Science.gov

Sample records for affect transcriptional regulation

  1. Transcriptional regulation is affected by subnuclear targeting of reporter plasmids to PML nuclear bodies.

    PubMed

    Block, Gregory J; Eskiw, Christopher H; Dellaire, Graham; Bazett-Jones, David P

    2006-12-01

    Whereas the PML protein has been reported to have both transcriptional coactivator and corepressor potential, the contribution of the PML nuclear body (PML NB) itself to transcriptional regulation is not well understood. Here we demonstrate that plasmid DNA artificially tethered to PML or the PML NB-targeting domain of Sp100 is preferentially localized to PML NBs. Using the tethering technique, we targeted a simian virus 40 promoter-driven luciferase reporter plasmid to PML NBs, resulting in the repression of the transgene transcriptional activity. Conversely, the tethering of a cytomegalovirus promoter-containing reporter plasmid resulted in activation. Targeting a minimal eukaryotic promoter did not affect its activity. The expression of targeted promoters could be modulated by altering the cellular concentration of PML NB components, including Sp100 and isoforms of the PML protein. Finally, we demonstrate that ICP0, the promiscuous herpes simplex virus transactivator, increases the level of transcriptional activation of plasmid DNA tethered to the PML NB. We conclude that when PML NB components are artificially tethered to reporter plasmids, the PML NB contributes to the regulation of the tethered DNA in a promoter-dependent manner. Our findings demonstrate that transient transcription assays are sensitive to the subnuclear localization of the transgene plasmid.

  2. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    SciTech Connect

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-04-23

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic {beta}-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  3. Eccentric exercise activates novel transcriptional regulation of hypertrophic signaling pathways not affected by hormone changes.

    PubMed

    MacNeil, Lauren G; Melov, Simon; Hubbard, Alan E; Baker, Steven K; Tarnopolsky, Mark A

    2010-05-18

    Unaccustomed eccentric exercise damages skeletal muscle tissue, activating mechanisms of recovery and remodeling that may be influenced by the female sex hormone 17beta-estradiol (E2). Using high density oligonucleotide based microarrays, we screened for differences in mRNA expression caused by E2 and eccentric exercise. After random assignment to 8 days of either placebo (CON) or E2 (EXP), eighteen men performed 150 single-leg eccentric contractions. Muscle biopsies were collected at baseline (BL), following supplementation (PS), +3 hours (3H) and +48 hours (48H) after exercise. Serum E2 concentrations increased significantly with supplementation (P<0.001) but did not affect microarray results. Exercise led to early transcriptional changes in striated muscle activator of Rho signaling (STARS), Rho family GTPase 3 (RND3), mitogen activated protein kinase (MAPK) regulation and the downstream transcription factor FOS. Targeted RT-PCR analysis identified concurrent induction of negative regulators of calcineurin signaling RCAN (P<0.001) and HMOX1 (P = 0.009). Protein contents were elevated for RND3 at 3H (P = 0.02) and FOS at 48H (P<0.05). These findings indicate that early RhoA and NFAT signaling and regulation are altered following exercise for muscle remodeling and repair, but are not affected by E2.

  4. Zinc oxide nanoparticles cause inhibition of microbial denitrification by affecting transcriptional regulation and enzyme activity.

    PubMed

    Zheng, Xiong; Su, Yinglong; Chen, Yinguang; Wan, Rui; Liu, Kun; Li, Mu; Yin, Daqiang

    2014-12-02

    Over the past few decades, human activities have accelerated the rates and extents of water eutrophication and global warming through increasing delivery of biologically available nitrogen such as nitrate and large emissions of anthropogenic greenhouse gases. In particular, nitrous oxide (N2O) is one of the most important greenhouse gases, because it has a 300-fold higher global warming potential than carbon dioxide. Microbial denitrification is a major pathway responsible for nitrate removal, and also a dominant source of N2O emissions from terrestrial or aquatic environments. However, whether the release of zinc oxide nanoparticles (ZnO NPs) into the environment affects microbial denitrification is largely unknown. Here we show that the presence of ZnO NPs lead to great increases in nitrate delivery (9.8-fold higher) and N2O emissions (350- and 174-fold higher in the gas and liquid phases, respectively). Our data further reveal that ZnO NPs significantly change the transcriptional regulations of glycolysis and polyhydroxybutyrate synthesis, which causes the decrease in reducing powers available for the reduction of nitrate and N2O. Moreover, ZnO NPs substantially inhibit the gene expressions and catalytic activities of key denitrifying enzymes. These negative effects of ZnO NPs on microbial denitrification finally cause lower nitrate removal and higher N2O emissions, which is likely to exacerbate water eutrophication and global warming.

  5. Sphingolipids regulate telomere clustering by affecting the transcription of genes involved in telomere homeostasis.

    PubMed

    Ikeda, Atsuko; Muneoka, Tetsuya; Murakami, Suguru; Hirota, Ayaka; Yabuki, Yukari; Karashima, Takefumi; Nakazono, Kota; Tsuruno, Masahiro; Pichler, Harald; Shirahige, Katsuhiko; Kodama, Yukiko; Shimamoto, Toshi; Mizuta, Keiko; Funato, Kouichi

    2015-07-15

    In eukaryotic organisms, including mammals, nematodes and yeasts, the ends of chromosomes, telomeres are clustered at the nuclear periphery. Telomere clustering is assumed to be functionally important because proper organization of chromosomes is necessary for proper genome function and stability. However, the mechanisms and physiological roles of telomere clustering remain poorly understood. In this study, we demonstrate a role for sphingolipids in telomere clustering in the budding yeast Saccharomyces cerevisiae. Because abnormal sphingolipid metabolism causes downregulation of expression levels of genes involved in telomere organization, sphingolipids appear to control telomere clustering at the transcriptional level. In addition, the data presented here provide evidence that telomere clustering is required to protect chromosome ends from DNA-damage checkpoint signaling. As sphingolipids are found in all eukaryotes, we speculate that sphingolipid-based regulation of telomere clustering and the protective role of telomere clusters in maintaining genome stability might be conserved in eukaryotes.

  6. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement

    PubMed Central

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-01-01

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K+ (K+in) channels and reduced K+in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K+in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K+in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants. PMID:27035938

  7. GOLDEN 2-LIKE transcription factors for chloroplast development affect ozone tolerance through the regulation of stomatal movement.

    PubMed

    Nagatoshi, Yukari; Mitsuda, Nobutaka; Hayashi, Maki; Inoue, Shin-Ichiro; Okuma, Eiji; Kubo, Akihiro; Murata, Yoshiyuki; Seo, Mitsunori; Saji, Hikaru; Kinoshita, Toshinori; Ohme-Takagi, Masaru

    2016-04-12

    Stomatal movements regulate gas exchange, thus directly affecting the efficiency of photosynthesis and the sensitivity of plants to air pollutants such as ozone. The GARP family transcription factors GOLDEN 2-LIKE1 (GLK1) and GLK2 have known functions in chloroplast development. Here, we show that Arabidopsis thaliana (A. thaliana) plants expressing the chimeric repressors for GLK1 and -2 (GLK1/2-SRDX) exhibited a closed-stomata phenotype and strong tolerance to ozone. By contrast, plants that overexpress GLK1/2 exhibited an open-stomata phenotype and higher sensitivity to ozone. The plants expressing GLK1-SRDX had reduced expression of the genes for inwardly rectifying K(+) (K(+) in) channels and reduced K(+) in channel activity. Abscisic acid treatment did not affect the stomatal phenotype of 35S:GLK1/2-SRDX plants or the transcriptional activity for K(+) in channel gene, indicating that GLK1/2 act independently of abscisic acid signaling. Our results indicate that GLK1/2 positively regulate the expression of genes for K(+) in channels and promote stomatal opening. Because the chimeric GLK1-SRDX repressor driven by a guard cell-specific promoter induced a closed-stomata phenotype without affecting chloroplast development in mesophyll cells, modulating GLK1/2 activity may provide an effective tool to control stomatal movements and thus to confer resistance to air pollutants.

  8. Power training and postmenopausal hormone therapy affect transcriptional control of specific co-regulated gene clusters in skeletal muscle

    PubMed Central

    Fey, Vidal; Törmäkangas, Timo; Ronkainen, Paula H. A.; Taaffe, Dennis R.; Takala, Timo; Koskinen, Satu; Cheng, Sulin; Puolakka, Jukka; Kujala, Urho M.; Suominen, Harri; Sipilä, Sarianna; Kovanen, Vuokko

    2010-01-01

    At the moment, there is no clear molecular explanation for the steeper decline in muscle performance after menopause or the mechanisms of counteractive treatments. The goal of this genome-wide study was to identify the genes and gene clusters through which power training (PT) comprising jumping activities or estrogen containing hormone replacement therapy (HRT) may affect skeletal muscle properties after menopause. We used musculus vastus lateralis samples from early stage postmenopausal (50–57 years old) women participating in a yearlong randomized double-blind placebo-controlled trial with PT and HRT interventions. Using microarray platform with over 24,000 probes, we identified 665 differentially expressed genes. The hierarchical clustering method was used to assort the genes. Additionally, enrichment analysis of gene ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was carried out to clarify whether assorted gene clusters are enriched with particular functional categories. The analysis revealed transcriptional regulation of 49 GO/KEGG categories. PT upregulated transcription in “response to contraction”—category revealing novel candidate genes for contraction-related regulation of muscle function while HRT upregulated gene expression related to functionality of mitochondria. Moreover, several functional categories tightly related to muscle energy metabolism, development, and function were affected regardless of the treatment. Our results emphasize that during the early stages of the postmenopause, muscle properties are under transcriptional modulation, which both PT and HRT partially counteract leading to preservation of muscle power and potentially reducing the risk for aging-related muscle weakness. More specifically, PT and HRT may function through improving energy metabolism, response to contraction as well as by preserving functionality of the mitochondria. Electronic supplementary material The online version of this

  9. Transcription Regulation in Archaea

    PubMed Central

    Gehring, Alexandra M.; Walker, Julie E.

    2016-01-01

    The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495

  10. Natural mixtures of POPs affected body weight gain and induced transcription of genes involved in weight regulation and insulin signaling.

    PubMed

    Lyche, Jan L; Nourizadeh-Lillabadi, Rasoul; Karlsson, Camilla; Stavik, Benedicte; Berg, Vidar; Skåre, Janneche Utne; Alestrøm, Peter; Ropstad, Erik

    2011-04-01

    Obesity is reaching epidemic proportions worldwide, and is associated with chronic illnesses such as diabetes, cardiovascular disease, hypertension and dyslipidemias (metabolic syndrome). Commonly held causes of obesity are overeating coupled with a sedentary lifestyle. However, it has also been postulated that exposure to endocrine disrupting chemicals (EDCs) may be related to the significant increase in the prevalence of obesity and associated diseases. In the present study, developmental and reproductive effects of lifelong exposure to environmentally relevant concentrations of two natural mixtures of persistent organic pollutants (POPs) were investigated using classical and molecular methods in a controlled zebrafish model. The mixtures used were extracted from burbot (Lota lota) liver originating from freshwater systems in Norway (Lake Mjøsa and Lake Losna). The concentration of POPs in the zebrafish ranged from levels detected in wild fish (Lake Mjøsa and Lake Losna), to concentrations reported in human and wildlife populations. Phenotypic effects observed in both exposure groups included (1) earlier onset of puberty, (2) elevated male/female sex ratio, and (3) increased body weight at 5 months of age. Interestingly, genome-wide transcription profiling identified functional networks of genes, in which key regulators of weight homeostasis (PPARs, glucocoricoids, CEBPs, estradiol), steroid hormone functions (glucocoricoids, estradiol, NCOA3) and insulin signaling (HNF4A, CEBPs, PPARG) occupied central positions. The increased weight and the regulation of genes associated with weight homeostasis and insulin signaling observed in the present study suggest that environmental pollution may affect the endocrine regulation of the metabolism, possibly leading to increased weight gain and obesity.

  11. Regulation of Transcript Elongation

    PubMed Central

    Belogurov, Georgiy A.; Artsimovitch, Irina

    2015-01-01

    Bacteria lack subcellular compartments and harbor a single RNA polymerase that synthesizes both structural and protein-coding RNAs, which are cotranscriptionally processed by distinct pathways. Nascent rRNAs fold into elaborate secondary structures and associate with ribosomal proteins, whereas nascent mRNAs are translated by ribosomes. During elongation, nucleic acid signals and regulatory proteins modulate concurrent RNA-processing events, instruct RNA polymerase where to pause and terminate transcription, or act as roadblocks to the moving enzyme. Communications among complexes that carry out transcription, translation, repair, and other cellular processes ensure timely execution of the gene expression program and survival under conditions of stress. This network is maintained by auxiliary proteins that act as bridges between RNA polymerase, ribosome, and repair enzymes, blurring boundaries between separate information-processing steps and making assignments of unique regulatory functions meaningless. Understanding the regulation of transcript elongation thus requires genome-wide approaches, which confirm known and reveal new regulatory connections. PMID:26132790

  12. Transcriptional Regulation by Hypoxia Inducible Factors

    PubMed Central

    Espinosa, Joaquín M.

    2015-01-01

    The cellular response to oxygen deprivation is governed largely by a family of transcription factors known as Hypoxia Inducible Factors (HIFs). This review focuses on the molecular mechanisms by which HIFs regulate the transcriptional apparatus to enable the cellular and organismal response to hypoxia. We discuss here how the various HIF polypeptides, their post-translational modifications, binding partners and transcriptional cofactors affect RNA polymerase II activity to drive context-dependent transcriptional programs during hypoxia. PMID:24099156

  13. Adaptation with transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Shi, Wenjia; Ma, Wenzhe; Xiong, Liyang; Zhang, Mingyue; Tang, Chao

    2017-02-01

    Biochemical adaptation is one of the basic functions that are widely implemented in biological systems for a variety of purposes such as signal sensing, stress response and homeostasis. The adaptation time scales span from milliseconds to days, involving different regulatory machineries in different processes. The adaptive networks with enzymatic regulation (ERNs) have been investigated in detail. But it remains unclear if and how other forms of regulation will impact the network topology and other features of the function. Here, we systematically studied three-node transcriptional regulatory networks (TRNs), with three different types of gene regulation logics. We found that the topologies of adaptive gene regulatory networks can still be grouped into two general classes: negative feedback loop (NFBL) and incoherent feed-forward loop (IFFL), but with some distinct topological features comparing to the enzymatic networks. Specifically, an auto-activation loop on the buffer node is necessary for the NFBL class. For IFFL class, the control node can be either a proportional node or an inversely-proportional node. Furthermore, the tunability of adaptive behavior differs between TRNs and ERNs. Our findings highlight the role of regulation forms in network topology, implementation and dynamics.

  14. Adaptation with transcriptional regulation.

    PubMed

    Shi, Wenjia; Ma, Wenzhe; Xiong, Liyang; Zhang, Mingyue; Tang, Chao

    2017-02-24

    Biochemical adaptation is one of the basic functions that are widely implemented in biological systems for a variety of purposes such as signal sensing, stress response and homeostasis. The adaptation time scales span from milliseconds to days, involving different regulatory machineries in different processes. The adaptive networks with enzymatic regulation (ERNs) have been investigated in detail. But it remains unclear if and how other forms of regulation will impact the network topology and other features of the function. Here, we systematically studied three-node transcriptional regulatory networks (TRNs), with three different types of gene regulation logics. We found that the topologies of adaptive gene regulatory networks can still be grouped into two general classes: negative feedback loop (NFBL) and incoherent feed-forward loop (IFFL), but with some distinct topological features comparing to the enzymatic networks. Specifically, an auto-activation loop on the buffer node is necessary for the NFBL class. For IFFL class, the control node can be either a proportional node or an inversely-proportional node. Furthermore, the tunability of adaptive behavior differs between TRNs and ERNs. Our findings highlight the role of regulation forms in network topology, implementation and dynamics.

  15. Adaptation with transcriptional regulation

    PubMed Central

    Shi, Wenjia; Ma, Wenzhe; Xiong, Liyang; Zhang, Mingyue; Tang, Chao

    2017-01-01

    Biochemical adaptation is one of the basic functions that are widely implemented in biological systems for a variety of purposes such as signal sensing, stress response and homeostasis. The adaptation time scales span from milliseconds to days, involving different regulatory machineries in different processes. The adaptive networks with enzymatic regulation (ERNs) have been investigated in detail. But it remains unclear if and how other forms of regulation will impact the network topology and other features of the function. Here, we systematically studied three-node transcriptional regulatory networks (TRNs), with three different types of gene regulation logics. We found that the topologies of adaptive gene regulatory networks can still be grouped into two general classes: negative feedback loop (NFBL) and incoherent feed-forward loop (IFFL), but with some distinct topological features comparing to the enzymatic networks. Specifically, an auto-activation loop on the buffer node is necessary for the NFBL class. For IFFL class, the control node can be either a proportional node or an inversely-proportional node. Furthermore, the tunability of adaptive behavior differs between TRNs and ERNs. Our findings highlight the role of regulation forms in network topology, implementation and dynamics. PMID:28233824

  16. Phosphorylation Affects DNA-Binding of the Senescence-Regulating bZIP Transcription Factor GBF1

    PubMed Central

    Smykowski, Anja; Fischer, Stefan M.; Zentgraf, Ulrike

    2015-01-01

    Massive changes in the transcriptome of Arabidopsis thaliana during onset and progression of leaf senescence imply a central role for transcription factors. While many transcription factors are themselves up- or down-regulated during senescence, the bZIP transcription factor G-box-binding factor 1 (GBF1/bZIP41) is constitutively expressed in Arabidopsis leaf tissue but at the same time triggers the onset of leaf senescence, suggesting posttranscriptional mechanisms for senescence-specific GBF1 activation. Here we show that GBF1 is phosphorylated by the threonine/serine CASEIN KINASE II (CKII) in vitro and that CKII phosphorylation had a negative effect on GBF1 DNA-binding to G-boxes of two direct target genes, CATALASE2 and RBSCS1a. Phosphorylation mimicry at three serine positions in the basic region of GBF1 also had a negative effect on DNA-binding. Kinase assays revealed that CKII phosphorylates at least one serine in the basic domain but has additional phosphorylation sites outside this domain. Two different ckII α subunit1 and one α subunit2 T-DNA insertion lines showed no visible senescence phenotype, but in all lines the expression of the senescence marker gene SAG12 was remarkably diminished. A model is presented suggesting that senescence-specific GBF1 activation might be achieved by lowering the phosphorylation of GBF1 by CKII. PMID:27135347

  17. Regulation of transcription of the RNA splicing factor hSlu7 by Elk-1 and Sp1 affects alternative splicing.

    PubMed

    Alberstein, Moti; Amit, Maayan; Vaknin, Keren; O'Donnell, Amanda; Farhy, Chen; Lerenthal, Yaniv; Shomron, Noam; Shaham, Ohad; Sharrocks, Andrew D; Ashery-Padan, Ruth; Ast, Gil

    2007-11-01

    Alternative splicing plays a major role in transcriptome diversity and plasticity, but it is largely unknown how tissue-specific and embryogenesis-specific alternative splicing is regulated. The highly conserved splicing factor Slu7 is involved in 3' splice site selection and also regulates alternative splicing. We show that Slu7 has a unique spatial pattern of expression among human and mouse embryonic and adult tissues. We identified several functional Ets binding sites and GC-boxes in the human Slu7 (hSlu7) promoter region. The Ets and GC-box binding transcription factors, Elk-1 and Sp1, respectively, exerted opposite effects on hSlu7 transcription: Sp1 protein enhances and Elk-1 protein represses transcription in a dose-dependent manner. Sp1 protein bound to the hSlu7 promoter in vivo, and depletion of Sp1 by RNA interference (RNAi) repressed hSlu7 expression. Elk-1 protein bound to the hSlu7 promoter in vivo, and depletion of Elk-1 by RNAi caused an increase in the endogenous level of hSlu7 mRNA. Further, depletion of either Sp1 or Elk-1 affected alternative splicing. Our results provide indications of a complex transcription regulation mechanism that controls the spatial and temporal expression of Slu7, presumably allowing regulation of tissue-specific alternative splicing events.

  18. MADS-box transcription factor OsMADS25 regulates root development through affection of nitrate accumulation in rice.

    PubMed

    Yu, Chunyan; Liu, Yihua; Zhang, Aidong; Su, Sha; Yan, An; Huang, Linli; Ali, Imran; Liu, Yu; Forde, Brian G; Gan, Yinbo

    2015-01-01

    MADS-box transcription factors are vital regulators participating in plant growth and development process and the functions of most of them are still unknown. ANR1 was reported to play a key role in controlling lateral root development through nitrate signal in Arabidopsis. OsMADS25 is one of five ANR1-like genes in Oryza Sativa and belongs to the ANR1 clade. Here we have investigated the role of OsMADS25 in the plant's responses to external nitrate in Oryza Sativa. Our results showed that OsMADS25 protein was found in the nucleus as well as in the cytoplasm. Over-expression of OsMADS25 significantly promoted lateral and primary root growth as well as shoot growth in a nitrate-dependent manner in Arabidopsis. OsMADS25 overexpression in transgenic rice resulted in significantly increased primary root length, lateral root number, lateral root length and shoot fresh weight in the presence of nitrate. Down-regulation of OsMADS25 in transgenic rice exhibited significantly reduced shoot and root growth in the presence of nitrate. Furthermore, over-expression of OsMADS25 in transgenic rice promoted nitrate accumulation and significantly increased the expressions of nitrate transporter genes at high rates of nitrate supply while down-regulation of OsMADS25 produced the opposite effect. Taken together, our findings suggest that OsMADS25 is a positive regulator control lateral and primary root development in rice.

  19. RNA-guided transcriptional regulation

    DOEpatents

    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.

    2016-02-23

    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  20. SOX2 gene regulates the transcriptional network of oncogenes and affects tumorigenesis of human lung cancer cells.

    PubMed

    Chen, Si; Xu, Yingxi; Chen, Yanan; Li, Xuefei; Mou, Wenjun; Wang, Lina; Liu, Yanhua; Reisfeld, Ralph A; Xiang, Rong; Lv, Dan; Li, Na

    2012-01-01

    Recent studies demonstrated that cancer stem cells (CSCs) have higher tumorigenesis properties than those of differentiated cancer cells and that transcriptional factor-SOX2 plays a vital role in maintaining the unique properties of CSCs; however, the function and underlying mechanism of SOX2 in carcinogenesis of lung cancer are still elusive. This study applied immunohistochemistry to analyze the expression of SOX2 in human lung tissues of normal individuals as well as patients with adenocarcinoma, squamous cell carcinoma, and large cell and small cell carcinoma and demonstrated specific overexpression of SOX2 in all types of lung cancer tissues. This finding supports the notion that SOX2 contributes to the tumorigenesis of lung cancer cells and can be used as a diagnostic probe. In addition, obviously higher expression of oncogenes c-MYC, WNT1, WNT2, and NOTCH1 was detected in side population (SP) cells than in non-side population (NSP) cells of human lung adenocarcinoma cell line-A549, revealing a possible mechanism for the tenacious tumorigenic potential of CSCs. To further elucidate the function of SOX2 in tumorigenesis of cancer cells, A549 cells were established with expression of luciferase and doxycycline-inducible shRNA targeting SOX2. We found silencing of SOX2 gene reduces the tumorigenic property of A549 cells with attenuated expression of c-MYC, WNT1, WNT2, and NOTCH1 in xenografted NOD/SCID mice. By using the RNA-Seq method, an additional 246 target cancer genes of SOX2 were revealed. These results present evidence that SOX2 may regulate the expression of oncogenes in CSCs to promote the development of human lung cancer.

  1. Transcription regulation mechanisms of bacteriophages

    PubMed Central

    Yang, Haiquan; Ma, Yingfang; Wang, Yitian; Yang, Haixia; Shen, Wei; Chen, Xianzhong

    2014-01-01

    Phage diversity significantly contributes to ecology and evolution of new bacterial species through horizontal gene transfer. Therefore, it is essential to understand the mechanisms underlying phage-host interactions. After initial infection, the phage utilizes the transcriptional machinery of the host to direct the expression of its own genes. This review presents a view on the transcriptional regulation mechanisms of bacteriophages, and its contribution to phage diversity and classification. Through this review, we aim to broaden the understanding of phage-host interactions while providing a reference source for researchers studying the regulation of phage transcription. PMID:25482231

  2. Maternal dietary protein affects transcriptional regulation of myostatin gene distinctively at weaning and finishing stages in skeletal muscle of Meishan pigs.

    PubMed

    Liu, Xiujuan; Wang, Jinquan; Li, Runsheng; Yang, Xiaojing; Sun, Qinwei; Albrecht, Elke; Zhao, Ruqian

    2011-07-01

    Myostatin (MSTN) is suggested to mediate the effect of maternal nutrition on offspring phenotype, yet the mechanisms underlying such adaptive gene regulation is elusive. In this study, we determined the effects of maternal dietary protein on transcriptional regulation of MSTN in skeletal muscle of pig offspring. Fourteen Meishan sows were fed either low-protein (LP) or standard-protein (SP) diets throughout gestation and lactation. MSTN expression in the longissimus dorsi muscle was determined both at weaning and finishing stages. Myostatin mRNA abundance was downregulated at weaning, but upregulated at finishing in LP pigs, indicating stage-specific transcriptional regulation. At weaning, CCAAT/enhancer-binding protein beta (C/EBPβ) in muscle nuclear lysate was decreased in LP piglets, associated with diminished binding of C/EBPβ to all the 3 putative binding sites in MSTN promoter. None of the four histone modification marks investigated showed differences between SP and LP piglets. Among 12 microRNAs predicted to target MSTN, none was differently expressed. At finishing stage, C/EBPβ content remained unchanged, but the binding of C/EBPβ to two of the 3 putative binding sites increased in LP pigs. Histone H3 acetylation and histone H3 lysine 27 trimethylation on MSTN promoter were increased, while histone H3 lysine 9 monomethylation was decreased in LP pigs. Moreover, expression of ssc-miR-136 and ssc-miR-500 was significantly reduced. These results indicate that maternal dietary protein affects MSTN expression through distinct regulatory mechanisms at different stages. The immediate effect at weaning is mediated by C/EBPβ binding without epigenetic modifications, whereas the long-term effect at finishing stage involves both C/EBPβ binding and epigenetic regulations, including histone modification and microRNA expression.

  3. Transcriptional regulation at the yeast nuclear envelope

    PubMed Central

    Steglich, Babett; Sazer, Shelley; Ekwall, Karl

    2013-01-01

    The spatial organization of the genome inside the nucleus affects many nuclear processes, such as DNA replication, DNA repair, and gene transcription. In metazoans, the nuclear periphery harbors mainly repressed genes that associate with the nuclear lamina. This review discusses how peripheral positioning is connected to transcriptional regulation in yeasts. Tethering of reporter genes to the nuclear envelope was found to result in transcriptional silencing. Similarly, repression of the silent mating type loci and subtelomeric genes is influenced by their position close to the nuclear envelope. In contrast, active genes are bound by nucleoporins and inducible genes associate with the nuclear pore complex upon activation. Taken together, these results portray the nuclear envelope as a platform for transcriptional regulation, both through activation at nuclear pores and silencing at the nuclear envelope. PMID:24021962

  4. Human I-mfa domain proteins specifically interact with KSHV LANA and affect its regulation of Wnt signaling-dependent transcription

    SciTech Connect

    Kusano, Shuichi; Eizuru, Yoshito

    2010-06-04

    Kaposi's sarcoma-associated herpes virus (KSHV)-encoded latency-associated nuclear antigen (LANA) protein has been reported to interact with glycogen synthase kinase 3{beta} (GSK-3{beta}) and to negatively regulate its activity, leading to stimulation of GSK-3{beta}-dependent {beta}-catenin degradation. We show here that the I-mfa domain proteins, HIC (human I-mfa domain-containing protein) and I-mfa (inhibitor of MyoD family a), interacted in vivo with LANA through their C-terminal I-mfa domains. This interaction affected the intracellular localization of HIC, inhibited the LANA-dependent transactivation of a {beta}-catenin-regulated reporter construct, and decreased the level of the LANA.GSK-3{beta} complex. These data reveal for the first time that I-mfa domain proteins interact with LANA and negatively regulate LANA-mediated activation of Wnt signaling-dependent transcription by inhibiting the formation of the LANA.GSK-3{beta} complex.

  5. Nascent transcription affected by RNA polymerase IV in Zea mays.

    PubMed

    Erhard, Karl F; Talbot, Joy-El R B; Deans, Natalie C; McClish, Allison E; Hollick, Jay B

    2015-04-01

    All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3'-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance.

  6. The Friend leukaemia virus integration 1 (Fli-1) transcription factor affects lupus nephritis development by regulating inflammatory cell infiltration into the kidney

    PubMed Central

    Sato, S; Zhang, X K

    2014-01-01

    The transcription factor Friend leukaemia virus integration 1 (Fli-1) is implicated in the pathogenesis of systemic lupus erythematosus in both human patients and murine models of lupus. Murphy Roths large (MRL)/lpr mice and New Zealand mixed (NZM)2410 mice, murine models of lupus, with decreased expression of Fli-1 had significantly prolonged survival and reduced nephritis. Lupus nephritis is a major cause of mortality and morbidity in patients, and inflammatory cell infiltration plays a key role in the development of the disease. To study how the expression of Fli-1 affects the infiltration of inflammatory cells into the kidneys, we generated congenic enhanced green fluorescent protein (GFP) transgenic MRL/lpr mice. A significantly increased number of GFP-expressing inflammatory cells infiltrated the kidneys of wild-type MRL/lpr mice compared to Fli-1 heterozygous (Fli-1+/−) MRL/lpr mice after injection of GFP+ cells. Expression of inflammatory chemokine mRNA, including chemokine (C-C motif) ligand (CCL)2, CCL3, CCL4 and CCL5, was significantly lower in the kidneys from Fli-1+/− MRL/lpr mice compared to wild-type littermates. Numbers of infiltrated cells into the kidneys correlate with expression levels of CCL2, CCL4 and CCL5, but not the titres of anti-dsDNA autoantibodies in these mice. Significantly increased inflammatory cells from wild-type MRL/lpr mice infiltrated into kidneys compared to the cells from Fli-1+/− MRL/lpr mice. The chemotaxis of inflammatory cells from Fli-1+/− MRL/lpr mice towards each chemokine was decreased significantly compared to inflammatory cells from wild-type MRL/lpr mice in the transwell migration assay in vitro. Our results indicate that Fli-1 affects lupus nephritis development by regulating the expression of chemokines in the kidney and the migration of inflammatory cells. PMID:24580413

  7. The Friend leukaemia virus integration 1 (Fli-1) transcription factor affects lupus nephritis development by regulating inflammatory cell infiltration into the kidney.

    PubMed

    Sato, S; Zhang, X K

    2014-07-01

    The transcription factor Friend leukaemia virus integration 1 (Fli-1) is implicated in the pathogenesis of systemic lupus erythematosus in both human patients and murine models of lupus. Murphy Roths large (MRL)/lpr mice and New Zealand mixed (NZM)2410 mice, murine models of lupus, with decreased expression of Fli-1 had significantly prolonged survival and reduced nephritis. Lupus nephritis is a major cause of mortality and morbidity in patients, and inflammatory cell infiltration plays a key role in the development of the disease. To study how the expression of Fli-1 affects the infiltration of inflammatory cells into the kidneys, we generated congenic enhanced green fluorescent protein (GFP) transgenic MRL/lpr mice. A significantly increased number of GFP-expressing inflammatory cells infiltrated the kidneys of wild-type MRL/lpr mice compared to Fli-1 heterozygous (Fli-1(+/-)) MRL/lpr mice after injection of GFP(+) cells. Expression of inflammatory chemokine mRNA, including chemokine (C-C motif) ligand (CCL)2, CCL3, CCL4 and CCL5, was significantly lower in the kidneys from Fli-1(+/-) MRL/lpr mice compared to wild-type littermates. Numbers of infiltrated cells into the kidneys correlate with expression levels of CCL2, CCL4 and CCL5, but not the titres of anti-dsDNA autoantibodies in these mice. Significantly increased inflammatory cells from wild-type MRL/lpr mice infiltrated into kidneys compared to the cells from Fli-1(+/-) MRL/lpr mice. The chemotaxis of inflammatory cells from Fli-1(+/-) MRL/lpr mice towards each chemokine was decreased significantly compared to inflammatory cells from wild-type MRL/lpr mice in the transwell migration assay in vitro. Our results indicate that Fli-1 affects lupus nephritis development by regulating the expression of chemokines in the kidney and the migration of inflammatory cells.

  8. Informational Requirements for Transcriptional Regulation

    PubMed Central

    O'Neill, Patrick K.; Forder, Robert

    2014-01-01

    Abstract Transcription factors (TFs) regulate transcription by binding to specific sites in promoter regions. Information theory provides a useful mathematical framework to analyze the binding motifs associated with TFs but imposes several assumptions that limit their applicability to specific regulatory scenarios. Explicit simulations of the co-evolution of TFs and their binding motifs allow the study of the evolution of regulatory networks with a high degree of realism. In this work we analyze the impact of differential regulatory demands on the information content of TF-binding motifs by means of evolutionary simulations. We generalize a predictive index based on information theory, and we validate its applicability to regulatory scenarios in which the TF binds significantly to the genomic background. Our results show a logarithmic dependence of the evolved information content on the occupancy of target sites and indicate that TFs may actively exploit pseudo-sites to modulate their occupancy of target sites. In regulatory networks with differentially regulated targets, we observe that information content in TF-binding motifs is dictated primarily by the fraction of total probability mass that the TF assigns to its target sites, and we provide a predictive index to estimate the amount of information associated with arbitrarily complex regulatory systems. We observe that complex regulatory patterns can exert additional demands on evolved information content, but, given a total occupancy for target sites, we do not find conclusive evidence that this effect is because of the range of required binding affinities. PMID:24689750

  9. Expression pattern of cellulolytic and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1 are affected by carbon source in Trichoderma reesei.

    PubMed

    Castro, Lilian dos Santos; Antoniêto, Amanda Cristina Campos; Pedersoli, Wellington Ramos; Silva-Rocha, Rafael; Persinoti, Gabriela F; Silva, Roberto Nascimento

    2014-03-01

    Trichoderma reesei is the most important fungus for the industrial production of enzymes to biomass deconstruction. Most of the genes encoding cellulases and hemicellulases are regulated by the transcription factors CRE1 and XYR1. In this work, the regulation of 22 genes of cellulases and xylanases by these transcription factors was investigated under three different carbon sources. Analysis of gene expression and enzymatic profiles of CMCase, β-glucosidase, and xylanases showed different regulation that was depended of the carbon source in both Δxyr1 and Δcre1 mutants. In the presence of glucose, the majority of genes evaluated (82%) showed increased expression levels in the Δcre1 mutant compared to the parental QM9414 strain. In the Δxyr1 mutant, it was observed that expression of cellulase and xylanase genes was reduced compared to the parental QM9414 strain, when cultured in the presence of cellulose or sophorose. Interesting, in the presence of glucose, approximately 60% of the analyzed genes had increased expression in the Δxyr1 mutant compared to parental strain. Furthermore, no correlation between gene expression and the number of putative binding sites of XYR1 and CRE1 to promoter region of cellulolytic and xylanolytic studied genes was observed. Therefore, these results demonstrated that the regulation of cellulase and xylanase by the transcription factors CRE1 and XYR1 is influenced by different carbon sources.

  10. Transcription factor CecR (YbiH) regulates a set of genes affecting the sensitivity of Escherichia coli against cefoperazone and chloramphenicol.

    PubMed

    Yamanaka, Yuki; Shimada, Tomohiro; Yamamoto, Kaneyoshi; Ishihama, Akira

    2016-07-01

    Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening was performed for identification of the binding site of YbiH, an as yet uncharacterized TetR-family transcription factor, on the Escherichia coli genome. YbiH was found to be a unique single-target regulator that binds in vitro within the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses indicated one clear binding site of YbiH, including a complete palindromic sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of the ybiH operon and activation of the rhlE operon by YbiH. After phenotype microarray screening, YbiH was indicated to confer resistance to chloramphenicol and cefazoline (a first-generation cephalosporin). A systematic survey of the participation of each of the predicted YbiH-regulated genes in the antibiotic sensitivity indicated involvement of the YbhFSR ABC-type transporter in the sensitivity to cefoperazone (a third-generation cephalosporin) and of the membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken together with the growth test in the presence of these two antibiotics and in vitro transcription assay, it was concluded that the hitherto uncharacterized YbiH regulates transcription of both the bidirectional transcription units, the ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the control of sensitivity to cefoperazone and chloramphenicol. We thus propose to rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity).

  11. Transcriptional regulation of cuticle biosynthesis.

    PubMed

    Borisjuk, Nikolai; Hrmova, Maria; Lopato, Sergiy

    2014-01-01

    Plant cuticle is the hydrophobic protection layer that covers aerial plant organs and plays a pivotal role during plant development and interactions of plants with the environment. The mechanical structure and chemical composition of cuticle lipids and other secondary metabolites vary considerably between plant species, and in response to environmental stimuli and stresses. As the cuticle plays an important role in responses of plants to major abiotic stresses such as drought and high salinity, close attention has been paid to molecular processes underlying the stress-induced biosynthesis of cuticle components. This review addresses the genetic networks responsible for cuticle formation and in particular highlights the role of transcription factors that regulate cuticle formation in response to abiotic stresses.

  12. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  13. Nickel-responsive transcriptional regulators.

    PubMed

    Musiani, Francesco; Zambelli, Barbara; Bazzani, Micaela; Mazzei, Luca; Ciurli, Stefano

    2015-09-01

    Nickel is an essential micronutrient for a large number of living organisms, but it is also a toxic metal ion when it accumulates beyond the sustainable level as it may result if and when its cellular trafficking is not properly governed. Therefore, the homeostasis and metabolism of nickel is tightly regulated through metal-specific protein networks that respond to the available Ni(II) concentration. These are directed by specific nickel sensors, able to couple Ni(II) binding to a change in their DNA binding affinity and/or specificity, thus translating the cellular level of Ni(II) into a modification of the expression of the proteins devoted to modulating nickel uptake, efflux and cellular utilization. This review describes the Ni(II)-dependent transcriptional regulators discovered so far, focusing on their structural features, metal coordination modes and metal binding thermodynamics. Understanding these properties is essential to comprehend how these sensors correlate nickel availability to metal coordination and functional responses. A broad and comparative study, described here, reveals some general traits that characterize the binding stoichiometry and Ni(II) affinity of these metallo-sensors.

  14. Agouti regulates adipocyte transcription factors.

    PubMed

    Mynatt, R L; Stephens, J M

    2001-04-01

    Agouti is a secreted paracrine factor that regulates pigmentation in hair follicle melanocytes. Several dominant mutations cause ectopic expression of agouti, resulting in a phenotype characterized by yellow fur, adult-onset obesity and diabetes, increased linear growth and skeletal mass, and increased susceptibility to tumors. Humans also produce agouti protein, but the highest levels of agouti in humans are found in adipose tissue. To mimic the human agouti expression pattern in mice, transgenic mice (aP2-agouti) that express agouti in adipose tissue were generated. The transgenic mice develop a mild form of obesity, and they are sensitized to the action of insulin. We correlated the levels of specific regulators of insulin signaling and adipocyte differentiation with these phenotypic changes in adipose tissue. Signal transducers and activators of transcription (STAT)1, STAT3, and peroxisome proliferator-activated receptor (PPAR)-gamma protein levels were elevated in the transgenic mice. Treatment of mature 3T3-L1 adipocytes recapitulated these effects. These data demonstrate that agouti has potent effects on adipose tissue. We hypothesize that agouti increases adiposity and promotes insulin sensitivity by acting directly on adipocytes via PPAR-gamma.

  15. A polymorphism of the GTP-cyclohydrolase I feedback regulator gene alters transcriptional activity and may affect response to SSRI antidepressants.

    PubMed

    McHugh, P C; Joyce, P R; Deng, X; Kennedy, M A

    2011-06-01

    Tetrahydrobiopterin (BH(4)) is an essential cofactor for synthesis of many neurotransmitters including serotonin. In serotonergic neurons, BH(4) is tightly regulated by GTP-cyclohydrolase I feedback regulator (GFRP). Given the pivotal role of the serotonergic system in mood disorders and selective serotonin reuptake inhibitors (SSRIs) antidepressant function, we tested the hypothesis that GFRP gene (GCHFR) variants would modify response to antidepressants in subjects with major depression. Two single nucleotide polymorphisms (rs7164342 and rs7163862) in the GCHFR promoter were identified and occurred as two haplotypes (GA or TT). A multiple regression analysis revealed that homozygous individuals for the TT haplotype were less likely to respond to the SSRI fluoxetine than to the tricyclic antidepressant nortriptyline (P = 0.037). Moreover, the TT haplotype showed a reduced transcription rate in luciferase reporter gene assays, which may impact on BH(4)-mediated neurotransmitter production, thus suggesting a biological process through which GCHFR promoter variants might influence antidepressant response.

  16. Transcriptional regulation of mammalian selenoprotein expression

    PubMed Central

    Stoytcheva, Zoia R.; Berry, Marla J.

    2009-01-01

    Background Selenoproteins contain the twenty-first amino acid, selenocysteine, and are involved in cellular defenses against oxidative damage, important metabolic and developmental pathways, and responses to environmental challenges. Elucidating the mechanisms regulating selenoprotein expression at the transcriptional level is key to understanding how these mechanisms are called into play to respond to the changing environment. Methods This review summarizes published studies on transcriptional regulation of selenoprotein genes, focused primarily on genes whose encoded protein functions are at least partially understood. This is followed by in silico analysis of predicted regulatory elements in selenoprotein genes, including those in the aforementioned category as well as the genes whose functions are not known. Results Our findings reveal regulatory pathways common to many selenoprotein genes, including several involved in stress-responses. In addition, tissue-specific regulatory factors are implicated in regulating many selenoprotein genes. Conclusions These studies provide new insights into how selenoprotein genes respond to environmental and other challenges, and the roles these proteins play in allowing cells to adapt to these changes. General Significance Elucidating the regulatory mechanisms affecting selenoprotein expression is essential for understanding their roles in human diseases, and for developing diagnostic and potential therapeutic approaches to address dysregulation of members of this gene family. PMID:19465084

  17. Histone variants in plant transcriptional regulation.

    PubMed

    Jiang, Danhua; Berger, Frédéric

    2017-01-01

    Chromatin based organization of eukaryotic genome plays a profound role in regulating gene transcription. Nucleosomes form the basic subunits of chromatin by packaging DNA with histone proteins, impeding the access of DNA to transcription factors and RNA polymerases. Exchange of histone variants in nucleosomes alters the properties of nucleosomes and thus modulates DNA exposure during transcriptional regulation. Growing evidence indicates the important function of histone variants in programming transcription during developmental transitions and stress response. Here we review how histone variants and their deposition machineries regulate the nucleosome stability and dynamics, and discuss the link between histone variants and transcriptional regulation in plants. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

  18. Silencing of molt-regulating transcription factor gene, CiHR3, affects growth and development of sugarcane stem borer, Chilo infuscatellus.

    PubMed

    Zhang, Yu-liang; Zhang, Shu-zhen; Kulye, Mahesh; Wu, Su-ran; Yu, Nai-tong; Wang, Jian-hua; Zeng, Hong-mei; Liu, Zhi-xin

    2012-01-01

    RNA interference (RNAi) is a technology for conducting functional genomic studies and a potential tool for crop protection against insect pests. Development of reliable methods for production and delivery of double-stranded RNA (dsRNA) is the major challenge for efficient pest control. In this study, Chilo infuscatellus Snellen (Crambidae: Lepidoptera) was fed with CiHR3 dsRNA expressed in bacteria or synthesized in vitro. The dsRNA ingested by C. infuscatellus successfully triggered silencing of the molt-regulating transcription factor CiHR3, an important gene for insect growth and development, and caused significant abnormalities and weight loss in insects within seven days of treatment. This study is an ideal example of feeding-based RNAi mediated by dsRNA expressed in bacteria or synthesized in vitro. The results also suggested that feeding-based RNA interference is a potential method for the management of C. infuscatellus.

  19. Suppressor of cytokine signaling 2 (SOCS2) negatively regulates the expression of antimicrobial peptides by affecting the Stat transcriptional activity in shrimp Marsupenaeus japonicus.

    PubMed

    Sun, Jie-Jie; Lan, Jiang-Feng; Xu, Ji-Dong; Niu, Guo-Juan; Wang, Jin-Xing

    2016-09-01

    The suppressor of cytokine signaling (SOCS) family is a kind of negative regulators in the Janus kinase/signal transducer and activator of transcription (Jak/Stat) pathway in mammals and Drosophila. In kuruma shrimp, Marsupenaeus japonicus, SOCS2 is identified and its expression can be stimulated by peptidoglycan and polycytidylic acid. However, if SOCS2 participates in regulating Jak/Stat pathway in shrimp still needs further study. In this study, SOCS2 with Src homology 2 domain and SOCS box was identified in kuruma shrimp, M. japonicus. SOCS2 existed in hemocytes, heart, hepatopancreas, gills, stomach, and intestine, the expression of SOCS2 was upregulated significantly in the hemocytes and intestine of shrimp challenged with Vibrio anguillarum at 6 h. To analyze SOCS2 function in shrimp immunity, bacterial clearance and survival rate were analyzed after knockdown of SOCS2 in shrimp challenged with V. anguillarum. Results showed that bacterial clearance increased, and the survival rate improved significantly comparing with controls. The SOCS2 was expressed in Escherichia coli and the recombinant SOCS2 was injected into shrimp, and Stat phosphorylation and translocation were analyzed. The result showed that "overexpression" of SOCS2 declined Stat phosphorylation level and inhibited Stat translocation into the nucleus. After knockdown of SOCS2 in shrimp prior to V. anguillarum infection, the expression level of antimicrobial peptides, including anti-lipopolysaccharide factors C1, C2 and D1, and Crustin I was upregulated significantly, and the expression of the AMPs was declined after recombinant SOCS2 injection. The SOCS2 expression was also decreased in Stat-knockdown shrimp challenged by V. anguillarum at 6 and 12 h. Therefore, SOCS2 negatively regulates the AMP expression by inhibiting Stat phosphorylation and translocation into nucleus in shrimp, meanwhile, SOCS2 expression was also regulated by Jak/Stat pathway.

  20. A mutation in cnot8, component of the Ccr4-not complex regulating transcript stability, affects expression levels of developmental regulators and reveals a role of Fgf3 in development of caudal hypothalamic dopaminergic neurons.

    PubMed

    Koch, Peter; Löhr, Heiko B; Driever, Wolfgang

    2014-01-01

    While regulation of the activity of developmental control genes at the transcriptional level as well as by specific miRNA-based degradation are intensively studied, little is known whether general cellular mechanisms controlling mRNA decay may contribute to differential stability of mRNAs of developmental control genes. Here, we investigate whether a mutation in the deadenylation dependent mRNA decay pathway may reveal differential effects on developmental mechanisms, using dopaminergic differentiation in the zebrafish brain as model system. In a zebrafish genetic screen aimed at identifying genes controlling dopaminergic neuron development we isolated the m1061 mutation that selectively caused increased dopaminergic differentiation in the caudal hypothalamus, while other dopaminergic groups were not affected. Positional cloning revealed that m1061 causes a premature stop codon in the cnot8 open reading frame. Cnot8 is a component of the Ccr4-Not complex and displays deadenylase activity, which is required for removal of the poly (A) tail in bulk mRNA turnover. Analyses of expression of developmental regulators indicate that loss of Cnot8 activity results in increased mRNA in situ hybridization signal levels for a subset of developmental control genes. We show that in the area of caudal hypothalamic dopaminergic differentiation, mRNA levels for several components of the FGF signaling pathway, including Fgf3, FGF receptors, and FGF target genes, are increased. Pharmacological inhibition of FGF signaling or a mutation in the fgf3 gene can compensate the gain of caudal hypothalamic dopaminergic neurons in cnot8m1061 mutants, indicating a role for Fgf3 in control of development of this dopaminergic population. The cnot8m1061 mutant phenotype provides an in vivo system to study roles of the Cnot8 deadenylase component of the mRNA decay pathway in vertebrate development. Our data indicate that attenuation of Cnot8 activity differentially affects mRNA levels of

  1. A Mutation in cnot8, Component of the Ccr4-Not Complex Regulating Transcript Stability, Affects Expression Levels of Developmental Regulators and Reveals a Role of Fgf3 in Development of Caudal Hypothalamic Dopaminergic Neurons

    PubMed Central

    Koch, Peter; Löhr, Heiko B.; Driever, Wolfgang

    2014-01-01

    While regulation of the activity of developmental control genes at the transcriptional level as well as by specific miRNA-based degradation are intensively studied, little is known whether general cellular mechanisms controlling mRNA decay may contribute to differential stability of mRNAs of developmental control genes. Here, we investigate whether a mutation in the deadenylation dependent mRNA decay pathway may reveal differential effects on developmental mechanisms, using dopaminergic differentiation in the zebrafish brain as model system. In a zebrafish genetic screen aimed at identifying genes controlling dopaminergic neuron development we isolated the m1061 mutation that selectively caused increased dopaminergic differentiation in the caudal hypothalamus, while other dopaminergic groups were not affected. Positional cloning revealed that m1061 causes a premature stop codon in the cnot8 open reading frame. Cnot8 is a component of the Ccr4-Not complex and displays deadenylase activity, which is required for removal of the poly (A) tail in bulk mRNA turnover. Analyses of expression of developmental regulators indicate that loss of Cnot8 activity results in increased mRNA in situ hybridization signal levels for a subset of developmental control genes. We show that in the area of caudal hypothalamic dopaminergic differentiation, mRNA levels for several components of the FGF signaling pathway, including Fgf3, FGF receptors, and FGF target genes, are increased. Pharmacological inhibition of FGF signaling or a mutation in the fgf3 gene can compensate the gain of caudal hypothalamic dopaminergic neurons in cnot8m1061 mutants, indicating a role for Fgf3 in control of development of this dopaminergic population. The cnot8m1061 mutant phenotype provides an in vivo system to study roles of the Cnot8 deadenylase component of the mRNA decay pathway in vertebrate development. Our data indicate that attenuation of Cnot8 activity differentially affects mRNA levels of

  2. Affect and Self-Regulation

    ERIC Educational Resources Information Center

    Malmivuori, Marja-Liisa

    2006-01-01

    This paper presents affect as an essential aspect of students' self-reflection and self-regulation. The introduced concepts of self-system and self-system process stress the importance of self-appraisals of personal competence and agency in affective responses and self-regulation in problem solving. Students are viewed as agents who constantly…

  3. The Shwachman-Bodian-Diamond syndrome associated protein interacts with HsNip7 and its down-regulation affects gene expression at the transcriptional and translational levels

    SciTech Connect

    Hesling, Cedric; Oliveira, Carla C.; Castilho, Beatriz A.; Zanchin, Nilson I.T.

    2007-12-10

    The Shwachman-Bodian-Diamond syndrome (SDS) is an autosomal disorder with pleiotropic phenotypes including pancreatic, skeletal and bone marrow deficiencies and predisposition to hematological dysfunctions. SDS has been associated to mutations in the SBDS gene, encoding a highly conserved protein that was shown to function in ribosome biogenesis in yeast. In this work, we show that SBDS is found in complexes containing the human Nip7 ortholog. Analysis of pre-rRNA processing in a stable SBDS knock-down HEK293-derivative cell line revealed accumulation of a small RNA which is a further indication of SBDS involvement in rRNA biosynthesis. Global transcription and polysome-bound mRNA profiling revealed that SBDS knock-down affects expression of critical genes involved in brain development and function, bone morphogenesis, blood cell proliferation and differentiation, and cell adhesion. Expression of a group of growth and signal transduction factors and of DNA damage response genes is also affected. In SBDS knock-down cells, 34 mRNAs showed decreased and 55 mRNAs showed increased association to polysomes, among which is a group encoding proteins involved in alternative splicing and RNA modification. These results indicate that SBDS is required for accurate expression of genes important for proper brain, skeletal, and blood cell development.

  4. Regulating transcription traffic around DSBs.

    PubMed

    Plosky, Brian S

    2015-05-07

    If a double-strand break (DSB) occurs and either a DNA polymerase or RNA polymerase is coming along, how do we save the train? In this issue of Molecular Cell, Ui et al. (2015) describe a connection between an elongation factor and a repressive complex to prevent transcription in proximity to a DSB.

  5. The dyadic regulation of affect.

    PubMed

    Fosha, D

    2001-02-01

    Accelerated Experiential-Dynamic Psychotherapy integrates experiential, relational, and psychodynamic elements. Deep authentic affective experience and its regulation through coordinated emotional interchanges between patient and therapist are viewed as key transformational agents. When maintaining attachment with caregivers necessitates excluding particular affects, a patient's capacity to regulate emotion becomes compromised. Being in an emotionally alive therapeutic relationship enables patients to better tolerate and communicate affective states; doing so, in turn, fosters security, openness, and intimacy in their other relationships. A clinical vignette will illustrate how using the therapist's affect, and focusing on the patient's experience of it, contributes to the repair of affect regulatory difficulties.

  6. Fli-1 transcription factor affects glomerulonephritis development by regulating expression of monocyte chemoattractant protein-1 in endothelial cells in the kidney.

    PubMed

    Suzuki, Eiji; Karam, Eva; Williams, Sarah; Watson, Dennis K; Gilkeson, Gary; Zhang, Xian K

    2012-12-01

    Expression of transcription factor Fli-1 is implicated in the development of glomerulonephritis. Fli-1 heterozygous knockout (Fli1(+/-)) NZM2410 mice, a murine model of lupus, had significantly improved survival and reduced glomerulonephritis. In this study, we found that infiltrated inflammatory cells were significantly decreased in the kidneys from Fli-1(+/-) NZM2410 mice. The expression of monocyte chemoattractant protein-1 (MCP-1) was significantly decreased in kidneys from Fli-1(+/-) NZM2410 mice. The primary endothelial cells isolated from the kidneys of Fli-1(+/-) NZM2410 mice produced significantly less MCP-1. In endothelial cells transfected with specific Fli-1 siRNA the production of MCP-1 was significantly reduced compared to cells transfected with negative control siRNA. By Chromatin Immunoprecipitation (ChIP) assay, we further demonstrated that Fli-1 directly binds to the promoter of the MCP-1 gene. Our data indicate that Fli-1 impacts glomerulonephritis development by regulating expression of inflammatory chemokine MCP-1 and inflammatory cell infiltration in the kidneys in the NZM2410 mice.

  7. Combinatorial Regulation in Yeast Transcription Networks

    NASA Astrophysics Data System (ADS)

    Li, Hao

    2006-03-01

    Yeast has evolved a complex network to regulate its transcriptional program in response to changes in environment. It is quite common that in response to an external stimulus, several transcription factors will be activated and they work in combinations to control different subsets of genes in the genome. We are interested in how the promoters of genes are designed to integrate signals from multiple transcription factors and what are the functional and evolutionary constraints. To answer how, we have developed a number of computational algorithms to systematically map the binding sites and target genes of transcription factors using sequence and gene expression data. To analyze the functional constraints, we have employed mechanistic models to study the dynamic behavior of genes regulated by multiple factors. We have also developed methods to trace the evolution of transcriptional networks via comparative analysis of multiple species.

  8. Catching transcriptional regulation by thermostatistical modeling

    NASA Astrophysics Data System (ADS)

    Frank, Till D.; Cheong, Alex; Okada-Hatakeyama, Mariko; Kholodenko, Boris N.

    2012-08-01

    Gene expression is frequently regulated by multiple transcription factors (TFs). Thermostatistical methods allow for a quantitative description of interactions between TFs, RNA polymerase and DNA, and their impact on the transcription rates. We illustrate three different scales of the thermostatistical approach: the microscale of TF molecules, the mesoscale of promoter energy levels and the macroscale of transcriptionally active and inactive cells in a cell population. We demonstrate versatility of combinatorial transcriptional activation by exemplifying logic functions, such as AND and OR gates. We discuss a metric for cell-to-cell transcriptional activation variability known as Fermi entropy. Suitability of thermostatistical modeling is illustrated by describing the experimental data on transcriptional induction of NFκB and the c-Fos protein.

  9. Mechanisms of mutational robustness in transcriptional regulation

    PubMed Central

    Payne, Joshua L.; Wagner, Andreas

    2015-01-01

    Robustness is the invariance of a phenotype in the face of environmental or genetic change. The phenotypes produced by transcriptional regulatory circuits are gene expression patterns that are to some extent robust to mutations. Here we review several causes of this robustness. They include robustness of individual transcription factor binding sites, homotypic clusters of such sites, redundant enhancers, transcription factors, redundant transcription factors, and the wiring of transcriptional regulatory circuits. Such robustness can either be an adaptation by itself, a byproduct of other adaptations, or the result of biophysical principles and non-adaptive forces of genome evolution. The potential consequences of such robustness include complex regulatory network topologies that arise through neutral evolution, as well as cryptic variation, i.e., genotypic divergence without phenotypic divergence. On the longest evolutionary timescales, the robustness of transcriptional regulation has helped shape life as we know it, by facilitating evolutionary innovations that helped organisms such as flowering plants and vertebrates diversify. PMID:26579194

  10. Emerging roles for post-transcriptional regulation in circadian clocks.

    PubMed

    Lim, Chunghun; Allada, Ravi

    2013-11-01

    Circadian clocks temporally organize behavior and physiology across the 24-h day. Great progress has been made in understanding the molecular basis of timekeeping, with a focus on transcriptional feedback networks that are post-translationally modulated. Yet emerging evidence indicates an important role for post-transcriptional regulation, from splicing, polyadenylation and mRNA stability to translation and non-coding functions exemplified by microRNAs. This level of regulation affects virtually all aspects of circadian systems, from the core timing mechanism and input pathways that synchronize clocks to the environment and output pathways that control overt rhythmicity. We hypothesize that post-transcriptional control confers on circadian clocks enhanced robustness as well as the ability to adapt to different environments. As much of what is known derives from nonneural cells or tissues, future work will be required to investigate the role of post-transcriptional regulation in neural clocks.

  11. Identifying Novel Transcriptional Regulators with Circadian Expression

    PubMed Central

    Schick, Sandra; Thakurela, Sudhir; Fournier, David; Hampel, Mareike Hildegard

    2015-01-01

    Organisms adapt their physiology and behavior to the 24-h day-night cycle to which they are exposed. On a cellular level, this is regulated by intrinsic transcriptional-translational feedback loops that are important for maintaining the circadian rhythm. These loops are organized by members of the core clock network, which further regulate transcription of downstream genes, resulting in their circadian expression. Despite progress in understanding circadian gene expression, only a few players involved in circadian transcriptional regulation, including transcription factors, epigenetic regulators, and long noncoding RNAs, are known. Aiming to discover such genes, we performed a high-coverage transcriptome analysis of a circadian time course in murine fibroblast cells. In combination with a newly developed algorithm, we identified many transcription factors, epigenetic regulators, and long intergenic noncoding RNAs that are cyclically expressed. In addition, a number of these genes also showed circadian expression in mouse tissues. Furthermore, the knockdown of one such factor, Zfp28, influenced the core clock network. Mathematical modeling was able to predict putative regulator-effector interactions between the identified circadian genes and may help for investigations into the gene regulatory networks underlying circadian rhythms. PMID:26644408

  12. Regulation of the microRNA 200b (miRNA-200b) by transcriptional regulators PEA3 and ELK-1 protein affects expression of Pin1 protein to control anoikis.

    PubMed

    Zhang, Xusen; Zhang, Bailin; Gao, Jidong; Wang, Xiang; Liu, Zhihua

    2013-11-08

    MicroRNA (miRNA) 200s regulate E-cadherin by directly targeting ZEB1/ZEB2, which are transcriptional repressors of E-cadherin. Decreased expression of E-cadherin results in cancer cells losing interaction with the extracellular matrix and detaching from the primary tumor. Normally, cells will undergo anoikis after losing interaction with the extracellular matrix. Cancer cells must, therefore, possess the ability to resist anoikis during the process of metastasis. Here we show that miRNA-200b regulates anoikis by directly targeting the 3' UTR of Pin1 mRNA and regulating Pin1 expression at the translational level. We found that down-regulation of miRNA-200b promotes cancer cells survival during metastasis, and the homeless state of these cells resulted in decreased expression of miRNA-200b in the MCF-7 cell line. We also found that expression of miRNA-200b is down-regulated in human breast cancer during lymph node metastasis, which has a significant negative correlation with Pin1 expression. Two members of the ETS (E-26) family (PEA3 and ELK-1) regulate the expression of miRNA-200b. PEA3 promotes the expression of miRNA-200b, and ELK-1 is a transcriptional repressor of miRNA-200b. In addition, miRNA-200b regulates the activity of PEA3 and ELK-1 via the Pin1-pERK pathway and forms self-regulated feedback loops. This study characterizes the role of miRNA-200b in the regulation of anoikis and demonstrates the regulation of its own expression in the process of metastasis.

  13. Transcriptional Regulation and Macrophage Differentiation.

    PubMed

    Hume, David A; Summers, Kim M; Rehli, Michael

    2016-06-01

    Monocytes and macrophages are professional phagocytes that occupy specific niches in every tissue of the body. Their survival, proliferation, and differentiation are controlled by signals from the macrophage colony-stimulating factor receptor (CSF-1R) and its two ligands, CSF-1 and interleukin-34. In this review, we address the developmental and transcriptional relationships between hematopoietic progenitor cells, blood monocytes, and tissue macrophages as well as the distinctions from dendritic cells. A huge repertoire of receptors allows monocytes, tissue-resident macrophages, or pathology-associated macrophages to adapt to specific microenvironments. These processes create a broad spectrum of macrophages with different functions and individual effector capacities. The production of large transcriptomic data sets in mouse, human, and other species provides new insights into the mechanisms that underlie macrophage functional plasticity.

  14. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

    PubMed Central

    De la Cruz, Miguel A.; Pérez-Morales, Deyanira; Palacios, Irene J.; Fernández-Mora, Marcos; Calva, Edmundo; Bustamante, Víctor H.

    2015-01-01

    Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella. PMID:26300871

  15. Proteasome Regulation of ULBP1 Transcription

    PubMed Central

    Butler, James E.; Moore, Mikel B.; Presnell, Steven R.; Chan, Huei-Wei; Chalupny, N. Jan; Lutz, Charles T.

    2009-01-01

    Killer lymphocytes recognize stress-activated NKG2D ligands on tumors. We examined NKG2D ligand expression in head and neck squamous cell carcinoma (HNSCC) cells and other cell lines. HNSCC cells typically expressed MHC class I chain-related gene A (MICA), MICB, UL16-binding protein (ULBP)2, and ULBP3, but they were uniformly negative for cell surface ULBP1 and ULBP4. We then studied how cancer treatments affected NKG2D ligand expression. NKG2D ligand expression was not changed by most cancer-relevant treatments. However, bortezomib and other proteasome inhibitor drugs with distinct mechanisms of action dramatically and specifically up-regulated HNSCC ULBP1 mRNA and cell surface protein. Proteasome inhibition also increased RNA for ULBP1 and other NKG2D ligands in nontransformed human keratinocytes. Proteasome inhibitor drugs increased ULBP1 transcription by acting at a site in the 522-bp ULBP1 promoter. Although the DNA damage response pathways mediated by ATM (ataxia-telangiectasia, mutated) and ATR (ATM and Rad3-related) signaling had been reported to up-regulate NKG2D ligand expression, we found that ULBP1 up-regulation was not inhibited by caffeine and wortmannin, inhibitors of ATM/ATR signaling. ULBP1 expression in HNSCC cells was not increased by several ATM/ATR activating treatments, including bleomycin, cisplatin, aphidicolin, and hydroxyurea. Ionizing radiation caused ATM activation in HNSCC cells, but high-level ULBP1 expression was not induced by gamma radiation or UV radiation. Thus, ATM/ATR signaling was neither necessary nor sufficient for high-level ULBP1 expression in human HNSCC cell lines and could not account for the proteasome effect. The selective induction of ULBP1 expression by proteasome inhibitor drugs, along with variable NKG2D ligand expression by human tumor cells, indicates that NKG2D ligand genes are independently regulated. PMID:19414815

  16. Transcriptional Regulation: It Takes a Village

    PubMed Central

    Panning, Barbara; Taatjes, Dylan J.

    2015-01-01

    A FASEB conference on “Transcriptional Regulation during Cell Growth, Differentiation and Development” met in June, 2008, just outside of Aspen in Snowmass Village, Colorado. The meeting covered a broad range of topics, including the structure of transcription factors (TFs), Preinitiation Complex (PIC) assembly, RNA polymerase II (Pol II) pausing, genome-wide patterns of histone modifications, and the role of TFs in development. PMID:18775322

  17. The evolution of transcriptional regulation in eukaryotes

    NASA Technical Reports Server (NTRS)

    Wray, Gregory A.; Hahn, Matthew W.; Abouheif, Ehab; Balhoff, James P.; Pizer, Margaret; Rockman, Matthew V.; Romano, Laura A.

    2003-01-01

    Gene expression is central to the genotype-phenotype relationship in all organisms, and it is an important component of the genetic basis for evolutionary change in diverse aspects of phenotype. However, the evolution of transcriptional regulation remains understudied and poorly understood. Here we review the evolutionary dynamics of promoter, or cis-regulatory, sequences and the evolutionary mechanisms that shape them. Existing evidence indicates that populations harbor extensive genetic variation in promoter sequences, that a substantial fraction of this variation has consequences for both biochemical and organismal phenotype, and that some of this functional variation is sorted by selection. As with protein-coding sequences, rates and patterns of promoter sequence evolution differ considerably among loci and among clades for reasons that are not well understood. Studying the evolution of transcriptional regulation poses empirical and conceptual challenges beyond those typically encountered in analyses of coding sequence evolution: promoter organization is much less regular than that of coding sequences, and sequences required for the transcription of each locus reside at multiple other loci in the genome. Because of the strong context-dependence of transcriptional regulation, sequence inspection alone provides limited information about promoter function. Understanding the functional consequences of sequence differences among promoters generally requires biochemical and in vivo functional assays. Despite these challenges, important insights have already been gained into the evolution of transcriptional regulation, and the pace of discovery is accelerating.

  18. O-Linked N-Acetylglucosamine (O-GlcNAc) Expression Levels Epigenetically Regulate Colon Cancer Tumorigenesis by Affecting the Cancer Stem Cell Compartment via Modulating Expression of Transcriptional Factor MYBL1.

    PubMed

    Guo, Huabei; Zhang, Bing; Nairn, Alison V; Nagy, Tamas; Moremen, Kelley W; Buckhaults, Phillip; Pierce, Michael

    2017-03-10

    To study the regulation of colorectal adenocarcinoma progression by O-GlcNAc, we have focused on the O-GlcNAc-mediated epigenetic regulation of human colon cancer stem cells (CCSC). Xenograft tumors from colon tumor cells with O-linked N-acetylglucosamine transferase (OGT) knockdown grew significantly slower than those formed from control cells, indicating a reduced proliferation of tumor cells due to inhibition of OGT expression. Significant reduction of the CCSC population was observed in the tumor cells after OGT knockdown, whereas tumor cells treated with the O-GlcNAcase inhibitor showed an increased CCSC population, indicating that O-GlcNAc levels regulated the CCSC compartment. When grown in suspension, tumor cells with OGT knockdown showed a reduced ability to form tumorspheres, indicating a reduced self-renewal of CCSC due to reduced levels of O-GlcNAc. ChIP-sequencing experiments using an anti-O-GlcNAc antibody revealed significant chromatin enrichment of O-GlcNAc-modified proteins at the promoter of the transcription factor MYBL1, which was also characterized by the presence of H3K27me3. RNA-sequencing analysis showed an increased expression of MYBL1 in tumor cells with OGT knockdown. Forced overexpression of MYBL1 led to a reduced population of CCSC and tumor growth in vivo, similar to the effects of OGT silencing. Moreover, two CpG islands near the transcription start site of MYBL1 were identified, and O-GlcNAc levels regulated their methylation status. These results strongly argue that O-GlcNAc epigenetically regulates MYBL1, functioning similarly to H3K27me3. The aberrant CCSC compartment observed after modulating O-GlcNAc levels is therefore likely to result, at least in part, from the epigenetic regulation of MYBL1 expression by O-GlcNAc, thereby significantly affecting tumor progression.

  19. The regulation of transcriptional repression in hypoxia.

    PubMed

    Cavadas, Miguel A S; Cheong, Alex; Taylor, Cormac T

    2017-02-20

    A sufficient supply molecular oxygen is essential for the maintenance of physiologic metabolism and bioenergetic homeostasis for most metazoans. For this reason, mechanisms have evolved for eukaryotic cells to adapt to conditions where oxygen demand exceeds supply (hypoxia). These mechanisms rely on the modification of pre-existing proteins, translational arrest and transcriptional changes. The hypoxia inducible factor (HIF; a master regulator of gene induction in response to hypoxia) is responsible for the majority of induced gene expression in hypoxia. However, much less is known about the mechanism(s) responsible for gene repression, an essential part of the adaptive transcriptional response. Hypoxia-induced gene repression leads to a reduction in energy demanding processes and the redirection of limited energetic resources to essential housekeeping functions. Recent developments have underscored the importance of transcriptional repressors in cellular adaptation to hypoxia. To date, at least ten distinct transcriptional repressors have been reported to demonstrate sensitivity to hypoxia. Central among these is the Repressor Element-1 Silencing Transcription factor (REST), which regulates over 200 genes. In this review, written to honor the memory and outstanding scientific legacy of Lorenz Poellinger, we provide an overview of our existing knowledge with respect to transcriptional repressors and their target genes in hypoxia.

  20. The Regulation of Transcription in Memory Consolidation

    PubMed Central

    Alberini, Cristina M.; Kandel, Eric R.

    2015-01-01

    De novo transcription of DNA is a fundamental requirement for the formation of long-term memory. It is required during both consolidation and reconsolidation, the posttraining and postreactivation phases that change the state of the memory from a fragile into a stable and long-lasting form. Transcription generates both mRNAs that are translated into proteins, which are necessary for the growth of new synaptic connections, as well as noncoding RNA transcripts that have regulatory or effector roles in gene expression. The result is a cascade of events that ultimately leads to structural changes in the neurons that mediate long-term memory storage. The de novo transcription, critical for synaptic plasticity and memory formation, is orchestrated by chromatin and epigenetic modifications. The complexity of transcription regulation, its temporal progression, and the effectors produced all contribute to the flexibility and persistence of long-term memory formation. In this article, we provide an overview of the mechanisms contributing to this transcriptional regulation underlying long-term memory formation. PMID:25475090

  1. The regulation of transcription in memory consolidation.

    PubMed

    Alberini, Cristina M; Kandel, Eric R

    2014-12-04

    De novo transcription of DNA is a fundamental requirement for the formation of long-term memory. It is required during both consolidation and reconsolidation, the posttraining and postreactivation phases that change the state of the memory from a fragile into a stable and long-lasting form. Transcription generates both mRNAs that are translated into proteins, which are necessary for the growth of new synaptic connections, as well as noncoding RNA transcripts that have regulatory or effector roles in gene expression. The result is a cascade of events that ultimately leads to structural changes in the neurons that mediate long-term memory storage. The de novo transcription, critical for synaptic plasticity and memory formation, is orchestrated by chromatin and epigenetic modifications. The complexity of transcription regulation, its temporal progression, and the effectors produced all contribute to the flexibility and persistence of long-term memory formation. In this article, we provide an overview of the mechanisms contributing to this transcriptional regulation underlying long-term memory formation.

  2. Regulation of Specialized Metabolism by WRKY Transcription Factors

    PubMed Central

    Schluttenhofer, Craig; Yuan, Ling

    2015-01-01

    WRKY transcription factors (TFs) are well known for regulating plant abiotic and biotic stress tolerance. However, much less is known about how WRKY TFs affect plant-specialized metabolism. Analysis of WRKY TFs regulating the production of specialized metabolites emphasizes the values of the family outside of traditionally accepted roles in stress tolerance. WRKYs with conserved roles across plant species seem to be essential in regulating specialized metabolism. Overall, the WRKY family plays an essential role in regulating the biosynthesis of important pharmaceutical, aromatherapy, biofuel, and industrial components, warranting considerable attention in the forthcoming years. PMID:25501946

  3. Transcriptional regulation by post-transcriptional modification--role of phosphorylation in Sp1 transcriptional activity.

    PubMed

    Chu, Shijian

    2012-10-15

    Sp1 is a ubiquitously expressed transcription factor involved in the regulation of a large number of genes including housekeeping genes as well as actively regulated genes. Although Sp1 was discovered nearly three decades ago, its functional diversity is still not completely understood. One of the ways that make Sp1 versatile in transcriptional regulation is its post-transcriptional modification, which alters Sp1 structure in different cells and at different times. Compared to other types of modifications of the Sp1 protein, phosphorylation has been studied far more extensively. This review focuses on the inducers, pathways, enzymes, and biological effects of Sp1 phosphorylation. Recent data are beginning to reveal the biological significance and universal presence of Sp1 phosphorylation-related cell/molecular responses. Studies in this field provide a quick glance at how a simple chemical modification of a transcription factor could produce significant functional diversity of the protein.

  4. An overview on transcriptional regulators in Streptomyces.

    PubMed

    Romero-Rodríguez, Alba; Robledo-Casados, Ivonne; Sánchez, Sergio

    2015-08-01

    Streptomyces are Gram-positive microorganisms able to adapt and respond to different environmental conditions. It is the largest genus of Actinobacteria comprising over 900 species. During their lifetime, these microorganisms are able to differentiate, produce aerial mycelia and secondary metabolites. All of these processes are controlled by subtle and precise regulatory systems. Regulation at the transcriptional initiation level is probably the most common for metabolic adaptation in bacteria. In this mechanism, the major players are proteins named transcription factors (TFs), capable of binding DNA in order to repress or activate the transcription of specific genes. Some of the TFs exert their action just like activators or repressors, whereas others can function in both manners, depending on the target promoter. Generally, TFs achieve their effects by using one- or two-component systems, linking a specific type of environmental stimulus to a transcriptional response. After DNA sequencing, many streptomycetes have been found to have chromosomes ranging between 6 and 12Mb in size, with high GC content (around 70%). They encode for approximately 7000 to 10,000 genes, 50 to 100 pseudogenes and a large set (around 12% of the total chromosome) of regulatory genes, organized in networks, controlling gene expression in these bacteria. Among the sequenced streptomycetes reported up to now, the number of transcription factors ranges from 471 to 1101. Among these, 315 to 691 correspond to transcriptional regulators and 31 to 76 are sigma factors. The aim of this work is to give a state of the art overview on transcription factors in the genus Streptomyces.

  5. [Modulation of transcriptional regulation during bone and cartilage development and their disease].

    PubMed

    Nishimura, Riko; Hata, Kenji; Takashima, Rikako; Yoshida, Michiko; Nakamura, Eriko; Kida, Junpei; Yagi, Hiroko

    2013-11-01

    Genetic and biochemical studies have identified transcription factors critical and specific for bone and cartilage development. More recent studies revealed the molecular mechanisms how these transcription factors regulate bone and cartilage development. Especially, we appreciate recent advances in molecular function of the complex assembled by these transcription factors and epigenetic regulation of them. Aging, inflammation, biological stress, and disorder of endocrine system induce several bone and/or cartilage diseases by affecting the transcriptional and epigenetic regulation. In this review, we would like to describe the transcriptional and epigenetic regulation during developmental and pathological stages. In addition, we discuss possible application of these information in regeneration of bone and cartilage.

  6. Switching on cilia: transcriptional networks regulating ciliogenesis.

    PubMed

    Choksi, Semil P; Lauter, Gilbert; Swoboda, Peter; Roy, Sudipto

    2014-04-01

    Cilia play many essential roles in fluid transport and cellular locomotion, and as sensory hubs for a variety of signal transduction pathways. Despite having a conserved basic morphology, cilia vary extensively in their shapes and sizes, ultrastructural details, numbers per cell, motility patterns and sensory capabilities. Emerging evidence indicates that this diversity, which is intimately linked to the different functions that cilia perform, is in large part programmed at the transcriptional level. Here, we review our understanding of the transcriptional control of ciliary biogenesis, highlighting the activities of FOXJ1 and the RFX family of transcriptional regulators. In addition, we examine how a number of signaling pathways, and lineage and cell fate determinants can induce and modulate ciliogenic programs to bring about the differentiation of distinct cilia types.

  7. Musical affect regulation in infancy.

    PubMed

    Trehub, Sandra E; Ghazban, Niusha; Corbeil, Mariève

    2015-03-01

    Adolescents and adults commonly use music for various forms of affect regulation, including relaxation, revitalization, distraction, and elicitation of pleasant memories. Mothers throughout the world also sing to their infants, with affect regulation as the principal goal. To date, the study of maternal singing has focused largely on its acoustic features and its consequences for infant attention. We describe recent laboratory research that explores the consequences of singing for infant affect regulation. Such work reveals that listening to recordings of play songs can maintain 6- to 9-month-old infants in a relatively contented or neutral state considerably longer than recordings of infant-directed or adult-directed speech. When 10-month-old infants fuss or cry and are highly aroused, mothers' multimodal singing is more effective than maternal speech at inducing recovery from such distress. Moreover, play songs are more effective than lullabies at reducing arousal in Western infants. We explore the implications of these findings along with possible practical applications.

  8. TRANSFAC: transcriptional regulation, from patterns to profiles.

    PubMed

    Matys, V; Fricke, E; Geffers, R; Gössling, E; Haubrock, M; Hehl, R; Hornischer, K; Karas, D; Kel, A E; Kel-Margoulis, O V; Kloos, D-U; Land, S; Lewicki-Potapov, B; Michael, H; Münch, R; Reuter, I; Rotert, S; Saxel, H; Scheer, M; Thiele, S; Wingender, E

    2003-01-01

    The TRANSFAC database on eukaryotic transcriptional regulation, comprising data on transcription factors, their target genes and regulatory binding sites, has been extended and further developed, both in number of entries and in the scope and structure of the collected data. Structured fields for expression patterns have been introduced for transcription factors from human and mouse, using the CYTOMER database on anatomical structures and developmental stages. The functionality of Match, a tool for matrix-based search of transcription factor binding sites, has been enhanced. For instance, the program now comes along with a number of tissue-(or state-)specific profiles and new profiles can be created and modified with Match Profiler. The GENE table was extended and gained in importance, containing amongst others links to LocusLink, RefSeq and OMIM now. Further, (direct) links between factor and target gene on one hand and between gene and encoded factor on the other hand were introduced. The TRANSFAC public release is available at http://www.gene-regulation.com. For yeast an additional release including the latest data was made available separately as TRANSFAC Saccharomyces Module (TSM) at http://transfac.gbf.de. For CYTOMER free download versions are available at http://www.biobase.de:8080/index.html.

  9. Epigenetic regulation of transcription in intermediate heterochromatin.

    PubMed

    Habu, Yoshiki; Mathieu, Olivier; Tariq, Muhammad; Probst, Aline V; Smathajitt, Chotika; Zhu, Tong; Paszkowski, Jerzy

    2006-12-01

    Constitutive heterochromatin is a compact, transcriptionally inert structure formed in gene-poor and repeat- and transposon-rich regions. In Arabidopsis, constitutive heterochromatin is characterized by hypermethylated DNA and histone H3 dimethylated at lysine (K) 9 (H3K9me2) together with depletion of histone H3 dimethylated at lysine 4 (H3K4me2). Here, we describe loci with intermediate properties of heterochromatin in which transcription downregulation is inherited in a manner similar to constitutive heterochromatin, although the loci are associated with opposing histone marks--H3K4me2 and H3K9me2. In the ddm1 (decrease in DNA methylation 1) mutants, their transcriptional activation is accompanied by the expected shift in the H3 modifications--depletion of H3K9me2 and enrichment in H3K4me2. In mom1 (Morpheus' molecule 1) mutants, however, a marked increase in transcription is not accompanied by detectable changes in the levels of H3K4me2 and H3K9me2. Therefore, transcriptional regulation in the intermediate heterochromatin involves two distinct epigenetic mechanisms. Interestingly, silent transgenic inserts seem to acquire properties characteristic of the intermediate heterochromatin.

  10. Transcriptional regulation of epithelial-mesenchymal transition.

    PubMed

    Teng, Yingqi; Zeisberg, Michael; Kalluri, Raghu

    2007-02-01

    It has become increasingly obvious that the notion of a terminally differentiated cell is likely a simplified concept. Epithelial-mesenchymal transition (EMT), during which epithelial cells assume a mesenchymal phenotype, is a key event occurring during normal development and pathological processes. Multiple extracellular stimuli and transcriptional regulators can trigger EMT, but how such distinct signaling pathways orchestrate the complex cellular events that facilitate EMT is not well understood. In this issue of the JCI, Venkov et al. report on their examination of fibroblasts resulting from EMT and describe a novel protein-DNA complex that is essential for transcription of fibroblast-specific protein 1 (FSP1) and sufficient to induce early EMT events (see the related article beginning on page 482). Collectively, their results suggest that this complex is an important regulator of the EMT transcriptome.

  11. Transcriptional regulation of epithelial-mesenchymal transition

    PubMed Central

    Teng, Yingqi; Zeisberg, Michael; Kalluri, Raghu

    2007-01-01

    It has become increasingly obvious that the notion of a terminally differentiated cell is likely a simplified concept. Epithelial-mesenchymal transition (EMT), during which epithelial cells assume a mesenchymal phenotype, is a key event occurring during normal development and pathological processes. Multiple extracellular stimuli and transcriptional regulators can trigger EMT, but how such distinct signaling pathways orchestrate the complex cellular events that facilitate EMT is not well understood. In this issue of the JCI, Venkov et al. report on their examination of fibroblasts resulting from EMT and describe a novel protein-DNA complex that is essential for transcription of fibroblast-specific protein 1 (FSP1) and sufficient to induce early EMT events (see the related article beginning on page 482). Collectively, their results suggest that this complex is an important regulator of the EMT transcriptome. PMID:17273552

  12. Epigenetic regulation of transcription in Drosophila.

    PubMed

    Swaminathan, Aishwarya; Gajan, Ambikai; Pile, Lori A

    2012-01-01

    Post-translational modification of histones is a major mechanism of epigenetic regulation of eukaryotic transcription. Drosophila has proven to be an important model system for the study of histone modifying enzymes and the cross talk that occurs between the various modifications. Polytene chromosome analysis and genome-wide chromatin immunoprecipitation (ChIP) studies have provided much insight into the location of marks and many of the enzymes that perform the catalytic reactions. Gene specific effects have been determined through study of flies carrying mutations in histone modifying enzymes. This review will highlight classic studies and present recent progress on both the localization data and mutant analyses. This information has been used to assign function to the marks and to the enzymes that place or remove them, critical for the process of transcriptional regulation.

  13. The Mediator complex and transcription regulation.

    PubMed

    Poss, Zachary C; Ebmeier, Christopher C; Taatjes, Dylan J

    2013-01-01

    The Mediator complex is a multi-subunit assembly that appears to be required for regulating expression of most RNA polymerase II (pol II) transcripts, which include protein-coding and most non-coding RNA genes. Mediator and pol II function within the pre-initiation complex (PIC), which consists of Mediator, pol II, TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH and is approximately 4.0 MDa in size. Mediator serves as a central scaffold within the PIC and helps regulate pol II activity in ways that remain poorly understood. Mediator is also generally targeted by sequence-specific, DNA-binding transcription factors (TFs) that work to control gene expression programs in response to developmental or environmental cues. At a basic level, Mediator functions by relaying signals from TFs directly to the pol II enzyme, thereby facilitating TF-dependent regulation of gene expression. Thus, Mediator is essential for converting biological inputs (communicated by TFs) to physiological responses (via changes in gene expression). In this review, we summarize an expansive body of research on the Mediator complex, with an emphasis on yeast and mammalian complexes. We focus on the basics that underlie Mediator function, such as its structure and subunit composition, and describe its broad regulatory influence on gene expression, ranging from chromatin architecture to transcription initiation and elongation, to mRNA processing. We also describe factors that influence Mediator structure and activity, including TFs, non-coding RNAs and the CDK8 module.

  14. Post-transcriptional regulation of ornithine decarboxylase

    PubMed Central

    Nowotarski, Shannon L.; Origanti, Sofia; Shantz, Lisa M.

    2013-01-01

    Activity of the polyamine biosynthetic enzyme ornithine decarboxylase (ODC), and intracellular levels of ODC protein are controlled very tightly. Numerous studies have described ODC regulation at the levels of transcription, translation and protein degradation in normal cells, and dysregulation of these processes in response to oncogenic stimuli. Although post-transcriptional regulation of ODC has been well-documented, the RNA binding proteins (RBPs) that interact with ODC mRNA and control synthesis of the ODC protein have not been defined. Using Ras-transformed rat intestinal epithelial cells (Ras12V cells) as a model, we have begun identifying the RBPs that associate with the ODC transcript. Binding of RBPs could potentially regulate ODC synthesis by either changing mRNA stability or rate of mRNA translation. Techniques for measuring RBP binding and translation initiation are described here. Targeting control of ODC translation or mRNA decay could be a valuable method of limiting polyamine accumulation and subsequent tumor development in a variety of cancers. PMID:21318880

  15. Semantic integration of data on transcriptional regulation

    PubMed Central

    Baitaluk, Michael; Ponomarenko, Julia

    2010-01-01

    Motivation: Experimental and predicted data concerning gene transcriptional regulation are distributed among many heterogeneous sources. However, there are no resources to integrate these data automatically or to provide a ‘one-stop shop’ experience for users seeking information essential for deciphering and modeling gene regulatory networks. Results: IntegromeDB, a semantic graph-based ‘deep-web’ data integration system that automatically captures, integrates and manages publicly available data concerning transcriptional regulation, as well as other relevant biological information, is proposed in this article. The problems associated with data integration are addressed by ontology-driven data mapping, multiple data annotation and heterogeneous data querying, also enabling integration of the user's data. IntegromeDB integrates over 100 experimental and computational data sources relating to genomics, transcriptomics, genetics, and functional and interaction data concerning gene transcriptional regulation in eukaryotes and prokaryotes. Availability: IntegromeDB is accessible through the integrated research environment BiologicalNetworks at http://www.BiologicalNetworks.org Contact: baitaluk@sdsc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20427517

  16. Opposing Transcriptional Mechanisms Regulate Toxoplasma Development

    PubMed Central

    Hong, Dong-Pyo; Radke, Joshua B.

    2017-01-01

    ABSTRACT The Toxoplasma biology that underlies human chronic infection is developmental conversion of the acute tachyzoite stage into the latent bradyzoite stage. We investigated the roles of two alkaline-stress-induced ApiAP2 transcription factors, AP2IV-3 and AP2IX-9, in bradyzoite development. These factors were expressed in two overlapping waves during bradyzoite development, with AP2IX-9 increasing expression earlier than AP2IV-3, which peaked as AP2IX-9 expression was declining. Disruption of the AP2IX-9 gene enhanced, while deletion of AP2IV-3 gene decreased, tissue cyst formation, demonstrating that these factors have opposite functions in bradyzoite development. Conversely, conditional overexpression of FKBP-modified AP2IX-9 or AP2IV-3 with the small molecule Shield 1 had a reciprocal effect on tissue cyst formation, confirming the conclusions of the knockout experiments. The AP2IX-9 repressor and AP2IV-3 activator tissue cyst phenotypes were borne out in gene expression studies that determined that many of the same bradyzoite genes were regulated in an opposite manner by these transcription factors. A common gene target was the canonical bradyzoite marker BAG1, and mechanistic experiments determined that, like AP2IX-9, AP2IV-3 regulates a BAG1 promoter-luciferase reporter and specifically binds the BAG1 promoter in parasite chromatin. Altogether, these results suggest that the AP2IX-9 transcriptional repressor and the AP2IV-3 transcriptional activator likely compete to control bradyzoite gene expression, which may permit Toxoplasma to better adapt to different tissue environments and select a suitable host cell for long-term survival of the dormant tissue cyst. IMPORTANCE Toxoplasma infections are lifelong because of the development of the bradyzoite tissue cyst, which is effectively invisible to the immune system. Despite the important clinical consequences of this developmental pathway, the molecular basis of the switch mechanisms that control tissue

  17. Evolution of a transcriptional regulator from a transmembrane nucleoporin.

    PubMed

    Franks, Tobias M; Benner, Chris; Narvaiza, Iñigo; Marchetto, Maria C N; Young, Janet M; Malik, Harmit S; Gage, Fred H; Hetzer, Martin W

    2016-05-15

    Nuclear pore complexes (NPCs) emerged as nuclear transport channels in eukaryotic cells ∼1.5 billion years ago. While the primary role of NPCs is to regulate nucleo-cytoplasmic transport, recent research suggests that certain NPC proteins have additionally acquired the role of affecting gene expression at the nuclear periphery and in the nucleoplasm in metazoans. Here we identify a widely expressed variant of the transmembrane nucleoporin (Nup) Pom121 (named sPom121, for "soluble Pom121") that arose by genomic rearrangement before the divergence of hominoids. sPom121 lacks the nuclear membrane-anchoring domain and thus does not localize to the NPC. Instead, sPom121 colocalizes and interacts with nucleoplasmic Nup98, a previously identified transcriptional regulator, at gene promoters to control transcription of its target genes in human cells. Interestingly, sPom121 transcripts appear independently in several mammalian species, suggesting convergent innovation of Nup-mediated transcription regulation during mammalian evolution. Our findings implicate alternate transcription initiation as a mechanism to increase the functional diversity of NPC components.

  18. Evolution of a transcriptional regulator from a transmembrane nucleoporin

    PubMed Central

    Franks, Tobias M.; Benner, Chris; Narvaiza, Iñigo; Marchetto, Maria C.N.; Young, Janet M.; Malik, Harmit S.; Gage, Fred H.; Hetzer, Martin W.

    2016-01-01

    Nuclear pore complexes (NPCs) emerged as nuclear transport channels in eukaryotic cells ∼1.5 billion years ago. While the primary role of NPCs is to regulate nucleo–cytoplasmic transport, recent research suggests that certain NPC proteins have additionally acquired the role of affecting gene expression at the nuclear periphery and in the nucleoplasm in metazoans. Here we identify a widely expressed variant of the transmembrane nucleoporin (Nup) Pom121 (named sPom121, for “soluble Pom121”) that arose by genomic rearrangement before the divergence of hominoids. sPom121 lacks the nuclear membrane-anchoring domain and thus does not localize to the NPC. Instead, sPom121 colocalizes and interacts with nucleoplasmic Nup98, a previously identified transcriptional regulator, at gene promoters to control transcription of its target genes in human cells. Interestingly, sPom121 transcripts appear independently in several mammalian species, suggesting convergent innovation of Nup-mediated transcription regulation during mammalian evolution. Our findings implicate alternate transcription initiation as a mechanism to increase the functional diversity of NPC components. PMID:27198230

  19. Methylation Affects Transposition and Splicing of a Large CACTA Transposon from a MYB Transcription Factor Regulating Anthocyanin Synthase Genes in Soybean Seed Coats

    PubMed Central

    Zabala, Gracia; Vodkin, Lila O.

    2014-01-01

    We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-rm is homozygous for a mutable allele (rm) that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-rm line had a 13 kb CACTA subfamily transposon insertion (designated TgmR*) at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3) to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-rm progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element. PMID:25369033

  20. Post-transcriptional regulation of interferons and their signaling pathways.

    PubMed

    Savan, Ram

    2014-05-01

    Interferons (IFNs) are low molecular weight cell-derived proteins that include the type I, II, and III IFN families. IFNs are critical for an optimal immune response during microbial infections while dysregulated expression can lead to autoimmune diseases. Given its role in disease, it is important to understand cellular mechanisms of IFN regulation. 3' untranslated regions (3' UTRs) have emerged as potent regulators of mRNA and protein dosage and are controlled through multiple regulatory elements including adenylate uridylate (AU)-rich elements (AREs) and microRNA (miRNA) recognition elements. These AREs are targeted by RNA-binding proteins (ARE-BPs) for degradation and/or stabilization through an ARE-mediated decay process. miRNA are endogenous, single-stranded RNA molecules ~22 nucleotides in length that regulate mRNA translation through the miRNA-induced silencing complex. IFN transcripts, like other labile mRNAs, harbor AREs in their 3' UTRs that dictate the turnover of mRNA. This review is a survey of the literature related to IFN regulation by miRNA, ARE-BPs, and how these complexes interact dynamically on the 3' UTR. Additionally, downstream effects of these post-transcriptional regulators on the immune response will be discussed. Review topics include past studies, current understanding, and future challenges in the study of post-transcriptional regulation affecting IFN responses.

  1. Post-Transcriptional Regulation of Interferons and Their Signaling Pathways

    PubMed Central

    2014-01-01

    Interferons (IFNs) are low molecular weight cell-derived proteins that include the type I, II, and III IFN families. IFNs are critical for an optimal immune response during microbial infections while dysregulated expression can lead to autoimmune diseases. Given its role in disease, it is important to understand cellular mechanisms of IFN regulation. 3′ untranslated regions (3′ UTRs) have emerged as potent regulators of mRNA and protein dosage and are controlled through multiple regulatory elements including adenylate uridylate (AU)-rich elements (AREs) and microRNA (miRNA) recognition elements. These AREs are targeted by RNA-binding proteins (ARE-BPs) for degradation and/or stabilization through an ARE-mediated decay process. miRNA are endogenous, single-stranded RNA molecules ∼22 nucleotides in length that regulate mRNA translation through the miRNA-induced silencing complex. IFN transcripts, like other labile mRNAs, harbor AREs in their 3′ UTRs that dictate the turnover of mRNA. This review is a survey of the literature related to IFN regulation by miRNA, ARE-BPs, and how these complexes interact dynamically on the 3′ UTR. Additionally, downstream effects of these post-transcriptional regulators on the immune response will be discussed. Review topics include past studies, current understanding, and future challenges in the study of post-transcriptional regulation affecting IFN responses. PMID:24702117

  2. Transcriptional Regulation of TMP21 by NFAT

    PubMed Central

    2011-01-01

    Background TMP21 is a member of the p24 cargo protein family, which is involved in protein transport between the Golgi apparatus and ER. Alzheimer's Disease (AD) is the most common neurodegenerative disorder leading to dementia and deposition of amyloid β protein (Aβ) is the pathological feature of AD pathogenesis. Knockdown of TMP21 expression by siRNA causes a sharp increase in Aβ production; however the underlying mechanism by which TMP21 regulates Aβ generation is unknown, and human TMP21 gene expression regulation has not yet been studied. Results In this report we have cloned a 3.3-kb fragment upstream of the human TMP21 gene. The transcription start site (TSS) of the human TMP21 gene was identified. A series of nested deletions of the 5' flanking region of the human TMP21 gene were subcloned into the pGL3-basic luciferase reporter plasmid. We identified the -120 to +2 region as containing the minimal sequence necessary for TMP21 gene promoter activity. Gel shift assays revealed that the human TMP21 gene promoter contains NFAT response elements. Expression of NFAT increased TMP21 gene expression and inhibition of NFAT by siRNA reduced TMP21 gene expression. Conclusion NFAT plays a very important role in the regulation of human TMP21 gene expression. This study demonstrates that the human TMP21 gene expression is transcriptionally regulated by NFAT signaling. PMID:21375783

  3. Peroxide-Sensing Transcriptional Regulators in Bacteria

    PubMed Central

    Mongkolsuk, Skorn

    2012-01-01

    The ability to maintain intracellular concentrations of toxic reactive oxygen species (ROS) within safe limits is essential for all aerobic life forms. In bacteria, as well as other organisms, ROS are produced during the normal course of aerobic metabolism, necessitating the constitutive expression of ROS scavenging systems. However, bacteria can also experience transient high-level exposure to ROS derived either from external sources, such as the host defense response, or as a secondary effect of other seemingly unrelated environmental stresses. Consequently, transcriptional regulators have evolved to sense the levels of ROS and coordinate the appropriate oxidative stress response. Three well-studied examples of these are the peroxide responsive regulators OxyR, PerR, and OhrR. OxyR and PerR are sensors of primarily H2O2, while OhrR senses organic peroxide (ROOH) and sodium hypochlorite (NaOCl). OxyR and OhrR sense oxidants by means of the reversible oxidation of specific cysteine residues. In contrast, PerR senses H2O2 via the Fe-catalyzed oxidation of histidine residues. These transcription regulators also influence complex biological phenomena, such as biofilm formation, the evasion of host immune responses, and antibiotic resistance via the direct regulation of specific proteins. PMID:22797754

  4. Peroxide-sensing transcriptional regulators in bacteria.

    PubMed

    Dubbs, James M; Mongkolsuk, Skorn

    2012-10-01

    The ability to maintain intracellular concentrations of toxic reactive oxygen species (ROS) within safe limits is essential for all aerobic life forms. In bacteria, as well as other organisms, ROS are produced during the normal course of aerobic metabolism, necessitating the constitutive expression of ROS scavenging systems. However, bacteria can also experience transient high-level exposure to ROS derived either from external sources, such as the host defense response, or as a secondary effect of other seemingly unrelated environmental stresses. Consequently, transcriptional regulators have evolved to sense the levels of ROS and coordinate the appropriate oxidative stress response. Three well-studied examples of these are the peroxide responsive regulators OxyR, PerR, and OhrR. OxyR and PerR are sensors of primarily H(2)O(2), while OhrR senses organic peroxide (ROOH) and sodium hypochlorite (NaOCl). OxyR and OhrR sense oxidants by means of the reversible oxidation of specific cysteine residues. In contrast, PerR senses H(2)O(2) via the Fe-catalyzed oxidation of histidine residues. These transcription regulators also influence complex biological phenomena, such as biofilm formation, the evasion of host immune responses, and antibiotic resistance via the direct regulation of specific proteins.

  5. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation

    PubMed Central

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5’ upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile. PMID:28005945

  6. Repetitive Elements in Mycoplasma hyopneumoniae Transcriptional Regulation.

    PubMed

    Cattani, Amanda Malvessi; Siqueira, Franciele Maboni; Guedes, Rafael Lucas Muniz; Schrank, Irene Silveira

    2016-01-01

    Transcriptional regulation, a multiple-step process, is still poorly understood in the important pig pathogen Mycoplasma hyopneumoniae. Basic motifs like promoters and terminators have already been described, but no other cis-regulatory elements have been found. DNA repeat sequences have been shown to be an interesting potential source of cis-regulatory elements. In this work, a genome-wide search for tandem and palindromic repetitive elements was performed in the intergenic regions of all coding sequences from M. hyopneumoniae strain 7448. Computational analysis demonstrated the presence of 144 tandem repeats and 1,171 palindromic elements. The DNA repeat sequences were distributed within the 5' upstream regions of 86% of transcriptional units of M. hyopneumoniae strain 7448. Comparative analysis between distinct repetitive sequences found in related mycoplasma genomes demonstrated different percentages of conservation among pathogenic and nonpathogenic strains. qPCR assays revealed differential expression among genes showing variable numbers of repetitive elements. In addition, repeats found in 206 genes already described to be differentially regulated under different culture conditions of M. hyopneumoniae strain 232 showed almost 80% conservation in relation to M. hyopneumoniae strain 7448 repeats. Altogether, these findings suggest a potential regulatory role of tandem and palindromic DNA repeats in the M. hyopneumoniae transcriptional profile.

  7. Information flow and optimization in transcriptional regulation.

    PubMed

    Tkacik, Gasper; Callan, Curtis G; Bialek, William

    2008-08-26

    In the simplest view of transcriptional regulation, the expression of a gene is turned on or off by changes in the concentration of a transcription factor (TF). We use recent data on noise levels in gene expression to show that it should be possible to transmit much more than just one regulatory bit. Realizing this optimal information capacity would require that the dynamic range of TF concentrations used by the cell, the input/output relation of the regulatory module, and the noise in gene expression satisfy certain matching relations, which we derive. These results provide parameter-free, quantitative predictions connecting independently measurable quantities. Although we have considered only the simplified problem of a single gene responding to a single TF, we find that these predictions are in surprisingly good agreement with recent experiments on the Bicoid/Hunchback system in the early Drosophila embryo and that this system achieves approximately 90% of its theoretical maximum information transmission.

  8. Transcriptional regulation of cranial sensory placode development

    PubMed Central

    Moody, Sally A.; LaMantia, Anthony-Samuel

    2015-01-01

    Cranial sensory placodes derive from discrete patches of the head ectoderm, and give rise to numerous sensory structures. During gastrulation, a specialized “neural border zone” forms around the neural plate in response to interactions between the neural and non-neural ectoderm and signals from adjacent mesodermal and/or endodermal tissues. This zone subsequently gives rise to two distinct precursor populations of the peripheral nervous system: the neural crest and the pre-placodal ectoderm (PPE). The PPE is a common field from which all cranial sensory placodes arise (adenohypophyseal, olfactory, lens, trigeminal, epibranchial, otic). Members of the Six family of transcription factors are major regulators of PPE specification, in partnership with co-factor proteins such as Eya. Six gene activity also maintains tissue boundaries between the PPE, neural crest and epidermis by repressing genes that specify the fates of those adjacent ectodermally-derived domains. As the embryo acquires anterior-posterior identity, the PPE becomes transcriptionally regionalized, and it subsequently subdivides into specific placodes with distinct developmental fates in response to signaling from adjacent tissues. Each placode is characterized by a unique transcriptional program that leads to the differentiation of highly specialized cells, such as neurosecretory cells, somatic sensory receptor cells, chemosensory neurons, peripheral glia and supporting cells. In this review, we summarize the transcriptional and signaling factors that regulate key steps of placode development, influence subsequent sensory neuron specification, and discuss what is known about mutations in some of the essential PPE genes that underlie human congenital syndromes. PMID:25662264

  9. Transcriptional regulator GntR of Brucella abortus regulates cytotoxicity, induces the secretion of inflammatory cytokines and affects expression of the type IV secretion system and quorum sensing system in macrophages.

    PubMed

    Li, Zhiqiang; Wang, Shuli; Zhang, Hui; Zhang, Jinliang; Xi, Li; Zhang, Junbo; Chen, Chuangfu

    2017-03-01

    The pathogenic mechanisms of Brucella are still poorly understood. GntR is a transcriptional regulator and plays an important role in the intracellular survival of Brucella. To investigate whether GntR is involved in the cytotoxicity of Brucella abortus (B. abortus), we created a 2308ΔgntR mutant of B. abortus 2308 (S2308). Lactate dehydrogenase (LDH) cytotoxicity assays using a murine macrophage cell line (RAW 264.7) show that high-dose infection with the parental strain produces a high level of cytotoxicity to macrophages, but the 2308ΔgntR mutant exhibits a very low level of cytotoxicity, indicating that mutation of GntR impairs the cytotoxicity of B. abortus to macrophages. After the macrophages are infected with 2308ΔgntR, the levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-8 (IL-8) increase and are slightly higher than that for the S2308 infected group, indicating that the 2308ΔgntR mutant could induce the secretion of inflammatory cytokines. The virulence factor detection experiments indicate that genes involved in the type IV secretion system (T4SS) and quorum sensing system (QSS) are down-regulated in 2308ΔgntR. The lower levels of survival of 2308ΔgntR under various stress conditions and the increased sensitivity of 2308ΔgntR to polymyxin B suggest that GntR is a virulence factor and that deletion of gntR reduces of B. abortus to stress conditions. Taken together, our results demonstrate that GntR is involved in the cytotoxicity, virulence and intracellular survival of B. abortus during its infection.

  10. Transcriptional regulation of plant phosphate transporters

    PubMed Central

    Muchhal, Umesh S.; Raghothama, K. G.

    1999-01-01

    Phosphorus is acquired by plant roots primarily via the high-affinity inorganic phosphate (Pi) transporters. The transcripts for Pi transporters are highly inducible upon Pi starvation, which also results in enhanced Pi uptake when Pi is resupplied. Using antibodies specific to one of the tomato Pi transporters (encoded by LePT1), we show that an increase in the LePT1 transcript under Pi starvation leads to a concurrent increase in the transporter protein, suggesting a transcriptional regulation for Pi acquisition. LePT1 protein accumulates rapidly in tomato roots in response to Pi starvation. The level of transporter protein accumulation depends on the Pi concentration in the medium, and it is reversible upon resupply of Pi. LePT1 protein accumulates all along the roots under Pi starvation and is localized primarily in the plasma membranes. These results clearly demonstrate that plants increase their capacity for Pi uptake during Pi starvation by synthesis of additional transporter molecules. PMID:10318976

  11. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-01-01

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  12. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.

    PubMed

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-02-15

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  13. Sumoylation and transcription regulation at nuclear pores.

    PubMed

    Texari, Lorane; Stutz, Françoise

    2015-03-01

    Increasing evidence indicates that besides promoters, enhancers, and epigenetic modifications, nuclear organization is another parameter contributing to optimal control of gene expression. Although differences between species exist, the influence of gene positioning on expression seems to be a conserved feature from yeast to Drosophila and mammals. The nuclear periphery is one of the nuclear compartments implicated in gene regulation. It consists of the nuclear envelope (NE) and the nuclear pore complexes (NPC), which have distinct roles in the control of gene expression. The NPC has recently been shown to tether proteins involved in the sumoylation pathway. Here, we will focus on the importance of gene positioning and NPC-linked sumoylation/desumoylation in transcription regulation. We will mainly discuss observations made in the yeast Saccharomyces cerevisiae model system and highlight potential parallels in metazoan species.

  14. Forkhead transcription factors regulate mosquito reproduction

    PubMed Central

    Hansen, Immo A.; Sieglaff, Douglas H.; Munro, James B.; Shiao, Shin-Hong; Cruz, Josefa; Lee, Iris W.; Heraty, John M.; Raikhel, Alexander S.

    2007-01-01

    Forkhead box (Fox) genes encode a family of transcription factors defined by a ‘winged helix’ DNA-binding domain. In this study we aimed to identify Fox factors that are expressed within the fat body of the yellow fever mosquito Aedes aegypti, and determine whether any of these are involved in the regulation of mosquito yolk protein gene expression. The Ae. aegypti genome contains eighteen loci that encode putative Fox factors. Our stringent cladistic analysis has profound implications for the use of Fox genes as phylogenetic markers. Twelve Ae. aegypti Fox genes are expressed within various tissues of adult females, six of which are expressed within the fat body. All six Fox genes expressed in the fat body displayed dynamic expression profiles following a blood meal. We knocked down the ’fat body Foxes’ through RNAi to determine whether these “knockdowns” hindered amino acid-induced vitellogenin gene expression. We also determined the effect of these knockdowns on the number of eggs deposited following a blood meal. Knockdown of FoxN1, FoxN2, FoxL, and FoxO, had a negative effect on amino acid- induced vitellogenin gene expression and resulted in significantly fewer eggs laid. Our analysis stresses the importance of Fox transcription factors in regulating mosquito reproduction. PMID:17681238

  15. Transcriptional Regulation of Mononuclear Phagocyte Development

    PubMed Central

    Tussiwand, Roxane; Gautier, Emmanuel L.

    2015-01-01

    Mononuclear phagocytes (MP) are a quite unique subset of hematopoietic cells, which comprise dendritic cells (DC), monocytes as well as monocyte-derived and tissue-resident macrophages. These cells are extremely diverse with regard to their origin, their phenotype as well as their function. Developmentally, DC and monocytes are constantly replenished from a bone marrow hematopoietic progenitor. The ontogeny of macrophages is more complex and is temporally linked and specified by the organ where they reside, occurring early during embryonic or perinatal life. The functional heterogeneity of MPs is certainly a consequence of the tissue of residence and also reflects the diverse ontogeny of the subsets. In this review, we will highlight the developmental pathways of murine MP, with a particular emphasis on the transcriptional factors that regulate their development and function. Finally, we will discuss and point out open questions in the field. PMID:26539196

  16. Method to determine transcriptional regulation pathways in organisms

    DOEpatents

    Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah

    2012-11-06

    The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.

  17. WRKY Transcription Factors: Molecular Regulation and Stress Responses in Plants

    PubMed Central

    Phukan, Ujjal J.; Jeena, Gajendra S.; Shukla, Rakesh K.

    2016-01-01

    Plants in their natural habitat have to face multiple stresses simultaneously. Evolutionary adaptation of developmental, physiological, and biochemical parameters give advantage over a single window of stress but not multiple. On the other hand transcription factors like WRKY can regulate diverse responses through a complicated network of genes. So molecular orchestration of WRKYs in plant may provide the most anticipated outcome of simultaneous multiple responses. Activation or repression through W-box and W-box like sequences is regulated at transcriptional, translational, and domain level. Because of the tight regulation involved in specific recognition and binding of WRKYs to downstream promoters, they have become promising candidate for crop improvement. Epigenetic, retrograde and proteasome mediated regulation enable WRKYs to attain the dynamic cellular homeostatic reprograming. Overexpression of several WRKYs face the paradox of having several beneficial affects but with some unwanted traits. These overexpression-associated undesirable phenotypes need to be identified and removed for proper growth, development and yeild. Taken together, we have highlighted the diverse regulation and multiple stress response of WRKYs in plants along with the future prospects in this field of research. PMID:27375634

  18. Scaling factors: transcription factors regulating subcellular domains.

    PubMed

    Mills, Jason C; Taghert, Paul H

    2012-01-01

    Developing cells acquire mature fates in part by selective (i.e. qualitatively different) expression of a few cell-specific genes. However, all cells share the same basic repertoire of molecular and subcellular building blocks. Therefore, cells must also specialize according to quantitative differences in cell-specific distributions of those common molecular resources. Here we propose the novel hypothesis that evolutionarily-conserved transcription factors called scaling factors (SFs) regulate quantitative differences among mature cell types. SFs: (1) are induced during late stages of cell maturation; (2) are dedicated to specific subcellular domains; and, thus, (3) allow cells to emphasize specific subcellular features. We identify candidate SFs and discuss one in detail: MIST1 (BHLHA15, vertebrates)/DIMM (CG8667, Drosophila); professional secretory cells use this SF to scale up regulated secretion. Because cells use SFs to develop their mature properties and also to adapt them to ever-changing environmental conditions, SF aberrations likely contribute to diseases of adult onset.

  19. sRNA roles in regulating transcriptional regulators: Lrp and SoxS regulation by sRNAs

    PubMed Central

    Lee, Hyun-Jung; Gottesman, Susan

    2016-01-01

    Post-transcriptional regulation of transcription factors contributes to regulatory circuits. We created translational reporter fusions for multiple central regulators in Escherichia coli and examined the effect of Hfq-dependent non-coding RNAs on these fusions. This approach yields an ‘RNA landscape,’ identifying Hfq-dependent sRNAs that regulate a given fusion. No significant sRNA regulation of crp or fnr was detected. hns was regulated only by DsrA, as previously reported. Lrp and SoxS were both found to be regulated post-transcriptionally. Lrp, ‘leucine-responsive regulatory protein,’ regulates genes involved in amino acid biosynthesis and catabolism and other cellular functions. sRNAs DsrA, MicF and GcvB each independently downregulate the lrp translational fusion, confirming previous reports for MicF and GcvB. MicF and DsrA interact with an overlapping site early in the lrp ORF, while GcvB acts upstream at two independent sites in the long lrp leader. Surprisingly, GcvB was found to be responsible for significant downregulation of lrp after oxidative stress; MicF also contributed. SoxS, an activator of genes used to combat oxidative stress, is negatively regulated by sRNA MgrR. This study demonstrates that while not all global regulators are subject to sRNA regulation, post-transcriptional control by sRNAs allows multiple environmental signals to affect synthesis of the transcriptional regulator. PMID:27137887

  20. Studying Gene Expression: Database Searches and Promoter Fusions to Investigate Transcriptional Regulation in Bacteria†

    PubMed Central

    Martinez-Vaz, Betsy M.; Makarevitch, Irina; Stensland, Shane

    2010-01-01

    A laboratory project was designed to illustrate how to search biological databases and utilize the information provided by these resources to investigate transcriptional regulation in Escherichia coli. The students searched several databases (NCBI Genomes, RegulonDB and EcoCyc) to learn about gene function, regulation, and the organization of transcriptional units. A fluorometer and GFP promoter fusions were used to obtain fluorescence data and measure changes in transcriptional activity. The class designed and performed experiments to investigate the regulation of genes necessary for biosynthesis of amino acids and how expression is affected by environmental signals and transcriptional regulators. Assessment data showed that this activity enhanced students’ knowledge of databases, reporter genes and transcriptional regulation. PMID:23653697

  1. Statins and transcriptional regulation: The FXR connection

    SciTech Connect

    Habeos, Ioannis; Ziros, Panos G.; Psyrogiannis, Agathoklis; Vagenakis, Apostolos G.; Papavassiliou, Athanasios G. . E-mail: papavas@med.upatras.gr

    2005-08-26

    Farnesoid X receptor (FXR) is a nuclear receptor involved in lipoprotein as well as glucose metabolism. Statins are widely used hypolipidemic agents with many pleiotropic actions. It is known that statins affect other nuclear hormone receptors, but no reports are available on the effect of these drugs on FXR. Employing an animal model (Syrian hamsters), we hereby present evidence to demonstrate that Simvastatin, a broadly prescribed statin, decreases the expression of FXR at both the RNA and protein levels and down-regulates its DNA-binding activity. This novel property may have important implications on the mode statins influence on lipoprotein and carbohydrate homeostasis in the organism.

  2. Transcriptional Regulation of the Pancreatic Islet: Implications for Islet Function

    PubMed Central

    Stitzel, Michael L.; Kycia, Ina; Kursawe, Romy; Ucar, Duygu

    2015-01-01

    Islets of Langerhans contain multiple hormone-producing endocrine cells controlling glucose homeostasis. Transcription establishes and maintains islet cellular fates and identities. Genetic and environmental disruption of islet transcription triggers cellular dysfunction and disease. Early transcriptional regulation studies of specific islet genes, including insulin (INS) and the transcription factor PDX1, identified the first cis-regulatory DNA sequences and trans-acting factors governing islet function. Here, we review how human islet “omics” studies are reshaping our understanding of transcriptional regulation in islet (dys)function and diabetes. First, we highlight the expansion of islet transcript number, form, and function and of DNA transcriptional regulatory elements controlling their production. Next, we cover islet transcriptional effects of genetic and environmental perturbation. Finally, we discuss how these studies’ emerging insights should empower our diabetes research community to build mechanistic understanding of diabetes pathophysiology and to equip clinicians with tailored, precision medicine options to prevent and treat islet dysfunction and diabetes. PMID:26272056

  3. Transcriptional regulation of the uncoupling protein-1 gene.

    PubMed

    Villarroya, Francesc; Peyrou, Marion; Giralt, Marta

    2017-03-01

    Regulated transcription of the uncoupling protein-1 (UCP1) gene, and subsequent UCP1 protein synthesis, is a hallmark of the acquisition of the differentiated, thermogenically competent status of brown and beige/brite adipocytes, as well as of the responsiveness of brown and beige/brite adipocytes to adaptive regulation of thermogenic activity. The 5' non-coding region of the UCP1 gene contains regulatory elements that confer tissue specificity, differentiation dependence, and neuro-hormonal regulation to UCP1 gene transcription. Two main regions-a distal enhancer and a proximal promoter region-mediate transcriptional regulation through interactions with a plethora of transcription factors, including nuclear hormone receptors and cAMP-responsive transcription factors. Co-regulators, such as PGC-1α, play a pivotal role in the concerted regulation of UCP1 gene transcription. Multiple interactions of transcription factors and co-regulators at the promoter region of the UCP1 gene result in local chromatin remodeling, leading to activation and increased accessibility of RNA polymerase II and subsequent gene transcription. Moreover, a commonly occurring A-to-G polymorphism in close proximity to the UCP1 gene enhancer influences the extent of UCP1 gene transcription. Notably, it has been reported that specific aspects of obesity and associated metabolic diseases are associated with human population variability at this site. On another front, the unique properties of the UCP1 promoter region have been exploited to develop brown adipose tissue-specific gene delivery tools for experimental purposes.

  4. Transcriptional Regulation of Telomerase Reverse Transcriptase (TERT) by MYC

    PubMed Central

    Khattar, Ekta; Tergaonkar, Vinay

    2017-01-01

    Telomerase elongates telomeres and is crucial for maintaining genomic stability. While stem cells and cancer cells display high telomerase activity, normal somatic cells lack telomerase activity primarily due to transcriptional repression of telomerase reverse transcriptase (TERT), the catalytic component of telomerase. Transcription factor binding, chromatin status as well as epigenetic modifications at the TERT promoter regulates TERT transcription. Myc is an important transcriptional regulator of TERT that directly controls its expression by promoter binding and associating with other transcription factors. In this review, we discuss the current understanding of the molecular mechanisms behind regulation of TERT transcription by Myc. We also discuss future perspectives in investigating the regulation of Myc at TERT promoter during cancer development. PMID:28184371

  5. The Lrp family of transcription regulators in archaea.

    PubMed

    Peeters, Eveline; Charlier, Daniel

    2010-11-30

    Archaea possess a eukaryotic-type basal transcription apparatus that is regulated by bacteria-like transcription regulators. A universal and abundant family of transcription regulators are the bacterial/archaeal Lrp-like regulators. The Lrp family is one of the best studied regulator families in archaea, illustrated by investigations of proteins from the archaeal model organisms: Sulfolobus, Pyrococcus, Methanocaldococcus, and Halobacterium. These regulators are extremely versatile in their DNA-binding properties, response to effector molecules, and molecular regulatory mechanisms. Besides being involved in the regulation of the amino acid metabolism, they also regulate central metabolic processes. It appears that these regulatory proteins are also involved in large regulatory networks, because of hierarchical regulations and the possible combinatorial use of different Lrp-like proteins. Here, we discuss the recent developments in our understanding of this important class of regulators.

  6. Darkness affects differentially the expression of plastid-encoded genes and delays the senescence-induced down-regulation of chloroplast transcription in cotyledons of Cucurbita pepo L. (Zucchini).

    PubMed

    Mishev, Kiril; Dimitrova, Anna; Ananiev, Evguéni D

    2011-01-01

    In contrast to differentiated leaves, the regulatory mechanisms of chloroplast gene expression in darkened cotyledons have not been elucidated. Although some results have been reported indicating accelerated senescence in Arabidopsis upon reillumination, the capacity of cotyledons to recover after dark stress remains unclear. We analysed the effect of two-days dark stress, applied locally or at the whole-plant level, on plastid gene expression in zucchini cotyledons. Our results showed that in the dark the overall chloroplast transcription rate was much more inhibited than the nuclear run-on transcription. While the activities of the plastid-encoded RNA polymerase (PEP) and nuclear RNA polymerase II were strongly reduced, the activities of the nuclear-encoded plastid RNA polymerase (NEP) and nuclear RNA polymerase I were less affected. During recovery upon reillumination, chloroplast transcription in the cotyledons was strongly stimulated (3-fold) compared with the naturally senescing controls, suggesting delayed senescence. Northern blot and dot blot analyses of the expression of key chloroplast-encoded photosynthetic genes showed that in contrast to psbA, which remained almost unaffected, both the transcription rate and mRNA content of psaB and rbcL were substantially decreased.

  7. Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria.

    PubMed

    Troxell, Bryan; Hassan, Hosni M

    2013-01-01

    In the ancient anaerobic environment, ferrous iron (Fe(2+)) was one of the first metal cofactors. Oxygenation of the ancient world challenged bacteria to acquire the insoluble ferric iron (Fe(3+)) and later to defend against reactive oxygen species (ROS) generated by the Fenton chemistry. To acquire Fe(3+), bacteria produce low-molecular weight compounds, known as siderophores, which have extremely high affinity for Fe(3+). However, during infection the host restricts iron from pathogens by producing iron- and siderophore-chelating proteins, by exporting iron from intracellular pathogen-containing compartments, and by limiting absorption of dietary iron. Ferric Uptake Regulator (Fur) is a transcription factor which utilizes Fe(2+) as a corepressor and represses siderophore synthesis in pathogens. Fur, directly or indirectly, controls expression of enzymes that protect against ROS damage. Thus, the challenges of iron homeostasis and defense against ROS are addressed via Fur. Although the role of Fur as a repressor is well-documented, emerging evidence demonstrates that Fur can function as an activator. Fur activation can occur through three distinct mechanisms (1) indirectly via small RNAs, (2) binding at cis regulatory elements that enhance recruitment of the RNA polymerase holoenzyme (RNAP), and (3) functioning as an antirepressor by removing or blocking DNA binding of a repressor of transcription. In addition, Fur homologs control defense against peroxide stress (PerR) and control uptake of other metals such as zinc (Zur) and manganese (Mur) in pathogenic bacteria. Fur family members are important for virulence within bacterial pathogens since mutants of fur, perR, or zur exhibit reduced virulence within numerous animal and plant models of infection. This review focuses on the breadth of Fur regulation in pathogenic bacteria.

  8. Genome wide analysis of human genes transcriptionally and post-transcriptionally regulated by the HTLV-I protein p30

    PubMed Central

    Taylor, John M; Ghorbel, Sofiane; Nicot, Christophe

    2009-01-01

    Background Human T-cell leukemia virus type 1 (HTLV-I) is a human retrovirus that is etiologically linked to adult T-cell leukemia (ATL), an aggressive and fatal lymphoproliferative disease. The viral transactivator, Tax, is thought to play an important role during the initial stages of CD4+ T-cell immortalization by HTLV-1. Tax has been shown to activate transcription through CREB/ATF and NF-KB, and to alter numerous signaling pathways. These pleiotropic effects of Tax modify the expression of a wide array of cellular genes. Another viral protein encoded by HTLV-I, p30, has been shown to affect virus replication at the transcriptional and posttranscriptional levels. Little is currently known regarding the effect of p30 on the expression and nuclear export of cellular host mRNA transcripts. Identification of these RNA may reveal new targets and increase our understanding of HTLV-I pathogenesis. In this study, using primary peripheral blood mononuclear cells, we report a genome wide analysis of human genes transcriptionally and post-transcriptionally regulated by the HTLV-I protein p30. Results Using microarray analysis, we analyzed total and cytoplasmic cellular mRNA transcript levels isolated from PBMCs to assess the effect of p30 on cellular RNA transcript expression and their nuclear export. We report p30-dependent transcription resulting in the 2.5 fold up-regulation of 15 genes and the down-regulation of 65 human genes. We further tested nuclear export of cellular mRNA and found that p30 expression also resulted in a 2.5 fold post-transcriptional down-regulation of 90 genes and the up-regulation of 33 genes. Conclusion Overall, our study describes that expression of the HTLV-I protein p30 both positively and negatively alters the expression of cellular transcripts. Our study identifies for the first time the cellular genes for which nuclear export is affected by p30. These results suggest that p30 may possess a more global function with respect to m

  9. Transcriptional and epigenetic regulation of human microRNAs.

    PubMed

    Wang, Zifeng; Yao, Hong; Lin, Sheng; Zhu, Xiao; Shen, Zan; Lu, Gang; Poon, Wai Sang; Xie, Dan; Lin, Marie Chia-mi; Kung, Hsiang-fu

    2013-04-30

    MicroRNAs (miRNAs) are members of non-coding RNAs. They are involved in diverse biological functions. MiRNAs are precisely regulated in a tissue- and developmental-specific manner, but dysregulated in many human diseases, in particular cancers. Transcriptional regulation, post-transcriptional regulation, as well as genetic alterations, are the three major mechanisms controlling the spatial and temporal expression of miRNAs. Emerging evidence now indicates that transcriptional and epigenetic regulations play major roles in miRNA expression. This review summarizes the current knowledge and discusses the future challenges.

  10. Modulation of RNA polymerase assembly dynamics in transcriptional regulation

    PubMed Central

    Gorski, Stanislaw A.; Snyder, Sara K.; John, Sam; Grummt, Ingrid; Misteli, Tom

    2008-01-01

    The interaction of transcription factors with target genes is highly dynamic. Whether the dynamic nature of these interactions is merely an intrinsic property of transcriptions factors or serves a regulatory role is unknown. Here, we have used single cell fluorescence imaging combined with computational modeling and chromatin immunoprecipitation to analyze transcription complex dynamics in gene regulation during the cell cycle in living cells. We demonstrate a link between the dynamics of RNA polymerase I (RNA pol I) assembly and transcriptional output. We show that transcriptional upregulation is accompanied by prolonged retention of RNA pol I components at the promoter, resulting in longer promoter dwell time, and an increase in the steady state population of assembling polymerase. As a consequence, polymerase assembly efficiency, and ultimately, an rate of entry into processive elongation are elevated. Our results show that regulation of rDNA transcription in vivo occurs via modulation of the efficiency of transcription complex subunit capture and assembly. PMID:18498750

  11. Transcriptional Regulation of Gene Expression in C. elegans

    PubMed Central

    Reinke, Valerie; Krause, Michael; Okkema, Peter

    2013-01-01

    Protein coding gene sequences are converted to mRNA by the highly regulated process of transcription. The precise temporal and spatial control of transcription for many genes is an essential part of development in metazoans. Thus, understanding the molecular mechanisms underlying transcriptional control is essential to understanding cell fate determination during embryogenesis, post-embryonic development, many environmental interactions, and disease-related processes. Studies of transcriptional regulation in C. elegans exploit its genomic simplicity and physical characteristics to define regulatory events with single cell and minute time scale resolution. When combined with the genetics of the system, C. elegans offers a unique and powerful vantage point from which to study how chromatin-associated protein and their modifications interact with transcription factors and their binding sites to yield precise control of gene expression through transcriptional regulation. PMID:23801596

  12. Understanding regulations affecting pet foods.

    PubMed

    Dzanis, David A

    2008-08-01

    In the United States, pet foods are subject to regulation at both the federal and the state levels. The US Food and Drug Administration has jurisdiction over all animal feeds (including pet foods, treats, chews, supplements, and ingredients) in interstate commerce, which includes imported products. Many states adopt and enforce at least in part the Association of American Feed Control Officials Model Bill and Model Regulations for Pet Food and Specialty Pet Food. Thus, all pet foods in multi-state distribution are subject to a host of labeling requirements covering aspects such as product names, ingredient lists, nutrient content guarantees, and nutritional adequacy statements. Ingredients must be GRAS (generally recognized as safe) substances, approved food additives, or defined by Association of American Feed Control Officials for their intended use. Pet food labels may not bear claims that are false or misleading or that state or imply use for the treatment or prevention of disease. Pet foods that are found to be adulterated or misbranded may be subject to seizure or other enforcement actions.

  13. Methylation of an intragenic alternative promoter regulates transcription of GARP.

    PubMed

    Haupt, Sonja; Söntgerath, Viktoria Sophie Apollonia; Leipe, Jan; Schulze-Koops, Hendrik; Skapenko, Alla

    2016-02-01

    Alternative promoter usage has been proposed as a mechanism regulating transcriptional and translational diversity in highly elaborated systems like the immune system in humans. Here, we report that transcription of human glycoprotein A repetitions predominant (GARP) in regulatory CD4 T cells (Tregs) is tightly regulated by two alternative promoters. An intragenic promoter contains several CpGs and acts as a weak promoter that is demethylated and initiates transcription Treg-specifically. The strong up-stream promoter containing a CpG-island is, in contrast, fully demethylated throughout tissues. Transcriptional activity of the strong promoter was surprisingly down-regulated upon demethylation of the weak promoter. This demethylation-induced transcriptional attenuation regulated the magnitude of GARP expression and correlated with disease activity in rheumatoid arthritis. Treg-specific GARP transcription was initiated by synergistic interaction of forkhead box protein 3 (Foxp3) with nuclear factor of activated T cells (NFAT) and was underpinned by permissive chromatin remodeling caused by release of the H3K4 demethylase, PLU-1. Our findings describe a novel function of alternative promoters in regulating the extent of transcription. Moreover, since GARP functions as a transporter of transforming growth factor β (TGFβ), a cytokine with broad pleiotropic traits, GARP transcriptional attenuation by alternative promoters might provide a mechanism regulating peripheral TGFβ to avoid unwanted harmful effects.

  14. The Affective Regulation of Cognitive Priming

    PubMed Central

    Storbeck, Justin; Clore, Gerald L.

    2008-01-01

    Semantic and affective priming are classic effects observed in cognitive and social psychology, respectively. We discovered that affect regulates such priming effects. In Experiment 1, positive and negative moods were induced prior to one of three priming tasks; evaluation, categorization, or lexical decision. As predicted, positive affect led to both affective priming (evaluation task) and semantic priming (category and lexical decision tasks). However, negative affect inhibited such effects. In Experiment 2, participants in their natural affective state completed the same priming tasks as in Experiment 1. As expected, affective priming (evaluation task) and category priming (categorization and lexical decision tasks) were observed in such resting affective states. Hence, we conclude that negative affect inhibits semantic and affective priming. These results support recent theoretical models, which suggest that positive affect promotes associations among strong and weak concepts, and that negative affect impairs such associations (Kuhl, 2000; Clore & Storbeck, 2006). PMID:18410195

  15. Interaction of the RcsB Response Regulator with Auxiliary Transcription Regulators in Escherichia coli*

    PubMed Central

    Pannen, Derk; Fabisch, Maria; Gausling, Lisa; Schnetz, Karin

    2016-01-01

    The Rcs phosphorelay is a two-component signal transduction system that is induced by cell envelope stress. RcsB, the response regulator of this signaling system, is a pleiotropic transcription regulator, which is involved in the control of various stress responses, cell division, motility, and biofilm formation. RcsB regulates transcription either as a homodimer or together with auxiliary regulators, such as RcsA, BglJ, and GadE in Escherichia coli. In this study, we show that RcsB in addition forms heterodimers with MatA (also known as EcpR) and with DctR. Our data suggest that the MatA-dependent transcription regulation is mediated by the MatA-RcsB heterodimer and is independent of RcsB phosphorylation. Furthermore, we analyzed the relevance of amino acid residues of the active quintet of conserved residues, and of surface-exposed residues for activity of RcsB. The data suggest that the activity of the phosphorylation-dependent dimers, such as RcsA-RcsB and RcsB-RcsB, is affected by mutation of residues in the vicinity of the phosphorylation site, suggesting that a phosphorylation-induced structural change modulates their activity. In contrast, the phosphorylation-independent heterodimers BglJ-RcsB and MatA-RcsB are affected by only very few mutations. Heterodimerization of RcsB with various auxiliary regulators and their differential dependence on phosphorylation add an additional level of control to the Rcs system that is operating at the output level. PMID:26635367

  16. Transcriptional Regulation in Saccharomyces cerevisiae: Transcription Factor Regulation and Function, Mechanisms of Initiation, and Roles of Activators and Coactivators

    PubMed Central

    Hahn, Steven; Young, Elton T.

    2011-01-01

    Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422

  17. Using targeted chromatin regulators to engineer combinatorial and spatial transcriptional regulation.

    PubMed

    Keung, Albert J; Bashor, Caleb J; Kiriakov, Szilvia; Collins, James J; Khalil, Ahmad S

    2014-07-03

    The transcription of genomic information in eukaryotes is regulated in large part by chromatin. How a diverse array of chromatin regulator (CR) proteins with different functions and genomic localization patterns coordinates chromatin activity to control transcription remains unclear. Here, we take a synthetic biology approach to decipher the complexity of chromatin regulation by studying emergent transcriptional behaviors from engineered combinatorial, spatial, and temporal patterns of individual CRs. We fuse 223 yeast CRs to programmable zinc finger proteins. Site-specific and combinatorial recruitment of CRs to distinct intralocus locations reveals a range of transcriptional logic and behaviors, including synergistic activation, long-range and spatial regulation, and gene expression memory. Comparing these transcriptional behaviors with annotated CR complex and function terms provides design principles for the engineering of transcriptional regulation. This work presents a bottom-up approach to investigating chromatin-mediated transcriptional regulation and introduces chromatin-based components and systems for synthetic biology and cellular engineering.

  18. Effects of the lifestyle habits in breast cancer transcriptional regulation.

    PubMed

    Pérez-Solis, Marco Allán; Maya-Nuñez, Guadalupe; Casas-González, Patricia; Olivares, Aleida; Aguilar-Rojas, Arturo

    2016-01-01

    Through research carried out in the last 25 years about the breast cancer etiology, it has been possible to estimate that less than 10 % of patients who are diagnosed with the condition are carriers of some germline or somatic mutation. The clinical reports of breast cancer patients with healthy twins and the development of disease in women without high penetrance mutations detected, warn the participation more factors in the transformation process. The high incidence of mammary adenocarcinoma in the modern woman and the urgent need for new methods of prevention and early detection have demanded more information about the role that environment and lifestyle have on the transformation of mammary gland epithelial cells. Obesity, alcoholism and smoking are factors that have shown a close correlation with the risk of developing breast cancer. And although these conditions affect different cell regulation levels, the study of its effects in the mechanisms of transcriptional and epigenetic regulation is considered critical for a better understanding of the loss of identity of epithelial cells during carcinogenesis of this tissue. The main objective of this review was to establish the importance of changes occurring to transcriptional level in the mammary gland as a consequence of acute or chronic exposure to harmful products such as obesity-causing foods, ethanol and cigarette smoke components. At analyze the main studies related to topic, it has concluded that the understanding of effects caused by the lifestyle factors in performance of the transcriptional mechanisms that determine gene expression of the mammary gland epithelial cells, may help explain the development of this disease in women without genetic propensity and different phenotypic manifestations of this cancer type.

  19. The transcriptional repressor Hes1 attenuates inflammation via regulating transcriptional elongation

    PubMed Central

    Shang, Yingli; Coppo, Maddalena; He, Teng; Ning, Fei; Yu, Li; Kang, Lan; Zhang, Bin; Ju, Chanyang; Qiao, Yu; Zhao, Baohong; Gessler, Manfred; Rogatsky, Inez; Hu, Xiaoyu

    2016-01-01

    Most of the known regulatory mechanisms that curb inflammatory gene expression target pre-transcription initiation steps and evidence for regulation of inflammatory gene expression post initiation remains scarce. Here we show that transcription repressor hairy and enhancer of split 1 (Hes1) suppresses production of CXCL1, a chemokine crucial for recruiting neutrophils. Hes1 negatively regulates neutrophil recruitment in vivo in a manner that is dependent on macrophage-produced CXCL1 and attenuates severity of inflammatory arthritis. Mechanistically, inhibition of Cxcl1 expression by Hes1 does not involve modification of transcription initiation. Instead, Hes1 inhibits signal-induced recruitment of positive transcription elongation complex P-TEFb, thereby preventing phosphorylation of RNA polymerase II on serine-2 and productive elongation. Thus, our results identify Hes1 as a homeostatic suppressor of inflammatory responses which exerts its suppressive function by regulating transcription elongation. PMID:27322654

  20. Affect regulation: holding, containing and mirroring.

    PubMed

    Pedersen, Signe Holm; Poulsen, Stig; Lunn, Susanne

    2014-10-01

    Gergely and colleagues' state that their "Social Biofeedback Theory of Parental Affect Mirroring" can be seen as a kind of operationalization of the classical psychoanalytic concepts of holding, containing and mirroring. This article examines to what extent the social biofeedback theory of parental affect mirroring may be understood as a specification of these concepts. It is argued that despite similarities at a descriptive level the concepts are embedded in theories with different ideas of subjectivity. Hence an understanding of the concept of affect regulation as a concretization and specification of the classical concepts dilutes the complexity of both the concept of affect regulation and of the classical concepts.

  1. Na+-induced transcription of nhaA, which encodes an Na+/H+ antiporter in Escherichia coli, is positively regulated by nhaR and affected by hns.

    PubMed Central

    Dover, N; Higgins, C F; Carmel, O; Rimon, A; Pinner, E; Padan, E

    1996-01-01

    nhaA encodes an Na+/H+ antiporter in Escherichia coli which is essential for adaptation to high salinity and alkaline pH in the presence of Na+. We used Northern (RNA) analysis to measure directly the cellular levels of nhaA mRNA. NhaR belongs to the LysR family of regulatory proteins. Consistent with our previous data with an nhaA'-'lacZ fusion, NhaR was found to be a positive regulator and Na+ was found to be a specific inducer of nhaA transcription. In the nhaA'-'lacZ fusion, maximal induction was observed at alkaline pH. In contrast, in the nhaA+ strain both the level of nhaA expression and the induction ratio were lower at alkaline pH. This difference may be due to the activity of NhaA in the wild-type strain as NhaA efficiently excreted Na+ at alkaline pH and reduced the intracellular concentration of Na+, the signal for induction. We also showed that although the global regulator rpoS was not involved in nhaA regulation, the global regulator hns played a role. Thus, the expression of nhaA'-'lacZ was derepressed in strains bearing hns mutations and transformation with a low-copy-number plasmid carrying hns repressed expression and restored Na+ induction. The derepression in hns strains was nhaR independent. Most interestingly, multicopy nhaR, which in an hns+ background acted only as an Na+-dependent positive regulator, acted as a repressor in an hns strain in the absence of Na+ but was activated in the presence of the ion. Hence, an interplay between nhaR and hns in the regulation of nhaA was suggested. PMID:8932307

  2. Transcriptional Regulation of Tetrapyrrole Biosynthesis in Arabidopsis thaliana

    PubMed Central

    Kobayashi, Koichi; Masuda, Tatsuru

    2016-01-01

    Biosynthesis of chlorophyll (Chl) involves many enzymatic reactions that share several first steps for biosynthesis of other tetrapyrroles such as heme, siroheme, and phycobilins. Chl allows photosynthetic organisms to capture light energy for photosynthesis but with simultaneous threat of photooxidative damage to cells. To prevent photodamage by Chl and its highly photoreactive intermediates, photosynthetic organisms have developed multiple levels of regulatory mechanisms to coordinate tetrapyrrole biosynthesis (TPB) with the formation of photosynthetic and photoprotective systems and to fine-tune the metabolic flow with the varying needs of Chl and other tetrapyrroles under various developmental and environmental conditions. Among a wide range of regulatory mechanisms of TPB, this review summarizes transcriptional regulation of TPB genes during plant development, with focusing on several transcription factors characterized in Arabidopsis thaliana. Key TPB genes are tightly coexpressed with other photosynthesis-associated nuclear genes and are induced by light, oscillate in a diurnal and circadian manner, are coordinated with developmental and nutritional status, and are strongly downregulated in response to arrested chloroplast biogenesis. LONG HYPOCOTYL 5 and PHYTOCHROME-INTERACTING FACTORs, which are positive and negative transcription factors with a wide range of light signaling, respectively, target many TPB genes for light and circadian regulation. GOLDEN2-LIKE transcription factors directly regulate key TPB genes to fine-tune the formation of the photosynthetic apparatus with chloroplast functionality. Some transcription factors such as FAR-RED ELONGATED HYPOCOTYL3, REVEILLE1, and scarecrow-like transcription factors may directly regulate some specific TPB genes, whereas other factors such as GATA transcription factors are likely to regulate TPB genes in an indirect manner. Comprehensive transcriptional analyses of TPB genes and detailed characterization of

  3. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  4. Divergence of the yeast transcription factor FZF1 affects sulfite resistance.

    PubMed

    Engle, Elizabeth K; Fay, Justin C

    2012-01-01

    Changes in gene expression are commonly observed during evolution. However, the phenotypic consequences of expression divergence are frequently unknown and difficult to measure. Transcriptional regulators provide a mechanism by which phenotypic divergence can occur through multiple, coordinated changes in gene expression during development or in response to environmental changes. Yet, some changes in transcriptional regulators may be constrained by their pleiotropic effects on gene expression. Here, we use a genome-wide screen for promoters that are likely to have diverged in function and identify a yeast transcription factor, FZF1, that has evolved substantial differences in its ability to confer resistance to sulfites. Chimeric alleles from four Saccharomyces species show that divergence in FZF1 activity is due to changes in both its coding and upstream noncoding sequence. Between the two closest species, noncoding changes affect the expression of FZF1, whereas coding changes affect the expression of SSU1, a sulfite efflux pump activated by FZF1. Both coding and noncoding changes also affect the expression of many other genes. Our results show how divergence in the coding and promoter region of a transcription factor alters the response to an environmental stress.

  5. The WRKY Transcription Factor WRKY71/EXB1 Controls Shoot Branching by Transcriptionally Regulating RAX Genes in Arabidopsis

    PubMed Central

    Guo, Dongshu; Zhang, Jinzhe; Wang, Xinlei; Han, Xiang; Wei, Baoye; Yu, Hao; Huang, Qingpei

    2015-01-01

    Plant shoot branching is pivotal for developmental plasticity and crop yield. The formation of branch meristems is regulated by several key transcription factors including REGULATOR OF AXILLARY MERISTEMS1 (RAX1), RAX2, and RAX3. However, the regulatory network of shoot branching is still largely unknown. Here, we report the identification of EXCESSIVE BRANCHES1 (EXB1), which affects axillary meristem (AM) initiation and bud activity. Overexpression of EXB1 in the gain-of-function mutant exb1-D leads to severe bushy and dwarf phenotypes, which result from excessive AM initiation and elevated bud activities. EXB1 encodes the WRKY transcription factor WRKY71, which has demonstrated transactivation activities. Disruption of WRKY71/EXB1 by chimeric repressor silencing technology leads to fewer branches, indicating that EXB1 plays important roles in the control of shoot branching. We demonstrate that EXB1 controls AM initiation by positively regulating the transcription of RAX1, RAX2, and RAX3. Disruption of the RAX genes partially rescues the branching phenotype caused by EXB1 overexpression. We further show that EXB1 also regulates auxin homeostasis in control of shoot branching. Our data demonstrate that EXB1 plays pivotal roles in shoot branching by regulating both transcription of RAX genes and auxin pathways. PMID:26578700

  6. Quantitative characterization of gene regulation by Rho dependent transcription termination.

    PubMed

    Hussein, Razika; Lee, Tiffany Y; Lim, Han N

    2015-08-01

    Rho factor dependent transcription termination (RTT) is common within the coding sequences of bacterial genes and it acts to couple transcription and translation levels. Despite the importance of RTT for gene regulation, its effects on mRNA and protein concentrations have not been quantitatively characterized. Here we demonstrate that the exogenous cfp gene encoding the cyan fluorescent protein can serve as a model for gene regulation by RTT. This was confirmed by showing that Psu and bicyclomycin decrease RTT and increase full length cfp mRNAs (but remarkably they have little effect on protein production). We then use cfp to characterize the relationship between its protein and full length mRNA concentrations when the translation initiation rate is varied by sequence modifications of the translation initiation region (TIR). These experiments reveal that the fold change in protein concentration (RP) and the fold change in full length mRNA concentration (Rm) have the relationship RP≈Rm(b), where b is a constant. The average value of b was determined from three separate data sets to be ~3.6. We demonstrate that the above power law function can predict how altering the translation initiation rate of a gene in an operon will affect the mRNA concentrations of downstream genes and specify a lower bound for the associated changes in protein concentrations. In summary, this study defines a simple phenomenological model to help program expression from single genes and operons that are regulated by RTT, and to guide molecular models of RTT.

  7. Transcriptional master regulator analysis in breast cancer genetic networks.

    PubMed

    Tovar, Hugo; García-Herrera, Rodrigo; Espinal-Enríquez, Jesús; Hernández-Lemus, Enrique

    2015-12-01

    Gene regulatory networks account for the delicate mechanisms that control gene expression. Under certain circumstances, gene regulatory programs may give rise to amplification cascades. Such transcriptional cascades are events in which activation of key-responsive transcription factors called master regulators trigger a series of gene expression events. The action of transcriptional master regulators is then important for the establishment of certain programs like cell development and differentiation. However, such cascades have also been related with the onset and maintenance of cancer phenotypes. Here we present a systematic implementation of a series of algorithms aimed at the inference of a gene regulatory network and analysis of transcriptional master regulators in the context of primary breast cancer cells. Such studies were performed in a highly curated database of 880 microarray gene expression experiments on biopsy-captured tissue corresponding to primary breast cancer and healthy controls. Biological function and biochemical pathway enrichment analyses were also performed to study the role that the processes controlled - at the transcriptional level - by such master regulators may have in relation to primary breast cancer. We found that transcription factors such as AGTR2, ZNF132, TFDP3 and others are master regulators in this gene regulatory network. Sets of genes controlled by these regulators are involved in processes that are well-known hallmarks of cancer. This kind of analyses may help to understand the most upstream events in the development of phenotypes, in particular, those regarding cancer biology.

  8. Transcriptional coregulator RIP140: an essential regulator of physiology.

    PubMed

    Nautiyal, Jaya

    2017-04-01

    Transcriptional coregulators drive gene regulatory decisions in the transcriptional space. Although transcription factors including all nuclear receptors provide a docking platform for coregulators to bind, these proteins bring enzymatic capabilities to the gene regulatory sites. RIP140 is a transcriptional coregulator essential for several physiological processes, and aberrations in its function may lead to diseased states. Unlike several other coregulators that are known either for their coactivating or corepressing roles, in gene regulation, RIP140 is capable of acting both as a coactivator and a corepressor. The role of RIP140 in female reproductive axis and recent findings of its role in carcinogenesis and adipose biology have been summarised.

  9. Riboswitches in regulation of Rho-dependent transcription termination.

    PubMed

    Proshkin, Sergey; Mironov, Alexander; Nudler, Evgeny

    2014-10-01

    Riboswitches are RNA sensors of small metabolites and ions that regulate gene expression in response to environmental changes. In bacteria, the riboswitch sensor domain usually controls the formation of a strong RNA hairpin that either functions as a potent transcription terminator or sequesters a ribosome-binding site. A recent study demonstrated a novel mechanism by which a riboswitch controls Rho-dependent transcription termination. This riboswitch mechanism is likely a widespread mode of gene regulation that determines whether a protein effector is able to attenuate transcription. This article is part of a Special Issue entitled: Riboswitches.

  10. Transcription regulation mechanisms of bacteriophages: recent advances and future prospects.

    PubMed

    Yang, Haiquan; Ma, Yingfang; Wang, Yitian; Yang, Haixia; Shen, Wei; Chen, Xianzhong

    2014-01-01

    Phage diversity significantly contributes to ecology and evolution of new bacterial species through horizontal gene transfer. Therefore, it is essential to understand the mechanisms underlying phage-host interactions. After initial infection, the phage utilizes the transcriptional machinery of the host to direct the expression of its own genes. This review presents a view on the transcriptional regulation mechanisms of bacteriophages, and its contribution to phage diversity and classification. Through this review, we aim to broaden the understanding of phage-host interactions while providing a reference source for researchers studying the regulation of phage transcription.

  11. [Measurement of Affect Regulation Styles (MARS) expanded].

    PubMed

    Rovira, Darío Páez; Martínez Sánchez, Francisco; Sevillano Triguero, Verónica; Mendiburo Seguel, Andrés; Campos, Miriam

    2012-05-01

    An expanded Spanish version of the Measure of Affect Regulation Styles (MARS), was applied to episodes of anger and sadness, in a sample of 355 graduate students from Chile, Spain, and Mexico. The study examines the association between affective regulation, adaptation to episodes and dispositional coping and emotional regulation, and psychological well-being. With regard to perceived improvement of adaptive goals, the following adaptive affect regulation strategies were confirmed: Instrumental coping, seeking social support, positive reappraisal, distraction, rumination, self-comfort, self-control, and emotional expression were functional; whereas inhibition and suppression were dysfunctional. Adaptive strategies were positively associated with psychological well-being, reappraisal and humor as a coping strategy. Negative associations were found between adaptive strategies and suppression and alexithymia. Maladaptive strategies show the opposite profile. Confrontation, instrumental coping, social support as well as social isolation were more frequently found in anger, an approach emotion.

  12. Landscape of post-transcriptional gene regulation during hepatitis C virus infection

    PubMed Central

    Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram

    2015-01-01

    Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065

  13. RVX-208, an inhibitor of BET transcriptional regulators with selectivity for the second bromodomain

    PubMed Central

    Picaud, Sarah; Wells, Christopher; Felletar, Ildiko; Brotherton, Deborah; Martin, Sarah; Savitsky, Pavel; Diez-Dacal, Beatriz; Philpott, Martin; Bountra, Chas; Lingard, Hannah; Fedorov, Oleg; Müller, Susanne; Brennan, Paul E.; Knapp, Stefan; Filippakopoulos, Panagis

    2013-01-01

    Bromodomains have emerged as attractive candidates for the development of inhibitors targeting gene transcription. Inhibitors of the bromo and extraterminal (BET) family recently showed promising activity in diverse disease models. However, the pleiotropic nature of BET proteins regulating tissue-specific transcription has raised safety concerns and suggested that attempts should be made for domain-specific targeting. Here, we report that RVX-208, a compound currently in phase II clinical trials, is a BET bromodomain inhibitor specific for second bromodomains (BD2s). Cocrystal structures revealed binding modes of RVX-208 and its synthetic precursor, and fluorescent recovery after photobleaching demonstrated that RVX-208 displaces BET proteins from chromatin. However, gene-expression data showed that BD2 inhibition only modestly affects BET-dependent gene transcription. Our data demonstrate the feasibility of specific targeting within the BET family resulting in different transcriptional outcomes and highlight the importance of BD1 in transcriptional regulation. PMID:24248379

  14. RVX-208, an inhibitor of BET transcriptional regulators with selectivity for the second bromodomain.

    PubMed

    Picaud, Sarah; Wells, Christopher; Felletar, Ildiko; Brotherton, Deborah; Martin, Sarah; Savitsky, Pavel; Diez-Dacal, Beatriz; Philpott, Martin; Bountra, Chas; Lingard, Hannah; Fedorov, Oleg; Müller, Susanne; Brennan, Paul E; Knapp, Stefan; Filippakopoulos, Panagis

    2013-12-03

    Bromodomains have emerged as attractive candidates for the development of inhibitors targeting gene transcription. Inhibitors of the bromo and extraterminal (BET) family recently showed promising activity in diverse disease models. However, the pleiotropic nature of BET proteins regulating tissue-specific transcription has raised safety concerns and suggested that attempts should be made for domain-specific targeting. Here, we report that RVX-208, a compound currently in phase II clinical trials, is a BET bromodomain inhibitor specific for second bromodomains (BD2s). Cocrystal structures revealed binding modes of RVX-208 and its synthetic precursor, and fluorescent recovery after photobleaching demonstrated that RVX-208 displaces BET proteins from chromatin. However, gene-expression data showed that BD2 inhibition only modestly affects BET-dependent gene transcription. Our data demonstrate the feasibility of specific targeting within the BET family resulting in different transcriptional outcomes and highlight the importance of BD1 in transcriptional regulation.

  15. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  16. Exporting licensing regulations affecting US geothermal firms

    SciTech Connect

    Not Available

    1988-08-01

    This document presents a brief introduction and overview of the Department of Commerce's Export Administration Regulations which might affect potential US geothermal goods exporters. It is intended to make US geothermal firms officials aware of the existence of such regulations and to provide them with references, contacts and phone numbers where they can obtain specific and detailed information and assistance. It must be stressed however, that the ultimate responsibility for complying with the above mentioned regulations lies with the exporter who must consult the complete version of the regulations.

  17. Nucleosomal arrangement affects single-molecule transcription dynamics

    PubMed Central

    Fitz, Veronika; Shin, Jaeoh; Ehrlich, Christoph; Farnung, Lucas; Cramer, Patrick; Zaburdaev, Vasily; Grill, Stephan W.

    2016-01-01

    In eukaryotes, gene expression depends on chromatin organization. However, how chromatin affects the transcription dynamics of individual RNA polymerases has remained elusive. Here, we use dual trap optical tweezers to study single yeast RNA polymerase II (Pol II) molecules transcribing along a DNA template with two nucleosomes. The slowdown and the changes in pausing behavior within the nucleosomal region allow us to determine a drift coefficient, χ, which characterizes the ability of the enzyme to recover from a nucleosomal backtrack. Notably, χ can be used to predict the probability to pass the first nucleosome. Importantly, the presence of a second nucleosome changes χ in a manner that depends on the spacing between the two nucleosomes, as well as on their rotational arrangement on the helical DNA molecule. Our results indicate that the ability of Pol II to pass the first nucleosome is increased when the next nucleosome is turned away from the first one to face the opposite side of the DNA template. These findings help to rationalize how chromatin arrangement affects Pol II transcription dynamics. PMID:27791062

  18. The Affective Regulation of Social Interaction*

    PubMed Central

    Clore, Gerald L.; Pappas, Jesse

    2008-01-01

    The recent publication of David Heise’s Expressive Order (2007) provides an occasion for discussing some of the key ideas in Affect Control Theory. The theory proposes that a few dimensions of affective meaning provide a common basis for interrelating personal identities and social actions. It holds that during interpersonal interactions, social behavior is continually regulated to maintain an affective tone compatible with whatever social roles or identities define the situation. We outline the intellectual history of the proposed dimensions and of the idea that each social action invites an action from the other that has a particular location along these dimensions. We also relate these ideas to the Affect-as-Information hypothesis, an approach that often guides research in psychology on the role of affect in regulating judgment and thought. PMID:18461152

  19. Transcriptional Regulation by Trithorax-Group Proteins

    PubMed Central

    Kingston, Robert E.; Tamkun, John W.

    2014-01-01

    The trithorax group of genes (trxG) was identified in mutational screens that examined developmental phenotypes and suppression of Polycomb mutant phenotypes. The protein products of these genes are primarily involved in gene activation, although some can also have repressive effects. There is no central function for these proteins. Some move nucleosomes about on the genome in an ATP-dependent manner, some covalently modify histones such as methylating lysine 4 of histone H3, and some directly interact with the transcription machinery or are a part of that machinery. It is interesting to consider why these specific members of large families of functionally related proteins have strong developmental phenotypes. PMID:25274705

  20. Translin and Trax differentially regulate telomere-associated transcript homeostasis

    PubMed Central

    Alshehri, Zafer; Thallinger, Gerhard G.; Wakeman, Jane A.; McFarlane, Ramsay J.

    2016-01-01

    Translin and Trax proteins are highly conserved nucleic acid binding proteins that have been implicated in RNA regulation in a range of biological processes including tRNA processing, RNA interference, microRNA degradation during oncogenesis, spermatogenesis and neuronal regulation. Here, we explore the function of this paralogue pair of proteins in the fission yeast. Using transcript analysis we demonstrate a reciprocal mechanism for control of telomere-associated transcripts. Mutation of tfx1+ (Trax) elevates transcript levels from silenced sub-telomeric regions of the genome, but not other silenced regions, such as the peri-centromeric heterochromatin. In the case of some sub-telomeric transcripts, but not all, this elevation is dependent on the Trax paralogue, Tsn1 (Translin). In a reciprocal fashion, Tsn1 (Translin) serves to repress levels of transcripts (TERRAs) from the telomeric repeats, whereas Tfx1 serves to maintain these elevated levels. This reveals a novel mechanism for the regulation of telomeric transcripts. We extend this to demonstrate that human Translin and Trax also control telomere-associated transcript levels in human cells in a telomere-specific fashion. PMID:27183912

  1. Genetic Regulation of Transcriptional Variation in Natural Arabidopsis thaliana Accessions

    PubMed Central

    Zan, Yanjun; Shen, Xia; Forsberg, Simon K. G.; Carlborg, Örjan

    2016-01-01

    An increased knowledge of the genetic regulation of expression in Arabidopsis thaliana is likely to provide important insights about the basis of the plant’s extensive phenotypic variation. Here, we reanalyzed two publicly available datasets with genome-wide data on genetic and transcript variation in large collections of natural A. thaliana accessions. Transcripts from more than half of all genes were detected in the leaves of all accessions, and from nearly all annotated genes in at least one accession. Thousands of genes had high transcript levels in some accessions, but no transcripts at all in others, and this pattern was correlated with the genome-wide genotype. In total, 2669 eQTL were mapped in the largest population, and 717 of them were replicated in the other population. A total of 646 cis-eQTL-regulated genes that lacked detectable transcripts in some accessions was found, and for 159 of these we identified one, or several, common structural variants in the populations that were shown to be likely contributors to the lack of detectable RNA transcripts for these genes. This study thus provides new insights into the overall genetic regulation of global gene expression diversity in the leaf of natural A. thaliana accessions. Further, it also shows that strong cis-acting polymorphisms, many of which are likely to be structural variations, make important contributions to the transcriptional variation in the worldwide A. thaliana population. PMID:27226169

  2. Regulation of maternal transcript destabilization during egg activation in Drosophila.

    PubMed Central

    Tadros, Wael; Houston, Simon A; Bashirullah, Arash; Cooperstock, Ramona L; Semotok, Jennifer L; Reed, Bruce H; Lipshitz, Howard D

    2003-01-01

    In animals, the transfer of developmental control from maternal RNAs and proteins to zygotically derived products occurs at the midblastula transition. This is accompanied by the destabilization of a subset of maternal transcripts. In Drosophila, maternal transcript destabilization occurs in the absence of fertilization and requires specific cis-acting instability elements. We show here that egg activation is necessary and sufficient to trigger transcript destabilization. We have identified 13 maternal-effect lethal loci that, when mutated, result in failure of maternal transcript degradation. All mutants identified are defective in one or more additional processes associated with egg activation. These include vitelline membrane reorganization, cortical microtubule depolymerization, translation of maternal mRNA, completion of meiosis, and chromosome condensation (the S-to-M transition) after meiosis. The least pleiotropic class of transcript destabilization mutants consists of three genes: pan gu, plutonium, and giant nuclei. These three genes regulate the S-to-M transition at the end of meiosis and are thought to be required for the maintenance of cyclin-dependent kinase (CDK) activity during this cell cycle transition. Consistent with a possible functional connection between this S-to-M transition and transcript destabilization, we show that in vitro-activated eggs, which exhibit aberrant postmeiotic chromosome condensation, fail to initiate transcript degradation. Several genetic tests exclude the possibility that reduction of CDK/cyclin complex activity per se is responsible for the failure to trigger transcript destabilization in these mutants. We propose that the trigger for transcript destabilization occurs coincidently with the S-to-M transition at the end of meiosis and that pan gu, plutonium, and giant nuclei regulate maternal transcript destabilization independent of their role in cell cycle regulation. PMID:12871909

  3. Transcriptional and epigenetic regulation of PPARγ expression during adipogenesis

    PubMed Central

    2014-01-01

    The nuclear receptor PPARγ is a master regulator of adipogenesis. PPARγ is highly expressed in adipose tissues and its expression is markedly induced during adipogenesis. In this review, we describe the current knowledge, as well as future directions, on transcriptional and epigenetic regulation of PPARγ expression during adipogenesis. Investigating the molecular mechanisms that control PPARγ expression during adipogenesis is critical for understanding the development of white and brown adipose tissues, as well as pathological conditions such as obesity and diabetes. The robust induction of PPARγ expression during adipogenesis also serves as an excellent model system for studying transcriptional and epigenetic regulation of cell-type-specific gene expression. PMID:24904744

  4. A Chromatin-Focused siRNA Screen for Regulators of p53-Dependent Transcription

    PubMed Central

    Sammons, Morgan A.; Zhu, Jiajun; Berger, Shelley L.

    2016-01-01

    The protein product of the Homo sapiens TP53 gene is a transcription factor (p53) that regulates the expression of genes critical for the response to DNA damage and tumor suppression, including genes involved in cell cycle arrest, apoptosis, DNA repair, metabolism, and a number of other tumorigenesis-related pathways. Differential transcriptional regulation of these genes is believed to alter the balance between two p53-dependent cell fates: cell cycle arrest or apoptosis. A number of previously identified p53 cofactors covalently modify and alter the function of both the p53 protein and histone proteins. Both gain- and loss-of-function mutations in chromatin modifiers have been strongly implicated in cancer development; thus, we sought to identify novel chromatin regulatory proteins that affect p53-dependent transcription and the balance between the expression of pro-cell cycle arrest and proapoptotic genes. We utilized an siRNA library designed against predicted chromatin regulatory proteins, and identified known and novel chromatin-related factors that affect both global p53-dependent transcription and gene-specific regulators of p53 transcriptional activation. The results from this screen will serve as a comprehensive resource for those interested in further characterizing chromatin and epigenetic factors that regulate p53 transcription. PMID:27334938

  5. The bile acid sensor FXR regulates insulin transcription and secretion.

    PubMed

    Renga, Barbara; Mencarelli, Andrea; Vavassori, Piero; Brancaleone, Vincenzo; Fiorucci, Stefano

    2010-03-01

    Farnesoid X Receptor plays an important role in maintaining bile acid, cholesterol homeostasis and glucose metabolism. Here we investigated whether FXR is expressed by pancreatic beta-cells and regulates insulin signaling in pancreatic beta-cell line and human islets. We found that FXR activation induces positive regulatory effects on glucose-induced insulin transcription and secretion by genomic and non-genomic activities. Genomic effects of FXR activation relay on the induction of the glucose regulated transcription factor KLF11. Indeed, results from silencing experiments of KLF11 demonstrate that this transcription factor is essential for FXR activity on glucose-induced insulin gene transcription. In addition FXR regulates insulin secretion by non-genomic effects. Thus, activation of FXR in betaTC6 cells increases Akt phosphorylation and translocation of the glucose transporter GLUT2 at plasma membrane, increasing the glucose uptake by these cells. In vivo experiments on Non Obese Diabetic (NOD) mice demonstrated that FXR activation delays development of signs of diabetes, hyperglycemia and glycosuria, by enhancing insulin secretion and by stimulating glucose uptake by the liver. These data established that an FXR-KLF11 regulated pathway has an essential role in the regulation of insulin transcription and secretion induced by glucose.

  6. INITIATION AND REGULATION OF PARAMYXOVIRUS TRANSCRIPTION AND REPLICATION

    PubMed Central

    Noton, Sarah L.; Fearns, Rachel

    2015-01-01

    The paramyxovirus family has a genome consisting of a single strand of negative sense RNA. This genome acts as a template for two distinct processes: transcription to generate subgenomic, capped and polyadenylated mRNAs, and genome replication. These viruses only encode one polymerase. Thus, an intriguing question is, how does the viral polymerase initiate and become committed to either transcription or replication? By answering this we can begin to understand how these two processes are regulated. In this review article, we present recent findings from studies on the paramyxovirus, respiratory syncytial virus, which show how its polymerase is able to initiate transcription and replication from a single promoter. We discuss how these findings apply to other paramyxoviruses. Then, we examine how trans-acting proteins and promoter secondary structure might serve to regulate transcription and replication during different phases of the paramyxovirus replication cycle. PMID:25683441

  7. Transcriptional and post-transcriptional regulation of Drosophila germline stem cells and their differentiating progeny.

    PubMed

    White-Cooper, Helen; Caporilli, Simona

    2013-01-01

    In this chapter we will concentrate on the transcriptional and translational regulations that govern the development and differentiation of male germline cells. Our focus will be on the processes that occur during differentiation, that distinguish the differentiating population of cells from their stem cell parents. We discuss how these defining features are established as cells transit from a stem cell character to that of a fully committed differentiating cell. The focus will be on how GSCs differentiate, via spermatogonia, to spermatocytes. We will achieve this by first describing the transcriptional activity in the differentiating spermatocytes, cataloguing the known transcriptional regulators in these cells and then investigating how the transcription programme is set up by processes in the progentior cells. This process is particularly interesting to study from a stem cell perspective as the male GSCs are unipotent, so lineage decisions in differentiating progeny of stem cells, which occurs in many other stem cell systems, do not impinge on the behaviour of these cells.

  8. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway.

  9. Homeodomain transcription factors regulate BMP-2-induced osteoactivin transcription in osteoblasts.

    PubMed

    Singh, Maneet; Del Carpio-Cano, Fabiola E; Monroy, M Alexandra; Popoff, Steven N; Safadi, Fayez F

    2012-01-01

    Osteoactivin (OA) is required for the differentiation of osteoblast cells. OA expression is stimulated by bone morphogenetic protein-2 (BMP-2). BMP-2 recruits homeodomain transcription factors Dlx3, Dlx5, and Msx2 to selectively activate or repress transcription of osteogenic genes and hence tightly regulate their transcription during osteoblast differentiation. Considering the key roles of Dlx3, Dlx5, and Msx2 in osteoblast differentiation, here we hypothesize that homeodomain proteins regulate BMP-2-induced OA transcription during osteoblast differentiation. Four classical homeodomain binding sites were identified in the proximal 0.96 kb region of rat OA promoter. Deletions and mutagenesis studies of the OA promoter region indicated that all four homeodomain binding sites are crucial for BMP-2-induced OA promoter activity. Simultaneous disruption of homeodomain binding sites at -852 and -843 of the transcription start site of OA gene significantly decreased the BMP-2-induced OA transcription and inhibited binding of Dlx3, Dlx5, and Msx2 proteins to the OA promoter. Dlx3 and Dlx5 proteins were found to activate the OA transcription, whereas, Msx2 suppressed BMP-2-induced OA transcription. Using chromatin immunoprecipitation assays, we demonstrated that the OA promoter is predominantly occupied by Dlx3 and Dlx5 during the proliferation and matrix maturation stages of osteoblast differentiation, respectively. During the matrix mineralization stage, BMP-2 robustly enhanced the recruitment of Dlx5 and to a lesser extent of Dlx3 and Msx2 to the OA promoter region. Collectively, our results show that the BMP-2-induced OA transcription is differentially regulated by Dlx3, Dlx5, and Msx2 during osteoblast differentiation.

  10. Toxaphene affects the levels of mRNA transcripts that encode antioxidant enzymes in Hydra.

    PubMed

    Woo, Seonock; Lee, Aekyung; Won, Hyokyoung; Ryu, Jae-Chun; Yum, Seungshic

    2012-06-01

    We evaluated toxaphene-induced acute toxicity in Hydra magnipapillata. The median lethal concentrations of the animals (LC(50)) were determined to be 34.5 mg/L, 25.0 mg/L and 12.0 mg/L after exposure to toxaphene for 24 h, 48 h and 72 h, respectively. Morphological responses of hydra polyps to a range of toxaphene concentrations suggested that toxaphene negatively affects the nervous system of H. magnipapillata. We used real-time quantitative PCR of RNA extracted from polyps exposed to two concentrations of toxaphene (0.3 mg/L and 3 mg/L) for 24 h to evaluate the differential regulation of levels of transcripts that encode six antioxidant enzymes (CAT, G6PD, GPx, GR, GST and SOD), two proteins involved in detoxification and molecular stress responses (CYP1A and UB), and two proteins involved in neurotransmission and nerve cell differentiation (AChE and Hym-355). Of the genes involved in antioxidant responses, the most striking changes were observed for transcripts that encode GPx, G6PD, SOD, CAT and GST, with no evident change in levels of transcripts encoding GR. Levels of UB and CYP1A transcripts increased in a dose-dependent manner following exposure to toxaphene. Given that toxaphene-induced neurotoxicity was not reflected in the level of AChE transcripts and only slight accumulation of Hym-355 transcript was observed only at the higher of the two doses of toxaphene tested, there remains a need to identify transcriptional biomarkers for toxaphene-mediated neurotoxicity in H. magnipapillata. Transcripts that respond to toxaphene exposure could be valuable biomarkers for stress levels in H. magnipapillata and may be useful for monitoring the pollution of aquatic environments.

  11. Quantitative regulation of FLC via coordinated transcriptional initiation and elongation

    PubMed Central

    Wu, Zhe; Ietswaart, Robert; Liu, Fuquan; Yang, Hongchun; Howard, Martin; Dean, Caroline

    2016-01-01

    The basis of quantitative regulation of gene expression is still poorly understood. In Arabidopsis thaliana, quantitative variation in expression of FLOWERING LOCUS C (FLC) influences the timing of flowering. In ambient temperatures, FLC expression is quantitatively modulated by a chromatin silencing mechanism involving alternative polyadenylation of antisense transcripts. Investigation of this mechanism unexpectedly showed that RNA polymerase II (Pol II) occupancy changes at FLC did not reflect RNA fold changes. Mathematical modeling of these transcriptional dynamics predicted a tight coordination of transcriptional initiation and elongation. This prediction was validated by detailed measurements of total and chromatin-bound FLC intronic RNA, a methodology appropriate for analyzing elongation rate changes in a range of organisms. Transcription initiation was found to vary ∼25-fold with elongation rate varying ∼8- to 12-fold. Premature sense transcript termination contributed very little to expression differences. This quantitative variation in transcription was coincident with variation in H3K36me3 and H3K4me2 over the FLC gene body. We propose different chromatin states coordinately influence transcriptional initiation and elongation rates and that this coordination is likely to be a general feature of quantitative gene regulation in a chromatin context. PMID:26699513

  12. CRTR-1, a developmentally regulated transcriptional repressor related to the CP2 family of transcription factors.

    PubMed

    Rodda, S; Sharma, S; Scherer, M; Chapman, G; Rathjen, P

    2001-02-02

    CP2-related proteins comprise a family of DNA-binding transcription factors that are generally activators of transcription and expressed ubiquitously. We reported a differential display polymerase chain reaction fragment, Psc2, which was expressed in a regulated fashion in mouse pluripotent cells in vitro and in vivo. Here, we report further characterization of the Psc2 cDNA and function. The Psc2 cDNA contained an open reading frame homologous to CP2 family proteins. Regions implicated in DNA binding and oligomeric complex formation, but not transcription activation, were conserved. Psc2 expression in vivo during embryogenesis and in the adult mouse demonstrated tight spatial and temporal regulation, with the highest levels of expression in the epithelial lining of distal convoluted tubules in embryonic and adult kidneys. Functional analysis demonstrated that PSC2 repressed transcription 2.5-15-fold when bound to a heterologous promoter in ES, 293T, and COS-1 cells. The N-terminal 52 amino acids of PSC2 were shown to be necessary and sufficient for this activity and did not share obvious homology with reported repressor motifs. These results represent the first report of a CP2 family member that is expressed in a developmentally regulated fashion in vivo and that acts as a direct repressor of transcription. Accordingly, the protein has been named CP2-Related Transcriptional Repressor-1 (CRTR-1).

  13. Navigating the transcriptional roadmap regulating plant secondary cell wall deposition

    PubMed Central

    Hussey, Steven G.; Mizrachi, Eshchar; Creux, Nicky M.; Myburg, Alexander A.

    2013-01-01

    The current status of lignocellulosic biomass as an invaluable resource in industry, agriculture, and health has spurred increased interest in understanding the transcriptional regulation of secondary cell wall (SCW) biosynthesis. The last decade of research has revealed an extensive network of NAC, MYB and other families of transcription factors regulating Arabidopsis SCW biosynthesis, and numerous studies have explored SCW-related transcription factors in other dicots and monocots. Whilst the general structure of the Arabidopsis network has been a topic of several reviews, they have not comprehensively represented the detailed protein–DNA and protein–protein interactions described in the literature, and an understanding of network dynamics and functionality has not yet been achieved for SCW formation. Furthermore the methodologies employed in studies of SCW transcriptional regulation have not received much attention, especially in the case of non-model organisms. In this review, we have reconstructed the most exhaustive literature-based network representations to date of SCW transcriptional regulation in Arabidopsis. We include a manipulable Cytoscape representation of the Arabidopsis SCW transcriptional network to aid in future studies, along with a list of supporting literature for each documented interaction. Amongst other topics, we discuss the various components of the network, its evolutionary conservation in plants, putative modules and dynamic mechanisms that may influence network function, and the approaches that have been employed in network inference. Future research should aim to better understand network function and its response to dynamic perturbations, whilst the development and application of genome-wide approaches such as ChIP-seq and systems genetics are in progress for the study of SCW transcriptional regulation in non-model organisms. PMID:24009617

  14. New Regulations Affect School Debt Financing.

    ERIC Educational Resources Information Center

    Olson, Carol Duane

    1993-01-01

    Provides an overview of changes in Treasury Regulations as they affect school debt financing, including bond and note construction and acquisition issues, other types of equipment and property financing, as well as tax and revenue anticipation notes for working capital needs. (MLF)

  15. Transcriptional and Chromatin Regulation during Fasting - The Genomic Era.

    PubMed

    Goldstein, Ido; Hager, Gordon L

    2015-12-01

    An elaborate metabolic response to fasting is orchestrated by the liver and is heavily reliant on transcriptional regulation. In response to hormones (glucagon, glucocorticoids) many transcription factors (TFs) are activated and regulate various genes involved in metabolic pathways aimed at restoring homeostasis: gluconeogenesis, fatty acid oxidation, ketogenesis, and amino acid shuttling. We summarize recent discoveries regarding fasting-related TFs with an emphasis on genome-wide binding patterns. Collectively, the findings we discuss reveal a large degree of cooperation between TFs during fasting that occurs at motif-rich DNA sites bound by a combination of TFs. These new findings implicate transcriptional and chromatin regulation as major determinants of the response to fasting and unravels the complex, multi-TF nature of this response.

  16. How the ubiquitin proteasome system regulates the regulators of transcription.

    PubMed

    Ee, Gary; Lehming, Norbert

    2012-01-01

    The ubiquitin proteasome system plays an important role in transcription. Monoubiquitination of activators is believed to aid their function, while the 26S proteasomal degradation of repressors is believed to restrict their function. What remains controversial is the question of whether the degradation of activators aids or restricts their function.

  17. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-06-16

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  18. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  19. Identification of transcriptional regulators in the mouse immune system.

    PubMed

    Jojic, Vladimir; Shay, Tal; Sylvia, Katelyn; Zuk, Or; Sun, Xin; Kang, Joonsoo; Regev, Aviv; Koller, Daphne; Best, Adam J; Knell, Jamie; Goldrath, Ananda; Joic, Vladimir; Koller, Daphne; Shay, Tal; Regev, Aviv; Cohen, Nadia; Brennan, Patrick; Brenner, Michael; Kim, Francis; Rao, Tata Nageswara; Wagers, Amy; Heng, Tracy; Ericson, Jeffrey; Rothamel, Katherine; Ortiz-Lopez, Adriana; Mathis, Diane; Benoist, Christophe; Bezman, Natalie A; Sun, Joseph C; Min-Oo, Gundula; Kim, Charlie C; Lanier, Lewis L; Miller, Jennifer; Brown, Brian; Merad, Miriam; Gautier, Emmanuel L; Jakubzick, Claudia; Randolph, Gwendalyn J; Monach, Paul; Blair, David A; Dustin, Michael L; Shinton, Susan A; Hardy, Richard R; Laidlaw, David; Collins, Jim; Gazit, Roi; Rossi, Derrick J; Malhotra, Nidhi; Sylvia, Katelyn; Kang, Joonsoo; Kreslavsky, Taras; Fletcher, Anne; Elpek, Kutlu; Bellemarte-Pelletier, Angelique; Malhotra, Deepali; Turley, Shannon

    2013-06-01

    The differentiation of hematopoietic stem cells into cells of the immune system has been studied extensively in mammals, but the transcriptional circuitry that controls it is still only partially understood. Here, the Immunological Genome Project gene-expression profiles across mouse immune lineages allowed us to systematically analyze these circuits. To analyze this data set we developed Ontogenet, an algorithm for reconstructing lineage-specific regulation from gene-expression profiles across lineages. Using Ontogenet, we found differentiation stage-specific regulators of mouse hematopoiesis and identified many known hematopoietic regulators and 175 previously unknown candidate regulators, as well as their target genes and the cell types in which they act. Among the previously unknown regulators, we emphasize the role of ETV5 in the differentiation of γδ T cells. As the transcriptional programs of human and mouse cells are highly conserved, it is likely that many lessons learned from the mouse model apply to humans.

  20. Acetylation of RNA polymerase II regulates growth-factor-induced gene transcription in mammalian cells.

    PubMed

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S; Capra, John A; Schnölzer, Martina; Cole, Philip A; Geyer, Matthias; Bruneau, Benoit G; Adelman, Karen; Ott, Melanie

    2013-11-07

    Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes.

  1. Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver

    PubMed Central

    Atger, Florian; Gobet, Cédric; Marquis, Julien; Martin, Eva; Wang, Jingkui; Weger, Benjamin; Lefebvre, Grégory; Descombes, Patrick; Naef, Felix; Gachon, Frédéric

    2015-01-01

    Diurnal oscillations of gene expression are a hallmark of rhythmic physiology across most living organisms. Such oscillations are controlled by the interplay between the circadian clock and feeding rhythms. Although rhythmic mRNA accumulation has been extensively studied, comparatively less is known about their transcription and translation. Here, we quantified simultaneously temporal transcription, accumulation, and translation of mouse liver mRNAs under physiological light–dark conditions and ad libitum or night-restricted feeding in WT and brain and muscle Arnt-like 1 (Bmal1)-deficient animals. We found that rhythmic transcription predominantly drives rhythmic mRNA accumulation and translation for a majority of genes. Comparison of wild-type and Bmal1 KO mice shows that circadian clock and feeding rhythms have broad impact on rhythmic gene expression, Bmal1 deletion affecting surprisingly both transcriptional and posttranscriptional levels. Translation efficiency is differentially regulated during the diurnal cycle for genes with 5′-Terminal Oligo Pyrimidine tract (5′-TOP) sequences and for genes involved in mitochondrial activity, many harboring a Translation Initiator of Short 5′-UTR (TISU) motif. The increased translation efficiency of 5′-TOP and TISU genes is mainly driven by feeding rhythms but Bmal1 deletion also affects amplitude and phase of translation, including TISU genes. Together this study emphasizes the complex interconnections between circadian and feeding rhythms at several steps ultimately determining rhythmic gene expression and translation. PMID:26554015

  2. Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver.

    PubMed

    Atger, Florian; Gobet, Cédric; Marquis, Julien; Martin, Eva; Wang, Jingkui; Weger, Benjamin; Lefebvre, Grégory; Descombes, Patrick; Naef, Felix; Gachon, Frédéric

    2015-11-24

    Diurnal oscillations of gene expression are a hallmark of rhythmic physiology across most living organisms. Such oscillations are controlled by the interplay between the circadian clock and feeding rhythms. Although rhythmic mRNA accumulation has been extensively studied, comparatively less is known about their transcription and translation. Here, we quantified simultaneously temporal transcription, accumulation, and translation of mouse liver mRNAs under physiological light-dark conditions and ad libitum or night-restricted feeding in WT and brain and muscle Arnt-like 1 (Bmal1)-deficient animals. We found that rhythmic transcription predominantly drives rhythmic mRNA accumulation and translation for a majority of genes. Comparison of wild-type and Bmal1 KO mice shows that circadian clock and feeding rhythms have broad impact on rhythmic gene expression, Bmal1 deletion affecting surprisingly both transcriptional and posttranscriptional levels. Translation efficiency is differentially regulated during the diurnal cycle for genes with 5'-Terminal Oligo Pyrimidine tract (5'-TOP) sequences and for genes involved in mitochondrial activity, many harboring a Translation Initiator of Short 5'-UTR (TISU) motif. The increased translation efficiency of 5'-TOP and TISU genes is mainly driven by feeding rhythms but Bmal1 deletion also affects amplitude and phase of translation, including TISU genes. Together this study emphasizes the complex interconnections between circadian and feeding rhythms at several steps ultimately determining rhythmic gene expression and translation.

  3. Transcriptional and post-transcriptional regulation of the ionizing radiation response by ATM and p53

    PubMed Central

    Venkata Narayanan, Ishwarya; Paulsen, Michelle T.; Bedi, Karan; Berg, Nathan; Ljungman, Emily A.; Francia, Sofia; Veloso, Artur; Magnuson, Brian; di Fagagna, Fabrizio d’Adda; Wilson, Thomas E.; Ljungman, Mats

    2017-01-01

    In response to ionizing radiation (IR), cells activate a DNA damage response (DDR) pathway to re-program gene expression. Previous studies using total cellular RNA analyses have shown that the stress kinase ATM and the transcription factor p53 are integral components required for induction of IR-induced gene expression. These studies did not distinguish between changes in RNA synthesis and RNA turnover and did not address the role of enhancer elements in DDR-mediated transcriptional regulation. To determine the contribution of synthesis and degradation of RNA and monitor the activity of enhancer elements following exposure to IR, we used the recently developed Bru-seq, BruChase-seq and BruUV-seq techniques. Our results show that ATM and p53 regulate both RNA synthesis and stability as well as enhancer element activity following exposure to IR. Importantly, many genes in the p53-signaling pathway were coordinately up-regulated by both increased synthesis and RNA stability while down-regulated genes were suppressed either by reduced synthesis or stability. Our study is the first of its kind that independently assessed the effects of ionizing radiation on transcription and post-transcriptional regulation in normal human cells. PMID:28256581

  4. Concentration- and chromosome-organization-dependent regulator unbinding from DNA for transcription regulation in living cells

    PubMed Central

    Chen, Tai-Yen; Santiago, Ace George; Jung, Won; Krzemiński, Łukasz; Yang, Feng; Martell, Danya J.; Helmann, John D.; Chen, Peng

    2015-01-01

    Binding and unbinding of transcription regulators at operator sites constitute a primary mechanism for gene regulation. While many cellular factors are known to regulate their binding, little is known on how cells can modulate their unbinding for regulation. Using nanometer-precision single-molecule tracking, we study the unbinding kinetics from DNA of two metal-sensing transcription regulators in living Escherichia coli cells. We find that they show unusual concentration-dependent unbinding kinetics from chromosomal recognition sites in both their apo and holo forms. Unexpectedly, their unbinding kinetics further varies with the extent of chromosome condensation, and more surprisingly, varies in opposite ways for their apo-repressor versus holo-activator forms. These findings suggest likely broadly relevant mechanisms for facile switching between transcription activation and deactivation in vivo and in coordinating transcription regulation of resistance genes with the cell cycle. PMID:26145755

  5. Transcriptional Regulation of the p16 Tumor Suppressor Gene.

    PubMed

    Kotake, Yojiro; Naemura, Madoka; Murasaki, Chihiro; Inoue, Yasutoshi; Okamoto, Haruna

    2015-08-01

    The p16 tumor suppressor gene encodes a specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 and is found altered in a wide range of human cancers. p16 plays a pivotal role in tumor suppressor networks through inducing cellular senescence that acts as a barrier to cellular transformation by oncogenic signals. p16 protein is relatively stable and its expression is primary regulated by transcriptional control. Polycomb group (PcG) proteins associate with the p16 locus in a long non-coding RNA, ANRIL-dependent manner, leading to repression of p16 transcription. YB1, a transcription factor, also represses the p16 transcription through direct association with its promoter region. Conversely, the transcription factors Ets1/2 and histone H3K4 methyltransferase MLL1 directly bind to the p16 locus and mediate p16 induction during replicative and premature senescence. In the present review, we discuss the molecular mechanisms by which these factors regulate p16 transcription.

  6. Involvement of the SIN4 global transcriptional regulator in the chromatin structure of Saccharomyces cerevisiae.

    PubMed Central

    Jiang, Y W; Stillman, D J

    1992-01-01

    We have cloned and sequenced the SIN4 gene and determined that SIN4 is identical to TSF3, identified as a negative regulator of GAL1 gene transcription (S. Chen, R.W. West, Jr., S.L. Johnson, H. Gans, and J. Ma, submitted for publication). Yeast strains bearing a sin4 delta null mutation have been constructed and are temperature sensitive for growth and display defects in both negative and positive regulation of transcription. Transcription of the CTS1 gene is reduced in sin4 delta mutants, suggesting that Sin4 functions as a positive transcriptional regulator. Additionally, a Sin4-LexA fusion protein activates transcription from test promoters containing LexA binding sites. The sin4 delta mutant also shows phenotypes common to histone and spt mutants, including suppression of delta insertion mutations in the HIS4 and LYS2 promoters, expression of promoters lacking upstream activation sequence elements, and decreased superhelical density of circular DNA molecules. These results suggest that the sin4 delta mutation may alter the structure of chromatin, and these changes in chromatin structure may affect transcriptional regulation. Images PMID:1406639

  7. TGF-β signaling to chromatin: how Smads regulate transcription during self-renewal and differentiation.

    PubMed

    Gaarenstroom, Tessa; Hill, Caroline S

    2014-08-01

    Ligands of the TGF-β superfamily (including the TGF-βs, Nodal and BMPs) play instructive roles during embryonic development. This is achieved by regulation of genes important for both maintaining pluripotency and germ layer specification and differentiation. Here we review how the TGF-β superfamily ligands signal to the chromatin to regulate transcription during development. The effectors of the pathway, the Smad transcription factors, are regulated in a combinatorial and spatiotemporal manner. This occurs via post-translational modifications affecting stability, localization and activity, as well as through interactions with other transcription factors and chromatin modifying enzymes, which occur on DNA. Expression profiling and Chromatin Immunoprecipitation have defined Smad target genes and binding sites on a genome-wide scale, which vary between cell types and differentiation stages. This has led to the insight that Smad-mediated transcriptional responses are influenced by the presence of master transcription factors, such as OCT4, SOX2 and NANOG in embryonic stem cells, interaction with other signal-induced factors, as well as by the general chromatin remodeling machinery. Interplay with transcriptional repressors and the polycomb group proteins also regulates the balance between expression of self-renewal and mesendoderm-specific genes in embryonic stem cells and during early development.

  8. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  9. Transcriptional regulators of Na,K-ATPase subunits

    PubMed Central

    Li, Zhiqin; Langhans, Sigrid A.

    2015-01-01

    The Na,K-ATPase classically serves as an ion pump creating an electrochemical gradient across the plasma membrane that is essential for transepithelial transport, nutrient uptake and membrane potential. In addition, Na,K-ATPase also functions as a receptor, a signal transducer and a cell adhesion molecule. With such diverse roles, it is understandable that the Na,K-ATPase subunits, the catalytic α-subunit, the β-subunit and the FXYD proteins, are controlled extensively during development and to accommodate physiological needs. The spatial and temporal expression of Na,K-ATPase is partially regulated at the transcriptional level. Numerous transcription factors, hormones, growth factors, lipids, and extracellular stimuli modulate the transcription of the Na,K-ATPase subunits. Moreover, epigenetic mechanisms also contribute to the regulation of Na,K-ATPase expression. With the ever growing knowledge about diseases associated with the malfunction of Na,K-ATPase, this review aims at summarizing the best-characterized transcription regulators that modulate Na,K-ATPase subunit levels. As abnormal expression of Na,K-ATPase subunits has been observed in many carcinoma, we will also discuss transcription factors that are associated with epithelial-mesenchymal transition, a crucial step in the progression of many tumors to malignant disease. PMID:26579519

  10. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  11. Combinatorial Gene Regulation through Kinetic Control of the Transcription Cycle.

    PubMed

    Scholes, Clarissa; DePace, Angela H; Sánchez, Álvaro

    2017-01-25

    Cells decide when, where, and to what level to express their genes by "computing" information from transcription factors (TFs) binding to regulatory DNA. How is the information contained in multiple TF-binding sites integrated to dictate the rate of transcription? The dominant conceptual and quantitative model is that TFs combinatorially recruit one another and RNA polymerase to the promoter by direct physical interactions. Here, we develop a quantitative framework to explore kinetic control, an alternative model in which combinatorial gene regulation can result from TFs working on different kinetic steps of the transcription cycle. Kinetic control can generate a wide range of analog and Boolean computations without requiring the input TFs to be simultaneously bound to regulatory DNA. We propose experiments that will illuminate the role of kinetic control in transcription and discuss implications for deciphering the cis-regulatory "code."

  12. Malleable machines take shape in eukaryotic transcriptional regulation

    PubMed Central

    Fuxreiter, Monika; Tompa, Peter; Simon, István; Uversky, Vladimir N; Hansen, Jeffrey C; Asturias, Francisco J

    2010-01-01

    Transcriptional control requires the spatially and temporally coordinated action of many macromolecular complexes. Chromosomal proteins, transcription factors, co-activators and components of the general transcription machinery, including RNA polymerases, often use structurally or stoichiometrically ill-defined regions for interactions that convey regulatory information in processes ranging from chromatin remodeling to mRNA processing. Determining the functional significance of intrinsically disordered protein regions and developing conceptual models of their action will help to illuminate their key role in transcription regulation. Complexes comprising disordered regions often display short recognition elements embedded in flexible and sequentially variable environments that can lead to structural and functional malleability. This provides versatility to recognize multiple targets having different structures, facilitate conformational rearrangements and physically communicate with many partners in response to environmental changes. All these features expand the capacities of ordered complexes and give rise to efficient regulatory mechanisms. PMID:19008886

  13. Dynamic Post-Transcriptional Regulation of HIV-1 Gene Expression

    PubMed Central

    Kula, Anna; Marcello, Alessandro

    2012-01-01

    Gene expression of the human immunodeficiency virus type 1 (HIV-1) is a highly regulated process. Basal transcription of the integrated provirus generates early transcripts that encode for the viral products Tat and Rev. Tat promotes the elongation of RNA polymerase while Rev mediates the nuclear export of viral RNAs that contain the Rev-responsive RNA element (RRE). These RNAs are exported from the nucleus to allow expression of Gag-Pol and Env proteins and for the production of full-length genomic RNAs. A balance exists between completely processed mRNAs and RRE-containing RNAs. Rev functions as an adaptor that recruits cellular factors to re-direct singly spliced and unspliced viral RNAs to nuclear export. The aim of this review is to address the dynamic regulation of this post-transcriptional pathway in light of recent findings that implicate several novel cellular cofactors of Rev function. PMID:24832221

  14. Nutritional conditions regulate transcriptional activity of SF-1 by controlling sumoylation and ubiquitination

    PubMed Central

    Lee, Jiwon; Yang, Dong Joo; Lee, Syann; Hammer, Gary D.; Kim, Ki Woo; Elmquist, Joel K.

    2016-01-01

    Steroidogenic factor 1 (SF-1) is a transcription factor expressed in the ventral medial nucleus of the hypothalamus that regulates energy homeostasis. However, the molecular mechanisms of SF-1 in the control of energy balance are largely unknown. Here, we show that nutritional conditions, such as the presence or absence of serum, affect SF-1 action. Serum starvation significantly decreased hypothalamic SF-1 levels by promoting ubiquitin-dependent degradation, and sumoylation was required for this process. SF-1 transcriptional activity was also differentially regulated by nutritional status. Under normal conditions, the transcriptional activity of hypothalamic SF-1 was activated by SUMO, but this was attenuated during starvation. Taken together, these results indicate that sumoylation and ubiquitination play crucial roles in the regulation of SF-1 function and that these effects are dependent on nutritional conditions, further supporting the importance of SF-1 in the control of energy homeostasis. PMID:26750456

  15. Endothelial Gata5 transcription factor regulates blood pressure

    PubMed Central

    Messaoudi, Smail; He, Ying; Gutsol, Alex; Wight, Andrew; Hébert, Richard L.; Vilmundarson, Ragnar O.; Makrigiannis, Andrew P.; Chalmers, John; Hamet, Pavel; Tremblay, Johanne; McPherson, Ruth; Stewart, Alexandre F. R.; Touyz, Rhian M.; Nemer, Mona

    2015-01-01

    Despite its high prevalence and economic burden, the aetiology of human hypertension remains incompletely understood. Here we identify the transcription factor GATA5, as a new regulator of blood pressure (BP). GATA5 is expressed in microvascular endothelial cells and its genetic inactivation in mice (Gata5-null) leads to vascular endothelial dysfunction and hypertension. Endothelial-specific inactivation of Gata5 mimics the hypertensive phenotype of the Gata5-null mice, suggestive of an important role for GATA5 in endothelial homeostasis. Transcriptomic analysis of human microvascular endothelial cells with GATA5 knockdown reveals that GATA5 affects several genes and pathways critical for proper endothelial function, such as PKA and nitric oxide pathways. Consistent with a role in human hypertension, we report genetic association of variants at the GATA5 locus with hypertension traits in two large independent cohorts. Our results unveil an unsuspected link between GATA5 and a prominent human condition, and provide a new animal model for hypertension. PMID:26617239

  16. Transcriptionally Regulated Cell Adhesion Network Dictates Distal Tip Cell Directionality

    PubMed Central

    Wong, Ming-Ching; Kennedy, William P.; Schwarzbauer, Jean E.

    2015-01-01

    Background The mechanisms that govern directional changes in cell migration are poorly understood. The migratory paths of two distal tip cells (DTC) determine the U-shape of the C. elegans hermaphroditic gonad. The morphogenesis of this organ provides a model system to identify genes necessary for the DTCs to execute two stereotyped turns. Results Using candidate genes for RNAi knockdown in a DTC-specific strain, we identified two transcriptional regulators required for DTC turning: cbp-1, the CBP/p300 transcriptional coactivator homologue, and let-607, a CREBH transcription factor homologue. Further screening of potential target genes uncovered a network of integrin adhesion-related genes that have roles in turning and are dependent on cbp-1 and let-607 for expression. These genes include src-1/Src kinase, tln-1/talin, pat-2/α integrin and nmy-2, a nonmuscle myosin heavy chain. Conclusions Transcriptional regulation by means of cbp-1 and let-607 is crucial for determining directional changes during DTC migration. These regulators coordinate a gene network that is necessary for integrin-mediated adhesion. Overall, these results suggest that directional changes in cell migration rely on the precise gene regulation of adhesion. PMID:24811939

  17. Transcriptional Auto-Regulation of RUNX1 P1 Promoter.

    PubMed

    Martinez, Milka; Hinojosa, Marcela; Trombly, Daniel; Morin, Violeta; Stein, Janet; Stein, Gary; Javed, Amjad; Gutierrez, Soraya E

    2016-01-01

    RUNX1 a member of the family of runt related transcription factors (RUNX), is essential for hematopoiesis. The expression of RUNX1 gene is controlled by two promoters; the distal P1 promoter and the proximal P2 promoter. Several isoforms of RUNX1 mRNA are generated through the use of both promoters and alternative splicing. These isoforms not only differs in their temporal expression pattern but also exhibit differences in tissue specificity. The RUNX1 isoforms derived from P2 are expressed in a variety of tissues, but expression of P1-derived isoform is restricted to cells of hematopoietic lineage. However, the control of hematopoietic-cell specific expression is poorly understood. Here we report regulation of P1-derived RUNX1 mRNA by RUNX1 protein. In silico analysis of P1 promoter revealed presence of two evolutionary conserved RUNX motifs, 0.6kb upstream of the transcription start site, and three RUNX motifs within 170bp of the 5'UTR. Transcriptional contribution of these RUNX motifs was studied in myeloid and T-cells. RUNX1 genomic fragment containing all sites show very low basal activity in both cell types. Mutation or deletion of RUNX motifs in the UTR enhances basal activity of the RUNX1 promoter. Chromatin immunoprecipitation revealed that RUNX1 protein is recruited to these sites. Overexpression of RUNX1 in non-hematopoietic cells results in a dose dependent activation of the RUNX1 P1 promoter. We also demonstrate that RUNX1 protein regulates transcription of endogenous RUNX1 mRNA in T-cell. Finally we show that SCL transcription factor is recruited to regions containing RUNX motifs in the promoter and the UTR and regulates activity of the RUNX1 P1 promoter in vitro. Thus, multiple lines of evidence show that RUNX1 protein regulates its own gene transcription.

  18. BRCA1 transcriptionally regulates genes involved in breast tumorigenesis

    PubMed Central

    Welcsh, Piri L.; Lee, Ming K.; Gonzalez-Hernandez, Rachel M.; Black, Daniel J.; Mahadevappa, Mamatha; Swisher, Elizabeth M.; Warrington, Janet A.; King, Mary-Claire

    2002-01-01

    Loss of function of BRCA1 caused by inherited mutation and tissue-specific somatic mutation leads to breast and ovarian cancer. Nearly all BRCA1 germ-line mutations involve truncation or loss of the C-terminal BRCT transcriptional activation domain, suggesting that transcriptional regulation is a critical function of the wild-type gene. The purpose of this project was to determine whether there is a link between the role of BRCA1 in transcriptional regulation and its role in tumor suppression. We developed a cell line (in which BRCA1 can be induced) and used microarray analysis to compare transcription profiles of epithelial cells with low endogenous levels of BRCA1 vs. transcription profiles of cells with 2–4-fold higher induced levels of expression of BRCA1. At these levels of expression, BRCA1 did not induce apoptosis. Undirected cluster analysis of six paired experiments revealed 373 genes, the expression of which was altered significantly and consistently by BRCA1 induction. Expression of 62 genes was altered more than 2-fold. BRCA1-regulated genes associated with breast tumorigenesis included the estrogen-responsive genes MYC and cyclin D1, which are overexpressed in many breast tumors; STAT1 and JAK1, key components of the cytokine signal transduction pathway; the extracellular matrix protein laminin 3A; ID4, an inhibitor of DNA-binding transcriptional activators, which in turn negatively regulates BRCA1 expression; and the prohormone stanniocalcin, expression of which is lost in breast tumor cells. Coordinated expression of BRCA1 with ID4 and with stanniocalcin was confirmed in primary breast and ovarian tumors. PMID:12032322

  19. The physical size of transcription factors is key to transcriptional regulation in chromatin domains

    NASA Astrophysics Data System (ADS)

    Maeshima, Kazuhiro; Kaizu, Kazunari; Tamura, Sachiko; Nozaki, Tadasu; Kokubo, Tetsuro; Takahashi, Koichi

    2015-02-01

    Genetic information, which is stored in the long strand of genomic DNA as chromatin, must be scanned and read out by various transcription factors. First, gene-specific transcription factors, which are relatively small (˜50 kDa), scan the genome and bind regulatory elements. Such factors then recruit general transcription factors, Mediators, RNA polymerases, nucleosome remodellers, and histone modifiers, most of which are large protein complexes of 1-3 MDa in size. Here, we propose a new model for the functional significance of the size of transcription factors (or complexes) for gene regulation of chromatin domains. Recent findings suggest that chromatin consists of irregularly folded nucleosome fibres (10 nm fibres) and forms numerous condensed domains (e.g., topologically associating domains). Although the flexibility and dynamics of chromatin allow repositioning of genes within the condensed domains, the size exclusion effect of the domain may limit accessibility of DNA sequences by transcription factors. We used Monte Carlo computer simulations to determine the physical size limit of transcription factors that can enter condensed chromatin domains. Small gene-specific transcription factors can penetrate into the chromatin domains and search their target sequences, whereas large transcription complexes cannot enter the domain. Due to this property, once a large complex binds its target site via gene-specific factors it can act as a ‘buoy’ to keep the target region on the surface of the condensed domain and maintain transcriptional competency. This size-dependent specialization of target-scanning and surface-tethering functions could provide novel insight into the mechanisms of various DNA transactions, such as DNA replication and repair/recombination.

  20. The fur transcription regulator and fur-regulated genes in Clostridium botulinum A ATCC 3502.

    PubMed

    Zhang, Weibin; Ma, Junhua; Zang, Chengyuan; Song, Yingying; Liu, Peipei

    2011-01-01

    Clostridium botulinum is a spore-forming bacterium that can produce a very powerful neurotoxin that causes botulism. In this study, we have investigated the Fur transcription regulators in Clostridium botulinum and Fur-regulated genes in Clostridium botulinum A ATCC 3502. We found that gene loss may be the main cause leading to the different numbers of Fur transcription regulators in different Clostridium botulinum strains. Meanwhile, 46 operons were found to be regulated by the Fur transcription regulator in Clostridium botulinum A ATCC 3502, involved in several functional classifications, including iron acquisition, iron utilization, iron transport, and transcription regulator. Under an iron-restricted medium, we experimentally found that a Fur transcription regulator (CBO1372) and two operons (DedA, CBO2610-CBO2614 and ABC transporter, CBO0845-CBO0847) are shown to be differentially expressed in Clostridium botulinum A ATCC 3502. This study has provided-us novel insights into the diversity of Fur transcription regulators in different Clostridium botulinum strains and diversity of Fur-targeted genes, as well as a better understanding of the dynamic changes in iron restriction occurring in response to this stress.

  1. Dynamic equilibrium on DNA defines transcriptional regulation of a multidrug binding transcriptional repressor, LmrR.

    PubMed

    Takeuchi, Koh; Imai, Misaki; Shimada, Ichio

    2017-03-21

    LmrR is a multidrug binding transcriptional repressor that controls the expression of a major multidrug transporter, LmrCD, in Lactococcus lactis. Promiscuous compound ligations reduce the affinity of LmrR for the lmrCD operator by several fold to release the transcriptional repression; however, the affinity reduction is orders of magnitude smaller than that of typical transcriptional repressors. Here, we found that the transcriptional regulation of LmrR is achieved through an equilibrium between the operator-bound and non-specific DNA-adsorption states in vivo. The effective dissociation constant of LmrR for the lmrCD operator under the equilibrium is close to the endogenous concentration of LmrR, which allows a substantial reduction of LmrR occupancy upon compound ligations. Therefore, LmrR represents a dynamic type of transcriptional regulation of prokaryotic multidrug resistance systems, where the small affinity reduction induced by compounds is coupled to the functional relocalization of the repressor on the genomic DNA via nonspecific DNA adsorption.

  2. The Leucine-rich Pentatricopeptide-Repeat Containing Protein Regulates Mitochondrial Transcription

    PubMed Central

    Sondheimer, Neal; Fang, Ji-Kang; Polyak, Erzsebet; Falk, Marni; Avadhani, Narayan G.

    2010-01-01

    Mitochondrial function depends upon the coordinated expression of the mitochondrial and nuclear genomes. Although the basal factors that carry out the process of mitochondrial transcription are known, the regulation of this process is incompletely understood. To further our understanding of mitochondrial gene regulation we identified proteins that bound to the previously described point of termination for the major mRNA-coding transcript H2. One was the leucine-rich pentatricopeptide-repeat containing protein (LRPPRC), which has been linked to the French-Canadian variant of Leigh syndrome. Cells with reduced expression of LRPPRC had a reduction in oxygen consumption. The expression of mitochondrial mRNA and tRNA was dependent upon LRPPRC levels, but reductions in LRPPRC did not affect the expression of mitochondrial rRNA. Reduction of LRPPRC levels interfered with mitochondrial transcription in vitro but did not affect the stability of mitochondrial mRNAs or alter the expression of nuclear genes responsible for mitochondrial transcription in vivo. These findings demonstrate the control of mitochondrial mRNA synthesis by a protein that has an established role in regulating nuclear transcription, and a link to mitochondrial disease. PMID:20677761

  3. Circadian rhythms and post-transcriptional regulation in higher plants

    PubMed Central

    Romanowski, Andrés; Yanovsky, Marcelo J.

    2015-01-01

    The circadian clock of plants allows them to cope with daily changes in their environment. This is accomplished by the rhythmic regulation of gene expression, in a process that involves many regulatory steps. One of the key steps involved at the RNA level is post-transcriptional regulation, which ensures a correct control on the different amounts and types of mRNA that will ultimately define the current physiological state of the plant cell. Recent advances in the study of the processes of regulation of pre-mRNA processing, RNA turn-over and surveillance, regulation of translation, function of lncRNAs, biogenesis and function of small RNAs, and the development of bioinformatics tools have helped to vastly expand our understanding of how this regulatory step performs its role. In this work we review the current progress in circadian regulation at the post-transcriptional level research in plants. It is the continuous interaction of all the information flow control post-transcriptional processes that allow a plant to precisely time and predict daily environmental changes. PMID:26124767

  4. Post-transcriptional Regulation of Immunological Responses through Riboclustering

    PubMed Central

    Ganguly, Koelina; Giddaluru, Jeevan; August, Avery; Khan, Nooruddin

    2016-01-01

    Immunological programing of immune cells varies in response to changing environmental signals. This process is facilitated by modifiers that regulate the translational fate of mRNAs encoding various immune mediators, including cytokines and chemokines, which in turn determine the rapid activation, tolerance, and plasticity of the immune system. RNA-binding proteins (RBPs) recruited by the specific sequence elements in mRNA transcripts are one such modifiers. These RBPs form RBP–RNA complexes known as “riboclusters.” These riboclusters serve as RNA sorting machinery, where depending upon the composition of the ribocluster, translation, degradation, or storage of mRNA is controlled. Recent findings suggest that this regulation of mRNA homeostasis is critical for controlling the immune response. Here, we present the current knowledge of the ribocluster-mediated post-transcriptional regulation of immune mediators and highlight recent findings regarding their implications for the pathogenesis of acute or chronic inflammatory diseases. PMID:27199986

  5. MOF Acetyl Transferase Regulates Transcription and Respiration in Mitochondria.

    PubMed

    Chatterjee, Aindrila; Seyfferth, Janine; Lucci, Jacopo; Gilsbach, Ralf; Preissl, Sebastian; Böttinger, Lena; Mårtensson, Christoph U; Panhale, Amol; Stehle, Thomas; Kretz, Oliver; Sahyoun, Abdullah H; Avilov, Sergiy; Eimer, Stefan; Hein, Lutz; Pfanner, Nikolaus; Becker, Thomas; Akhtar, Asifa

    2016-10-20

    A functional crosstalk between epigenetic regulators and metabolic control could provide a mechanism to adapt cellular responses to environmental cues. We report that the well-known nuclear MYST family acetyl transferase MOF and a subset of its non-specific lethal complex partners reside in mitochondria. MOF regulates oxidative phosphorylation by controlling expression of respiratory genes from both nuclear and mtDNA in aerobically respiring cells. MOF binds mtDNA, and this binding is dependent on KANSL3. The mitochondrial pool of MOF, but not a catalytically deficient mutant, rescues respiratory and mtDNA transcriptional defects triggered by the absence of MOF. Mof conditional knockout has catastrophic consequences for tissues with high-energy consumption, triggering hypertrophic cardiomyopathy and cardiac failure in murine hearts; cardiomyocytes show severe mitochondrial degeneration and deregulation of mitochondrial nutrient metabolism and oxidative phosphorylation pathways. Thus, MOF is a dual-transcriptional regulator of nuclear and mitochondrial genomes connecting epigenetics and metabolism.

  6. Mechanisms of post-transcriptional gene regulation in bacterial biofilms

    PubMed Central

    Martínez, Luary C.; Vadyvaloo, Viveka

    2014-01-01

    Biofilms are characterized by a dense multicellular community of microorganisms that can be formed by the attachment of bacteria to an inert surface and to each other. The development of biofilm involves the initial attachment of planktonic bacteria to a surface, followed by replication, cell-to-cell adhesion to form microcolonies, maturation, and detachment. Mature biofilms are embedded in a self-produced extracellular polymeric matrix composed primarily of bacterial-derived exopolysaccharides, specialized proteins, adhesins, and occasionally DNA. Because the synthesis and assembly of biofilm matrix components is an exceptionally complex process, the transition between its different phases requires the coordinate expression and simultaneous regulation of many genes by complex genetic networks involving all levels of gene regulation. The finely controlled intracellular level of the chemical second messenger molecule, cyclic-di-GMP is central to the post-transcriptional mechanisms governing the switch between the motile planktonic lifestyle and the sessile biofilm forming state in many bacteria. Several other post-transcriptional regulatory mechanisms are known to dictate biofilm development and assembly and these include RNA-binding proteins, small non-coding RNAs, toxin-antitoxin systems, riboswitches, and RNases. Post-transcriptional regulation is therefore a powerful molecular mechanism employed by bacteria to rapidly adjust to the changing environment and to fine tune gene expression to the developmental needs of the cell. In this review, we discuss post-transcriptional mechanisms that influence the biofilm developmental cycle in a variety of pathogenic bacteria. PMID:24724055

  7. Pathway-specific regulation revisited: cross-regulation of multiple disparate gene clusters by PAS-LuxR transcriptional regulators.

    PubMed

    Vicente, Cláudia M; Payero, Tamara D; Santos-Aberturas, Javier; Barreales, Eva G; de Pedro, Antonio; Aparicio, Jesús F

    2015-06-01

    PAS-LuxR regulators are highly conserved proteins devoted to the control of antifungal production by binding to operators located in given promoters of polyene biosynthetic genes. The canonical operator of PimM, archetype of this class of regulators, has been used here to search for putative targets of orthologous protein PteF in the genome of Streptomyces avermitilis, finding 97 putative operators outside the pentaene filipin gene cluster (pte). The processes putatively affected included genetic information processing; energy, carbohydrate, and lipid metabolism; DNA replication and repair; morphological differentiation; secondary metabolite biosynthesis; and transcriptional regulation, among others. Seventeen of these operators were selected, and their binding to PimM DNA-binding domain was assessed by electrophoretic mobility shift assays. Strikingly, the protein bound all predicted operators suggesting a direct control over targeted processes. As a proof of concept, we studied the biosynthesis of the ATP-synthase inhibitor oligomycin whose gene cluster included two operators. Regulator mutants showed a severe loss of oligomycin production, whereas gene complementation of the mutant restored phenotype, and gene duplication in the wild-type strain boosted oligomycin production. Comparative gene expression analyses in parental and mutant strains by reverse transcription-quantitative polymerase chain reaction of selected olm genes corroborated production results. These results demonstrate that PteF is able to cross-regulate the biosynthesis of two related secondary metabolites, filipin and oligomycin, but might be extended to all the processes indicated above. This study highlights the complexity of the network of interactions in which PAS-LuxR regulators are involved and opens new possibilities for the manipulation of metabolite production in Streptomycetes.

  8. CpG islands and the regulation of transcription

    PubMed Central

    Deaton, Aimée M.; Bird, Adrian

    2011-01-01

    Vertebrate CpG islands (CGIs) are short interspersed DNA sequences that deviate significantly from the average genomic pattern by being GC-rich, CpG-rich, and predominantly nonmethylated. Most, perhaps all, CGIs are sites of transcription initiation, including thousands that are remote from currently annotated promoters. Shared DNA sequence features adapt CGIs for promoter function by destabilizing nucleosomes and attracting proteins that create a transcriptionally permissive chromatin state. Silencing of CGI promoters is achieved through dense CpG methylation or polycomb recruitment, again using their distinctive DNA sequence composition. CGIs are therefore generically equipped to influence local chromatin structure and simplify regulation of gene activity. PMID:21576262

  9. Systematic Genetic Screen for Transcriptional Regulators of the Candida albicans White-Opaque Switch.

    PubMed

    Lohse, Matthew B; Ene, Iuliana V; Craik, Veronica B; Hernday, Aaron D; Mancera, Eugenio; Morschhäuser, Joachim; Bennett, Richard J; Johnson, Alexander D

    2016-08-01

    The human fungal pathogen Candida albicans can reversibly switch between two cell types named "white" and "opaque," each of which is stable through many cell divisions. These two cell types differ in their ability to mate, their metabolic preferences and their interactions with the mammalian innate immune system. A highly interconnected network of eight transcriptional regulators has been shown to control switching between these two cell types. To identify additional regulators of the switch, we systematically and quantitatively measured white-opaque switching rates of 196 strains, each deleted for a specific transcriptional regulator. We identified 19 new regulators with at least a 10-fold effect on switching rates and an additional 14 new regulators with more subtle effects. To investigate how these regulators affect switching rates, we examined several criteria, including the binding of the eight known regulators of switching to the control region of each new regulatory gene, differential expression of the newly found genes between cell types, and the growth rate of each mutant strain. This study highlights the complexity of the transcriptional network that regulates the white-opaque switch and the extent to which switching is linked to a variety of metabolic processes, including respiration and carbon utilization. In addition to revealing specific insights, the information reported here provides a foundation to understand the highly complex coupling of white-opaque switching to cellular physiology.

  10. Direct transcriptional regulation of MDM2 by Fli-1.

    PubMed

    Truong, Amandine H L; Cervi, David; Lee, Jane; Ben-David, Yaacov

    2005-02-03

    The Ets transcription factor, Fli-1, has been shown to play a pivotal role in the induction and progression of Friend Murine Leukemia Virus (F-MuLV)-induced erythroleukemia, with its overexpression leading to erythroblast survival, proliferation, and inhibition of terminal differentiation. P53 inactivation is an additional genetic alteration that occurs in late-stage leukemic progression associated with in vivo and in vitro immortalization. Since p53 protein expression levels are low, to undetectable, in primary erythroleukemic cells that express elevated levels of Fli-1, we investigated the potential regulation of p53 by Fli-1. We assessed whether the overexpression of Fli-1 could partially regulate p53 via modulation of its well-established regulator, MDM2. In this paper, we demonstrate that the promoter of MDM2 contains a consensus binding site for Fli-1 that is bound by this transcription factor in vitro and in vivo, resulting in MDM2 transcriptional regulation. We further substantiate these observations in vivo by demonstrating a positive correlation in the expression of Fli-1 and MDM2, and a negative correlation with p53 in leukemic tissues obtained from mice with Friend Disease. These observations depict a significant function of Fli-1 overexpression in the indirect control of p53, evidently capable of leading to an increasingly aggressive erythroleukemic clone in vivo.

  11. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  12. Stochastic Proofreading Mechanism Alleviates Crosstalk in Transcriptional Regulation

    NASA Astrophysics Data System (ADS)

    Cepeda-Humerez, Sarah A.; Rieckh, Georg; Tkačik, Gašper

    2015-12-01

    Gene expression is controlled primarily by interactions between transcription factor proteins (TFs) and the regulatory DNA sequence, a process that can be captured well by thermodynamic models of regulation. These models, however, neglect regulatory crosstalk: the possibility that noncognate TFs could initiate transcription, with potentially disastrous effects for the cell. Here, we estimate the importance of crosstalk, suggest that its avoidance strongly constrains equilibrium models of TF binding, and propose an alternative nonequilibrium scheme that implements kinetic proofreading to suppress erroneous initiation. This proposal is consistent with the observed covalent modifications of the transcriptional apparatus and predicts increased noise in gene expression as a trade-off for improved specificity. Using information theory, we quantify this trade-off to find when optimal proofreading architectures are favored over their equilibrium counterparts. Such architectures exhibit significant super-Poisson noise at low expression in steady state.

  13. Nicotine regulates cocaine-amphetamine-Regulated Transcript (Cart) in the mesocorticolimbic system.

    PubMed

    Kaya, Egemen; Gozen, Oguz; Ugur, Muzeyyen; Koylu, Ersin O; Kanit, Lutfiye; Balkan, Burcu

    2016-07-01

    Cocaine-and-Amphetamine Regulated Transcript (CART) mRNA and peptides are intensely expressed in the brain regions comprising mesocorticolimbic system. Studies suggest that CART peptides may have a role in the regulation of reward circuitry. The present study aimed to examine the effect of nicotine on CART expression in the mesocorticolimbic system. Three different doses of nicotine (0.2, 0.4, 0.6 mg/kg free base) were injected subcutaneously for 5 days, and on day 6, rats were decapitated following a challenge dose. CART mRNA and peptide levels in medial prefrontal cortex (mPFC), nucleus accumbens (NAc), dorsal striatum (DST), amygdala (AMG), lateral hypothalamic area (LHA), and ventral tegmental area (VTA) were measured by quantitative real-time PCR (qPCR) and Western Blot analysis, respectively. In the mPFC, 0.4 and 0.6 mg/kg nicotine, decreased CART peptide levels whereas there was no effect on CART mRNA levels. In the VTA, a down-regulation of CART peptide expression was observed with 0.2 and 0.6 mg/kg nicotine. Conversely, 0.4 and 0.6 mg/kg nicotine increased CART mRNA levels in the AMG without affecting the CART peptide expression. Nicotine did not regulate CART mRNA or CART peptide expression in the NAc, DST, and LHA. We conclude that nicotine regulates CART expression in the mesocorticolimbic system and this regulation may play an important role in nicotine reward. Synapse 70:283-292, 2016. © 2016 Wiley Periodicals, Inc.

  14. The Role of the Ubiquitously Expressed Transcription Factor Sp1 in Tissue-specific Transcriptional Regulation and in Disease

    PubMed Central

    O’Connor, Leigh; Gilmour, Jane; Bonifer, Constanze

    2016-01-01

    Sp1 belongs to the 26 member strong Sp/KLF family of transcription factors. It is a paradigm for a ubiquitously expressed transcription factor and is involved in regulating the expression of genes associated with a wide range of cellular processes in mammalian cells. Sp1 can interact with a range of proteins, including other transcription factors, members of the transcription initiation complex and epigenetic regulators, enabling tight regulation of its target genes. In this review, we discuss the mechanisms involved in Sp1-mediated transcriptional regulation, as well as how a ubiquitous transcription factor can be involved in establishing a tissue-specific pattern of gene expression and mechanisms by which its activity may be regulated. We also consider the role of Sp1 in human diseases, such as cancer. PMID:28018142

  15. Angiotensin II-regulated transcription regulatory genes in adrenal steroidogenesis.

    PubMed

    Romero, Damian G; Gomez-Sanchez, Elise P; Gomez-Sanchez, Celso E

    2010-11-29

    Transcription regulatory genes are crucial modulators of cell physiology and metabolism whose intracellular levels are tightly controlled in response to extracellular stimuli. We previously reported a set of 29 transcription regulatory genes modulated by angiotensin II in H295R human adrenocortical cells and their roles in regulating the expression of the last and unique enzymes of the glucocorticoid and mineralocorticoid biosynthetic pathways, 11β-hydroxylase and aldosterone synthase, respectively, using gene expression reporter assays. To study the effect of this set of transcription regulatory genes on adrenal steroidogenesis, H295R cells were transfected by high-efficiency nucleofection and aldosterone and cortisol were measured in cell culture supernatants under basal and angiotensin II-stimulated conditions. BCL11B, BHLHB2, CITED2, ELL2, HMGA1, MAFF, NFIL3, PER1, SERTAD1, and VDR significantly stimulated aldosterone secretion, while EGR1, FOSB, and ZFP295 decreased aldosterone secretion. BTG2, HMGA1, MITF, NR4A1, and ZFP295 significantly increased cortisol secretion, while BCL11B, NFIL3, PER1, and SIX2 decreased cortisol secretion. We also report the effect of some of these regulators on the expression of endogenous aldosterone synthase and 11β-hydroxylase under basal and angiotensin II-stimulated conditions. In summary, this study reports for the first time the effects of a set of angiotensin II-modulated transcription regulatory genes on aldosterone and cortisol secretion and the expression levels of the last and unique enzymes of the mineralocorticoid and glucocorticoid biosynthetic pathways. Abnormal regulation of mineralocorticoid or glucocorticoid secretion is involved in several pathophysiological conditions. These transcription regulatory genes may be involved in adrenal steroidogenesis pathologies; thus they merit additional study as potential candidates for therapeutic intervention.

  16. TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes.

    PubMed

    Matys, V; Kel-Margoulis, O V; Fricke, E; Liebich, I; Land, S; Barre-Dirrie, A; Reuter, I; Chekmenev, D; Krull, M; Hornischer, K; Voss, N; Stegmaier, P; Lewicki-Potapov, B; Saxel, H; Kel, A E; Wingender, E

    2006-01-01

    The TRANSFAC database on transcription factors, their binding sites, nucleotide distribution matrices and regulated genes as well as the complementing database TRANSCompel on composite elements have been further enhanced on various levels. A new web interface with different search options and integrated versions of Match and Patch provides increased functionality for TRANSFAC. The list of databases which are linked to the common GENE table of TRANSFAC and TRANSCompel has been extended by: Ensembl, UniGene, EntrezGene, HumanPSD and TRANSPRO. Standard gene names from HGNC, MGI and RGD, are included for human, mouse and rat genes, respectively. With the help of InterProScan, Pfam, SMART and PROSITE domains are assigned automatically to the protein sequences of the transcription factors. TRANSCompel contains now, in addition to the COMPEL table, a separate table for detailed information on the experimental EVIDENCE on which the composite elements are based. Finally, for TRANSFAC, in respect of data growth, in particular the gain of Drosophila transcription factor binding sites (by courtesy of the Drosophila DNase I footprint database) and of Arabidopsis factors (by courtesy of DATF, Database of Arabidopsis Transcription Factors) has to be stressed. The here described public releases, TRANSFAC 7.0 and TRANSCompel 7.0, are accessible under http://www.gene-regulation.com/pub/databases.html.

  17. TRANSCRIPTIONAL REGULATION OF THE HUMAN KiSS1 GENE

    PubMed Central

    Mueller, Johanna K.; Dietzel, Anja; Lomniczi, Alejandro; Loche, Alberto; Tefs, Katrin; Kiess, Wieland; Danne, Thomas; Ojeda, Sergio R.; Heger, Sabine

    2011-01-01

    Kisspeptin, the product of the KiSS1 gene, has emerged as a key component of the mechanism by which the hypothalamus controls puberty and reproductive development. It does so by stimulating the secretion of gonadotropin releasing hormone (GnRH). Little is known about the transcriptional control of the KiSS1 gene. Here we show that a set of proteins postulated to be upstream components of a hypothalamic network involved in controlling female puberty regulates KiSS1 transcriptional activity. Using RACE-PCR we determined that transcription of KiSS1 mRNA is initiated at a single transcription start site (TSS) located 153–156 bp upstream of the ATG translation initiation codon. Promoter assays performed using 293 MSR cells showed that the KiSS1 promoter is activated by TTF1 and CUX1-p200, and repressed by EAP1, YY1, and CUX1-p110. EAP1 and CUX-110 were also repressive in GT1-7 cells. All four TFs are recruited in vivo to the KiSS1 promoter and are expressed in kisspeptin neurons. These results suggest that expression of the KiSS1 gene is regulated by trans-activators and repressors involved in the system-wide control of mammalian puberty. PMID:21672609

  18. Changing Faces of Transcriptional Regulation Reflected by Zic3

    PubMed Central

    Winata, Cecilia Lanny; Kondrychyn, Igor; Deddens, J.C.; Korzh, Vladimir

    2015-01-01

    The advent of genomics in the study of developmental mechanisms has brought a trove of information on gene datasets and regulation during development, where the Zic family of zinc-finger proteins plays an important role. Genomic analysis of the modes of action of Zic3 in pluripotent cells demonstrated its requirement for maintenance of stem cells pluripotency upon binding to the proximal regulatory regions (promoters) of genes associated with cell pluripotency (Nanog, Sox2, Oct4, etc.) as well as cell cycle, proliferation, oncogenesis and early embryogenesis. In contrast, during gastrulation and neurulation Zic3 acts by binding the distal regulatory regions (enhancers, etc) associated with control of gene transcription in the Nodal and Wnt signaling pathways, including genes that act to break body symmetry. This illustrates a general role of Zic3 as a transcriptional regulator that acts not only alone, but in many instances in conjunction with other transcription factors. The latter is done by binding to adjacent sites in the context of multi-transcription factor complexes associated with regulatory elements. PMID:26085810

  19. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-05

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases.

  20. Identification of Arabidopsis Transcriptional Regulators by Yeast One-Hybrid Screens Using a Transcription Factor ORFeome.

    PubMed

    Breton, Ghislain; Kay, Steve A; Pruneda-Paz, José L

    2016-01-01

    Genetic and molecular approaches revealed that the circadian clock network structure is comprised of several interlocked positive and negative transcriptional feedback loops. The network evolved to sense and integrate inputs from environmental cues to adjust daily rhythms in physiological processes. Compiling evidence indicates that part of this regulation happens at the transcriptional level through subtle adjustments in the expression of core clock genes. Thus, to better understand the network and identify the molecular mechanisms of clock input pathways, it is imperative to determine how core clock genes are regulated. For this purpose we developed reagents for an unbiased approach to identify transcription factors (TFs) interacting with the promoters of core clock genes. At the center of this approach lies the yeast one-hybrid (Y1H) assay in which a pool of proteins fused to the GAL4 transcriptional activation domain are tested for their ability to interact with a selected promoter fragment in yeast cells. Taking advantage of the fact that Arabidopsis TF genes are well annotated, we generated a comprehensive TF clone collection (TF ORFeome) and used it to replace the standard cDNA pool strategy traditionally used in Y1H screens. The use of this TF clone collection substantially accelerates the comprehensive discovery of promoter-specific DNA binding activities among all Arabidopsis TFs. Considering that this strategy can be extended to the study of the promoter interactome of any Arabidopsis gene, we developed a low throughput protocol that can be universally implemented to screen the ~2000 TF clone library.

  1. Analysis of Genomic Sequence Motifs for Deciphering Transcription Factor Binding and Transcriptional Regulation in Eukaryotic Cells

    PubMed Central

    Boeva, Valentina

    2016-01-01

    Eukaryotic genomes contain a variety of structured patterns: repetitive elements, binding sites of DNA and RNA associated proteins, splice sites, and so on. Often, these structured patterns can be formalized as motifs and described using a proper mathematical model such as position weight matrix and IUPAC consensus. Two key tasks are typically carried out for motifs in the context of the analysis of genomic sequences. These are: identification in a set of DNA regions of over-represented motifs from a particular motif database, and de novo discovery of over-represented motifs. Here we describe existing methodology to perform these two tasks for motifs characterizing transcription factor binding. When applied to the output of ChIP-seq and ChIP-exo experiments, or to promoter regions of co-modulated genes, motif analysis techniques allow for the prediction of transcription factor binding events and enable identification of transcriptional regulators and co-regulators. The usefulness of motif analysis is further exemplified in this review by how motif discovery improves peak calling in ChIP-seq and ChIP-exo experiments and, when coupled with information on gene expression, allows insights into physical mechanisms of transcriptional modulation. PMID:26941778

  2. Transcriptional and Post-Transcriptional Regulation of Thrombospondin-1 Expression: A Computational Model

    PubMed Central

    Isenberg, Jeffrey S.; Popel, Aleksander S.

    2017-01-01

    Hypoxia is an important physiological stress signal that drives angiogenesis, the formation of new blood vessels. Besides an increase in the production of pro-angiogenic signals such as vascular endothelial growth factor (VEGF), hypoxia also stimulates the production of anti-angiogenic signals. Thrombospondin-1 (TSP-1) is one of the anti-angiogenic factors whose synthesis is driven by hypoxia. Cellular synthesis of TSP-1 is tightly regulated by different intermediate biomolecules including proteins that interact with hypoxia-inducible factors (HIFs), transcription factors that are activated by receptor and intracellular signaling, and microRNAs which are small non-coding RNA molecules that function in post-transcriptional modification of gene expression. Here we present a computational model that describes the mechanistic interactions between intracellular biomolecules and cooperation between signaling pathways that together make up the complex network of TSP-1 regulation both at the transcriptional and post-transcriptional level. Assisted by the model, we conduct in silico experiments to compare the efficacy of different therapeutic strategies designed to modulate TSP-1 synthesis in conditions that simulate tumor and peripheral arterial disease microenvironment. We conclude that TSP-1 production in endothelial cells depends on not only the availability of certain growth factors but also the fine-tuned signaling cascades that are initiated by hypoxia. PMID:28045898

  3. Epigenetics regulates transcription and pathogenesis in the parasite Trichomonas vaginalis.

    PubMed

    Pachano, Tomas; Nievas, Yesica R; Lizarraga, Ayelen; Johnson, Patricia J; Strobl-Mazzulla, Pablo H; de Miguel, Natalia

    2017-01-05

    Trichomonas vaginalis is a common sexually transmitted parasite that colonizes the human urogenital tract. Infections range from asymptomatic to highly inflammatory, depending on the host and the parasite strain. Different T. vaginalis strains vary greatly in their adherence and cytolytic capacities. These phenotypic differences might be attributed to differentially expressed genes as a consequence of extra-genetic variation, such as epigenetic modifications. In this study, we explored the role of histone acetylation in regulating gene transcription and pathogenesis in T. vaginalis. Here, we show that histone 3 lysine acetylation (H3KAc) is enriched in nucleosomes positioned around the transcription start site of active genes (BAP1 and BAP2) in a highly adherent parasite strain; compared with the low acetylation abundance in contrast to that observed in a less-adherent strain that expresses these genes at low levels. Additionally, exposition of less-adherent strain with a specific histone deacetylases inhibitor, trichostatin A, upregulated the transcription of BAP1 and BAP2 genes in concomitance with an increase in H3KAc abundance and chromatin accessibility around their transcription start sites. Moreover, we demonstrated that the binding of initiator binding protein, the transcription factor responsible for the initiation of transcription of ~75% of known T. vaginalis genes, depends on the histone acetylation state around the metazoan-like initiator to which initiator binding protein binds. Finally, we found that trichostatin A treatment increased parasite aggregation and adherence to host cells. Our data demonstrated for the first time that H3KAc is a permissive histone modification that functions to mediate both transcription and pathogenesis of the parasite T. vaginalis.

  4. Histone methylation by the Drosophila epigenetic transcriptional regulator Ash1.

    PubMed

    Beisel, Christian; Imhof, Axel; Greene, Jaime; Kremmer, Elisabeth; Sauer, Frank

    2002-10-24

    The establishment and maintenance of mitotic and meiotic stable (epigenetic) transcription patterns is fundamental for cell determination and function. Epigenetic regulation of transcription is mediated by epigenetic activators and repressors, and may require the establishment, 'spreading' and maintenance of epigenetic signals. Although these signals remain unclear, it has been proposed that chromatin structure and consequently post-translational modification of histones may have an important role in epigenetic gene expression. Here we show that the epigenetic activator Ash1 (ref. 5) is a multi-catalytic histone methyl-transferase (HMTase) that methylates lysine residues 4 and 9 in H3 and 20 in H4. Transcriptional activation by Ash1 coincides with methylation of these three lysine residues at the promoter of Ash1 target genes. The methylation pattern placed by Ash1 may serve as a binding surface for a chromatin remodelling complex containing the epigenetic activator Brahma (Brm), an ATPase, and inhibits the interaction of epigenetic repressors with chromatin. Chromatin immunoprecipitation indicates that epigenetic activation of Ultrabithorax transcription in Drosophila coincides with trivalent methylation by Ash1 and recruitment of Brm. Thus, histone methylation by Ash1 may provide a specific signal for the establishment of epigenetic, active transcription patterns.

  5. Identification of E2F1 as a positive transcriptional regulator for {delta}-catenin

    SciTech Connect

    Kim, Kwonseop; Oh, Minsoo; Ki, Hyunkyoung; Wang Tao; Bareiss, Sonja; Fini, M. Elizabeth.; Li Dawei; Lu Qun

    2008-05-02

    {delta}-Catenin is upregulated in human carcinomas. However, little is known about the potential transcriptional factors that regulate {delta}-catenin expression in cancer. Using a human {delta}-catenin reporter system, we have screened several nuclear signaling modulators to test whether they can affect {delta}-catenin transcription. Among {beta}-catenin/LEF-1, Notch1, and E2F1, E2F1 dramatically increased {delta}-catenin-luciferase activities while {beta}-catenin/LEF-1 induced only a marginal increase. Rb suppressed the upregulation of {delta}-catenin-luciferase activities induced by E2F1 but did not interact with {delta}-catenin. RT-PCR and Western blot analyses in 4 different prostate cancer cell lines revealed that regulation of {delta}-catenin expression is controlled mainly at the transcriptional level. Interestingly, the effects of E2F1 on {delta}-catenin expression were observed only in human cancer cells expressing abundant endogenous {delta}-catenin. These studies identify E2F1 as a positive transcriptional regulator for {delta}-catenin, but further suggest the presence of strong negative regulator(s) for {delta}-catenin in prostate cancer cells with minimal endogenous {delta}-catenin expression.

  6. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.

    PubMed

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J

    2014-10-15

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs.

  7. Id1 regulates angiogenesis through transcriptional repression of thrombospondin-1.

    PubMed

    Volpert, Olga V; Pili, Roberto; Sikder, Hashmat A; Nelius, Thomas; Zaichuk, Tetiana; Morris, Chad; Shiflett, Clinton B; Devlin, Meghann K; Conant, Katherine; Alani, Rhoda M

    2002-12-01

    Id proteins are helix-loop-helix transcription factors that regulate tumor angiogenesis. In order to identify downstream effectors of Id1 involved in the regulation of angiogenesis, we performed PCR-select subtractive hybridization on wild-type and Id1 knockout mouse embryo fibroblasts (MEFs). Here we demonstrate that thrombospondin-1 (TSP-1), a potent inhibitor of angiogenesis, is a target of transcriptional repression by Id1. We also show that Id1-null MEFs secrete an inhibitor of endothelial cell migration, which is completely inactivated by depletion of TSP-1. Furthermore, in vivo studies revealed decreased neovascularization in matrigel assays in Id1-null mice compared to their wild-type littermates. This decrease was completely reversed by a TSP-1 neutralizing antibody. We conclude that TSP-1 is a major target for Id1 effects on angiogenesis.

  8. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus.

    PubMed

    Khoroshkin, Matvei S; Leyn, Semen A; Van Sinderen, Douwe; Rodionov, Dmitry A

    2016-01-01

    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics.

  9. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus

    PubMed Central

    Khoroshkin, Matvei S.; Leyn, Semen A.; Van Sinderen, Douwe; Rodionov, Dmitry A.

    2016-01-01

    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics. PMID:26903998

  10. The expression and post-transcriptional regulation of FSTL1 transcripts in placental trophoblasts

    PubMed Central

    Mouillet, Jean-Francois; Mishima, Takuya; Paffaro, Andrea Mollica do Amarante; Parks, Tony W.; Ziegler, Judy A.; Chu, Tianjiao; Sadovsky, Yoel

    2015-01-01

    Introduction Follistatin-like-1 (FSTL1) is a widely expressed secreted protein with diverse but poorly understood functions. Originally described as a pro-inflammatory molecule, it has recently been reported to play a role in signaling pathways that regulate development and homeostasis. Distinctively, FSTL1 harbors within its 3′-UTR the sequence encoding microRNA-198 (miR-198), shown to be inversely regulated relative to FSTL1 expression and to exhibit opposite actions on cellular processes such as cell migration. We sought to investigate the expression of FSTL1 and to assess its interplay with miR-198 in human trophoblasts. Methods We used a combination of northern blot analyses, quantitative PCR, small RNA sequencing, western blot and immunohistochemistry to characterize FSTL1 and miR-198 expression in placental trophoblasts. We also used reporter assays to examine the post-transcriptional regulation of FSTL1 and assess its putative regulation by miR-198. Results We detected the expression of FSTL1 transcript in both the human extravillous trophoblast line HTR-8/SVneo and in primary term human villous trophoblasts. We also found that the expression of FSTL1 was largely restricted to extravillous trophoblasts. Hypoxia enhanced the expression of FSTL1 protein in cultured primary villous trophoblasts. Interestingly, we did not detect any evidence for expression or function of mature miR-198 in human trophoblasts. Discussion Our data indicate that placental FSTL1 is expressed particularly in extravillous trophoblasts. We also found no evidence for placental expression of miR-198, or for its regulation of FSTL1, implying that the post-transcriptional regulation of FSTL1 by miR-198 is tissue specific. PMID:26386648

  11. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene

    PubMed Central

    Zhou, Jiawei

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  12. Bacterial Transcriptional Regulators for Degradation Pathways of Aromatic Compounds

    PubMed Central

    Tropel, David; van der Meer, Jan Roelof

    2004-01-01

    Human activities have resulted in the release and introduction into the environment of a plethora of aromatic chemicals. The interest in discovering how bacteria are dealing with hazardous environmental pollutants has driven a large research community and has resulted in important biochemical, genetic, and physiological knowledge about the degradation capacities of microorganisms and their application in bioremediation, green chemistry, or production of pharmacy synthons. In addition, regulation of catabolic pathway expression has attracted the interest of numerous different groups, and several catabolic pathway regulators have been exemplary for understanding transcription control mechanisms. More recently, information about regulatory systems has been used to construct whole-cell living bioreporters that are used to measure the quality of the aqueous, soil, and air environment. The topic of biodegradation is relatively coherent, and this review presents a coherent overview of the regulatory systems involved in the transcriptional control of catabolic pathways. This review summarizes the different regulatory systems involved in biodegradation pathways of aromatic compounds linking them to other known protein families. Specific attention has been paid to describing the genetic organization of the regulatory genes, promoters, and target operon(s) and to discussing present knowledge about signaling molecules, DNA binding properties, and operator characteristics, and evidence from regulatory mutants. For each regulator family, this information is combined with recently obtained protein structural information to arrive at a possible mechanism of transcription activation. This demonstrates the diversity of control mechanisms existing in catabolic pathways. PMID:15353566

  13. Autopalmitoylation of TEAD Proteins Regulates Transcriptional Output of Hippo Pathway

    PubMed Central

    Chan, PuiYee; Han, Xiao; Zheng, Baohui; DeRan, Michael; Yu, Jianzhong; Jarugumilli, Gopala K.; Deng, Hua; Pan, Duojia; Luo, Xuelian; Wu, Xu

    2016-01-01

    TEA domain (TEAD) transcription factors bind to the co-activator YAP/TAZ, and regulate the transcriptional output of Hippo pathway, playing critical roles in organ size control and tumorigenesis. Protein S-palmitoylation attaches fatty acid (palmitate) to cysteine residues, and regulates protein trafficking, membrane localization and signaling activities. Using activity-based chemical probes, we discovered that human TEADs possess intrinsic palmitoylating enzyme-like activities, and undergo autopalmitoylation at evolutionarily conserved cysteine residues under physiological conditions. We determined the crystal structures of lipid-bound TEADs, and found that the lipid chain of palmitate inserts into a conserved deep hydrophobic pocket. Strikingly, palmitoylation is required for TEAD’s binding to YAP/TAZ, but dispensable for the binding to Vgll4 tumor suppressor. In addition, palmitoylation does not alter TEAD’s localization. Moreover, TEAD palmitoylation-deficient mutants impaired TAZ-mediated muscle differentiation in vitro, and Yorkie-mediated tissue overgrowth in Drosophila in vivo. Our study directly linked autopalmitoylation to the transcriptional regulation of Hippo pathway. PMID:26900866

  14. Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots

    PubMed Central

    Lee, Ji-Young; Colinas, Juliette; Wang, Jean Y.; Mace, Daniel; Ohler, Uwe; Benfey, Philip N.

    2006-01-01

    Understanding how the expression of transcription factor (TF) genes is modulated is essential for reconstructing gene regulatory networks. There is increasing evidence that sequences other than upstream noncoding can contribute to modulating gene expression, but how frequently they do so remains unclear. Here, we investigated the regulation of TFs expressed in a tissue-enriched manner in Arabidopsis roots. For 61 TFs, we created GFP reporter constructs driven by each TF’s upstream noncoding sequence (including the 5′UTR) fused to the GFP reporter gene alone or together with the TF’s coding sequence. We compared the visually detectable GFP patterns with endogenous mRNA expression patterns, as defined by a genome-wide microarray root expression map. An automated image analysis method for quantifying GFP signals in different tissues was developed and used to validate our visual comparison method. From these combined analyses, we found that (i) the upstream noncoding sequence was sufficient to recapitulate the mRNA expression pattern for 80% (35/44) of the TFs, and (ii) 25% of the TFs undergo posttranscriptional regulation via microRNA-mediated mRNA degradation (2/24) or via intercellular protein movement (6/24). The results suggest that, for Arabidopsis TFs, upstream noncoding sequences are major contributors to mRNA expression pattern establishment, but modulation of transcription factor protein expression pattern after transcription is relatively frequent. This study provides a systematic overview of regulation of TF expression at a cellular level. PMID:16581911

  15. Hydrogen peroxide sensing, signaling and regulation of transcription factors

    PubMed Central

    Marinho, H. Susana; Real, Carla; Cyrne, Luísa; Soares, Helena; Antunes, Fernando

    2014-01-01

    The regulatory mechanisms by which hydrogen peroxide (H2O2) modulates the activity of transcription factors in bacteria (OxyR and PerR), lower eukaryotes (Yap1, Maf1, Hsf1 and Msn2/4) and mammalian cells (AP-1, NRF2, CREB, HSF1, HIF-1, TP53, NF-κB, NOTCH, SP1 and SCREB-1) are reviewed. The complexity of regulatory networks increases throughout the phylogenetic tree, reaching a high level of complexity in mammalians. Multiple H2O2 sensors and pathways are triggered converging in the regulation of transcription factors at several levels: (1) synthesis of the transcription factor by upregulating transcription or increasing both mRNA stability and translation; (ii) stability of the transcription factor by decreasing its association with the ubiquitin E3 ligase complex or by inhibiting this complex; (iii) cytoplasm–nuclear traffic by exposing/masking nuclear localization signals, or by releasing the transcription factor from partners or from membrane anchors; and (iv) DNA binding and nuclear transactivation by modulating transcription factor affinity towards DNA, co-activators or repressors, and by targeting specific regions of chromatin to activate individual genes. We also discuss how H2O2 biological specificity results from diverse thiol protein sensors, with different reactivity of their sulfhydryl groups towards H2O2, being activated by different concentrations and times of exposure to H2O2. The specific regulation of local H2O2 concentrations is also crucial and results from H2O2 localized production and removal controlled by signals. Finally, we formulate equations to extract from typical experiments quantitative data concerning H2O2 reactivity with sensor molecules. Rate constants of 140 M−1 s−1 and ≥1.3 × 103 M−1 s−1 were estimated, respectively, for the reaction of H2O2 with KEAP1 and with an unknown target that mediates NRF2 protein synthesis. In conclusion, the multitude of H2O2 targets and mechanisms provides an opportunity for highly

  16. Transcriptional regulation of autophagy by an FXR/CREB axis

    PubMed Central

    Seok, Sunmi; Fu, Ting; Choi, Sung-E; Li, Yang; Zhu, Rong; Kumar, Subodh; Sun, Xiaoxiao; Yoon, Gyesoon; Kang, Yup; Zhong, Wenxuan; Ma, Jian; Kemper, Byron; Kemper, Jongsook Kim

    2014-01-01

    Lysosomal degradation of cytoplasmic components by autophagy is essential for cellular survival and homeostasis under nutrient-deprived conditions1–4. Acute regulation of autophagy by nutrient-sensing kinases is well defined3, 5–7, but longer-term transcriptional regulation is relatively unknown. Here we show that the fed-state sensing nuclear receptor FXR8, 9 and the fasting transcriptional activator CREB10, 11 coordinately regulate the hepatic autophagy gene network. Pharmacological activation of FXR repressed many autophagy genes and inhibited autophagy even in fasted mice and feeding-mediated inhibition of macroautophagy was attenuated in FXR-knockout mice. From mouse liver ChIP-seq data12–15, FXR and CREB binding peaks were detected at 178 and 112, respectively, of 230 autophagy-related genes, and 78 genes showed shared binding, mostly in their promoter regions. CREB promoted lipophagy, autophagic degradation of lipids16, under nutrient-deprived conditions, and FXR inhibited this response. Mechanistically, CREB upregulated autophagy genes, including Atg7, Ulk1, and Tfeb, by recruiting the coactivator CRTC2. After feeding or pharmacological activation, FXR trans-repressed these genes by disrupting the functional CREB/CRTC2 complex. This study identifies the novel FXR/CREB axis as a key physiological switch regulating autophagy, resulting in sustained nutrient regulation of autophagy during feeding/fasting cycles. PMID:25383523

  17. Transcriptional regulation of storage protein synthesis during dicotyledon seed filling.

    PubMed

    Verdier, Jérôme; Thompson, Richard D

    2008-09-01

    Seeds represent a major source of nutrients for human and animal livestock diets. The nutritive value of seeds is largely due to storage products which accumulate during a key phase of seed development, seed filling. In recent years, our understanding of the mechanisms regulating seed filling has advanced significantly due to the diversity of experimental approaches used. This review summarizes recent findings related to transcription factors that regulate seed storage protein accumulation. A framework for the regulation of storage protein synthesis is established which incorporates the events before, during and after seed storage protein synthesis. The transcriptional control of storage protein synthesis is accompanied by physiological and environmental controls, notably through the action of plant hormones and other intermediary metabolites. Finally, recent post-genomics analyses on different model plants have established the existence of a conserved seed filling process involving the master regulators (LEC1, LEC2, ABI3 and FUS3) but also revealed certain differences in fine regulation between plant families.

  18. Nuclear pore proteins regulate chromatin structure and transcriptional memory by a conserved mechanism.

    PubMed

    Light, William H; Brickner, Jason H

    2013-01-01

    Previous experience alters the rate of transcriptional induction of many genes in yeast and this phenomenon persists through several cell division cycles. This phenomenon is called epigenetic transcriptional memory. For the yeast gene INO1, transcriptional memory requires a physical interaction with the nuclear pore complex (NPC) and changes in the chromatin structure of the promoter. These changes lead to binding of a preinitiation form of RNA Polymerase II (RNAPII) to the INO1 promoter, bypassing the need to recruit RNAPII to the promoter during reactivation. In our recent study, we found that in human cells, hundreds of interferon-γ responsive genes exhibit a mechanistically similar form of transcriptional memory. Transcriptional memory requires a homologous nuclear pore protein in yeast and humans, which interacts with the promoters of genes that exhibit transcriptional memory and promotes both alteration of chromatin structure and binding of RNAPII. Whereas the interaction of yeast genes with nuclear pore proteins occurs at the NPC, the interaction of human genes with nuclear pore proteins occurs in the nucleoplasm. Thus, the interaction of nuclear pore proteins with genes plays an important and conserved role in affecting long-term epigenetic changes in transcriptional regulation.

  19. Glucocorticoid regulation of transcription at an amplified, episomal promoter.

    PubMed Central

    Ostrowski, M C; Richard-Foy, H; Wolford, R G; Berard, D S; Hager, G L

    1983-01-01

    The mouse mammary tumor virus long terminal repeat (MMTV LTR) has been introduced into cultured murine cells, using the 69% transforming fragment of bovine papilloma virus type 1 (BPV). Transformed cells contain up to 200 copies of the chimeric molecules per diploid genome. The restriction endonuclease map of the acquired recombinants, as well as the physical structure of the DNA, indicates that the LTR-BPV molecules present in these cells occur exclusively as unintegrated, extrachromosomal episome. When a 72-base pair direct repeat "enhancer" element (derived from the Harvey sarcoma retrovirus) was included in the MMTV LTR-BPV chimeric plasmids, DNA acquired through transfection, with a single exception, was integrated or rearranged or both. The transcriptional potential of the episomal MMTV promoter present in these cells was tested in two ways. First, steady-state levels of MMTV-initiated RNA were measured by quantitative S1 mapping. Second, the relative number of transcription complexes initiated in vivo was determined by using a subnuclear fraction highly enriched for MMTV-BPV minichromosomes in an in vitro transcription extension assay. Both approaches showed that the MMTV LTR present in the episomal state was capable of supporting glucocorticoid hormone-regulated transcription. We have therefore demonstrated the hormone response for the first time in a totally defined primary sequence environment. Significant differences both in the basal level of MMTV-initiated transcription and in the extent of glucocorticoid induction were observed in individual cell lines with similar episomal copy numbers. These phenotypic variations suggest that epigenetic structure is an important component of the mechanism of regulation. Images PMID:6318079

  20. Nuclear localization of γ-tubulin affects E2F transcriptional activity and S-phase progression

    PubMed Central

    Höög, Greta; Zarrizi, Reihaneh; von Stedingk, Kristoffer; Jonsson, Kristina; Alvarado-Kristensson, Maria

    2011-01-01

    We show that the centrosome- and microtubule-regulating protein γ-tubulin interacts with E2 promoter binding factors (E2Fs) to modulate E2F transcriptional activity and thereby control cell cycle progression. γ-Tubulin contains a C-terminal signal that results in its translocation to the nucleus during late G1 to early S phase. γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1–γ-tubulin complex is formed during the G1/S transition, when E2F1 is transcriptionally active. Furthermore, E2F transcriptional activity is altered by reduced expression of γ-tubulin or by complex formation between γ-tubulin and E2F1, E2F2, or E2F3, but not E2F6. In addition, the γ-tubulin C terminus encodes a DNA-binding domain that interacts with E2F-regulated promoters, resulting in γ-tubulin-mediated transient activation of E2Fs. Thus, we report a novel mechanism regulating the activity of E2Fs, which can help explain how these proteins affect cell cycle progression in mammalian cells.—Höög, G., Zarrizi, R., von Stedingk, K., Jonsson, K., Alvarado-Kristensson, M. Nuclear localization of γ-tubulin affects E2F transcriptional activity and S-phase progression. PMID:21788450

  1. Transcriptional regulation of neurodevelopmental and metabolic pathways by NPAS3.

    PubMed

    Sha, L; MacIntyre, L; Machell, J A; Kelly, M P; Porteous, D J; Brandon, N J; Muir, W J; Blackwood, D H; Watson, D G; Clapcote, S J; Pickard, B S

    2012-03-01

    The basic helix-loop-helix PAS (Per, Arnt, Sim) domain transcription factor gene NPAS3 is a replicated genetic risk factor for psychiatric disorders. A knockout (KO) mouse model exhibits behavioral and adult neurogenesis deficits consistent with human illness. To define the location and mechanism of NPAS3 etiopathology, we combined immunofluorescent, transcriptomic and metabonomic approaches. Intense Npas3 immunoreactivity was observed in the hippocampal subgranular zone-the site of adult neurogenesis--but was restricted to maturing, rather than proliferating, neuronal precursor cells. Microarray analysis of a HEK293 cell line over-expressing NPAS3 showed that transcriptional targets varied according to circadian rhythm context and C-terminal deletion. The most highly up-regulated NPAS3 target gene, VGF, encodes secretory peptides with established roles in neurogenesis, depression and schizophrenia. VGF was just one of many NPAS3 target genes also regulated by the SOX family of transcription factors, suggesting an overlap in neurodevelopmental function. The parallel repression of multiple glycolysis genes by NPAS3 reveals a second role in the regulation of glucose metabolism. Comparison of wild-type and Npas3 KO metabolite composition using high-resolution mass spectrometry confirmed these transcriptional findings. KO brain tissue contained significantly altered levels of NAD(+), glycolysis metabolites (such as dihydroxyacetone phosphate and fructose-1,6-bisphosphate), pentose phosphate pathway components and Kreb's cycle intermediates (succinate and α-ketoglutarate). The dual neurodevelopmental and metabolic aspects of NPAS3 activity described here increase our understanding of mental illness etiology, and may provide a mechanism for innate and medication-induced susceptibility to diabetes commonly reported in psychiatric patients.

  2. Arac/XylS family of transcriptional regulators.

    PubMed Central

    Gallegos, M T; Schleif, R; Bairoch, A; Hofmann, K; Ramos, J L

    1997-01-01

    The ArC/XylS family of prokaryotic positive transcriptional regulators includes more than 100 proteins and polypeptides derived from open reading frames translated from DNA sequences. Members of this family are widely distributed and have been found in the gamma subgroup of the proteobacteria, low- and high-G + C-content gram-positive bacteria, and cyanobacteria. These proteins are defined by a profile that can be accessed from PROSITE PS01124. Members of the family are about 300 amino acids long and have three main regulatory functions in common: carbon metabolism, stress response, and pathogenesis. Multiple alignments of the proteins of the family define a conserved stretch of 99 amino acids usually located at the C-terminal region of the regulator and connected to a nonconserved region via a linker. The conserved stretch contains all the elements required to bind DNA target sequences and to activate transcription from cognate promoters. Secondary analysis of the conserved region suggests that it contains two potential alpha-helix-turn-alpha-helix DNA binding motifs. The first, and better-fitting motif is supported by biochemical data, whereas existing biochemical data neither support nor refute the proposal that the second region possesses this structure. The phylogenetic relationship suggests that members of the family have recruited the nonconserved domain(s) into a series of existing domains involved in DNA recognition and transcription stimulation and that this recruited domain governs the role that the regulator carries out. For some regulators, it has been demonstrated that the nonconserved region contains the dimerization domain. For the regulators involved in carbon metabolism, the effector binding determinants are also in this region. Most regulators belonging to the AraC/XylS family recognize multiple binding sites in the regulated promoters. One of the motifs usually overlaps or is adjacent to the -35 region of the cognate promoters. Footprinting

  3. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses.

    PubMed

    Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Luo, De-Xu; Gong, Zhen-Hui; Lu, Ming-Hui

    2016-01-01

    Abiotic stresses such as high temperature, salinity, and drought adversely affect the survival, growth, and reproduction of plants. Plants respond to such unfavorable changes through developmental, physiological, and biochemical ways, and these responses require expression of stress-responsive genes, which are regulated by a network of transcription factors (TFs), including heat stress transcription factors (HSFs). HSFs play a crucial role in plants response to several abiotic stresses by regulating the expression of stress-responsive genes, such as heat shock proteins (Hsps). In this review, we describe the conserved structure of plant HSFs, the identification of HSF gene families from various plant species, their expression profiling under abiotic stress conditions, regulation at different levels and function in abiotic stresses. Despite plant HSFs share highly conserved structure, their remarkable diversification across plants reflects their numerous functions as well as their integration into the complex stress signaling and response networks, which can be employed in crop improvement strategies via biotechnological intervention.

  4. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses

    PubMed Central

    Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Luo, De-Xu; Gong, Zhen-Hui; Lu, Ming-Hui

    2016-01-01

    Abiotic stresses such as high temperature, salinity, and drought adversely affect the survival, growth, and reproduction of plants. Plants respond to such unfavorable changes through developmental, physiological, and biochemical ways, and these responses require expression of stress-responsive genes, which are regulated by a network of transcription factors (TFs), including heat stress transcription factors (HSFs). HSFs play a crucial role in plants response to several abiotic stresses by regulating the expression of stress-responsive genes, such as heat shock proteins (Hsps). In this review, we describe the conserved structure of plant HSFs, the identification of HSF gene families from various plant species, their expression profiling under abiotic stress conditions, regulation at different levels and function in abiotic stresses. Despite plant HSFs share highly conserved structure, their remarkable diversification across plants reflects their numerous functions as well as their integration into the complex stress signaling and response networks, which can be employed in crop improvement strategies via biotechnological intervention. PMID:26904076

  5. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  6. Transcriptional regulation of voltage-gated Ca(2+) channels.

    PubMed

    González-Ramírez, Ricardo; Felix, Ricardo

    2017-03-31

    The transcriptional regulation of voltage-gated Ca(2+) (CaV ) channels is an emerging research area that promises to improve our understanding of how many relevant physiological events are shaped in the central nervous system, the skeletal muscle, and other tissues. Interestingly, a picture of how transcription of CaV channel subunit genes is controlled is evolving with the identification of the promoter regions required for tissue-specific expression, and the identification of transcription factors that control their expression. These promoters share several characteristics that include multiple transcriptional start sites, lack of a TATA box, and the presence of elements conferring tissue-selective expression. Likewise, changes in CaV channel expression occur throughout development, following ischemia, seizures, or chronic drug administration. This review focuses on insights achieved regarding the control of CaV channel gene expression. To further understand the complexities of expression and to increase the possibilities of detecting CaV channel alterations causing human disease, a deeper knowledge on the structure of the 5' upstream regions of the genes encoding these remarkable proteins will be necessary. This article is protected by copyright. All rights reserved.

  7. Drosophila OVO regulates ovarian tumor transcription by binding unusually near the transcription start site.

    PubMed

    Lü, J; Oliver, B

    2001-05-01

    Evolutionarily conserved ovo loci encode developmentally regulated, sequence-specific, DNA-binding, C(2)H(2)-zinc-finger proteins required in the germline and epidermal cells of flies and mice. The direct targets of OVO activity are not known. Genetic experiments suggest that ovo acts in the same regulatory network as ovarian tumor (otu), but the relative position of these genes in the pathway is controversial. Three OVO-binding sites exist in a compact regulatory region that controls germline expression of the otu gene. Interestingly, the strongest OVO-binding site is very near the otu transcription start, where basal transcriptional complexes must function. Loss-of-function, gain-of-function and promoter swapping constructs demonstrate that OVO binding near the transcription start site is required for OVO-dependent otu transcription in vivo. These data unambiguously identify otu as a direct OVO target gene and raise the tantalizing possibility that an OVO site, at the location normally occupied by basal components, functions as part of a specialized core promoter.

  8. Redox regulation of FoxO transcription factors

    PubMed Central

    Klotz, Lars-Oliver; Sánchez-Ramos, Cristina; Prieto-Arroyo, Ignacio; Urbánek, Pavel; Steinbrenner, Holger; Monsalve, Maria

    2015-01-01

    Transcription factors of the forkhead box, class O (FoxO) family are important regulators of the cellular stress response and promote the cellular antioxidant defense. On one hand, FoxOs stimulate the transcription of genes coding for antioxidant proteins located in different subcellular compartments, such as in mitochondria (i.e. superoxide dismutase-2, peroxiredoxins 3 and 5) and peroxisomes (catalase), as well as for antioxidant proteins found extracellularly in plasma (e.g., selenoprotein P and ceruloplasmin). On the other hand, reactive oxygen species (ROS) as well as other stressful stimuli that elicit the formation of ROS, may modulate FoxO activity at multiple levels, including posttranslational modifications of FoxOs (such as phosphorylation and acetylation), interaction with coregulators, alterations in FoxO subcellular localization, protein synthesis and stability. Moreover, transcriptional and posttranscriptional control of the expression of genes coding for FoxOs is sensitive to ROS. Here, we review these aspects of FoxO biology focusing on redox regulation of FoxO signaling, and with emphasis on the interplay between ROS and FoxOs under various physiological and pathophysiological conditions. Of particular interest are the dual role played by FoxOs in cancer development and their key role in whole body nutrient homeostasis, modulating metabolic adaptations and/or disturbances in response to low vs. high nutrient intake. Examples discussed here include calorie restriction and starvation as well as adipogenesis, obesity and type 2 diabetes. PMID:26184557

  9. Myogenic regulatory transcription factors regulate growth in rhabdomyosarcoma

    PubMed Central

    Tenente, Inês M; Hayes, Madeline N; Ignatius, Myron S; McCarthy, Karin; Yohe, Marielle; Sindiri, Sivasish; Gryder, Berkley; Oliveira, Mariana L; Ramakrishnan, Ashwin; Tang, Qin; Chen, Eleanor Y; Petur Nielsen, G; Khan, Javed; Langenau, David M

    2017-01-01

    Rhabdomyosarcoma (RMS) is a pediatric malignacy of muscle with myogenic regulatory transcription factors MYOD and MYF5 being expressed in this disease. Consensus in the field has been that expression of these factors likely reflects the target cell of transformation rather than being required for continued tumor growth. Here, we used a transgenic zebrafish model to show that Myf5 is sufficient to confer tumor-propagating potential to RMS cells and caused tumors to initiate earlier and have higher penetrance. Analysis of human RMS revealed that MYF5 and MYOD are mutually-exclusively expressed and each is required for sustained tumor growth. ChIP-seq and mechanistic studies in human RMS uncovered that MYF5 and MYOD bind common DNA regulatory elements to alter transcription of genes that regulate muscle development and cell cycle progression. Our data support unappreciated and dominant oncogenic roles for MYF5 and MYOD convergence on common transcriptional targets to regulate human RMS growth. DOI: http://dx.doi.org/10.7554/eLife.19214.001 PMID:28080960

  10. TOR-dependent post-transcriptional regulation of autophagy.

    PubMed

    Hu, Guowu; McQuiston, Travis; Bernard, Amélie; Park, Yoon-Dong; Qiu, Jin; Vural, Ali; Zhang, Nannan; Waterman, Scott R; Blewett, Nathan H; Myers, Timothy G; Maraia, Richard J; Kehrl, John H; Uzel, Gulbu; Klionsky, Daniel J; Williamson, Peter R

    2015-01-01

    Regulation of autophagy is required to maintain cellular equilibrium and prevent disease. While extensive study of post-translational mechanisms has yielded important insights into autophagy induction, less is known about post-transcriptional mechanisms that could potentiate homeostatic control. In our study, we showed that the RNA-binding protein, Dhh1 in Saccharomyces cerevisiae and Vad1 in the pathogenic yeast Cryptococcus neoformans is involved in recruitment and degradation of key autophagy mRNAs. In addition, phosphorylation of the decapping protein Dcp2 by the target of rapamycin (TOR), facilitates decapping and degradation of autophagy-related mRNAs, resulting in repression of autophagy under nutrient-replete conditions. The post-transcriptional regulatory process is conserved in both mouse and human cells and plays a role in autophagy-related modulation of the inflammasome product IL1B. These results were then applied to provide mechanistic insight into autoimmunity of a patient with a PIK3CD/p110δ gain-of-function mutation. These results thus identify an important new post-transcriptional mechanism of autophagy regulation that is highly conserved between yeast and mammals.

  11. Transport and transcriptional regulation of oil production in plants.

    PubMed

    Manan, Sehrish; Chen, Beibei; She, Guangbiao; Wan, Xiaochun; Zhao, Jian

    2016-08-23

    Triacylglycerol (TAG) serves as an energy reservoir and phospholipids as build blocks of biomembrane to support plant life. They also provide human with foods and nutrients. Multi-compartmentalized biosynthesis, trafficking or cross-membrane transport of lipid intermediates or precursors and their regulatory mechanisms are not fully understood. Recent progress has aided our understanding of how fatty acids (FAs) and phospholipids are transported between the chloroplast, the cytoplasm, and the endoplasmic reticulum (ER), and how the ins and outs of lipids take place in the peroxisome and other organelles for lipid metabolism and function. In addition, information regarding the transcriptional regulation network associated with FA and TAG biosynthesis has been further enriched. Recent breakthroughs made in lipid transport and transcriptional regulation has provided significant insights into our comprehensive understanding of plant lipid biology. This review attempts to highlight the recent progress made on lipid synthesis, transport, degradation, and their regulatory mechanisms. Metabolic engineering, based on these knowledge-powered technologies for production of edible oils or biofuels, is reviewed. The biotechnological application of metabolic enzymes, transcription factors and transporters, for oil production and composition improvement, are discussed in a broad context in order to provide a fresh scenario for researchers and to guide future research and applications.

  12. Beyond transcription factors: The role of chromatin modifying enzymes in regulating transcription required for memory

    PubMed Central

    Barrett, Ruth M.; Wood, Marcelo A.

    2008-01-01

    One of the alluring aspects of examining chromatin modifications in the role of modulating transcription required for long-term memory processes is that these modifications may provide transient and potentially stable epigenetic marks in the service of activating and/or maintaining transcriptional processes. These, in turn, may ultimately participate in the molecular mechanisms required for neuronal changes subserving long-lasting changes in behavior. As an epigenetic mechanism of transcriptional control, chromatin modification has been shown to participate in maintaining cellular memory (e.g., cell fate) and may underlie the strengthening and maintenance of synaptic connections required for long-term changes in behavior. Epigenetics has become central to several fields of neurobiology, where researchers have found that regulation of chromatin modification has a significant role in epilepsy, drug addiction, depression, neurodegenerative diseases, and memory. In this review, we will discuss the role of chromatin modifying enzymes in memory processes, as well as how recent studies in yeast genetics and cancer biology may impact the way we think about how chromatin modification and chromatin remodeling regulate neuronal function. PMID:18583646

  13. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  14. Affect-regulation expectancies among Gamblers.

    PubMed

    Will Shead, N; Hodgins, David C

    2009-09-01

    Factor scores on a gambling expectancy questionnaire (GEQ) were used to subtype 132 university students who gamble regularly (37.9% male; M age = 22.6 years, SD = 6.04) as: Reward Expectancy Gamblers (Reward EGs)-have strong expectations that gambling augments positive mood, Relief Expectancy Gamblers (Relief EGs)-have strong expectations that gambling relieves negative affect, and Non-Expectancy Gamblers (Non-EGs)-have neither strong expectation. Gambling on a high-low card game was compared across subtypes following priming for either "relief" or "reward" affect-regulation expectancies with the Scrambled Sentence Test (SST). The hypothesized Prime type x GEQ subtype interaction was not significant. When a more stringent set of criteria for GEQ subtyping was imposed, the "purified" sub-sample (n = 54) resulted in the hypothesized statistically significant Prime type x GEQ subtype interaction. Relief EGs gambled more after being primed with the construct "relief of negative emotions" compared to after being primed with the construct "augmentation of positive emotion." Planned orthogonal contrasts showed a significant linear increase in number of bets made across GEQ subtypes when prime type corresponded to GEQ subtype. The results suggest a need for components in gambling treatment programs that address clients' expectancies that gambling can provide a specific desirable emotional outcome.

  15. Legislation: Legislation and Regulations Affecting Libraries in 2002; Legislation and Regulations Affecting Publishing in 2002.

    ERIC Educational Resources Information Center

    Sheketoff, Emily; Costabile, Mary R.; Adler, Allan

    2003-01-01

    Reviews legislation and regulations affecting libraries and the publishing industry, including the Museum and Library Services Act; Office of Educational Research and Improvement (OERI); copyright; access to electronic government information; telecommunications and technology; electronic surveillance and privacy, including the USA Patriot Act;…

  16. Transcriptional regulation of myeloid-derived suppressor cells

    PubMed Central

    Condamine, Thomas; Mastio, Jérôme; Gabrilovich, Dmitry I.

    2015-01-01

    Myeloid-derived suppressor cells are a heterogeneous group of pathologically activated immature cells that play a major role in the negative regulation of the immune response in cancer, autoimmunity, many chronic infections, and inflammatory conditions, as well as in the regulation of tumor angiogenesis, tumor cell invasion, and metastases. Accumulation of myeloid-derived suppressor cells is governed by a network of transcriptional regulators that could be combined into 2 partially overlapping groups: factors promoting myelopoiesis and preventing differentiation of mature myeloid cells and factors promoting pathologic activation of myeloid-derived suppressor cells. In this review, we discuss the specific nature of these factors and their impact on myeloid-derived suppressor cell development. PMID:26337512

  17. Pervasive transcription constitutes a new level of eukaryotic genome regulation

    PubMed Central

    Berretta, Julia; Morillon, Antonin

    2009-01-01

    During the past few years, it has become increasingly evident that the expression of eukaryotic genomes is far more complex than had been previously noted. The idea that the transcriptome is derived exclusively from protein-coding genes and some specific non-coding RNAs—such as snRNAs, snoRNAs, tRNAs or rRNAs—has been swept away by numerous studies indicating that RNA polymerase II can be found at almost any genomic location. Pervasive transcription is widespread and, far from being a futile process, has a crucial role in controlling gene expression and genomic plasticity. Here, we review recent findings that point to cryptic transcription as a fundamental component of the regulation of eukaryotic genomes. PMID:19680288

  18. Regulation of basophil and mast cell development by transcription factors.

    PubMed

    Sasaki, Haruka; Kurotaki, Daisuke; Tamura, Tomohiko

    2016-04-01

    Basophils and mast cells play important roles in host defense against parasitic infections and allergic responses. Several progenitor populations, either shared or specific, for basophils and/or mast cells have been identified, thus elucidating the developmental pathways of these cells. Multiple transcription factors essential for their development and the relationships between them have been also revealed. For example, IRF8 induces GATA2 expression to promote the generation of both basophils and mast cells. The STAT5-GATA2 axis induces C/EBPα and MITF expression, facilitating the differentiation into basophils and mast cells, respectively. In addition, C/EBPα and MITF mutually suppress each other's expression. This review provides an overview of recent advances in our understanding of how transcription factors regulate the development of basophils and mast cells.

  19. Transcriptional regulation of bone and joint remodeling by NFAT

    PubMed Central

    Sitara, Despina; Aliprantis, Antonios O.

    2010-01-01

    Summary Osteoporosis and arthritis are highly prevalent diseases and a significant cause of morbidity and mortality worldwide. These diseases result from aberrant tissue remodeling leading to weak, fracture-prone bones or painful, dysfunctional joints. The nuclear factor of activated T cells (NFAT) transcription factor family controls diverse biologic processes in vertebrates. Here, we review the scientific evidence that links NFAT-regulated gene transcription to bone and joint pathology. A particular emphasis is placed on the role of NFATs in bone resorption and formation by osteoclasts and osteoblasts, respectively. In addition, emerging data that connect NFATs with cartilage biology, angiogenesis, nociception, and neurogenic inflammation are explored. The goal of this article is to highlight the importance of tissue remodeling in musculoskeletal disease and situate NFAT-driven cellular responses within this context to inspire future research endeavors. PMID:20193006

  20. Transcriptional regulation of decreased protein synthesis during skeletal muscle unloading

    NASA Technical Reports Server (NTRS)

    Howard, G.; Steffen, J. M.; Geoghegan, T. E.

    1989-01-01

    The regulatory role of transcriptional alterations in unloaded skeletal muscles was investigated by determining levels of total muscle RNA and mRNA fractions in soleus, gastrocnemius, and extensor digitorum longus (EDL) of rats subjected to whole-body suspension for up to 7 days. After 7 days, total RNA and mRNA contents were lower in soleus and gastrocnemius, compared with controls, but the concentrations of both RNAs per g muscle were unaltered. Alpha-actin mRNA (assessed by dot hybridization) was significantly reduced in soleus after 1, 3, and 7 days of suspension and in gastrocnemius after 3 and 7 days, but was unchanged in EDL. Protein synthesis directed by RNA extracted from soleus and EDL indicated marked alteration in mRNAs coding for several small proteins. Results suggest that altered transcription and availability of specific mRNAs contribute significantly to the regulation of protein synthesis during skeletal muscle unloading.

  1. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation

    PubMed Central

    Cavazza, Alessia; Miccio, Annarita; Romano, Oriana; Petiti, Luca; Malagoli Tagliazucchi, Guidantonio; Peano, Clelia; Severgnini, Marco; Rizzi, Ermanno; De Bellis, Gianluca; Bicciato, Silvio; Mavilio, Fulvio

    2016-01-01

    Summary Human skin is maintained by the differentiation and maturation of interfollicular stem and progenitors cells. We used DeepCAGE, genome-wide profiling of histone modifications and retroviral integration analysis, to map transcripts, promoters, enhancers, and super-enhancers (SEs) in prospectively isolated keratinocytes and transit-amplifying progenitors, and retrospectively defined keratinocyte stem cells. We show that >95% of the active promoters are in common and differentially regulated in progenitors and differentiated keratinocytes, while approximately half of the enhancers and SEs are stage specific and account for most of the epigenetic changes occurring during differentiation. Transcription factor (TF) motif identification and correlation with TF binding site maps allowed the identification of TF circuitries acting on enhancers and SEs during differentiation. Overall, our study provides a broad, genome-wide description of chromatin dynamics and differential enhancer and promoter usage during epithelial differentiation, and describes a novel approach to identify active regulatory elements in rare stem cell populations. PMID:27050947

  2. Transcription factors regulating B cell fate in the germinal centre.

    PubMed

    Recaldin, T; Fear, D J

    2016-01-01

    Diversification of the antibody repertoire is essential for the normal operation of the vertebrate adaptive immune system. Following antigen encounter, B cells are activated, proliferate rapidly and undergo two diversification events; somatic hypermutation (followed by selection), which enhances the affinity of the antibody for its cognate antigen, and class-switch recombination, which alters the effector functions of the antibody to adapt the response to the challenge faced. B cells must then differentiate into antibody-secreting plasma cells or long-lived memory B cells. These activities take place in specialized immunological environments called germinal centres, usually located in the secondary lymphoid organs. To complete the germinal centre activities successfully, a B cell adopts a transcriptional programme that allows it to migrate to specific sites within the germinal centre, proliferate, modify its DNA recombination and repair pathways, alter its apoptotic potential and finally undergo terminal differentiation. To co-ordinate these processes, B cells employ a number of 'master regulator' transcription factors which mediate wholesale transcriptomic changes. These master transcription factors are mutually antagonistic and form a complex regulatory network to maintain distinct gene expression programs. Within this network, multiple points of positive and negative feedback ensure the expression of the 'master regulators', augmented by a number of 'secondary' factors that reinforce these networks and sense the progress of the immune response. In this review we will discuss the different activities B cells must undertake to mount a successful T cell-dependent immune response and describe how a regulatory network of transcription factors controls these processes.

  3. Transcription factor FOXA2-centered transcriptional regulation network in non-small cell lung cancer

    SciTech Connect

    Jang, Sang-Min; An, Joo-Hee; Kim, Chul-Hong; Kim, Jung-Woong Choi, Kyung-Hee

    2015-08-07

    Lung cancer is the leading cause of cancer-mediated death. Although various therapeutic approaches are used for lung cancer treatment, these mainly target the tumor suppressor p53 transcription factor, which is involved in apoptosis and cell cycle arrest. However, p53-targeted therapies have limited application in lung cancer, since p53 is found to be mutated in more than half of lung cancers. In this study, we propose tumor suppressor FOXA2 as an alternative target protein for therapies against lung cancer and reveal a possible FOXA2-centered transcriptional regulation network by identifying new target genes and binding partners of FOXA2 by using various screening techniques. The genes encoding Glu/Asp-rich carboxy-terminal domain 2 (CITED2), nuclear receptor subfamily 0, group B, member 2 (NR0B2), cell adhesion molecule 1 (CADM1) and BCL2-associated X protein (BAX) were identified as putative target genes of FOXA2. Additionally, the proteins including highly similar to heat shock protein HSP 90-beta (HSP90A), heat shock 70 kDa protein 1A variant (HSPA1A), histone deacetylase 1 (HDAC1) and HDAC3 were identified as novel interacting partners of FOXA2. Moreover, we showed that FOXA2-dependent promoter activation of BAX and p21 genes is significantly reduced via physical interactions between the identified binding partners and FOXA2. These results provide opportunities to understand the FOXA2-centered transcriptional regulation network and novel therapeutic targets to modulate this network in p53-deficient lung cancer. - Highlights: • Identification of new target genes of FOXA2. • Identifications of novel interaction proteins of FOXA2. • Construction of FOXA2-centered transcriptional regulatory network in non-small cell lung cancer.

  4. The transcriptional regulation of the human CYP2C genes

    PubMed Central

    Chen, Yuping; Goldstein, Joyce A.

    2010-01-01

    In humans, four members of the CYP2C subfamily (CYP2C8, CYP2C9, CYP2C18, and CYP2C19) metabolize more than 20% of all therapeutic drugs as well as a number of endogenous compounds. The CYP2C enzymes are found predominantly in the liver, where they comprise ∼20% of the total cytochrome P450. A variety of xenobiotics such as phenobarbital, rifampicin, and hyperforin have been shown to induce the transcriptional expression of CYP2C genes in primary human hepatocytes and to increase the metabolism of CYP2C substrates in vivo in man. This induction can result in drug-drug interactions, drug tolerance, and therapeutic failure. Several drug-activated nuclear receptors including CAR, PXR, VDR, and GR recognize drug responsive elements within the 5′ flanking promoter region of CYP2C genes to mediate the transcriptional upregulation of these genes in response to xenobiotics and steroids. Other nuclear receptors and transcriptional factors including HNF4α, HNF3γ, C/EBPα and more recently RORs, have been reported to regulate the constitutive expression of CYP2C genes in liver. The maximum transcriptional induction of CYP2C genes appears to be achieved through a coordinative cross-talk between drug responsive nuclear receptors, hepatic factors, and coactivators. The transcriptional regulatory mechanisms of the expression of CYP2C genes in extrahepatic tissues has received less study, but these may be altered by perturbations from pathological conditions such as ischemia as well as some of the receptors mentioned above. PMID:19702536

  5. Role of CTCF Protein in Regulating FMR1 Locus Transcription

    PubMed Central

    Lanni, Stella; Goracci, Martina; Borrelli, Loredana; Mancano, Giorgia; Chiurazzi, Pietro; Moscato, Umberto; Ferrè, Fabrizio; Helmer-Citterich, Manuela; Tabolacci, Elisabetta; Neri, Giovanni

    2013-01-01

    Fragile X syndrome (FXS), the leading cause of inherited intellectual disability, is caused by epigenetic silencing of the FMR1 gene, through expansion and methylation of a CGG triplet repeat (methylated full mutation). An antisense transcript (FMR1-AS1), starting from both promoter and intron 2 of the FMR1 gene, was demonstrated in transcriptionally active alleles, but not in silent FXS alleles. Moreover, a DNA methylation boundary, which is lost in FXS, was recently identified upstream of the FMR1 gene. Several nuclear proteins bind to this region, like the insulator protein CTCF. Here we demonstrate for the first time that rare unmethylated full mutation (UFM) alleles present the same boundary described in wild type (WT) alleles and that CTCF binds to this region, as well as to the FMR1 gene promoter, exon 1 and intron 2 binding sites. Contrariwise, DNA methylation prevents CTCF binding to FXS alleles. Drug-induced CpGs demethylation does not restore this binding. CTCF knock-down experiments clearly established that CTCF does not act as insulator at the active FMR1 locus, despite the presence of a CGG expansion. CTCF depletion induces heterochromatinic histone configuration of the FMR1 locus and results in reduction of FMR1 transcription, which however is not accompanied by spreading of DNA methylation towards the FMR1 promoter. CTCF depletion is also associated with FMR1-AS1 mRNA reduction. Antisense RNA, like sense transcript, is upregulated in UFM and absent in FXS cells and its splicing is correlated to that of the FMR1-mRNA. We conclude that CTCF has a complex role in regulating FMR1 expression, probably through the organization of chromatin loops between sense/antisense transcriptional regulatory regions, as suggested by bioinformatics analysis. PMID:23874213

  6. Role of CTCF protein in regulating FMR1 locus transcription.

    PubMed

    Lanni, Stella; Goracci, Martina; Borrelli, Loredana; Mancano, Giorgia; Chiurazzi, Pietro; Moscato, Umberto; Ferrè, Fabrizio; Helmer-Citterich, Manuela; Tabolacci, Elisabetta; Neri, Giovanni

    2013-01-01

    Fragile X syndrome (FXS), the leading cause of inherited intellectual disability, is caused by epigenetic silencing of the FMR1 gene, through expansion and methylation of a CGG triplet repeat (methylated full mutation). An antisense transcript (FMR1-AS1), starting from both promoter and intron 2 of the FMR1 gene, was demonstrated in transcriptionally active alleles, but not in silent FXS alleles. Moreover, a DNA methylation boundary, which is lost in FXS, was recently identified upstream of the FMR1 gene. Several nuclear proteins bind to this region, like the insulator protein CTCF. Here we demonstrate for the first time that rare unmethylated full mutation (UFM) alleles present the same boundary described in wild type (WT) alleles and that CTCF binds to this region, as well as to the FMR1 gene promoter, exon 1 and intron 2 binding sites. Contrariwise, DNA methylation prevents CTCF binding to FXS alleles. Drug-induced CpGs demethylation does not restore this binding. CTCF knock-down experiments clearly established that CTCF does not act as insulator at the active FMR1 locus, despite the presence of a CGG expansion. CTCF depletion induces heterochromatinic histone configuration of the FMR1 locus and results in reduction of FMR1 transcription, which however is not accompanied by spreading of DNA methylation towards the FMR1 promoter. CTCF depletion is also associated with FMR1-AS1 mRNA reduction. Antisense RNA, like sense transcript, is upregulated in UFM and absent in FXS cells and its splicing is correlated to that of the FMR1-mRNA. We conclude that CTCF has a complex role in regulating FMR1 expression, probably through the organization of chromatin loops between sense/antisense transcriptional regulatory regions, as suggested by bioinformatics analysis.

  7. Transcriptional regulation of IGF-I expression in skeletal muscle

    NASA Technical Reports Server (NTRS)

    McCall, G. E.; Allen, D. L.; Haddad, F.; Baldwin, K. M.

    2003-01-01

    The present study investigated the role of transcription in the regulation of insulin-like growth factor (IGF)-I expression in skeletal muscle. RT-PCR was used to determine endogenous expression of IGF-I pre-mRNA and mRNA in control (Con) and functionally overloaded (FO) rat plantaris. The transcriptional activities of five different-length IGF-I promoter fragments controlling transcription of a firefly luciferase (FLuc) reporter gene were tested in vitro by transfection of myoblasts or in vivo during FO by direct gene transfer into the plantaris. Increased endogenous IGF-I gene transcription during 7 days of plantaris FO was evidenced by an approximately 140-160% increase (P < 0.0001) in IGF-I pre-mRNA (a transcriptional marker). IGF-I mRNA expression also increased by approximately 90% (P < 0.0001), and it was correlated (R = 0.93; P < 0.0001) with the pre-mRNA increases. The three longest IGF-I exon 1 promoters induced reporter gene expression in proliferating C2C12 and L6E9 myoblasts. In differentiated L6E9 myotubes, promoter activity increased approximately two- to threefold over myoblasts. Overexpression of calcineurin and MyoD increased the activity of the -852/+192 promoter in C2C12 myotubes by approximately 5- and approximately 18-fold, respectively. However, FO did not induce these exogenous promoter fragments. Nevertheless, the present findings are consistent with the hypothesis that the IGF-I gene is transcriptionally regulated during muscle hypertrophy in vivo as evidenced by the induction of the endogenous IGF-I pre-mRNA during plantaris FO. The exon 1 promoter region of the IGF-I gene is sufficient to direct inducible expression in vitro; however, an in vivo response to FO may require elements outside the -852/+346 region of the exon 1 IGF-I promoter or features inherent to the endogenous IGF-I gene.

  8. Post-transcriptional RNA Regulons Affecting Cell Cycle and Proliferation

    PubMed Central

    Blackinton, Jeff G.

    2014-01-01

    The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

  9. Land use type significantly affects microbial gene transcription in soil.

    PubMed

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

  10. High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

    PubMed Central

    Sidarovich, Viktoryia; Adami, Valentina; Quattrone, Alessandro

    2015-01-01

    Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3' untranslated region (3’ UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3’ UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3’ UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3’ UTR. PMID:25867708

  11. Transcriptional networks that regulate muscle stem cell function.

    PubMed

    Punch, Vincent G; Jones, Andrew E; Rudnicki, Michael A

    2009-01-01

    Muscle stem cells comprise different populations of stem and progenitor cells found in embryonic and adult tissues. A number of signaling and transcriptional networks are responsible for specification and survival of these cell populations and regulation of their behavior during growth and regeneration. Muscle progenitor cells are mostly derived from the somites of developing embryos, while satellite cells are the progenitor cells responsible for the majority of postnatal growth and adult muscle regeneration. In resting muscle, these stem cells are quiescent, but reenter the cell cycle during their activation, whereby they undergo decisions to self-renew, proliferate, or differentiate and fuse into multinucleated myofibers to repair damaged muscle. Regulation of muscle stem cell activity is under the precise control of a number of extrinsic signaling pathways and active transcriptional networks that dictate their behavior, fate, and regenerative potential. Here, we review the networks responsible for these different aspects of muscle stem cell biology and discuss prevalent parallels between mechanisms regulating the activity of embryonic muscle progenitor cells and adult satellite cells.

  12. Inference of self-regulated transcriptional networks by comparative genomics.

    PubMed

    Cornish, Joseph P; Matthews, Fialelei; Thomas, Julien R; Erill, Ivan

    2012-01-01

    The assumption of basic properties, like self-regulation, in simple transcriptional regulatory networks can be exploited to infer regulatory motifs from the growing amounts of genomic and meta-genomic data. These motifs can in principle be used to elucidate the nature and scope of transcriptional networks through comparative genomics. Here we assess the feasibility of this approach using the SOS regulatory network of Gram-positive bacteria as a test case. Using experimentally validated data, we show that the known regulatory motif can be inferred through the assumption of self-regulation. Furthermore, the inferred motif provides a more robust search pattern for comparative genomics than the experimental motifs defined in reference organisms. We take advantage of this robustness to generate a functional map of the SOS response in Gram-positive bacteria. Our results reveal definite differences in the composition of the LexA regulon between Firmicutes and Actinobacteria, and confirm that regulation of cell-division inhibition is a widespread characteristic of this network among Gram-positive bacteria.

  13. Structural basis for the transcriptional regulation of membrane lipid homeostasis

    SciTech Connect

    Miller, Darcie J.; Zhang, Yong-Mei; Subramanian, Chitra; Rock, Charles O.; White, Stephen W.

    2010-11-09

    DesT is a transcriptional repressor that regulates the genes that control the unsaturated:saturated fatty acid ratio available for membrane lipid synthesis. DesT bound to unsaturated acyl-CoA has a high affinity for its cognate palindromic DNA-binding site, whereas DesT bound to saturated acyl-CoA does not bind this site. Structural analyses of the DesT-oleoyl-CoA-DNA and DesT-palmitoyl-CoA complexes reveal that acyl chain shape directly influences the packing of hydrophobic core residues within the DesT ligand-binding domain. These changes are propagated to the paired DNA-binding domains via conformational changes to modulate DNA binding. These structural interpretations are supported by the in vitro and in vivo characterization of site-directed mutants. The regulation of DesT by the unsaturated:saturated ratio of acyl chains rather than the concentration of a single ligand is a paradigm for understanding transcriptional regulation of membrane lipid homeostasis.

  14. The MYB107 Transcription Factor Positively Regulates Suberin Biosynthesis

    SciTech Connect

    Gou, Mingyue; Hou, Guichuan; Yang, Huijun; Zhang, Xuebin; Cai, Yuanheng; Kai, Guoyin; Liu, Chang-Jun

    2016-12-13

    Suberin, a lipophilic polymer deposited in the outer integument of the Arabidopsis (Arabidopsis thaliana) seed coat, represents an essential sealing component controlling water and solute movement and protecting seed from pathogenic infection. Although many genes responsible for suberin synthesis are identified, the regulatory components controlling its biosynthesis have not been definitively determined. Here, we show that the Arabidopsis MYB107 transcription factor acts as a positive regulator controlling suberin biosynthetic gene expression in the seed coat. MYB107 coexpresses with suberin biosynthetic genes in a temporal manner during seed development. Disrupting MYB107 particularly suppresses the expression of genes involved in suberin but not cutin biosynthesis, lowers seed coat suberin accumulation, alters suberin lamellar structure, and consequently renders higher seed coat permeability and susceptibility to abiotic stresses. Furthermore, MYB107 directly binds to the promoters of suberin biosynthetic genes, verifying its primary role in regulating their expression. Identifying MYB107 as a positive regulator for seed coat suberin synthesis offers a basis for discovering the potential transcriptional network behind one of the most abundant lipid-based polymers in nature.

  15. Transcription factor TBX4 regulates myofibroblast accumulation and lung fibrosis

    PubMed Central

    Xie, Ting; Liang, Jiurong; Liu, Ningshan; Huan, Caijuan; Zhang, Yanli; Liu, Weijia; Kumar, Maya; Xiao, Rui; D’Armiento, Jeanine; Metzger, Daniel; Chambon, Pierre; Papaioannou, Virginia E.; Stripp, Barry R.; Jiang, Dianhua

    2016-01-01

    Progressive tissue fibrosis is a major cause of the morbidity and mortality associated with repeated epithelial injuries and accumulation of myofibroblasts. Successful treatment options are limited by an incomplete understanding of the molecular mechanisms that regulate myofibroblast accumulation. Here, we employed in vivo lineage tracing and real-time gene expression transgenic reporting methods to analyze the early embryonic transcription factor T-box gene 4 (TBX4), and determined that TBX4-lineage mesenchymal progenitors are the predominant source of myofibroblasts in injured adult lung. In a murine model, ablation of TBX4-expressing cells or disruption of TBX4 signaling attenuated lung fibrosis after bleomycin-induced injury. Furthermore, TBX4 regulated hyaluronan synthase 2 production to enable fibroblast invasion of matrix both in murine models and in fibroblasts from patients with severe pulmonary fibrosis. These data identify TBX4 as a mesenchymal transcription factor that drives accumulation of myofibroblasts and the development of lung fibrosis. Targeting TBX4 and downstream factors that regulate fibroblast invasiveness could lead to therapeutic approaches in lung fibrosis. PMID:27400124

  16. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    SciTech Connect

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.

    2014-11-20

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.

  17. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    DOE PAGES

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; ...

    2014-11-20

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less

  18. The MYB107 Transcription Factor Positively Regulates Suberin Biosynthesis

    DOE PAGES

    Gou, Mingyue; Hou, Guichuan; Yang, Huijun; ...

    2016-12-13

    Suberin, a lipophilic polymer deposited in the outer integument of the Arabidopsis (Arabidopsis thaliana) seed coat, represents an essential sealing component controlling water and solute movement and protecting seed from pathogenic infection. Although many genes responsible for suberin synthesis are identified, the regulatory components controlling its biosynthesis have not been definitively determined. Here, we show that the Arabidopsis MYB107 transcription factor acts as a positive regulator controlling suberin biosynthetic gene expression in the seed coat. MYB107 coexpresses with suberin biosynthetic genes in a temporal manner during seed development. Disrupting MYB107 particularly suppresses the expression of genes involved in suberin butmore » not cutin biosynthesis, lowers seed coat suberin accumulation, alters suberin lamellar structure, and consequently renders higher seed coat permeability and susceptibility to abiotic stresses. Furthermore, MYB107 directly binds to the promoters of suberin biosynthetic genes, verifying its primary role in regulating their expression. Identifying MYB107 as a positive regulator for seed coat suberin synthesis offers a basis for discovering the potential transcriptional network behind one of the most abundant lipid-based polymers in nature.« less

  19. Transcriptional and post-translational regulation of pannexins.

    PubMed

    Boyce, Andrew K J; Epp, Anna L; Nagarajan, Archana; Swayne, Leigh Anne

    2017-03-07

    Pannexins are a 3-membered family of proteins that form large pore ion and metabolite channels in vertebrates. The impact of pannexins on vertebrate biology is intricately tied to where and when they are expressed, and how they are modified, once produced. The purpose of this review is therefore to outline our current understanding of transcriptional and post-translational regulation of pannexins. First, we briefly summarize their discovery and characteristics. Next, we describe several aspects of transcriptional regulation, including cell and tissue-specific expression, dynamic expression over development and disease, as well as new insights into the underlying molecular machinery involved. Following this, we delve into the role of post-translational modifications in the regulation of trafficking and channel properties, highlighting important work on glycosylation, phosphorylation, S-nitrosylation and proteolytic cleavage. Embedded throughout, we also highlight important knowledge gaps and avenues of future research. This article is part of a Special Issue entitled: Gap Junction Proteins edited by Jean Claude Herve.

  20. Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM

    SciTech Connect

    Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim

    2014-07-18

    Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations.

  1. Extensive Transcriptional Regulation of Chromatin Modifiers during Human Neurodevelopment

    PubMed Central

    Weng, Matthias K.; Zimmer, Bastian; Pöltl, Dominik; Broeg, Marc P.; Ivanova, Violeta; Gaspar, John A.; Sachinidis, Agapios; Wüllner, Ullrich

    2012-01-01

    Epigenetic changes, including histone modifications or chromatin remodeling are regulated by a large number of human genes. We developed a strategy to study the coordinate regulation of such genes, and to compare different cell populations or tissues. A set of 150 genes, comprising different classes of epigenetic modifiers was compiled. This new tool was used initially to characterize changes during the differentiation of human embryonic stem cells (hESC) to central nervous system neuroectoderm progenitors (NEP). qPCR analysis showed that more than 60% of the examined transcripts were regulated, and >10% of them had a >5-fold increased expression. For comparison, we differentiated hESC to neural crest progenitors (NCP), a distinct peripheral nervous system progenitor population. Some epigenetic modifiers were regulated into the same direction in NEP and NCP, but also distinct differences were observed. For instance, the remodeling ATPase SMARCA2 was up-regulated >30-fold in NCP, while it remained unchanged in NEP; up-regulation of the ATP-dependent chromatin remodeler CHD7 was increased in NEP, while it was down-regulated in NCP. To compare the neural precursor profiles with those of mature neurons, we analyzed the epigenetic modifiers in human cortical tissue. This resulted in the identification of 30 regulations shared between all cell types, such as the histone methyltransferase SETD7. We also identified new markers for post-mitotic neurons, like the arginine methyl transferase PRMT8 and the methyl transferase EZH1. Our findings suggest a hitherto unexpected extent of regulation, and a cell type-dependent specificity of epigenetic modifiers in neurodifferentiation. PMID:22590590

  2. Identifying combinatorial regulation of transcription factors and binding motifs

    PubMed Central

    Kato, Mamoru; Hata, Naoya; Banerjee, Nilanjana; Futcher, Bruce; Zhang, Michael Q

    2004-01-01

    Background Combinatorial interaction of transcription factors (TFs) is important for gene regulation. Although various genomic datasets are relevant to this issue, each dataset provides relatively weak evidence on its own. Developing methods that can integrate different sequence, expression and localization data have become important. Results Here we use a novel method that integrates chromatin immunoprecipitation (ChIP) data with microarray expression data and with combinatorial TF-motif analysis. We systematically identify combinations of transcription factors and of motifs. The various combinations of TFs involved multiple binding mechanisms. We reconstruct a new combinatorial regulatory map of the yeast cell cycle in which cell-cycle regulation can be drawn as a chain of extended TF modules. We find that the pairwise combination of a TF for an early cell-cycle phase and a TF for a later phase is often used to control gene expression at intermediate times. Thus the number of distinct times of gene expression is greater than the number of transcription factors. We also see that some TF modules control branch points (cell-cycle entry and exit), and in the presence of appropriate signals they can allow progress along alternative pathways. Conclusions Combining different data sources can increase statistical power as demonstrated by detecting TF interactions and composite TF-binding motifs. The original picture of a chain of simple cell-cycle regulators can be extended to a chain of composite regulatory modules: different modules may share a common TF component in the same pathway or a TF component cross-talking to other pathways. PMID:15287978

  3. Yap5 Is an Iron-Responsive Transcriptional Activator That Regulates Vacuolar Iron Storage in Yeast▿

    PubMed Central

    Li, Liangtao; Bagley, Dustin; Ward, Diane M.; Kaplan, Jerry

    2008-01-01

    The transporter Ccc1 imports iron into the vacuole, which is the major site of iron storage in fungi and plants. CCC1 mRNA is destabilized under low-iron conditions by the binding of Cth1 and Cth2 to the 3′ untranslated region (S. Puig, E. Askeland, and D. J. Thiele, Cell 120:99-110, 2005). Here, we show that the transcription of CCC1 is stimulated by iron through a Yap consensus site in the CCC1 promoter. We identified YAP5 as being the iron-sensitive transcription factor and show that a yap5Δ strain is sensitive to high iron. Green fluorescent protein-tagged Yap5 is localized to the nucleus and occupies the CCC1 promoter independent of the iron concentration. Yap5 contains two cysteine-rich domains, and the mutation of the cysteines to alanines in each of the domains affects the transcription of CCC1 but not DNA binding. The fusion of the Yap5 cysteine-containing domains to a GAL4 DNA binding domain results in iron-sensitive GAL1-lacZ expression. Iron affects the sulfhydryl status of Yap5, which is indicative of the generation of intramolecular disulfide bonds. These results show that Yap5 is an iron-sensing transcription factor and that iron regulates transcriptional activation. PMID:18070921

  4. Yap5 is an iron-responsive transcriptional activator that regulates vacuolar iron storage in yeast.

    PubMed

    Li, Liangtao; Bagley, Dustin; Ward, Diane M; Kaplan, Jerry

    2008-02-01

    The transporter Ccc1 imports iron into the vacuole, which is the major site of iron storage in fungi and plants. CCC1 mRNA is destabilized under low-iron conditions by the binding of Cth1 and Cth2 to the 3' untranslated region (S. Puig, E. Askeland, and D. J. Thiele, Cell 120:99-110, 2005). Here, we show that the transcription of CCC1 is stimulated by iron through a Yap consensus site in the CCC1 promoter. We identified YAP5 as being the iron-sensitive transcription factor and show that a yap5Delta strain is sensitive to high iron. Green fluorescent protein-tagged Yap5 is localized to the nucleus and occupies the CCC1 promoter independent of the iron concentration. Yap5 contains two cysteine-rich domains, and the mutation of the cysteines to alanines in each of the domains affects the transcription of CCC1 but not DNA binding. The fusion of the Yap5 cysteine-containing domains to a GAL4 DNA binding domain results in iron-sensitive GAL1-lacZ expression. Iron affects the sulfhydryl status of Yap5, which is indicative of the generation of intramolecular disulfide bonds. These results show that Yap5 is an iron-sensing transcription factor and that iron regulates transcriptional activation.

  5. The cell cycle rallies the transcription cycle: Cdc28/Cdk1 is a cell cycle-regulated transcriptional CDK.

    PubMed

    Chymkowitch, Pierre; Enserink, Jorrit M

    2013-01-01

    In the budding yeast Saccharomyces cerevisiae, the cyclin-dependent kinases (CDKs) Kin28, Bur1 and Ctk1 regulate basal transcription by phosphorylating the carboxyl-terminal domain (CTD) of RNA polymerase II. However, very little is known about the involvement of the cell cycle CDK Cdc28 in the transcription process. We have recently shown that, upon cell cycle entry, Cdc28 kinase activity boosts transcription of a subset of genes by directly stimulating the basal transcription machinery. Here, we discuss the biological significance of this finding and give our view of the kinase-dependent role of Cdc28 in regulation of RNA polymerase II.

  6. Calcium regulates caveolin-1 expression at the transcriptional level

    SciTech Connect

    Yang, Xiao-Yan; Huang, Cheng-Cheng; Kan, Qi-Ming; Li, Yan; Liu, Dan; Zhang, Xue-Cheng; Sato, Toshinori; Yamagata, Sadako; Yamagata, Tatsuya

    2012-09-28

    Highlights: Black-Right-Pointing-Pointer Caveolin-1 expression is regulated by calcium signaling at the transcriptional level. Black-Right-Pointing-Pointer An inhibitor of or siRNA to L-type calcium channel suppressed caveolin-1 expression. Black-Right-Pointing-Pointer Cyclosporine A or an NFAT inhibitor markedly reduced caveolin-1 expression. Black-Right-Pointing-Pointer Caveolin-1 regulation by calcium signaling is observed in several mouse cell lines. -- Abstract: Caveolin-1, an indispensable component of caveolae serving as a transformation suppressor protein, is highly expressed in poorly metastatic mouse osteosarcoma FBJ-S1 cells while highly metastatic FBJ-LL cells express low levels of caveolin-1. Calcium concentration is higher in FBJ-S1 cells than in FBJ-LL cells; therefore, we investigated the possibility that calcium signaling positively regulates caveolin-1 in mouse FBJ-S1 cells. When cells were treated with the calcium channel blocker nifedipine, cyclosporin A (a calcineurin inhibitor), or INCA-6 (a nuclear factor of activated T-cells [NFAT] inhibitor), caveolin-1 expression at the mRNA and protein levels decreased. RNA silencing of voltage-dependent L-type calcium channel subunit alpha-1C resulted in suppression of caveolin-1 expression. This novel caveolin-1 regulation pathway was also identified in mouse NIH 3T3 cells and Lewis lung carcinoma cells. These results indicate that caveolin-1 is positively regulated at the transcriptional level through a novel calcium signaling pathway mediated by L-type calcium channel/Ca{sup 2+}/calcineurin/NFAT.

  7. Transcription by RNA polymerase III: insights into mechanism and regulation

    PubMed Central

    Turowski, Tomasz W.; Tollervey, David

    2016-01-01

    The highly abundant, small stable RNAs that are synthesized by RNA polymerase III (RNAPIII) have key functional roles, particularly in the protein synthesis apparatus. Their expression is metabolically demanding, and is therefore coupled to changing demands for protein synthesis during cell growth and division. Here, we review the regulatory mechanisms that control the levels of RNAPIII transcripts and discuss their potential physiological relevance. Recent analyses have revealed differential regulation of tRNA expression at all steps on its biogenesis, with significant deregulation of mature tRNAs in cancer cells. PMID:27911719

  8. Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator

    PubMed Central

    Vassart, Amelia; Wolferen, Marleen; Orell, Alvaro; Hong, Ye; Peeters, Eveline; Albers, Sonja-Verena; Charlier, Daniel

    2013-01-01

    Sa-Lrp is a member of the leucine-responsive regulatory protein (Lrp)-like family of transcriptional regulators in Sulfolobus acidocaldarius. Previously, we demonstrated the binding of Sa-Lrp to the control region of its own gene in vitro. However, the function and cofactor of Sa-Lrp remained an enigma. In this work, we demonstrate that glutamine is the cofactor of Sa-Lrp by inducing the formation of octamers and increasing the DNA-binding affinity and sequence specificity. In vitro protein-DNA interaction assays indicate that Sa-Lrp binds to promoter regions of genes with a variety of functions including ammonia assimilation, transcriptional control, and UV-induced pili synthesis. DNA binding occurs with a specific affinity for AT-rich binding sites, and the protein induces DNA bending and wrapping upon binding, indicating an architectural role of the regulator. Furthermore, by analyzing an Sa-lrp deletion mutant, we demonstrate that the protein affects transcription of some of the genes of which the promoter region is targeted and that it is an important determinant of the cellular aggregation phenotype. Taking all these results into account, we conclude that Sa-Lrp is a glutamine-responsive global transcriptional regulator with an additional architectural role. PMID:23255531

  9. Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator.

    PubMed

    Vassart, Amelia; Van Wolferen, Marleen; Orell, Alvaro; Hong, Ye; Peeters, Eveline; Albers, Sonja-Verena; Charlier, Daniel

    2013-02-01

    Sa-Lrp is a member of the leucine-responsive regulatory protein (Lrp)-like family of transcriptional regulators in Sulfolobus acidocaldarius. Previously, we demonstrated the binding of Sa-Lrp to the control region of its own gene in vitro. However, the function and cofactor of Sa-Lrp remained an enigma. In this work, we demonstrate that glutamine is the cofactor of Sa-Lrp by inducing the formation of octamers and increasing the DNA-binding affinity and sequence specificity. In vitro protein-DNA interaction assays indicate that Sa-Lrp binds to promoter regions of genes with a variety of functions including ammonia assimilation, transcriptional control, and UV-induced pili synthesis. DNA binding occurs with a specific affinity for AT-rich binding sites, and the protein induces DNA bending and wrapping upon binding, indicating an architectural role of the regulator. Furthermore, by analyzing an Sa-lrp deletion mutant, we demonstrate that the protein affects transcription of some of the genes of which the promoter region is targeted and that it is an important determinant of the cellular aggregation phenotype. Taking all these results into account, we conclude that Sa-Lrp is a glutamine-responsive global transcriptional regulator with an additional architectural role.

  10. Extensive Regulation of Diurnal Transcription and Metabolism by Glucocorticoids

    PubMed Central

    Schink, Andrea; Gobet, Cédric; Keime, Céline; Poschet, Gernot; Jost, Bernard; Dickmeis, Thomas

    2016-01-01

    Altered daily patterns of hormone action are suspected to contribute to metabolic disease. It is poorly understood how the adrenal glucocorticoid hormones contribute to the coordination of daily global patterns of transcription and metabolism. Here, we examined diurnal metabolite and transcriptome patterns in a zebrafish glucocorticoid deficiency model by RNA-Seq, NMR spectroscopy and liquid chromatography-based methods. We observed dysregulation of metabolic pathways including glutaminolysis, the citrate and urea cycles and glyoxylate detoxification. Constant, non-rhythmic glucocorticoid treatment rescued many of these changes, with some notable exceptions among the amino acid related pathways. Surprisingly, the non-rhythmic glucocorticoid treatment rescued almost half of the entire dysregulated diurnal transcriptome patterns. A combination of E-box and glucocorticoid response elements is enriched in the rescued genes. This simple enhancer element combination is sufficient to drive rhythmic circadian reporter gene expression under non-rhythmic glucocorticoid exposure, revealing a permissive function for the hormones in glucocorticoid-dependent circadian transcription. Our work highlights metabolic pathways potentially contributing to morbidity in patients with glucocorticoid deficiency, even under glucocorticoid replacement therapy. Moreover, we provide mechanistic insight into the interaction between the circadian clock and glucocorticoids in the transcriptional regulation of metabolism. PMID:27941970

  11. Genomic Perspectives of Transcriptional Regulation in Forebrain Development

    PubMed Central

    Nord, Alex S.; Pattabiraman, Kartik; Visel, Axel; Rubenstein, John L. R.

    2015-01-01

    The forebrain is the seat of higher order brain functions, and many human neuropsychiatric disorders are due to genetic defects affecting forebrain development, making it imperative to understand the underlying genetic circuitry. Recent progress now makes it possible to begin fully elucidating the genomic regulatory mechanisms that control forebrain gene expression. Herein, we discuss the current knowledge of how transcription factors drive gene expression programs through their interactions with cis-acting genomic elements, such as enhancers; how analyses of chromatin and DNA modifications provide insights into gene expression states; and how these approaches yield insights into the evolution of the human brain. PMID:25569346

  12. Dynamic regulation of transcription factors by nucleosome remodeling.

    PubMed

    Li, Ming; Hada, Arjan; Sen, Payel; Olufemi, Lola; Hall, Michael A; Smith, Benjamin Y; Forth, Scott; McKnight, Jeffrey N; Patel, Ashok; Bowman, Gregory D; Bartholomew, Blaine; Wang, Michelle D

    2015-06-05

    The chromatin landscape and promoter architecture are dominated by the interplay of nucleosome and transcription factor (TF) binding to crucial DNA sequence elements. However, it remains unclear whether nucleosomes mobilized by chromatin remodelers can influence TFs that are already present on the DNA template. In this study, we investigated the interplay between nucleosome remodeling, by either yeast ISW1a or SWI/SNF, and a bound TF. We found that a TF serves as a major barrier to ISW1a remodeling, and acts as a boundary for nucleosome repositioning. In contrast, SWI/SNF was able to slide a nucleosome past a TF, with concurrent eviction of the TF from the DNA, and the TF did not significantly impact the nucleosome positioning. Our results provide direct evidence for a novel mechanism for both nucleosome positioning regulation by bound TFs and TF regulation via dynamic repositioning of nucleosomes.

  13. Zinc triggers a complex transcriptional and post-transcriptional regulation of the metal homeostasis gene FRD3 in Arabidopsis relatives

    PubMed Central

    Charlier, Jean-Benoit; Polese, Catherine; Nouet, Cécile; Carnol, Monique; Bosman, Bernard; Krämer, Ute; Motte, Patrick; Hanikenne, Marc

    2015-01-01

    In Arabidopsis thaliana, FRD3 (FERRIC CHELATE REDUCTASE DEFECTIVE 3) plays a central role in metal homeostasis. FRD3 is among a set of metal homeostasis genes that are constitutively highly expressed in roots and shoots of Arabidopsis halleri, a zinc hyperaccumulating and hypertolerant species. Here, we examined the regulation of FRD3 by zinc in both species to shed light on the evolutionary processes underlying the evolution of hyperaccumulation in A. halleri. We combined gene expression studies with the use of β-glucuronidase and green fluorescent protein reporter constructs to compare the expression profile and transcriptional and post-transcriptional regulation of FRD3 in both species. The AtFRD3 and AhFRD3 genes displayed a conserved expression profile. In A. thaliana, alternative transcription initiation sites from two promoters determined transcript variants that were differentially regulated by zinc supply in roots and shoots to favour the most highly translated variant under zinc-excess conditions. In A. halleri, a single transcript variant with higher transcript stability and enhanced translation has been maintained. The FRD3 gene thus undergoes complex transcriptional and post-transcriptional regulation in Arabidopsis relatives. Our study reveals that a diverse set of mechanisms underlie increased gene dosage in the A. halleri lineage and illustrates how an environmental challenge can alter gene regulation. PMID:25900619

  14. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development.

    PubMed

    Liu, Xiao; Guo, Ling-Xia; Jin, Long-Fei; Liu, Yong-Zhong; Liu, Tao; Fan, Yu-Hua; Peng, Shu-Ang

    2016-10-01

    Growth-regulating factor (GRF) is an important protein in GA-mediated response, with key roles in plant growth and development. However, it is not known whether or how the GRF proteins in citrus to regulate organ size. In this study, nine citrus GRF genes (CsGRF1-9) were validated from the 'Anliu' sweet orange (AL, Citrus sinensis cv. Anliu) by PCR amplification. They all contain two conserved motifs (QLQ and WRC) and have 3-4 exons. The transcript levels of genes were detected by qRT-PCR. Transcript analysis showed that (1) CsGRF 1, 2, 5, 6, 7, and 9 expressed predominantly in young leaf, CsGRF 3 and 4 expressed predominantly in fruit immature juice sacs and CsGRF 8 expressed predominantly in root; (2) all citrus GRF genes had significantly higher expression in young leaves than mature leaf; (3) in juice sacs, the transcript levels of CsGRF1, 4, 5, 6, and 8 increased significantly while the transcript levels of CsGRF2, 3, 7, and 9 had no significant change from 80 DAF to 100 DAF. Besides, GA3 treatment did not affect the transcript levels of CsGRF5 and CsGRF6 but significantly increased the transcript levels of the other seven CsGRF genes in young leaves. These results suggested that all CsGRF genes involve in the leaf development, CsGRF1, 4, 5, 6, and 8 act developmentally whilst CsGRF2, 3, 7, and 9 play fundamental roles in fruit cell enlargement, which may be through GA pathway or GA-independent pathway.

  15. Molecular basis of RNA polymerase promoter specificity switch revealed through studies of Thermus bacteriophage transcription regulator

    PubMed Central

    Severinov, Konstantin; Minakhin, Leonid; Sekine, Shun-ichi; Lopatina, Anna; Yokoyama, Shigeyuki

    2014-01-01

    Transcription initiation is the central point of gene expression regulation. Understanding of molecular mechanism of transcription regulation requires, ultimately, the structural understanding of consequences of transcription factors binding to DNA-dependent RNA polymerase (RNAP), the enzyme of transcription. We recently determined a structure of a complex between transcription factor gp39 encoded by a Thermus bacteriophage and Thermus RNAP holoenzyme. In this addendum to the original publication, we highlight structural insights that explain the ability of gp39 to act as an RNAP specificity switch which inhibits transcription initiation from a major class of bacterial promoters, while allowing transcription from a minor promoter class to continue. PMID:25105059

  16. A pseudogene long noncoding RNA network regulates PTEN transcription and translation in human cells

    PubMed Central

    Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V.

    2013-01-01

    PTEN is a tumor suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1 encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, alpha and beta. The alpha isoform functions in trans, localizes to the PTEN promoter, and epigenetically modulates PTEN transcription by the recruitment of DNMT3a and EZH2. In contrast, the beta isoform interacts with PTENpg1 through an RNA:RNA pairing interaction, which affects PTEN protein output via changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell cycle arrest and sensitizes cells to doxorubicin, suggesting a biological function for the respective PTENpg1 expressed asRNAs. PMID:23435381

  17. Glutamine Metabolism Regulates the Pluripotency Transcription Factor OCT4

    PubMed Central

    Marsboom, Glenn; Zhang, Guo-Fang; Pohl-Avila, Nicole; Zhang, Yanmin; Yuan, Yang; Kang, Hojin; Hao, Bo; Brunengraber, Henri; Malik, Asrar B.; Rehman, Jalees

    2016-01-01

    SUMMARY The molecular mechanisms underlying the regulation of pluripotency by cellular metabolism in human embryonic stem cells (hESCs) are not fully understood. We found that high levels of glutamine metabolism are essential to prevent degradation of OCT4, a key transcription factor regulating hESC pluripotency. Glutamine withdrawal depletes the endogenous anti-oxidant glutathione, which results in the oxidation of OCT4 cysteine residues required for its DNA binding and enhanced OCT4 degradation. The emergence of the OCT4lo cell population following glutamine withdrawal did not result in greater propensity for cell death. Instead, glutamine withdrawal during vascular differentiation of hESCs generated cells with greater angiogenic capacity, thus indicating that modulating glutamine metabolism enhances the differentiation and functional maturation of cells. These findings demonstrate that the pluripotency transcription factor OCT4 can serve as a metabolic-redox sensor in hESCs and that metabolic cues can act in concert with growth factor signaling to orchestrate stem cell differentiation. PMID:27346346

  18. Fungal Morphology, Iron Homeostasis, and Lipid Metabolism Regulated by a GATA Transcription Factor in Blastomyces dermatitidis

    PubMed Central

    Marty, Amber J.; Broman, Aimee T.; Zarnowski, Robert; Dwyer, Teigan G.; Bond, Laura M.; Lounes-Hadj Sahraoui, Anissa; Fontaine, Joël; Ntambi, James M.; Keleş, Sündüz; Kendziorski, Christina; Gauthier, Gregory M.

    2015-01-01

    In response to temperature, Blastomyces dermatitidis converts between yeast and mold forms. Knowledge of the mechanism(s) underlying this response to temperature remains limited. In B. dermatitidis, we identified a GATA transcription factor, SREB, important for the transition to mold. Null mutants (SREBΔ) fail to fully complete the conversion to mold and cannot properly regulate siderophore biosynthesis. To capture the transcriptional response regulated by SREB early in the phase transition (0–48 hours), gene expression microarrays were used to compare SREB∆ to an isogenic wild type isolate. Analysis of the time course microarray data demonstrated SREB functioned as a transcriptional regulator at 37°C and 22°C. Bioinformatic and biochemical analyses indicated SREB was involved in diverse biological processes including iron homeostasis, biosynthesis of triacylglycerol and ergosterol, and lipid droplet formation. Integration of microarray data, bioinformatics, and chromatin immunoprecipitation identified a subset of genes directly bound and regulated by SREB in vivo in yeast (37°C) and during the phase transition to mold (22°C). This included genes involved with siderophore biosynthesis and uptake, iron homeostasis, and genes unrelated to iron assimilation. Functional analysis suggested that lipid droplets were actively metabolized during the phase transition and lipid metabolism may contribute to filamentous growth at 22°C. Chromatin immunoprecipitation, RNA interference, and overexpression analyses suggested that SREB was in a negative regulatory circuit with the bZIP transcription factor encoded by HAPX. Both SREB and HAPX affected morphogenesis at 22°C; however, large changes in transcript abundance by gene deletion for SREB or strong overexpression for HAPX were required to alter the phase transition. PMID:26114571

  19. RBFOX1 regulates both splicing and transcriptional networks in human neuronal development

    PubMed Central

    Fogel, Brent L.; Wexler, Eric; Wahnich, Amanda; Friedrich, Tara; Vijayendran, Chandran; Gao, Fuying; Parikshak, Neelroop; Konopka, Genevieve; Geschwind, Daniel H.

    2012-01-01

    RNA splicing plays a critical role in the programming of neuronal differentiation and, consequently, normal human neurodevelopment, and its disruption may underlie neurodevelopmental and neuropsychiatric disorders. The RNA-binding protein, fox-1 homolog (RBFOX1; also termed A2BP1 or FOX1), is a neuron-specific splicing factor predicted to regulate neuronal splicing networks clinically implicated in neurodevelopmental disease, including autism spectrum disorder (ASD), but only a few targets have been experimentally identified. We used RNA sequencing to identify the RBFOX1 splicing network at a genome-wide level in primary human neural stem cells during differentiation. We observe that RBFOX1 regulates a wide range of alternative splicing events implicated in neuronal development and maturation, including transcription factors, other splicing factors and synaptic proteins. Downstream alterations in gene expression define an additional transcriptional network regulated by RBFOX1 involved in neurodevelopmental pathways remarkably parallel to those affected by splicing. Several of these differentially expressed genes are further implicated in ASD and related neurodevelopmental diseases. Weighted gene co-expression network analysis demonstrates a high degree of connectivity among these disease-related genes, highlighting RBFOX1 as a key factor coordinating the regulation of both neurodevelopmentally important alternative splicing events and clinically relevant neuronal transcriptional programs in the development of human neurons. PMID:22730494

  20. RFX2 Is a Major Transcriptional Regulator of Spermiogenesis

    PubMed Central

    Kistler, W. Stephen; Baas, Dominique; Lemeille, Sylvain; Paschaki, Marie; Seguin-Estevez, Queralt; Barras, Emmanuèle; Ma, Wenli; Duteyrat, Jean-Luc; Morlé, Laurette

    2015-01-01

    Spermatogenesis consists broadly of three phases: proliferation of diploid germ cells, meiosis, and finally extensive differentiation of the haploid cells into effective delivery vehicles for the paternal genome. Despite detailed characterization of many haploid developmental steps leading to sperm, only fragmentary information exists on the control of gene expression underlying these processes. Here we report that the RFX2 transcription factor is a master regulator of genes required for the haploid phase. A targeted mutation of Rfx2 was created in mice. Rfx2-/- mice are perfectly viable but show complete male sterility. Spermatogenesis appears to progress unperturbed through meiosis. However, haploid cells undergo a complete arrest in spermatid development just prior to spermatid elongation. Arrested cells show altered Golgi apparatus organization, leading to a deficit in the generation of a spreading acrosomal cap from proacrosomal vesicles. Arrested cells ultimately merge to form giant multinucleated cells released to the epididymis. Spermatids also completely fail to form the flagellar axoneme. RNA-Seq analysis and ChIP-Seq analysis identified 139 genes directly controlled by RFX2 during spermiogenesis. Gene ontology analysis revealed that genes required for cilium function are specifically enriched in down- and upregulated genes showing that RFX2 allows precise temporal expression of ciliary genes. Several genes required for cell adhesion and cytoskeleton remodeling are also downregulated. Comparison of RFX2-regulated genes with those controlled by other major transcriptional regulators of spermiogenesis showed that each controls independent gene sets. Altogether, these observations show that RFX2 plays a major and specific function in spermiogenesis. PMID:26162102

  1. Regulation of the malic enzyme gene malE by the transcriptional regulator MalR in Corynebacterium glutamicum.

    PubMed

    Krause, Jens P; Polen, Tino; Youn, Jung-Won; Emer, Denise; Eikmanns, Bernhard J; Wendisch, Volker F

    2012-06-15

    Corynebacterium glutamicum is a Gram-positive nonpathogenic bacterium that is used for the biotechnological production of amino acids. Here, we investigated the transcriptional control of the malE gene encoding malic enzyme (MalE) in C. glutamicum ATCC 13032, which is known to involve the nitrogen regulator AmtR. Gel shift experiments using purified regulators RamA and RamB revealed binding of these regulators to the malE promoter. In DNA-affinity purification experiments a hitherto uncharacterized transcriptional regulator belonging to the MarR family was found to bind to malE promoter DNA and was designated as MalR. C. glutamicum cells overexpressing malR showed reduced MalE activities in LB medium or in minimal media with acetate, glucose, pyruvate or citrate. Deletion of malR positively affected MalE activities during growth in LB medium and minimal media with pyruvate, glucose or the TCA cycle dicarboxylates l-malate, succinate and fumarate. Transcriptional fusion analysis revealed elevated malE promoter activity in the malR deletion mutant during growth in pyruvate minimal medium suggesting that MalR acts as a repressor of malE. Purified MalR bound malE promoter DNA in gel shift experiments. Two MalR binding sites were identified in the malE promoter by mutational analysis. Thus, MalR contributes to the complex transcriptional control of malE which also involves RamA, RamB and AmtR.

  2. New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

    PubMed

    Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

    2014-01-01

    The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

  3. The transcriptional regulator Np20 is the zinc uptake regulator in Pseudomonas aeruginosa.

    PubMed

    Ellison, Matthew L; Farrow, John M; Farrow, John Matthew; Parrish, Whitney; Danell, Allison S; Pesci, Everett C

    2013-01-01

    Zinc is essential for all bacteria, but excess amounts of the metal can have toxic effects. To address this, bacteria have developed tightly regulated zinc uptake systems, such as the ZnuABC zinc transporter which is regulated by the Fur-like zinc uptake regulator (Zur). In Pseudomonas aeruginosa, a Zur protein has yet to be identified experimentally, however, sequence alignment revealed that the zinc-responsive transcriptional regulator Np20, encoded by np20 (PA5499), shares high sequence identity with Zur found in other bacteria. In this study, we set out to determine whether Np20 was functioning as Zur in P. aeruginosa. Using RT-PCR, we determined that np20 (hereafter known as zur) formed a polycistronic operon with znuC and znuB. Mutant strains, lacking the putative znuA, znuB, or znuC genes were found to grow poorly in zinc deplete conditions as compared to wild-type strain PAO1. Intracellular zinc concentrations in strain PAO-Zur (Δzur) were found to be higher than those for strain PAO1, further implicating the zur as the zinc uptake regulator. Reporter gene fusions and real time RT-PCR revealed that transcription of znuA was repressed in a zinc-dependent manner in strain PAO1, however zinc-dependent transcriptional repression was alleviated in strain PAO-Zur, suggesting that the P. aeruginosa Zur homolog (ZurPA) directly regulates expression of znuA. Electrophoretic mobility shift assays also revealed that recombinant ZurPA specifically binds to the promoter region of znuA and does not bind in the presence of the zinc chelator N,N',N-tetrakis(2-pyridylmethyl) ethylenediamine (TPEN). Taken together, these data support the notion that Np20 is the P. aeruginosa Zur, which regulates the transcription of the genes encoding the high affinity ZnuABC zinc transport system.

  4. Transcriptional regulation analysis and the potential transcription regulator site in the extended KAP6.1 promoter in sheep.

    PubMed

    Yang, Zu; Cui, Kai; Zhang, Yuanyuan; Deng, Xuemei

    2014-09-01

    The high glycine/tyrosine type II keratin protein 6.1 (KAP6.1) is a member of the keratin-associated protein family, which is restricted to cells in hair follicles and is associated with fiber diameter and fiber curvature in Merino sheep. In this study, we obtained a series of progressive 5'-deletion fragments of the KAP6.1 gene promoter from ovine genomic DNA. The KAP6.1 5'-upstream region was fused to luciferase and transfected into sheep fetal fibroblast cells (sFFCs). We demonstrated that the sequence from -1,523 to -1 bp (taking the A of the initiator methionine ATG as the +1 nt position) gave rise to a higher luciferase activity comparing to the published region from -1,042 to -1 bp. Whereas, decreased transcriptional activity of the KAP6.1 promoter was observed when the sequence extended to -3,699 bp. To identify the DNA elements that are important for transcriptional activity, we performed structural analysis and electrophoretic mobility shift assay (EMSA). Structural analysis of the KAP6.1 promoter showed that transcription factors NF-kappa-B, AP-1, and C/EBP-alpha synergistically activate KAP6.1 promoter, while POU2F1 might function as a strong negative regulator. The EMSA showed that NF-kappa-B element bound to the nuclear protein extracted from sFFCs. We conclude that NF-kappa-B binding site is an enhancer element of KAP6.1 promoter in vitro. The results are potentially useful for elucidating the regulator mechanisms of KAP6.1.

  5. Autoimmune regulator is acetylated by transcription coactivator CBP/p300

    SciTech Connect

    Saare, Mario; Rebane, Ana; Rajashekar, Balaji; Vilo, Jaak; Peterson, Paert

    2012-08-15

    The Autoimmune Regulator (AIRE) is a regulator of transcription in the thymic medulla, where it controls the expression of a large set of peripheral-tissue specific genes. AIRE interacts with the transcriptional coactivator and acetyltransferase CBP and synergistically cooperates with it in transcriptional activation. Here, we aimed to study a possible role of AIRE acetylation in the modulation of its activity. We found that AIRE is acetylated in tissue culture cells and this acetylation is enhanced by overexpression of CBP and the CBP paralog p300. The acetylated lysines were located within nuclear localization signal and SAND domain. AIRE with mutations that mimicked acetylated K243 and K253 in the SAND domain had reduced transactivation activity and accumulated into fewer and larger nuclear bodies, whereas mutations that mimicked the unacetylated lysines were functionally similar to wild-type AIRE. Analogously to CBP, p300 localized to AIRE-containing nuclear bodies, however, the overexpression of p300 did not enhance the transcriptional activation of AIRE-regulated genes. Further studies showed that overexpression of p300 stabilized the AIRE protein. Interestingly, gene expression profiling revealed that AIRE, with mutations mimicking K243/K253 acetylation in SAND, was able to activate gene expression, although the affected genes were different and the activation level was lower from those regulated by wild-type AIRE. Our results suggest that the AIRE acetylation can influence the selection of AIRE activated genes. -- Highlights: Black-Right-Pointing-Pointer AIRE is acetylated by the acetyltransferases p300 and CBP. Black-Right-Pointing-Pointer Acetylation occurs between CARD and SAND domains and within the SAND domain. Black-Right-Pointing-Pointer Acetylation increases the size of AIRE nuclear dots. Black-Right-Pointing-Pointer Acetylation increases AIRE protein stability. Black-Right-Pointing-Pointer AIRE acetylation mimic regulates a different set of AIRE

  6. Post-transcriptional regulation of gene PA5507 controls PQS concentration in Pseudomonas aeruginosa

    PubMed Central

    Tipton, Kyle A.; Coleman, James P.; Pesci, Everett C.

    2015-01-01

    Summary Pseudomonas aeruginosa can sense and respond to a myriad of environmental signals and utilizes a system of small molecules to communicate through intercellular signaling. The small molecule 2-heptyl-3-hydroxy-4-quinolone (Pseudomonas Quinolone Signal [PQS]) is one of these signals and its synthesis is important for virulence. Previously, we identified an RpiR-type transcriptional regulator, QapR, that positively affects PQS production by repressing the qapR operon. An in-frame deletion of this regulator caused P. aeruginosa to produce a greatly reduced concentration of PQS. Here, we report that QapR translation is linked to the downstream gene PA5507. We found that introduction of a premature stop codon within qapR eliminates transcriptional autorepression of the qapR operon as expected but has no effect on PQS concentration. This was investigated with a series of lacZ reporter fusions which showed that translation of QapR must terminate at, or close to, the native qapR stop codon in order for translation of PA5507 to occur. Also, it was shown that truncation of the 5′ end of the qapR transcript permitted PA5507 translation without translation of QapR. Our findings led us to conclude that PA5507 transcription and translation are both tightly controlled by QapR and this control is important for PQS homeostasis. PMID:25662317

  7. The DOF transcription factor OBP1 is involved in cell cycle regulation in Arabidopsis thaliana.

    PubMed

    Skirycz, Aleksandra; Radziejwoski, Amandine; Busch, Wolfgang; Hannah, Matthew A; Czeszejko, Joanna; Kwaśniewski, Mirosław; Zanor, Maria-Inès; Lohmann, Jan U; De Veylder, Lieven; Witt, Isabell; Mueller-Roeber, Bernd

    2008-12-01

    In contrast to animal growth, plant growth is largely post-embryonic. Therefore plants have developed new mechanisms to precisely regulate cell proliferation by means of internal and external stimuli whilst the general core cell cycle machinery is conserved between eukaryotes. In this work we demonstrate a role for the Arabidopsis thaliana DNA-binding-with-one-finger (DOF) transcription factor OBP1 in the control of cell division upon developmental signalling. Inducible overexpression of OBP1 resulted in a significant overrepresentation of cell cycle genes among the upregulated transcripts. Direct targets of OBP1, as verified by chromatin immunoprecipitation, include at least the core cell cycle gene CYCD3;3 and the replication-specific transcription factor gene AtDOF2;3. Consistent with our molecular data, short-term activation of OBP1 in cell cultures affected cell cycle re-entry, shortening the duration of the G(1) phase and the overall length of the cell cycle, whilst constitutive overexpression of OBP1 in plants influenced cell size and cell number, leading to a dwarfish phenotype. Expression during embryogenesis, germination and lateral root initiation suggests an important role for OBP1 in cell cycle re-entry, operating as a transcriptional regulator of key cell cycle genes. Our findings provide significant input into our understanding of how cell cycle activity is incorporated into plant growth and development.

  8. A monoallelic-to-biallelic T-cell transcriptional switch regulates GATA3 abundance

    PubMed Central

    Ku, Chia-Jui; Lim, Kim-Chew; Kalantry, Sundeep; Maillard, Ivan; Engel, James Douglas; Hosoya, Tomonori

    2015-01-01

    Protein abundance must be precisely regulated throughout life, and nowhere is the stringency of this requirement more evident than during T-cell development: A twofold increase in the abundance of transcription factor GATA3 results in thymic lymphoma, while reduced GATA3 leads to diminished T-cell production. GATA3 haploinsufficiency also causes human HDR (hypoparathyroidism, deafness, and renal dysplasia) syndrome, often accompanied by immunodeficiency. Here we show that loss of one Gata3 allele leads to diminished expansion (and compromised development) of immature T cells as well as aberrant induction of myeloid transcription factor PU.1. This effect is at least in part mediated transcriptionally: We discovered that Gata3 is monoallelically expressed in a parent of origin-independent manner in hematopoietic stem cells and early T-cell progenitors. Curiously, half of the developing cells switch to biallelic Gata3 transcription abruptly at midthymopoiesis. We show that the monoallelic-to-biallelic transcriptional switch is stably maintained and therefore is not a stochastic phenomenon. This unique mechanism, if adopted by other regulatory genes, may provide new biological insights into the rather prevalent phenomenon of monoallelic expression of autosomal genes as well as into the variably penetrant pathophysiological spectrum of phenotypes observed in many human syndromes that are due to haploinsufficiency of the affected gene. PMID:26385963

  9. Regulation of transcription factors on sexual dimorphism of fig wasps.

    PubMed

    Sun, Bao-Fa; Li, Yong-Xing; Jia, Ling-Yi; Niu, Li-Hua; Murphy, Robert W; Zhang, Peng; He, Shunmin; Huang, Da-Wei

    2015-06-02

    Fig wasps exhibit extreme intraspecific morphological divergence in the wings, compound eyes, antennae, body color, and size. Corresponding to this, behaviors and lifestyles between two sexes are also different: females can emerge from fig and fly to other fig tree to oviposit and pollinate, while males live inside fig for all their lifetime. Genetic regulation may drive these extreme intraspecific morphological and behavioral divergence. Transcription factors (TFs) involved in morphological development and physiological activity may exhibit sex-specific expressions. Herein, we detect 865 TFs by using genomic and transcriptomic data of the fig wasp Ceratosolen solmsi. Analyses of transcriptomic data indicated that up-regulated TFs in females show significant enrichment in development of the wing, eye and antenna in all stages, from larva to adult. Meanwhile, TFs related to the development of a variety of organs display sex-specific patterns of expression in the adults and these may contribute significantly to their sexual dimorphism. In addition, up-regulated TFs in adult males exhibit enrichment in genitalia development and circadian rhythm, which correspond with mating and protandry. This finding is consistent with their sex-specific behaviors. In conclusion, our results strongly indicate that TFs play important roles in the sexual dimorphism of fig wasps.

  10. The Fli-1 transcription factor regulates the expression of CCL5/RANTES1

    PubMed Central

    Lennard Richard, Mara L.; Sato, Shuzo; Suzuki, Eiji; Williams, Sarah; Nowling, Tamara K.; Zhang, Xian K.

    2014-01-01

    The Fli-1 transcription factor, an Ets family member, is implicated in the pathogenesis of systemic lupus erythematosus (SLE) in human patients and murine models of lupus. Lupus-prone mice with reduced Fli-1 expression have significantly less nephritis, prolonged survival and decreased infiltrating inflammatory cells into the kidney. Inflammatory chemokines, including CCL5, are critical for attracting inflammatory cells. In this study, decreased CCL5 mRNA expression was observed in kidneys of lupus prone NZM2410 mice, with reduced Fli-1 expression. CCL5 protein expression was significantly decreased in endothelial cells transfected with Fli-1 specific siRNA compared to controls. Fli-1 binds to endogenous Ets binding sites in the distal region of the CCL5 promoter. Transient transfection assays demonstrate that Fli-1 drives transcription from the CCL5 promoter in a dose-dependent manner. Both Ets1, another Ets family member, and Fli-1 drive transcription from the CCL5 promoter, although Fli-1 transactivation was significantly stronger. Ets1 acts as a dominant negative transcription factor to Fli-1, indicating that they may have at least one DNA binding site in common. Systematic deletion of DNA binding sites demonstrates the importance of the sites located within a 225bp region of the promoter. Mutation of the Fli-1 DNA binding domain significantly reduces transactivation of the CCL5 promoter by Fli-1. We have identified a novel regulator of transcription for CCL5. These results suggest that Fli-1 is a novel and critical regulator of proinflammatory chemokines and affects the pathogenesis of disease through the regulation of factors that recruit inflammatory cells to sites of inflammation. PMID:25098295

  11. The Fli-1 transcription factor regulates the expression of CCL5/RANTES.

    PubMed

    Lennard Richard, Mara L; Sato, Shuzo; Suzuki, Eiji; Williams, Sarah; Nowling, Tamara K; Zhang, Xian K

    2014-09-15

    The friend leukemia insertion site 1 (Fli-1) transcription factor, an Ets family member, is implicated in the pathogenesis of systemic lupus erythematosus in human patients and murine models of lupus. Lupus-prone mice with reduced Fli-1 expression have significantly less nephritis, prolonged survival, and decreased infiltrating inflammatory cells into the kidney. Inflammatory chemokines, including CCL5, are critical for attracting inflammatory cells. In this study, decreased CCL5 mRNA expression was observed in kidneys of lupus-prone NZM2410 mice with reduced Fli-1 expression. CCL5 protein expression was significantly decreased in endothelial cells transfected with Fli-1-specific small interfering RNA compared with controls. Fli-1 binds to endogenous Ets binding sites in the distal region of the CCL5 promoter. Transient transfection assays demonstrate that Fli-1 drives transcription from the CCL5 promoter in a dose-dependent manner. Both Ets1, another Ets family member, and Fli-1 drive transcription from the CCL5 promoter, although Fli-1 transactivation was significantly stronger. Ets1 acts as a dominant-negative transcription factor for Fli-1, indicating that they may have at least one DNA binding site in common. Systematic deletion of DNA binding sites demonstrates the importance of the sites located within a 225-bp region of the promoter. Mutation of the Fli-1 DNA binding domain significantly reduces transactivation of the CCL5 promoter by Fli-1. We identified a novel regulator of transcription for CCL5. These results suggest that Fli-1 is a novel and critical regulator of proinflammatory chemokines and affects the pathogenesis of disease through the regulation of factors that recruit inflammatory cells to sites of inflammation.

  12. Non-equilibrium thermodynamics analysis of transcriptional regulation kinetics

    NASA Astrophysics Data System (ADS)

    Hernández-Lemus, Enrique; Tovar, Hugo; Mejía, Carmen

    2014-12-01

    Gene expression in eukaryotic cells is an extremely complex and interesting phenomenon whose dynamics are controlled by a large number of subtle physicochemical processes commonly described by means of gene regulatory networks. Such networks consist in a series of coupled chemical reactions, conformational changes, and other biomolecular processes involving the interaction of the DNA molecule itself with a number of proteins usually called transcription factors as well as enzymes and other components. The kinetics behind the functioning of such gene regulatory networks are largely unknown, though its description in terms of non-equilibrium thermodynamics has been discussed recently. In this work we will derive general kinetic equations for a gene regulatory network from a non-equilibrium thermodynamical description and discuss its use in understanding the free energy constrains imposed in the network structure. We also will discuss explicit expressions for the kinetics of a simple model of gene regulation and show that the kinetic role of mRNA decay during the RNA synthesis stage (or transcription) is somehow limited due to the comparatively low values of decay rates. At the level discussed here, this implies a decoupling of the kinetics of mRNA synthesis and degradation a fact that may become quite useful when modeling gene regulatory networks from experimental data on whole genome gene expression.

  13. Coordinated transcriptional regulation patterns associated with infertility phenotypes in men

    PubMed Central

    Ellis, Peter J I; Furlong, Robert A; Conner, Sarah J; Kirkman‐Brown, Jackson; Afnan, Masoud; Barratt, Christopher; Griffin, Darren K; Affara, Nabeel A

    2007-01-01

    Introduction Microarray gene‐expression profiling is a powerful tool for global analysis of the transcriptional consequences of disease phenotypes. Understanding the genetic correlates of particular pathological states is important for more accurate diagnosis and screening of patients, and thus for suggesting appropriate avenues of treatment. As yet, there has been little research describing gene‐expression profiling of infertile and subfertile men, and thus the underlying transcriptional events involved in loss of spermatogenesis remain unclear. Here we present the results of an initial screen of 33 patients with differing spermatogenic phenotypes. Methods Oligonucleotide array expression profiling was performed on testis biopsies for 33 patients presenting for testicular sperm extraction. Significantly regulated genes were selected using a mixed model analysis of variance. Principle components analysis and hierarchical clustering were used to interpret the resulting dataset with reference to the patient history, clinical findings and histological composition of the biopsies. Results Striking patterns of coordinated gene expression were found. The most significant contains multiple germ cell‐specific genes and corresponds to the degree of successful spermatogenesis in each patient, whereas a second pattern corresponds to inflammatory activity within the testis. Smaller‐scale patterns were also observed, relating to unique features of the individual biopsies. PMID:17496197

  14. A Transcriptional Regulator Sll0794 Regulates Tolerance to Biofuel Ethanol in Photosynthetic Synechocystis sp. PCC 6803*

    PubMed Central

    Song, Zhongdi; Chen, Lei; Wang, Jiangxin; Lu, Yinhua; Jiang, Weihong; Zhang, Weiwen

    2014-01-01

    To improve ethanol production directly from CO2 in photosynthetic cyanobacterial systems, one key issue that needs to be addressed is the low ethanol tolerance of cyanobacterial cells. Our previous proteomic and transcriptomic analyses found that several regulatory proteins were up-regulated by exogenous ethanol in Synechocystis sp. PCC6803. In this study, through tolerance analysis of the gene disruption mutants of the up-regulated regulatory genes, we uncovered that one transcriptional regulator, Sll0794, was related directly to ethanol tolerance in Synechocystis. Using a quantitative iTRAQ-LC-MS/MS proteomics approach coupled with quantitative real-time reverse transcription-PCR (RT-qPCR), we further determined the possible regulatory network of Sll0794. The proteomic analysis showed that in the Δsll0794 mutant grown under ethanol stress a total of 54 and 87 unique proteins were down- and up-regulated, respectively. In addition, electrophoretic mobility shift assays demonstrated that the Sll0794 transcriptional regulator was able to bind directly to the upstream regions of sll1514, slr1512, and slr1838, which encode a 16.6 kDa small heat shock protein, a putative sodium-dependent bicarbonate transporter and a carbon dioxide concentrating mechanism protein CcmK, respectively. The study provided a proteomic description of the putative ethanol-tolerance network regulated by the sll0794 gene, and revealed new insights on the ethanol-tolerance regulatory mechanism in Synechocystis. As the first regulatory protein discovered related to ethanol tolerance, the gene may serve as a valuable target for transcription machinery engineering to further improve ethanol tolerance in Synechocystis. All MS data have been deposited in the ProteomeXchange with identifier PXD001266 (http://proteomecentral.proteomexchange.org/dataset/PXD001266). PMID:25239498

  15. Transcriptional and post-transcriptional regulation of histone variant H2A.Z during sea urchin development.

    PubMed

    Hajdu, Mihai; Calle, Jasmine; Puno, Andrea; Haruna, Aminat; Arenas-Mena, César

    2016-12-01

    Histone variant H2A.Z promotes chromatin accessibility at transcriptional regulatory elements and is developmentally regulated in metazoans. We characterize the transcriptional and post-transcriptional regulation of H2A.Z in the purple sea urchin Strongylocentrotus purpuratus. H2A.Z depletion by antisense translation-blocking morpholino oligonucleotides during early development causes developmental collapse, in agreement with its previously demonstrated general role in transcriptional multipotency. During H2A.Z peak expression in 24-h embryos, endogenous H2A.Z 3' UTR sequences stabilize GFP mRNAs relative to those with SV40 3' UTR sequences, although the 3' UTR of H2A.Z does not determine the spatial distribution of H2A.Z transcripts during embryonic and postembryonic development. We elaborated an H2A.Z::GFP BAC reporter that reproduces embryonic H2A.Z expression. Genome-wide chromatin accessibility analysis using ATAC-seq revealed a cis-regulatory module (CRM) that, when deleted, causes a significant decline of the H2A.Z reporter expression. In addition, the mutation of a Sox transcription factor binding site motif and, more strongly, of a Myb motif cause significant decline of reporter gene expression. Our results suggest that an undetermined Myb-family transcription factor controls the transcriptional regulation of H2A.Z.

  16. Post-transcriptional gene regulation by mRNA modifications

    PubMed Central

    Zhao, Boxuan Simen; Roundtree, Ian A.; He, Chuan

    2016-01-01

    The recent discovery of reversible mRNA methylation has opened a new realm of post-transcriptional gene regulation in eukaryotes. The identification and functional characterization of proteins that specifically recognize RNA N6-methyladenosine (m6A) unveiled it as a modification that cells utilize to accelerate mRNA metabolism and translation. N6-adenosine methylation directs mRNAs to distinct fates by grouping them for differential processing, translation and decay in processes such as cell differentiation, embryonic development and stress responses. Other mRNA modifications, including N1-methyladenosine (m1A), 5-methylcytosine (m5C) and pseudouridine, together with m6A form the epitranscriptome and collectively code a new layer of information that controls protein synthesis. PMID:27808276

  17. Calcineurin regulates phosphorylation status of transcription factor osterix.

    PubMed

    Okamura, Hirohiko; Amorim, Bruna Rabelo; Wang, Jie; Yoshida, Kaya; Haneji, Tatsuji

    2009-02-06

    Osterix is an osteoblast-specific transcriptional factor that is essential for osteoblast differentiation and bone formation. Calcineurin regulates bone formation through modulating osteoblast differentiation. However, post-translational modification of osterix such as phosphorylation and interactions between osterix and calcineurin remains unclear. In the present study, we demonstrated that calcineurin interacted with osterix determined by immunoprecipitation assay and Western analysis. Immunocytochemical study also revealed that osterix and calcineurin were co-localized in nucleus. Deletion of calcineurin binding motif on osterix molecule disrupted osterix-calcineurin interaction. Phosphorylation status of osterix was augmented by treatment with phosphatase inhibitors, FK506 and calyculin A. In contrast, treatment of recombinant calcineurin reduced phosphorylation status of osterix. Our present study suggests that calcineurin has an important role in the function of osterix through its modification of phosphorylation.

  18. Disentangling the Many Layers of Eukaryotic Transcriptional Regulation

    PubMed Central

    Lelli, Katherine M.; Slattery, Matthew; Mann, Richard S.

    2015-01-01

    Regulation of gene expression in eukaryotes is an extremely complex process. In this review, we break down several critical steps, emphasizing new data and techniques that have expanded current gene regulatory models. We begin at the level of DNA sequence where cis-regulatory modules (CRMs) provide important regulatory information in the form of transcription factor (TF) binding sites. In this respect, CRMs function as instructional platforms for the assembly of gene regulatory complexes. We discuss multiple mechanisms controlling complex assembly, including cooperative DNA binding, combinatorial codes, and CRM architecture. The second section of this review places CRM assembly in the context of nucleosomes and condensed chromatin. We discuss how DNA accessibility and histone modifications contribute to TF function. Lastly, new advances in chromosomal mapping techniques have provided increased understanding of intra- and interchromosomal interactions. We discuss how these topological maps influence gene regulatory models. PMID:22934649

  19. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  20. Acetylation of histone H3 at lysine 64 regulates nucleosome dynamics and facilitates transcription.

    PubMed

    Di Cerbo, Vincenzo; Mohn, Fabio; Ryan, Daniel P; Montellier, Emilie; Kacem, Salim; Tropberger, Philipp; Kallis, Eleni; Holzner, Monika; Hoerner, Leslie; Feldmann, Angelika; Richter, Florian Martin; Bannister, Andrew J; Mittler, Gerhard; Michaelis, Jens; Khochbin, Saadi; Feil, Robert; Schuebeler, Dirk; Owen-Hughes, Tom; Daujat, Sylvain; Schneider, Robert

    2014-03-25

    Post-translational modifications of proteins have emerged as a major mechanism for regulating gene expression. However, our understanding of how histone modifications directly affect chromatin function remains limited. In this study, we investigate acetylation of histone H3 at lysine 64 (H3K64ac), a previously uncharacterized acetylation on the lateral surface of the histone octamer. We show that H3K64ac regulates nucleosome stability and facilitates nucleosome eviction and hence gene expression in vivo. In line with this, we demonstrate that H3K64ac is enriched in vivo at the transcriptional start sites of active genes and it defines transcriptionally active chromatin. Moreover, we find that the p300 co-activator acetylates H3K64, and consistent with a transcriptional activation function, H3K64ac opposes its repressive counterpart H3K64me3. Our findings reveal an important role for a histone modification within the nucleosome core as a regulator of chromatin function and they demonstrate that lateral surface modifications can define functionally opposing chromatin states. DOI: http://dx.doi.org/10.7554/eLife.01632.001.

  1. Acetylation of histone H3 at lysine 64 regulates nucleosome dynamics and facilitates transcription

    PubMed Central

    Di Cerbo, Vincenzo; Mohn, Fabio; Ryan, Daniel P; Montellier, Emilie; Kacem, Salim; Tropberger, Philipp; Kallis, Eleni; Holzner, Monika; Hoerner, Leslie; Feldmann, Angelika; Richter, Florian Martin; Bannister, Andrew J; Mittler, Gerhard; Michaelis, Jens; Khochbin, Saadi; Feil, Robert; Schuebeler, Dirk; Owen-Hughes, Tom; Daujat, Sylvain; Schneider, Robert

    2014-01-01

    Post-translational modifications of proteins have emerged as a major mechanism for regulating gene expression. However, our understanding of how histone modifications directly affect chromatin function remains limited. In this study, we investigate acetylation of histone H3 at lysine 64 (H3K64ac), a previously uncharacterized acetylation on the lateral surface of the histone octamer. We show that H3K64ac regulates nucleosome stability and facilitates nucleosome eviction and hence gene expression in vivo. In line with this, we demonstrate that H3K64ac is enriched in vivo at the transcriptional start sites of active genes and it defines transcriptionally active chromatin. Moreover, we find that the p300 co-activator acetylates H3K64, and consistent with a transcriptional activation function, H3K64ac opposes its repressive counterpart H3K64me3. Our findings reveal an important role for a histone modification within the nucleosome core as a regulator of chromatin function and they demonstrate that lateral surface modifications can define functionally opposing chromatin states. DOI: http://dx.doi.org/10.7554/eLife.01632.001 PMID:24668167

  2. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun

    2015-01-01

    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  3. Sucrose regulation of ADP-glucose pyrophosphorylase subunit genes transcript levels in leaves and fruits

    NASA Technical Reports Server (NTRS)

    Li, Xiangyang; Xing, Jinpeng; Gianfagna, Thomas J.; Janes, Harry W.

    2002-01-01

    ADP-glucose pyrophosphorylase (AGPase, EC2.7.7.27) is a key regulatory enzyme in starch biosynthesis. The enzyme is a heterotetramer with two S and two B subunits. In tomato, there are three multiple forms of the S subunit gene. Agp S1, S2 and B are highly expressed in fruit from 10 to 25 days after anthesis. Agp S3 is only weakly expressed in fruit. Sucrose significantly elevates expression of Agp S1, S2 and B in both leaves and fruits. Agp S1 exhibits the highest degree of regulation by sucrose. In fact, sucrose may be required for Agp S1 expression. For excised leaves incubated in water, no transcripts for Agp S1 could be detected in the absence of sucrose, whereas it took up to 16 h in water before transcripts were no longer detectable for Agp S2 and B. Neither Agp S3 nor the tubulin gene is affected by sucrose, demonstrating that this response is specifically regulated by a carbohydrate metabolic signal, and is not due to a general increase in metabolism caused by sucrose treatment. Truncated versions of the promoter for Agp S1 indicate that a specific region 1.3-3.0 kb upstream from the transcription site is responsible for sucrose sensitivity. This region of the S1 promoter contains several cis-acting elements present in the promoters of other genes that are also regulated by sucrose. c2002 Elsevier Science Ireland Ltd. All rights reserved.

  4. The homeobox transcription factor Even-skipped regulates acquisition of electrical properties in Drosophila neurons

    PubMed Central

    Pym, Edward CG; Southall, Tony D; Mee, Christopher J; Brand, Andrea H; Baines, Richard A

    2006-01-01

    Background While developmental processes such as axon pathfinding and synapse formation have been characterized in detail, comparatively less is known of the intrinsic developmental mechanisms that regulate transcription of ion channel genes in embryonic neurons. Early decisions, including motoneuron axon targeting, are orchestrated by a cohort of transcription factors that act together in a combinatorial manner. These transcription factors include Even-skipped (Eve), islet and Lim3. The perdurance of these factors in late embryonic neurons is, however, indicative that they might also regulate additional aspects of neuron development, including the acquisition of electrical properties. Results To test the hypothesis that a combinatorial code transcription factor is also able to influence the acquisition of electrical properties in embryonic neurons we utilized the molecular genetics of Drosophila to manipulate the expression of Eve in identified motoneurons. We show that increasing expression of this transcription factor, in two Eve-positive motoneurons (aCC and RP2), is indeed sufficient to affect the electrical properties of these neurons in early first instar larvae. Specifically, we observed a decrease in both the fast K+ conductance (IKfast) and amplitude of quantal cholinergic synaptic input. We used charybdotoxin to pharmacologically separate the individual components of IKfast to show that increased Eve specifically down regulates the Slowpoke (a BK Ca2+-gated potassium channel), but not Shal, component of this current. Identification of target genes for Eve, using DNA adenine methyltransferase identification, revealed strong binding sites in slowpoke and nAcRα-96Aa (a nicotinic acetylcholine receptor subunit). Verification using real-time PCR shows that pan-neuronal expression of eve is sufficient to repress transcripts for both slo and nAcRα-96Aa. Conclusion Taken together, our findings demonstrate, for the first time, that Eve is sufficient to regulate

  5. Different regulation of limb development by p63 transcript variants

    PubMed Central

    Kawata, Manabu; Taniguchi, Yuki; Mori, Daisuke; Yano, Fumiko; Ohba, Shinsuke; Chung, Ung-il; Shimogori, Tomomi; Mills, Alea A.; Tanaka, Sakae

    2017-01-01

    The apical ectodermal ridge (AER), located at the distal end of each limb bud, is a key signaling center which controls outgrowth and patterning of the proximal-distal axis of the limb through secretion of various molecules. Fibroblast growth factors (FGFs), particularly Fgf8 and Fgf4, are representative molecules produced by AER cells, and essential to maintain the AER and cell proliferation in the underlying mesenchyme, meanwhile Jag2-Notch pathway negatively regulates the AER and limb development. p63, a transcription factor of the p53 family, is expressed in the AER and indispensable for limb formation. However, the underlying mechanisms and specific roles of p63 variants are unknown. Here, we quantified the expression of p63 variants in mouse limbs from embryonic day (E) 10.5 to E12.5, and found that ΔNp63γ was strongly expressed in limbs at all stages, while TAp63γ expression was rapidly increased in the later stages. Fluorescence-activated cell sorting analysis of limb bud cells from reporter mouse embryos at E11.5 revealed that all variants were abundantly expressed in AER cells, and their expression was very low in mesenchymal cells. We then generated AER-specific p63 knockout mice by mating mice with a null and a flox allele of p63, and Msx2-Cre mice (Msx2-Cre;p63Δ/fl). Msx2-Cre;p63Δ/fl neonates showed limb malformation that was more obvious in distal elements. Expression of various AER-related genes was decreased in Msx2-Cre;p63Δ/fl limb buds and embryoid bodies formed by p63-knockdown induced pluripotent stem cells. Promoter analyses and chromatin immunoprecipitation assays demonstrated Fgf8 and Fgf4 as transcriptional targets of ΔNp63γ, and Jag2 as that of TAp63γ. Furthermore, TAp63γ overexpression exacerbated the phenotype of Msx2-Cre;p63Δ/fl mice. These data indicate that ΔNp63 and TAp63 control limb development through transcriptional regulation of different target molecules with different roles in the AER. Our findings contribute to

  6. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    PubMed

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-02-27

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  7. Transcription factor ZBED6 mediates IGF2 gene expression by regulating promoter activity and DNA methylation in myoblasts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were up regulated during C2C12 differentiation. The IGF2 expression levels wer...

  8. Implicit emotion regulation affects outcome evaluation.

    PubMed

    Yang, Qiwei; Tang, Ping; Gu, Ruolei; Luo, Wenbo; Luo, Yue-jia

    2015-06-01

    Efficient implicit emotion regulation processes, which run without awareness, are important for human well-being. In this study, to investigate the influence of implicit emotion regulation on psychological and electrophysiological responses to gains and losses, participants were required to select between two Chinese four-character idioms to match the meaning of the third one before they performed a monetary gambling task. According to whether their meanings were related to emotion regulation, the idioms fell into two categories. Event-related potentials and self-rating emotional experiences to outcome feedback were recorded during the task. Priming emotion regulation reduced subjective emotional experience to both gains and losses and the amplitudes of the feedback-related negativity, while the P3 component was not influenced. According to these results, we suggest that the application of implicit emotion regulation effectively modulated the subjective emotional experience and the motivational salience of current outcomes without the cost of cognitive resources. This study implicates the potential significance of implicit emotion regulation in decision-making processes.

  9. Gasoline Composition Regulations Affecting LUST Sites

    EPA Science Inventory

    Passage of the Clean Air Act Amendments in 1990 imposed requirements on gasoline composition in the United States. Impacts to ground water are affected by the provisions that required oxygenated additives and limited benzene concentration. Reformulated and oxygenated gasoline w...

  10. [Emotional intelligence, social support and affect regulation].

    PubMed

    Verissimo, Ramiro

    2005-01-01

    The aim of the present study was to gain additional information about the relationship between emotional intelligence, social support, and affectivity. The subjects were 64 university students who completed the short form of the Trait Meta-Mood Scale (TMMS-30), the Social Support Questionnaire, and the Multiple Affect Adjective Check List (MAACL). The results show that Social Support is high and significantly related with both Mood Repair, on one hand, and more Positive Affects and Sensation Seeking, on the other. These findings are consistent with the hypothesis that social support can be considered, somehow, as a way of mood repair; and thus not surprisingly is also associated with more Positive Affects and Sensation Seeking.

  11. ATF2, a paradigm of the multifaceted regulation of transcription factors in biology and disease.

    PubMed

    Watson, Gregory; Ronai, Ze'ev; Lau, Eric

    2017-02-15

    Stringent transcriptional regulation is crucial for normal cellular biology and organismal development. Perturbations in the proper regulation of transcription factors can result in numerous pathologies, including cancer. Thus, understanding how transcription factors are regulated and how they are dysregulated in disease states is key to the therapeutic targeting of these factors and/or the pathways that they regulate. Activating transcription factor 2 (ATF2) has been studied in a number of developmental and pathological conditions. Recent findings have shed light on the transcriptional, post-transcriptional, and post-translational regulatory mechanisms that influence ATF2 function, and thus, the transcriptional programs coordinated by ATF2. Given our current knowledge of its multiple levels of regulation and function, ATF2 represents a paradigm for the mechanistic complexity that can regulate transcription factor function. Thus, increasing our understanding of the regulation and function of ATF2 will provide insights into fundamental regulatory mechanisms that influence how cells integrate extracellular and intracellular signals into a genomic response through transcription factors. Characterization of ATF2 dysfunction in the context of pathological conditions, particularly in cancer biology and response to therapy, will be important in understanding how pathways controlled by ATF2 or other transcription factors might be therapeutically exploited. In this review, we provide an overview of the currently known upstream regulators and downstream targets of ATF2.

  12. Self-regulation and Beyond: Affect Regulation and the Infant-Caregiver Dyad.

    PubMed

    Taipale, Joona

    2016-01-01

    In the available psychological literature, affect regulation is fundamentally considered in terms of self-regulation, and according to this standard picture, the contribution of other people in our affect regulation has been viewed in terms of socially assisted self-regulation. The present article challenges this standard picture. By focusing on affect regulation as it unfolds in early infancy, it will be argued that instead of being something original and fundamental, self-regulation developmentally emerges from the basis of a further type of affect regulation. While infants' capacities in recognizing, understanding, and modifying their own affective states are initially immature and undeveloped, affect regulation is initially managed by the other: it is initially the self, and not the other, that plays the role of an assistant in affect regulation. To capture this phenomenon, the concepts of "auto-matic," "hetero-matic," and "altero-matic" affect regulation will be introduced and their interrelations elaborated. By showing how the capacity of affective self-regulation, which is characteristic to maturity, is developmentally achieved by internalizing regulative functions that, at the outset of development, are managed by the caregiver, it will be argued that altero-matic affect regulation is an autonomous type of affect regulation and the developmental basis for self-regulation.

  13. Self-regulation and Beyond: Affect Regulation and the Infant–Caregiver Dyad

    PubMed Central

    Taipale, Joona

    2016-01-01

    In the available psychological literature, affect regulation is fundamentally considered in terms of self-regulation, and according to this standard picture, the contribution of other people in our affect regulation has been viewed in terms of socially assisted self-regulation. The present article challenges this standard picture. By focusing on affect regulation as it unfolds in early infancy, it will be argued that instead of being something original and fundamental, self-regulation developmentally emerges from the basis of a further type of affect regulation. While infants’ capacities in recognizing, understanding, and modifying their own affective states are initially immature and undeveloped, affect regulation is initially managed by the other: it is initially the self, and not the other, that plays the role of an assistant in affect regulation. To capture this phenomenon, the concepts of “auto-matic,” “hetero-matic,” and “altero-matic” affect regulation will be introduced and their interrelations elaborated. By showing how the capacity of affective self-regulation, which is characteristic to maturity, is developmentally achieved by internalizing regulative functions that, at the outset of development, are managed by the caregiver, it will be argued that altero-matic affect regulation is an autonomous type of affect regulation and the developmental basis for self-regulation. PMID:27378984

  14. Molecular mechanisms of ligand-mediated attenuation of DNA binding by MarR family transcriptional regulators.

    PubMed

    Perera, Inoka C; Grove, Anne

    2010-10-01

    Bacteria and archaea encode members of the large multiple antibiotic resistance regulator (MarR) family of transcriptional regulators. Generally, MarR homologs regulate activity of genes involved in antibiotic resistance, stress responses, virulence or catabolism of aromatic compounds. They constitute a diverse group of transcriptional regulators that includes both repressors and activators, and the conventional mode of regulation entails a genetic locus in which the MarR homolog and a gene under its regulation are encoded divergently; binding of the MarR homolog to the intergenic region typically represses transcription of both genes, while binding of a specific ligand to the transcription factor results in attenuated DNA binding and hence activated gene expression. For many homologs, the natural ligand is unknown. Crystal structures reveal a common architecture with a characteristic winged helix domain for DNA binding, and recent structural information of homologs solved both in the absence and presence of their respective ligands, as well as biochemical data, is finally converging to illuminate the mechanisms by which ligand-binding causes attenuated DNA binding. As MarR homologs regulate pathways that are critical to bacterial physiology, including virulence, a molecular understanding of mechanisms by which ligands affect a regulation of gene activity is essential. Specifying the position of ligand-binding pockets further has the potential to aid in identifying the ligands for MarR homologs for which the ligand remains unknown.

  15. Wound-regulated accumulation of specific transcripts in tomato fruit: interactions with fruit development, ethylene and light.

    PubMed

    Parsons, B L; Mattoo, A K

    1991-09-01

    Regulation of three cDNA clones (pT52, pT53, and pT58) was analyzed in terms of wounding alone and wounding in conjunction with developmental and environmental cues (ripening, ethylene, and light) in tomato fruit tissue. The pT52-specific transcript level is induced by wounding in early-red and red stage fruit and by ethylene. The pT58-specific transcript level is also induced by wounding and ethylene in early-red stage fruit but is not induced by wounding in red fruit. The pT53-specific transcript level is repressed by wounding in early-red and red stage fruit. Like the pT52- and pT58-specific transcripts, the pT53-specific transcript is induced by ethylene. Furthermore, the level of the pT52-specific transcript is regulated by light. Analysis of unwounded tissue showed that the abundance of each cDNA-specific transcript changes during fruit ripening and that each of the transcripts is present in other plant organs as well. This analysis provides information about the interactions between developmental and environmental factors affecting these genes.

  16. Regulation of Memory Formation by the Transcription Factor XBP1.

    PubMed

    Martínez, Gabriela; Vidal, René L; Mardones, Pablo; Serrano, Felipe G; Ardiles, Alvaro O; Wirth, Craig; Valdés, Pamela; Thielen, Peter; Schneider, Bernard L; Kerr, Bredford; Valdés, Jose L; Palacios, Adrian G; Inestrosa, Nibaldo C; Glimcher, Laurie H; Hetz, Claudio

    2016-02-16

    Contextual memory formation relies on the induction of new genes in the hippocampus. A polymorphism in the promoter of the transcription factor XBP1 was identified as a risk factor for Alzheimer's disease and bipolar disorders. XBP1 is a major regulator of the unfolded protein response (UPR), mediating adaptation to endoplasmic reticulum (ER) stress. Using a phenotypic screen, we uncovered an unexpected function of XBP1 in cognition and behavior. Mice lacking XBP1 in the nervous system showed specific impairment of contextual memory formation and long-term potentiation (LTP), whereas neuronal XBP1s overexpression improved performance in memory tasks. Gene expression analysis revealed that XBP1 regulates a group of memory-related genes, highlighting brain-derived neurotrophic factor (BDNF), a key component in memory consolidation. Overexpression of BDNF in the hippocampus reversed the XBP1-deficient phenotype. Our study revealed an unanticipated function of XBP1 in cognitive processes that is apparently unrelated to its role in ER stress.

  17. Transcriptional regulation of 15-lipoxygenase expression by promoter methylation.

    PubMed

    Liu, Cheng; Xu, Dawei; Sjöberg, Jan; Forsell, Pontus; Björkholm, Magnus; Claesson, Hans-Erik

    2004-07-01

    15-Lipoxygenase type 1 (15-LO), a lipid-peroxidating enzyme implicated in physiological membrane remodeling and the pathogenesis of atherosclerosis, inflammation, and carcinogenesis, is highly regulated and expressed in a tissue- and cell-type-specific fashion. It is known that interleukins (IL) 4 and 13 play important roles in transactivating the 15-LO gene. However, the fact that they only exert such effects on a few types of cells suggests additional mechanism(s) for the profile control of 15-LO expression. In the present study, we demonstrate that hyper- and hypomethylation of CpG islands in the 15-LO promoter region is intimately associated with the transcriptional repression and activation of the 15-LO gene, respectively. The 15-LO promoter was exclusively methylated in all examined cells incapable of expressing 15-LO (certain solid tumor and human lymphoma cell lines and human T lymphocytes) while unmethylated in 15-LO-competent cells (the human airway epithelial cell line A549 and human monocytes) where 15-LO expression is IL4-inducible. Inhibition of DNA methylation in L428 lymphoma cells restores IL4 inducibility to 15-LO expression. Consistent with this, the unmethylated 15-LO promoter reporter construct exhibited threefold higher activity in A549 cells compared to its methylated counterpart. Taken together, demethylation of the 15-LO promoter is a prerequisite for the gene transactivation, which contributes to tissue- and cell-type-specific regulation of 15-LO expression.

  18. Ribulokinase and transcriptional regulation of arabinose metabolism in Clostridium acetobutylicum.

    PubMed

    Zhang, Lei; Leyn, Semen A; Gu, Yang; Jiang, Weihong; Rodionov, Dmitry A; Yang, Chen

    2012-03-01

    The transcription factor AraR controls utilization of L-arabinose in Bacillus subtilis. In this study, we combined a comparative genomic reconstruction of AraR regulons in nine Clostridium species with detailed experimental characterization of AraR-mediated regulation in Clostridium acetobutylicum. Based on the reconstructed AraR regulons, a novel ribulokinase, AraK, present in all analyzed Clostridium species was identified, which was a nonorthologous replacement of previously characterized ribulokinases. The predicted function of the araK gene was confirmed by inactivation of the araK gene in C. acetobutylicum and biochemical assays using purified recombinant AraK. In addition to the genes involved in arabinose utilization and arabinoside degradation, extension of the AraR regulon to the pentose phosphate pathway genes in several Clostridium species was revealed. The predicted AraR-binding sites in the C. acetobutylicum genome and the negative effect of L-arabinose on DNA-regulator complex formation were verified by in vitro binding assays. The predicted AraR-controlled genes in C. acetobutylicum were experimentally validated by testing gene expression patterns in both wild-type and araR-inactivated mutant strains during growth in the absence or presence of L-arabinose.

  19. Transcriptional regulation of the stress response by mTOR.

    PubMed

    Aramburu, Jose; Ortells, M Carmen; Tejedor, Sonia; Buxadé, Maria; López-Rodríguez, Cristina

    2014-07-01

    The kinase mammalian target of rapamycin (mTOR) is a central regulator of cell growth and proliferation that integrates inputs from growth factor receptors, nutrient availability, intracellular ATP (adenosine 5'-triphosphate), and a variety of stressors. Since early works in the mid-1990s uncovered the role of mTOR in stimulating protein translation, this kinase has emerged as a rather multifaceted regulator of numerous processes. Whereas mTOR is generally activated by growth- and proliferation-stimulating signals, its activity can be reduced and even suppressed when cells are exposed to a variety of stress conditions. However, cells can also adapt to stress while maintaining their growth capacity and mTOR function. Despite knowledge accumulated on how stress represses mTOR, less is known about mTOR influencing stress responses. In this review, we discuss the capability of mTOR, in particular mTOR complex 1 (mTORC1), to activate stress-responsive transcription factors, and we outline open questions for future investigation.

  20. Stochastic model of transcription factor-regulated gene expression

    NASA Astrophysics Data System (ADS)

    Karmakar, Rajesh; Bose, Indrani

    2006-09-01

    We consider a stochastic model of transcription factor (TF)-regulated gene expression. The model describes two genes, gene A and gene B, which synthesize the TFs and the target gene proteins, respectively. We show through analytic calculations that the TF fluctuations have a significant effect on the distribution of the target gene protein levels when the mean TF level falls in the highest sensitive region of the dose-response curve. We further study the effect of reducing the copy number of gene A from two to one. The enhanced TF fluctuations yield results different from those in the deterministic case. The probability that the target gene protein level exceeds a threshold value is calculated with the knowledge of the probability density functions associated with the TF and target gene protein levels. Numerical simulation results for a more detailed stochastic model are shown to be in agreement with those obtained through analytic calculations. The relevance of these results in the context of the genetic disorder haploinsufficiency is pointed out. Some experimental observations on the haploinsufficiency of the tumour suppressor gene, Nkx 3.1, are explained with the help of the stochastic model of TF-regulated gene expression.

  1. Integration of the transcriptional networks regulating limb morphogenesis.

    PubMed

    Rabinowitz, Adam H; Vokes, Steven A

    2012-08-15

    The developing limb is one of the best described vertebrate systems for understanding how coordinated gene expression during embryogenesis leads to the structures present in the mature organism. This knowledge, derived from decades of research, is largely based upon gain- and loss-of-function experiments. These studies have provided limited information about how the key signaling pathways interact with each other and the downstream effectors of these pathways. We summarize our current understanding of known genetic interactions in the context of three temporally defined gene regulatory networks. These networks crystallize our current knowledge, depicting a dynamic process involving multiple feedback loops between the ectoderm and mesoderm. At the same time, they highlight the fact that many essential processes are still largely undescribed. Much of the dynamic transcriptional activity occurring during development is regulated by distal cis-regulatory elements. Modern genomic tools have provided new approaches for studying the function of cis-regulatory elements and we discuss the results of these studies in regard to understanding limb development. Ultimately, these genomic techniques will allow scientists to understand how multiple signaling pathways are integrated in space and time to drive gene expression and regulate the formation of the limb.

  2. Transcriptional regulation of the Drosophila glial gene repo.

    PubMed

    Lee, Bruce P; Jones, Bradley W

    2005-06-01

    reversed polarity (repo) is a putative target gene of glial cells missing (gcm), the primary regulator of glial cell fate in Drosophila. Transient expression of Gcm is followed by maintained expression of repo. Multiple Gcm binding sites are found in repo upstream DNA. However, while repo is expressed in Gcm positive glia, it is not expressed in Gcm positive hemocytes. These observations suggest factors in addition to Gcm are required for repo expression. Here we have undertaken an analysis of the cis-regulatory DNA elements of repo using lacZ reporter activity in transgenic embryos. We have found that a 4.2 kb DNA region upstream of the repo start site drives the wild-type repo expression pattern. We show that expression is dependent on multiple Gcm binding sites. By ectopically expressing Repo, we show that Repo can regulate its own enhancer. Finally, by systematically analyzing fragments of repo upstream DNA, we show that expression is dependent on multiple elements that are responsible for activity in subsets of glia, as well as repressing inappropriate expression in the epidermis. Our results suggest that Gcm acts synergistically with other factors to control repo transcription in glial cells.

  3. Intragenic DNA methylation in transcriptional regulation, normal differentiation and cancer.

    PubMed

    Kulis, Marta; Queirós, Ana C; Beekman, Renée; Martín-Subero, José I

    2013-11-01

    Ever since the discovery of DNA methylation at cytosine residues, the role of this so called fifth base has been extensively studied and debated. Until recently, the majority of DNA methylation studies focused on the analysis of CpG islands associated to promoter regions. However, with the upcoming possibilities to study DNA methylation in a genome-wide context, this epigenetic mark can now be studied in an unbiased manner. As a result, recent studies have shown that not only promoters but also intragenic and intergenic regions are widely modulated during physiological processes and disease. In particular, it is becoming increasingly clear that DNA methylation in the gene body is not just a passive witness of gene transcription but it seems to be actively involved in multiple gene regulation processes. In this review we discuss the potential role of intragenic DNA methylation in alternative promoter usage, regulation of short and long non-coding RNAs, alternative RNA processing, as well as enhancer activity. Furthermore, we summarize how the intragenic DNA methylome is modified both during normal cell differentiation and neoplastic transformation.

  4. SWI/SNF regulates a transcriptional program that induces senescence to prevent liver cancer

    PubMed Central

    Tordella, Luca; Khan, Sadaf; Hohmeyer, Anja; Banito, Ana; Klotz, Sabrina; Raguz, Selina; Martin, Nadine; Dhamarlingam, Gopuraja; Carroll, Thomas; González Meljem, José Mario; Deswal, Sumit; Martínez-Barbera, Juan Pedro; García-Escudero, Ramón; Zuber, Johannes; Zender, Lars; Gil, Jesús

    2016-01-01

    Oncogene-induced senescence (OIS) is a potent tumor suppressor mechanism. To identify senescence regulators relevant to cancer, we screened an shRNA library targeting genes deleted in hepatocellular carcinoma (HCC). Here, we describe how knockdown of the SWI/SNF component ARID1B prevents OIS and cooperates with RAS to induce liver tumors. ARID1B controls p16INK4a and p21CIP1a transcription but also regulates DNA damage, oxidative stress, and p53 induction, suggesting that SWI/SNF uses additional mechanisms to regulate senescence. To systematically identify SWI/SNF targets regulating senescence, we carried out a focused shRNA screen. We discovered several new senescence regulators, including ENTPD7, an enzyme that hydrolyses nucleotides. ENTPD7 affects oxidative stress, DNA damage, and senescence. Importantly, expression of ENTPD7 or inhibition of nucleotide synthesis in ARID1B-depleted cells results in re-establishment of senescence. Our results identify novel mechanisms by which epigenetic regulators can affect tumor progression and suggest that prosenescence therapies could be employed against SWI/SNF-mutated cancers. PMID:27737960

  5. Transcriptional regulation of lycopene metabolism mediated by rootstock during the ripening of grafted watermelons.

    PubMed

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Liu, Peng; Cao, Lei; Huang, Yuan; Zhao, Liqiang; Lv, Huifang; Bie, Zhilong

    2017-01-01

    Rootstocks have comprehensive effects on lycopene accumulation in grafted watermelon fruits. However, little is known about lycopene metabolic regulation in grafted watermelon. To address this problem, parallel changes in lycopene contents and the expression of its metabolic genes were analyzed during the fruit ripening of nongrafted watermelon and watermelon grafted onto bottle gourd, pumpkin, and wild watermelon. Results showed that rootstocks mediated the transcriptional regulations of lycopene accumulation in different ways. Bottle gourd and wild watermelon promoted lycopene accumulation in grafted watermelon fruits by upregulating the biosynthetic genes phytoene synthase (PSY) and ζ-carotene desaturase (ZDS), and downregulating the catabolic genes β-carotene hydroxylase (CHYB), zeaxanthin epoxidase (ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), and carotenoid cleavage dioxygenase (CCD). However, pumpkin did not affect lycopene accumulation by upregulating both biosynthetic and catabolic genes. The rootstock-dependent characteristic of lycopene accumulation in grafted watermelon fruits provided an alternative model for investigating lycopene metabolic regulation.

  6. A WRKY Transcription Factor Regulates Fe Translocation under Fe Deficiency1[OPEN

    PubMed Central

    Yan, Jing Ying; Li, Chun Xiao; Sun, Li; Ren, Jiang Yuan; Li, Gui Xin

    2016-01-01

    Iron (Fe) deficiency affects plant growth and development, leading to reduction of crop yields and quality. Although the regulation of Fe uptake under Fe deficiency has been well studied in the past decade, the regulatory mechanism of Fe translocation inside the plants remains unknown. Here, we show that a WRKY transcription factor WRKY46 is involved in response to Fe deficiency. Lack of WRKY46 (wrky46-1 and wrky46-2 loss-of-function mutants) significantly affects Fe translocation from root to shoot and thus causes obvious chlorosis on the new leaves under Fe deficiency. Gene expression analysis reveals that expression of a nodulin-like gene (VACUOLAR IRON TRANSPORTER1-LIKE1 [VITL1]) is dramatically increased in wrky46-1 mutant. VITL1 expression is inhibited by Fe deficiency, while the expression of WRKY46 is induced in the root stele. Moreover, down-regulation of VITL1 expression can restore the chlorosis phenotype on wrky46-1 under Fe deficiency. Further yeast one-hybrid and chromatin immunoprecipitation experiments indicate that WRKY46 is capable of binding to the specific W-boxes present in the VITL1 promoter. In summary, our results demonstrate that WRKY46 plays an important role in the control of root-to-shoot Fe translocation under Fe deficiency condition via direct regulation of VITL1 transcript levels. PMID:27208259

  7. Xist and Tsix Transcription Dynamics Is Regulated by the X-to-Autosome Ratio and Semistable Transcriptional States

    PubMed Central

    Loos, Friedemann; Maduro, Cheryl; Loda, Agnese; Lehmann, Johannes; Kremers, Gert-Jan; ten Berge, Derk; Grootegoed, J. Anton

    2016-01-01

    In female mammals, X chromosome inactivation (XCI) is a key process in the control of gene dosage compensation between X-linked genes and autosomes. Xist and Tsix, two overlapping antisense-transcribed noncoding genes, are central elements of the X inactivation center (Xic) regulating XCI. Xist upregulation results in the coating of the entire X chromosome by Xist RNA in cis, whereas Tsix transcription acts as a negative regulator of Xist. Here, we generated Xist and Tsix reporter mouse embryonic stem (ES) cell lines to study the genetic and dynamic regulation of these genes upon differentiation. Our results revealed mutually antagonistic roles for Tsix on Xist and vice versa and indicate the presence of semistable transcriptional states of the Xic locus predicting the outcome of XCI. These transcriptional states are instructed by the X-to-autosome ratio, directed by regulators of XCI, and can be modulated by tissue culture conditions. PMID:27528619

  8. The transcription factor GATA-6 regulates pathological cardiac hypertrophy

    PubMed Central

    van Berlo, Jop H.; Elrod, John W.; van den Hoogenhof, Maarten M.G.; York, Allen J.; Aronow, Bruce J.; Duncan, Stephen A.; Molkentin, Jeffery D.

    2010-01-01

    Rationale The transcriptional code that programs maladaptive cardiac hypertrophy involves the zinc finger-containing DNA binding factor GATA-4. The highly related transcription factor GATA-6 is also expressed in the adult heart, although its role in controlling the hypertrophic program is unknown. Objective To determine the role of GATA-6 in cardiac hypertrophy and homeostasis. Methods and Results Here we performed a cardiomyocyte-specific conditional gene targeting approach for Gata6, as well as a transgenic approach to overexpress GATA-6 in the mouse heart. Deletion of Gata6-loxP with Nkx2.5-cre produced late embryonic lethality with heart defects, while deletion with β-myosin heavy chain-cre (βMHC-cre) produced viable adults with greater than 95% loss of GATA-6 protein in the heart. These later mice were subjected to pressure overload induced hypertrophy for 2 and 6 weeks, which showed a significant reduction in cardiac hypertrophy similar to that observed Gata4 heart-specific deleted mice. Gata6-deleted mice subjected to pressure overload also developed heart failure while control mice maintained proper cardiac function. Gata6-deleted mice also developed less cardiac hypertrophy following 2 weeks of angiotensin II/phenylephrine infusion. Controlled GATA-6 overexpression in the heart induced hypertrophy with aging and predisposed to greater hypertrophy with pressure overload stimulation. Combinatorial deletion of Gata4 and Gata6 from the adult heart resulted in dilated cardiomyopathy and lethality by 16 weeks of age. Mechanistically, deletion of Gata6 from the heart resulted in fundamental changes in the levels of key regulatory genes and myocyte differentiation-specific genes. Conclusions These results indicate that GATA-6 is both necessary and sufficient for regulating the cardiac hypertrophic response and differentiated gene expression, both alone and in coordination with GATA-4. PMID:20705924

  9. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    PubMed Central

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  10. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  11. Regulation of Transcriptional Bursting by a Naturally Oscillating Signal

    PubMed Central

    Corrigan, Adam M.; Chubb, Jonathan R.

    2014-01-01

    Summary Transcription is highly stochastic, occurring in irregular bursts [1–3]. For temporal and spatial precision of gene expression, cells must somehow deal with this noisy behavior. To address how this is achieved, we investigated how transcriptional bursting is entrained by a naturally oscillating signal, by direct measurement of transcription together with signal dynamics in living cells. We identify a Dictyostelium gene showing rapid transcriptional oscillations with the same period as extracellular cAMP signaling waves. Bursting approaches antiphase to cAMP waves, with accelerating transcription cycles during differentiation. Although coupling between signal and transcription oscillations was clear at the population level, single-cell transcriptional bursts retained considerable heterogeneity, indicating that transcription is not governed solely by signaling frequency. Previous studies implied that burst heterogeneity reflects distinct chromatin states [4–6]. Here we show that heterogeneity is determined by multiple intrinsic and extrinsic cues and is maintained by a transcriptional persistence. Unusually for a persistent transcriptional behavior, the lifetime was only 20 min, with rapid randomization of transcriptional state by the response to oscillatory signaling. Linking transcription to rapid signaling oscillations allows reduction of gene expression heterogeneity by temporal averaging, providing a mechanism to generate precision in cell choices during development. PMID:24388853

  12. Regulation of Nitrogen Metabolism by GATA Zinc Finger Transcription Factors in Yarrowia lipolytica

    PubMed Central

    2017-01-01

    ABSTRACT Fungi accumulate lipids in a manner dependent on the quantity and quality of the nitrogen source on which they are growing. In the oleaginous yeast Yarrowia lipolytica, growth on a complex source of nitrogen enables rapid growth and limited accumulation of neutral lipids, while growth on a simple nitrogen source promotes lipid accumulation in large lipid droplets. Here we examined the roles of nitrogen catabolite repression and its regulation by GATA zinc finger transcription factors on lipid metabolism in Y. lipolytica. Deletion of the GATA transcription factor genes gzf3 and gzf2 resulted in nitrogen source-specific growth defects and greater accumulation of lipids when the cells were growing on a simple nitrogen source. Deletion of gzf1, which is most similar to activators of genes repressed by nitrogen catabolite repression in filamentous ascomycetes, did not affect growth on the nitrogen sources tested. We examined gene expression of wild-type and GATA transcription factor mutants on simple and complex nitrogen sources and found that expression of enzymes involved in malate metabolism, beta-oxidation, and ammonia utilization are strongly upregulated on a simple nitrogen source. Deletion of gzf3 results in overexpression of genes with GATAA sites in their promoters, suggesting that it acts as a repressor, while gzf2 is required for expression of ammonia utilization genes but does not grossly affect the transcription level of genes predicted to be controlled by nitrogen catabolite repression. Both GATA transcription factor mutants exhibit decreased expression of genes controlled by carbon catabolite repression via the repressor mig1, including genes for beta-oxidation, highlighting the complex interplay between regulation of carbon, nitrogen, and lipid metabolism. IMPORTANCE Nitrogen source is commonly used to control lipid production in industrial fungi. Here we identified regulators of nitrogen catabolite repression in the oleaginous yeast Y

  13. Zinc Coordination Is Required for and Regulates Transcription Activation by Epstein-Barr Nuclear Antigen 1

    PubMed Central

    Aras, Siddhesh; Singh, Gyanendra; Johnston, Kenneth; Foster, Timothy; Aiyar, Ashok

    2009-01-01

    Epstein-Barr Nuclear Antigen 1 (EBNA1) is essential for Epstein-Barr virus to immortalize naïve B-cells. Upon binding a cluster of 20 cognate binding-sites termed the family of repeats, EBNA1 transactivates promoters for EBV genes that are required for immortalization. A small domain, termed UR1, that is 25 amino-acids in length, has been identified previously as essential for EBNA1 to activate transcription. In this study, we have elucidated how UR1 contributes to EBNA1's ability to transactivate. We show that zinc is necessary for EBNA1 to activate transcription, and that UR1 coordinates zinc through a pair of essential cysteines contained within it. UR1 dimerizes upon coordinating zinc, indicating that EBNA1 contains a second dimerization interface in its amino-terminus. There is a strong correlation between UR1-mediated dimerization and EBNA1's ability to transactivate cooperatively. Point mutants of EBNA1 that disrupt zinc coordination also prevent self-association, and do not activate transcription cooperatively. Further, we demonstrate that UR1 acts as a molecular sensor that regulates the ability of EBNA1 to activate transcription in response to changes in redox and oxygen partial pressure (pO2). Mild oxidative stress mimicking such environmental changes decreases EBNA1-dependent transcription in a lymphoblastoid cell-line. Coincident with a reduction in EBNA1-dependent transcription, reductions are observed in EBNA2 and LMP1 protein levels. Although these changes do not affect LCL survival, treated cells accumulate in G0/G1. These findings are discussed in the context of EBV latency in body compartments that differ strikingly in their pO2 and redox potential. PMID:19521517

  14. The role of transcriptional regulators in central control of appetite and body weight.

    PubMed

    Coppari, Roberto; Ramadori, Giorgio; Elmquist, Joel K

    2009-03-01

    Individuals who live in industrialized countries often eat a calorie-rich diet and perform little physical activity. These habits are thought to be critical contributors to the rapidly rising incidence of obesity, a condition that affects hundreds of millions of people worldwide. High-calorie intake alters metabolic-sensing pathways in central nervous system neurons, and these changes have pathogenic roles in the development of obesity. This review aims to summarize our current knowledge about the neuronal populations (the central melanocortin system in particular) and transcriptional regulators, including STAT3 and FOXO1, that are involved in the maintenance of normal body weight. We describe the interactions between these transcriptional factors and their target genes, which encode the main appetite-regulating neuropeptides (agouti-related peptide and alpha-melanocyte-stimulating hormone). We discuss the transcriptional co-activator PGC-1-alpha and the supposed metabolic-sensor protein SIRT1, and their potential roles as targets for novel antiobesity medications.

  15. Transcription factor co-localization patterns affect human cell type-specific gene expression

    PubMed Central

    2012-01-01

    Background Cellular development requires the precise control of gene expression states. Transcription factors are involved in this regulatory process through their combinatorial binding with DNA. Information about transcription factor binding sites can help determine which combinations of factors work together to regulate a gene, but it is unclear how far the binding data from one cell type can inform about regulation in other cell types. Results By integrating data on co-localized transcription factor binding sites in the K562 cell line with expression data across 38 distinct hematopoietic cell types, we developed regression models to describe the relationship between the expression of target genes and the transcription factors that co-localize nearby. With K562 binding sites identifying the predictors, the proportion of expression explained by the models is statistically significant only for monocytic cells (p-value< 0.001), which are closely related to K562. That is, cell type specific binding patterns are crucial for choosing the correct transcription factors for the model. Comparison of predictors obtained from binding sites in the GM12878 cell line with those from K562 shows that the amount of difference between binding patterns is directly related to the quality of the prediction. By identifying individual genes whose expression is predicted accurately by the binding sites, we are able to link transcription factors FOS, TAF1 and YY1 to a sparsely studied gene LRIG2. We also find that the activity of a transcription factor may be different depending on the cell type and the identity of other co-localized factors. Conclusion Our approach shows that gene expression can be explained by a modest number of co-localized transcription factors, however, information on cell-type specific binding is crucial for understanding combinatorial gene regulation. PMID:22721266

  16. CTCF regulates NELF, DSIF and P-TEFb recruitment during transcription.

    PubMed

    Laitem, Clélia; Zaborowska, Justyna; Tellier, Michael; Yamaguchi, Yuki; Cao, Qingfu; Egloff, Sylvain; Handa, Hiroshi; Murphy, Shona

    2015-01-01

    CTCF is a versatile transcription factor with well-established roles in chromatin organization and insulator function. Recent findings also implicate CTCF in the control of elongation by RNA polymerase (RNAP) II. Here we show that CTCF knockdown abrogates RNAP II pausing at the early elongation checkpoint of c-myc by affecting recruitment of DRB-sensitivity-inducing factor (DSIF). CTCF knockdown also causes a termination defect on the U2 snRNA genes (U2), by affecting recruitment of negative elongation factor (NELF). In addition, CTCF is required for recruitment of positive elongation factor b (P-TEFb), which phosphorylates NELF, DSIF, and Ser2 of the RNAP II CTD to activate elongation of transcription of c-myc and recognition of the snRNA gene-specific 3' box RNA processing signal. These findings implicate CTCF in a complex network of protein:protein/protein:DNA interactions and assign a key role to CTCF in controlling RNAP II transcription through the elongation checkpoint of the protein-coding c-myc and the termination site of the non-coding U2, by regulating the recruitment and/or activity of key players in these processes.

  17. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.

    PubMed

    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent

    2016-01-15

    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context.

  18. Regulation of microcin C51 operon expression: the role of global regulators of transcription.

    PubMed

    Fomenko, D; Veselovskii, A; Khmel, I

    2001-06-01

    Expression of the microcin C51 operon in Escherichia coli cells is regulated as a function of the phase of growth; it is stimulated during the decelerating phase of growth. Using single-copy P(mcc)-lac transcriptional fusion (the promoter region of the microcin C51 operon fused to a promoterless lac operon in lambda phage), we showed that transcription from the microcin operon promoter is dependent on sigma(s) (RpoS) factor. However, some level of P(mcc)-lac expression is possible in rpoS null mutants, indicating that another sigma factor might be involved in transcription of the microcin C51 operon. Overproduction of sigma70 decreased Pmcc-directed transcription, presumably as a result of competition of sigma factors for the limited amount of core RNA polymerase. The cyclic AMP-CRP complex was shown to stimulate transcription from Pmcc: the absence of CRP or cAMP in crp or cya mutant cells strongly decreased the level of P(mcc)-lac expression. The production of C51 microcin decreased or was absent in rpoS, crp and cya mutant cells. Leucine-responsive protein Lrp and histone-like protein H-NS repressed P(mcc)-lac expression in the exponential and decelerating phases of growth. In studies of P(mcc)-lac expression in double mutant cells, we showed that proteins CRP, Lrp and H-NS acted in rpoS-dependent and rpoS-independent ways in transcription of the microcin C51 operon. Mutation hns(-) resulted in an increase in P(mcc)-lac expression in crp, rpoS and lrp mutant cells, as in wild-type cells.

  19. A positive role for polycomb in transcriptional regulation via H4K20me1.

    PubMed

    Lv, Xiangdong; Han, Zhijun; Chen, Hao; Yang, Bo; Yang, Xiaofeng; Xia, Yuanxin; Pan, Chenyu; Fu, Lin; Zhang, Shuo; Han, Hui; Wu, Min; Zhou, Zhaocai; Zhang, Lei; Li, Lin; Wei, Gang; Zhao, Yun

    2016-05-01

    The highly conserved polycomb group (PcG) proteins maintain heritable transcription repression of the genes essential for development from fly to mammals. However, sporadic reports imply a potential role of PcGs in positive regulation of gene transcription, although systematic investigation of such function and the underlying mechanism has rarely been reported. Here, we report a Pc-mediated, H3K27me3-dependent positive transcriptional regulation of Senseless (Sens), a key transcription factor required for development. Mechanistic studies show that Pc regulates Sens expression by promoting H4K20me1 at the Sens locus. Further bioinformatic analysis at genome-wide level indicates that the existence of H4K20me1 acts as a selective mark for positive transcriptional regulation by Pc/H3K27me3. Both the intensities and specific patterns of Pc and H3K27me3 are important for the fates of target gene transcription. Moreover, binding of transcription factor Broad (Br), which physically interacts with Pc and positively regulates the transcription of Sens, is observed in Pc(+)H3K27me3(+)H4K20me1(+) genes, but not in Pc(+)H3K27me3(+)H4K20me1(-) genes. Taken together, our study reveals that, coupling with the transcription factor Br, Pc positively regulates transcription of Pc(+)H3K27me3(+)H4K20me1(+) genes in developing Drosophila wing disc.

  20. Affect regulation and HIV risk among youth in therapeutic schools

    PubMed Central

    Brown, Larry K.; Houck, Christopher; Lescano, Celia; Donenberg, Geri; Tolou-Shams, Marina; Mello, Justin

    2012-01-01

    The acquisition of affect regulation skills is often impaired or delayed in youth with mental health problems but the relationship between affect dysregulation and risk behaviors has not been well studied. Baseline data from adolescents (N =418; ages 13–19) recruited from therapeutic school settings examined the relationship between affect dysregulation, substance use, self-cutting, and sexual risk behavior. Analyses of covariance demonstrated that adolescents who did not use condoms at last sex, ever self-cut, attempted suicide, used alcohol and other drugs and reported less condom use self-efficacy when emotionally aroused were significantly more likely (p < .01) to report greater difficulty with affect regulation than peers who did not exhibit these behaviors. General patterns of difficulty with affect regulation may be linked to HIV risk behavior, including condom use at last sex. HIV prevention strategies for youth in mental health treatment should target affect regulation in relation to multiple risk behaviors. PMID:22669595

  1. Transcriptional pausing at the translation start site operates as a critical checkpoint for riboswitch regulation

    PubMed Central

    Chauvier, Adrien; Picard-Jean, Frédéric; Berger-Dancause, Jean-Christophe; Bastet, Laurène; Naghdi, Mohammad Reza; Dubé, Audrey; Turcotte, Pierre; Perreault, Jonathan; Lafontaine, Daniel A.

    2017-01-01

    On the basis of nascent transcript sequencing, it has been postulated but never demonstrated that transcriptional pausing at translation start sites is important for gene regulation. Here we show that the Escherichia coli thiamin pyrophosphate (TPP) thiC riboswitch contains a regulatory pause site in the translation initiation region that acts as a checkpoint for thiC expression. By biochemically probing nascent transcription complexes halted at defined positions, we find a narrow transcriptional window for metabolite binding, in which the downstream boundary is delimited by the checkpoint. We show that transcription complexes at the regulatory pause site favour the formation of a riboswitch intramolecular lock that strongly prevents TPP binding. In contrast, cotranscriptional metabolite binding increases RNA polymerase pausing and induces Rho-dependent transcription termination at the checkpoint. Early transcriptional pausing may provide a general mechanism, whereby transient transcriptional windows directly coordinate the sensing of environmental cues and bacterial mRNA regulation. PMID:28071751

  2. The transcription factor AREB1 regulates primary metabolic pathways in tomato fruits.

    PubMed

    Bastías, Adriana; Yañez, Mónica; Osorio, Sonia; Arbona, Vicent; Gómez-Cadenas, Aurelio; Fernie, Alisdair R; Casaretto, José A

    2014-06-01

    Tomato fruit development is regulated both by the action of plant hormones and by tight genetic control. Recent studies suggest that abscisic acid (ABA) signalling may affect different aspects of fruit maturation. Previously, it was shown that SlAREB1, an ABA-regulated transcription factor involved in stress-induced responses, is expressed in seeds and in fruit tissues in tomato. Here, the role of SlAREB1 in regulating the expression of genes relevant for primary metabolic pathways and affecting the metabolic profile of the fruit was investigated using transgenic tomato lines. Metabolite profiling using gas chromatography-time of flight mass spectrometry (GC-TOF-MS) and non-targeted liquid chromatography-mass spectrometry (LC-MS) was performed on pericarp tissue from fruits harvested at three stages of fruit development. Principal component analysis of the data could distinguish the metabolite profiles of non-transgenic fruits from those that overexpress and down-regulate SlAREB1. Overexpression of SlAREB1 resulted in increased content of organic acids, hexoses, hexose-phosphates, and amino acids in immature green, mature green, and red ripe fruits, and these modifications correlated with the up-regulation of enzyme-encoding genes involved in primary carbohydrate and amino acid metabolism. A non-targeted LC-MS analysis indicated that the composition of secondary metabolites is also affected in transgenic lines. In addition, gene expression data revealed that some genes associated with fruit ripening are also up-regulated in SlAREB1-overexpressing lines compared with wild-type and antisense lines. Taken together, the results suggest that SlAREB1 participates in the regulation of the metabolic programming that takes place during fruit ripening and that may explain part of the role of ABA in fruit development in tomato.

  3. The transcription factor AREB1 regulates primary metabolic pathways in tomato fruits

    PubMed Central

    Bastías, Adriana; Osorio, Sonia; Casaretto, José A.

    2014-01-01

    Tomato fruit development is regulated both by the action of plant hormones and by tight genetic control. Recent studies suggest that abscisic acid (ABA) signalling may affect different aspects of fruit maturation. Previously, it was shown that SlAREB1, an ABA-regulated transcription factor involved in stress-induced responses, is expressed in seeds and in fruit tissues in tomato. Here, the role of SlAREB1 in regulating the expression of genes relevant for primary metabolic pathways and affecting the metabolic profile of the fruit was investigated using transgenic tomato lines. Metabolite profiling using gas chromatography–time of flight mass spectrometry (GC-TOF-MS) and non-targeted liquid chromatography–mass spectrometry (LC-MS) was performed on pericarp tissue from fruits harvested at three stages of fruit development. Principal component analysis of the data could distinguish the metabolite profiles of non-transgenic fruits from those that overexpress and down-regulate SlAREB1. Overexpression of SlAREB1 resulted in increased content of organic acids, hexoses, hexose-phosphates, and amino acids in immature green, mature green, and red ripe fruits, and these modifications correlated with the up-regulation of enzyme-encoding genes involved in primary carbohydrate and amino acid metabolism. A non-targeted LC-MS analysis indicated that the composition of secondary metabolites is also affected in transgenic lines. In addition, gene expression data revealed that some genes associated with fruit ripening are also up-regulated in SlAREB1-overexpressing lines compared with wild-type and antisense lines. Taken together, the results suggest that SlAREB1 participates in the regulation of the metabolic programming that takes place during fruit ripening and that may explain part of the role of ABA in fruit development in tomato. PMID:24659489

  4. Transcriptional regulation of the peripheral nervous system in Ciona intestinalis.

    PubMed

    Joyce Tang, W; Chen, Jerry S; Zeller, Robert W

    2013-06-15

    The formation of the sensory organs and cells that make up the peripheral nervous system (PNS) relies on the activity of transcription factors encoded by proneural genes (PNGs). Although PNGs have been identified in the nervous systems of both vertebrates and invertebrates, the complexity of their interactions has complicated efforts to understand their function in the context of their underlying regulatory networks. To gain insight into the regulatory network of PNG activity in chordates, we investigated the roles played by PNG homologs in regulating PNS development of the invertebrate chordate Ciona intestinalis. We discovered that in Ciona, MyT1, Pou4, Atonal, and NeuroD-like are expressed in a sequential regulatory cascade in the developing epidermal sensory neurons (ESNs) of the PNS and act downstream of Notch signaling, which negatively regulates these genes and the number of ESNs along the tail midlines. Transgenic embryos mis-expressing any of these proneural genes in the epidermis produced ectopic midline ESNs. In transgenic embryos mis-expressing Pou4, and MyT1 to a lesser extent, numerous ESNs were produced outside of the embryonic midlines. In addition we found that the microRNA miR-124, which inhibits Notch signaling in ESNs, is activated downstream of all the proneural factors we tested, suggesting that these genes operate collectively in a regulatory network. Interestingly, these factors are encoded by the same genes that have recently been demonstrated to convert fibroblasts into neurons. Our findings suggest the ascidian PNS can serve as an in vivo model to study the underlying regulatory mechanisms that enable the conversion of cells into sensory neurons.

  5. Transcriptional regulation of mouse hypoglossal motor neuron somatotopic map formation.

    PubMed

    Chen, Xin; Wang, Jae Woong; Salin-Cantegrel, Adele; Dali, Rola; Stifani, Stefano

    2016-11-01

    Somatic motor neurons in the hypoglossal nucleus innervate tongue muscles controlling vital functions such as chewing, swallowing and respiration. Formation of functional hypoglossal nerve circuits depends on the establishment of precise hypoglossal motor neuron maps correlating with specific tongue muscle innervations. Little is known about the molecular mechanisms controlling mammalian hypoglossal motor neuron topographic map formation. Here we show that combinatorial expression of transcription factors Runx1, SCIP and FoxP1 defines separate mouse hypoglossal motor neuron groups with different topological, neurotransmitter and calcium-buffering phenotypes. Runx1 and SCIP are coexpressed in ventromedial hypoglossal motor neurons involved in control of tongue protrusion whereas FoxP1 is expressed in dorsomedial motor neurons associated with tongue retraction. Establishment of separate hypoglossal motor neuron maps depends in part on Runx1-mediated suppression of ventrolateral and dorsomedial motor neuron phenotypes and regulation of FoxP1 expression pattern. These findings suggest that combinatorial actions of Runx1, SCIP and FoxP1 are important for mouse hypoglossal nucleus somatotopic map formation.

  6. Metabolic Context Regulates Distinct Hypothalamic Transcriptional Responses to Antiaging Interventions

    PubMed Central

    Stranahan, Alexis M.; Martin, Bronwen; Chadwick, Wayne; Park, Sung-Soo; Wang, Liyun; Becker, Kevin G.; WoodIII, William H.; Zhang, Yongqing; Maudsley, Stuart

    2012-01-01

    The hypothalamus is an essential relay in the neural circuitry underlying energy metabolism that needs to continually adapt to changes in the energetic environment. The neuroendocrine control of food intake and energy expenditure is associated with, and likely dependent upon, hypothalamic plasticity. Severe disturbances in energy metabolism, such as those that occur in obesity, are therefore likely to be associated with disruption of hypothalamic transcriptomic plasticity. In this paper, we investigated the effects of two well-characterized antiaging interventions, caloric restriction and voluntary wheel running, in two distinct physiological paradigms, that is, diabetic (db/db) and nondiabetic wild-type (C57/Bl/6) animals to investigate the contextual sensitivity of hypothalamic transcriptomic responses. We found that, both quantitatively and qualitatively, caloric restriction and physical exercise were associated with distinct transcriptional signatures that differed significantly between diabetic and non-diabetic mice. This suggests that challenges to metabolic homeostasis regulate distinct hypothalamic gene sets in diabetic and non-diabetic animals. A greater understanding of how genetic background contributes to hypothalamic response mechanisms could pave the way for the development of more nuanced therapeutics for the treatment of metabolic disorders that occur in diverse physiological backgrounds. PMID:22934110

  7. Evolution of proline biosynthesis: enzymology, bioinformatics, genetics, and transcriptional regulation.

    PubMed

    Fichman, Yosef; Gerdes, Svetlana Y; Kovács, Hajnalka; Szabados, László; Zilberstein, Aviah; Csonka, Laszlo N

    2015-11-01

    Proline is not only an essential component of proteins but it also has important roles in adaptation to osmotic and dehydration stresses, redox control, and apoptosis. Here, we review pathways of proline biosynthesis in the three domains of life. Pathway reconstruction from genome data for hundreds of eubacterial and dozens of archaeal and eukaryotic organisms revealed evolutionary conservation and variations of this pathway across different taxa. In the most prevalent pathway of proline synthesis, glutamate is phosphorylated to γ-glutamyl phosphate by γ-glutamyl kinase, reduced to γ-glutamyl semialdehyde by γ-glutamyl phosphate reductase, cyclized spontaneously to Δ(1)-pyrroline-5-carboxylate and reduced to proline by Δ(1)-pyrroline-5-carboxylate reductase. In higher plants and animals the first two steps are catalysed by a bi-functional Δ(1) -pyrroline-5-carboxylate synthase. Alternative pathways of proline formation use the initial steps of the arginine biosynthetic pathway to ornithine, which can be converted to Δ(1)-pyrroline-5-carboxylate by ornithine aminotransferase and then reduced to proline or converted directly to proline by ornithine cyclodeaminase. In some organisms, the latter pathways contribute to or could be fully responsible for the synthesis of proline. The conservation of proline biosynthetic enzymes and significance of specific residues for catalytic activity and allosteric regulation are analysed on the basis of protein structural data, multiple sequence alignments, and mutant studies, providing novel insights into proline biosynthesis in organisms. We also discuss the transcriptional control of the proline biosynthetic genes in bacteria and plants.

  8. Production and transcriptional regulation of proanthocyanidin biosynthesis in forage legumes.

    PubMed

    Zhou, Meiliang; Wei, Li; Sun, Zhanmin; Gao, Lihua; Meng, Yu; Tang, Yixiong; Wu, Yanmin

    2015-05-01

    Proanthocyanidins (PA), also known as condensed tannins, contribute to important forage legumes traits including disease resistance and forage quality. PA in forage plants has both positive and negative effects on feed digestibility and animal performance. The analytical methods and their applicability in measuring the contents of PA in forage plants are essential to studies on their nutritional effects. In spite of important breakthroughs in our understanding of the PA biosynthesis, important questions still remain to be answered such as the PA polymerization and transport. Recent advances in the understanding of transcription factor-mediated gene regulation mechanisms in anthocyanin and PA biosynthetic pathway in model plants suggest new approaches for the metabolic engineering of PA in forage plants. The present review will attempt to present the state-of-the-art of research in these areas and provide an update on the production and metabolic engineering of PA in forage plants. We hope that this will contribute to a better understanding of the ways in which PA production to manipulate the content of PA for beneficial effects in forage plants.

  9. Transcriptional Regulation in Mammalian Cells by Sequence-Specific DNA Binding Proteins

    NASA Astrophysics Data System (ADS)

    Mitchell, Pamela J.; Tjian, Robert

    1989-07-01

    The cloning of genes encoding mammalian DNA binding transcription factors for RNA polymerase II has provided the opportunity to analyze the structure and function of these proteins. This review summarizes recent studies that define structural domains for DNA binding and transcriptional activation functions in sequence-specific transcription factors. The mechanisms by which these factors may activate transcriptional initiation and by which they may be regulated to achieve differential gene expression are also discussed.

  10. MicroRNA-27a regulates basal transcription by targeting the p44 subunit of general transcription factor IIH

    PubMed Central

    Portal, Maximiliano M.

    2011-01-01

    General transcription factor IIH (TFIIH) is a complex RNA polymerase II basal transcription factor comprising 10 different polypeptides that display activities involved in transcription and DNA repair processes. Although biochemical studies have uncovered TFIIH importance, little is known about how the mRNAs that code for TFIIH subunits are regulated. Here it is shown that mRNAs encoding seven of the TFIIH subunits (p34, p44, p52, p62, XPB, CDK7, and p8) are regulated at the posttranscriptional level in a Dicer-dependent manner. Indeed, abolition of the miRNA pathway induces abnormal accumulation, stabilization, and translational activation of these seven mRNAs. Herein, miR-27a was identified as a key regulator of p44 mRNA. Moreover, miR-27a was shown to destabilize the p44 subunit of the TFIIH complex during the G2-M phase, thereby modulating the transcriptional shutdown observed during this transition. This work is unique in providing a demonstration of global transcriptional regulation through the action of a single miRNA. PMID:21558443

  11. Factors that influence the response of the LysR type transcriptional regulators to aromatic compounds

    PubMed Central

    2011-01-01

    Background The transcriptional regulators DntR, NagR and NtdR have a high sequence identity and belong to the large family of LysR type transcriptional regulators (LTTRs). These three regulators are all involved in regulation of genes identified in pathways for degradation of aromatic compounds. They activate the transcription of these genes in the presence of an inducer, but the inducer specificity profiles are different. Results The results from this study show that NtdR has the broadest inducer specificity, responding to several nitro-aromatic compounds. Mutational studies of residues that differ between DntR, NagR and NtdR suggest that a number of specific residues are involved in the broader inducer specificity of NtdR when compared to DntR and NagR. The inducer response was also investigated as a function of the experimental conditions and a number of parameters such as the growth media, plasmid arrangement of the LTTR-encoding genes, promoter and gfp reporter gene, and the presence of a His6-tag were shown to affect the inducer response in E.coli DH5α. Furthermore, the response upon addition of both salicylate and 4-nitrobenzoate to the growth media was larger than the sum of responses upon addition of each of the compounds, which suggests the presence of a secondary binding site, as previously reported for other LTTRs. Conclusions Optimization of the growth conditions and gene arrangement resulted in improved responses to nitro-aromatic inducers. The data also suggests the presence of a previously unknown secondary binding site in DntR, analogous to that of BenM. PMID:21884597

  12. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes

    PubMed Central

    Leśniewska, Ewa

    2017-01-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency. PMID:28228471

  13. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes.

    PubMed

    Leśniewska, Ewa; Boguta, Magdalena

    2017-02-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency.

  14. Atrophy, hypertrophy, and hypoxemia induce transcriptional regulators of the ubiquitin proteasome system in the rat heart

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle, transcript levels of proteins regulating the ubiquitin proteasome system (UPS) increase with atrophy and decrease with hypertrophy. Whether the same is true for heart muscle is not known. We set out to characterize the transcriptional profile of regulators of the UPS during atrop...

  15. Comparative studies of transcriptional regulation mechanisms in a group of eight gamma-proteobacterial genomes.

    PubMed

    Espinosa, Vladimir; González, Abel D; Vasconcelos, Ana T; Huerta, Araceli M; Collado-Vides, Julio

    2005-11-18

    Experimental data on the Escherichia coli transcriptional regulation has enabled the construction of statistical models to predict new regulatory elements within its genome. Far less is known about the transcriptional regulatory elements in other gamma-proteobacteria with sequenced genomes, so it is of great interest to conduct comparative genomic studies oriented to extracting biologically relevant information about transcriptional regulation in these less studied organisms using the knowledge from E. coli. In this work, we use the information stored in the TRACTOR_DB database to conduct a comparative study on the mechanisms of transcriptional regulation in eight gamma-proteobacteria and 38 regulons. We assess the conservation of transcription factors binding specificity across all the eight genomes and show a correlation between the conservation of a regulatory site and the structure of the transcription unit it regulates. We also find a marked conservation of site-promoter distances across the eight organisms and a correspondence of the statistical significance of co-occurrence of pairs of transcription factor binding sites in the regulatory regions, which is probably related to a conserved architecture of higher-order regulatory complexes in the organisms studied. The results obtained in this study using the information on transcriptional regulation in E. coli enable us to conclude that not only transcription factor-binding sites are conserved across related species but also several of the transcriptional regulatory mechanisms previously identified in E. coli.

  16. Plant Mediator complex and its critical functions in transcription regulation.

    PubMed

    Yang, Yan; Li, Ling; Qu, Li-Jia

    2016-02-01

    The Mediator complex is an important component of the eukaryotic transcriptional machinery. As an essential link between transcription factors and RNA polymerase II, the Mediator complex transduces diverse signals to genes involved in different pathways. The plant Mediator complex was recently purified and comprises conserved and specific subunits. It functions in concert with transcription factors to modulate various responses. In this review, we summarize the recent advances in understanding the plant Mediator complex and its diverse roles in plant growth, development, defense, non-coding RNA production, response to abiotic stresses, flowering, genomic stability and metabolic homeostasis. In addition, the transcription factors interacting with the Mediator complex are also highlighted.

  17. Prolactin regulates transcription of the ion uptake Na+/Cl- cotransporter (ncc) gene in zebrafish gill

    USGS Publications Warehouse

    Breves, Jason P.; Serizier, Sandy B.; Goffin, Vincent; McCormick, Stephen D.; Karlstrom, Rolf O.

    2013-01-01

    Prolactin (PRL) is a well-known regulator of ion and water transport within osmoregulatory tissues across vertebrate species, yet how PRL acts on some of its target tissues remains poorly understood. Using zebrafish as a model, we show that ionocytes in the gill directly respond to systemic PRL to regulate mechanisms of ion uptake. Ion-poor conditions led to increases in the expression of PRL receptor (prlra), Na+/Cl− cotransporter (ncc; slc12a10.2), Na+/H+ exchanger (nhe3b; slc9a3.2), and epithelial Ca2+ channel (ecac; trpv6) transcripts within the gill. Intraperitoneal injection of ovine PRL (oPRL) increased ncc and prlra transcripts, but did not affect nhe3b or ecac. Consistent with direct PRL action in the gill, addition of oPRL to cultured gill filaments stimulated ncc in a concentration-dependent manner, an effect blocked by a pure human PRL receptor antagonist (Δ1-9-G129R-hPRL). These results suggest that PRL signaling through PRL receptors in the gill regulates the expression of ncc, thereby linking this pituitary hormone with an effector of Cl− uptake in zebrafish for the first time.

  18. Cooperation meets competition in microRNA-mediated DMPK transcript regulation

    PubMed Central

    Koscianska, Edyta; Witkos, Tomasz M.; Kozlowska, Emilia; Wojciechowska, Marzena; Krzyzosiak, Wlodzimierz J.

    2015-01-01

    The fundamental role of microRNAs (miRNAs) in the regulation of gene expression has been well-established, but many miRNA-driven regulatory mechanisms remain elusive. In the present study, we demonstrate that miRNAs regulate the expression of DMPK, the gene mutated in myotonic dystrophy type 1 (DM1), and we provide insight regarding the concerted effect of the miRNAs on the DMPK target. Specifically, we examined the binding of several miRNAs to the DMPK 3′ UTR using luciferase assays. We validated the interactions between the DMPK transcript and the conserved miR-206 and miR-148a. We suggest a possible cooperativity between these two miRNAs and discuss gene targeting by miRNA pairs that vary in distance between their binding sites and expression profiles. In the same luciferase reporter system, we showed miR-15b/16 binding to the non-conserved CUG repeat tract present in the DMPK transcript and that the CUG-repeat-binding miRNAs might also act cooperatively. Moreover, we detected miR-16 in cytoplasmic foci formed by exogenously expressed RNAs with expanded CUG repeats. Therefore, we propose that the expanded CUGs may serve as a target for concerted regulation by miRNAs and may also act as molecular sponges for natural miRNAs with CAG repeats in their seed regions, thereby affecting their physiological functions. PMID:26304544

  19. The TrmB family: a versatile group of transcriptional regulators in Archaea.

    PubMed

    Gindner, Antonia; Hausner, Winfried; Thomm, Michael

    2014-09-01

    Microbes are organisms which are well adapted to their habitat. Their survival depends on the regulation of gene expression levels in response to environmental signals. The most important step in regulation of gene expression takes place at the transcriptional level. This regulation is intriguing in Archaea because the eu-karyotic-like transcription apparatus is modulated by bacterial-like transcription regulators. The transcriptional regulator of mal operon (TrmB) family is well known as a very large group of regulators in Archaea with more than 250 members to date. One special feature of these regulators is that some of them can act as repressor, some as activator and others as both repressor and activator. This review gives a short updated overview of the TrmB family and their regulatory patterns in different Archaea as a lot of new data have been published on this topic since the last review from 2008.

  20. Complex genomic interactions in the dynamic regulation of transcription by the glucocorticoid receptor.

    PubMed

    Miranda, Tina B; Morris, Stephanie A; Hager, Gordon L

    2013-11-05

    The glucocorticoid receptor regulates transcriptional output through complex interactions with the genome. These events require continuous remodeling of chromatin, interactions of the glucocorticoid receptor with chaperones and other accessory factors, and recycling of the receptor by the proteasome. Therefore, the cohort of factors expressed in a particular cell type can determine the physiological outcome upon treatment with glucocorticoid hormones. In addition, circadian and ultradian cycling of hormones can also affect GR response. Here we will discuss revision of the classical static model of GR binding to response elements to incorporate recent findings from single cell and genome-wide analyses of GR regulation. We will highlight how these studies have changed our views on the dynamics of GR recruitment and its modulation of gene expression.

  1. Carotenoid genes transcriptional regulation for astaxanthin accumulation in fresh water unicellular alga Haematococcus pluvialis by gibberellin A3 (GA3).

    PubMed

    Gao, Zhengquan; Meng, Chunxiao; Gao, Hongzheng; Li, Yan; Zhang, Xiaowen; Xu, Dong; Zhou, Shitan; Liu, Banghui; Su, Yuanfeng; Ye, Naihao

    2013-12-01

    The fresh water unicellular alga Haematococcus pluvialis is a promising natural source of astaxanthin. The present study investigated the transcriptional expression of carotenoid genes for astaxanthin accumulation in H. pluvialis using real-time fluorescence quantitative PCR (qRT-PCR). With treatments of 20 and 40 mg/L of gibberllin A3 (GA3), five genes ipi-1, ipi-2, psy, pds and bkt2 were up-regulated with different expression profiles. GA20 (20 mg/L of GA3) treatment had a greater effect on transcriptional expression of bkt2 than on ipi-1 ipi-2, psy and pds (> 4-fold up-regulation). However, GA40 (40 mg/L of GA3) induced more transcriptional expression of ipi-2, psy and bkt2 than both ipi-1 and pds. The expression of lyc, crtR-B and crtO for astaxanthin biosynthesis was not affected by GA3 in H. piuvialis. In the presence of GA3, astaxanthin biosynthesis genes of ipi-1, pds and bkt2 were up-regulated at transcriptional level, psy at post-transcriptional level, whereas ipi-2 was up-regulated at both levels. The study could potentially lead to a scale application of exogenous GA3 in astaxanthin production with H. pluvialis just like GAs perform in increasing crops production and it would provide new insight about the multifunctional roles of carotenogenesis in response to GA3.

  2. Genome-scale study of the importance of binding site context for transcription factor binding and gene regulation

    PubMed Central

    Westholm, Jakub Orzechowski; Xu, Feifei; Ronne, Hans; Komorowski, Jan

    2008-01-01

    Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence) is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context. PMID:19014636

  3. Discovery of Transcriptional Targets Regulated by Nuclear Receptors Using a Probabilistic Graphical Model.

    PubMed

    Lee, Mikyung; Huang, Ruili; Tong, Weida

    2016-03-01

    Nuclear receptors (NRs) are ligand-activated transcriptional regulators that play vital roles in key biological processes such as growth, differentiation, metabolism, reproduction, and morphogenesis. Disruption of NRs can result in adverse health effects such as NR-mediated endocrine disruption. A comprehensive understanding of core transcriptional targets regulated by NRs helps to elucidate their key biological processes in both toxicological and therapeutic aspects. In this study, we applied a probabilistic graphical model to identify the transcriptional targets of NRs and the biological processes they govern. The Tox21 program profiled a collection of approximate 10 000 environmental chemicals and drugs against a panel of human NRs in a quantitative high-throughput screening format for their NR disruption potential. The Japanese Toxicogenomics Project, one of the most comprehensive efforts in the field of toxicogenomics, generated large-scale gene expression profiles on the effect of 131 compounds (in its first phase of study) at various doses, and different durations, and their combinations. We applied author-topic model to these 2 toxicological datasets, which consists of 11 NRs run in either agonist and/or antagonist mode (18 assays total) and 203 in vitro human gene expression profiles connected by 52 shared drugs. As a result, a set of clusters (topics), which consists of a set of NRs and their associated target genes were determined. Various transcriptional targets of the NRs were identified by assays run in either agonist or antagonist mode. Our results were validated by functional analysis and compared with TRANSFAC data. In summary, our approach resulted in effective identification of associated/affected NRs and their target genes, providing biologically meaningful hypothesis embedded in their relationships.

  4. Structural insights into NusG regulating transcription elongation

    PubMed Central

    Liu, Bin; Steitz, Thomas A.

    2017-01-01

    NusG is an essential transcription factor that plays multiple key regulatory roles in transcription elongation, termination and coupling translation and transcription. The core role of NusG is to enhance transcription elongation and RNA polymerase processivity. Here, we present the structure of Escherichia coli RNA polymerase complexed with NusG. The structure shows that the NusG N-terminal domain (NGN) binds at the central cleft of RNA polymerase surrounded by the β' clamp helices, the β protrusion, and the β lobe domains to close the promoter DNA binding channel and constrain the β' clamp domain, but with an orientation that is different from the one observed in the archaeal β' clamp–Spt4/5 complex. The structure also allows us to construct a reliable model of the complete NusG-associated transcription elongation complex, suggesting that the NGN domain binds at the upstream fork junction of the transcription elongation complex, similar to σ2 in the transcription initiation complex, to stabilize the junction, and therefore enhances transcription processivity. PMID:27899640

  5. Global nucleosome distribution and the regulation of transcription in yeast

    PubMed Central

    Ercan, Sevinc; Carrozza, Michael J; Workman, Jerry L

    2004-01-01

    Recent studies show that active regulatory regions of the yeast genome have a lower density of nucleosomes than other regions, and that there is an inverse correlation between nucleosome density and the transcription rate of a gene. This may be the result of transcription factors displacing nucleosomes. PMID:15461807

  6. Beyond Transcription Factors: The Role of Chromatin Modifying Enzymes in Regulating Transcription Required for Memory

    ERIC Educational Resources Information Center

    Barrett, Ruth M.; Wood, Marcelo A.

    2008-01-01

    One of the alluring aspects of examining chromatin modifications in the role of modulating transcription required for long-term memory processes is that these modifications may provide transient and potentially stable epigenetic marks in the service of activating and/or maintaining transcriptional processes. These, in turn, may ultimately…

  7. Transcriptional and post-transcriptional regulation of SPAST, the gene most frequently mutated in hereditary spastic paraplegia.

    PubMed

    Henson, Brian J; Zhu, Wan; Hardaway, Kelsey; Wetzel, Jaime L; Stefan, Mihaela; Albers, Kathryn M; Nicholls, Robert D

    2012-01-01

    Hereditary spastic paraplegias (HSPs) comprise a group of neurodegenerative disorders that are characterized by progressive spasticity of the lower extremities, due to axonal degeneration in the corticospinal motor tracts. HSPs are genetically heterogeneous and show autosomal dominant inheritance in ∼70-80% of cases, with additional cases being recessive or X-linked. The most common type of HSP is SPG4 with mutations in the SPAST gene, encoding spastin, which occurs in 40% of dominantly inherited cases and in ∼10% of sporadic cases. Both loss-of-function and dominant-negative mutation mechanisms have been described for SPG4, suggesting that precise or stoichiometric levels of spastin are necessary for biological function. Therefore, we hypothesized that regulatory mechanisms controlling expression of SPAST are important determinants of spastin biology, and if altered, could contribute to the development and progression of the disease. To examine the transcriptional and post-transcriptional regulation of SPAST, we used molecular phylogenetic methods to identify conserved sequences for putative transcription factor binding sites and miRNA targeting motifs in the SPAST promoter and 3'-UTR, respectively. By a variety of molecular methods, we demonstrate that SPAST transcription is positively regulated by NRF1 and SOX11. Furthermore, we show that miR-96 and miR-182 negatively regulate SPAST by effects on mRNA stability and protein level. These transcriptional and miRNA regulatory mechanisms provide new functional targets for mutation screening and therapeutic targeting in HSP.

  8. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders

    PubMed Central

    Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C.; Lipska, Barbara K.; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R.; Kleinman, Joel E.; Hyde, Thomas M.

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders. PMID:26848839

  9. Biogenesis of photosystem II complexes: transcriptional, translational, and posttranslational regulation

    PubMed Central

    1986-01-01

    The integral membrane proteins of photosystem II (PS II) reaction center complexes are encoded by chloroplast genomes. These proteins are absent from thylakoids of PS II mutants of algae and vascular plants as a result of either chloroplast or nuclear gene mutations. To resolve the molecular basis for the concurrent absence of the PS II polypeptides, protein synthesis rates and mRNA levels were measured in mutants of Chlamydomonas reinhardtii that lack PS II. The analyses show that one nuclear gene product regulates the levels of transcripts from the chloroplast gene encoding the 51-kD chlorophyll a-binding polypeptide (polypeptide 5) but is not involved in the synthesis of other chloroplast mRNAs. Another nuclear product is specifically required for translation of mRNA encoding the 32-34-kD polypeptide, D1. The absence of either D1 or polypeptide 5 does not eliminate the synthesis and thylakoid insertion of two other integral membrane proteins of PS II, the chlorophyll a-binding polypeptide of 46 kD (polypeptide 6) and the 30-kD "D1-like" protein, D2. However, these two unassembled subunits cannot be properly processed and/or are degraded in the mutants even though they reside in the membrane. In addition, pulse labeling of the nuclear mutants and a chloroplast mutant that does not synthesize D1 mRNA indicates that synthesis of polypeptide 5 and D1 is coordinated at the translational level. A model is presented to explain how absence of one of the two proteins could lead to translational arrest of the other. PMID:3533953

  10. Plant Elongator regulates auxin-related genes during RNA polymerase II transcription elongation.

    PubMed

    Nelissen, Hilde; De Groeve, Steven; Fleury, Delphine; Neyt, Pia; Bruno, Leonardo; Bitonti, Maria Beatrice; Vandenbussche, Filip; Van der Straeten, Dominique; Yamaguchi, Takahiro; Tsukaya, Hirokazu; Witters, Erwin; De Jaeger, Geert; Houben, Andreas; Van Lijsebettens, Mieke

    2010-01-26

    In eukaryotes, transcription of protein-encoding genes is strongly regulated by posttranslational modifications of histones that affect the accessibility of the DNA by RNA polymerase II (RNAPII). The Elongator complex was originally identified in yeast as a histone acetyltransferase (HAT) complex that activates RNAPII-mediated transcription. In Arabidopsis thaliana, the Elongator mutants elo1, elo2, and elo3 with decreased leaf and primary root growth due to reduced cell proliferation identified homologs of components of the yeast Elongator complex, Elp4, Elp1, and Elp3, respectively. Here we show that the Elongator complex was purified from plant cell cultures as a six-component complex. The role of plant Elongator in transcription elongation was supported by colocalization of the HAT enzyme, ELO3, with euchromatin and the phosphorylated form of RNAPII, and reduced histone H3 lysine 14 acetylation at the coding region of the SHORT HYPOCOTYL 2 auxin repressor and the LAX2 auxin influx carrier gene with reduced expression levels in the elo3 mutant. Additional auxin-related genes were down-regulated in the transcriptome of elo mutants but not targeted by the Elongator HAT activity showing specificity in target gene selection. Biological relevance was apparent by auxin-related phenotypes and marker gene analysis. Ethylene and jasmonic acid signaling and abiotic stress responses were up-regulated in the elo transcriptome and might contribute to the pleiotropic elo phenotype. Thus, although the structure of Elongator and its substrate are conserved, target gene selection has diverged, showing that auxin signaling and influx are under chromatin control.

  11. Investigating Conservation of the Cell-Cycle-Regulated Transcriptional Program in the Fungal Pathogen, Cryptococcus neoformans

    PubMed Central

    Sierra, Crystal S.; Haase, Steven B.

    2016-01-01

    The pathogenic yeast Cryptococcus neoformans causes fungal meningitis in immune-compromised patients. Cell proliferation in the budding yeast form is required for C. neoformans to infect human hosts, and virulence factors such as capsule formation and melanin production are affected by cell-cycle perturbation. Thus, understanding cell-cycle regulation is critical for a full understanding of virulence factors for disease. Our group and others have demonstrated that a large fraction of genes in Saccharomyces cerevisiae is expressed periodically during the cell cycle, and that proper regulation of this transcriptional program is important for proper cell division. Despite the evolutionary divergence of the two budding yeasts, we found that a similar percentage of all genes (~20%) is periodically expressed during the cell cycle in both yeasts. However, the temporal ordering of periodic expression has diverged for some orthologous cell-cycle genes, especially those related to bud emergence and bud growth. Genes regulating DNA replication and mitosis exhibited a conserved ordering in both yeasts, suggesting that essential cell-cycle processes are conserved in periodicity and in timing of expression (i.e. duplication before division). In S. cerevisiae cells, we have proposed that an interconnected network of periodic transcription factors (TFs) controls the bulk of the cell-cycle transcriptional program. We found that temporal ordering of orthologous network TFs was not always maintained; however, the TF network topology at cell-cycle commitment appears to be conserved in C. neoformans. During the C. neoformans cell cycle, DNA replication genes, mitosis genes, and 40 genes involved in virulence are periodically expressed. Future work toward understanding the gene regulatory network that controls cell-cycle genes is critical for developing novel antifungals to inhibit pathogen proliferation. PMID:27918582

  12. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  13. SUMOylation of the ING1b tumor suppressor regulates gene transcription

    PubMed Central

    Satpathy, Shankha; Guérillon, Claire; Kim, Tae-Sun; Bigot, Nicolas; Thakur, Satbir; Bonni, Shirin; Riabowol, Karl; Pedeux, Rémy

    2014-01-01

    The INhibitor of Growth (ING) proteins are encoded as multiple isoforms in five ING genes (ING1 –5) and act as type II tumor suppressors. They are growth inhibitory when overexpressed and are frequently mislocalized or downregulated in several forms of cancer. ING1 and ING2 are stoichiometric members of histone deacetylase complexes, whereas ING3–5 are stoichiometric components of different histone acetyltransferase complexes. The INGs target these complexes to histone marks, thus acting as epigenetic regulators. ING proteins affect angiogenesis, apoptosis, DNA repair, metastasis and senescence, but how the proteins themselves are regulated is not yet clear. Here, we find a small ubiquitin-like modification (SUMOylation) of the ING1b protein and identify lysine 193 (K193) as the preferred ING1b SUMO acceptor site. We also show that PIAS4 is the E3 SUMO ligase responsible for ING1b SUMOylation on K193. Sequence alignment reveals that the SUMO consensus site on ING1b contains a phosphorylation-dependent SUMOylation motif (PDSM) and our data indicate that the SUMOylation on K193 is enhanced by the S199D phosphomimic mutant. Using an ING1b protein mutated at the major SUMOylation site (ING1b E195A), we further demonstrate that ING1b SUMOylation regulates the binding of ING1b to the ISG15 and DGCR8 promoters, consequently regulating ISG15 and DGCR8 transcription. These results suggest a role for ING1b SUMOylation in the regulation of gene transcription. PMID:24903338

  14. Genetically regulated hepatic transcripts and pathways orchestrate haematological, biochemical and body composition traits

    PubMed Central

    Ponsuksili, Siriluck; Trakooljul, Nares; Hadlich, Frieder; Haack, Fiete; Murani, Eduard; Wimmers, Klaus

    2016-01-01

    The liver is the central metabolic organ and exhibits fundamental functions in haematological traits. Hepatic expression, haematological, plasma biochemical, and body composition traits were assessed in a porcine model (n = 297) to establish tissue-specific genetic variations that influence the function of immune-metabolism-correlated expression networks. At FDR (false discovery rate) <1%, more than 3,600 transcripts were jointly correlated (r = |0.22–0.48|) with the traits. Functional enrichment analysis demonstrated common links of metabolic and immune traits. To understand how immune and metabolic traits are affected via genetic regulation of gene expression, eQTLs were assessed. 20517 significant (FDR < 5%) eQTLs for 1401 transcripts were identified, among which 443 transcripts were associated with at least one of the examined traits and had cis-eQTL (such as ACO1 (6.52 × 10−7) and SOD1 (6.41 × 10−30). The present study establishes a comprehensive view of hepatic gene activity which links together metabolic and immune traits in a porcine model for medical research. PMID:28000754

  15. SUMOylation regulates the transcriptional repression activity of FOG-2 and its association with GATA-4.

    PubMed

    Perdomo, José; Jiang, Xing-Mai; Carter, Daniel R; Khachigian, Levon M; Chong, Beng H

    2012-01-01

    Friend of GATA 2 (FOG-2), a co-factor of several GATA transcription factors (GATA-4, -5 and 6), is a critical regulator of coronary vessel formation and heart morphogenesis. Here we demonstrate that FOG-2 is SUMOylated and that this modification modulates its transcriptional activity. FOG-2 SUMOylation occurs at four lysine residues (K324, 471, 915, 955) [corrected]. Three of these residues are part of the characteristic SUMO consensus site (ψKXE), while K955 is found in the less frequent TKXE motif. Absence of SUMOylation did not affect FOG-2's nuclear localization. However, mutation of the FOG-2 SUMOylation sites, or de-SUMOylation, with SENP-1 or SENP-8 resulted in stronger transcriptional repression activity in both heterologous cells and cardiomyocytes. Conversely, increased FOG-2 SUMOylation by overexpression of SUMO-1 or expression of a SUMO-1-FOG-2 fusion protein rendered FOG-2 incapable of repressing GATA-4-mediated activation of the B-type natriuretic peptide (BNP) promoter. Moreover, we demonstrate both increased interaction between a FOG-2 SUMO mutant and GATA-4 and enhanced SUMOylation of wild-type FOG-2 by co-expression of GATA-4. These data suggest a new dynamics in which GATA-4 may alter the activity of FOG-2 by influencing its SUMOylation status.

  16. Genetics and Diet Regulate Vitamin A Production via the Homeobox Transcription Factor ISX*

    PubMed Central

    Lobo, Glenn P.; Amengual, Jaume; Baus, Diane; Shivdasani, Ramesh A.; Taylor, Derek; von Lintig, Johannes

    2013-01-01

    Low dietary intake of β-carotene is associated with chronic disease and vitamin A deficiency. β-Carotene is converted to vitamin A in the intestine by the enzyme β-carotene-15,15′-monoxygenase (BCMO1) to support vision, reproduction, immune function, and cell differentiation. Considerable variability for this key step in vitamin A metabolism, as reported in the human population, could be related to genetics and individual vitamin A status, but it is unclear how these factors influence β-carotene metabolism and vitamin A homeostasis. Here we show that the intestine-specific transcription factor ISX binds to the Bcmo1 promoter. Moreover, upon induction by the β-carotene derivative retinoic acid, this ISX binding decreased expression of a luciferase reporter gene in human colonic CaCo-2 cells indicating that ISX acts as a transcriptional repressor of BCMO1 expression. Mice deficient for this transcription factor displayed increased intestinal BCMO1 expression and produced significantly higher amounts of vitamin A from supplemental β-carotene. The ISX binding site in the human BCMO1 promoter contains a common single nucleotide polymorphism that is associated with decreased conversion rates and increased fasting blood levels of β-carotene. Thus, our study establishes ISX as a critical regulator of vitamin A production and provides a mechanistic explanation for how both genetics and diet can affect this process. PMID:23393141

  17. Transcriptional organization and regulation of the Escherichia coli K30 group 1 capsule biosynthesis (cps) gene cluster.

    PubMed

    Rahn, Andrea; Whitfield, Chris

    2003-02-01

    Escherichia coli group 1 capsules are important virulence determinants, yet little is known about the transcriptional organization or regulation of their biosynthetic (cps) operons. Transcription of the prototype serotype K30 cluster is modulated by the JUMPStart-RfaH antitermination mechanism, with the cps promoter being localized to a region immediately upstream of the JUMPStart sequence. A putative stem-loop structure located within the K30 cps cluster separates conserved genes with products that are required for surface expression of capsule from serotype-specific genes encoding enzymes for polymer repeat-unit synthesis and polymerization. This putative stem-loop structure significantly reduces transcription in a termination-probe vector and may contribute to differential expression of the cps genes. Previous work indicated that increased amounts of group 1 capsular polysaccharide synthesis resulted from the overexpression of the Rcs (regulator of capsule synthesis) proteins. However, neither overexpression of the transcriptional activator RcsB nor an rcsB::aadA chromosomal insertion altered the level of transcription measured by cps::lacZ fusions. In the group 1 strains examined, an RcsAB box was found immediately upstream of galF, a gene involved in the production of sugar nucleotide precursors. Overexpression of RcsB was found to result in a threefold increase in transcription of a galF::lacZ chromosomal fusion. Moreover, overexpression of GalF gave rise to a two- to threefold increase in cell-free as well as cell-associated capsule, without affecting cps::lacZ activity. These results indicate that transcription of the E. coli group 1 capsule cluster itself is not regulated by the Rcs system and may, in fact, be constitutive. However, the Rcs system can potentially influence levels of capsular polysaccharide production by increasing galF transcription and influencing the available pool of biosynthetic precursors.

  18. TransFind—predicting transcriptional regulators for gene sets

    PubMed Central

    Kiełbasa, Szymon M.; Klein, Holger; Roider, Helge G.; Vingron, Martin; Blüthgen, Nils

    2010-01-01

    The analysis of putative transcription factor binding sites in promoter regions of coregulated genes allows to infer the transcription factors that underlie observed changes in gene expression. While such analyses constitute a central component of the in-silico characterization of transcriptional regulatory networks, there is still a lack of simple-to-use web servers able to combine state-of-the-art prediction methods with phylogenetic analysis and appropriate multiple testing corrected statistics, which returns the results within a short time. Having these aims in mind we developed TransFind, which is freely available at http://transfind.sys-bio.net/. PMID:20511592

  19. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

  20. Sucrose-mediated transcriptional regulation of sucrose symporter activity in the phloem.

    SciTech Connect

    Matt Vaughn Greg Harrington Daniel R Bush

    2002-08-06

    This project was based on our discovery that sucrose acts as a signaling molecule that regulates the activity of a proton-sucrose symporter in sugar beet leaf tissue. A major objective here was determining how sucrose transporter activity is being regulated. When sucrose accumulates in the phloem sucrose transport activity drops dramatically. Western blots of plasma membrane proteins isolated from sucrose treated leaves showed that the loss of sucrose transport activity was proportional to a decline in symporter abundance, demonstrating that sucrose transport is regulated by changes in the amount of BvSUT1 protein. BvSUT1 transcript levels decreased in parallel with the loss of sucrose transport activity. Nuclear run-on experiments demonstrated that BvSUT1 gene transcription was repressed significantly in nuclei from leaves fed 100 mM exogenous sucrose, showing that sucrose-dependent modulation of BvSUT1 mRNA levels is mediated by changes in transcription. To identify which secondary messenger systems might be involved in regulating symporter activity, we used a variety of pharmacological agents to probe for a role of calcium or protein phosphorylation in sucrose signaling. In a detailed analysis, only okadaic acid altered sucrose transport activity. These results suggest a protein phosphatase is involved. We hypothesized that protein kinase inhibitors would have a neutral affect or increase symporter transcription. Transpirational feeding of the protein kinase inhibitor staurosporine had no impact on sucrose transport while calphostin C, an inhibitor of protein kinase C, caused a 60% increase. These data provided good evidence that protein phosphorylation plays a central role in regulating sucrose symporter expression and sucrose transport activity. To determine whether protein phosphorylation is involved in sucrose regulation of proton-sucrose symporter activity, we pre-fed leaves with staurosporine for 4 h and then fed the treated leaves water or 100 mM sucrose

  1. Transcription regulation by distal enhancers: who's in the loop?

    PubMed

    Stadhouders, Ralph; van den Heuvel, Anita; Kolovos, Petros; Jorna, Ruud; Leslie, Kris; Grosveld, Frank; Soler, Eric

    2012-01-01

    Genome-wide chromatin profiling efforts have shown that enhancers are often located at large distances from gene promoters within the noncoding genome. Whereas enhancers can stimulate transcription initiation by communicating with promoters via chromatin looping mechanisms, we propose that enhancers may also stimulate transcription elongation by physical interactions with intronic elements. We review here recent findings derived from the study of the hematopoietic system.

  2. Demonstration of transcriptional regulation of specific genes by phytochrome action

    PubMed Central

    Silverthorne, Jane; Tobin, Elaine M.

    1984-01-01

    We have developed an in vitro transcription system that uses nuclei isolated from Lemna gibba G-3. The in vitro transcripts include sequences homologous to hybridization probes for the small subunit of ribulose-1,5-bisphosphate carboxylase [3-phospho-D-glycerate carboxy-lyase (dimerizing), EC 4.1.1.39], the light-harvesting chlorophyll a/b-protein, and rRNA. Light-harvesting chlorophyll a/b-protein sequences are transcribed to a greater extent in nuclei isolated from plants grown in darkness with 2 min of red light every 8 hr than in nuclei isolated from dark-treated plants. Furthermore, the amount of these transcripts measured in plants given a single minute of red light after dark treatment is increased over the amount measured in dark-treated plants. The effect of red light is at least partially reversible by 10 min of far-red light given immediately after the red light pulse. Transcription of both rRNA and small subunit sequences is also stimulated by a single minute of red light as compared to dark-treated tissue. However, the relative magnitudes of the increases compared to the dark levels are smaller than the increase seen for the chlorophyll a/b-protein, possibly because of the higher level of transcription of these sequences in the dark. The effect of red light on the transcription of small subunit and rRNA sequences is also reversible by immediate treatment with 10 min of far-red light. Pulse chase studies of dark-treated nuclei for up to 110 min do not show substantial turnover of in vitro labeled small subunit and chlorophyll a/b-protein transcripts. We therefore conclude that phytochrome action has induced specific changes in transcription of these genes. Images PMID:16593420

  3. Mblk-1 Transcription Factor Family: Its Roles in Various Animals and Regulation by NOL4 Splice Variants in Mammals.

    PubMed

    Takayanagi-Kiya, Seika; Kiya, Taketoshi; Kunieda, Takekazu; Kubo, Takeo

    2017-01-25

    Transcription factors play critical roles in regulation of neural development and functions. A transcription factor Mblk-1 was previously reported from a screen for factors possibly important for the higher brain functions of the honeybee. This review first summarizes how Mblk-1 was identified, and then provides an overview of the studies of Mblk-1 and their homologs. Mblk-1 family proteins are found broadly in animals and are shown to affect transcription activities. Studies have revealed that the mammalian homologs can interact with several cofactors and together regulate transcription. Interestingly, a recent study using the mouse homologs, Mlr1 and Mlr2, showed that one of their cofactor proteins, NOL4, have several splice variants with different effects on the transactivation activities of Mlr proteins. These findings suggest that there is an additional layer of the regulation of Mblk-1 family proteins by cofactor splice variants and provide novel insights into our current understanding of the roles of the conserved transcription factor family.

  4. Mblk-1 Transcription Factor Family: Its Roles in Various Animals and Regulation by NOL4 Splice Variants in Mammals

    PubMed Central

    Takayanagi-Kiya, Seika; Kiya, Taketoshi; Kunieda, Takekazu; Kubo, Takeo

    2017-01-01

    Transcription factors play critical roles in regulation of neural development and functions. A transcription factor Mblk-1 was previously reported from a screen for factors possibly important for the higher brain functions of the honeybee. This review first summarizes how Mblk-1 was identified, and then provides an overview of the studies of Mblk-1 and their homologs. Mblk-1 family proteins are found broadly in animals and are shown to affect transcription activities. Studies have revealed that the mammalian homologs can interact with several cofactors and together regulate transcription. Interestingly, a recent study using the mouse homologs, Mlr1 and Mlr2, showed that one of their cofactor proteins, NOL4, have several splice variants with different effects on the transactivation activities of Mlr proteins. These findings suggest that there is an additional layer of the regulation of Mblk-1 family proteins by cofactor splice variants and provide novel insights into our current understanding of the roles of the conserved transcription factor family. PMID:28125049

  5. Transcriptional regulation of the FSH receptor: new perspectives

    PubMed Central

    Hermann, Brian P.; Heckert, Leslie L.

    2013-01-01

    The cell-surface receptor for the gonadotropin follicle-stimulating hormone (FSH) is expressed exclusively on Sertoli cells of the testis and granulosa cells of the ovary. FSH signal transduction through its receptor (Fshr) is critical for the timing and maintenance of normal gametogenesis in the mammalian gonad. In the 13 years since the gene encoding Fshr was first cloned, the mechanisms controlling its transcription have been extensively examined, but a clear understanding of what drives its unique cell-specificity remains elusive. Current knowledge of basal Fshr transcription highlights the role of an E-box in the proximal promoter which is bound by the basic helix-loop-helix transcription factors upstream stimulatory factor 1 (Usf1) and Usf2. Recent studies utilizing knockout mice and chromatin immunoprecipitation validated the importance of Usf to Fshr transcription and demonstrated a sexually dimorphic requirement for the Usf proteins to maintain normal Fshr expression. Studies have also shown that the promoter region itself is insufficient for appropriate Fshr expression in transgenic mice, indicating Fshr transcription depends on regulatory elements that lie outside of the promoter. Identification of such elements has been propelled by recent availability of genome sequence data, which facilitated studies using comparative genomics, DNase I hypersensitivity mapping, and transgenic analysis with large fragments of DNA. This review will focus on the current understanding of transcriptional regulatory processes that control expression of rat Fshr, including recent advances from our laboratory. PMID:17084019

  6. The CREB-binding protein affects the circadian regulation of behaviour.

    PubMed

    Maurer, Christian; Winter, Tobias; Chen, Siwei; Hung, Hsiu-Cheng; Weber, Frank

    2016-09-01

    Rhythmic changes in light and temperature conditions form the primary environmental cues that synchronize the molecular circadian clock of most species with the external cycles of day and night. Previous studies established a role for the CREB-binding protein (CBP) in molecular clock function by coactivation of circadian transcription. Here, we report that moderately increased levels of CBP strongly dampen circadian behavioural rhythms without affecting molecular oscillations of circadian transcription. Interestingly, light-dark cycles as well as high temperature facilitated a circadian control of behavioural activity. Based on these observations we propose that in addition to its coactivator function for circadian transcription, CBP is involved in the regulation of circadian behaviour down-stream of the circadian clock.

  7. Polycombs and microRNA-223 regulate human granulopoiesis by transcriptional control of target gene expression.

    PubMed

    Zardo, Giuseppe; Ciolfi, Alberto; Vian, Laura; Starnes, Linda M; Billi, Monia; Racanicchi, Serena; Maresca, Carmen; Fazi, Francesco; Travaglini, Lorena; Noguera, Nelida; Mancini, Marco; Nanni, Mauro; Cimino, Giuseppe; Lo-Coco, Francesco; Grignani, Francesco; Nervi, Clara

    2012-04-26

    Epigenetic modifications regulate developmental genes involved in stem cell identity and lineage choice. NFI-A is a posttranscriptional microRNA-223 (miR-223) target directing human hematopoietic progenitor lineage decision: NFI-A induction or silencing boosts erythropoiesis or granulopoiesis, respectively. Here we show that NFI-A promoter silencing, which allows granulopoiesis, is guaranteed by epigenetic events, including the resolution of opposing chromatin "bivalent domains," hypermethylation, recruitment of polycomb (PcG)-RNAi complexes, and miR-223 promoter targeting activity. During granulopoiesis, miR-223 localizes inside the nucleus and targets the NFI-A promoter region containing PcGs binding sites and miR-223 complementary DNA sequences, evolutionarily conserved in mammalians. Remarkably, both the integrity of the PcGs-RNAi complex and DNA sequences matching the seed region of miR-223 are required to induce NFI-A transcriptional silencing. Moreover, ectopic miR-223 expression in human myeloid progenitors causes heterochromatic repression of NFI-A gene and channels granulopoiesis, whereas its stable knockdown produces the opposite effects. Our findings indicate that, besides the regulation of translation of mRNA targets, endogenous miRs can affect gene expression at the transcriptional level, functioning in a critical interface between chromatin remodeling complexes and the genome to direct fate lineage determination of hematopoietic progenitors.

  8. The transcriptional repressor Nab1 is a specific regulator of pathological cardiac hypertrophy.

    PubMed

    Buitrago, Monika; Lorenz, Kristina; Maass, Alexander H; Oberdorf-Maass, Silke; Keller, Ursula; Schmitteckert, Eva M; Ivashchenko, Yuri; Lohse, Martin J; Engelhardt, Stefan

    2005-08-01

    Hypertrophy represents the major physiological response of the heart to adapt to chronically enhanced workload, but is also crucial in the development of heart failure. Although we know of numerous inducers of cardiac hypertrophy, little is known about mechanisms that limit cardiac hypertrophy. Here, we describe the transcriptional repressor NAB1 as an endogenous regulator of cardiac growth. We identified NAB1 as being upregulated in both mouse and human heart failure. Nab1 is highly expressed in mammalian cardiac myocytes and it inhibited cardiomyocyte hypertrophy through repression of its targets, transcription factor Egr. Transgenic mice with cardiac-specific overexpression of Nab1 showed that Nab1 is a potent inhibitor of cardiac growth in response to pathological stimuli in vivo. Nab1 overexpression suppressed adrenergically induced and pressure overload-induced hypertrophy, whereas physiological growth during development and in response to exercise was not affected. These findings implicate the Nab1-Egr1 axis as a crucial regulator of pathological cardiac growth.

  9. E. coli 6S RNA: a universal transcriptional regulator within the centre of growth adaptation.

    PubMed

    Geissen, René; Steuten, Benedikt; Polen, Tino; Wagner, Rolf

    2010-01-01

    Bacterial 6S RNA has been shown to bind with high affinity to σ(70)-containing RNA polymerase, suppressing σ(70)-dependent transcription during stationary phase, when 6S RNA concentrations are highest. We recently reported a genome-wide transcriptional comparison of wild-type and 6S RNA deficient E. coli strains. Contrary to the expected σ(70)- and stationary phase-specific regulatory effect of 6S RNA it turned out that mRNA levels derived from many alternative sigma factors, including σ(38) or σ(32), were affected during exponential and stationary growth. Among the most noticeably down-regulated genes at stationary growth are ribosomal proteins and factors involved in translation. In addition, a striking number of mRNA levels coding for enzymes involved in the purine metabolism, for transporters and stress regulators are altered both during log- and stationary phase. During the study we discovered a link between 6S RNA and the general stress alarmone ppGpp, which has a higher basal level in cells deficient in 6S RNA. This finding points to a functional interrelation of 6S RNA and the global network of stress and growth adaptation.

  10. Functions of the Magnaporthe oryzae Flb3p and Flb4p transcription factors in the regulation of conidiation.

    PubMed

    Matheis, S; Yemelin, A; Scheps, D; Andresen, K; Jacob, S; Thines, E; Foster, A J

    2017-03-01

    The Magnaporthe oryzae genes FLB3 and FLB4, orthologues of the Aspergillus nidulans regulators of conidiation FlbC and FlbD, were inactivated. These genes encode C2H2 zinc finger and Myb-like transcription factors, respectively, in A. nidulans. Analysis of the resultant mutants demonstrated that FLB4 is essential for spore formation and that strains lacking this gene are fluffy in their colony morphology due to an inability to complete conidiophore formation. Meanwhile, FLB3 is required for normal levels of aerial mycelium formation. We identified genes dependent on both transcription factors using microarray analysis. This analysis revealed that the transcription of several genes encoding proteins implicated in sporulation in Magnaporthe oryzae and other filamentous fungi are affected by FLB3 or FLB4 inactivation. Furthermore, the microarray analysis indicates that Flb3p may effectively reprogramme the cell metabolically by repressing transcription of genes encoding biosynthetic enzymes and inducing transcription of genes encoding catabolic enzymes. Additionally, qRT-PCR was employed and showed that FLB3 and FLB4 transcripts are enriched in synchronously sporulating cultures, as were the transcripts of other genes that are necessary for normal conidiation, consistent with a role for their gene products in this process.

  11. Post-transcriptional regulation in the myo1Δ mutant of Saccharomyces cerevisiae

    PubMed Central

    2010-01-01

    Background Saccharomyces cerevisiae myosin type II-deficient (myo1Δ) strains remain viable and divide, despite the absence of a cytokinetic ring, by activation of the PKC1-dependent cell wall integrity pathway (CWIP). Since the myo1Δ transcriptional fingerprint is a subset of the CWIP fingerprint, the myo1Δ strain may provide a simplified paradigm for cell wall stress survival. Results To explore the post-transcriptional regulation of the myo1Δ stress response, 1,301 differentially regulated ribosome-bound mRNAs were identified by microarray analysis of which 204 were co-regulated by transcription and translation. Four categories of mRNA were significantly affected - protein biosynthesis, metabolism, carbohydrate metabolism, and unknown functions. Nine genes of the 20 CWIP fingerprint genes were post-transcriptionally regulated. Down and up regulation of selected ribosomal protein and cell wall biosynthesis mRNAs was validated by their distribution in polysomes from wild type and myo1Δ strains. Western blot analysis revealed accumulation of the phosphorylated form of eukaryotic translation initiation factor 2 (eIF2α-P) and a reduction in the steady state levels of the translation initiation factor eIF4Gp in myo1Δ strains. Deletion of GCN2 in myo1Δ abolished eIF2αp phosphorylation, and showed a severe growth defect. The presence of P-bodies in myo1Δ strains suggests that the process of mRNA sequestration is active, however, the three representative down regulated RP mRNAs, RPS8A, RPL3 and RPL7B were present at equivalent levels in Dcp2p-mCh-positive immunoprecipitated fractions from myo1Δ and wild type cells. These same RP mRNAs were also selectively co-precipitated with eIF2α-P in myo1Δ strains. Conclusions Quantitative analysis of ribosome-associated mRNAs and their polyribosome distributions suggests selective regulation of mRNA translation efficiency in myo1Δ strains. Inhibition of translation initiation factor eIF2α (eIF2α-P) in these strains

  12. Switching on sex: transcriptional regulation of the testis-determining gene Sry.

    PubMed

    Larney, Christian; Bailey, Timothy L; Koopman, Peter

    2014-06-01

    Mammalian sex determination hinges on the development of ovaries or testes, with testis fate being triggered by the expression of the transcription factor sex-determining region Y (Sry). Reduced or delayed Sry expression impairs testis development, highlighting the importance of its accurate spatiotemporal regulation and implying a potential role for SRY dysregulation in human intersex disorders. Several epigenetic modifiers, transcription factors and kinases are implicated in regulating Sry transcription, but it remains unclear whether or how this farrago of factors acts co-ordinately. Here we review our current understanding of Sry regulation and provide a model that assembles all known regulators into three modules, each converging on a single transcription factor that binds to the Sry promoter. We also discuss potential future avenues for discovering the cis-elements and trans-factors required for Sry regulation.

  13. Post-Transcriptional Regulation of Cytokine Signaling by AU-Rich and GU-Rich Elements

    PubMed Central

    Bohjanen, Paul R.

    2014-01-01

    Cytokines are necessary for cell communication to enable responses to external stimuli that are imperative for the survival and maintenance of homeostasis. Dysfunction of the cytokine network has detrimental effects on intra- and extracellular environments. Thus, it is critical that the expression of cytokines and the signals transmitted by cytokines to target cells are tightly regulated at numerous levels, including transcriptional and post-transcriptional levels. Here, we briefly summarize the role of AU-rich elements (AREs) in the regulation of cytokine gene expression at the post-transcriptional level and describe a role for GU-rich elements (GREs) in coordinating the regulation of cytokine signaling. GREs function as post-transcriptional regulators of proteins that control cellular activation, growth, and apoptosis. GREs and AREs work in concert to coordinate cytokine signal transduction pathways. The precise regulation of cytokine signaling is particularly important, because its dysregulation can lead to human diseases. PMID:24697201

  14. Punctual Transcriptional Regulation by the Rice Circadian Clock under Fluctuating Field Conditions[OPEN

    PubMed Central

    Matsuzaki, Jun; Kawahara, Yoshihiro; Izawa, Takeshi

    2015-01-01

    Plant circadian clocks that oscillate autonomously with a roughly 24-h period are entrained by fluctuating light and temperature and globally regulate downstream genes in the field. However, it remains unknown how punctual internal time produced by the circadian clock in the field is and how it is affected by environmental fluctuations due to weather or daylength. Using hundreds of samples of field-grown rice (Oryza sativa) leaves, we developed a statistical model for the expression of circadian clock-related genes integrating diurnally entrained circadian clock with phase setting by light, both responses to light and temperature gated by the circadian clock. We show that expression of individual genes was strongly affected by temperature. However, internal time estimated from expression of multiple genes, which may reflect transcriptional regulation of downstream genes, is punctual to 22 min and not affected by weather, daylength, or plant developmental age in the field. We also revealed perturbed progression of internal time under controlled environment or in a mutant of the circadian clock gene GIGANTEA. Thus, we demonstrated that the circadian clock is a regulatory network of multiple genes that retains accurate physical time of day by integrating the perturbations on individual genes under fluctuating environments in the field. PMID:25757473

  15. Synaptic regulation of affective behaviors; role of BDNF

    PubMed Central

    Ninan, Ipe

    2013-01-01

    Brain derived neurotrophic factor (BDNF), a neurotrophin essential for nervous system development and synaptic plasticity, has been found to have a significant influence on affective behaviors. The notion that an impairment in BDNF signaling might be involved in affective disorders is originated primarily from the opposing effects of antidepressants and stress on BDNF signaling. Antidepressants enhance BDNF signaling and synaptic plasticity. On the other hand, negative environmental factors such as severe stress suppress BDNF signaling, impair synaptic activity and increase susceptibility to affective disorders. Postmortem studies provided strong support for decreased BDNF signaling in depressive disorders. Remarkably, studies in humans with a single nucleotide polymorphism in the BDNF gene, the BDNF Val66Met which affects regulated release of BDNF, showed profound deficits in hippocampal and prefrontal cortical (PFC) plasticity and cognitive behaviors. BDNF regulates synaptic mechanisms responsible for various cognitive processes including attenuation of aversive memories, a key process in the regulation of affective behaviors. The unique role of BDNF in cognitive and affective behaviors suggests that cognitive deficits due to altered BDNF signaling might underlie affective disorders. Understanding how BDNF modulates synapses in neural circuits relevant to affective behaviors, particularly the medial prefrontal cortical (mPFC)-hippocampus-amygdala pathway, and its interaction with development, sex, and environmental risk factors might shed light on potential therapeutic targets for affective disorders. PMID:23747574

  16. Ribbon regulates morphogenesis of the Drosophila embryonic salivary gland through transcriptional activation and repression

    PubMed Central

    Loganathan, Rajprasad; Lee, Joslynn S.; Wells, Michael B.; Grevengoed, Elizabeth; Slattery, Matthew; Andrew, Deborah J.

    2015-01-01

    Transcription factors affect spatiotemporal patterns of gene expression often regulating multiple aspects of tissue morphogenesis, including cell-type specification, cell proliferation, cell death, cell polarity, cell shape, cell arrangement and cell migration. In this work, we describe a distinct role for Ribbon (Rib) in controlling cell shape/volume increases during elongation of the Drosophila salivary gland (SG). Notably, the morphogenetic changes in rib mutants occurred without effects on general SG cell attributes such as specification, proliferation and apoptosis. Moreover, the changes in cell shape/volume in rib mutants occurred without compromising epithelial-specific morphological attributes such as apicobasal polarity and junctional integrity. To identify the genes regulated by Rib, we performed ChIP-seq analysis in embryos driving expression of GFP-tagged Rib specifically in the SGs. To learn if the Rib binding sites identified in the ChIP-seq analysis were linked to changes in gene expression, we performed microarray analysis comparing RNA samples from age-matched wild-type and rib null embryos. From the superposed ChIP-seq and microarray gene expression data, we identified 60 genomic sites bound by Rib likely to regulate SG-specific gene expression. We confirmed several of the identified Rib targets by qRT-pCR and/or in situ hybridization. Our results indicate that Rib regulates cell growth and tissue shape in the Drosophila salivary gland via a diverse array of targets through both transcriptional activation and repression. Furthermore, our results suggest that autoregulation of rib expression may be a key component of the SG morphogenetic gene network. PMID:26477561

  17. Variability of Gene Expression Identifies Transcriptional Regulators of Early Human Embryonic Development

    PubMed Central

    Hasegawa, Yu; Taylor, Deanne; Ovchinnikov, Dmitry A.; Wolvetang, Ernst J.; de Torrenté, Laurence; Mar, Jessica C.

    2015-01-01

    An analysis of gene expression variability can provide an insightful window into how regulatory control is distributed across the transcriptome. In a single cell analysis, the inter-cellular variability of gene expression measures the consistency of transcript copy numbers observed between cells in the same population. Application of these ideas to the study of early human embryonic development may reveal important insights into the transcriptional programs controlling this process, based on which components are most tightly regulated. Using a published single cell RNA-seq data set of human embryos collected at four-cell, eight-cell, morula and blastocyst stages, we identified genes with the most stable, invariant expression across all four developmental stages. Stably-expressed genes were found to be enriched for those sharing indispensable features, including essentiality, haploinsufficiency, and ubiquitous expression. The stable genes were less likely to be associated with loss-of-function variant genes or human recessive disease genes affected by a DNA copy number variant deletion, suggesting that stable genes have a functional impact on the regulation of some of the basic cellular processes. Genes with low expression variability at early stages of development are involved in regulation of DNA methylation, responses to hypoxia and telomerase activity, whereas by the blastocyst stage, low-variability genes are enriched for metabolic processes as well as telomerase signaling. Based on changes in expression variability, we identified a putative set of gene expression markers of morulae and blastocyst stages. Experimental validation of a blastocyst-expressed variability marker demonstrated that HDDC2 plays a role in the maintenance of pluripotency in human ES and iPS cells. Collectively our analyses identified new regulators involved in human embryonic development that would have otherwise been missed using methods that focus on assessment of the average expression

  18. Transcriptional Regulation of Frizzled-1 in Human Osteoblasts by Sp1

    PubMed Central

    Yu, Shibing; Yerges-Armstrong, Laura M.; Chu, Yanxia; Zmuda, Joseph M.; Zhang, Yingze

    2016-01-01

    The wingless pathway has a powerful influence on bone metabolism and is a therapeutic target in skeletal disorders. Wingless signaling is mediated in part through the Frizzled (FZD) receptor family. FZD transcriptional regulation is poorly understood. Herein we tested the hypothesis that Sp1 plays an important role in the transcriptional regulation of FZD1 expression in osteoblasts and osteoblast mineralization. To test this hypothesis, we conducted FZD1 promoter assays in Saos2 cells with and without Sp1 overexpression. We found that Sp1 significantly up-regulates FZD1 promoter activity in Saos2 cells. Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift (EMSA) assays identified a novel and functional Sp1 binding site at -44 to -40 from the translation start site in the FZD1 promoter. The Sp1-dependent activation of the FZD1 promoter was abolished by mithramycin A (MMA), an antibiotic affecting both Sp1 binding and Sp1 protein levels in Saos2 cells. Similarly, down-regulation of Sp1 in hFOB cells resulted in less FZD1 expression and lower alkaline phosphatase activity. Moreover, over-expression of Sp1 increased FZD1 expression and Saos2 cell mineralization while MMA decreased Sp1 and FZD1 expression and Saos2 cell mineralization. Knockdown of FZD1 prior to Sp1 overexpression partially abolished Sp1 stimulation of osteoblast differentiation markers. Taken together, our results suggest that Sp1 plays a role in human osteoblast differentiation and mineralization, which is at least partially mediated by Sp1-dependent transactivation of FZD1. PMID:27695039

  19. Dynamic regulation of eve stripe 2 expression reveals transcriptional bursts in living Drosophila embryos.

    PubMed

    Bothma, Jacques P; Garcia, Hernan G; Esposito, Emilia; Schlissel, Gavin; Gregor, Thomas; Levine, Michael

    2014-07-22

    We present the use of recently developed live imaging methods to examine the dynamic regulation of even-skipped (eve) stripe 2 expression in the precellular Drosophila embryo. Nascent transcripts were visualized via MS2 RNA stem loops. The eve stripe 2 transgene exhibits a highly dynamic pattern of de novo transcription, beginning with a broad domain of expression during nuclear cycle 12 (nc12), and progressive refinement during nc13 and nc14. The mature stripe 2 pattern is surprisingly transient, constituting just ∼15 min of the ∼90-min period of expression. Nonetheless, this dynamic transcription profile faithfully predicts the limits of the mature stripe visualized by conventional in situ detection methods. Analysis of individual transcription foci reveals intermittent bursts of de novo transcription, with duration cycles of 4-10 min. We discuss a multistate model of transcription regulation and speculate on its role in the dynamic repression of the eve stripe 2 expression pattern during development.

  20. Genome-wide assessment of differential roles for p300 and CBP in transcription regulation

    PubMed Central

    Ramos, Yolande F. M.; Hestand, Matthew S.; Verlaan, Matty; Krabbendam, Elise; Ariyurek, Yavuz; van Galen, Michiel; van Dam, Hans; van Ommen, Gert-Jan B.; den Dunnen, Johan T.; Zantema, Alt; ′t Hoen, Peter A. C.

    2010-01-01

    Despite high levels of homology, transcription coactivators p300 and CREB binding protein (CBP) are both indispensable during embryogenesis. They are largely known to regulate the same genes. To identify genes preferentially regulated by p300 or CBP, we performed an extensive genome-wide survey using the ChIP-seq on cell-cycle synchronized cells. We found that 57% of the tags were within genes or proximal promoters, with an overall preference for binding to transcription start and end sites. The heterogeneous binding patterns possibly reflect the divergent roles of CBP and p300 in transcriptional regulation. Most of the 16 103 genes were bound by both CBP and p300. However, after stimulation 89 and 1944 genes were preferentially bound by CBP or p300, respectively. Target genes were found to be primarily involved in the regulation of metabolic and developmental processes, and transcription, with CBP showing a stronger preference than p300 for genes active in negative regulation of transcription. Analysis of transcription factor binding sites suggest that CBP and p300 have many partners in common, but AP-1 and Serum Response Factor (SRF) appear to be more prominent in CBP-specific sequences, whereas AP-2 and SP1 are enriched in p300-specific targets. Taken together, our findings further elucidate the distinct roles of coactivators p300 and CBP in transcriptional regulation. PMID:20435671

  1. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo

    2016-01-01

    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  2. Regulation of cytokine gene transcription in the immune system.

    PubMed

    Holloway, A F; Rao, S; Shannon, M F

    2002-01-01

    The controlled expression of cytokine genes is an essential component of an immune response. The specific types of cytokines as well as the time and place of their production is important in generating an appropriate immune response to an infectious agent. Aberrant expression is associated with pathological conditions of the immune system such as autoimmunity, atopy and chronic inflammation. Cytokine gene transcription is generally induced in a cell-specific manner. Over the last 15 years, a large amount of information has been generated describing the transcriptional controls that are exerted on cytokine genes. Recently, efforts have been directed at understanding how these genes are transcribed in a chromatin context. This review will discuss the mechanisms by which cytokine genes become available for transcription in a cell-restricted manner as well as the mechanisms by which these genes sense their environment and activate high level transcription in a transient manner. Particular attention will be paid to the role of chromatin in allowing transcription factor access to appropriate genes.

  3. Transcriptional regulation of ATG9 by the Pho23-Rpd3 complex modulates the frequency of autophagosome formation.

    PubMed

    Jin, Meiyan; Klionsky, Daniel J

    2014-09-01

    Studies of the physiological and pathological roles of autophagy have revealed that too little or too much autophagy can be detrimental, and therefore autophagy activity needs to be tightly regulated. Altered transcription of autophagy-related (ATG) genes has been reported in many diseases, and ATG genes can be the most direct targets for the treatment of autophagy-associated diseases. Thus, it is important to understand how the amounts of different Atg proteins affect autophagy, and how the expression of their corresponding genes is regulated. Using budding yeast as the model, we showed that Pho23, a component of the Rpd3 large (Rpd3L) complex, represses the transcription of several ATG genes including ATG9, the expression of which regulates the frequency of autophagosome formation. More autophagosomes are formed in PHO23 null cells or in those overexpressing Atg9; conversely, there are fewer autophagosomes seen in cells with reduced Atg9 expression.

  4. The role of abscisic acid in regulating cucumber fruit development and ripening and its transcriptional regulation.

    PubMed

    Wang, Yanping; Wang, Ya; Ji, Kai; Dai, Shengjie; Hu, Ying; Sun, Liang; Li, Qian; Chen, Pei; Sun, Yufei; Duan, Chaorui; Wu, Yan; Luo, Hao; Zhang, Dian; Guo, Yangdong; Leng, Ping

    2013-03-01

    Cucumber (Cucumis sativus L.), a kind of fruit usually harvested at the immature green stage, belongs to non-climacteric fruit. To investigate the contribution of abscisic acid (ABA) to cucumber fruit development and ripening, variation in ABA level was investigated and a peak in ABA level was found in pulp before fruit get fully ripe. To clarify this point further, exogenous ABA was applied to cucumber fruits at two different development stages. Results showed that ABA application at the turning stage promotes cucumber fruit ripening, while application at the immature green stage had inconspicuous effects. In addition, with the purpose of understanding the transcriptional regulation of ABA, two partial cDNAs of CsNCED1 and CsNCED2 encoding 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in ABA biosynthetic pathway; one partial cDNA of CsCYP707A1 for 8'-hydroxylase, a key enzyme in the oxidative catabolism of ABA and two partial cDNAs of CsBG1 and CsBG2 for β-glucosidase (BG) that hydrolyzes ABA glucose ester (ABA-GE) to release active ABA were cloned from cucumber. The DNA and deduced amino acid sequences of these obtained genes respectively showed high similarities to their homologous genes in other plants. Real-time PCR analysis revealed that ABA content may be regulated by its biosynthesis (CsNCEDs), catabolism (CsCYP707A1) and reactivation genes (CsBGs) at the transcriptional level during cucumber fruit development and ripening, in response to ABA application, dehydration and pollination, among which CsNCED1, CsCYP707A1 and CsBG1 were highly expressed in pulp and may play more important roles in regulating ABA metabolism.

  5. Regulation of competence and gene expression in Streptococcus mutans by the RcrR transcriptional regulator

    PubMed Central

    Burne, Robert A.

    2014-01-01

    SUMMARY An intimate linkage between the regulation of biofilm formation, stress tolerance and genetic competence exists in the dental caries pathogen Streptococcus mutans. The rcrRPQ genes encode ABC exporters (RcrPQ) and a MarR-family transcriptional repressor of the rcr operon (RcrR) play a dominant role in regulation of the development of genetic competence and connect competence with stress tolerance and (p)ppGpp production in S. mutans. Here we identify the target for efficient RcrR binding in the rcr promoter region using purified recombinant RcrR (rRcrR) protein in electrophoretic mobility shift assays and show that DNA fragments carrying mutations in the binding region were not bound as efficiently by rRcrR in vitro. Mutations in the RcrR binding site impacted expression from the rcrR promoter in vivo and elicited changes in transformation efficiency, competence gene expression, and growth inhibition by competence stimulating peptide; even when the changes in rcrRPQ transcription were minor. An additional mechanistic linkage of RcrR with competence and (p)ppGpp metabolism was identified by showing that the rRcrR protein could bind to the promoter regions of comX, comYA and relP, although the binding was not as efficient as to the rcrRPQ promoter under the conditions tested. Thus, tightly controlled autogenous regulation of the rcrRPQ operon by RcrR binding to specific target sites is essential for cellular homeostasis, and RcrR contributes to the integration of genetic competence, (p)ppGpp metabolism, and acid and oxidative stress tolerance in S. mutans through both direct and indirect mechanisms. PMID:25146832

  6. Transcriptional Pathways and Potential Therapeutic Targets in the Regulation of Ncx1 Expression in Cardiac Hypertrophy and Failure

    PubMed Central

    Li, Mona S.; Chernysh, Olga; Renaud, Ludivine; Kimbrough, Denise; Kasiganesan, Harinath; Mani, Santhosh K.

    2013-01-01

    Changes in cardiac gene expression contribute to the progression of heart failure by affecting cardiomyocyte growth, function, and survival. The Na+ -Ca2+ exchanger gene (Ncx1) is upregulated in hypertrophy and is often found elevated in end-stage heart failure. Studies have shown that the change in its expression contributes to contractile dysfunction. Several transcriptional pathways mediate Ncx1 expression in pathological cardiac remodeling. Both α-adrenergic receptor (α-AR) and β-adrenergic receptor (β-AR) signaling can play a role in the regulation of calcium homeostasis in the cardiomyocyte, but chronic activation in periods of cardiac stress contributes to heart failure by mechanisms which include Ncx1 upregulation. Our studies have even demonstrated that NCX1 can directly act as a regulator of “activity-dependent signal transduction” mediating changes in its own expression. Finally, we present evidence that histone deacetylases (HDACs) and histone acetyltransferases (HATs) act as master regulators of Ncx1 expression. We show that many of the transcription factors regulating Ncx1 expression are important in cardiac development and also in the regulation of many other genes in the so-called fetal gene program, which are activated by pathological stimuli. Importantly, studies have revealed that the transcriptional network regulating Ncx1 expression is also mediating many of the other changes in genetic remodeling contributing to the development of cardiac dysfunction and revealed potential therapeutic targets for the treatment of hypertrophy and failure. PMID:23224875

  7. Ribavirin suppresses bacterial virulence by targeting LysR-type transcriptional regulators

    PubMed Central

    Mandal, Rahul Shubhra; Ta, Atri; Sinha, Ritam; Theeya, Nagaraja; Ghosh, Anirban; Tasneem, Mohsina; Bhunia, Anirban; Koley, Hemanta; Das, Santasabuj

    2016-01-01

    Targeting bacterial virulence mechanisms without compromising bacterial growth is a promising strategy to prevent drug resistance. LysR-type transcriptional regulators (LTTRs) possess structural conservation across bacterial species and regulate virulence in numerous pathogens, making them attractive targets for antimicrobial agents. We targeted AphB, a Vibrio cholerae LTTR, which regulates the expression of genes encoding cholera toxin and toxin-co-regulated pilus for inhibitor designing. Since AphB ligand is unknown, we followed a molecular fragment-based approach for ligand designing using FDA-approved drugs and subsequent screen to identify molecules that exhibited high-affinity binding to AphB ligand-binding pocket. Among the identified compounds, ribavirin, an anti-viral drug, antagonized AphB functions. Ribavirin perturbed Vibrio cholerae pathogenesis in animal models. The inhibitory effects of the drug was limited to the bacteria expressing wild type AphB, but not its constitutively active mutant (AphBN100E), which represents the ligand-bound state, suggesting that ribavirin binds to the active site of AphB to exert its inhibitory role and there exists no AphB-independent mechanism of its action. Similarly, ribavirin suppressed the functions of Salmonella Typhi LTTR Hrg, indicating its broad spectrum efficacy. Moreover, ribavirin did not affect the bacterial viability in culture. This study cites an example of drug repurposing for anti-infective therapy. PMID:27991578

  8. Following the affect: learning to observe emotional regulation.

    PubMed

    Delaney, Kathleen R

    2006-11-01

    On inpatient psychiatric units, staff deal with children and adolescents whose affect escalates quickly and intensely. These same children experience strong emotions that they can neither understand nor explain. To intervene effectively, inpatient staff must understand the regulation issues underneath the escalated behaviors. Emotion Regulation theory and the developmental line of emotional understanding are useful concepts in assessing and intervening with these children and adolescents. Presented here are criteria to guide inpatient staff's assessment of children and adolescents with emotion regulation difficulties. The assessment cues are based in concepts of Emotion Regulation and emotional understanding and are accompanied by suggested intervention strategies.

  9. COMBINING PROTEIN AND mRNA QUANTIFICATION TO DECIPHER TRANSCRIPTIONAL REGULATION

    PubMed Central

    Xu, Heng; Sepúlveda, Leonardo A.; Figard, Lauren; Sokac, Anna Marie; Golding, Ido

    2015-01-01

    We combine immunofluorescence and single-molecule fluorescence in situ hybridization (smFISH), followed by automated image analysis, to quantify the concentration of nuclear transcription factors, number of transcription factors bound, and number of nascent mRNAs synthesized at individual gene loci. A theoretical model is used to decipher how transcription-factor binding modulates the stochastic kinetics of mRNA production. We demonstrate this approach by examining the regulation of hunchback in the early Drosophila embryo. PMID:26098021

  10. Mean-field vs. Stochastic Models for Transcriptional Regulation

    NASA Astrophysics Data System (ADS)

    Blossey, Ralf; Giuraniuc, Claudiu

    2009-03-01

    We introduce a minimal model description for the dynamics of transcriptional regulatory networks. It is studied within a mean-field approximation, i.e., by deterministic ode's representing the reaction kinetics, and by stochastic simulations employing the Gillespie algorithm. We elucidate the different results both approaches can deliver, depending on the network under study, and in particular depending on the level of detail retained in the respective description. Two examples are addressed in detail: the repressilator, a transcriptional clock based on a three-gene network realized experimentally in E. coli, and a bistable two-gene circuit under external driving, a transcriptional network motif recently proposed to play a role in cellular development.

  11. Mean-field versus stochastic models for transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Blossey, R.; Giuraniuc, C. V.

    2008-09-01

    We introduce a minimal model description for the dynamics of transcriptional regulatory networks. It is studied within a mean-field approximation, i.e., by deterministic ODE’s representing the reaction kinetics, and by stochastic simulations employing the Gillespie algorithm. We elucidate the different results that both approaches can deliver, depending on the network under study, and in particular depending on the level of detail retained in the respective description. Two examples are addressed in detail: The repressilator, a transcriptional clock based on a three-gene network realized experimentally in E. coli, and a bistable two-gene circuit under external driving, a transcriptional network motif recently proposed to play a role in cellular development.

  12. TRANSCRIPTION. Allosteric transcriptional regulation via changes in the overall topology of the core promoter.

    PubMed

    Philips, Steven J; Canalizo-Hernandez, Monica; Yildirim, Ilyas; Schatz, George C; Mondragón, Alfonso; O'Halloran, Thomas V

    2015-08-21

    Many transcriptional activators act at a distance from core promoter elements and work by recruiting RNA polymerase through protein-protein interactions. We show here how the prokaryotic regulatory protein CueR both represses and activates transcription by differentially modulating local DNA structure within the promoter. Structural studies reveal that the repressor state slightly bends the promoter DNA, precluding optimal RNA polymerase-promoter recognition. Upon binding a metal ion in the allosteric site, CueR switches into an activator conformation. It maintains all protein-DNA contacts but introduces torsional stresses that kink and undertwist the promoter, stabilizing an A-form DNA-like conformation. These factors switch on and off transcription by exerting dynamic control of DNA stereochemistry, reshaping the core promoter and making it a better or worse substrate for polymerase.

  13. The ORCA2 transcription factor plays a key role in regulation of the terpenoid indole alkaloid pathway

    PubMed Central

    2013-01-01

    Background The terpenoid indole alkaloid (TIA) pathway leads to the production of pharmaceutically important drugs, such as the anticancer compounds vinblastine and vincristine. Unfortunately, these drugs are produced in trace amounts, causing them to be very costly. To increase production of these drugs, an improved understanding of the TIA regulatory pathway is needed. Towards this end, transgenic Catharanthus roseus hairy roots that overexpress the ORCA2 TIA transcriptional activator were generated and characterized. Results Transcriptional profiling experiments revealed that overexpression of ORCA2 results in altered expression of key genes from the indole and terpenoid pathways, which produce precursors for the TIA pathway, and from the TIA pathway itself. In addition, metabolite-profiling experiments revealed that overexpression of ORCA2 significantly affects the levels of several TIA metabolites. ORCA2 overexpression also causes significant increases in transcript levels of several TIA regulators, including TIA transcriptional repressors. Conclusions Results presented here indicate that ORCA2 plays a critical role in regulation of TIA metabolism. ORCA2 regulates expression of key genes from both feeder pathways, as well as the genes (STR and SGD) encoding the enzymes that catalyze the first two steps in TIA biosynthesis. ORCA2 may play an especially important role in regulation of the downstream branches of the TIA pathway, as it regulates four out of five genes characterized from this part of the pathway. Regulation of TIA transcriptional repressors by ORCA2 may provide a mechanism whereby increases in TIA metabolite levels in response to external stimuli are transient and limited in magnitude. PMID:24099172

  14. A positive role for polycomb in transcriptional regulation via H4K20me1

    PubMed Central

    Lv, Xiangdong; Han, Zhijun; Chen, Hao; Yang, Bo; Yang, Xiaofeng; Xia, Yuanxin; Pan, Chenyu; Fu, Lin; Zhang, Shuo; Han, Hui; Wu, Min; Zhou, Zhaocai; Zhang, Lei; Li, Lin; Wei, Gang; Zhao, Yun

    2016-01-01

    The highly conserved polycomb group (PcG) proteins maintain heritable transcription repression of the genes essential for development from fly to mammals. However, sporadic reports imply a potential role of PcGs in positive regulation of gene transcription, although systematic investigation of such function and the underlying mechanism has rarely been reported. Here, we report a Pc-mediated, H3K27me3-dependent positive transcriptional regulation of Senseless (Sens), a key transcription factor required for development. Mechanistic studies show that Pc regulates Sens expression by promoting H4K20me1 at the Sens locus. Further bioinformatic analysis at genome-wide level indicates that the existence of H4K20me1 acts as a selective mark for positive transcriptional regulation by Pc/H3K27me3. Both the intensities and specific patterns of Pc and H3K27me3 are important for the fates of target gene transcription. Moreover, binding of transcription factor Broad (Br), which physically interacts with Pc and positively regulates the transcription of Sens, is observed in Pc+H3K27me3+H4K20me1+ genes, but not in Pc+H3K27me3+H4K20me1− genes. Taken together, our study reveals that, coupling with the transcription factor Br, Pc positively regulates transcription of Pc+H3K27me3+H4K20me1+ genes in developing Drosophila wing disc. PMID:27002220

  15. Flexible parasympathetic responses to sadness facilitate spontaneous affect regulation.

    PubMed

    Stange, Jonathan P; Hamilton, Jessica L; Fresco, David M; Alloy, Lauren B

    2017-03-23

    The ability of the parasympathetic nervous system to flexibly adapt to changes in environmental context is thought to serve as a physiological indicator of self-regulatory capacity, and deficits in parasympathetic flexibility appear to characterize affective disorders such as depression. However, whether parasympathetic flexibility (vagal withdrawal to emotional or environmental challenges such as sadness, and vagal augmentation during recovery from sadness) could facilitate the effectiveness of adaptive affect regulation strategies is not known. In a study of 178 undergraduate students, we evaluated whether parasympathetic flexibility in response to a sad film involving loss would enhance the effectiveness of regulatory strategies (reappraisal, distraction, and suppression) spontaneously employed to reduce negative affect during a 2-min uninstructed recovery period following the induction. Parasympathetic reactivity and recovery were indexed by fluctuations in respiratory sinus arrhythmia and high-frequency heart rate variability. Cognitive reappraisal and distraction were more effective in attenuating negative affect among individuals with more parasympathetic flexibility, particularly greater vagal augmentation during recovery, relative to individuals with less parasympathetic flexibility. In contrast, suppression was associated with less attenuation of negative affect, but only among individuals who also had less vagal withdrawal during the sad film. Alternative models provided partial support for reversed directionality, with reappraisal predicting greater parasympathetic recovery, but only when individuals also experienced greater reductions in negative affect. These results suggest that contextually appropriate parasympathetic reactivity and recovery may facilitate the success of affect regulation. Impairments in parasympathetic flexibility could confer risk for affective disorders due to attenuated capacity for effective self-regulation.

  16. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants

    PubMed Central

    Nuruzzaman, Mohammed; Sharoni, Akhter M.; Kikuchi, Shoshi

    2013-01-01

    NAC transcription factors are one of the largest families of transcriptional regulators in plants, and members of the NAC gene family have been suggested to play important roles in the regulation of the transcriptional reprogramming associated with plant stress responses. A phylogenetic analysis of NAC genes, with a focus on rice and Arabidopsis, was performed. Herein, we present an overview of the regulation of the stress responsive NAC SNAC/(IX) group of genes that are implicated in the resistance to different stresses. SNAC factors have important roles for the control of biotic and abiotic stresses tolerance and that their overexpression can improve stress tolerance via biotechnological approaches. We also review the recent progress in elucidating the roles of NAC transcription factors in plant biotic and abiotic stresses. Modification of the expression pattern of transcription factor genes and/or changes in their activity contribute to the elaboration of various signaling pathways and regulatory networks. However, a single NAC gene often responds to several stress factors, and their protein products may participate in the regulation of several seemingly disparate processes as negative or positive regulators. Additionally, the NAC proteins function via auto-regulation or cross-regulation is extensively found among NAC genes. These observations assist in the understanding of the complex mechanisms of signaling and transcriptional reprogramming controlled by NAC proteins. PMID:24058359

  17. Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells.

    PubMed

    Min, Irene M; Waterfall, Joshua J; Core, Leighton J; Munroe, Robert J; Schimenti, John; Lis, John T

    2011-04-01

    Transitions between pluripotent stem cells and differentiated cells are executed by key transcription regulators. Comparative measurements of RNA polymerase distribution over the genome's primary transcription units in different cell states can identify the genes and steps in the transcription cycle that are regulated during such transitions. To identify the complete transcriptional profiles of RNA polymerases with high sensitivity and resolution, as well as the critical regulated steps upon which regulatory factors act, we used genome-wide nuclear run-on (GRO-seq) to map the density and orientation of transcriptionally engaged RNA polymerases in mouse embryonic stem cells (ESCs) and mouse embryonic fibroblasts (MEFs). In both cell types, progression of a promoter-proximal, paused RNA polymerase II (Pol II) into productive elongation is a rate-limiting step in transcription of ∼40% of mRNA-encoding genes. Importantly, quantitative comparisons between cell types reveal that transcription is controlled frequently at paused Pol II's entry into elongation. Furthermore, "bivalent" ESC genes (exhibiting both active and repressive histone modifications) bound by Polycomb group complexes PRC1 (Polycomb-repressive complex 1) and PRC2 show dramatically reduced levels of paused Pol II at promoters relative to an average gene. In contrast, bivalent promoters bound by only PRC2 allow Pol II pausing, but it is confined to extremely 5' proximal regions. Altogether, these findings identify rate-limiting targets for transcription regulation during cell differentiation.

  18. RNA-binding proteins involved in post-transcriptional regulation in bacteria

    PubMed Central

    Van Assche, Elke; Van Puyvelde, Sandra; Vanderleyden, Jos; Steenackers, Hans P.

    2015-01-01

    Post-transcriptional regulation is a very important mechanism to control gene expression in changing environments. In the past decade, a lot of interest has been directed toward the role of small RNAs (sRNAs) in bacterial post-transcriptional regulation. However, sRNAs are not the only molecules controlling gene expression at this level, RNA-binding proteins (RBPs) play an important role as well. CsrA and Hfq are the two best studied bacterial proteins of this type, but recently, additional proteins involved in post-transcriptional control have been identified. This review focuses on the general working mechanisms of post-transcriptionally active RBPs, which include (i) adaptation of the susceptibility of mRNAs and sRNAs to RNases, (ii) modulating the accessibility of the ribosome binding site of mRNAs, (iii) recruiting and assisting in the interaction of mRNAs with other molecules and (iv) regulating transcription terminator/antiterminator formation, and gives an overview of both the well-studied and the newly identified proteins that are involved in post-transcriptional regulatory processes. Additionally, the post-transcriptional mechanisms by which the expression or the activity of these proteins is regulated, are described. For many of the newly identified proteins, however, mechanistic questions remain. Most likely, more post-transcriptionally active proteins will be identified in the future. PMID:25784899

  19. Modeling Writing Development: Contribution of Transcription and Self-Regulation to Portuguese Students' Text Generation Quality

    ERIC Educational Resources Information Center

    Limpo, Teresa; Alves, Rui A.

    2013-01-01

    Writing is a complex activity that requires transcription and self-regulation. We used multiple-group structural equation modeling to test the contribution of transcription (handwriting and spelling), planning, revision, and self-efficacy to writing quality at 2 developmental points (Grades 4-6 vs. 7-9). In Grades 4-6, the model explained 76% of…

  20. The Transcriptional Cascade in the Heat Stress Response of Arabidopsis Is Strictly Regulated at the Level of Transcription Factor Expression.

    PubMed

    Ohama, Naohiko; Kusakabe, Kazuya; Mizoi, Junya; Zhao, Huimei; Kidokoro, Satoshi; Koizumi, Shinya; Takahashi, Fuminori; Ishida, Tetsuya; Yanagisawa, Shuichi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2016-01-01

    Group A1 heat shock transcription factors (HsfA1s) are the master regulators of the heat stress response (HSR) in plants. Upon heat shock, HsfA1s trigger a transcriptional cascade that is composed of many transcription factors. Despite the importance of HsfA1s and their downstream transcriptional cascade in the acquisition of thermotolerance in plants, the molecular basis of their activation remains poorly understood. Here, domain analysis of HsfA1d, one of several HsfA1s in Arabidopsis thaliana, demonstrated that the central region of HsfA1d is a key regulatory domain that represses HsfA1d transactivation activity through interaction with HEAT SHOCK PROTEIN70 (HSP70) and HSP90. We designated this region as the temperature-dependent repression (TDR) domain. We found that HSP70 dissociates from HsfA1d in response to heat shock and that the dissociation is likely regulated by an as yet unknown activation mechanism, such as HsfA1d phosphorylation. Overexpression of constitutively active HsfA1d that lacked the TDR domain induced expression of heat shock proteins in the absence of heat stress, thereby conferring potent thermotolerance on the overexpressors. However, transcriptome analysis of the overexpressors demonstrated that the constitutively active HsfA1d could not trigger the complete transcriptional cascade under normal conditions, thereby indicating that other factors are necessary to fully induce the HSR. These complex regulatory mechanisms related to the transcriptional cascade may enable plants to respond resiliently to various heat stress conditions.

  1. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  2. GRLD-1 regulates cell-wide abundance of glutamate receptor through post-transcriptional regulation

    PubMed Central

    Wang, George J.; Kang, Lijun; Kim, Julie E.; Maro, Géraldine S.; Xu, X. Z. Shawn; Shen, Kang

    2011-01-01

    AMPA receptors mediate most of the fast postsynaptic response at glutamatergic synapses. The abundance of AMPA receptors in neurons and at postsynaptic membranes is tightly regulated. Changes in synaptic AMPA receptor levels have been proposed to be a key regulatory event in synaptic plasticity and learning and memory. While the local, synapse-specific regulation of AMPA receptors has been intensely studied, the global, cell-wide control is less well understood. Using a forward genetic approach, we identified Glutamate Receptor Level Decreased-1 (GRLD-1), a putative RNA-binding protein that is required for efficient production of GLR-1 in the AVE interneurons in the nematode Caenorhabditis elegans. In grld-1 mutants, GLR-1 levels were drastically reduced. Consistently, both glutamate-induced currents in AVE and glr-1-dependent nose-touch avoidance behavior were defective in grld-1 mutants. We propose that this evolutionarily conserved family of proteins controls the abundance of GLR-1 by regulating glr-1 transcript splicing. PMID:21037582

  3. Genomic approaches to identifying transcriptional regulators of osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Civitelli, Roberto

    2003-01-01

    Recent microarray studies of mouse and human osteoblast differentiation in vitro have identified novel transcription factors that may be important in the establishment and maintenance of differentiation. These findings help unravel the pattern of gene-expression changes that underly the complex process of bone formation.

  4. Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors.

    PubMed

    Thiel, Gerald; Rössler, Oliver G

    2017-03-01

    Resveratrol (trans-3,4',5-trihydroxystilbene), a polyphenolic phytoalexin of grapes and other fruits and plants, is a common constituent of our diet and of dietary supplements. Many health-promoting benefits have been connected with resveratrol in the treatment of cardiovascular diseases, cancer, diabetes, inflammation, neurodegeneration, and diseases connected with aging. To explain the pleiotropic effects of resveratrol, the molecular targets of this compound have to be identified on the cellular level. Resveratrol induces intracellular signal transduction pathways which ultimately lead to changes in the gene expression pattern of the cells. Here, we review the effect of resveratrol on the activation of the stimulus-responsive transcription factors CREB, AP-1, Egr-1, Elk-1, and Nrf2. Following activation, these transcription factors induce transcription of delayed response genes. The gene products of these delayed response genes are ultimately responsible for the changes in the biochemistry and physiology of resveratrol-treated cells. The activation of stimulus-responsive transcription factors may explain many of the intracellular activities of resveratrol. However, results obtained in vitro may not easily be transferred to in vivo systems.

  5. Transcriptional regulation of kinases downstream of the T cell receptor: another immunomodulatory mechanism of glucocorticoids

    PubMed Central

    2014-01-01

    Background Glucocorticoids affect peripheral immune responses, including modulation of T-cell activation, differentiation, and apoptosis. The quantity and quality of T-cell receptor (TCR)-triggered intracellular signals modulate T-cell function. Thus, glucocorticoids may affect T cells by interfering with the TCR signaling cascade. The purpose of the study was to search for glucocorticoid-modulated kinases downstream of the TCR. Methods Gene modulation in lymphoid cells either treated with glucocorticoids or from glucocorticoid-treated mice was studied using a RNase protection assay, real-time PCR, and western blotting. The sensitivity of genetically modified thymocytes to glucocorticoid-induced apoptosis was studied by performing hypotonic propidium iodide staining and flow cytometry. The Student’s t-test was employed for statistical evaluation. Results We found that transcription of Itk, a non-receptor tyrosine kinase of the Tec family, was up-regulated in a mouse T-cell hybridoma by the synthetic glucocorticoid dexamethasone. In contrast, dexamethasone down-regulated the expression of Txk, a Tec kinase that functions redundantly with Itk, and Lck, the Src kinase immediately downstream of the TCR. We investigated the expression of Itk, Txk, and Lck in thymocytes and mature lymphocytes following in vitro and in vivo dexamethasone treatment at different time points and doses. Kinase expression was differentially modulated and followed distinct kinetics. Itk was up-regulated in all cell types and conditions tested. Txk was strongly up-regulated in mature lymphocytes but only weakly up-regulated or non-modulated in thymocytes in vitro or in vivo, respectively. Conversely, Lck was down-regulated in thymocytes, but not modulated or up-regulated in mature lymphocytes in the different experimental conditions. This complex behaviour correlates with the presence of both positive and negative glucocorticoid responsive elements (GRE and nGRE, respectively) in the Itk, Txk

  6. Transcriptional programs regulated by both LEAFY and APETALA1 at the time of flower formation.

    PubMed

    Winter, Cara M; Yamaguchi, Nobutoshi; Wu, Miin-Feng; Wagner, Doris

    2015-09-01

    Two key regulators of the switch to flower formation and of flower patterning in Arabidopsis are the plant-specific helix-turn-helix transcription factor LEAFY (LFY) and the MADS box transcription factor APETALA1 (AP1). The interactions between these two transcriptional regulators are complex. AP1 is both a direct target of LFY and can act in parallel with LFY. Available genetic and molecular evidence suggests that LFY and AP1 together orchestrate the switch to flower formation and early events during flower morphogenesis by altering transcriptional programs. However, very little is known about target genes regulated by both transcription factors. Here, we performed a meta-analysis of public datasets to identify genes that are likely to be regulated by both LFY and AP1. Our analyses uncovered known and novel direct LFY and AP1 targets with a role in the control of onset of flower formation. It also identified additional families of proteins and regulatory pathways that may be under transcriptional control by both transcription factors. In particular, several of these genes are linked to response to hormones, to transport and to development. Finally, we show that the gibberellin catabolism enzyme ELA1, which was recently shown to be important for the timing of the switch to flower formation, is positively feedback-regulated by AP1. Our study contributes to the elucidation of the regulatory network that leads to formation of a vital plant organ system, the flower.

  7. Transcriptional regulation of the novobiocin biosynthetic gene cluster.

    PubMed

    Dangel, Volker; Härle, Johannes; Goerke, Christiane; Wolz, Christiane; Gust, Bertolt; Pernodet, Jean-Luc; Heide, Lutz

    2009-12-01

    The aminocoumarin antibiotic novobiocin is a gyrase inhibitor formed by a Streptomyces strain. The biosynthetic gene cluster of novobiocin spans 23.4 kb and contains 20 coding sequences, among them the two regulatory genes novE and novG. We investigated the location of transcriptional promoters within this cluster by insertion of transcriptional terminator cassettes and RT-PCR analysis of the resulting mutants. The cluster was found to contain eight DNA regions with promoter activity. The regulatory protein NovG binds to a previously identified binding site within the promoter region located upstream of novH, but apparently not to any of the other seven promoters. Quantitative real-time PCR was used to compare the number of transcripts in a strain carrying an intact novobiocin cluster with strains carrying mutated clusters. Both in-frame deletion of the regulatory gene novG and insertion of a terminator cassette into the biosynthetic gene novH led to a strong reduction of the number of transcripts of the genes located between novH and novW. This suggested that these 16 biosynthetic genes form a single operon. Three internal promoters are located within this operon but appear to be of minor importance, if any, under our experimental conditions. Transcription of novG was found to depend on the presence of NovE, suggesting that the two regulatory genes, novE and novG, act in a cascade-like mechanism. The resistance gene gyrB(R), encoding an aminocoumarin-resistant gyrase B subunit, may initially be co-transcribed with the genes from novH to novW. However, when the gyrase inhibitor novobiocin accumulates in the cultures, gyrB(R) is transcribed from its own promoter. Previous work has suggested that this promoter is controlled by the superhelical density of chromosomal DNA.

  8. Feedback regulation of PRL secretion is mediated by the transcription factor, signal transducer, and activator of transcription 5b.

    PubMed

    Grattan, D R; Xu, J; McLachlan, M J; Kokay, I C; Bunn, S J; Hovey, R C; Davey, H W

    2001-09-01

    PRL secretion from the anterior pituitary gland is inhibited by dopamine produced in the tuberoinfundibular dopamine neurons of the hypothalamus. The activity of tuberoinfundibular dopamine neurons is stimulated by PRL; thus, PRL regulates its own secretion by a negative feedback mechanism. PRL receptors are expressed on tuberoinfundibular dopamine neurons, but the intracellular signaling pathway is not known. We have observed that mice with a disrupted signal transducer and activator of transcription 5b gene have grossly elevated serum PRL concentrations. Despite this hyperprolactinemia, mRNA levels and immunoreactivity of tyrosine hydroxylase, the key enzyme in dopamine synthesis, were significantly lower in the tuberoinfundibular dopamine neurons of these signal transducer and activator of transcription 5b-deficient mice. Concentrations of the dopamine metabolite dihydroxyphenylacetic acid in the median eminence were also significantly lower in signal transducer and activator of transcription 5b-deficient mice than in wild-type mice. No changes were observed in nonhypothalamic dopaminergic neuronal populations, indicating that the effects were selective to tuberoinfundibular dopamine neurons. These data indicate that in the absence of signal transducer and activator of transcription 5b, PRL signal transduction in tuberoinfundibular dopamine neurons is impaired, and they demonstrate that this transcription factor plays an obligatory and nonredundant role in mediating the negative feedback action of PRL on tuberoinfundibular dopamine neurons.

  9. Functional interaction between SNPs and microsatellite in the transcriptional regulation of insulin-like growth factor 1.

    PubMed

    Chen, Holly Y; Huang, Wei; Leung, Vincent H K; Fung, Simon L M; Ma, Suk Ling; Jiang, Hongling; Tang, Nelson L S

    2013-09-01

    A CA-repeat microsatellite in insulin-like growth factor 1 (IGF1) promoter was associated with interindividual variation of circulating IGF1 level. Previously, we reported that such association was due to variation of haplotype unit in a linkage disequilibrium block composed of microsatellite and single-nucleotide polymorphisms (SNPs), suggesting the presence of an interaction between them. In this study, reporter assays were performed to investigate the regulatory effect and interaction of genetic variants on gene expression. We used an in vitro system to compare the transcriptional activities of haplotypes (rs35767:T>C, the CA-repeat microsatellite, rs5742612:T>C, and rs2288377:T>A) in evolutionarily conserved region of IGF1 promoter. In haplotype C-T-T, a longer microsatellite had a lower transcriptional activity (17.6 ± 2.4-fold for 17 repeats and 8.3 ± 1.1-fold for 21 repeats), whereas in haplotype T-C-A, such trend could not be observed, as the microsatellite with 21 repeats had the highest transcriptional activity (17.5 ± 2.3-fold). Because the microsatellite and SNPs affected the transcriptional activity of each other, there may be an interaction between them in the regulation of IGF1 expression. For the first time, we demonstrated that a noncoding microsatellite polymorphism could act as a functional unit and interact with SNPs in the regulation of transcription in human genome.

  10. Nato3 integrates with the Shh-Foxa2 transcriptional network regulating the differentiation of midbrain dopaminergic neurons.

    PubMed

    Nissim-Eliraz, Einat; Zisman, Sophie; Schatz, Omri; Ben-Arie, Nissim

    2013-09-01

    Mesencephalic dopaminergic (mesDA) neurons originate from the floor plate of the midbrain, a transient embryonic organizing center located at the ventral-most midline. Since the loss of mesDA leads to Parkinson's disease, the molecular mechanisms controlling the genesis and differentiation of dopaminergic progenitors are extensively studied and the identification and characterization of new genes is of interest. Here, we show that the expression of the basic helix-loop-helix transcription factor Nato3 (Ferd3l) increases in parallel to the differentiation of SN4741 dopaminergic cells in vitro. Nato3 transcription is directly regulated by the transcription factor Foxa2, a target and effector of the Sonic hedgehog (Shh) signaling cascade. Moreover, pharmacological inhibition of Shh signaling downregulated the expression of Nato3, thus defining Nato3 as a novel component of one of the major pathways controlling cell patterning and generation of mesDA. Furthermore, we show that Nato3 regulated Shh and Foxa2 through a novel feed-backward loop. Up- and downregulation of Nato3 further affected the transcription of Nurr1, implicated in the genesis of mesDA, but not of TH. Taken together, these data shed new light on the transcriptional networks controlling the generation of mesDA and may be utilized in the efforts to direct stem cells towards a dopaminergic fate.

  11. Genetic variants in SIRT3 transcriptional regulatory region affect promoter activity and fat deposition in three cattle breeds.

    PubMed

    Gui, Linsheng; Hong, Jieyun; Raza, Sayed Haidar Abbas; Zan, Linsen

    2016-12-12

    Sirtuin 3 (SIRT3) is a mitochondrial nicotinamide adenine dinucleotide (NAD)-dependent deacetylase. It has crucial roles in regulating the respiratory chain, in adenosine triphosphate (ATP) production, and in both the citric acid and urea cycles. The aim of this study was to investigate whether SIRT3 could be used as a candidate gene in the breeding of cattle. Expression analysis by quantitative real-time polymerase chain reactions (qPCR) indicated that expression levels of SIRT3 were highest in the kidney, rumen, liver, omasum and muscle. Using sequencing technology on a total of 913 cattle representing three indigenous Chinese beef cattle breeds, three single nucleotide polymorphisms (SNPs) were identified in the promoter region of SIRT3, and five haplotypes representing five potential transcription factor compositions of polymorphic potential cis-acting elements. Association analysis indicated that the Hap3/8 diplotype performed better than other combinations in intramuscular fat content. In addition, the promoter activity with Hap1 haplotype was higher than the Hap8 haplotype, consistent with the association analysis. The results indicate that the polymorphisms in transcription factor binding sites of SIRT3 promoter may affect the transcriptional activity of SIRT3, and thus alter intramuscular fat content in beef cattle.

  12. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.

    2014-01-01

    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  13. Akirin Links Twist-Regulated Transcription with the Brahma Chromatin Remodeling Complex during Embryogenesis

    PubMed Central

    Nowak, Scott J.; Aihara, Hitoshi; Gonzalez, Katie; Nibu, Yutaka; Baylies, Mary K.

    2012-01-01

    The activities of developmentally critical transcription factors are regulated via interactions with cofactors. Such interactions influence transcription factor activity either directly through protein–protein interactions or indirectly by altering the local chromatin environment. Using a yeast double-interaction screen, we identified a highly conserved nuclear protein, Akirin, as a novel cofactor of the key Drosophila melanogaster mesoderm and muscle transcription factor Twist. We find that Akirin interacts genetically and physically with Twist to facilitate expression of some, but not all, Twist-regulated genes during embryonic myogenesis. akirin mutant embryos have muscle defects consistent with altered regulation of a subset of Twist-regulated genes. To regulate transcription, Akirin colocalizes and genetically interacts with subunits of the Brahma SWI/SNF-class chromatin remodeling complex. Our results suggest that, mechanistically, Akirin mediates a novel connection between Twist and a chromatin remodeling complex to facilitate changes in the chromatin environment, leading to the optimal expression of some Twist-regulated genes during Drosophila myogenesis. We propose that this Akirin-mediated link between transcription factors and the Brahma complex represents a novel paradigm for providing tissue and target specificity for transcription factor interactions with the chromatin remodeling machinery. PMID:22396663

  14. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    SciTech Connect

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  15. The PRR family of transcriptional regulators reflects the complexity and evolution of plant circadian clocks.

    PubMed

    Farré, Eva M; Liu, Tiffany

    2013-10-01

    Circadian clocks are internal time-keeping mechanisms that provide an adaptive advantage by enabling organisms to anticipate daily changes and orchestrate biological processes accordingly. Circadian regulated pseudo-response regulators are key components of transcription/translation circadian networks in green alga and plants. Recent studies in Arabidopsis thaliana have shown that most of them act as transcriptional repressors and directly regulate output pathways suggesting a close relationship between the central oscillator and circadian regulated processes. Moreover, phylogenetic studies on this small gene family have shed light on the evolution of circadian clocks in the green lineage.

  16. Disorders of Transcriptional Regulation: An Emerging Category of Multiple Malformation Syndromes

    PubMed Central

    Izumi, Kosuke

    2016-01-01

    Some genetic disorders caused by mutations in genes encoding components of the transcriptional machinery as well as proteins involved in epigenetic modification of the genome share many overlapping features, such as facial dysmorphisms, growth problems and developmental delay/intellectual disability. As a basis for some shared phenotypic characteristics in these syndromes, a similar transcriptome disturbance, characterized by global transcriptional dysregulation, is believed to play a major role. In this review article, a general overview of gene transcription is provided, and the current knowledge of the mechanisms underlying some disorders of transcriptional regulation, such as Rubinstein- Taybi, Coffin-Siris, Cornelia de Lange, and CHOPS syndromes, are discussed. PMID:27867341

  17. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    SciTech Connect

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-08-23

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  18. INO80-dependent regression of ecdysone-induced transcriptional responses regulates developmental timing in Drosophila.

    PubMed

    Neuman, Sarah D; Ihry, Robert J; Gruetzmacher, Kelly M; Bashirullah, Arash

    2014-03-15

    Sequential pulses of the steroid hormone ecdysone regulate the major developmental transitions in Drosophila, and the duration of each developmental stage is determined by the length of time between ecdysone pulses. Ecdysone regulates biological responses by directly initiating target gene transcription. In turn, these transcriptional responses are known to be self-limiting, with mechanisms in place to ensure regression of hormone-dependent transcription. However, the biological significance of these transcriptional repression mechanisms remains unclear. Here we show that the chromatin remodeling protein INO80 facilitates transcriptional repression of ecdysone-regulated genes during prepupal development. In ino80 mutant animals, inefficient repression of transcriptional responses to the late larval ecdysone pulse delays the onset of the subsequent prepupal ecdysone pulse, resulting in a significantly longer prepupal stage. Conversely, increased expression of ino80 is sufficient to shorten the prepupal stage by increasing the rate of transcriptional repression. Furthermore, we demonstrate that enhancing the rate of regression of the mid-prepupal competence factor βFTZ-F1 is sufficient to determine the timing of head eversion and thus the duration of prepupal development. Although ino80 is conserved from yeast to humans, this study represents the first characterization of a bona fide ino80 mutation in any metazoan, raising the possibility that the functions of ino80 in transcriptional repression and developmental timing are evolutionarily conserved.

  19. Transcriptional networks regulating the costamere, sarcomere, and other cytoskeletal structures in striated muscle.

    PubMed

    Estrella, Nelsa L; Naya, Francisco J

    2014-05-01

    Structural abnormalities in striated muscle have been observed in numerous transcription factor gain- and loss-of-function phenotypes in animal and cell culture model systems, indicating that transcription is important in regulating the cytoarchitecture. While most characterized cytoarchitectural defects are largely indistinguishable by histological and ultrastructural criteria, analysis of dysregulated gene expression in each mutant phenotype has yielded valuable information regarding specific structural gene programs that may be uniquely controlled by each of these transcription factors. Linking the formation and maintenance of each subcellular structure or subset of proteins within a cytoskeletal compartment to an overlapping but distinct transcription factor cohort may enable striated muscle to control cytoarchitectural function in an efficient and specific manner. Here we summarize the available evidence that connects transcription factors, those with established roles in striated muscle such as MEF2 and SRF, as well as other non-muscle transcription factors, to the regulation of a defined cytoskeletal structure. The notion that genes encoding proteins localized to the same subcellular compartment are coordinately transcriptionally regulated may prompt rationally designed approaches that target specific transcription factor pathways to correct structural defects in muscle disease.

  20. Regulation of heterochromatin transcription by Snail1/LOXL2 during epithelial-to-mesenchymal transition.

    PubMed

    Millanes-Romero, Alba; Herranz, Nicolás; Perrera, Valentina; Iturbide, Ane; Loubat-Casanovas, Jordina; Gil, Jesús; Jenuwein, Thomas; García de Herreros, Antonio; Peiró, Sandra

    2013-12-12

    Although heterochromatin is enriched with repressive traits, it is also actively transcribed, giving rise to large amounts of noncoding RNAs. Although these RNAs are responsible for the formation and maintenance of heterochromatin, little is known about how their transcription is regulated. Here, we show that the Snail1 transcription factor represses mouse pericentromeric transcription, acting through the H3K4 deaminase LOXL2. Since Snail1 plays a key role in the epithelial-to-mesenchymal transition (EMT), we analyzed the regulation of heterochromatin transcription in this process. At the onset of EMT, one of the major structural heterochromatin proteins, HP1α, is transiently released from heterochromatin foci in a Snail1/LOXL2-dependent manner, concomitantly with a downregulation of major satellite transcription. Moreover, preventing the downregulation of major satellite transcripts compromised the migratory and invasive behavior of mesenchymal cells. We propose that Snail1 regulates heterochromatin transcription through LOXL2, thus creating the favorable transcriptional state necessary for completing EMT.

  1. Multiple cis-elements and trans-acting factors regulate dynamic spatio-temporal transcription of let-7 in Caenorhabditis elegans.

    PubMed

    Kai, Zoya S; Finnegan, Emily F; Huang, Stacey; Pasquinelli, Amy E

    2013-02-01

    The let-7 microRNA (miRNA) is highly conserved across animal phyla and generally regulates cellular differentiation and developmental timing pathways. In Caenorhabditis elegans, the mature let-7 miRNA starts to accumulate in the last stages of larval development where it directs cellular differentiation programs required for adult fates. Here, we show that expression of the let-7 gene in C. elegans is under complex transcriptional control. The onset of let-7 transcription begins as early as the first larval stage in some tissues, and as late as the third larval stage in others, and is abrogated at the gravid adult stage. Transcription from two different start sites in the let-7 promoter oscillates during each larval stage. We show that transcription is regulated by two distinct cis-elements in the promoter of let-7, the previously described temporal regulatory element (TRE), and a novel element downstream of the TRE that we have named the let-7 transcription element (LTE). These elements play distinct and redundant roles in regulating let-7 expression in specific tissues. In the absence of the TRE and LTE, transcription of let-7 is undetectable and worms exhibit the lethal phenotype characteristic of let-7 null mutants. We also identify several genes that affect the transcription of let-7 generally and tissue-specifically. Overall, spatio-temporal regulation of let-7 transcription is orchestrated by multiple cis- and trans-acting factors to ensure appropriate expression of this essential miRNA during worm development.

  2. Transcriptional regulation of the bovine oxytocin receptor gene.

    PubMed

    Telgmann, Ralph; Bathgate, Ross A D; Jaeger, Stefanie; Tillmann, Gina; Ivell, Richard

    2003-03-01

    The oxytocin receptor (OTR) is expressed in the cow uterus at high levels at estrus and at term of pregnancy. This expression appears to be controlled mostly at the transcriptional level and correlates with increasing estrogen concentration and progesterone withdrawal. Approximately 3200 base pairs of the upstream region of the bovine OTR gene were cloned and analyzed using a combination of bioinformatic, electrophoretic mobility shift (EMSA), and transfection analyses. Using nuclear proteins from high- and low-expressing tissues, EMSA indicated no significant quantitative or qualitative changes in specific DNA-protein binding, suggesting that transcription is probably controlled by signalling systems targeting constitutive factors. Using various cell types, including primary and immortalized ruminant endometrial epithelial cells, as hosts for transfection of promoter-reporter constructs showed that endogenous activity resided only in the longest, i.e., 3.2-kb, construct but not in those shorter than 1.0 kb. While estrogen appears to be important in vivo, no effect of estradiol was found on any construct directly; only when the longest 3.2-kb construct was used in combination with some cotransfected steroid receptor cofactors, e.g., SRC1e, was an estradiol-dependent effect observed. A putative interferon-responsive element (IRE) was found at approximately -2,400 from the transcription start site. This element was shown to bind mouse IRF1 and IRF2 as well as similar proteins from bovine endometrial and myometrial nuclear extracts. This element also responded to these factors when cotransfected into various cell types. The bovine equivalents to IRF1 and IRF2 were molecularly cloned from endometrial tissue and shown to be expressed in a temporal fashion, supporting the role of interferon-tau in maternal recognition of pregnancy. Of many factors tested or analyzed, these components of the IFN system are the only ones found to significantly influence the transcription

  3. Contribution of transcriptional regulation to natural variations in Arabidopsis

    PubMed Central

    Chen, Wenqiong J; Chang, Sherman H; Hudson, Matthew E; Kwan, Wai-King; Li, Jingqiu; Estes, Bram; Knoll, Daniel; Shi, Liang; Zhu, Tong

    2005-01-01

    Background Genetic control of gene transcription is a key component in genome evolution. To understand the transcriptional basis of natural variation, we have studied genome-wide variations in transcription and characterized the genetic variations in regulatory elements among Arabidopsis accessions. Results Among five accessions (Col-0, C24, Ler, WS-2, and NO-0) 7,508 probe sets with no detectable genomic sequence variations were identified on the basis of the comparative genomic hybridization to the Arabidopsis GeneChip microarray, and used for accession-specific transcriptome analysis. Two-way ANOVA analysis has identified 60 genes whose mRNA levels differed in different accession backgrounds in an organ-dependent manner. Most of these genes were involved in stress responses and late stages of plant development, such as seed development. Correlation analysis of expression patterns of these 7,508 genes between pairs of accessions identified a group of 65 highly plastic genes with distinct expression patterns in each accession. Conclusion Genes that show substantial genetic variation in mRNA level are those with functions in signal transduction, transcription and stress response, suggesting the existence of variations in the regulatory mechanisms for these genes among different accessions. This is in contrast to those genes with significant polymorphisms in the coding regions identified by genomic hybridization, which include genes encoding transposon-related proteins, kinases and disease-resistance proteins. While relatively fewer sequence variations were detected on average in the coding regions of these genes, a number of differences were identified from the upstream regions, several of which alter potential cis-regulatory elements. Our results suggest that nucleotide polymorphisms in regulatory elements of genes encoding controlling factors could be primary targets of natural selection and a driving force behind the evolution of Arabidopsis accessions. PMID

  4. A NAC Transcription Factor Represses Putrescine Biosynthesis and Affects Drought Tolerance.

    PubMed

    Wu, Hao; Fu, Bing; Sun, Peipei; Xiao, Chang; Liu, Ji-Hong

    2016-11-01

    Arginine decarboxylase (ADC)-mediated putrescine biosynthesis plays an important role in plant stress responses, but the transcriptional regulation of ADC in response to abiotic stress is not well understood. We isolated a NAM, ATAF1/2, and CUC (NAC) domain-containing transcription factor, PtrNAC72, from trifoliate orange (Poncirus trifoliata) by yeast one-hybrid screening. PtrNAC72, localized to the nucleus, binds specifically to the promoter of PtADC and acts as a transcriptional repressor. PtrNAC72 expression was induced by cold, drought, and abscisic acid. ADC messenger RNA abundance and putrescine levels were decreased in transgenic tobacco (Nicotiana nudicaulis) plants overexpressing PtrNAC72 but increased, compared with the wild type, in an Arabidopsis (Arabidopsis thaliana) transfer DNA insertion mutant, nac72 While transgenic tobacco lines overexpressing PtrNAC72 were more sensitive to drought, plants of the Arabidopsis nac72 mutant exhibited enhanced drought tolerance, consistent with the accumulation of reactive oxygen species in the tested genotypes. In addition, exogenous application of putrescine to the overexpression lines restored drought tolerance, while treatment with d-arginine, an ADC inhibitor, compromised the drought tolerance of nac72 Taken together, these results demonstrate that PtrNAC72 is a repressor of putrescine biosynthesis and may negatively regulate the drought stress response, at least in part, via the modulation of putrescine-associated reactive oxygen species homeostasis.

  5. Transcriptional regulation of steroid hydroxylase genes by corticotropin.

    PubMed Central

    John, M E; John, M C; Boggaram, V; Simpson, E R; Waterman, M R

    1986-01-01

    Maintenance of optimal steroidogenic capacity in the adrenal cortex is the result of a cAMP-dependent response to the peptide hormone corticotropin (ACTH). The molecular mechanism of this action of ACTH has been examined by using five recombinant DNA clones specific for enzymes of the steroidogenic pathway (P-450scc, P-45011 beta, P-450C21, P-45017 alpha, and adrenodoxin). The presence of nuclear precursors in steady-state RNA samples derived from cultured bovine adrenocortical cells and moderate increases in the number of RNA chain initiations, as determined by in vitro nuclear run-off assays, indicate that ACTH controls the expression of the gene(s) for each of these proteins at the transcriptional level. The ACTH-mediated increase in accumulation of transcripts specific for steroid hydroxylases in nuclear RNA can be specifically blocked by inhibiting protein synthesis in bovine adrenocortical cell cultures. The steady-state concentrations of nuclear RNA for control genes show no decrease upon cycloheximide treatment. These studies suggest that a primary action of ACTH in the adrenal cortex is to activate (via cAMP) the synthesis of rapidly turning over protein factors that in turn mediate increased initiation of transcription of steroid hydroxylase genes. We propose that these protein factors impart specificity of induction to genes encoding components of this pathway in steroidogenic tissues. Images PMID:3014507

  6. Osterix represses adipogenesis by negatively regulating PPARγ transcriptional activity.

    PubMed

    Han, Younho; Kim, Chae Yul; Cheong, Heesun; Lee, Kwang Youl

    2016-10-18

    Osterix is a novel bone-related transcription factor involved in osteoblast differentiation, and bone maturation. Because a reciprocal relationship exists between adipocyte and osteoblast differentiation of bone marrow derived mesenchymal stem cells, we hypothesized that Osterix might have a role in adipogenesis. Ablation of Osterix enhanced adipogenesis in 3T3-L1 cells, whereas overexpression suppressed this process and inhibited the expression of adipogenic markers including CCAAT/enhancer-binding protein alpha (C/EBPα) and peroxisome proliferator-activated receptor gamma (PPARγ). Further studies indicated that Osterix significantly decreased PPARγ-induced transcriptional activity. Using co-immunoprecipitation and GST-pull down analysis, we found that Osterix directly interacts with PPARγ. The ligand-binding domain (LBD) of PPARγ was responsible for this interaction, which was followed by repression of PPARγ-induced transcriptional activity, even in the presence of rosiglitazone. Taken together, we identified the Osterix has an important regulatory role on PPARγ activity, which contributed to the mechanism of adipogenesis.

  7. Hepatocytes in collagen sandwich: evidence for transcriptional and translational regulation

    PubMed Central

    1992-01-01

    The influence of extracellular matrix configuration on the tissue- specific function of cultured hepatocytes was investigated. Adult rat hepatocytes sandwiched between two layers of collagen gel were compared to cells cultured on a single layer of collagen gel for differences in the total RNA content, the level of albumin-specific mRNA, the rate of albumin gene transcription, and the rate of albumin mRNA translation. Adult hepatocytes in the sandwich system maintained the level of albumin mRNA similar to that found in the normal liver for at least six weeks, whereas the level of albumin mRNA declined rapidly in the single gel system. After one week of culture, hepatocytes in the single gel system could be induced to recover the high level of albumin mRNA and albumin production when a second layer of collagen gel was overlaid at that time. Furthermore, sandwiched hepatocytes maintained significantly higher transcriptional activity compared to cells in the single gel system. In addition to transcriptional control, the ultimate rate of albumin production was shown to depend on the rate of translation, which increased with culture time and reached a plateau in one to two weeks. This increase in translational activity over time in culture was observed in both the sandwich and the single gel systems and, thus, appeared to be independent of the configuration of extracellular matrix. PMID:1734019

  8. Retroviral transcriptional regulation and embryonic stem cells: war and peace.

    PubMed

    Schlesinger, Sharon; Goff, Stephen P

    2015-03-01

    Retroviruses have evolved complex transcriptional enhancers and promoters that allow their replication in a wide range of tissue and cell types. Embryonic stem (ES) cells, however, characteristically suppress transcription of proviruses formed after infection by exogenous retroviruses and also of most members of the vast array of endogenous retroviruses in the genome. These cells have unusual profiles of transcribed genes and are poised to make rapid changes in those profiles upon induction of differentiation. Many of the transcription factors in ES cells control both host and retroviral genes coordinately, such that retroviral expression patterns can serve as markers of ES cell pluripotency. This overlap is not coincidental; retrovirus-derived regulatory sequences are often used to control cellular genes important for pluripotency. These sequences specify the temporal control and perhaps "noisy" control of cellular genes that direct proper cell gene expression in primitive cells and their differentiating progeny. The evidence suggests that the viral elements have been domesticated for host needs, reflecting the wide-ranging exploitation of any and all available DNA sequences in assembling regulatory networks.

  9. Retroviral Transcriptional Regulation and Embryonic Stem Cells: War and Peace

    PubMed Central

    Schlesinger, Sharon

    2014-01-01

    Retroviruses have evolved complex transcriptional enhancers and promoters that allow their replication in a wide range of tissue and cell types. Embryonic stem (ES) cells, however, characteristically suppress transcription of proviruses formed after infection by exogenous retroviruses and also of most members of the vast array of endogenous retroviruses in the genome. These cells have unusual profiles of transcribed genes and are poised to make rapid changes in those profiles upon induction of differentiation. Many of the transcription factors in ES cells control both host and retroviral genes coordinately, such that retroviral expression patterns can serve as markers of ES cell pluripotency. This overlap is not coincidental; retrovirus-derived regulatory sequences are often used to control cellular genes important for pluripotency. These sequences specify the temporal control and perhaps “noisy” control of cellular genes that direct proper cell gene expression in primitive cells and their differentiating progeny. The evidence suggests that the viral elements have been domesticated for host needs, reflecting the wide-ranging exploitation of any and all available DNA sequences in assembling regulatory networks. PMID:25547290

  10. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed

    Jin, S; Sonenshein, A L

    1994-08-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ.

  11. Myeloid-Derived Suppressor Cell Survival and Function Are Regulated by the Transcription Factor Nrf2.

    PubMed

    Beury, Daniel W; Carter, Kayla A; Nelson, Cassandra; Sinha, Pratima; Hanson, Erica; Nyandjo, Maeva; Fitzgerald, Phillip J; Majeed, Amry; Wali, Neha; Ostrand-Rosenberg, Suzanne

    2016-04-15

    Tumor-induced myeloid-derived suppressor cells (MDSC) contribute to immune suppression in tumor-bearing individuals and are a major obstacle to effective immunotherapy. Reactive oxygen species (ROS) are one of the mechanisms used by MDSC to suppress T cell activation. Although ROS are toxic to most cells, MDSC survive despite their elevated content and release of ROS. NF erythroid 2-related factor 2 (Nrf2) is a transcription factor that regulates a battery of genes that attenuate oxidative stress. Therefore, we hypothesized that MDSC resistance to ROS may be regulated by Nrf2. To test this hypothesis, we used Nrf2(+/+)and Nrf2(-/-)BALB/c and C57BL/6 mice bearing 4T1 mammary carcinoma and MC38 colon carcinoma, respectively. Nrf2 enhanced MDSC suppressive activity by increasing MDSC production of H2O2, and it increased the quantity of tumor-infiltrating MDSC by reducing their oxidative stress and rate of apoptosis. Nrf2 did not affect circulating levels of MDSC in tumor-bearing mice because the decreased apoptotic rate of tumor-infiltrating MDSC was balanced by a decreased rate of differentiation from bone marrow progenitor cells. These results demonstrate that Nrf2 regulates the generation, survival, and suppressive potency of MDSC, and that a feedback homeostatic mechanism maintains a steady-state level of circulating MDSC in tumor-bearing individuals.

  12. SVD identifies transcript length distribution functions from DNA microarray data and reveals evolutionary forces globally affecting GBM met