cl− cotransporter (ncc; slc12a10.2), Na+/H+ exchanger (nhe3b; slc9a3.2), and epithelial Ca2+ channel (ecac; trpv6) transcripts within the gill. Intraperitoneal injection of ovine PRL (oPRL) increased ncc and prlra transcripts, but did not affect nhe3b or ecac. Consistent with direct PRL action in the gill, addition of oPRL to cultured gill filaments stimulated ncc in a concentration-dependent manner, an effect blocked by a pure human PRL receptor antagonist (Δ1-9-G129R-hPRL). These results suggest that PRL signaling through PRL receptors in the gill regulates the expression of ncc, thereby linking this pituitary hormone with an effector of Cl− uptake in zebrafish for the first time. PMID:23395804

  4. The TrmB family: a versatile group of transcriptional regulators in Archaea.

    PubMed

    Gindner, Antonia; Hausner, Winfried; Thomm, Michael

    2014-09-01

    Microbes are organisms which are well adapted to their habitat. Their survival depends on the regulation of gene expression levels in response to environmental signals. The most important step in regulation of gene expression takes place at the transcriptional level. This regulation is intriguing in Archaea because the eu-karyotic-like transcription apparatus is modulated by bacterial-like transcription regulators. The transcriptional regulator of mal operon (TrmB) family is well known as a very large group of regulators in Archaea with more than 250 members to date. One special feature of these regulators is that some of them can act as repressor, some as activator and others as both repressor and activator. This review gives a short updated overview of the TrmB family and their regulatory patterns in different Archaea as a lot of new data have been published on this topic since the last review from 2008.

  5. Capsicum annuum WRKY transcription factor d (CaWRKYd) regulates hypersensitive response and defense response upon Tobacco mosaic virus infection.

    PubMed

    Huh, Sung Un; Choi, La Mee; Lee, Gil-Je; Kim, Young Jin; Paek, Kyung-Hee

    2012-12-01

    WRKY transcription factors regulate biotic, abiotic, and developmental processes. In terms of plant defense, WRKY factors have important roles as positive and negative regulators via transcriptional regulation or protein-protein interaction. Here, we report the characterization of the gene encoding Capsicum annuum WRKY transcription factor d (CaWRKYd) isolated from microarray analysis in the Tobacco mosaic virus (TMV)-P(0)-inoculated hot pepper plants. CaWRKYd belongs to the WRKY IIa group, a very small clade in the WRKY subfamily, and WRKY IIa group has positive/negative regulatory roles in Arabidopsis and rice. CaWRKYd transcripts were induced by various plant defense-related hormone treatments and TMV-P(0) inoculation. Silencing of CaWRKYd affected TMV-P(0)-mediated hypersensitive response (HR) cell death and accumulation of TMV-P(0) coat protein in local and systemic leaves. Furthermore, expression of some pathogenesis-related (PR) genes and HR-related genes was reduced in the CaWRKYd-silenced plants compared with TRV2 vector control plants upon TMV-P(0) inoculation. CaWRKYd was confirmed to bind to the W-box. Thus CaWRKYd is a newly identified Capsicum annuum WRKY transcription factor that appears to be involved in TMV-P(0)-mediated HR cell death by regulating downstream gene expression.

  6. Carotenoid genes transcriptional regulation for astaxanthin accumulation in fresh water unicellular alga Haematococcus pluvialis by gibberellin A3 (GA3).

    PubMed

    Gao, Zhengquan; Meng, Chunxiao; Gao, Hongzheng; Li, Yan; Zhang, Xiaowen; Xu, Dong; Zhou, Shitan; Liu, Banghui; Su, Yuanfeng; Ye, Naihao

    2013-12-01

    The fresh water unicellular alga Haematococcus pluvialis is a promising natural source of astaxanthin. The present study investigated the transcriptional expression of carotenoid genes for astaxanthin accumulation in H. pluvialis using real-time fluorescence quantitative PCR (qRT-PCR). With treatments of 20 and 40 mg/L of gibberllin A3 (GA3), five genes ipi-1, ipi-2, psy, pds and bkt2 were up-regulated with different expression profiles. GA20 (20 mg/L of GA3) treatment had a greater effect on transcriptional expression of bkt2 than on ipi-1 ipi-2, psy and pds (> 4-fold up-regulation). However, GA40 (40 mg/L of GA3) induced more transcriptional expression of ipi-2, psy and bkt2 than both ipi-1 and pds. The expression of lyc, crtR-B and crtO for astaxanthin biosynthesis was not affected by GA3 in H. piuvialis. In the presence of GA3, astaxanthin biosynthesis genes of ipi-1, pds and bkt2 were up-regulated at transcriptional level, psy at post-transcriptional level, whereas ipi-2 was up-regulated at both levels. The study could potentially lead to a scale application of exogenous GA3 in astaxanthin production with H. pluvialis just like GAs perform in increasing crops production and it would provide new insight about the multifunctional roles of carotenogenesis in response to GA3. PMID:24772980

  7. Insulin post-transcriptionally modulates Bmal1 protein to affect the hepatic circadian clock

    PubMed Central

    Dang, Fabin; Sun, Xiujie; Ma, Xiang; Wu, Rong; Zhang, Deyi; Chen, Yaqiong; Xu, Qian; Wu, Yuting; Liu, Yi

    2016-01-01

    Although food availability is a potent synchronizer of the peripheral circadian clock in mammals, the underlying mechanisms are unclear. Here, we show that hepatic Bmal1, a core transcription activator of the molecular clock, is post-transcriptionally regulated by signals from insulin, an important hormone that is temporally controlled by feeding. Insulin promotes postprandial Akt-mediated Ser42-phosphorylation of Bmal1 to induce its dissociation from DNA, interaction with 14-3-3 protein and subsequently nuclear exclusion, which results in the suppression of Bmal1 transcriptional activity. Inverted feeding cycles not only shift the phase of daily insulin oscillation, but also elevate the amplitude due to food overconsumption. This enhanced and reversed insulin signalling initiates the reset of clock gene rhythms by altering Bmal1 nuclear accumulation in mouse liver. These results reveal the molecular mechanism of insulin signalling in regulating peripheral circadian rhythms. PMID:27576939

  8. Insulin post-transcriptionally modulates Bmal1 protein to affect the hepatic circadian clock.

    PubMed

    Dang, Fabin; Sun, Xiujie; Ma, Xiang; Wu, Rong; Zhang, Deyi; Chen, Yaqiong; Xu, Qian; Wu, Yuting; Liu, Yi

    2016-01-01

    Although food availability is a potent synchronizer of the peripheral circadian clock in mammals, the underlying mechanisms are unclear. Here, we show that hepatic Bmal1, a core transcription activator of the molecular clock, is post-transcriptionally regulated by signals from insulin, an important hormone that is temporally controlled by feeding. Insulin promotes postprandial Akt-mediated Ser42-phosphorylation of Bmal1 to induce its dissociation from DNA, interaction with 14-3-3 protein and subsequently nuclear exclusion, which results in the suppression of Bmal1 transcriptional activity. Inverted feeding cycles not only shift the phase of daily insulin oscillation, but also elevate the amplitude due to food overconsumption. This enhanced and reversed insulin signalling initiates the reset of clock gene rhythms by altering Bmal1 nuclear accumulation in mouse liver. These results reveal the molecular mechanism of insulin signalling in regulating peripheral circadian rhythms. PMID:27576939

  9. Beyond Transcription Factors: The Role of Chromatin Modifying Enzymes in Regulating Transcription Required for Memory

    ERIC Educational Resources Information Center

    Barrett, Ruth M.; Wood, Marcelo A.

    2008-01-01

    One of the alluring aspects of examining chromatin modifications in the role of modulating transcription required for long-term memory processes is that these modifications may provide transient and potentially stable epigenetic marks in the service of activating and/or maintaining transcriptional processes. These, in turn, may ultimately…

  10. The multifunctional transcription factor Rap1: a regulator of yeast physiology.

    PubMed

    Azad, Gajendra Kumar; Tomar, Raghuvir Singh

    2016-01-01

    Transcription is a fundamental process that is tightly regulated by transcription factors to maintain cellular homeostasis. Transcription factors have DNA-binding domains, some of which are sequence specific, and are found throughout the eukaryotic kingdom. Recent studies have revealed the molecular mechanisms by which transcription factors perform their functions. In the budding yeast Saccharomyces cerevisiae, Rap1 (ScRap1) can either activate or repress transcription. This bimodal transcriptional activity has led to the widespread study of the mode of action of ScRap1. This review summarizes current knowledge about yeast ScRap1, including its structure, mechanisms of transcription regulation, and biological functions, and the future directions in the field.

  11. Forkhead transcription factor foxe1 regulates chondrogenesis in zebrafish.

    PubMed

    Nakada, Chisako; Iida, Atsumi; Tabata, Yoko; Watanabe, Sumiko

    2009-12-15

    Forkhead transcription factor (Fox) e1 is a causative gene for Bamforth-Lazarus syndrome, which is characterized by hypothyroidism and cleft palate. Applying degenerate polymerase chain reaction using primers specific for the conserved forkhead domain, we identified zebrafish foxe1 (foxe1). Foxe1 is expressed in the thyroid, pharynx, and pharyngeal skeleton during development; strongly expressed in the gill and weakly expressed in the brain, eye, and heart in adult zebrafish. A loss of function of foxe1 by morpholino antisense oligo (MO) exhibited abnormal craniofacial development, shortening of Meckel's cartilage and the ceratohyals, and suppressed chondrycytic proliferation. However, at 27 hr post fertilization, the foxe1 MO-injected embryos showed normal dlx2, hoxa2, and hoxb2 expression, suggesting that the initial steps of pharyngeal skeletal development, including neural crest migration and specification of the pharyngeal arch occurred normally. In contrast, at 2 dpf, a severe reduction in the expression of sox9a, colIIaI, and runx2b, which play roles in chondrocytic proliferation and differentiation, was observed. Interestingly, fgfr2 was strongly upregulated in the branchial arches of the foxe1 MO-injected embryos. Unlike Foxe1-null mice, normal thyroid development in terms of morphology and thyroid-specific marker expression was observed in foxe1 MO-injected zebrafish embryos. Taken together, our results indicate that Foxe1 plays an important role in chondrogenesis during development of the pharyngeal skeleton in zebrafish, probably through regulation of fgfr2 expression. Furthermore, the roles reported for FOXE1 in mammalian thyroid development may have been acquired during evolution.

  12. Analyzing phosphorylation-dependent regulation of subcellular localization and transcriptional activity of transcriptional coactivator NT-PGC-1α.

    PubMed

    Chang, Ji Suk; Gettys, Thomas W

    2013-01-01

    Peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α) is a nuclear transcriptional coactivator that regulates the genes involved in energy metabolism. Recent evidence has been provided that alternative splicing of PPARGC1A gene produces a functional but predominantly cytosolic isoform of PGC-1α (NT-PGC-1α). We have demonstrated that transcriptional coactivation capacity of NT-PGC-1α is directly correlated with its nuclear localization in a PKA phosphorylation-dependent manner. In this chapter, we describe quantitative imaging analysis methods that are developed to measure the relative fluorescence intensity of the protein of interest in the nucleus and cytoplasm in a single cell and the frequency distribution of nuclear/cytoplasmic intensity ratios in the population of cells, respectively. This chapter also describes transient cotransfection and dual-luciferase reporter gene assay that examine the ability of coactivators to activate the transcriptional activity of transcription factors.

  13. Tor Signaling Regulates Transcription of Amino Acid Permeases through a GATA Transcription Factor Gaf1 in Fission Yeast.

    PubMed

    Ma, Yan; Ma, Ning; Liu, Qingbin; Qi, Yao; Manabe, Ri-ichiroh; Furuyashiki, Tomoyuki

    2015-01-01

    In the fission yeast, two Tor isoforms, Tor1 and Tor2, oppositely regulate gene expression of amino acid permeases. To elucidate the transcriptional machinery for these regulations, here we have employed the cap analysis of gene expression (CAGE), a method of analyzing expression profiles and identifying transcriptional start sites (TSSs). The loss of Tor1 decreased, and Tor2 inhibition by its temperature sensitive mutation increased, mRNA expression of isp5+, per1+, put4+ and SPBPB2B2.01. In contrast, the loss of Tor1 increased, and Tor2 inhibition decreased, the expression of cat1+. These changes were confirmed by semi-quantitative RT-PCR. These opposite effects by the loss of Tor1 and Tor2 inhibition appeared to occur evenly across multiple TSSs for the respective genes. The motif discovery analysis based on the CAGE results identified the GATA motifs as a potential cis-regulatory element for Tor-mediated regulation. In the luciferase reporter assay, the loss of Tor1 reduced, and Tor2 inhibition and nitrogen depletion increased, the activity of isp5+ promoter as well as that of a GATAAG reporter. One of the GATAAG motifs in isp5+ promoter was critical for its transcriptional activity, and a GATA transcription factor Gaf1 was critical for the activities of isp5+ promoter and the GATAAG reporter. Furthermore, Tor2 inhibition and nitrogen depletion induced nuclear localization of Gaf1 from the cytosol and its dephosphorylation. These results suggest that Tor2 inhibition, which is known to be induced by nitrogen depletion, promotes nuclear localization of Gaf1, thereby inducing isp5+ transcription through Gaf1 binding to the GATAAG motif in its promoter. Since Gaf1 was also critical for transcription of per1+ and put4+, Tor-Gaf1 signaling may coordinate transcription of multiple amino acid permeases according to nutrient availability.

  14. Tor Signaling Regulates Transcription of Amino Acid Permeases through a GATA Transcription Factor Gaf1 in Fission Yeast

    PubMed Central

    Liu, Qingbin; Qi, Yao; Manabe, Ri-ichiroh; Furuyashiki, Tomoyuki

    2015-01-01

    In the fission yeast, two Tor isoforms, Tor1 and Tor2, oppositely regulate gene expression of amino acid permeases. To elucidate the transcriptional machinery for these regulations, here we have employed the cap analysis of gene expression (CAGE), a method of analyzing expression profiles and identifying transcriptional start sites (TSSs). The loss of Tor1 decreased, and Tor2 inhibition by its temperature sensitive mutation increased, mRNA expression of isp5+, per1+, put4+ and SPBPB2B2.01. In contrast, the loss of Tor1 increased, and Tor2 inhibition decreased, the expression of cat1+. These changes were confirmed by semi-quantitative RT-PCR. These opposite effects by the loss of Tor1 and Tor2 inhibition appeared to occur evenly across multiple TSSs for the respective genes. The motif discovery analysis based on the CAGE results identified the GATA motifs as a potential cis-regulatory element for Tor-mediated regulation. In the luciferase reporter assay, the loss of Tor1 reduced, and Tor2 inhibition and nitrogen depletion increased, the activity of isp5+ promoter as well as that of a GATAAG reporter. One of the GATAAG motifs in isp5+ promoter was critical for its transcriptional activity, and a GATA transcription factor Gaf1 was critical for the activities of isp5+ promoter and the GATAAG reporter. Furthermore, Tor2 inhibition and nitrogen depletion induced nuclear localization of Gaf1 from the cytosol and its dephosphorylation. These results suggest that Tor2 inhibition, which is known to be induced by nitrogen depletion, promotes nuclear localization of Gaf1, thereby inducing isp5+ transcription through Gaf1 binding to the GATAAG motif in its promoter. Since Gaf1 was also critical for transcription of per1+ and put4+, Tor-Gaf1 signaling may coordinate transcription of multiple amino acid permeases according to nutrient availability. PMID:26689777

  15. A Nonlinear Discrete Dynamical Model for Transcriptional Regulation: Construction and Properties

    PubMed Central

    Goutsias, John; Kim, Seungchan

    2004-01-01

    Transcriptional regulation is a fundamental mechanism of living cells, which allows them to determine their actions and properties, by selectively choosing which proteins to express and by dynamically controlling the amounts of those proteins. In this article, we revisit the problem of mathematically modeling transcriptional regulation. First, we adopt a biologically motivated continuous model for gene transcription and mRNA translation, based on first-order rate equations, coupled with a set of nonlinear equations that model cis-regulation. Then, we view the processes of transcription and translation as being discrete, which, together with the need to use computational techniques for large-scale analysis and simulation, motivates us to model transcriptional regulation by means of a nonlinear discrete dynamical system. Classical arguments from chemical kinetics allow us to specify the nonlinearities underlying cis-regulation and to include both activators and repressors as well as the notion of regulatory modules in our formulation. We show that the steady-state behavior of the proposed discrete dynamical system is identical to that of the continuous model. We discuss several aspects of our model, related to homeostatic and epigenetic regulation as well as to Boolean networks, and elaborate on their significance. Simulations of transcriptional regulation of a hypothetical metabolic pathway illustrate several properties of our model, and demonstrate that a nonlinear discrete dynamical system may be effectively used to model transcriptional regulation in a biologically relevant way. PMID:15041638

  16. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  17. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders.

    PubMed

    Davis, Kasey N; Tao, Ran; Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C; Lipska, Barbara K; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R; Kleinman, Joel E; Hyde, Thomas M

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders. PMID:26848839

  18. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders.

    PubMed

    Davis, Kasey N; Tao, Ran; Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C; Lipska, Barbara K; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R; Kleinman, Joel E; Hyde, Thomas M

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders.

  19. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders

    PubMed Central

    Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C.; Lipska, Barbara K.; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R.; Kleinman, Joel E.; Hyde, Thomas M.

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders. PMID:26848839

  20. Genetic and Physical Interactions between Yeast Rgr1 and Sin4 in Chromatin Organization and Transcriptional Regulation

    PubMed Central

    Jiang, Y. W.; Dohrmann, P. R.; Stillman, D. J.

    1995-01-01

    The SIN4 and RGR1 genes of Saccharomyces cerevisiae were identified by mutations in quite different genetic screens. We have shown that the SIN4 gene product is required for proper transcriptional regulation of many genes and that a sin4 mutation can affect either activation or repression of specific genes. We have suggested that this dual nature of SIN4 in transcriptional regulation is due to its involvement in chromatin organization. We now report that the role of RGR1 in gene regulation is similar to that of SIN4. SIN4 and RGR1 both function as negative transcriptional regulators of HO and IME1, and mutations in either gene lead to decreased expression of other genes including CTS1. Strains with sin4 or rgr1 mutations both have phenotypes similar to those caused by histone mutations, including suppression of {delta small} insertion into promoters (Spt- phenotype), activation of promoters lacking UAS elements, and decreased superhelical density of plasmid DNA molecules. Overexpression of RGR1 suppresses the temperature sensitivity due to a sin4 mutation. Finally, we use yeast strains expressing GST fusion proteins to demonstrate that the Sin4p and Rgr1p proteins are physically associated in vivo. These results indicate that Sin4p and Rgr1p act together in vivo to organize chromatin structure and thus regulate transcription. PMID:7635307

  1. Tryptophan derivatives regulate the transcription of Oct4 in stem-like cancer cells

    PubMed Central

    Cheng, Jie; Li, Wenxin; Kang, Bo; Zhou, Yanwen; Song, Jiasheng; Dan, Songsong; Yang, Ying; Zhang, Xiaoqian; Li, Jingchao; Yin, Shengyong; Cao, Hongcui; Yao, Hangping; Zhu, Chenggang; Yi, Wen; Zhao, Qingwei; Xu, Xiaowei; Zheng, Min; Zheng, Shusen; Li, Lanjuan; Shen, Binghui; Wang, Ying-Jie

    2015-01-01

    The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that responds to environmental toxicants, is increasingly recognized as a key player in embryogenesis and tumorigenesis. Here we show that a variety of tryptophan derivatives that act as endogenous AhR ligands can affect the transcription level of the master pluripotency factor Oct4. Among them, ITE enhances the binding of the AhR to the promoter of Oct4 and suppresses its transcription. Reduction of endogenous ITE levels in cancer cells by tryptophan deprivation or hypoxia leads to Oct4 elevation, which can be reverted by administration with synthetic ITE. Consequently, synthetic ITE induces the differentiation of stem-like cancer cells and reduces their tumorigenic potential in both subcutaneous and orthotopic xenograft tumour models. Thus, our results reveal a role of tryptophan derivatives and the AhR signalling pathway in regulating cancer cell stemness and open a new therapeutic avenue to target stem-like cancer cells. PMID:26059097

  2. HPR1 encodes a global positive regulator of transcription in Saccharomyces cerevisiae.

    PubMed Central

    Zhu, Y; Peterson, C L; Christman, M F

    1995-01-01

    The Hpr1 protein has an unknown function, although it contains a region of homology to DNA topoisomerase I. We have found that hpr1 null mutants are defective in the transcription of many physiologically unrelated genes, including GAL1, HO, ADH1, and SUC2, by using a combination of Northern (RNA) blot analysis, primer extension, and upstream activation sequence-lacZ fusions. Many of the genes positively regulated by HPR1 also require SWI1, SWI2-SNF2, SWI3, SNF5, and SNF6. The transcriptional defect at HO and the CCB::lacZ upstream activation sequence in hpr1 mutants is partially suppressed by a deletion of SIN1, which encodes an HMG1p-like protein. Elevated gene dosage of either histones H3 and H4 or H2A and H2B results in a severe growth defect in combination with an hpr1 null mutation. However, increased gene dosage of all four histones simultaneously restores near-normal growth in hpr1 mutants. Altered in vivo Dam methylase sensitivity is observed at two HPR1-dependent promoters (GAL1 and SUC2). Most of the Hpr1 protein present in the cell is in a large complex (10(6) Da) that is distinct from the SWI-SNF protein complex. We propose that HPR1 affects transcription and recombination by altering chromatin structure. PMID:7862161

  3. SUMOylation regulates the transcriptional repression activity of FOG-2 and its association with GATA-4.

    PubMed

    Perdomo, José; Jiang, Xing-Mai; Carter, Daniel R; Khachigian, Levon M; Chong, Beng H

    2012-01-01

    Friend of GATA 2 (FOG-2), a co-factor of several GATA transcription factors (GATA-4, -5 and 6), is a critical regulator of coronary vessel formation and heart morphogenesis. Here we demonstrate that FOG-2 is SUMOylated and that this modification modulates its transcriptional activity. FOG-2 SUMOylation occurs at four lysine residues (K324, 471, 915, 955) [corrected]. Three of these residues are part of the characteristic SUMO consensus site (ψKXE), while K955 is found in the less frequent TKXE motif. Absence of SUMOylation did not affect FOG-2's nuclear localization. However, mutation of the FOG-2 SUMOylation sites, or de-SUMOylation, with SENP-1 or SENP-8 resulted in stronger transcriptional repression activity in both heterologous cells and cardiomyocytes. Conversely, increased FOG-2 SUMOylation by overexpression of SUMO-1 or expression of a SUMO-1-FOG-2 fusion protein rendered FOG-2 incapable of repressing GATA-4-mediated activation of the B-type natriuretic peptide (BNP) promoter. Moreover, we demonstrate both increased interaction between a FOG-2 SUMO mutant and GATA-4 and enhanced SUMOylation of wild-type FOG-2 by co-expression of GATA-4. These data suggest a new dynamics in which GATA-4 may alter the activity of FOG-2 by influencing its SUMOylation status.

  4. The MYB96 Transcription Factor Regulates Cuticular Wax Biosynthesis under Drought Conditions in Arabidopsis[W

    PubMed Central

    Seo, Pil Joon; Lee, Saet Buyl; Suh, Mi Chung; Park, Mi-Jeong; Go, Young Sam; Park, Chung-Mo

    2011-01-01

    Drought stress activates several defense responses in plants, such as stomatal closure, maintenance of root water uptake, and synthesis of osmoprotectants. Accumulating evidence suggests that deposition of cuticular waxes is also associated with plant responses to cellular dehydration. Yet, how cuticular wax biosynthesis is regulated in response to drought is unknown. We have recently reported that an Arabidopsis thaliana abscisic acid (ABA)–responsive R2R3-type MYB transcription factor, MYB96, promotes drought resistance. Here, we show that transcriptional activation of cuticular wax biosynthesis by MYB96 contributes to drought resistance. Microarray assays showed that a group of wax biosynthetic genes is upregulated in the activation-tagged myb96-1D mutant but downregulated in the MYB96-deficient myb96-1 mutant. Cuticular wax accumulation was altered accordingly in the mutants. In addition, activation of cuticular wax biosynthesis by drought and ABA requires MYB96. By contrast, biosynthesis of cutin monomers was only marginally affected in the mutants. Notably, the MYB96 protein acts as a transcriptional activator of genes encoding very-long-chain fatty acid–condensing enzymes involved in cuticular wax biosynthesis by directly binding to conserved sequence motifs present in the gene promoters. These results demonstrate that ABA-mediated MYB96 activation of cuticular wax biosynthesis serves as a drought resistance mechanism. PMID:21398568

  5. Tryptophan derivatives regulate the transcription of Oct4 in stem-like cancer cells.

    PubMed

    Cheng, Jie; Li, Wenxin; Kang, Bo; Zhou, Yanwen; Song, Jiasheng; Dan, Songsong; Yang, Ying; Zhang, Xiaoqian; Li, Jingchao; Yin, Shengyong; Cao, Hongcui; Yao, Hangping; Zhu, Chenggang; Yi, Wen; Zhao, Qingwei; Xu, Xiaowei; Zheng, Min; Zheng, Shusen; Li, Lanjuan; Shen, Binghui; Wang, Ying-Jie

    2015-06-10

    The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that responds to environmental toxicants, is increasingly recognized as a key player in embryogenesis and tumorigenesis. Here we show that a variety of tryptophan derivatives that act as endogenous AhR ligands can affect the transcription level of the master pluripotency factor Oct4. Among them, ITE enhances the binding of the AhR to the promoter of Oct4 and suppresses its transcription. Reduction of endogenous ITE levels in cancer cells by tryptophan deprivation or hypoxia leads to Oct4 elevation, which can be reverted by administration with synthetic ITE. Consequently, synthetic ITE induces the differentiation of stem-like cancer cells and reduces their tumorigenic potential in both subcutaneous and orthotopic xenograft tumour models. Thus, our results reveal a role of tryptophan derivatives and the AhR signalling pathway in regulating cancer cell stemness and open a new therapeutic avenue to target stem-like cancer cells.

  6. TransFind--predicting transcriptional regulators for gene sets.

    PubMed

    Kiełbasa, Szymon M; Klein, Holger; Roider, Helge G; Vingron, Martin; Blüthgen, Nils

    2010-07-01

    The analysis of putative transcription factor binding sites in promoter regions of coregulated genes allows to infer the transcription factors that underlie observed changes in gene expression. While such analyses constitute a central component of the in-silico characterization of transcriptional regulatory networks, there is still a lack of simple-to-use web servers able to combine state-of-the-art prediction methods with phylogenetic analysis and appropriate multiple testing corrected statistics, which returns the results within a short time. Having these aims in mind we developed TransFind, which is freely available at http://transfind.sys-bio.net/.

  7. Retroviral vectors containing Tet-controlled bidirectional transcription units for simultaneous regulation of two gene activities

    PubMed Central

    Loew, Rainer; Vigna, Elisa; Lindemann, Dirk; Naldini, Luigi; Bujard, Herman

    2006-01-01

    In this study retroviral self-inactivating (SIN)-vectors were constructed, that allow simultaneous regulation of two genes by integration of bidirectional Tet controlled transcription units. Marker genes (luciferase and eGFP) were expressed under the control of various bidirectional promoters Ptetbis, in order to determine (i) the fraction of HtTA-1 cells exhibiting tight doxycycline (Dox) dependent control; (ii) possible effects of the vector backbone on the regulation of gene transcription; (iii) the possibility for crosstalk between different minimal promoters within Ptetbi. When HtTA-1 cells, constitutively expressing the Tet-Transactivator (tTA), were transduced by S2f-lMCg retroviral vector, a high percentage (40) of the cell population displayed tight regulation (5000 fold) of Ptetbi activity over a wide range of Dox concentrations. As a result of our comparative study on the activity of virus derived minimal promoters (from MMTV, HIV and CMV), a clear hierarchy of activity as well as a different sensitivity to external influences among the various promoters studied was observed. Furthermore, our results strongly support the idea, that viral elements such as part of the MuLV pol/env region significantly affect the regulation capacity of an integrate. Taking into account our observations as outlined above, we succeeded in generating significantly optimized Tet regulated retroviral vectors. The application of such a one-step transfer system for Ptet controlled genes would be of particular relevance to applications where cellular systems do not allow prolonged selection procedures as it is the case with primary cells considered for ex vivo gene therapy. PMID:19565004

  8. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. PMID:26768363

  9. Sucrose-mediated transcriptional regulation of sucrose symporter activity in the phloem.

    SciTech Connect

    Matt Vaughn Greg Harrington Daniel R Bush

    2002-08-06

    This project was based on our discovery that sucrose acts as a signaling molecule that regulates the activity of a proton-sucrose symporter in sugar beet leaf tissue. A major objective here was determining how sucrose transporter activity is being regulated. When sucrose accumulates in the phloem sucrose transport activity drops dramatically. Western blots of plasma membrane proteins isolated from sucrose treated leaves showed that the loss of sucrose transport activity was proportional to a decline in symporter abundance, demonstrating that sucrose transport is regulated by changes in the amount of BvSUT1 protein. BvSUT1 transcript levels decreased in parallel with the loss of sucrose transport activity. Nuclear run-on experiments demonstrated that BvSUT1 gene transcription was repressed significantly in nuclei from leaves fed 100 mM exogenous sucrose, showing that sucrose-dependent modulation of BvSUT1 mRNA levels is mediated by changes in transcription. To identify which secondary messenger systems might be involved in regulating symporter activity, we used a variety of pharmacological agents to probe for a role of calcium or protein phosphorylation in sucrose signaling. In a detailed analysis, only okadaic acid altered sucrose transport activity. These results suggest a protein phosphatase is involved. We hypothesized that protein kinase inhibitors would have a neutral affect or increase symporter transcription. Transpirational feeding of the protein kinase inhibitor staurosporine had no impact on sucrose transport while calphostin C, an inhibitor of protein kinase C, caused a 60% increase. These data provided good evidence that protein phosphorylation plays a central role in regulating sucrose symporter expression and sucrose transport activity. To determine whether protein phosphorylation is involved in sucrose regulation of proton-sucrose symporter activity, we pre-fed leaves with staurosporine for 4 h and then fed the treated leaves water or 100 mM sucrose

  10. p53 negatively regulates Aurora A via both transcriptional and posttranslational regulation

    PubMed Central

    Wu, Chun-Chi; Yang, Tsung-Ying; Yu, Chang-Tze Ricky; Phan, Liem; Ivan, Cristina; Sood, Anil K.; Hsu, Shih-Lan; Lee, Mong-Hong

    2012-01-01

    p53 plays an important role in mitotic checkpoint, but what its role is remains enigmatic. Aurora A is a Ser/Thr kinase involved in correcting progression of mitosis. Here, we show that p53 is a negative regulator for Aurora A. We found that p53 deficiency leads to Aurora A elevation. Ectopic expression of p53 or DNA damage-induced expression of p53 can suppress the expression of Aurora A. Mechanistic studies show that p53 is a negative regulator for Aurora A expression through both transcriptional and posttranslational regulation. p53 knockdown in cancer cells reduces the level of p21, which, in turn, increases the activity of CDK2 followed by induction of Rb1 hyperphosphorylation and its dissociation with transcriptional factor E2F3. E2F3 can bind to Aurora A gene promoter, potentiating Aurora A gene expression and p53 deficiency, enhancing the binding of E2F3 on Aurora A promoter. Also, p53 deficiency leads to decelerating Aurora A’s turnover rate, due to the fact that p53 deficiency causes the downregulation of Fbw7α, a component of E3 ligase of Aurora A. Consistently, p53 knockdown-mediated Aurora A elevation is mitigated when Fbw7α is ectopically expressed. Thus, p53-mediated Aurora A degradation requires Fbw7α expression. Significantly, inverse correlation between p53 and Aurora A elevation is translated into the deregulation of centrosome amplification. p53 knockdown leads to high percentages of cells with abnormal amplification of centrosome. These data suggest that p53 is an important negative regulator of Aurora A, and that loss of p53 in many types of cancer could lead to abnormal elevation of Aurora A and dysregulated mitosis, which provides a growth advantage for cancer cells. PMID:22894933

  11. Transcription regulation by distal enhancers: who's in the loop?

    PubMed

    Stadhouders, Ralph; van den Heuvel, Anita; Kolovos, Petros; Jorna, Ruud; Leslie, Kris; Grosveld, Frank; Soler, Eric

    2012-01-01

    Genome-wide chromatin profiling efforts have shown that enhancers are often located at large distances from gene promoters within the noncoding genome. Whereas enhancers can stimulate transcription initiation by communicating with promoters via chromatin looping mechanisms, we propose that enhancers may also stimulate transcription elongation by physical interactions with intronic elements. We review here recent findings derived from the study of the hematopoietic system.

  12. Post-transcriptional regulation of transcript abundance by a conserved member of the tristetraprolin family in Candida albicans

    PubMed Central

    Wells, Melissa L.; Washington, Onica L.; Hicks, Stephanie N.; Nobile, Clarissa J.; Hartooni, Nairi; Wilson, Gerald M.; Zucconi, Beth E.; Huang, Weichun; Li, Leping; Fargo, David C.; Blackshear, Perry J.

    2015-01-01

    Summary Members of the tristetraprolin (TTP) family of CCCH tandem zinc finger proteins bind to AU-rich regions in target mRNAs, leading to their deadenylation and decay. Family members in Saccharomyces cerevisiae influence iron metabolism, whereas the single protein expressed in Schizosaccharomyces pombe, Zfs1, regulates cell–cell interactions. In the human pathogen Candida albicans, deep sequencing of mutants lacking the orthologous protein, Zfs1, revealed significant increases (> 1.5-fold) in 156 transcripts. Of these, 113 (72%) contained at least one predicted TTP family member binding site in their 3′UTR, compared with only 3 of 56 (5%) down-regulated transcripts. The zfs1Δ/Δ mutant was resistant to 3-amino-1,2,4-triazole, perhaps because of increased expression of the potential target transcript encoded by HIS3. Sequences of the proteins encoded by the putative Zfs1 targets were highly conserved among other species within the fungal CTG clade, while the predicted Zfs1 binding sites in these mRNAs often ‘disappeared’ with increasing evolutionary distance from the parental species. C. albicans Zfs1 bound to the ideal mammalian TTP binding site with high affinity, and Zfs1 was associated with target transcripts after co-immunoprecipitation. Thus, the biochemical activities of these proteins in fungi are highly conserved, but Zfs1-like proteins may target different transcripts in each species. PMID:25524641

  13. Impacts of Pretranscriptional DNA Methylation, Transcriptional Transcription Factor, and Posttranscriptional microRNA Regulations on Protein Evolutionary Rate

    PubMed Central

    Chuang, Trees-Juen; Chiang, Tai-Wei

    2014-01-01

    Gene expression is largely regulated by DNA methylation, transcription factor (TF), and microRNA (miRNA) before, during, and after transcription, respectively. Although the evolutionary effects of TF/miRNA regulations have been widely studied, evolutionary analysis of simultaneously accounting for DNA methylation, TF, and miRNA regulations and whether promoter methylation and gene body (coding regions) methylation have different effects on the rate of gene evolution remain uninvestigated. Here, we compared human–macaque and human–mouse protein evolutionary rates against experimentally determined single base-resolution DNA methylation data, revealing that promoter methylation level is positively correlated with protein evolutionary rates but negatively correlated with TF/miRNA regulations, whereas the opposite was observed for gene body methylation level. Our results showed that the relative importance of these regulatory factors in determining the rate of mammalian protein evolution is as follows: Promoter methylation ≈ miRNA regulation > gene body methylation > TF regulation, and further indicated that promoter methylation and miRNA regulation have a significant dependent effect on protein evolutionary rates. Although the mechanisms underlying cooperation between DNA methylation and TFs/miRNAs in gene regulation remain unclear, our study helps to not only illuminate the impact of these regulatory factors on mammalian protein evolution but also their intricate interaction within gene regulatory networks. PMID:24923326

  14. E. coli 6S RNA: a universal transcriptional regulator within the centre of growth adaptation.

    PubMed

    Geissen, René; Steuten, Benedikt; Polen, Tino; Wagner, Rolf

    2010-01-01

    Bacterial 6S RNA has been shown to bind with high affinity to σ(70)-containing RNA polymerase, suppressing σ(70)-dependent transcription during stationary phase, when 6S RNA concentrations are highest. We recently reported a genome-wide transcriptional comparison of wild-type and 6S RNA deficient E. coli strains. Contrary to the expected σ(70)- and stationary phase-specific regulatory effect of 6S RNA it turned out that mRNA levels derived from many alternative sigma factors, including σ(38) or σ(32), were affected during exponential and stationary growth. Among the most noticeably down-regulated genes at stationary growth are ribosomal proteins and factors involved in translation. In addition, a striking number of mRNA levels coding for enzymes involved in the purine metabolism, for transporters and stress regulators are altered both during log- and stationary phase. During the study we discovered a link between 6S RNA and the general stress alarmone ppGpp, which has a higher basal level in cells deficient in 6S RNA. This finding points to a functional interrelation of 6S RNA and the global network of stress and growth adaptation. PMID:20930516

  15. The Arabidopsis thaliana NGATHA transcription factors negatively regulate cell proliferation of lateral organs.

    PubMed

    Lee, Byung Ha; Kwon, So Hyun; Lee, Sang-Joo; Park, Soon Ki; Song, Jong Tae; Lee, Sangman; Lee, Myeong Min; Hwang, Yong-sic; Kim, Jeong Hoe

    2015-11-01

    The cell proliferation process of aerial lateral organs, such as leaves and flowers, is coordinated by complex genetic networks that, in general, converge on the cell cycle. The Arabidopsis thaliana NGATHA (AtNGA) family comprises four members that belong to the B3-type transcription factor superfamily, and has been suggested to be involved in growth and development of aerial lateral organs, although its role in the cell proliferation and expansion processes remains to be resolved in more detail. In order to clarify the role of AtNGAs in lateral organ growth, we took a systematic approach using both the loss- and gain-of-functional mutants of all four members. Our results showed that overexpressors of AtNGA1 to AtNGA4 developed small, narrow lateral organs, whereas the nga1 nga2 nga3 nga4 quadruple mutant produced large, wide lateral organs. We found that cell numbers of the lateral organs were significantly affected: a decrease in overexpressors and, inversely, an increase in the quadruple mutant. Kinematic analyses on leaf growth revealed that, compared with the wild type, the overexpressors displayed a lower activity of cell proliferation and yet the mutant a higher activity. Changes in expression of cell cycle-regulating genes were well in accordance with the cell proliferation activities, establishing that the AtNGA transcription factors act as bona fide negative regulators of the cell proliferation of aerial lateral organs.

  16. The activity-dependent transcription factor NPAS4 regulates domain-specific inhibition

    PubMed Central

    Bloodgood, Brenda L.; Sharma, Nikhil; Browne, Heidi Adlman; Trepman, Alissa Z.; Greenberg, Michael E.

    2014-01-01

    A heterogeneous population of inhibitory neurons controls the flow of information through a neural circuit1–3. Inhibitory synapses that form on pyramidal neuron dendrites modulate the summation of excitatory synaptic potentials4–6 and prevent the generation of dendritic calcium spikes7,8. Precisely timed somatic inhibition limits both the number of action potentials and the time window during which firing can occur8,9. The activity-dependent transcription factor NPAS4 regulates inhibitory synapse number and function in cell culture10, but how this transcription factor affects the inhibitory inputs that form on distinct domains of a neuron in vivo was unclear. Here we show that in the mouse hippocampus behaviourally driven expression of NPAS4 coordinates the redistribution of inhibitory synapses made onto a CA1 pyramidal neuron, simultaneously increasing inhibitory synapse number on the cell body while decreasing the number of inhibitory synapses on the apical dendrites. This rearrangement of inhibition is mediated in part by the NPAS4 target gene brain derived neurotrophic factor (Bdnf), which specifically regulates somatic, and not dendritic, inhibition. These findings indicate that sensory stimuli, by inducing NPAS4 and its target genes, differentially control spatial features of neuronal inhibition in a way that restricts the output of the neuron while creating a dendritic environment that is permissive for plasticity. PMID:24201284

  17. The sequence-specific transcription factor c-Jun targets Cockayne syndrome protein B to regulate transcription and chromatin structure.

    PubMed

    Lake, Robert J; Boetefuer, Erica L; Tsai, Pei-Fang; Jeong, Jieun; Choi, Inchan; Won, Kyoung-Jae; Fan, Hua-Ying

    2014-04-01

    Cockayne syndrome is an inherited premature aging disease associated with numerous developmental and neurological defects, and mutations in the gene encoding the CSB protein account for the majority of Cockayne syndrome cases. Accumulating evidence suggests that CSB functions in transcription regulation, in addition to its roles in DNA repair, and those defects in this transcriptional activity might contribute to the clinical features of Cockayne syndrome. Transcription profiling studies have so far uncovered CSB-dependent effects on gene expression; however, the direct targets of CSB's transcriptional activity remain largely unknown. In this paper, we report the first comprehensive analysis of CSB genomic occupancy during replicative cell growth. We found that CSB occupancy sites display a high correlation to regions with epigenetic features of promoters and enhancers. Furthermore, we found that CSB occupancy is enriched at sites containing the TPA-response element. Consistent with this binding site preference, we show that CSB and the transcription factor c-Jun can be found in the same protein-DNA complex, suggesting that c-Jun can target CSB to specific genomic regions. In support of this notion, we observed decreased CSB occupancy of TPA-response elements when c-Jun levels were diminished. By modulating CSB abundance, we found that CSB can influence the expression of nearby genes and impact nucleosome positioning in the vicinity of its binding site. These results indicate that CSB can be targeted to specific genomic loci by sequence-specific transcription factors to regulate transcription and local chromatin structure. Additionally, comparison of CSB occupancy sites with the MSigDB Pathways database suggests that CSB might function in peroxisome proliferation, EGF receptor transactivation, G protein signaling and NF-κB activation, shedding new light on the possible causes and mechanisms of Cockayne syndrome.

  18. Switching on sex: transcriptional regulation of the testis-determining gene Sry

    PubMed Central

    Larney, Christian; Bailey, Timothy L.; Koopman, Peter

    2014-01-01

    Mammalian sex determination hinges on the development of ovaries or testes, with testis fate being triggered by the expression of the transcription factor sex-determining region Y (Sry). Reduced or delayed Sry expression impairs testis development, highlighting the importance of its accurate spatiotemporal regulation and implying a potential role for SRY dysregulation in human intersex disorders. Several epigenetic modifiers, transcription factors and kinases are implicated in regulating Sry transcription, but it remains unclear whether or how this farrago of factors acts co-ordinately. Here we review our current understanding of Sry regulation and provide a model that assembles all known regulators into three modules, each converging on a single transcription factor that binds to the Sry promoter. We also discuss potential future avenues for discovering the cis-elements and trans-factors required for Sry regulation. PMID:24866114

  19. O-GlcNAc modification of Sp3 and Sp4 transcription factors negatively regulates their transcriptional activities.

    PubMed

    Ha, Changhoon; Lim, Kihong

    2015-11-13

    The addition of O-linked N-acetylglucosamine (O-GlcNAc) on serine or threonine modifies a myriad of proteins and regulates their function, stability and localization. O-GlcNAc modification is common among chromosome-associated proteins, such as transcription factors, suggesting its extensive involvement in gene expression regulation. In this study, we demonstrate the O-GlcNAc status of the Sp family members of transcription factors and the functional impact on their transcriptional activities. We highlight the presence of O-GlcNAc residues in Sp3 and Sp4, but not Sp2, as demonstrated by their enrichment in GlcNAc positive protein fractions and by detection of O-GlcNAc residues on Sp3 and Sp4 co-expressed in Escherichia coli together with O-GlcNAc transferase (OGT) using an O-GlcNAc-specific antibody. Deletion mutants of Sp3 and Sp4 indicate that the majority of O-GlcNAc sites reside in their N-terminal transactivation domain. Overall, using reporter gene assays and co-immunoprecipitations, we demonstrate a functional inhibitory role of O-GlcNAc modifications in Sp3 and Sp4 transcription factors. Thereby, our study strengthens the current notion that O-GlcNAc modification is an important regulator of protein interactome.

  20. Transcriptional profiling of CcpE-regulated genes in Staphylococcus aureus.

    PubMed

    Li, Han; Ding, Yue; Lan, Lefu

    2015-09-01

    The transcriptional regulator CcpE is an important citrate-sensing regulator that modulates metabolic state, virulence factor expression, and bacterial virulence of Staphylococcus aureus (Ding et al., 2014 [1]). In this article, we report detailed methods for genome-wide transcriptional profiling of CcpE-regulated genes generated for the research article "Metabolic sensor governing bacterial virulence in Staphylococcus aureus" (Ding et al., 2014 [1]). All transcriptional profiling data was deposited to Gene Expression Omnibus (GEO) database under accession number GSE57260. PMID:26484245

  1. The FUR (ferric uptake regulator) superfamily: diversity and versatility of key transcriptional regulators.

    PubMed

    Fillat, María F

    2014-03-15

    Control of metal homeostasis is essential for life in all kingdoms. In most prokaryotic organisms the FUR (ferric uptake regulator) family of transcriptional regulators is involved in the regulation of iron and zinc metabolism through control by Fur and Zur proteins. A third member of this family, the peroxide-stress response PerR, is present in most Gram-positives, establishing a tight functional interaction with the global regulator Fur. These proteins play a pivotal role for microbial survival under adverse conditions and in the expression of virulence in most pathogens. In this paper we present the current state of the art in the knowledge of the FUR family, including those members only present in more reduced numbers of bacteria, namely Mur, Nur and Irr. The huge amount of work done in the two last decades shows that FUR proteins present considerable diversity in their regulatory mechanisms and interesting structural differences. However, much work needs to be done to obtain a more complete picture of this family, especially in connection with the roles of some members as gas and redox sensors as well as to fully characterize their participation in bacterial adaptative responses.

  2. Serine/threonine/tyrosine phosphorylation regulates DNA binding of bacterial transcriptional regulators.

    PubMed

    Kalantari, Aida; Derouiche, Abderahmane; Shi, Lei; Mijakovic, Ivan

    2015-09-01

    Reversible phosphorylation of bacterial transcriptional regulators (TRs) belonging to the family of two-component systems (TCSs) is a well-established mechanism for regulating gene expression. Recent evidence points to the fact that reversible phosphorylation of bacterial TRs on other types of residue, i.e. serine, threonine, tyrosine and cysteine, is also quite common. The phosphorylation of the ester type (phospho-serine/threonine/tyrosine) is more stable than the aspartate phosphorylation of TCSs. The kinases which catalyse these phosphorylation events (Hanks-type serine/threonine protein kinases and bacterial protein tyrosine kinases) are also much more promiscuous than the TCS kinases, i.e. each of them can phosphorylate several substrate proteins. As a consequence, the dynamics and topology of the signal transduction networks depending on these kinases differ significantly from the TCSs. Here, we present an overview of different classes of bacterial TR phosphorylated and regulated by serine/threonine and tyrosine kinases. Particular attention is given to examples when serine/threonine and tyrosine kinases interact with TCSs, phosphorylating either the histidine kinases or the response regulators. We argue that these promiscuous kinases connect several signal transduction pathways and serve the role of signal integration. PMID:26220449

  3. Punctual Transcriptional Regulation by the Rice Circadian Clock under Fluctuating Field Conditions[OPEN

    PubMed Central

    Matsuzaki, Jun; Kawahara, Yoshihiro; Izawa, Takeshi

    2015-01-01

    Plant circadian clocks that oscillate autonomously with a roughly 24-h period are entrained by fluctuating light and temperature and globally regulate downstream genes in the field. However, it remains unknown how punctual internal time produced by the circadian clock in the field is and how it is affected by environmental fluctuations due to weather or daylength. Using hundreds of samples of field-grown rice (Oryza sativa) leaves, we developed a statistical model for the expression of circadian clock-related genes integrating diurnally entrained circadian clock with phase setting by light, both responses to light and temperature gated by the circadian clock. We show that expression of individual genes was strongly affected by temperature. However, internal time estimated from expression of multiple genes, which may reflect transcriptional regulation of downstream genes, is punctual to 22 min and not affected by weather, daylength, or plant developmental age in the field. We also revealed perturbed progression of internal time under controlled environment or in a mutant of the circadian clock gene GIGANTEA. Thus, we demonstrated that the circadian clock is a regulatory network of multiple genes that retains accurate physical time of day by integrating the perturbations on individual genes under fluctuating environments in the field. PMID:25757473

  4. Dynamic regulation of eve stripe 2 expression reveals transcriptional bursts in living Drosophila embryos.

    PubMed

    Bothma, Jacques P; Garcia, Hernan G; Esposito, Emilia; Schlissel, Gavin; Gregor, Thomas; Levine, Michael

    2014-07-22

    We present the use of recently developed live imaging methods to examine the dynamic regulation of even-skipped (eve) stripe 2 expression in the precellular Drosophila embryo. Nascent transcripts were visualized via MS2 RNA stem loops. The eve stripe 2 transgene exhibits a highly dynamic pattern of de novo transcription, beginning with a broad domain of expression during nuclear cycle 12 (nc12), and progressive refinement during nc13 and nc14. The mature stripe 2 pattern is surprisingly transient, constituting just ∼15 min of the ∼90-min period of expression. Nonetheless, this dynamic transcription profile faithfully predicts the limits of the mature stripe visualized by conventional in situ detection methods. Analysis of individual transcription foci reveals intermittent bursts of de novo transcription, with duration cycles of 4-10 min. We discuss a multistate model of transcription regulation and speculate on its role in the dynamic repression of the eve stripe 2 expression pattern during development.

  5. Cell cycle-dependent regulation of RNA polymerase II basal transcription activity.

    PubMed Central

    Yonaha, M; Chibazakura, T; Kitajima, S; Yasukochi, Y

    1995-01-01

    Regulation of transcription by RNA polymerase II (pol II) in eukaryotic cells requires both basal and regulatory transcription factors. In this report we have investigated in vitro pol II basal transcription activity during the cell cycle by using nuclear extracts from synchronized HeLa cells. It is shown that pol II basal transcription activity is low in the S and G2 phases and high in early G1 phase and TFIID is the rate limiting component of pol II basal transcription activity during the cell cycle. Further analyses reveal that TFIID exists as a less active form in the S and G2 phases and nuclear extracts from S and G2 phase cells contain a heat-sensitive repressor(s) of TATA box binding protein (TBP). These results suggest that pol II basal transcription activity is regulated by a qualitative change in the TFIID complex, which could involve repression of TBP, during the cell cycle. Images PMID:7479063

  6. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo

    2016-01-01

    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  7. Transcriptional Regulation of Frizzled-1 in Human Osteoblasts by Sp1

    PubMed Central

    Yu, Shibing; Yerges-Armstrong, Laura M.; Chu, Yanxia; Zmuda, Joseph M.; Zhang, Yingze

    2016-01-01

    The wingless pathway has a powerful influence on bone metabolism and is a therapeutic target in skeletal disorders. Wingless signaling is mediated in part through the Frizzled (FZD) receptor family. FZD transcriptional regulation is poorly understood. Herein we tested the hypothesis that Sp1 plays an important role in the transcriptional regulation of FZD1 expression in osteoblasts and osteoblast mineralization. To test this hypothesis, we conducted FZD1 promoter assays in Saos2 cells with and without Sp1 overexpression. We found that Sp1 significantly up-regulates FZD1 promoter activity in Saos2 cells. Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift (EMSA) assays identified a novel and functional Sp1 binding site at -44 to -40 from the translation start site in the FZD1 promoter. The Sp1-dependent activation of the FZD1 promoter was abolished by mithramycin A (MMA), an antibiotic affecting both Sp1 binding and Sp1 protein levels in Saos2 cells. Similarly, down-regulation of Sp1 in hFOB cells resulted in less FZD1 expression and lower alkaline phosphatase activity. Moreover, over-expression of Sp1 increased FZD1 expression and Saos2 cell mineralization while MMA decreased Sp1 and FZD1 expression and Saos2 cell mineralization. Knockdown of FZD1 prior to Sp1 overexpression partially abolished Sp1 stimulation of osteoblast differentiation markers. Taken together, our results suggest that Sp1 plays a role in human osteoblast differentiation and mineralization, which is at least partially mediated by Sp1-dependent transactivation of FZD1. PMID:27695039

  8. Ribbon regulates morphogenesis of the Drosophila embryonic salivary gland through transcriptional activation and repression.

    PubMed

    Loganathan, Rajprasad; Lee, Joslynn S; Wells, Michael B; Grevengoed, Elizabeth; Slattery, Matthew; Andrew, Deborah J

    2016-01-01

    Transcription factors affect spatiotemporal patterns of gene expression often regulating multiple aspects of tissue morphogenesis, including cell-type specification, cell proliferation, cell death, cell polarity, cell shape, cell arrangement and cell migration. In this work, we describe a distinct role for Ribbon (Rib) in controlling cell shape/volume increases during elongation of the Drosophila salivary gland (SG). Notably, the morphogenetic changes in rib mutants occurred without effects on general SG cell attributes such as specification, proliferation and apoptosis. Moreover, the changes in cell shape/volume in rib mutants occurred without compromising epithelial-specific morphological attributes such as apicobasal polarity and junctional integrity. To identify the genes regulated by Rib, we performed ChIP-seq analysis in embryos driving expression of GFP-tagged Rib specifically in the SGs. To learn if the Rib binding sites identified in the ChIP-seq analysis were linked to changes in gene expression, we performed microarray analysis comparing RNA samples from age-matched wild-type and rib null embryos. From the superposed ChIP-seq and microarray gene expression data, we identified 60 genomic sites bound by Rib likely to regulate SG-specific gene expression. We confirmed several of the identified Rib targets by qRT-pCR and/or in situ hybridization. Our results indicate that Rib regulates cell growth and tissue shape in the Drosophila salivary gland via a diverse array of targets through both transcriptional activation and repression. Furthermore, our results suggest that autoregulation of rib expression may be a key component of the SG morphogenetic gene network.

  9. Regulation of competence and gene expression in Streptococcus mutans by the RcrR transcriptional regulator

    PubMed Central

    Burne, Robert A.

    2014-01-01

    SUMMARY An intimate linkage between the regulation of biofilm formation, stress tolerance and genetic competence exists in the dental caries pathogen Streptococcus mutans. The rcrRPQ genes encode ABC exporters (RcrPQ) and a MarR-family transcriptional repressor of the rcr operon (RcrR) play a dominant role in regulation of the development of genetic competence and connect competence with stress tolerance and (p)ppGpp production in S. mutans. Here we identify the target for efficient RcrR binding in the rcr promoter region using purified recombinant RcrR (rRcrR) protein in electrophoretic mobility shift assays and show that DNA fragments carrying mutations in the binding region were not bound as efficiently by rRcrR in vitro. Mutations in the RcrR binding site impacted expression from the rcrR promoter in vivo and elicited changes in transformation efficiency, competence gene expression, and growth inhibition by competence stimulating peptide; even when the changes in rcrRPQ transcription were minor. An additional mechanistic linkage of RcrR with competence and (p)ppGpp metabolism was identified by showing that the rRcrR protein could bind to the promoter regions of comX, comYA and relP, although the binding was not as efficient as to the rcrRPQ promoter under the conditions tested. Thus, tightly controlled autogenous regulation of the rcrRPQ operon by RcrR binding to specific target sites is essential for cellular homeostasis, and RcrR contributes to the integration of genetic competence, (p)ppGpp metabolism, and acid and oxidative stress tolerance in S. mutans through both direct and indirect mechanisms. PMID:25146832

  10. The role of abscisic acid in regulating cucumber fruit development and ripening and its transcriptional regulation.

    PubMed

    Wang, Yanping; Wang, Ya; Ji, Kai; Dai, Shengjie; Hu, Ying; Sun, Liang; Li, Qian; Chen, Pei; Sun, Yufei; Duan, Chaorui; Wu, Yan; Luo, Hao; Zhang, Dian; Guo, Yangdong; Leng, Ping

    2013-03-01

    Cucumber (Cucumis sativus L.), a kind of fruit usually harvested at the immature green stage, belongs to non-climacteric fruit. To investigate the contribution of abscisic acid (ABA) to cucumber fruit development and ripening, variation in ABA level was investigated and a peak in ABA level was found in pulp before fruit get fully ripe. To clarify this point further, exogenous ABA was applied to cucumber fruits at two different development stages. Results showed that ABA application at the turning stage promotes cucumber fruit ripening, while application at the immature green stage had inconspicuous effects. In addition, with the purpose of understanding the transcriptional regulation of ABA, two partial cDNAs of CsNCED1 and CsNCED2 encoding 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in ABA biosynthetic pathway; one partial cDNA of CsCYP707A1 for 8'-hydroxylase, a key enzyme in the oxidative catabolism of ABA and two partial cDNAs of CsBG1 and CsBG2 for β-glucosidase (BG) that hydrolyzes ABA glucose ester (ABA-GE) to release active ABA were cloned from cucumber. The DNA and deduced amino acid sequences of these obtained genes respectively showed high similarities to their homologous genes in other plants. Real-time PCR analysis revealed that ABA content may be regulated by its biosynthesis (CsNCEDs), catabolism (CsCYP707A1) and reactivation genes (CsBGs) at the transcriptional level during cucumber fruit development and ripening, in response to ABA application, dehydration and pollination, among which CsNCED1, CsCYP707A1 and CsBG1 were highly expressed in pulp and may play more important roles in regulating ABA metabolism.

  11. From cell membrane to the nucleus: an emerging role of E-cadherin in gene transcriptional regulation

    PubMed Central

    Du, Wenjun; Liu, Xi; Fan, Guiling; Zhao, Xingsheng; Sun, Yanying; Wang, Tianzhen; Zhao, Ran; Wang, Guangyu; Zhao, Ci; Zhu, Yuanyuan; Ye, Fei; Jin, Xiaoming; Zhang, Fengmin; Zhong, Zhaohua; Li, Xiaobo

    2014-01-01

    E-cadherin is a well-known mediator of cell–cell adherens junctions. However, many other functions of E-cadherin have been reported. Collectively, the available data suggest that E-cadherin may also act as a gene transcriptional regulator. Here, evidence supporting this claim is reviewed, and possible mechanisms of action are discussed. E-cadherin has been shown to modulate the activity of several notable cell signalling pathways, and given that most of these pathways in turn regulate gene expression, we proposed that E-cadherin may regulate gene transcription by affecting these pathways. Additionally, E-cadherin has been shown to accumulate in the nucleus where documentation of an E-cadherin fragment bound to DNA suggests that E-cadherin may directly regulate gene transcription. In summary, from the cell membrane to the nucleus, a role for E-cadherin in gene transcription may be emerging. Studies specifically focused on this potential role would allow for a more thorough understanding of this transmembrane glycoprotein in mediating intra- and intercellular activities. PMID:25164084

  12. NanoScript: A Nanoparticle-Based Artificial Transcription Factor for Effective Gene Regulation

    PubMed Central

    2015-01-01

    Transcription factor (TF) proteins are master regulators of transcriptional activity and gene expression. TF-based gene regulation is a promising approach for many biological applications; however, several limitations hinder the full potential of TFs. Herein, we developed an artificial, nanoparticle-based transcription factor, termed NanoScript, which is designed to mimic the structure and function of TFs. NanoScript was constructed by tethering functional peptides and small molecules called synthetic transcription factors, which mimic the individual TF domains, onto gold nanoparticles. We demonstrate that NanoScript localizes within the nucleus and initiates transcription of a reporter plasmid by over 15-fold. Moreover, NanoScript can effectively transcribe targeted genes on endogenous DNA in a nonviral manner. Because NanoScript is a functional replica of TF proteins and a tunable gene-regulating platform, it has great potential for various stem cell applications. PMID:25133310

  13. Regulation of calcitonin gene transcription by vitamin D metabolites in vivo in the rat.

    PubMed Central

    Naveh-Many, T; Silver, J

    1988-01-01

    Calcitonin is secreted by the C cells of the thyroid in response to a raised serum calcium, and acts on bone to lower serum calcium. The C cells have specific receptors for the dihydroxymetabolite of vitamin D3, 1,25(OH)2D3. Moreover, calcitonin stimulates the synthesis of 1,25(OH)2D3 in the kidney. Parathyroid hormone (PTH), the third calciotrophic hormone, is also trophic to the renal synthesis of 1,25(OH)2D3, and in turn 1,25(OH)2D3 inhibits PTH gene transcription and synthesis. We report here the marked inhibition of calcitonin gene transcription by the injection of physiologically relevant doses of 1,25(OH)2D3 to normal rats that did not raise serum calcium. Calcitonin mRNA levels after 100 pmol 1,25(OH)2D3 decreased to 6% of basal at 6 h and 4% at 48 h, and a dose response showed a marked effect even after 12.5 pmol 1,25(OH)2D3, with no appreciably greater effect with larger doses (up to 200 pmol). Control genes, actin, thyroglobulin (thyroid follicular cells), somatostatin (thyroid C-cells) were not affected by 1,25(OH)2D3. Gel blots showed that 1,25(OH)2D3 decreased calcitonin mRNA levels without any change in its size. In vitro nuclear transcription showed that 1,25(OH)2D3-treated (100 pmol) rats' calcitonin transcription was 10% of control, while thyroglobulin and actin were 100%. We propose that calcium is the major regulator of PTH and calcitonin secretion, while 1,25(OH)2D3 is an important regulator of PTH and calcitonin gene transcription. We believe this to be the first demonstration of an effect of 1,25(OH)2D3 on the C cells thereby establishing a new target organ and site of action of vitamin D. Calcitonin is trophic to 1,25(OH)2D3 synthesis, which in turn inhibits calcitonin synthesis, which are the components of a new endocrinological feedback loop. Images PMID:2891728

  14. Coupled Changes in Translation and Transcription during Cobalamin-Dependent Regulation of btuB Expression in Escherichia coli

    PubMed Central

    Nou, Xiangwu; Kadner, Robert J.

    1998-01-01

    The level of the vitamin B12 transport protein BtuB in the outer membrane of Escherichia coli is strongly reduced by growth in the presence of cobalamins. Previous analyses of regulatory mutants and of btuB-lacZ fusions indicated that the primary site of btuB gene regulation was at the translational level, and this required sequences throughout the 240-nucleotide (nt) leader region. Cobalamin-dependent regulation of transcriptional fusions was of a lesser magnitude but required, in addition to the leader, sequences within the first 100 nt of the coding sequence, termed the translated regulatory region (TRR). To analyze the process of transcription-level regulation of btuB in E. coli, the levels and metabolism of btuB RNA were analyzed by S1 nuclease protection assays, and mutations that alter the coupling of translational and transcriptional control were analyzed. Expression of transcriptional fusions was found to correlate with changes in the level of intact btuB RNA and was related to changes in the metabolic stability of the normally long-lived RNA. Mutational analysis showed that the btuB start codon and a hairpin structure that can sequester the Shine-Dalgarno sequence are necessary for cobalamin-dependent regulation and that translation of the TRR is necessary for extended RNA stability and for expression of the transcriptional fusion. The absence of regulation at the stage of transcription initiation was confirmed by the findings that several truncated btuB RNA fragments were expressed in a constitutive manner and that the normal regulatory response occurred even when the btuB promoter and upstream sequences were replaced by the heterologous bla and lac promoters. Transcription driven by phage T7 RNA polymerase was not regulated by cobalamins, although some regulation at the translational level was retained. Cobalamin-dependent changes in RNA structure were suggested from the RNase III-dependent production of a transcript fragment that is made only in the

  15. A positive role for polycomb in transcriptional regulation via H4K20me1

    PubMed Central

    Lv, Xiangdong; Han, Zhijun; Chen, Hao; Yang, Bo; Yang, Xiaofeng; Xia, Yuanxin; Pan, Chenyu; Fu, Lin; Zhang, Shuo; Han, Hui; Wu, Min; Zhou, Zhaocai; Zhang, Lei; Li, Lin; Wei, Gang; Zhao, Yun

    2016-01-01

    The highly conserved polycomb group (PcG) proteins maintain heritable transcription repression of the genes essential for development from fly to mammals. However, sporadic reports imply a potential role of PcGs in positive regulation of gene transcription, although systematic investigation of such function and the underlying mechanism has rarely been reported. Here, we report a Pc-mediated, H3K27me3-dependent positive transcriptional regulation of Senseless (Sens), a key transcription factor required for development. Mechanistic studies show that Pc regulates Sens expression by promoting H4K20me1 at the Sens locus. Further bioinformatic analysis at genome-wide level indicates that the existence of H4K20me1 acts as a selective mark for positive transcriptional regulation by Pc/H3K27me3. Both the intensities and specific patterns of Pc and H3K27me3 are important for the fates of target gene transcription. Moreover, binding of transcription factor Broad (Br), which physically interacts with Pc and positively regulates the transcription of Sens, is observed in Pc+H3K27me3+H4K20me1+ genes, but not in Pc+H3K27me3+H4K20me1− genes. Taken together, our study reveals that, coupling with the transcription factor Br, Pc positively regulates transcription of Pc+H3K27me3+H4K20me1+ genes in developing Drosophila wing disc. PMID:27002220

  16. Modeling Writing Development: Contribution of Transcription and Self-Regulation to Portuguese Students' Text Generation Quality

    ERIC Educational Resources Information Center

    Limpo, Teresa; Alves, Rui A.

    2013-01-01

    Writing is a complex activity that requires transcription and self-regulation. We used multiple-group structural equation modeling to test the contribution of transcription (handwriting and spelling), planning, revision, and self-efficacy to writing quality at 2 developmental points (Grades 4-6 vs. 7-9). In Grades 4-6, the model explained 76% of…

  17. Genomic clustering and co-regulation of transcriptional networks in the pathogenic fungus Fusarium graminearum

    PubMed Central

    2013-01-01

    Background Genes for the production of a broad range of fungal secondary metabolites are frequently colinear. The prevalence of such gene clusters was systematically examined across the genome of the cereal pathogen Fusarium graminearum. The topological structure of transcriptional networks was also examined to investigate control mechanisms for mycotoxin biosynthesis and other processes. Results The genes associated with transcriptional processes were identified, and the genomic location of transcription-associated proteins (TAPs) analyzed in conjunction with the locations of genes exhibiting similar expression patterns. Highly conserved TAPs reside in regions of chromosomes with very low or no recombination, contrasting with putative regulator genes. Co-expression group profiles were used to define positionally clustered genes and a number of members of these clusters encode proteins participating in secondary metabolism. Gene expression profiles suggest there is an abundance of condition-specific transcriptional regulation. Analysis of the promoter regions of co-expressed genes showed enrichment for conserved DNA-sequence motifs. Potential global transcription factors recognising these motifs contain distinct sets of DNA-binding domains (DBDs) from those present in local regulators. Conclusions Proteins associated with basal transcriptional functions are encoded by genes enriched in regions of the genome with low recombination. Systematic searches revealed dispersed and compact clusters of co-expressed genes, often containing a transcription factor, and typically containing genes involved in biosynthetic pathways. Transcriptional networks exhibit a layered structure in which the position in the hierarchy of a regulator is closely linked to the DBD structural class. PMID:23805903

  18. The transcriptional regulator network of human inflammatory macrophages is defined by open chromatin

    PubMed Central

    Schmidt, Susanne V; Krebs, Wolfgang; Ulas, Thomas; Xue, Jia; Baßler, Kevin; Günther, Patrick; Hardt, Anna-Lena; Schultze, Hartmut; Sander, Jil; Klee, Kathrin; Theis, Heidi; Kraut, Michael; Beyer, Marc; Schultze, Joachim L

    2016-01-01

    Differentiation of inflammatory macrophages from monocytes is characterized by an orderly integration of epigenetic and transcriptional regulatory mechanisms guided by lineage-determining transcription factors such as PU.1. Further activation of macrophages leads to a stimulus- or microenvironment-specific signal integration with subsequent transcriptional control established by the action of tissue- or signal-associated transcription factors. Here, we assess four histone modifications during human macrophage activation and integrate this information with the gene expression data from 28 different macrophage activation conditions in combination with GM-CSF. Bioinformatically, for inflammatory macrophages we define a unique network of transcriptional and epigenetic regulators (TRs), which was characterized by accessible promoters independent of the activation signal. In contrast to the general accessibility of promoters of TRs, mRNA expression of central TRs belonging to the TR network displayed stimulus-specific expression patterns, indicating a second level of transcriptional regulation beyond epigenetic chromatin changes. In contrast, stringent integration of epigenetic and transcriptional regulation was observed in networks of TRs established from somatic tissues and tissue macrophages. In these networks, clusters of TRs with permissive histone marks were associated with high gene expression whereas clusters with repressive chromatin marks were associated with absent gene expression. Collectively, these results support that macrophage activation during inflammation in contrast to lineage determination is mainly regulated transcriptionally by a pre-defined TR network. PMID:26729620

  19. The transcriptional regulator network of human inflammatory macrophages is defined by open chromatin.

    PubMed

    Schmidt, Susanne V; Krebs, Wolfgang; Ulas, Thomas; Xue, Jia; Baßler, Kevin; Günther, Patrick; Hardt, Anna-Lena; Schultze, Hartmut; Sander, Jil; Klee, Kathrin; Theis, Heidi; Kraut, Michael; Beyer, Marc; Schultze, Joachim L

    2016-02-01

    Differentiation of inflammatory macrophages from monocytes is characterized by an orderly integration of epigenetic and transcriptional regulatory mechanisms guided by lineage-determining transcription factors such as PU.1. Further activation of macrophages leads to a stimulus- or microenvironment-specific signal integration with subsequent transcriptional control established by the action of tissue- or signal-associated transcription factors. Here, we assess four histone modifications during human macrophage activation and integrate this information with the gene expression data from 28 different macrophage activation conditions in combination with GM-CSF. Bioinformatically, for inflammatory macrophages we define a unique network of transcriptional and epigenetic regulators (TRs), which was characterized by accessible promoters independent of the activation signal. In contrast to the general accessibility of promoters of TRs, mRNA expression of central TRs belonging to the TR network displayed stimulus-specific expression patterns, indicating a second level of transcriptional regulation beyond epigenetic chromatin changes. In contrast, stringent integration of epigenetic and transcriptional regulation was observed in networks of TRs established from somatic tissues and tissue macrophages. In these networks, clusters of TRs with permissive histone marks were associated with high gene expression whereas clusters with repressive chromatin marks were associated with absent gene expression. Collectively, these results support that macrophage activation during inflammation in contrast to lineage determination is mainly regulated transcriptionally by a pre-defined TR network.

  20. Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells.

    PubMed

    Min, Irene M; Waterfall, Joshua J; Core, Leighton J; Munroe, Robert J; Schimenti, John; Lis, John T

    2011-04-01

    Transitions between pluripotent stem cells and differentiated cells are executed by key transcription regulators. Comparative measurements of RNA polymerase distribution over the genome's primary transcription units in different cell states can identify the genes and steps in the transcription cycle that are regulated during such transitions. To identify the complete transcriptional profiles of RNA polymerases with high sensitivity and resolution, as well as the critical regulated steps upon which regulatory factors act, we used genome-wide nuclear run-on (GRO-seq) to map the density and orientation of transcriptionally engaged RNA polymerases in mouse embryonic stem cells (ESCs) and mouse embryonic fibroblasts (MEFs). In both cell types, progression of a promoter-proximal, paused RNA polymerase II (Pol II) into productive elongation is a rate-limiting step in transcription of ∼40% of mRNA-encoding genes. Importantly, quantitative comparisons between cell types reveal that transcription is controlled frequently at paused Pol II's entry into elongation. Furthermore, "bivalent" ESC genes (exhibiting both active and repressive histone modifications) bound by Polycomb group complexes PRC1 (Polycomb-repressive complex 1) and PRC2 show dramatically reduced levels of paused Pol II at promoters relative to an average gene. In contrast, bivalent promoters bound by only PRC2 allow Pol II pausing, but it is confined to extremely 5' proximal regions. Altogether, these findings identify rate-limiting targets for transcription regulation during cell differentiation.

  1. Transcription factor NF-Y is a functional regulator of the transcription of core clock gene Bmal1.

    PubMed

    Xiao, Jun; Zhou, Yongchun; Lai, Hao; Lei, Shi; Chi, Lisa H; Mo, Xianwei

    2013-11-01

    The circadian clock enables organisms to adjust to daily environmental changes and synchronize multiple molecular, biochemical, physiological, and behavioral processes accordingly. In mammalian clock work, Bmal1 is the most important core clock gene, which works with another core clock gene Clock to drive the expression of other clock genes and clock-controlled genes. However, the regulation of Bmal1 has not been fully understood. This work was aimed at identifying the positive regulator(s) of Bmal1 transcription. A series of 5' deletion reporter constructs was generated, and binding site mutations of mouse Bmal1 promoter fragments were cloned into pGL3-basic and pGL3(R2.1)-basic plasmids and transfected into NIH 3T3 cells. Luciferase activity was either measured 48 h after transfection or recorded for 4 days after serum shock. DNA affinity precipitation assay was used to detect the transcription factors binding to Bmal1 promoter. Small interfering RNA against nuclear factor Y, subunit A (NF-YA) and dominant negative NF-YA were employed to study the role of NF-Y in Bmal1 transcription regulation. Deletion and mutation analyses identified two clusters of CCAAT/GC-boxes at the proximal region of Bmal1 promoter as the activating cis-elements. Bmal1 promoter activity was up-regulated by NF-Y and/or Sp1 and repressed by dominant negative NF-YA or siRNA against NF-YA. The activation of Bmal1 promoter activity by NF-Y and Sp1 was inhibited by Rev-Erbα. DNA affinity precipitation assay showed that NF-Y and Sp1 bound to the two CCAAT/GC clusters of Bmal1 promoter. These results indicate that NF-Y is a functional activator of Bmal1 transcription and it cooperates with Sp1 and Rev-Erbα to generate the daily cycle of Bmal1 expression.

  2. Long noncoding RNA linc00598 regulates CCND2 transcription and modulates the G1 checkpoint.

    PubMed

    Jeong, Oh-Seok; Chae, Yun-Cheol; Jung, Hyeonsoo; Park, Soon Cheol; Cho, Sung-Jin; Kook, Hyun; Seo, SangBeom

    2016-01-01

    Data derived from genomic and transcriptomic analyses have revealed that long noncoding RNAs (lncRNAs) have important roles in the transcriptional regulation of various genes. Recent studies have identified the mechanism underlying this function. To date, a variety of noncoding transcripts have been reported to function in conjunction with epigenetic regulator proteins. In this study, we investigated the function of linc00598, which is transcribed by a genomic sequence on chromosome 13, downstream of FoxO1 and upstream of COG6. Microarray analysis showed that linc00598 regulates the transcription of specific target genes, including those for cell cycle regulators. We discovered that linc00598 regulates CCND2 transcription through modulation of the transcriptional regulatory effect of FoxO1 on the CCND2 promoter. Moreover, we observed that knockdown of linc00598 induced G0/G1 cell cycle arrest and inhibited proliferation. These data indicate that linc00598 plays an important role in cell cycle regulation and proliferation through its ability to regulate the transcription of CCND2. PMID:27572135

  3. Long noncoding RNA linc00598 regulates CCND2 transcription and modulates the G1 checkpoint

    PubMed Central

    Jeong, Oh-Seok; Chae, Yun-Cheol; Jung, Hyeonsoo; Park, Soon Cheol; Cho, Sung-Jin; Kook, Hyun; Seo, SangBeom

    2016-01-01

    Data derived from genomic and transcriptomic analyses have revealed that long noncoding RNAs (lncRNAs) have important roles in the transcriptional regulation of various genes. Recent studies have identified the mechanism underlying this function. To date, a variety of noncoding transcripts have been reported to function in conjunction with epigenetic regulator proteins. In this study, we investigated the function of linc00598, which is transcribed by a genomic sequence on chromosome 13, downstream of FoxO1 and upstream of COG6. Microarray analysis showed that linc00598 regulates the transcription of specific target genes, including those for cell cycle regulators. We discovered that linc00598 regulates CCND2 transcription through modulation of the transcriptional regulatory effect of FoxO1 on the CCND2 promoter. Moreover, we observed that knockdown of linc00598 induced G0/G1 cell cycle arrest and inhibited proliferation. These data indicate that linc00598 plays an important role in cell cycle regulation and proliferation through its ability to regulate the transcription of CCND2. PMID:27572135

  4. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants

    PubMed Central

    Nuruzzaman, Mohammed; Sharoni, Akhter M.; Kikuchi, Shoshi

    2013-01-01

    NAC transcription factors are one of the largest families of transcriptional regulators in plants, and members of the NAC gene family have been suggested to play important roles in the regulation of the transcriptional reprogramming associated with plant stress responses. A phylogenetic analysis of NAC genes, with a focus on rice and Arabidopsis, was performed. Herein, we present an overview of the regulation of the stress responsive NAC SNAC/(IX) group of genes that are implicated in the resistance to different stresses. SNAC factors have important roles for the control of biotic and abiotic stresses tolerance and that their overexpression can improve stress tolerance via biotechnological approaches. We also review the recent progress in elucidating the roles of NAC transcription factors in plant biotic and abiotic stresses. Modification of the expression pattern of transcription factor genes and/or changes in their activity contribute to the elaboration of various signaling pathways and regulatory networks. However, a single NAC gene often responds to several stress factors, and their protein products may participate in the regulation of several seemingly disparate processes as negative or positive regulators. Additionally, the NAC proteins function via auto-regulation or cross-regulation is extensively found among NAC genes. These observations assist in the understanding of the complex mechanisms of signaling and transcriptional reprogramming controlled by NAC proteins. PMID:24058359

  5. Synergistic transcriptional and post-transcriptional regulation of ESC characteristics by core pluripotency transcription factors in protein-protein interaction networks.

    PubMed

    Li, Leijie; Zhang, Liangcai; Liu, Guiyou; Feng, Rennan; Jiang, Yongshuai; Yang, Lei; Zhang, Shihua; Liao, Mingzhi; Hua, Jinlian

    2014-01-01

    The molecular mechanism that maintains the pluripotency of embryonic stem cells (ESCs) is not well understood but may be reflected in complex biological networks. However, there have been few studies on the effects of transcriptional and post-transcriptional regulation during the development of ESCs from the perspective of computational systems biology. In this study, we analyzed the topological properties of the "core" pluripotency transcription factors (TFs) OCT4, SOX2 and NANOG in protein-protein interaction networks (PPINs). Further, we identified synergistic interactions between these TFs and microRNAs (miRNAs) in PPINs during ESC development. Results show that there were significant differences in centrality characters between TF-targets and non-TF-targets in PPINs. We also found that there was consistent regulation of multiple "core" pluripotency TFs. Based on the analysis of shortest path length, we found that the module properties were not only within the targets regulated by common or multiple "core" pluripotency TFs but also between the groups of targets regulated by different TFs. Finally, we identified synergistic regulation of these TFs and miRNAs. In summary, the synergistic effects of "core" pluripotency TFs and miRNAs were analyzed using computational methods in both human and mouse PPINs. PMID:25171496

  6. The Transcriptional Cascade in the Heat Stress Response of Arabidopsis Is Strictly Regulated at the Level of Transcription Factor Expression.

    PubMed

    Ohama, Naohiko; Kusakabe, Kazuya; Mizoi, Junya; Zhao, Huimei; Kidokoro, Satoshi; Koizumi, Shinya; Takahashi, Fuminori; Ishida, Tetsuya; Yanagisawa, Shuichi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2016-01-01

    Group A1 heat shock transcription factors (HsfA1s) are the master regulators of the heat stress response (HSR) in plants. Upon heat shock, HsfA1s trigger a transcriptional cascade that is composed of many transcription factors. Despite the importance of HsfA1s and their downstream transcriptional cascade in the acquisition of thermotolerance in plants, the molecular basis of their activation remains poorly understood. Here, domain analysis of HsfA1d, one of several HsfA1s in Arabidopsis thaliana, demonstrated that the central region of HsfA1d is a key regulatory domain that represses HsfA1d transactivation activity through interaction with HEAT SHOCK PROTEIN70 (HSP70) and HSP90. We designated this region as the temperature-dependent repression (TDR) domain. We found that HSP70 dissociates from HsfA1d in response to heat shock and that the dissociation is likely regulated by an as yet unknown activation mechanism, such as HsfA1d phosphorylation. Overexpression of constitutively active HsfA1d that lacked the TDR domain induced expression of heat shock proteins in the absence of heat stress, thereby conferring potent thermotolerance on the overexpressors. However, transcriptome analysis of the overexpressors demonstrated that the constitutively active HsfA1d could not trigger the complete transcriptional cascade under normal conditions, thereby indicating that other factors are necessary to fully induce the HSR. These complex regulatory mechanisms related to the transcriptional cascade may enable plants to respond resiliently to various heat stress conditions. PMID:26715648

  7. Genomic approaches to identifying transcriptional regulators of osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Civitelli, Roberto

    2003-01-01

    Recent microarray studies of mouse and human osteoblast differentiation in vitro have identified novel transcription factors that may be important in the establishment and maintenance of differentiation. These findings help unravel the pattern of gene-expression changes that underly the complex process of bone formation.

  8. Selective autophagic receptor p62 regulates the abundance of transcriptional coregulator ARIP4 during nutrient starvation

    PubMed Central

    Tsuchiya, Megumi; Isogai, Shin; Taniguchi, Hiroaki; Tochio, Hidehito; Shirakawa, Masahiro; Morohashi, Ken-ichirou; Hiraoka, Yasushi; Haraguchi, Tokuko; Ogawa, Hidesato

    2015-01-01

    Transcriptional coregulators contribute to several processes involving nuclear receptor transcriptional regulation. The transcriptional coregulator androgen receptor-interacting protein 4 (ARIP4) interacts with nuclear receptors and regulates their transcriptional activity. In this study, we identified p62 as a major interacting protein partner for ARIP4 in the nucleus. Nuclear magnetic resonance analysis demonstrated that ARIP4 interacts directly with the ubiquitin-associated (UBA) domain of p62. ARIP4 and ubiquitin both bind to similar amino acid residues within UBA domains; therefore, these proteins may possess a similar surface structure at their UBA-binding interfaces. We also found that p62 is required for the regulation of ARIP4 protein levels under nutrient starvation conditions. We propose that p62 is a novel binding partner for ARIP4, and that its binding regulates the cellular protein level of ARIP4 under conditions of metabolic stress. PMID:26412716

  9. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  10. Transcriptional programs regulated by both LEAFY and APETALA1 at the time of flower formation.

    PubMed

    Winter, Cara M; Yamaguchi, Nobutoshi; Wu, Miin-Feng; Wagner, Doris

    2015-09-01

    Two key regulators of the switch to flower formation and of flower patterning in Arabidopsis are the plant-specific helix-turn-helix transcription factor LEAFY (LFY) and the MADS box transcription factor APETALA1 (AP1). The interactions between these two transcriptional regulators are complex. AP1 is both a direct target of LFY and can act in parallel with LFY. Available genetic and molecular evidence suggests that LFY and AP1 together orchestrate the switch to flower formation and early events during flower morphogenesis by altering transcriptional programs. However, very little is known about target genes regulated by both transcription factors. Here, we performed a meta-analysis of public datasets to identify genes that are likely to be regulated by both LFY and AP1. Our analyses uncovered known and novel direct LFY and AP1 targets with a role in the control of onset of flower formation. It also identified additional families of proteins and regulatory pathways that may be under transcriptional control by both transcription factors. In particular, several of these genes are linked to response to hormones, to transport and to development. Finally, we show that the gibberellin catabolism enzyme ELA1, which was recently shown to be important for the timing of the switch to flower formation, is positively feedback-regulated by AP1. Our study contributes to the elucidation of the regulatory network that leads to formation of a vital plant organ system, the flower.

  11. Histone chaperones Nap1 and Vps75 regulate histone acetylation during transcription elongation.

    PubMed

    Xue, Yu-Ming; Kowalska, Anna K; Grabowska, Kamila; Przybyt, Katarzyna; Cichewicz, Magda A; Del Rosario, Brian C; Pemberton, Lucy F

    2013-04-01

    Histone chaperones function in chromatin assembly and disassembly, suggesting they have important regulatory roles in transcription elongation. The Saccharomyces cerevisiae proteins Nap1 and Vps75 are structurally related, evolutionarily conserved histone chaperones. We showed that Nap1 genetically interacts with several transcription elongation factors and that both Nap1 and Vps75 interact with the RNA polymerase II kinase, CTK1. Loss of NAP1 or VPS75 suppressed cryptic transcription within the open reading frame (ORF) observed when strains are deleted for the kinase CTK1. Loss of the histone acetyltransferase Rtt109 also suppressed ctk1-dependent cryptic transcription. Vps75 regulates Rtt109 function, suggesting that they function together in this process. Histone H3 K9 was found to be the important lysine that is acetylated by Rtt109 during ctk1-dependent cryptic transcription. We showed that both Vps75 and Nap1 regulate the relative level of H3 K9 acetylation in the STE11 ORF. This supports a model in which Nap1, like Vps75, directly regulates Rtt109 activity or regulates the assembly of acetylated chromatin. Although Nap1 and Vps75 share many similarities, due to their distinct interactions with SET2, Nap1 and Vps75 may also play separate roles during transcription elongation. This work sheds further light on the importance of histone chaperones as general regulators of transcription elongation. PMID:23401858

  12. OsDREB2A, a rice transcription factor, significantly affects salt tolerance in transgenic soybean.

    PubMed

    Zhang, Xiu-Xiang; Tang, Yu-Juan; Ma, Qi-Bin; Yang, Cun-Yi; Mu, Ying-Hui; Suo, Hai-Cui; Luo, Lai-Hui; Nian, Hai

    2013-01-01

    The dehydration responsive element binding (DREB) transcription factors play an important role in regulating stress-related genes. OsDREB2A, a member of the DREBP subfamily of AP2/ERF transcription factors in rice (Oryza sativa), is involved in the abiotic stress response. OsDREB2A expression is induced by drought, low-temperature and salt stresses. Here, we report the ability of OsDREB2A to regulate high-salt response in transgenic soybean. Overexpressing OsDREB2A in soybeans enhanced salt tolerance by accumulating osmolytes, such as soluble sugars and free proline, and improving the expression levels of some stress-responsive transcription factors and key genes. The phenotypic characterization of transgenic soybean were significantly better than those of wild-type (WT). Electrophoresis mobility shift assay (EMSA) revealed that the OsDREB2A can bind to the DRE core element in vitro. These results indicate that OsDREB2A may participate in abiotic stress by directly binding with DRE element to regulate the expression of downstream genes. Overexpression of OsDREB2A in soybean might be used to improve tolerance to salt stress.

  13. Transcription Factor ATAF1 in Arabidopsis Promotes Senescence by Direct Regulation of Key Chloroplast Maintenance and Senescence Transcriptional Cascades1[OPEN

    PubMed Central

    Garapati, Prashanth; Xue, Gang-Ping

    2015-01-01

    Senescence represents a fundamental process of late leaf development. Transcription factors (TFs) play an important role for expression reprogramming during senescence; however, the gene regulatory networks through which they exert their functions, and their physiological integration, are still largely unknown. Here, we identify the Arabidopsis (Arabidopsis thaliana) abscisic acid (ABA)- and hydrogen peroxide-activated TF Arabidopsis thaliana ACTIVATING FACTOR1 (ATAF1) as a novel upstream regulator of senescence. ATAF1 executes its physiological role by affecting both key chloroplast maintenance and senescence-promoting TFs, namely GOLDEN2-LIKE1 (GLK1) and ORESARA1 (ARABIDOPSIS NAC092), respectively. Notably, while ATAF1 activates ORESARA1, it represses GLK1 expression by directly binding to their promoters, thereby generating a transcriptional output that shifts the physiological balance toward the progression of senescence. We furthermore demonstrate a key role of ATAF1 for ABA- and hydrogen peroxide-induced senescence, in accordance with a direct regulatory effect on ABA homeostasis genes, including NINE-CIS-EPOXYCAROTENOID DIOXYGENASE3 involved in ABA biosynthesis and ABC TRANSPORTER G FAMILY MEMBER40, encoding an ABA transport protein. Thus, ATAF1 serves as a core transcriptional activator of senescence by coupling stress-related signaling with photosynthesis- and senescence-related transcriptional cascades. PMID:25953103

  14. Transcriptional regulation of kinases downstream of the T cell receptor: another immunomodulatory mechanism of glucocorticoids

    PubMed Central

    2014-01-01

    Background Glucocorticoids affect peripheral immune responses, including modulation of T-cell activation, differentiation, and apoptosis. The quantity and quality of T-cell receptor (TCR)-triggered intracellular signals modulate T-cell function. Thus, glucocorticoids may affect T cells by interfering with the TCR signaling cascade. The purpose of the study was to search for glucocorticoid-modulated kinases downstream of the TCR. Methods Gene modulation in lymphoid cells either treated with glucocorticoids or from glucocorticoid-treated mice was studied using a RNase protection assay, real-time PCR, and western blotting. The sensitivity of genetically modified thymocytes to glucocorticoid-induced apoptosis was studied by performing hypotonic propidium iodide staining and flow cytometry. The Student’s t-test was employed for statistical evaluation. Results We found that transcription of Itk, a non-receptor tyrosine kinase of the Tec family, was up-regulated in a mouse T-cell hybridoma by the synthetic glucocorticoid dexamethasone. In contrast, dexamethasone down-regulated the expression of Txk, a Tec kinase that functions redundantly with Itk, and Lck, the Src kinase immediately downstream of the TCR. We investigated the expression of Itk, Txk, and Lck in thymocytes and mature lymphocytes following in vitro and in vivo dexamethasone treatment at different time points and doses. Kinase expression was differentially modulated and followed distinct kinetics. Itk was up-regulated in all cell types and conditions tested. Txk was strongly up-regulated in mature lymphocytes but only weakly up-regulated or non-modulated in thymocytes in vitro or in vivo, respectively. Conversely, Lck was down-regulated in thymocytes, but not modulated or up-regulated in mature lymphocytes in the different experimental conditions. This complex behaviour correlates with the presence of both positive and negative glucocorticoid responsive elements (GRE and nGRE, respectively) in the Itk, Txk

  15. Core human mitochondrial transcription apparatus is a regulated two-component system in vitro.

    PubMed

    Shutt, Timothy E; Lodeiro, Maria F; Cotney, Justin; Cameron, Craig E; Shadel, Gerald S

    2010-07-01

    The core human mitochondrial transcription apparatus is currently regarded as an obligate three-component system comprising the bacteriophage T7-related mitochondrial RNA polymerase, the rRNA methyltransferase-related transcription factor, h-mtTFB2, and the high mobility group box transcription/DNA-packaging factor, h-mtTFA/TFAM. Using a faithful recombinant human mitochondrial transcription system from Escherichia coli, we demonstrate that specific initiation from the mtDNA promoters, LSP and HSP1, only requires mitochondrial RNA polymerase and h-mtTFB2 in vitro. When h-mtTFA is added to these basal components, LSP exhibits a much lower threshold for activation and a larger amplitude response than HSP1. In addition, when LSP and HSP1 are together on the same transcription template, h-mtTFA-independent transcription from HSP1 and h-mtTFA-dependent transcription from both promoters is enhanced and a higher concentration of h-mtTFA is required to stimulate HSP1. Promoter competition experiments revealed that, in addition to LSP competing transcription components away from HSP1, additional cis-acting signals are involved in these aspects of promoter regulation. Based on these results, we speculate that the human mitochondrial transcription system may have evolved to differentially regulate transcription initiation and transcription-primed mtDNA replication in response to the amount of h-mtTFA associated with nucleoids, which could begin to explain the heterogeneity of nucleoid structure and activity in vivo. Furthermore, this study sheds new light on the evolution of mitochondrial transcription components by showing that the human system is a regulated two-component system in vitro, and thus more akin to that of budding yeast than thought previously.

  16. Core human mitochondrial transcription apparatus is a regulated two-component system in vitro

    PubMed Central

    Shutt, Timothy E.; Lodeiro, Maria F.; Cotney, Justin; Cameron, Craig E.; Shadel, Gerald S.

    2010-01-01

    The core human mitochondrial transcription apparatus is currently regarded as an obligate three-component system comprising the bacteriophage T7-related mitochondrial RNA polymerase, the rRNA methyltransferase-related transcription factor, h-mtTFB2, and the high mobility group box transcription/DNA-packaging factor, h-mtTFA/TFAM. Using a faithful recombinant human mitochondrial transcription system from Escherichia coli, we demonstrate that specific initiation from the mtDNA promoters, LSP and HSP1, only requires mitochondrial RNA polymerase and h-mtTFB2 in vitro. When h-mtTFA is added to these basal components, LSP exhibits a much lower threshold for activation and a larger amplitude response than HSP1. In addition, when LSP and HSP1 are together on the same transcription template, h-mtTFA-independent transcription from HSP1 and h-mtTFA-dependent transcription from both promoters is enhanced and a higher concentration of h-mtTFA is required to stimulate HSP1. Promoter competition experiments revealed that, in addition to LSP competing transcription components away from HSP1, additional cis-acting signals are involved in these aspects of promoter regulation. Based on these results, we speculate that the human mitochondrial transcription system may have evolved to differentially regulate transcription initiation and transcription-primed mtDNA replication in response to the amount of h-mtTFA associated with nucleoids, which could begin to explain the heterogeneity of nucleoid structure and activity in vivo. Furthermore, this study sheds new light on the evolution of mitochondrial transcription components by showing that the human system is a regulated two-component system in vitro, and thus more akin to that of budding yeast than thought previously. PMID:20562347

  17. TCERG1 Regulates Alternative Splicing of the Bcl-x Gene by Modulating the Rate of RNA Polymerase II Transcription

    PubMed Central

    Montes, Marta; Cloutier, Alexandre; Sánchez-Hernández, Noemí; Michelle, Laetitia; Lemieux, Bruno; Blanchette, Marco; Hernández-Munain, Cristina; Chabot, Benoit

    2012-01-01

    Complex functional coupling exists between transcriptional elongation and pre-mRNA alternative splicing. Pausing sites and changes in the rate of transcription by RNA polymerase II (RNAPII) may therefore have fundamental impacts in the regulation of alternative splicing. Here, we show that the elongation and splicing-related factor TCERG1 regulates alternative splicing of the apoptosis gene Bcl-x in a promoter-dependent manner. TCERG1 promotes the splicing of the short isoform of Bcl-x (Bcl-xs) through the SB1 regulatory element located in the first half of exon 2. Consistent with these results, we show that TCERG1 associates with the Bcl-x pre-mRNA. A transcription profile analysis revealed that the RNA sequences required for the effect of TCERG1 on Bcl-x alternative splicing coincide with a putative polymerase pause site. Furthermore, TCERG1 modifies the impact of a slow polymerase on Bcl-x alternative splicing. In support of a role for an elongation mechanism in the transcriptional control of Bcl-x alternative splicing, we found that TCERG1 modifies the amount of pre-mRNAs generated at distal regions of the endogenous Bcl-x. Most importantly, TCERG1 affects the rate of RNAPII transcription of endogenous human Bcl-x. We propose that TCERG1 modulates the elongation rate of RNAPII to relieve pausing, thereby activating the proapoptotic Bcl-xS 5′ splice site. PMID:22158966

  18. How to control self-digestion: transcriptional, post-transcriptional, and post-translational regulation of autophagy

    PubMed Central

    Feng, Yuchen; Yao, Zhiyuan; Klionsky, Daniel J.

    2015-01-01

    Macroautophagy (hereafter autophagy), literally defined as a type of self-eating, is a dynamic cellular process in which cytoplasm is sequestered within a unique compartment termed the phagophore. Upon completion, the phagophore matures into a double-membrane autophagosome that fuses with the lysosome or vacuole, allowing degradation of the cargo. Nonselective autophagy is primarily a cytoprotective response to various types of stress; however, the process can also be highly selective. Autophagy is involved in various aspects of cell physiology, and its dysregulation is associated with a range of diseases. The regulation of autophagy is complex, and the process must be properly modulated to maintain cellular homeostasis. In this review, we focus on the current state of knowledge concerning transcriptional, post-transcriptional, and post-translational regulation of autophagy in yeast and mammals. PMID:25759175

  19. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    SciTech Connect

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  20. Transcriptional regulation of OCT4 by the ETS transcription factor ESE-1 in NCCIT human embryonic carcinoma cells.

    PubMed

    Park, Sung-Won; Do, Hyun-Jin; Ha, Woo Tae; Han, Mi-Hee; Yang, Heung-Mo; Lee, Soo-Hong; Song, Hyuk; Kim, Nam-Hyung; Kim, Jae-Hwan

    2014-07-25

    The epithelium-specific ETS transcription factor-1 (ESE-1) is physiologically important in the pathogenesis of various diseases. Recently, OCT4, a transcription factor involved in stem cell pluripotency, has been implicated in tumorigenesis. In this study, we invested the molecular mechanism by which ESE-1 regulates transcription of OCT4 in NCCIT human embryonic carcinoma cells. Real-time PCR analysis revealed that OCT4 levels were high in undifferentiated NCCIT cells but significantly decreased upon retinoic acid-mediated differentiation, concomitant with up-regulation of ESE-1 expression. OCT4 mRNA level rose following shRNA-mediated knockdown of ESE-1, but declined when ESE-1 was overexpressed, suggesting that the expression levels of OCT4 and ESE-1 may be coordinated in an opposite manner. Promoter-reporter assays revealed that induced OCT4 promoter activity in NCCIT cells was significantly down-regulated by ESE-1 overexpression in a dose-dependent manner. The inhibitory effect of ESE-1 on OCT4 promoter activity was relieved by co-expression of an ESE-1 mutant lacking the transactivation domain, but not by mutants lacking other domains. Serial deletion and site-directed mutagenesis of the OCT4 promoter revealed that a potential ETS binding site (EBS) is present in the conserved region 2 (CR2). ESE-1 interacted with the EBS element in CR2 and enrichment of CR2 significantly increased upon RA-mediated differentiation of NCCIT cells, suggesting that this binding is likely to be involved in ESE-1-mediated repression of OCT4 promoter activity upon differentiation. Taken together, the results of this study reveal the molecular details of the mechanism by which the oncogenic factor ESE-1 regulates expression of the stem cell transcription factor OCT4 in pluripotent NCCIT cells.

  1. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.

    2014-01-01

    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  2. Recent advances in the transcriptional regulation of the flavonoid biosynthetic pathway.

    PubMed

    Hichri, Imène; Barrieu, François; Bogs, Jochen; Kappel, Christian; Delrot, Serge; Lauvergeat, Virginie

    2011-05-01

    Flavonoids are secondary metabolites involved in several aspects of plant development and defence. They colour fruits and flowers, favouring seed and pollen dispersal, and contribute to plant adaptation to environmental conditions such as cold or UV stresses, and pathogen attacks. Because they affect the quality of flowers (for horticulture), fruits and vegetables, and their derivatives (colour, aroma, stringency, etc.), flavonoids have a high economic value. Furthermore, these compounds possess pharmaceutical properties extremely attractive for human health. Thanks to easily detectable mutant phenotypes, such as modification of petal pigmentation and seeds exhibiting transparent testa, the enzymes involved in the flavonoid biosynthetic pathway have been characterized in several plant species. Conserved features as well as specific differences have been described. Regulation of structural gene expression appears tightly organized in a spatial and temporal way during plant development, and is orchestrated by a ternary complex involving transcription factors from the R2R3-MYB, basic helix-loop-helix (bHLH), and WD40 classes. This MYB-bHLH-WD40 (MBW) complex regulates the genes that encode enzymes specifically involved in the late steps of the pathway leading to the biosynthesis of anthocyanins and condensed tannins. Although several genes encoding transcription factors from these three families have been identified, many gaps remain in our understanding of the regulation of this biosynthetic pathway, especially about the respective roles of bHLH and WD40 proteins. A better knowledge of the regulatory mechanisms of the flavonoid pathway is likely to favour the development of new biotechnological tools for the generation of value-added plants with optimized flavonoid content.

  3. 3{prime} UTR sequence-specific mRNA-protein complexes and the post-transcriptional regulation of catalase

    SciTech Connect

    Reimer, D.L.; Ott, R.N.; Singh, S.M.

    1994-09-01

    Recently, sequences in the 3{prime} untranslated region (3{prime} UTR) of some genes have been recognized which may play an important role in the post-transcriptional regulation of gene expression. Mutations in this region of the gene are known to cause at least two diseases including myotonic dystrophy and a lysosomal accumulation disease. The mechanism is thought to involve mRNA-protein interactions that affect translation and/or mRNA stability. Reports of this nature are not common and the significance of the often large 3{prime} UTR on the regulation of gene expression remains speculative. Studies on the 3{prime} UTR mRNA-protein interactions in model eukaryotic genes therefore are critical to better understand the molecular mechanisms involved in post-transcriptional gene regulation. Mouse catalase, encoded by Cas-1, was used as a model to characterize the molecular mechanisms of post-transcriptional gene regulation. The 3{prime} UTR (752 bp) of Cas-1 contains three unusual, near repeats [(CA){sub 31}, (U){sub 15} and (TGTGC){sub 7}]. Gel mobility shift assays using {sup 32}P-labelled transcripts which contain these sequences and tissue homogenates from various sources identified mRNA-protein complexes specific to (CA){sub 31} and (U){sub 15} only. In all strains analyzed, a single protein of 69 kDa which was involved in the (CA){sub 31} complex, was observed in most tissues except lung and was localized to the polysomal fraction. Similarly, two proteins involved in the (U){sub 15} complex, 38 and 47 kDa, were observed in all tissues and strains studied. Only the 38 kDa protein was observed in the polysomal fraction. The results argue for a possible role for these 3{prime} UTR mRNA-binding protein complexes in the post-transcriptional regulation of this antioxidant enzyme.

  4. NFAT transcription factor regulation by urocortin II in cardiac myocytes and heart failure.

    PubMed

    Walther, Stefanie; Awad, Sawsan; Lonchyna, Vassyl A; Blatter, Lothar A

    2014-03-01

    Urocortin II (UcnII), a cardioactive peptide with beneficial effects in normal and failing hearts, is also arrhythmogenic and prohypertrophic. We demonstrated that cardiac effects are mediated by a phosphatidylinositol-3 kinase (PI3K)/Akt kinase (Akt)/endothelial nitric oxide synthase (eNOS)/nitric oxide (NO) signaling pathways. Nuclear factor of activated T-cells (NFAT) transcription factors play a key role in the regulation of gene expression in cardiac development, maintenance of an adult differentiated cardiac phenotype, and remodeling processes in cardiac hypertrophy and heart failure (HF). We tested the hypothesis that UcnII differentially regulates NFAT activity in cardiac myocytes from both normal and failing hearts through the PI3K/Akt/eNOS/NO pathway. Isoforms NFATc1 and NFATc3 revealed different basal subcellular distribution in normal and HF rabbit ventricular myocytes with a nuclear NFATc1 and a cytosolic localization of NFATc3. However, in HF, the nuclear localization of NFATc1 was less pronounced, whereas the nuclear occupancy of NFATc3 was increased. In normal myocytes, UcnII induced nuclear export of NFATc1 and attenuated NFAT-dependent transcriptional activity but did not affect the distribution of NFATc3. In HF UcnII facilitated nuclear export of both isoforms and reduced transcriptional activity. NFAT regulation was mediated by a PI3K/Akt/eNOS/NO signaling cascade that converged on the activation of several kinases, including glycogen synthase kinase-3β (GSK3β), c-Jun NH2-terminal kinase (JNK), p38 mitogen-activated kinase (p38), and PKG, resulting in phosphorylation, deactivation, and nuclear export of NFAT. In conclusion, while NFATc1 and NFATc3 reveal distinct subcellular distribution patterns, both are regulated by the UcnII-PI3K/Akt/eNOS/NO pathway that converges on the activation of NFAT kinases and NFAT inactivation. The data reconcile cardioprotective and prohypertrophic UcnII effects mediated by different NFAT isoforms.

  5. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    SciTech Connect

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-08-23

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  6. CHAPERONE-MEDIATED CHROMATIN ASSEMBLY AND TRANSCRIPTION REGULATION IN XENOPUS LAEVIS

    PubMed Central

    Onikubo, Takashi; Shechter, David

    2016-01-01

    Chromatin is the complex of DNA and histone proteins that is the physiological form of the eukaryotic genome. Chromatin is generally repressive for transcription, especially so during early metazoan development when maternal factors are explicitly in control of new zygotic gene expression. In the important model organism Xenopus laevis, maturing oocytes are transcriptionally active with reduced rates of chromatin assembly, while laid eggs and fertilized embryos have robust rates of chromatin assembly and are transcriptionally repressed. As the DNA-to-cytoplasmic ratio decreases approaching the mid-blastula transition (MBT) and the onset of zygotic transcription activation (ZGA), the chromatin assembly process changes with the concomitant reduction in maternal chromatin components. Chromatin assembly is mediated in part by histone chaperones that store maternal histones and release them into new zygotic chromatin. Here, we review literature on chromatin and transcription in frog embryos and cell-free extracts and highlight key insights demonstrating the roles of maternal and zygotic histone deposition and their relationship with transcriptional regulation. We explore the central historical and recent literature on the use of Xenopus embryos and the key contributions provided by experiments in cell-free oocyte and egg extracts for the interplay between histone chaperones, chromatin assembly, and transcriptional regulation. Ongoing and future studies in Xenopus cell free extracts will likely contribute essential new insights into the interplay between chromatin assembly and transcriptional regulation. PMID:27759155

  7. Regulation of heterochromatin transcription by Snail1/LOXL2 during epithelial-to-mesenchymal transition.

    PubMed

    Millanes-Romero, Alba; Herranz, Nicolás; Perrera, Valentina; Iturbide, Ane; Loubat-Casanovas, Jordina; Gil, Jesús; Jenuwein, Thomas; García de Herreros, Antonio; Peiró, Sandra

    2013-12-12

    Although heterochromatin is enriched with repressive traits, it is also actively transcribed, giving rise to large amounts of noncoding RNAs. Although these RNAs are responsible for the formation and maintenance of heterochromatin, little is known about how their transcription is regulated. Here, we show that the Snail1 transcription factor represses mouse pericentromeric transcription, acting through the H3K4 deaminase LOXL2. Since Snail1 plays a key role in the epithelial-to-mesenchymal transition (EMT), we analyzed the regulation of heterochromatin transcription in this process. At the onset of EMT, one of the major structural heterochromatin proteins, HP1α, is transiently released from heterochromatin foci in a Snail1/LOXL2-dependent manner, concomitantly with a downregulation of major satellite transcription. Moreover, preventing the downregulation of major satellite transcripts compromised the migratory and invasive behavior of mesenchymal cells. We propose that Snail1 regulates heterochromatin transcription through LOXL2, thus creating the favorable transcriptional state necessary for completing EMT.

  8. Gravity changes during animal development affect IgM heavy-chain transcription and probably lymphopoiesis.

    PubMed

    Huin-Schohn, Cécile; Guéguinou, Nathan; Schenten, Véronique; Bascove, Matthieu; Koch, Guillemette Gauquelin; Baatout, Sarah; Tschirhart, Eric; Frippiat, Jean-Pol

    2013-01-01

    Our previous research demonstrated that spaceflight conditions affect antibody production in response to an antigenic stimulation in adult amphibians. Here, we investigated whether antibody synthesis is affected when animal development occurs onboard a space station. To answer this question, embryos of the Iberian ribbed newt, Pleurodeles waltl, were sent to the International Space Station (ISS) before the initiation of immunoglobulin heavy-chain expression. Thus, antibody synthesis began in space. On landing, we determined the effects of spaceflight on P. waltl development and IgM heavy-chain transcription. Results were compared with those obtained using embryos that developed on Earth. We find that IgM heavy-chain transcription is doubled at landing and that spaceflight does not affect P. waltl development and does not induce inflammation. We also recreated the environmental modifications encountered by the embryos during their development onboard the ISS. This strategy allowed us to demonstrate that gravity change is the factor responsible for antibody heavy-chain transcription modifications that are associated with NF-κB mRNA level variations. Taken together, and given that the larvae were not immunized, these data suggest a modification of lymphopoiesis when gravity changes occur during ontogeny.

  9. Pleiohomeotic Interacts with the Core Transcription Elongation Factor Spt5 to Regulate Gene Expression in Drosophila

    PubMed Central

    Jennings, Barbara H.

    2013-01-01

    The early elongation checkpoint regulated by Positive Transcription Elongation Factor b (P-TEFb) is a critical control point for the expression of many genes. Spt5 interacts directly with RNA polymerase II and has an essential role in establishing this checkpoint, and also for further transcript elongation. Here we demonstrate that Drosophila Spt5 interacts both physically and genetically with the Polycomb Group (PcG) protein Pleiohomeotic (Pho), and the majority of Pho binding sites overlap with Spt5 binding sites across the genome in S2 cells. Our results indicate that Pho can interact with Spt5 to regulate transcription elongation in a gene specific manner. PMID:23894613

  10. Coupling transcriptional and post-transcriptional miRNA regulation in the control of cell fate

    PubMed Central

    Shalgi, Reut; Brosh, Ran; Oren, Moshe; Pilpel, Yitzhak; Rotter, Varda

    2009-01-01

    miRNAs function as a critical regulatory layer in development, differentiation, and the maintenance of cell fate. Depletion of miRNAs from embryonic stem cells impairs their differentiation capacity. Total elimination of miRNAs leads to premature senescence in normal cells and tissues through activation of the DNA-damage checkpoint, whereas ablation of miRNAs in cancer cell lines results in an opposite effect, enhancing their tumorigenic potential. Here we compile evidence from the literature that point at miRNAs as key players in the maintenance of genomic integrity and proper cell fate. There is an apparent gap between our understanding of the subtle way by which miRNAs modulate protein levels, and their profound impact on cell fate. We propose that examining miRNAs in the context of the regulatory transcriptional and post-transcriptional networks they are embedded in may provide a broader view of their role in controlling cell fate. PMID:20157565

  11. Evolution of transcription-regulating proteins: caveat lector!

    PubMed

    Arst, H N; Holden, D W; Caddick, M X

    1997-07-11

    The paper of Hawkins et al. [Gene 146 (1994) 145-158] reports incorrect descriptions of mutant phenotypes, omits mention of the absence of a highly relevant glutamine-binding site and contains sequence alignments which might mislead the reader. Extensive sequence analysis reveals as untenable a central hypothesis of the paper concerning a possible evolutionary relationship between anthranilate synthetases and the transcription factors mediating nitrogen metabolite repression in fungi. PMID:9253382

  12. Discovery of transcription factors and other candidate regulators of neural crest development

    PubMed Central

    Adams, MS; Gammill, LS; Bronner-Fraser, M

    2011-01-01

    Neural crest cells migrate long distances and form divergent derivatives in vertebrate embryos. Despite previous efforts to identify genes upregulated in neural crest populations, transcription factors have proved to be elusive due to relatively low expression levels and often transient expression. We screened newly induced neural crest cells for early target genes with the aim of identifying transcriptional regulators and other developmentally important genes. This yielded numerous candidate regulators, including fourteen transcription factors, many of which were not previously associated with neural crest development. Quantitative real-time PCR confirmed upregulation of several transcription factors in newly induced neural crest populations in vitro. In a secondary screen by in situ hybridization, we verified the expression of >100 genes in the neural crest. We note that several of the transcription factors and other genes from the screen are expressed in other migratory cell populations and have been implicated in diverse forms of cancer. PMID:18351660

  13. Interplay between transcriptional control and chromatin regulation in the oligodendrocyte lineage

    PubMed Central

    Hernandez, Marylens; Casaccia, Patrizia

    2015-01-01

    The recent years have been characterized by a surge of studies on the role of transcription factors and histone modifications in regulating the progression of progenitors into oligodendrocytes. This review summarizes this body of evidence and presents an integrated view of transcriptional networks and epigenetic regulators defining proliferating progenitors and their differentiation along the oligodendrocyte lineage. We suggest that transcription factors in proliferating progenitors have direct access to DNA, due to predominantly euchromatic nuclei. As progenitors differentiate, however, transcriptional competence is modulated by the formation of heterochromatin, which modifies the association of DNA with nucleosomal histones and renders the access of transcription factor dependent on the activity of epigenetic modulators. These concepts are delineated within the context of development and the potential functional implications are discussed. PMID:25970296

  14. Osterix represses adipogenesis by negatively regulating PPARγ transcriptional activity

    PubMed Central

    Han, Younho; Kim, Chae Yul; Cheong, Heesun; Lee, Kwang Youl

    2016-01-01

    Osterix is a novel bone-related transcription factor involved in osteoblast differentiation, and bone maturation. Because a reciprocal relationship exists between adipocyte and osteoblast differentiation of bone marrow derived mesenchymal stem cells, we hypothesized that Osterix might have a role in adipogenesis. Ablation of Osterix enhanced adipogenesis in 3T3-L1 cells, whereas overexpression suppressed this process and inhibited the expression of adipogenic markers including CCAAT/enhancer-binding protein alpha (C/EBPα) and peroxisome proliferator-activated receptor gamma (PPARγ). Further studies indicated that Osterix significantly decreased PPARγ-induced transcriptional activity. Using co-immunoprecipitation and GST-pull down analysis, we found that Osterix directly interacts with PPARγ. The ligand-binding domain (LBD) of PPARγ was responsible for this interaction, which was followed by repression of PPARγ-induced transcriptional activity, even in the presence of rosiglitazone. Taken together, we identified the Osterix has an important regulatory role on PPARγ activity, which contributed to the mechanism of adipogenesis. PMID:27752121

  15. [Immunoglobulin genes in lymphoid cells and regulation of their transcription].

    PubMed

    Stepchenko, A G; Urakov, D N; Luchina, N N; Deev, S M; Polianovskiĭ, O L

    1990-01-01

    The hybridoma genomes contain polyploid sets of immunoglobulin genes. We have shown, that the hybridoma PTF-02 genome contains three genes of heavy chains and two genes of light chains. The genes responsible for antibody synthesis were cloned and their structure were determined. Investigation of the kappa gene transcription and its fragments which contain regulatory sequences revealed a nuclear factor. The latter interacts with the octanucleotide localized at the promoter region of the kappa gene. The purified factor activates the transcription of the kappa gene in a heterologous cell-free system. Together with the tissue-specific factor there is also an universal factor interacting with the octanucleotide sequence. We have shown an additional factor in lymphoid cells interact with the protein which binds to the octanucleotide sequence. We have shown an additional factor in lymphoid cells interacting with the protein which binds to the octanucleotide sequence. As a result, there is a family of factors which interact with ATTTGCAT sequence. One major factor (m.w. 60 +/- 2 kDa) is an obligatory component for the initiation of immunoglobulin genes transcription.

  16. Post-transcriptional regulation of the chicken thymidine kinase gene.

    PubMed

    Groudine, M; Casimir, C

    1984-02-10

    In attempting to understand the molecular basis of the control of chicken thymidine kinase (cTK) gene expression, we have examined the steady state cTK RNA content, and the patterns of DNA methylation, chromatin structure and endogenous nuclear runoff transcription of this gene in dividing and non-dividing cells. Our results reveal that the steady state level of cTK poly A+ RNA is correlated with the divisional activity of normal avian cells and tissues. However, no differences in the pattern of Hpa II site methylation or chromatin structure are found among cells containing high or undetectable levels of steady state cTK RNA. In addition, no differences in cTK transcription as assayed by nuclear runoff experiments are detectable in isolated nuclei derived from dividing or non-dividing cells containing high or low levels of steady state cTK RNA. These results suggest that the principal control of chicken thymidine kinase gene expression is post-transcriptional in nature.

  17. Retroviral Transcriptional Regulation and Embryonic Stem Cells: War and Peace

    PubMed Central

    Schlesinger, Sharon

    2014-01-01

    Retroviruses have evolved complex transcriptional enhancers and promoters that allow their replication in a wide range of tissue and cell types. Embryonic stem (ES) cells, however, characteristically suppress transcription of proviruses formed after infection by exogenous retroviruses and also of most members of the vast array of endogenous retroviruses in the genome. These cells have unusual profiles of transcribed genes and are poised to make rapid changes in those profiles upon induction of differentiation. Many of the transcription factors in ES cells control both host and retroviral genes coordinately, such that retroviral expression patterns can serve as markers of ES cell pluripotency. This overlap is not coincidental; retrovirus-derived regulatory sequences are often used to control cellular genes important for pluripotency. These sequences specify the temporal control and perhaps “noisy” control of cellular genes that direct proper cell gene expression in primitive cells and their differentiating progeny. The evidence suggests that the viral elements have been domesticated for host needs, reflecting the wide-ranging exploitation of any and all available DNA sequences in assembling regulatory networks. PMID:25547290

  18. Expression and regulation of the Msx1 natural antisense transcript during development.

    PubMed

    Coudert, Amélie E; Pibouin, Laurence; Vi-Fane, Brigitte; Thomas, Bethan L; Macdougall, Mary; Choudhury, Anuradha; Robert, Benoît; Sharpe, Paul T; Berdal, Ariane; Lezot, Frédéric

    2005-01-01

    Bidirectional transcription, leading to the expression of an antisense (AS) RNA partially complementary to the protein coding sense (S) RNA, is an emerging subject in mammals and has been associated with various processes such as RNA interference, imprinting and transcription inhibition. Homeobox genes do not escape this bidirectional transcription, raising the possibility that such AS transcription occurs during embryonic development and may be involved in the complexity of regulation of homeobox gene expression. According to the importance of the Msx1 homeobox gene function in craniofacial development, especially in tooth development, the expression and regulation of its recently identified AS transcripts were investigated in vivo in mouse from E9.5 embryo to newborn, and compared with the S transcript and the encoded protein expression pattern and regulation. The spatial and temporal expression patterns of S, AS transcripts and protein are consistent with a role of AS RNA in the regulation of Msx1 expression in timely controlled developmental sites. Epithelial-mesenchymal interactions were shown to control the spatial organization of S and also AS RNA expression during early patterning of incisors and molars in the odontogenic mesenchyme. To conclude, this study clearly identifies the Msx1 AS RNA involvement during tooth development and evidences a new degree of complexity in craniofacial developmental biology: the implication of endogenous AS RNAs.

  19. Steroid Receptor Coactivator-2 Is a Dual Regulator of Cardiac Transcription Factor Function*

    PubMed Central

    Reineke, Erin L.; Benham, Ashley; Soibam, Benjamin; Stashi, Erin; Taegtmeyer, Heinrich; Entman, Mark L.; Schwartz, Robert J.; O'Malley, Bert W.

    2014-01-01

    We have previously demonstrated the potential role of steroid receptor coactivator-2 (SRC-2) as a co-regulator in the transcription of critical molecules modulating cardiac function and metabolism in normal and stressed hearts. The present study seeks to extend the previous information by demonstrating SRC-2 fulfills this role by serving as a critical coactivator for the transcription and activity of critical transcription factors known to control cardiac growth and metabolism as well as in their downstream signaling. This knowledge broadens our understanding of the mechanism by which SRC-2 acts in normal and stressed hearts and allows further investigation of the transcriptional modifications mediating different types and degrees of cardiac stress. Moreover, the genetic manipulation of SRC-2 in this study is specific for the heart and thereby eliminating potential indirect effects of SRC-2 deletion in other organs. We have shown that SRC-2 is critical to transcriptional control modulated by MEF2, GATA-4, and Tbx5, thereby enhancing gene expression associated with cardiac growth. Additionally, we describe SRC-2 as a novel regulator of PPARα expression, thus controlling critical steps in metabolic gene expression. We conclude that through regulation of cardiac transcription factor expression and activity, SRC-2 is a critical transcriptional regulator of genes important for cardiac growth, structure, and metabolism, three of the main pathways altered during the cardiac stress response. PMID:24811170

  20. Steroid receptor coactivator-2 is a dual regulator of cardiac transcription factor function.

    PubMed

    Reineke, Erin L; Benham, Ashley; Soibam, Benjamin; Stashi, Erin; Taegtmeyer, Heinrich; Entman, Mark L; Schwartz, Robert J; O'Malley, Bert W

    2014-06-20

    We have previously demonstrated the potential role of steroid receptor coactivator-2 (SRC-2) as a co-regulator in the transcription of critical molecules modulating cardiac function and metabolism in normal and stressed hearts. The present study seeks to extend the previous information by demonstrating SRC-2 fulfills this role by serving as a critical coactivator for the transcription and activity of critical transcription factors known to control cardiac growth and metabolism as well as in their downstream signaling. This knowledge broadens our understanding of the mechanism by which SRC-2 acts in normal and stressed hearts and allows further investigation of the transcriptional modifications mediating different types and degrees of cardiac stress. Moreover, the genetic manipulation of SRC-2 in this study is specific for the heart and thereby eliminating potential indirect effects of SRC-2 deletion in other organs. We have shown that SRC-2 is critical to transcriptional control modulated by MEF2, GATA-4, and Tbx5, thereby enhancing gene expression associated with cardiac growth. Additionally, we describe SRC-2 as a novel regulator of PPARα expression, thus controlling critical steps in metabolic gene expression. We conclude that through regulation of cardiac transcription factor expression and activity, SRC-2 is a critical transcriptional regulator of genes important for cardiac growth, structure, and metabolism, three of the main pathways altered during the cardiac stress response. PMID:24811170

  1. FoxO1 Deacetylation Regulates Thyroid Hormone-induced Transcription of Key Hepatic Gluconeogenic Genes*

    PubMed Central

    Singh, Brijesh Kumar; Sinha, Rohit Anthony; Zhou, Jin; Xie, Sherwin Ying; You, Seo-Hee; Gauthier, Karine; Yen, Paul Michael

    2013-01-01

    Hepatic gluconeogenesis is a concerted process that integrates transcriptional regulation with hormonal signals. A major regulator is thyroid hormone (TH), which acts through its nuclear receptor (TR) to induce the expression of the hepatic gluconeogenic genes, phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC). Forkhead transcription factor FoxO1 also is an important regulator of these genes; however, its functional interactions with TR are not known. Here, we report that TR-mediated transcriptional activation of PCK1 and G6PC in human hepatic cells and mouse liver was FoxO1-dependent and furthermore required FoxO1 deacetylation by the NAD+-dependent deacetylase, SirT1. siRNA knockdown of FoxO1 decreased, whereas overexpression of FoxO1 increased, TH-dependent transcriptional activation of PCK1 and G6PC in cultured hepatic cells. FoxO1 siRNA knockdown also decreased TH-mediated transcription in vivo. Additionally, TH was unable to induce FoxO1 deacetylation or hepatic PCK1 gene expression in TH receptor β-null (TRβ−/−) mice. Moreover, TH stimulated FoxO1 recruitment to the PCK1 and G6PC gene promoters in a SirT1-dependent manner. In summary, our results show that TH-dependent deacetylation of a second metabolically regulated transcription factor represents a novel mechanism for transcriptional integration of nuclear hormone action with cellular energy status. PMID:23995837

  2. The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

    SciTech Connect

    Pan, Yi; Fiscus, Valena; Meng, Wuyi; Zheng, Zhida; Zhang, Lian-Hui; Fuqua, Clay; Chen, Lingling

    2012-02-08

    The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA binding activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.

  3. Transformation/Transcription Domain-Associated Protein (TRRAP)-Mediated Regulation of Wee1

    PubMed Central

    Calonge, Teresa M.; Eshaghi, Majid; Liu, Jianhua; Ronai, Ze'ev; O'Connell, Matthew J.

    2010-01-01

    The G2 DNA damage checkpoint inhibits Cdc2 and mitotic entry through the dual regulation of Wee1 and Cdc25 by the Chk1 effector kinase. Upregulation of Chk1 by mutation or overexpression bypasses the requirement for upstream regulators or DNA damage to promote a G2 cell cycle arrest. We screened in fission yeast for mutations that rendered cells resistant to overexpressed chk1+. We identified a mutation in tra1, which encodes one of two homologs of transformation/transcription domain-associated protein (TRRAP), an ATM/R-related pseudokinase that scaffolds several histone acetyltransferase (HAT) complexes. Inhibition of histone deacetylases reverts the resistance to overexpressed chk1+, suggesting this phenotype is due to a HAT activity, although expression of checkpoint and cell cycle genes is not greatly affected. Cells with mutant or deleted tra1 activate Chk1 normally and are checkpoint proficient. However, these cells are semi-wee even when overexpressing chk1+ and accumulate inactive Wee1 protein. The changed division response (Cdr) kinases Cdr1 and Cdr2 are negative regulators of Wee1, and we show that they are required for the Tra1-dependent alterations to Wee1 function. This identifies Tra1 as another component controlling the timing of entry into mitosis via Cdc2 activation. PMID:20194963

  4. The Mycobacterium tuberculosis transcriptional repressor EthR is negatively regulated by Serine/Threonine phosphorylation.

    PubMed

    Leiba, Jade; Carrère-Kremer, Séverine; Blondiaux, Nicolas; Dimala, Martin Moune; Wohlkönig, Alexandre; Baulard, Alain; Kremer, Laurent; Molle, Virginie

    2014-04-18

    Recent efforts have underlined the role of Serine/Threonine Protein Kinases (STPKs) in growth, pathogenesis and cell wall metabolism in mycobacteria. Herein, we demonstrated that the Mycobacterium tuberculosis EthR, a transcriptional repressor that regulates the activation process of the antitubercular drug ethionamide (ETH) is a specific substrate of the mycobacterial kinase PknF. ETH is a prodrug that must undergo bioactivation by the monooxygenease EthA to exert its antimycobacterial activity and previous studies reported that EthR represses transcription of ethA by binding to the ethA-ethR intergenic region. Mass spectrometry analyses and site-directed mutagenesis identified a set of four phosphoacceptors, namely Thr2, Thr3, Ser4 and Ser7. This was further supported by the complete loss of PknF-dependent phosphorylation of a phosphoablative EthR mutant protein. Importantly, a phosphomimetic version of EthR, in which all phosphosites were replaced by Asp residues, exhibited markedly decreased DNA-binding activity compared with the wild-type protein. Together, these findings are the first demonstration of EthR phosphorylation and indicate that phosphorylation negatively affects its DNA-binding activity, which may impact ETH resistance levels in M. tb.

  5. Kctd10 regulates heart morphogenesis by repressing the transcriptional activity of Tbx5a in zebrafish

    NASA Astrophysics Data System (ADS)

    Tong, Xiangjun; Zu, Yao; Li, Zengpeng; Li, Wenyuan; Ying, Lingxiao; Yang, Jing; Wang, Xin; He, Shuonan; Liu, Da; Zhu, Zuoyan; Chen, Jianming; Lin, Shuo; Zhang, Bo

    2014-01-01

    The T-box transcription factor Tbx5 (Tbx5a in zebrafish) plays a crucial role in the formation of cardiac chambers in a dose-dependent manner. Its deregulation leads to congenital heart disease. However, little is known regarding its regulation. Here we isolate a zebrafish mutant with heart malformations, called 34c. The affected gene is identified as kctd10, a member of the potassium channel tetramerization domain (KCTD)-containing family. In the mutant, the expressions of the atrioventricular canal marker genes, such as tbx2b, hyaluronan synthase 2 (has2), notch1b and bmp4, are changed. The knockdown of tbx5 rescues the ectopic expression of has2, and knockdown of either tbx5a or has2 alleviates the heart defects. We show that Kctd10 directly binds to Tbx5 to repress its transcriptional activity. Our results reveal a new essential factor for cardiac development and suggest that KCTD10 could be considered as a new causative gene of congenital heart disease.

  6. Characterization of TRAP-mediated regulation of the B. subtilis trp operon using in vitro transcription and transcriptional reporter fusions in vivo.

    PubMed

    McAdams, Natalie M; Gollnick, Paul

    2015-01-01

    In Bacillus subtilis, transcription of the tryptophan biosynthetic operon is regulated by an attenuation mechanism involving two alternative RNA secondary structures in the 5' leader region upstream of the structural genes. Regulation is accomplished, at least in part, by controlling which RNA structure forms during transcription of the operon. When intracellular tryptophan levels are high, the trp RNA-binding attenuation protein (TRAP) binds to the nascent trp mRNA to promote formation of a transcription terminator structure so as to induce transcription termination prior to the structural genes. In limiting tryptophan, TRAP does not bind, the alternative antiterminator RNA structure forms, and the operon is transcribed. Several in vitro and in vivo assays have been utilized to study TRAP-mediated regulation of both transcription and translation. Here, we describe using in vitro transcription attenuation assays and in vivo trp-lacZ fusions to examine TRAP-mediated regulation of the trp genes. PMID:25579595