Science.gov

Sample records for affecting gene expression

  1. Does inbreeding affect gene expression in birds?

    PubMed

    Hansson, Bengt; Naurin, Sara; Hasselquist, Dennis

    2014-09-01

    Inbreeding increases homozygosity, exposes genome-wide recessive deleterious alleles and often reduces fitness. The physiological and reproductive consequences of inbreeding may be manifested already during gene regulation, but the degree to which inbreeding influences gene expression is unknown in most organisms, including in birds. To evaluate the pattern of inbreeding-affected gene expression over the genome and in relation to sex, we performed a transcriptome-wide gene expression (10 695 genes) study of brain tissue of 10-day-old inbred and outbred, male and female zebra finches. We found significantly lower gene expression in females compared with males at Z-linked genes, confirming that dosage compensation is incomplete in female birds. However, inbreeding did not affect gene expression at autosomal or sex-linked genes, neither in males nor in females. Analyses of single genes again found a clear sex-biased expression at Z-linked genes, whereas only a single gene was significantly affected by inbreeding. The weak effect of inbreeding on gene expression in zebra finches contrasts to the situation, for example, in Drosophila where inbreeding has been found to influence gene expression more generally and at stress-related genes in particular.

  2. Marker gene tethering by nucleoporins affects gene expression in plants.

    PubMed

    Smith, Sarah; Galinha, Carla; Desset, Sophie; Tolmie, Frances; Evans, David; Tatout, Christophe; Graumann, Katja

    2015-01-01

    In non-plant systems, chromatin association with the nuclear periphery affects gene expression, where interactions with nuclear envelope proteins can repress and interactions with nucleoporins can enhance transcription. In plants, both hetero- and euchromatin can localize at the nuclear periphery, but the effect of proximity to the nuclear periphery on gene expression remains largely unknown. This study explores the putative function of Seh1 and Nup50a nucleoporins on gene expression by using the Lac Operator / Lac Repressor (LacI-LacO) system adapted to Arabidopsis thaliana. We used LacO fused to the luciferase reporter gene (LacO:Luc) to investigate whether binding of the LacO:Luc transgene to nucleoporin:LacI protein fusions alters luciferase expression. Two separate nucleoporin-LacI-YFP fusions were introduced into single insert, homozygous LacO:Luc Arabidopsis plants. Homozygous plants carrying LacO:Luc and a single insert of either Seh1-LacI-YFP or Nup50a-LacI-YFP were tested for luciferase activity and compared to plants containing LacO:Luc only. Seh1-LacI-YFP increased, while Nup50a-LacI-YFP decreased luciferase activity. Seh1-LacI-YFP accumulated at the nuclear periphery as expected, while Nup50a-LacI-YFP was nucleoplasmic and was not selected for further study. Protein and RNA levels of luciferase were quantified by western blotting and RT-qPCR, respectively. Increased luciferase activity in LacO:Luc+Seh1-LacI-YFP plants was correlated with increased luciferase protein and RNA levels. This change of luciferase expression was abolished by disruption of LacI-LacO binding by treating with IPTG in young seedlings, rosette leaves and inflorescences. This study suggests that association with the nuclear periphery is involved in the regulation of gene expression in plants.

  3. Quantitative expression of candidate genes affecting eggshell color.

    PubMed

    Zheng, Chuanwei; Li, Zesheng; Yang, Ning; Ning, Zhonghua

    2014-05-01

    There are three pigments that affect the color of an eggshell: protoporphyrin, biliverdin and biliverdin-zinc chelate. Protoporphyrin is the main pigment in brown and light-brown eggshells, whereas very little protoporphyrin is found in white eggshells. Eggshell protoporphyrin is derived from the heme formation in birds. Coproporphyrinogen III oxidase (CPOX) and ferrochelatase (FECH) represent rate-limiting enzymes for the heme-biosynthetic pathway. Breast cancer resistance protein (BCRP), feline leukemia virus receptor (FLVCR), and heme-responsive gene-1 (HRG1) serve as primary transporters for both protoporphyrinogen and heme. Finally, four organic anion transporting polypeptide family members (including solute carrier organic anion transporter family, SLCO1C1, SLCO1A2, SLCO1B3 and LOC418189) may affect pigment transport within eggshells. Here we measured gene expression levels in key tissues of egg-producing hens. We analyzed three different types of hens that generated distinct eggshell colors: white, pink or brown. Our data revealed three ways in which eggshell color was genetically influenced. First, high-level expression of CPOX generated more protoporphyrinogen and a brown eggshell color. In contrast, high expression of FECH likely converted more protoporphyrinogen into heme, reduced protoporphyrinogen levels within the eggshell and generated a light color. Second, heme transporters also affected eggshell color. High-level expression of BCRP, HRG1 and FLVCR were associated with brown, white and generally lighter eggshell colors, respectively. Finally, protoporphyrin precipitation also affected eggshell color, as high expression of both SLCO1A2 and SLCO1C1 were associated with brown eggshell color. As such, we have identified seven genes in which expression levels in different tissues were associated with eggshell color.

  4. l-Ornithine affects peripheral clock gene expression in mice

    PubMed Central

    Fukuda, Takafumi; Haraguchi, Atsushi; Kuwahara, Mari; Nakamura, Kaai; Hamaguchi, Yutaro; Ikeda, Yuko; Ishida, Yuko; Wang, Guanying; Shirakawa, Chise; Tanihata, Yoko; Ohara, Kazuaki; Shibata, Shigenobu

    2016-01-01

    The peripheral circadian clock is entrained by factors in the external environment such as scheduled feeding, exercise, and mental and physical stresses. In addition, recent studies in mice demonstrated that some food components have the potential to control the peripheral circadian clock during scheduled feeding, although information about these components remains limited. l-Ornithine is a type of non-protein amino acid that is present in foods and has been reported to have various physiological functions. In human trials, for example, l-ornithine intake improved a subjective index of sleep quality. Here we demonstrate, using an in vivo monitoring system, that repeated oral administration of l-ornithine at an early inactive period in mice induced a phase advance in the rhythm of PER2 expression. By contrast, l-ornithine administration to mouse embryonic fibroblasts did not affect the expression of PER2, indicating that l-ornithine indirectly alters the phase of PER2. l-Ornithine also increased plasma levels of insulin, glucose and glucagon-like peptide-1 alongside mPer2 expression, suggesting that it exerts its effects probably via insulin secretion. Collectively, these findings demonstrate that l-ornithine affects peripheral clock gene expression and may expand the possibilities of L-ornithine as a health food. PMID:27703199

  5. l-Ornithine affects peripheral clock gene expression in mice.

    PubMed

    Fukuda, Takafumi; Haraguchi, Atsushi; Kuwahara, Mari; Nakamura, Kaai; Hamaguchi, Yutaro; Ikeda, Yuko; Ishida, Yuko; Wang, Guanying; Shirakawa, Chise; Tanihata, Yoko; Ohara, Kazuaki; Shibata, Shigenobu

    2016-10-05

    The peripheral circadian clock is entrained by factors in the external environment such as scheduled feeding, exercise, and mental and physical stresses. In addition, recent studies in mice demonstrated that some food components have the potential to control the peripheral circadian clock during scheduled feeding, although information about these components remains limited. l-Ornithine is a type of non-protein amino acid that is present in foods and has been reported to have various physiological functions. In human trials, for example, l-ornithine intake improved a subjective index of sleep quality. Here we demonstrate, using an in vivo monitoring system, that repeated oral administration of l-ornithine at an early inactive period in mice induced a phase advance in the rhythm of PER2 expression. By contrast, l-ornithine administration to mouse embryonic fibroblasts did not affect the expression of PER2, indicating that l-ornithine indirectly alters the phase of PER2. l-Ornithine also increased plasma levels of insulin, glucose and glucagon-like peptide-1 alongside mPer2 expression, suggesting that it exerts its effects probably via insulin secretion. Collectively, these findings demonstrate that l-ornithine affects peripheral clock gene expression and may expand the possibilities of L-ornithine as a health food.

  6. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

    PubMed

    Kosinová, Lucie; Cahová, Monika; Fábryová, Eva; Týcová, Irena; Koblas, Tomáš; Leontovyč, Ivan; Saudek, František; Kříž, Jan

    2016-01-01

    The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3) in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information from 48 hrs onwards.

  7. Caesium-affected gene expression in Arabidopsis thaliana.

    PubMed

    Sahr, Tobias; Voigt, Gabriele; Paretzke, Herwig G; Schramel, Peter; Ernst, Dieter

    2005-03-01

    * Excessive caesium can be toxic to plants. Here we investigated Cs uptake and caesium-induced gene expression in Arabidopsis thaliana. * Accumulation was measured in plants grown for 5 wk on agar supplemented with nontoxic and up to toxic levels of Cs. Caesium-induced gene expression was studied by suppression-subtractive hybridization (SSH) and RT-PCR. * Caesium accumulated in leaf rosettes dependent upon the external concentration in the growth media, whereas the potassium concentration decreased in rosettes. At a concentration of 850 microM, Cs plants showed reduced development, and withered with an increase in concentration to 1 mM Cs. SSH resulted in the isolation of 73 clones that were differentially expressed at a Cs concentration of 150 microM. Most of the genes identified belong to groups of genes encoding proteins in stress defence, detoxification, transport, homeostasis and general metabolism, and proteins controlling transcription and translation. * The present study identified a number of marker genes for Cs in Arabidopsis grown under nontoxic Cs concentrations, indicating that Cs acts as an abiotic stress factor.

  8. Pharmacological and Genetic Modulation of REV-ERB Activity and Expression Affects Orexigenic Gene Expression

    PubMed Central

    Amador, Ariadna; Wang, Yongjun; Banerjee, Subhashis; Kameneka, Theodore M.; Solt, Laura A.; Burris, Thomas P.

    2016-01-01

    The nuclear receptors REV-ERBα and REV-ERBβ are transcription factors that play pivotal roles in the regulation of the circadian rhythm and various metabolic processes. The circadian rhythm is an endogenous mechanism, which generates entrainable biological changes that follow a 24-hour period. It regulates a number of physiological processes, including sleep/wakeful cycles and feeding behaviors. We recently demonstrated that REV-ERB-specific small molecules affect sleep and anxiety. The orexinergic system also plays a significant role in mammalian physiology and behavior, including the regulation of sleep and food intake. Importantly, orexin genes are expressed in a circadian manner. Given these overlaps in function and circadian expression, we wanted to determine whether the REV-ERBs might regulate orexin. We found that acute in vivo modulation of REV-ERB activity, with the REV-ERB-specific synthetic ligand SR9009, affects the circadian expression of orexinergic genes in mice. Long term dosing with SR9009 also suppresses orexinergic gene expression in mice. Finally, REV-ERBβ-deficient mice present with increased orexinergic transcripts. These data suggest that the REV-ERBs may be involved in the repression of orexinergic gene expression. PMID:26963516

  9. Early Experiences Can Alter Gene Expression and Affect Long-Term Development. Working Paper #10

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2010

    2010-01-01

    New scientific research shows that environmental influences can actually affect whether and how genes are expressed. Thus, the old ideas that genes are "set in stone" or that they alone determine development have been disproven. In fact, scientists have discovered that early experiences can determine how genes are turned on and off and even…

  10. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-01-01

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  11. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.

    PubMed

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-02-15

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  12. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    PubMed Central

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.

    2016-01-01

    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring. PMID:27731423

  13. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    NASA Astrophysics Data System (ADS)

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.

    2016-10-01

    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring.

  14. Interspecies systems biology uncovers metabolites affecting C. elegans gene expression and life history traits.

    PubMed

    Watson, Emma; MacNeil, Lesley T; Ritter, Ashlyn D; Yilmaz, L Safak; Rosebrock, Adam P; Caudy, Amy A; Walhout, Albertha J M

    2014-02-13

    Diet greatly influences gene expression and physiology. In mammals, elucidating the effects and mechanisms of individual nutrients is challenging due to the complexity of both the animal and its diet. Here, we used an interspecies systems biology approach with Caenorhabditis elegans and two of its bacterial diets, Escherichia coli and Comamonas aquatica, to identify metabolites that affect the animal's gene expression and physiology. We identify vitamin B12 as the major dilutable metabolite provided by Comamonas aq. that regulates gene expression, accelerates development, and reduces fertility but does not affect lifespan. We find that vitamin B12 has a dual role in the animal: it affects development and fertility via the methionine/S-Adenosylmethionine (SAM) cycle and breaks down the short-chain fatty acid propionic acid, preventing its toxic buildup. Our interspecies systems biology approach provides a paradigm for understanding complex interactions between diet and physiology.

  15. Mutations in two regions upstream of the A gamma globin gene canonical promoter affect gene expression.

    PubMed Central

    Lloyd, J A; Lee, R F; Lingrel, J B

    1989-01-01

    Two regions upstream of the human fetal (A gamma) globin gene, which interact with protein factors from K562 and HeLa nuclear extracts, have functional significance in gene expression. One binding site (site I) is at a position -290 to -267 bp upstream of the transcription initiation site, the other (site II) is at -182 to -168 bp. Site II includes the octamer sequence (ATGCAAAT) found in an immunoglobulin enhancer and the histone H2b gene promoter. A point mutation (T----C) at -175, within the octamer sequence, is characteristic of a naturally occurring HPFH (hereditary persistence of fetal hemoglobin), and decreases factor binding to an oligonucleotide containing the octamer motif. Expression assays using a A gamma globin promoter-CAT (chloramphenicol acetyl transferase) fusion gene show that the point mutation at -175 increases expression in erythroid, but not non-erythroid cells when compared to a wild-type construct. This correlates with the actual effect of the HPFH mutation in humans. This higher expression may result from a mechanism more complex than reduced binding of a negative regulator. A site I clustered-base substitution gives gamma-CAT activity well below wild-type, suggesting that this factor is a positive regulator. Images PMID:2472607

  16. Endometriosis Located Proximal to or Remote From the Uterus Differentially Affects Uterine Gene Expression.

    PubMed

    Naqvi, Hanyia; Mamillapalli, Ramanaiah; Krikun, Graciela; Taylor, Hugh S

    2016-02-01

    The mechanisms that lead to the altered uterine gene expression in women with endometriosis are poorly understood. Are these changes in gene expression mediated by proximity to endometriotic lesions or is endometriosis a systemic disease where the effect is independent of proximity to the uterus? To answer this question, we created endometriosis in a murine model either in the peritoneal cavity (proximal) or at a subcutaneous remote site (distal). The expression of several genes that are involved in endometrial receptivity (homeobox A10 [Hoxa10], homeobox A11 [Hoxa11], insulin-like growth factor binding protein 1 [Igfbp1], Kruppel-like factor 9 [Klf9], and progesterone receptor [Pgr]) was measured in the eutopic endometrium of mice transplanted with either proximal or distal endometriosis lesions. Decreased expression of Hoxa10, Igfbp1, Klf9, and total Pgr genes was observed in the eutopic endometrium of mice with peritoneal endometriosis. In the mice with distal lesions, overall expression of these genes was not as severely affected, however, Igfbp1 expression was similarly decreased and the effect on Pgr was more pronounced. Endometriosis does have a systemic effect that varies with distance to the end organ. However, even remote disease selectively and profoundly alters the expression of genes such as Pgr. This is the first controlled experiment demonstrating that endometriosis is not simply a local peritoneal disease. Selective alteration of genes critical for endometrial receptivity and endometriosis propagation may be systemic. Similarly, systemic effects of endometriosis on other organs may also be responsible for the widespread manifestations of the disease.

  17. TITER AND PRODUCT AFFECTS THE DISTRIBUTION OF GENE EXPRESSION AFTER INTRAPUTAMINAL CONVECTION-ENHANCED DELIVERY

    PubMed Central

    Emborg, Marina E.; Hurley, Samuel A.; Joers, Valerie; Tromp, Do P.M.; Swanson, Christine R.; Ohshima-Hosoyama, Sachiko; Bondarenko, Viktorya; Cummisford, Kyle; Sonnemans, Marc; Hermening, Stephan; Blits, Bas; Alexander, Andrew L.

    2014-01-01

    Background Efficacy and safety of intracerebral gene therapy for brain disorders, like Parkinson’s disease, depends on appropriate distribution of gene expression. Objectives To assess if the distribution of gene expression is affected by vector titer and protein type. Methods Four adult macaque monkeys seronegative for adeno-associated virus 5 (AAV5) received in the right and left ventral postcommisural putamen 30μl inoculation of a high or low titer suspension of AAV5 encoding glial derived neurotrophic factor (GDNF) or green fluorescent protein (GFP). Inoculations were performed using convection enhanced delivery and intraoperative MRI (IMRI). Results IMRI confirmed targeting and infusion cloud irradiating from the catheter tip into surrounding area. Postmortem analysis six weeks after surgery revealed GFP and GDNF expression ipsilateral to the injection side that had a titer-dependent distribution. GFP and GDNF expression was also observed in fibers in the Substantia Nigra (SN) pars reticulata (pr), demonstrating anterograde transport. Few GFP-positive neurons were present in the SN pars compacta (pc), possibly by direct retrograde transport of the vector. GDNF was present in many SNpc and SNpr neurons. Conclusions After controlling for target and infusate volume, intracerebral distribution of gene product is affected by vector titer and product biology. PMID:24943657

  18. Iron nanoparticles significantly affect the in vitro and in vivo expression of Id genes.

    PubMed

    Zou, Jinglu; Wang, Xin; Zhang, Ling; Wang, Jinke

    2015-03-16

    In recent DNA microarray studies, we found that the transcription of the Id3 gene was significantly down-regulated in five cell lines (RAW264.7, Hepa1-6, THP-1, HepG2, and HL7702) treated with two doses (50 and 100 μg/mL) of a DMSA-coated magnetite nanoparticle. Given the regulatory roles of Id genes in the cell cycle, growth, and differentiation, we wanted to do more investigations on the effect of the nanoparticle upon the Id genes. This study detected the expression of Id genes in six cell lines (the above cell lines plus HeLa) treated with the nanoparticle at the same doses using quantitative PCR. The results revealed that the expression of Id genes was significantly affected by the nanoparticle in these cell lines. Under each treatment, the Id3 gene was significantly (p < 0.01) down-regulated in all cell lines, the Id1 gene was significantly down-regulated in all cell lines except the RAW264.7 cells, and the Id2 gene was significantly down-regulated in the HepG2, HL7702, and HeLa cells. Because the Id1, Id2, and Id3 genes were significantly down-regulated in three liver-derived cell lines (Hepa1-6, HepG2, and HL7702) in both microarray and PCR detections, this study then detected the expression of Id genes in the liver tissues of mice that were intravenously injected with the nanoparticle at two doses (2 and 5 mg/kg body weight). The results revealed that the expression of Id1, Id2, and Id3 genes was also significantly down-regulated in the liver tissues under each treatment. Another Id gene, Id4, was also significantly regulated in some cells or liver tissues treated with the nanoparticle. These results reveal that the nanoparticle exerts a significant effect on the in vitro and in vivo expression of Id genes. This study thus provides new insights into the Id-related nanotoxicity of the nanoparticle and the close relationship between the regulation of Id genes and iron.

  19. FAK and HAS Inhibition Synergistically Decrease Colon Cancer Cell Viability and Affect Expression of Critical Genes

    PubMed Central

    Heffler, Melissa; Golubovskaya, Vita; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William; Dunn, Kelli B.

    2013-01-01

    Focal adhesion kinase (FAK), hyaluronan (HA), and hyaluronan synthase-3 (HAS3) have been implicated in cancer growth and progression. FAK inhibition with the small molecule inhibitor Y15 decreases colon cancer cell growth in vitro and in vivo. HAS3 inhibition in colon cancer cells decreases FAK expression and activation, and exogenous HA increases FAK activation. We sought to determine the genes affected by HAS and FAK inhibition and hypothesized that dual inhibition would synergistically inhibit viability. Y15 (FAK inhibitor) and the HAS inhibitor 4-methylumbelliferone (4-MU) decreased viability in a dose dependent manner; viability was further inhibited by treatment with Y15 and 4-MU in colon cancer cells. HAS inhibited cells treated with 2μM of Y15 showed significantly decreased viability compared to HAS scrambled cells treated with the same dose (p<0.05) demonstrating synergistic inhibition of viability with dual FAK/HAS inhibition. Microarray analysis showed more than 2-fold up- or down-regulation of 121 genes by HAS inhibition, and 696 genes by FAK inhibition (p<0.05) and revealed 29 common genes affected by both signaling. Among the genes affected by FAK or HAS3 inhibition were genes, playing role in apoptosis, cell cycle regulation, adhesion, transcription, heat-shock and WNT pathways. Thus, FAK or HAS inhibition decreases SW620 viability and affects several similar genes, which are involved in the regulation of tumor survival. Dual inhibition of FAK and HAS3 decreases viability to a greater degree than with either agent alone, and suggests that synergistic inhibition of colon cancer cell growth can result from affecting similar genetic pathways. PMID:22934709

  20. FAK and HAS inhibition synergistically decrease colon cancer cell viability and affect expression of critical genes.

    PubMed

    Heffler, Melissa; Golubovskaya, Vita M; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G; Dunn, Kelli B

    2013-05-01

    Focal adhesion kinase (FAK), hyaluronan (HA), and hyaluronan synthase-3 (HAS3) have been implicated in cancer growth and progression. FAK inhibition with the small molecule inhibitor Y15 decreases colon cancer cell growth in vitro and in vivo. HAS3 inhibition in colon cancer cells decreases FAK expression and activation, and exogenous HA increases FAK activation. We sought to determine the genes affected by HAS and FAK inhibition and hypothesized that dual inhibition would synergistically inhibit viability. Y15 (FAK inhibitor) and the HAS inhibitor 4-methylumbelliferone (4-MU) decreased viability in a dose dependent manner; viability was further inhibited by treatment with Y15 and 4-MU in colon cancer cells. HAS inhibited cells treated with 2 μM of Y15 showed significantly decreased viability compared to HAS scrambled cells treated with the same dose (p < 0.05) demonstrating synergistic inhibition of viability with dual FAK/HAS inhibition. Microarray analysis showed more than 2-fold up- or down-regulation of 121 genes by HAS inhibition, and 696 genes by FAK inhibition (p < 0.05) and revealed 29 common genes affected by both signaling. Among the genes affected by FAK or HAS3 inhibition were genes, playing role in apoptosis, cell cycle regulation, adhesion, transcription, heatshock and WNT pathways. Thus, FAK or HAS inhibition decreases SW620 viability and affects several similar genes, which are involved in the regulation of tumor survival. Dual inhibition of FAK and HAS3 decreases viability to a greater degree than with either agent alone, and suggests that synergistic inhibition of colon cancer cell growth can result from affecting similar genetic pathways.

  1. Paternal benzo[a]pyrene exposure affects gene expression in the early developing mouse embryo.

    PubMed

    Brevik, Asgeir; Lindeman, Birgitte; Rusnakova, Vendula; Olsen, Ann-Karin; Brunborg, Gunnar; Duale, Nur

    2012-09-01

    The health of the offspring depends on the genetic constitution of the parental germ cells. The paternal genome appears to be important; e.g., de novo mutations in some genes seem to arise mostly from the father, whereas epigenetic modifications of DNA and histones are frequent in the paternal gonads. Environmental contaminants which may affect the integrity of the germ cells comprise the polycyclic aromatic hydrocarbon, benzo[a]pyrene (B[a]P). B[a]P has received much attention due to its ubiquitous distribution, its carcinogenic and mutagenic potential, and also effects on reproduction. We conducted an in vitro fertilization (IVF) experiment using sperm cells from B[a]P-exposed male mice to study effects of paternal B[a]P exposure on early gene expression in the developing mouse embryo. Male mice were exposed to a single acute dose of B[a]P (150 mg/kg, ip) 4 days prior to isolation of cauda sperm, followed by IVF of oocytes from unexposed superovulated mice. Gene expression in fertilized zygotes/embryos was determined using reverse transcription-qPCR at the 1-, 2-, 4-, 8-, and blastocyst cell stages of embryo development. We found that paternal B[a]P exposure altered the expression of numerous genes in the developing embryo especially at the blastocyst stage. Some genes were also affected at earlier developmental stages. Embryonic gene expression studies seem useful to identify perturbations of signaling pathways resulting from exposure to contaminants, and can be used to address mechanisms of paternal effects on embryo development.

  2. Identification of Differentially Expressed Genes through Integrated Study of Alzheimer’s Disease Affected Brain Regions

    PubMed Central

    Berretta, Regina; Moscato, Pablo

    2016-01-01

    Background Alzheimer’s disease (AD) is the most common form of dementia in older adults that damages the brain and results in impaired memory, thinking and behaviour. The identification of differentially expressed genes and related pathways among affected brain regions can provide more information on the mechanisms of AD. In the past decade, several studies have reported many genes that are associated with AD. This wealth of information has become difficult to follow and interpret as most of the results are conflicting. In that case, it is worth doing an integrated study of multiple datasets that helps to increase the total number of samples and the statistical power in detecting biomarkers. In this study, we present an integrated analysis of five different brain region datasets and introduce new genes that warrant further investigation. Methods The aim of our study is to apply a novel combinatorial optimisation based meta-analysis approach to identify differentially expressed genes that are associated to AD across brain regions. In this study, microarray gene expression data from 161 samples (74 non-demented controls, 87 AD) from the Entorhinal Cortex (EC), Hippocampus (HIP), Middle temporal gyrus (MTG), Posterior cingulate cortex (PC), Superior frontal gyrus (SFG) and visual cortex (VCX) brain regions were integrated and analysed using our method. The results are then compared to two popular meta-analysis methods, RankProd and GeneMeta, and to what can be obtained by analysing the individual datasets. Results We find genes related with AD that are consistent with existing studies, and new candidate genes not previously related with AD. Our study confirms the up-regualtion of INFAR2 and PTMA along with the down regulation of GPHN, RAB2A, PSMD14 and FGF. Novel genes PSMB2, WNK1, RPL15, SEMA4C, RWDD2A and LARGE are found to be differentially expressed across all brain regions. Further investigation on these genes may provide new insights into the development of AD

  3. Dopamine Transporter Gene Variant Affecting Expression in Human Brain is Associated with Bipolar Disorder

    PubMed Central

    Pinsonneault, Julia K; Han, Dawn D; Burdick, Katherine E; Kataki, Maria; Bertolino, Alessandro; Malhotra, Anil K; Gu, Howard H; Sadee, Wolfgang

    2011-01-01

    The gene encoding the dopamine transporter (DAT) has been implicated in CNS disorders, but the responsible polymorphisms remain uncertain. To search for regulatory polymorphisms, we measured allelic DAT mRNA expression in substantia nigra of human autopsy brain tissues, using two marker SNPs (rs6347 in exon 9 and rs27072 in the 3′-UTR). Allelic mRNA expression imbalance (AEI), an indicator of cis-acting regulatory polymorphisms, was observed in all tissues heterozygous for either of the two marker SNPs. SNP scanning of the DAT locus with AEI ratios as the phenotype, followed by in vitro molecular genetics studies, demonstrated that rs27072 C>T affects mRNA expression and translation. Expression of the minor T allele was dynamically regulated in transfected cell cultures, possibly involving microRNA interactions. Both rs6347 and rs3836790 (intron8 5/6 VNTR) also seemed to affect DAT expression, but not the commonly tested 9/10 VNTR in the 3′UTR (rs28363170). All four polymorphisms (rs6347, intron8 5/6 VNTR, rs27072 and 3′UTR 9/10 VNTR) were genotyped in clinical cohorts, representing schizophrenia, bipolar disorder, depression, and controls. Only rs27072 was significantly associated with bipolar disorder (OR=2.1, p=0.03). This result was replicated in a second bipolar/control population (OR=1.65, p=0.01), supporting a critical role for DAT regulation in bipolar disorder. PMID:21525861

  4. Global Deletion of TSPO Does Not Affect the Viability and Gene Expression Profile

    PubMed Central

    Wang, Huaishan; Yang, Jia; Yang, Qi; Fu, Yi; Hu, Yu; Liu, Fang; Wang, Weiqing; Cui, Lianxian; Chen, Hui; Zhang, Jianmin; He, Wei

    2016-01-01

    Translocator Protein (18kDa, TSPO) is a mitochondrial outer membrane transmembrane protein. Its expression is elevated during inflammation and injury. However, the function of TSPO in vivo is still controversial. Here, we constructed a TSPO global knockout (KO) mouse with a Cre-LoxP system that abolished TSPO protein expression in all tissues and showed normal phenotypes in the physiological condition. The birth rates of TSPO heterozygote (Het) x Het or KO x KO breeding were consistent with Mendel’s Law, suggesting a normal viability of TSPO KO mice at birth. RNA-seq analysis showed no significant difference in the gene expression profile of lung tissues from TSPO KO mice compared with wild type mice, including the genes associated with bronchial alveoli immune homeostasis. The alveolar macrophage population was not affected by TSPO deletion in the physiological condition. Our findings contradict the results of Papadopoulos, but confirmed Selvaraj’s findings. This study confirms TSPO deficiency does not affect viability and bronchial alveolar immune homeostasis. PMID:27907096

  5. Vanillin differentially affects azoxymethane-injected rat colon carcinogenesis and gene expression.

    PubMed

    Ho, Ket Li; Chong, Pei Pei; Yazan, Latifah Saiful; Ismail, Maznah

    2012-12-01

    Vanillin is the substance responsible for the flavor and smell of vanilla, a widely used flavoring agent. Previous studies reported that vanillin is a good antimutagen and anticarcinogen. However, there are also some contradicting findings showing that vanillin was a comutagen and cocarcinogen. This study investigated whether vanillin is an anticarcinogen or a cocarcinogen in rats induced with azoxymethane (AOM). Rats induced with AOM will develop aberrant crypt foci (ACF). AOM-challenged rats were treated with vanillin orally and intraperitoneally at low and high concentrations and ACF density, multiplicity, and distribution were observed. The gene expression of 14 colorectal cancer-related genes was also studied. Results showed that vanillin consumed orally had no effect on ACF. However, high concentrations (300 mg/kg body weight) of vanillin administered through intraperitoneal injection could increase ACF density and ACF multiplicity. ACF were mainly found in the distal colon rather than in the mid-section and proximal colon. The expression of colorectal cancer biomarkers, protooncogenes, recombinational repair, mismatch repair, and cell cycle arrest, and tumor suppressor gene expression were also affected by vanillin. Vanillin was not cocarcinogenic when consumed orally. However, it was cocarcinogenic when being administered intraperitoneally at high concentration. Hence, the use of vanillin in food should be safe but might have cocarcinogenic potential when it is used in high concentration for therapeutic purposes.

  6. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells

    PubMed Central

    Trevisan, Marta; Desole, Giovanna; Costanzi, Giulia; Lavezzo, Enrico; Palù, Giorgio; Barzon, Luisa

    2017-01-01

    Induced pluripotent stem cells (iPSCs) are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs. PMID:28117672

  7. Low intensity infrared laser affects expression of oxidative DNA repair genes in mitochondria and nucleus

    NASA Astrophysics Data System (ADS)

    Fonseca, A. S.; Magalhães, L. A. G.; Mencalha, A. L.; Geller, M.; Paoli, F.

    2014-11-01

    Practical properties and physical characteristics of low intensity lasers have made possible their application to treat soft tissue diseases. Excitation of intracellular chromophores by red and infrared radiation at low energy fluences with increase of mitochondrial metabolism is the basis of the biostimulation effect but free radicals can be produced. DNA lesions induced by free radicals are repaired by the base excision repair pathway. In this work, we evaluate the expression of POLγ and APEX2 genes related to repair of mitochondrial and nuclear DNA, respectively. Skin and muscle tissue of Wistar rats were exposed to low intensity infrared laser at different fluences. One hour and 24 hours after laser exposure, tissue samples were withdrawn for total RNA extraction, cDNA synthesis, and evaluation of POLγ and APEX2 mRNA expression by real time quantitative polymerase chain reaction. Skin and muscle tissue of Wistar rats exposed to laser radiation show different expression of POLγ and APEX2 mRNA depending of the fluence and time after exposure. Our study suggests that a low intensity infrared laser affects expression of genes involved in repair of oxidative lesions in mitochondrial and nuclear DNA.

  8. Self administration of oxycodone by adolescent and adult mice affects striatal neurotransmitter receptor gene expression.

    PubMed

    Mayer-Blackwell, B; Schlussman, S D; Butelman, E R; Ho, A; Ott, J; Kreek, M J; Zhang, Y

    2014-01-31

    Illicit use of prescription opioid analgesics (e.g., oxycodone) in adolescence is a pressing public health issue. Our goal was to determine whether oxycodone self administration differentially affects striatal neurotransmitter receptor gene expression in the dorsal striatum of adolescent compared to adult C57BL/6J mice. Groups of adolescent mice (4 weeks old, n=12) and of adult mice (11 weeks old, n=11) underwent surgery during which a catheter was implanted into their jugular veins. After recovering from surgery, mice self administered oxycodone (0.25 mg/kg/infusion) 2 h/day for 14 consecutive days or served as yoked saline controls. Mice were sacrificed within 1h after the last self-administration session and the dorsal striatum was isolated for mRNA analysis. Gene expression was analyzed with real time PCR using a commercially available neurotransmitter receptor PCR array containing 84 genes. We found that adolescent mice self administered less oxycodone than adult mice over the 14 days. Monoamine oxidase A (Maoa) and neuropeptide Y receptor 5 mRNA levels were lower in adolescent mice than in adult mice without oxycodone exposure. Oxycodone self administration increased Maoa mRNA levels compared to controls in both age groups. There was a positive correlation of the amount of oxycodone self administered in the last session or across 14 sessions with Maoa mRNA levels. Gastrin-releasing peptide receptor mRNA showed a significant Drug × Age interaction, with point-wise significance. More genes in the dorsal striatum of adolescents (19) changed in response to oxycodone self administration compared to controls than in adult (4) mice. Overall, this study demonstrates that repeated oxycodone self administration alters neurotransmitter receptors gene expression in the dorsal striatum of adolescent and adult mice.

  9. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    SciTech Connect

    Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.

    2010-04-23

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic {beta}-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  10. In vivo treatments with fulvestrant and anastrozole differentially affect gene expression in the rat efferent ductules.

    PubMed

    Gomes, Gisele Renata Oliveira; Yasuhara, Fabiana; Siu, Erica Rosanna; Fernandes, Sheilla Alessandra Ferreira; Avellar, Maria Christina Werneck; Lazari, Maria Fatima Magalhaes; Porto, Catarina Segreti

    2011-01-01

    Estrogen plays a key role in maintaining the morphology and function of the efferent ductules. We previously demonstrated that the antiestrogen fulvestrant markedly affected gene expression in the rat efferent ductules. The mechanism of fulvestrant action to modulate gene expression may involve not only the blockade of ESR1 and ESR2 estrogen receptors, but also the activation of ESR1 and ESR2 when the receptors are tethered to AP-1 or SP1 transcription factors, or the activation of the G protein-coupled estrogen receptor 1. We therefore compared the effects of two strategies to interfere with estrogen action in the rat efferent ductules: treatment with fulvestrant or with the aromatase inhibitor anastrozole. Whereas fulvestrant markedly increased Mmp7 and Spp1, and reduced Nptx1 mRNA levels, no changes were observed with anastrozole. Fulvestrant caused changes in epithelial morphology that were not seen with anastrozole. Fulvestrant shifted MMP7 immunolocalization in the epithelial cells from the supranuclear to the apical region; this effect was less pronounced with anastrozole. In vitro studies of (35)S-methionine incorporation showed that protein release was increased, whereas tissue protein content in the efferent ductules of fulvestrant-treated rats was decreased. Although fulvestrant markedly affected gene expression, no changes were observed on AP-1 and SP1 DNA-binding activity. The blockade of ESRs seems to be the major reason explaining the differences between both treatments. At least some of the effects of fulvestrant appear to result from compensatory mechanisms activated by the dramatic changes caused by ESR1 blockade.

  11. A family with a dystrophin gene mutation specifically affecting dystrophin expression in the heart

    SciTech Connect

    Muntoni, F.; Davies, K.; Dubowitz, V.

    1994-09-01

    We recently described a family with X-linked dilated cardiomyopathy where a large deletion in the muscle promoter region of the dystrophin gene was associated with a severe dilated cardiomyopathy in absence of clinical skeletal muscle involvement. The deletion removed the entire muscle promoter region, the first muscle exon and part of intron 1. The brain and Purkinje cell promoters were not affected by the deletion. Despite the lack of both the muscle promoter and the first muscle exon, dystrophin was detected immunocytochemically in relative high levels in the skeletal muscle of the affected males. We have now found that both the brain and Purkinje cell promoters were transcribed at high levels in the skeletal muscle of these individuals. This phenomenon, that does not occur in normal skeletal muscle, indicates that these two isoforms, physiologically expressed mainly in the central nervous system, can be transcribed and be functionally active in skeletal muscle under specific circumstances. Contrary to what is observed in skeletal muscle, dystrophin was not detected in the heart of one affected male using immunocytochemistry and an entire panel of anti-dystrophin antibodies. This was most likely the cause for the pronounced cardiac fibrosis observed and eventually responsible for the severe cardiac involvement invariably seen in seven affected males. In conclusion, the mutation of the muscle promoter, first muscle exon and part of intron 1 specifically affected expression of dystrophin in the heart. We believe that this deletion removes sequences involved in regulation of dystrophin expression in the heart and are at the moment characterizing other families with X-linked cardiomyopathy secondary to a dystrophinopathy.

  12. Inbreeding Affects Gene Expression Differently in Two Self-Incompatible Arabidopsis lyrata Populations with Similar Levels of Inbreeding Depression.

    PubMed

    Menzel, Mandy; Sletvold, Nina; Ågren, Jon; Hansson, Bengt

    2015-08-01

    Knowledge of which genes and pathways are affected by inbreeding may help understanding the genetic basis of inbreeding depression, the potential for purging (selection against deleterious recessive alleles), and the transition from outcrossing to selfing. Arabidopsis lyrata is a predominantly self-incompatible perennial plant, closely related to the selfing model species A. thaliana. To examine how inbreeding affects gene expression, we compared the transcriptome of experimentally selfed and outcrossed A. lyrata originating from two Scandinavian populations that express similar inbreeding depression for fitness (∂ ≈ 0.80). The number of genes significantly differentially expressed between selfed and outcrossed individuals were 2.5 times higher in the Norwegian population (≈ 500 genes) than in the Swedish population (≈ 200 genes). In both populations, a majority of genes were upregulated on selfing (≈ 80%). Functional annotation analysis of the differentially expressed genes showed that selfed offspring were characterized by 1) upregulation of stress-related genes in both populations and 2) upregulation of photosynthesis-related genes in Sweden but downregulation in Norway. Moreover, we found that reproduction- and pollination-related genes were affected by inbreeding only in Norway. We conclude that inbreeding causes both general and population-specific effects. The observed common effects suggest that inbreeding generally upregulates rather than downregulates gene expression and affects genes associated with stress response and general metabolic activity. Population differences in the number of affected genes and in effects on the expression of photosynthesis-related genes show that the genetic basis of inbreeding depression can differ between populations with very similar levels of inbreeding depression.

  13. Fasting and sampling time affect liver gene expression of high-fat diet-fed mice.

    PubMed

    Lee, C Y

    2010-05-01

    Several physiological and biological variables are known to affect peroxisome proliferator-activated receptor (PPAR)-α-dependent signaling pathway and plasma biochemical profiles. However, less is known about the effect of these variables on high-fat diet-fed mice. In a 5-week study, C57BL/6 mice were divided into control (C) and high-fat diet-fed (H) groups, whereby before dissection, each group was subdivided into non-fasted (nC and nH) and a 15-h fasted mice (fC and fH) killed in the early light cycle, and a 15-h fasted mice (eC and eH) killed in the late phase of the light cycle. Liver and blood from the vena cava were collected. Non-fasted nC and nH mice have a marginal difference in their body weight gain, whereas significant differences were found for fasted mice. In nH mice, PPAR-α, acyl-CoA oxidase and insulin-like growth factor-binding protein expressions were significantly elevated, in contrast to fatty acid synthase (Fasn), stearoyl CoA-desaturase (SCD)-1, and elongase (ELOVL)-6 expressions. Fasn was profoundly induced in fH mice, while decreased sterol regulatory-binding protein-1 and SCD-1 were found only in eH mice. Different from the gene expression profiles, plasma total cholesterol level of the eH mice was higher than controls, whereas nH mice have increased plasma non-esterified fatty acids. Only glucose level of the fH mice was higher than that observed for controls. Results showed that fasting and sampling time have significantly affected liver gene expression and plasma biochemical indices of the high-fat diet-treated mice. An overlook in these aspects can cause serious discrepancies in the experimental data and their interpretations.

  14. Differential replication dynamics for large and small Vibrio chromosomes affect gene dosage, expression and location

    PubMed Central

    Dryselius, Rikard; Izutsu, Kaori; Honda, Takeshi; Iida, Tetsuya

    2008-01-01

    Background Replication of bacterial chromosomes increases copy numbers of genes located near origins of replication relative to genes located near termini. Such differential gene dosage depends on replication rate, doubling time and chromosome size. Although little explored, differential gene dosage may influence both gene expression and location. For vibrios, a diverse family of fast growing gammaproteobacteria, gene dosage may be particularly important as they harbor two chromosomes of different size. Results Here we examined replication dynamics and gene dosage effects for the separate chromosomes of three Vibrio species. We also investigated locations for specific gene types within the genome. The results showed consistently larger gene dosage differences for the large chromosome which also initiated replication long before the small. Accordingly, large chromosome gene expression levels were generally higher and showed an influence from gene dosage. This was reflected by a higher abundance of growth essential and growth contributing genes of which many locate near the origin of replication. In contrast, small chromosome gene expression levels were low and appeared independent of gene dosage. Also, species specific genes are highly abundant and an over-representation of genes involved in transcription could explain its gene dosage independent expression. Conclusion Here we establish a link between replication dynamics and differential gene dosage on one hand and gene expression levels and the location of specific gene types on the other. For vibrios, this relationship appears connected to a polarisation of genetic content between its chromosomes, which may both contribute to and be enhanced by an improved adaptive capacity. PMID:19032792

  15. Age affects gene expression in mouse spermatogonial stem/progenitor cells.

    PubMed

    Kokkinaki, Maria; Lee, Tin-Lap; He, Zuping; Jiang, Jiji; Golestaneh, Nady; Hofmann, Marie-Claude; Chan, Wai-Yee; Dym, Martin

    2010-06-01

    Spermatogenesis in man starts with spermatogonial stem cells (SSCs), and leads to the production of sperm in approximately 64 days, common to old and young men. Sperm from elderly men are functional and able to fertilize eggs and produce offspring, even though daily sperm production is more than 50% lower and damage to sperm DNA is significantly higher in older men than in those who are younger. Our hypothesis is that the SSC/spermatogonial progenitors themselves age. To test this hypothesis, we studied the gene expression profile of mouse SSC/progenitor cells at several ages using microarrays. After sequential enzyme dispersion, we purified the SSC/progenitors with immunomagnetic cell sorting using an antibody to GFRA1, a known SSC/progenitor cell marker. RNA was isolated and used for the in vitro synthesis of amplified and labeled cRNAs that were hybridized to the Affymetrix mouse genome microarrays. The experiments were repeated twice with different cell preparations, and statistically significant results are presented. Quantitative RT-PCR analysis was used to confirm the microarray results. Comparison of four age groups (6 days, 21 days, 60 days, and 8 months old) showed a number of genes that were expressed specifically in the older mice. Two of them (i.e. Icam1 and Selp) have also been shown to mark aging hematopoietic stem cells. On the other hand, the expression levels of the genes encoding the SSC markers Gfra1 and Plzf did not seem to be significantly altered by age, indicating that age affects only certain SSC/progenitor properties.

  16. Seawater Acidification and Elevated Temperature Affect Gene Expression Patterns of the Pearl Oyster Pinctada fucata

    PubMed Central

    Liu, Wenguang; Huang, Xiande; Lin, Jianshi; He, Maoxian

    2012-01-01

    Oceanic uptake of anthropogenic carbon dioxide results in decrease in seawater pH and increase in temperature. In this study, we demonstrated the synergistic effects of elevated seawater temperature and declined seawater pH on gene expression patterns of aspein, calmodulin, nacrein, she-7-F10 and hsp70 in the pearl oyster Pinctada fucata. Under ‘business-as-usual’ scenarios, four treatments were examined: (1) ambient pH (8.10) and ambient temperature (27°C) (control condition), (2) ambient pH and elevated temperature (+3°C), (3) declined pH (7.70) and ambient temperature, (4) declined pH and elevated temperature. The results showed that under warming and acidic seawater conditions, expression of aspein and calmodulin showed no significant differences among different time point in condition 8.10 T. But the levels of aspein and calmodulin in conditions 8.10 T+3, 7.70 T and 7.70 T+3, and levels of nacrein, she-7-F10 in all the four treatments changed significantly. Low pH and pH×temperature interaction influenced the expression of aspein and calmodulin significantly after hours 48 and 96. Significant effects of low pH and pH×temperature interaction on the expression of nacrein were observed at hour 96. The expression level of she-7-F10 was affected significantly by pH after hours 48 and 96. The expression of hsp70 was significantly affected by temperature, pH, temperature×pH interaction at hour 6, and by temperature×pH interaction at hour 24. This study suggested that declined pH and pH×temperature interaction induced down regulation of calcification related genes, and the interaction between declined seawater pH and elevated temperature caused up regulation of hsp70 in P. facata. These results demonstrate that the declined seawater pH and elevated temperature will impact the physiological process, and potentially the adaptability of P. fucata to future warming and acidified ocean. PMID:22438983

  17. Changes in gravity affect gene expression, protein modulation and metabolite pools of arabidopsis

    NASA Astrophysics Data System (ADS)

    Hampp, R.; Martzivanou, M.; Maier, R. M.; Magel, E.

    Callus cultures of Arabidopsis thaliana (cv. Columbia) in Petri dishes / suspension cultures were exposed to altered g-forces by centrifugation (1 to 10 g), klinorotation, and μ g (sounding rocket flights). Using semi-quantitative RT-PCR, transcripts of genes coding for metabolic key enzymes (ADP-glucose pyrophosphorylase, ADPG-PP; ß-amylase, fructose-1,6-bisphosphatase, FBPase; glyceraldehyde-P dehydrogenase, GAPDH; hydroxymethylglutaryl-CoA reductase, HMG; phenylalanine-ammonium-lyase, PAL; PEP carboxylase, PEPC) were used to monitor threshold conditions for g-number (all) and time of exposure (ß-amylase) which led to altered amounts of the gene product. Exposure to approx. 5 g and higher for 1h resulted in altered transcript levels: transcripts of ß-amylase, PAL, and PEPC were increased, those of ADPG-PP decreased, while those of FBPase, GAPDH, and HMG were not affected. This probably indicates a shift from starch synthesis to starch degradation and increased rates of anaplerosis (PEPC: supply of ketoacids for amino acid synthesis). In order to get more information about g-related effects on gene expression, we used a 1h-exposure to 7 g for a microarray analysis. Transcripts of more than 200 genes were significantly increased in amount (ratio 7g / 1g control; 21.6 and larger). They fall into several categories. Transcripts coding for enzymes of major pathways form the largest group (25%), followed by gene products involved in cellular organisation and cell wall formation / rearrangement (17%), signalling, phosphorylation/dephosphorylation (12%), proteolysis and transport (10% each), hormone synthesis plus related events (8%), defense (4%), stress-response (2%), and gravisensing (2%). Many of the alterations are part of a general stress response, but some changes related to the synthesis / rearrangement of cell wall components could be more hyper-g-specific. Using macroarrays with selected genes according to our hypergravity study (metabolism / signalling

  18. Perinatal exposure to diesel exhaust affects gene expression in mouse cerebrum.

    PubMed

    Tsukue, Naomi; Watanabe, Manabu; Kumamoto, Takayuki; Takano, Hirohisa; Takeda, Ken

    2009-11-01

    Many environmental toxins alter reproductive function and affect the central nervous system (CNS). Gonadal steroid hormones cause differentiation of neurons and affect brain function and behavior during the perinatal period, and the CNS is thought to be particularly susceptible to toxic insult during this period. It was, therefore, hypothesized that inhalation of diesel exhaust (DE) during the fetal or suckling period would disrupt the sexual differentiation of brain function in mice, and the effects of exposure to DE during the perinatal period on sexual differentiation related gene expression of the brain were investigated. In the fetal period exposure group, pregnant ICR mice were exposed to DE from 1.5 days post-coitum (dpc) until 16 dpc. In the neonatal period exposure group, dams and their offspring were exposed to DE from the day of birth [postnatal day (PND)-0] until PND-16. Then, the cerebrums of males and females at PND-2, -5, and -16 from both groups were analyzed for expression level of mRNA encoding stress-related proteins [cytochrome P450 1A1 (CYP1A1), heme oxygenase-1 (HO-1)] and steroid hormone receptors [estrogen receptor alpha (ER alpha), estrogen receptor beta (ER beta), androgen receptor (AR)]. Expression levels of ER alpha and ER beta mRNA were increased in the cerebrum of newborns in the DE exposure groups as well as mRNA for CYP1A1 and HO-1. Results indicate that perinatal exposure to DE during the critical period of sexual differentiation of the brain may affect endocrine function.

  19. Cold sore susceptibility gene-1 genotypes affect the expression of herpes labialis in unrelated human subjects.

    PubMed

    Kriesel, John D; Bhatia, Amiteshwar; Thomas, Alun

    2014-01-01

    Our group has recently described a gene on human chromosome 21, the Cold Sore Susceptibility Gene-1 (CSSG-1, also known as C21orf91), which may confer susceptibility to frequent cold sores in humans. We present here a genotype-phenotype analysis of CSSG-1 in a new, unrelated human population. Seven hundred fifty-eight human subjects were enrolled in a case/control Cold Sore Study. CSSG-1 genotyping, herpes simplex virus 1 (HSV1) serotyping, demographic and phenotypic data was available from 622 analyzed subjects. Six major alleles (H1-H6) were tested for associations with each of the self-reported phenotypes. The statistical analysis was adjusted for age, sex and ethnicity. Genotype-phenotype associations were analyzed from 388 HSV1-seropositive subjects. There were significant CSSG-1 haplotype effects on annual cold sore outbreaks (P=0.006), lifetime cold sores (P=0.012) and perceived cold sore severity (P=0.012). There were relatively consistent trends toward protection from frequent and severe cold sores among those with the H3 or H5/6 haplotypes, whereas those with H1, H2, and H4 haplotypes tended to have more frequent and more severe episodes. Different alleles of the newly described gene CSSG-1 affect the expression of cold sore phenotypes in this new, unrelated human population, confirming the findings of the previous family-based study.

  20. Transcription factor organic cation transporter 1 (OCT-1) affects the expression of porcine Klotho (KL) gene

    PubMed Central

    Zhou, Jiawei

    2016-01-01

    Klotho (KL), originally discovered as an aging suppressor, is a membrane protein that shares sequence similarity with the β-glucosidase enzymes. Recent reports showed Klotho might play a role in adipocyte maturation and systemic glucose metabolism. However, little is known about the transcription factors involved in regulating the expression of porcine KL gene. Deletion fragment analysis identified KL-D2 (−418 bp to −3 bp) as the porcine KL core promoter. MARC0022311SNP (A or G) in KL intron 1 was detected in Landrace × DIV pigs using the Porcine SNP60 BeadChip. The pGL-D2-A and pGL-D2-G were constructed with KL-D2 and the intron fragment of different alleles and relative luciferase activity of pGL3-D2-G was significantly higher than that of pGL3-D2-A in the PK cells and ST cells. This was possibly the result of a change in KL binding ability with transcription factor organic cation transporter 1 (OCT-1), which was confirmed using electrophoretic mobility shift assays (EMSA) and chromatin immune-precipitation (ChIP). Moreover, OCT-1 regulated endogenous KL expression by RNA interference experiments. Our study indicates SNP MARC0022311 affects porcine KL expression by regulating its promoter activity via OCT-1. PMID:27478698

  1. Fluoride at non-toxic dose affects odontoblast gene expression in vitro.

    PubMed

    Wurtz, Tilmann; Houari, Sophia; Mauro, Nicole; MacDougall, Mary; Peters, Heiko; Berdal, Ariane

    2008-07-10

    Elevated fluoride intake may lead to local tissue disturbances, known as fluorosis. Towards an understanding of this effect, fluoride-induced molecular responses were analyzed in MO6-G3 cultured odontoblasts cells. NaF at 1mM changed expression of genes implicated in tissue formation and growth, without affecting cell proliferation or inducing stress factor RNAs. Up to 1mM NaF, DNA accumulation was not inhibited, whereas at 3mM, cells detached from their support and did not proliferate. Intracellular structures, characterized by EM, were normal up to 1mM, but at 3mM, necrotic features were evident. No sign of apoptotic transformation appeared at any NaF concentration. Fluoride-sensitive genes were identified by microarray analysis; expression levels of selected RNAs were determined by conventional and real-time RT-PCR. At 1mM fluoride, RNAs encoding the extracellular matrix proteins asporin and fibromodulin, and the cell membrane associated proteins periostin and IMT2A were 10-fold reduced. RNA coding for signaling factor TNF-receptor 9 was diminished to one-third, whereas that for the chemokine Scya-5 was enhanced 2.5-fold. These RNAs are present in vivo in tooth forming cells. This was demonstrated by in situ hybridization and RT-PCR on RNA from dissected tissue samples; for the presence and functioning of fibromodulin in dentin matrix, a more comprehensive study has earlier been performed by others [Goldberg, M., Septier, D., Oldberg, A., Young, M.F., Ameye, L.G., 2006. Fibromodulin deficient mice display impaired collagen fibrillogenesis in predentin as well as altered dentin mineralization and enamel formation. J. Histochem. Cytochem. 54, 525-537]. Expression of most other RNA species, in particular of stress factor coding RNAs, was not altered. It was concluded that fluoride could influence the transcription pattern without inducing cell stress or apoptosis. In odontoblasts in vivo, aberrant expression of these fluoride-sensitive genes may impair the

  2. Trichostatin A affects histone acetylation and gene expression in porcine somatic cell nucleus transfer embryos.

    PubMed

    Cervera, R P; Martí-Gutiérrez, N; Escorihuela, E; Moreno, R; Stojkovic, M

    2009-11-01

    Epigenetic aberrancies likely preclude correct and complete nuclear reprogramming after somatic cell nucleus transfer (SCNT) and may underlie the observed reduced viability of cloned embryos. In the current study, we tested the effects of the histone deacetylase-inhibitor trichostatin A (TSA) on preimplantation development and on histone acetylation and the gene expression of nucleus transfer (NT) porcine (Sus scrofa) embryos. Our results showed that 5 nM TSA for 26 h after reconstitution resulted in embryos (NTTSA) that reached the blastocyst stage at a higher level (48.1% vs. 20.2%) and increased number of cells (105.0 vs. 75.3) than that of the control (NTC) embryos. In addition, and unlike the NTC embryos, the treated embryos displayed a global acetylated histone H4 at lysine 8 profile similar to the in vitro-fertilized (IVF) and cultured embryos during the preimplantation development. Finally, we determined that several transcription factors exert a dramatic amount of genetic control over pluripotency, including Oct4, Nanog, Cdx2, and Rex01, the imprinting genes Igf2 and Igf2r, and the histone deacetyltransferase gene Hdac2. The NT blastocysts showed similar levels of Oct4, Cdx2, and Hdac2 but lower levels of Nanog than those of the IVF blastocyst. However, the NTTSA blastocysts showed similar levels of Rex01, Igf2, and Igf2r as those of IVF blastocysts, whereas the NTC blastocysts showed significantly lower levels for those genes. Our results suggest that TSA improves porcine SCNT preimplantation development and affects the acetylated status of the H4K8, rendering acetylation levels similar to those of the IVF counterparts.

  3. Extended in vitro maturation affects gene expression and DNA methylation in bovine oocytes.

    PubMed

    Heinzmann, Julia; Mattern, Felix; Aldag, Patrick; Bernal-Ulloa, Sandra Milena; Schneider, Tamara; Haaf, Thomas; Niemann, Heiner

    2015-10-01

    To mimic post-ovulatory ageing, we have extended the in vitro maturation (IVM) phase to 48 h and examined effects on (i) developmental potential, (ii) expression of a panel of developmentally important genes and (iii) gene-specific epigenetic marks. Results were compared with the 24 h IVM protocol (control) usually employed for bovine oocytes. Cleavage rates and blastocyst yields were significantly reduced in oocytes after extended IVM. No significant differences were observed in the methylation of entire alleles in oocytes for the genes bH19, bSNRPN, bZAR1, bOct4 and bDNMT3A. However, we found differentially methylated CpG sites in the bDNMT3Ls locus in oocytes after extended IVM and in embryos derived from them compared with controls. Moreover, embryos derived from the 48 h matured oocyte group were significantly less methylated at CpG5 and CpG7 compared with the 24 h group. CpG7 was significantly hypermethylated in embryos produced from the control oocytes, but not in oocytes matured for 48 h. Furthermore, methylation for CpG5-CpG8 of bDNMT3Ls was significantly lower in oocytes of the 24 h group compared with embryos derived therefrom, whereas no such difference was found for oocytes and embryos of the in vitro aged group. Expression of most of the selected genes was not affected by duration of IVM. However, transcript abundance for the imprinted gene bIGF2R was significantly reduced in oocytes analyzed after extended IVM compared with control oocytes. Transcript levels for bPRDX1, bDNMT3A and bBCLXL were significantly reduced in 4- to 8-cell embryos derived from in vitro aged oocytes. These results indicate that extended IVM leads to ageing-like alterations and demonstrate that epigenetic mechanisms are critically involved in ageing of bovine oocytes, which warrants further studies into epigenetic mechanisms involved in ageing of female germ cells, including humans.

  4. Detection of differentially expressed genes in broiler pectoralis major muscle affected by White Striping - Wooden Breast myopathies.

    PubMed

    Zambonelli, Paolo; Zappaterra, Martina; Soglia, Francesca; Petracci, Massimiliano; Sirri, Federico; Cavani, Claudio; Davoli, Roberta

    2016-12-01

    White Striping and Wooden Breast (WS/WB) are abnormalities increasingly occurring in the fillets of high breast yield and growth rate chicken hybrids. These defects lead to consistent economic losses for poultry meat industry, as affected broiler fillets present an impaired visual appearance that negatively affects consumers' acceptability. Previous studies have highlighted in affected fillets a severely damaged muscle, showing profound inflammation, fibrosis, and lipidosis. The present study investigated the differentially expressed genes and pathways linked to the compositional changes observed in WS/WB breast muscles, in order to outline a more complete framework of the gene networks related to the occurrence of this complex pathological picture. The biochemical composition was performed on 20 pectoralis major samples obtained from high breast yield and growth rate broilers (10 affected vs. 10 normal) and 12 out of the 20 samples were used for the microarray gene expression profiling (6 affected vs. 6 normal). The obtained results indicate strong changes in muscle mineral composition, coupled to an increased deposition of fat. In addition, 204 differentially expressed genes (DEG) were found: 102 up-regulated and 102 down-regulated in affected breasts. The gene expression pathways found more altered in WS/WB muscles are those related to muscle development, polysaccharide metabolic processes, proteoglycans synthesis, inflammation, and calcium signaling pathway. On the whole, the findings suggest that a multifactorial and complex etiology is associated with the occurrence of WS/WB muscle abnormalities, contributing to further defining the transcription patterns associated with these myopathies.

  5. CP27 affects viability, proliferation, attachment and gene expression in embryonic fibroblasts.

    PubMed

    Luan, X; Diekwisch, T G H

    2002-08-01

    CP27 is a gene that has been cloned from an E11 early embryonic library and has been suggested to mediate early organogenesis (Diekwisch et al., 1999, Gene 235, 19). We have hypothesized that CP27 exhibits its effects on organogenesis by affecting individual cell function. Based on the CP27 expression pattern we have selected the CP27 expressing embryonic fibroblast cell line BALB/c 3T3 to determine the effects of CP27 on cell function. CP27 loss of function strategies were performed by adding 5, 12.5 or 25 micro g/ml anti-CP27 antibody to cultured BALB/c 3T3 cells and comparing the results to controls in which identical concentrations of rabbit serum were added to the culture medium. Other controls included an antibody against another extracellular matrix protein amelogenin (negative control) and anti-CP27 antibodies directed against other areas of the CP27 molecule (positive control). Following cell culture, cell viability, apoptosis, cell proliferation, cell shape, cellular attachment and fibronectin matrix production were assayed using MTT colourimetric assay, BrdU staining, morphometry, immunostaining and western blot analysis. Block of CP27 function using an antibody strategy resulted in the following significant changes: (i) reduced viability, (ii) increased number of apoptotic cells, (iii) reduced proliferation, (iv) alterations in cell shape, (v) loss of attachment, and (vi) reduction in fibronectin matrix production. There was also a redistribution in fibronectin matrix organization demonstrated by immunohistochemistry. We conclude that CP27 plays an important role in the maintance of normal cell function and that CP27 block leads to significant changes in cellular behaviour.

  6. Selank Administration Affects the Expression of Some Genes Involved in GABAergic Neurotransmission

    PubMed Central

    Volkova, Anastasiya; Shadrina, Maria; Kolomin, Timur; Andreeva, Lyudmila; Limborska, Svetlana; Myasoedov, Nikolay; Slominsky, Petr

    2016-01-01

    Clinical studies have shown the similarity of the spectrum of physiological effects of Selank and classical benzodiazepines, such as diazepam and phenazepam. These data suggest that there is a similar basis of their mechanism of action. To test this hypothesis we studied the effect of Selank and GABA on the expression of genes involved in neurotransmission. We analyzed the expression of 84 genes involved in neurotransmission (e.g., major subunit of the GABA receptor, transporters, ion channels, dopamine, and serotonin receptors) in the frontal cortex of rats 1 and 3 h after the administration of Selank or GABA (300 μg/kg) using real-time PCR method. We found significant changes in the expression of 45 genes 1 h after the administration of the compounds. Three hours after Selank or GABA administration, 22 genes changed their expression. We found positive correlation between the changes in genes expression within 1 h after administration of Selank or GABA. Our results showed that Selank caused a number of alterations in the expression of genes involved in neurotransmission. The data obtained indicate that Selank is characterized by its complex effects on nerve cells, and one of its possible molecular mechanisms is associated with allosteric modulation of the GABAergic system. PMID:26924987

  7. Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens

    PubMed Central

    Ederli, Luisa; Dawe, Adam; Pasqualini, Stefania; Quaglia, Mara; Xiong, Liming; Gehring, Chris

    2015-01-01

    We investigated whether the Arabidopsis flower evolved protective measures to increase reproductive success. Firstly, analyses of available transcriptome data show that the most highly expressed transcripts in the closed sepal (stage 12) are enriched in genes with roles in responses to chemical stimuli and cellular metabolic processes. At stage 15, there is enrichment in transcripts with a role in responses to biotic stimuli. Comparative analyses between the sepal and petal in the open flower mark an over-representation of transcripts with a role in responses to stress and catalytic activity. Secondly, the content of the biotic defense-associated phytohormone salicylic acid (SA) in sepals and petals is significantly higher than in leaves. To understand whether the high levels of stress responsive transcripts and the higher SA content affect defense, wild-type plants (Col-0) and transgenic plants defective in SA accumulation (nahG) were challenged with the biotrophic fungus Golovinomyces cichoracearum, the causal agent of powdery mildew, and the necrotrophic fungus Botrytis cinerea. NahG leaves were more sensitive than those of Col-0, suggesting that in leaves SA has a role in the defense against biotrophs. In contrast, sepals and petals of both genotypes were resistant to G. cichoracearum, indicating that in the flower, resistance to the biotrophic pathogen is not critically dependent on SA, but likely dependent on the up-regulation of stress-responsive genes. Since sepals and petals of both genotypes are equally susceptible to B. cinerea, we conclude that neither stress-response genes nor increased SA accumulation offers protection against the necrotrophic pathogen. These results are interpreted in the light of the distinctive role of the flower and we propose that in the early stages, the sepal may act as a chemical defense barrier of the developing reproductive structures against biotrophic pathogens. PMID:25750645

  8. The synthetic gestagen levonorgestrel directly affects gene expression in thyroid and pituitary glands of Xenopus laevis tadpoles.

    PubMed

    Lorenz, Claudia; Opitz, Robert; Trubiroha, Achim; Lutz, Ilka; Zikova, Andrea; Kloas, Werner

    2016-08-01

    The synthetic gestagen levonorgestrel (LNG) was previously shown to perturb thyroid hormone-dependent metamorphosis in Xenopus laevis. However, so far the mechanisms underlying the anti-metamorphic effects of LNG remained unknown. Therefore, a series of in vivo and ex vivo experiments was performed to identify potential target sites of LNG action along the pituitary-thyroid axis of X. laevis tadpoles. Prometamorphic tadpoles were treated in vivo with LNG (0.01-10nM) for 72h and brain-pituitary and thyroid tissue was analyzed for marker gene expression. While no treatment-related changes were observed in brain-pituitary tissue, LNG treatment readily affected thyroidal gene expression in tadpoles including decreased slc5a5 and iyd mRNA expression and a strong induction of dio2 and dio3 expression. When using an ex vivo organ explant culture approach, direct effects of LNG on both pituitary and thyroid gland gene expression were detecTable Specifically, treatment of pituitary explants with 10nM LNG strongly stimulated dio2 expression and concurrently suppressed tshb expression. In thyroid glands, ex vivo LNG treatment induced dio2 and dio3 mRNA expression in a thyrotropin-independent manner. When thyroid explants were cultured in thyrotropin-containing media, LNG caused similar gene expression changes as seen after 72h in vivo treatment including a very strong repression of thyrotropin-induced slc5a5 expression. Concerning the anti-thyroidal activity of LNG as seen under in vivo conditions, our ex vivo data provide clear evidence that LNG directly affects expression of genes important for thyroidal iodide handling as well as genes involved in negative feedback regulation of pituitary tshb expression.

  9. MC1R variants affect the expression of melanocortin and melanogenic genes and the association between melanocortin genes and coloration.

    PubMed

    San-Jose, Luis M; Ducrest, Anne-Lyse; Ducret, Valérie; Simon, Céline; Richter, Hannes; Wakamatsu, Kazumasa; Roulin, Alexandre

    2017-01-01

    The melanocortin-1 receptor (MC1R) gene influences coloration by altering the expression of genes acting downstream in the melanin synthesis. MC1R belongs to the melanocortin system, a genetic network coding for the ligands that regulate MC1R and other melanocortin receptors controlling different physiological and behavioural traits. The impact of MC1R variants on these regulatory melanocortin genes was never considered, even though MC1R mutations could alter the influence of these genes on coloration (e.g. by decreasing MC1R response to melanocortin ligands). Using barn owl growing feathers, we investigated the differences between MC1R genotypes in the (co)expression of six melanocortin and nine melanogenic-related genes and in the association between melanocortin gene expression and phenotype (feather pheomelanin content). Compared to the MC1R rufous allele, responsible for reddish coloration, the white allele was not only associated with an expected lower expression of melanogenic-related genes (TYR, TYRP1, OCA2, SLC45A2, KIT, DCT) but also with a lower MC1R expression and a higher expression of ASIP, the MC1R antagonist. More importantly, the expression of PCSK2, responsible for the maturation of the MC1R agonist, α-melanocyte-stimulating hormone, was positively related to pheomelanin content in MC1R white homozygotes but not in individuals carrying the MC1R rufous allele. These findings indicate that MC1R mutations not only alter the expression of melanogenic-related genes but also the association between coloration and the expression of melanocortin genes upstream of MC1R. This suggests that MC1R mutations can modulate the regulation of coloration by the pleiotropic melanocortin genes, potentially decoupling the often-observed associations between coloration and other phenotypes.

  10. Gene Expression in Gut Symbiotic Organ of Stinkbug Affected by Extracellular Bacterial Symbiont

    PubMed Central

    Futahashi, Ryo; Tanaka, Kohjiro; Tanahashi, Masahiko; Nikoh, Naruo; Kikuchi, Yoshitomo; Lee, Bok Luel; Fukatsu, Takema

    2013-01-01

    The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations. PMID:23691247

  11. Silver nanoparticles administered to chicken affect VEGFA and FGF2 gene expression in breast muscle and heart

    NASA Astrophysics Data System (ADS)

    Hotowy, Anna; Sawosz, Ewa; Pineda, Lane; Sawosz, Filip; Grodzik, Marta; Chwalibog, André

    2012-07-01

    Nanoparticles of colloidal silver (AgNano) can influence gene expression. Concerning trials of AgNano application in poultry nutrition, it is useful to reveal whether they affect the expression of genes crucial for bird development. AgNano were administered to broiler chickens as a water solution in two concentrations (10 and 20 ppm). After dissection of the birds, breast muscles and hearts were collected. Gene expression of FGF2 and VEGFA on the mRNA and protein levels were evaluated using quantitative polymerase chain reaction and enzyme-linked immunosorbent assay methods. The results for gene expression in the breast muscle revealed changes on the mRNA level ( FGF2 was up-regulated, P < 0.05) but not on the protein level. In the heart, 20 ppm of silver nanoparticles in drinking water increased the expression of VEGFA ( P < 0.05), at the same time decreasing FGF2 expression both on the transcriptional and translational levels. Changes in the expression of these genes may lead to histological changes, but this needs to be proven using histological and immunohistochemical examination of tissues. In general, we showed that AgNano application in poultry feeding influences the expression of FGF2 and VEGFA genes on the mRNA and protein levels in growing chicken.

  12. Transcription factor co-localization patterns affect human cell type-specific gene expression

    PubMed Central

    2012-01-01

    Background Cellular development requires the precise control of gene expression states. Transcription factors are involved in this regulatory process through their combinatorial binding with DNA. Information about transcription factor binding sites can help determine which combinations of factors work together to regulate a gene, but it is unclear how far the binding data from one cell type can inform about regulation in other cell types. Results By integrating data on co-localized transcription factor binding sites in the K562 cell line with expression data across 38 distinct hematopoietic cell types, we developed regression models to describe the relationship between the expression of target genes and the transcription factors that co-localize nearby. With K562 binding sites identifying the predictors, the proportion of expression explained by the models is statistically significant only for monocytic cells (p-value< 0.001), which are closely related to K562. That is, cell type specific binding patterns are crucial for choosing the correct transcription factors for the model. Comparison of predictors obtained from binding sites in the GM12878 cell line with those from K562 shows that the amount of difference between binding patterns is directly related to the quality of the prediction. By identifying individual genes whose expression is predicted accurately by the binding sites, we are able to link transcription factors FOS, TAF1 and YY1 to a sparsely studied gene LRIG2. We also find that the activity of a transcription factor may be different depending on the cell type and the identity of other co-localized factors. Conclusion Our approach shows that gene expression can be explained by a modest number of co-localized transcription factors, however, information on cell-type specific binding is crucial for understanding combinatorial gene regulation. PMID:22721266

  13. Factor Analysis of MYB Gene Expression and Flavonoid Affecting Petal Color in Three Crabapple Cultivars.

    PubMed

    Zhang, Jie; Liu, Yingying; Bu, YuFen; Zhang, Xi; Yao, Yuncong

    2017-01-01

    Flavonoid biosynthesis has received much attention concerning the structural genes and expression of the associated transcription factors (TFs). In the present study, we examined the gene expression patterns for petals of three colors using a statistical method. Factor analysis was successfully used to examine the expression patterns most present during regulation. The first expression patterns in the white and red petals were clearly demonstrated and have revealed different mechanisms of producing the proper components, whereas that in the pink petals was more complex, requiring factor analysis to supplement the other results. Combining the results of the correlation analysis between TFs and structural genes, the effects of each TF on the main expression pattern in each cultivar were determined. Moreover, McMYB10 was implicated in the regulation of the gene expression pattern in red petals, and McMYB5 was implicated in the maintenance of the balance of the pigment components and proanthocyanin (PA) production in cooperation with McMYB4 to generate pigmentation in the pink petals.

  14. Factor Analysis of MYB Gene Expression and Flavonoid Affecting Petal Color in Three Crabapple Cultivars

    PubMed Central

    Zhang, Jie; Liu, Yingying; Bu, YuFen; Zhang, Xi; Yao, Yuncong

    2017-01-01

    Flavonoid biosynthesis has received much attention concerning the structural genes and expression of the associated transcription factors (TFs). In the present study, we examined the gene expression patterns for petals of three colors using a statistical method. Factor analysis was successfully used to examine the expression patterns most present during regulation. The first expression patterns in the white and red petals were clearly demonstrated and have revealed different mechanisms of producing the proper components, whereas that in the pink petals was more complex, requiring factor analysis to supplement the other results. Combining the results of the correlation analysis between TFs and structural genes, the effects of each TF on the main expression pattern in each cultivar were determined. Moreover, McMYB10 was implicated in the regulation of the gene expression pattern in red petals, and McMYB5 was implicated in the maintenance of the balance of the pigment components and proanthocyanin (PA) production in cooperation with McMYB4 to generate pigmentation in the pink petals. PMID:28223999

  15. Monoterpenoid-based preparations in beehives affect learning, memory, and gene expression in the bee brain.

    PubMed

    Bonnafé, Elsa; Alayrangues, Julie; Hotier, Lucie; Massou, Isabelle; Renom, Allan; Souesme, Guillaume; Marty, Pierre; Allaoua, Marion; Treilhou, Michel; Armengaud, Catherine

    2017-02-01

    Bees are exposed in their environment to contaminants that can weaken the colony and contribute to bee declines. Monoterpenoid-based preparations can be introduced into hives to control the parasitic mite Varroa destructor. The long-term effects of monoterpenoids are poorly investigated. Olfactory conditioning of the proboscis extension reflex (PER) has been used to evaluate the impact of stressors on cognitive functions of the honeybee such as learning and memory. The authors tested the PER to odorants on bees after exposure to monoterpenoids in hives. Octopamine receptors, transient receptor potential-like (TRPL), and γ-aminobutyric acid channels are thought to play a critical role in the memory of food experience. Gene expression levels of Amoa1, Rdl, and trpl were evaluated in parallel in the bee brain because these genes code for the cellular targets of monoterpenoids and some pesticides and neural circuits of memory require their expression. The miticide impaired the PER to odors in the 3 wk following treatment. Short-term and long-term olfactory memories were improved months after introduction of the monoterpenoids into the beehives. Chronic exposure to the miticide had significant effects on Amoa1, Rdl, and trpl gene expressions and modified seasonal changes in the expression of these genes in the brain. The decrease of expression of these genes in winter could partly explain the improvement of memory. The present study has led to new insights into alternative treatments, especially on their effects on memory and expression of selected genes involved in this cognitive function. Environ Toxicol Chem 2017;36:337-345. © 2016 SETAC.

  16. Acid environments affect biofilm formation and gene expression in isolates of Salmonella enterica Typhimurium DT104.

    PubMed

    O'Leary, Denis; McCabe, Evonne M; McCusker, Matthew P; Martins, Marta; Fanning, Séamus; Duffy, Geraldine

    2015-08-03

    The aim of this study was to examine the survival and potential virulence of biofilm-forming Salmonella Typhimurium DT104 under mild acid conditions. Salmonella Typhimurium DT104 employs an acid tolerance response (ATR) allowing it to adapt to acidic environments. The threat that these acid adapted cells pose to food safety could be enhanced if they also produce biofilms in acidic conditions. The cells were acid-adapted by culturing them in 1% glucose and their ability to form biofilms on stainless steel and on the surface of Luria Bertani (LB) broth at pH7 and pH5 was examined. Plate counts were performed to examine cell survival. RNA was isolated from cells to examine changes in the expression of genes associated with virulence, invasion, biofilm formation and global gene regulation in response to acid stress. Of the 4 isolates that were examined only one (1481) that produced a rigid biofilm in LB broth at pH7 also formed this same structure at pH5. This indicated that the lactic acid severely impeded the biofilm producing capabilities of the other isolates examined under these conditions. Isolate 1481 also had higher expression of genes associated with virulence (hilA) and invasion (invA) with a 24.34-fold and 13.68-fold increase in relative gene expression respectively at pH5 compared to pH7. Although genes associated with biofilm formation had increased expression in response to acid stress for all the isolates this only resulted in the formation of a biofilm by isolate 1481. This suggests that in addition to the range of genes associated with biofilm production at neutral pH, there are genes whose protein products specifically aid in biofilm production in acidic environments. Furthermore, it highlights the potential for the use of lactic acid for the inhibition of Salmonella biofilms.

  17. Golden Pigment Production and Virulence Gene Expression Are Affected by Metabolisms in Staphylococcus aureus▿ †

    PubMed Central

    Lan, Lefu; Cheng, Alice; Dunman, Paul M.; Missiakas, Dominique; He, Chuan

    2010-01-01

    The pathogenesis of staphylococcal infections is multifactorial. Golden pigment is an eponymous feature of the human pathogen Staphylococcus aureus that shields the microbe from oxidation-based clearance, an innate host immune response to infection. Here, we screened a collection of S. aureus transposon mutants for pigment production variants. A total of 15 previously unidentified genes were discovered. Notably, disrupting metabolic pathways such as the tricarboxylic acid cycle, purine biosynthesis, and oxidative phosphorylation yields mutants with enhanced pigmentation. The dramatic effect on pigment production seems to correlate with altered expression of virulence determinants. Microarray analysis further indicates that purine biosynthesis impacts the expression of ∼400 genes involved in a broad spectrum of functions including virulence. The purine biosynthesis mutant and oxidative phosphorylation mutant strains exhibit significantly attenuated virulence in a murine abscess model of infection. Inhibition of purine biosynthesis with a known small-molecule inhibitor results in altered virulence gene expression and virulence attenuation during infection. Taken together, these results suggest an intimate link between metabolic processes and virulence gene expression in S. aureus. This study also establishes the importance of purine biosynthesis and oxidative phosphorylation for in vivo survival. PMID:20400547

  18. The two CcdA proteins of Bacillus anthracis differentially affect virulence gene expression and sporulation.

    PubMed

    Han, Hesong; Wilson, Adam C

    2013-12-01

    The cytochrome c maturation system influences the expression of virulence factors in Bacillus anthracis. B. anthracis carries two copies of the ccdA gene, encoding predicted thiol-disulfide oxidoreductases that contribute to cytochrome c maturation, while the closely related organism Bacillus subtilis carries only one copy of ccdA. To investigate the roles of the two ccdA gene copies in B. anthracis, strains were constructed without each ccdA gene, and one strain was constructed without both copies simultaneously. Loss of both ccdA genes results in a reduction of cytochrome c production, an increase in virulence factor expression, and a reduction in sporulation efficiency. Complementation and expression analyses indicate that ccdA2 encodes the primary CcdA in B. anthracis, active in all three pathways. While CcdA1 retains activity in cytochrome c maturation and virulence control, it has completely lost its activity in the sporulation pathway. In support of this finding, expression of ccdA1 is strongly reduced when cells are grown under sporulation-inducing conditions. When the activities of CcdA1 and CcdA2 were analyzed in B. subtilis, neither protein retained activity in cytochrome c maturation, but CcdA2 could still function in sporulation. These observations reveal the complexities of thiol-disulfide oxidoreductase function in pathways relevant to virulence and physiology.

  19. Modification of AtGRDP1 gene expression affects silique and seed development in Arabidopsis thaliana.

    PubMed

    Rodríguez-Hernández, Aída Araceli; Muro-Medina, Carlos Vladimir; Ramírez-Alonso, Jocelin Itzel; Jiménez-Bremont, Juan Francisco

    2017-03-08

    Glycine Rich Proteins (GRPs) are induced at different developmental stages and in specific plant tissues. Recently, we described a novel Arabidopsis gene encoding a short glycine-rich domain protein (AtGRDP1). This gene is involved in abiotic stress responsiveness; the Atgrdp1-null mutant seeds were more sensitive to stress, while the opposite phenotype was achieved by AtGRDP1 overexpression. In this study, we analyzed the phenotype of the fruits produced by Arabidopsis Atgrdp1 mutants and 35S::AtGRDP1 overexpression lines. Our analyses revealed important changes in silique length, seed number, seed weight and morphology in the analyzed lines. In particular, Atgrdp1 mutant lines exhibited several defects including short siliques, a diminished number of seeds per silique, and reduction in seed size and weight as compared to Col-0. The overexpression of the AtGRDP1 gene also generated phenotypes with alterations in size of silique, number of seeds per silique, and size and weight of seed. In addition, the expression analysis of AtGRDP1 gene showed that it was expressed in floral and fruit organs, with the highest expression level in mature siliques. The alterations in the siliques and seeds traits in the Atgrdp1 mutant line, as well as the phenotypes observed in AtGRDP1 overexpression lines, suggest a role of the AtGRDP1 gene in the Arabidopsis fruit development.

  20. Neonatal local noxious insult affects gene expression in the spinal dorsal horn of adult rats.

    PubMed

    Ren, Ke; Novikova, Svetlana I; He, Fang; Dubner, Ronald; Lidow, Michael S

    2005-09-22

    Neonatal noxious insult produces a long-term effect on pain processing in adults. Rats subjected to carrageenan (CAR) injection in one hindpaw within the sensitive period develop bilateral hypoalgesia as adults. In the same rats, inflammation of the hindpaw, which was the site of the neonatal injury, induces a localized enhanced hyperalgesia limited to this paw. To gain an insight into the long-term molecular changes involved in the above-described long-term nociceptive effects of neonatal noxious insult at the spinal level, we performed DNA microarray analysis (using microarrays containing oligo-probes for 205 genes encoding receptors and transporters for glutamate, GABA, and amine neurotransmitters, precursors and receptors for neuropeptides, and neurotrophins, cytokines and their receptors) to compare gene expression profiles in the lumbar spinal dorsal horn (LDH) of adult (P60) male rats that received neonatal CAR treatment within (at postnatal day 3; P3) and outside (at postnatal 12; P12) of the sensitive period. The data were obtained both without inflammation (at baseline) and during complete Freund's adjuvant induced inflammation of the neonatally injured paw. The observed changes were verified by real-time RT-PCR. This study revealed significant basal and inflammation-associated aberrations in the expression of multiple genes in the LDH of adult animals receiving CAR injection at P3 as compared to their expression levels in the LDH of animals receiving either no injections or CAR injection at P12. In particular, at baseline, twelve genes (representing GABA, serotonin, adenosine, neuropeptide Y, cholecystokinin, opioid, tachykinin and interleukin systems) were up-regulated in the bilateral LDH of the former animals. The baseline condition in these animals was also characterized by up-regulation of seven genes (encoding members of GABA, cholecystokinin, histamine, serotonin, and neurotensin systems) in the LDH ipsilateral to the neonatally-injured paw. The

  1. Studies of Normal and Position-Affected Expression of ROSY Region Genes in DROSOPHILA MELANOGASTER

    PubMed Central

    Clark, Stephen H.; Chovnick, Arthur

    1986-01-01

    Transformant complementation, intragenic deletions and Northern blot analyses provide unambiguous localization of the l(3) S12 gene immediately proximal to the 5' end of the rosy locus. We have characterized an array of transformants with respect to l( 3)S12 and rosy expression. The l(3) S12 gene is exceedingly sensitive to euchromatic site-specific position effects. Unlike the rosy locus, l(3)S12 is insensitive to heterochromatic position effect in rearrangements, as well as in a transformant located in heterochromatin. Cotransformants for both l(3)S12 and rosy elicit no apparent pattern of concordance with respect to euchromatic site-specific position effects. Heterochromatic-euchromatic rearrangements are examined with respect to position effects on expression of the rosy region genes l(3) 12, rosy, snake and piccolo, as well as suppressor effects. Clear distinction is seen between euchromatic and heterochromatic effects. PMID:3098623

  2. Low-level lasers affect uncoupling protein gene expression in skin and skeletal muscle tissues

    NASA Astrophysics Data System (ADS)

    Canuto, K. S.; Sergio, L. P. S.; Paoli, F.; Mencalha, A. L.; Fonseca, A. S.

    2016-03-01

    Wavelength, frequency, power, fluence, and emission mode determine the photophysical, photochemical, and photobiological responses of biological tissues to low-level lasers. Free radicals are involved in these responses acting as second messengers in intracellular signaling processes. Irradiated cells present defenses against these chemical species to avoid unwanted effects, such as uncoupling proteins (UCPs), which are part of protective mechanisms and minimize the effects of free radical generation in mitochondria. In this work UCP2 and UCP3 mRNA gene relative expression in the skin and skeletal muscle tissues of Wistar rats exposed to low-level red and infrared lasers was evaluated. Samples of the skin and skeletal muscle tissue of Wistar rats exposed to low-level red and infrared lasers were withdrawn for total RNA extraction, cDNA synthesis, and the evaluation of gene expression by quantitative polymerase chain reaction. UCP2 and UCP3 mRNA expression was differently altered in skin and skeletal muscle tissues exposed to lasers in a wavelength-dependent effect, with the UCP3 mRNA expression dose-dependent. Alteration on UCP gene expression could be part of the biostimulation effect and is necessary to make cells exposed to red and infrared low-level lasers more resistant or capable of adapting in damaged tissues or diseases.

  3. Fusarium culmorum affects expression of biofilm formation key genes in Bacillus subtilis

    PubMed Central

    Khezri, Maryam; Jouzani, Gholamreza Salehi; Ahmadzadeh, Masoud

    2016-01-01

    It is known that there is correlation between biofilm formation and antagonistic activities of Bacillus subtilis strains; but, the mechanism of this correlation is not clear. So, the effect of the plant pathogen (Fusarium culmorum) on the biofilm formation in a B. subtilis strain with high antagonistic and biofilm formation activities was studied. The expression of sinR and tasA genes involved in the biofilm formation was studied in both single culture of bacterium (B) and co-culture with F. culmorum (FB) using real-time PCR. The results revealed that the expression of the sinR gene in both B and FB conditions was continuously decreased during the biofilm formation period and, after 24 h (B4 and FB4), it reached 1% and 0.3% at the planktonic phase (B1), respectively, whereas the expression of the tasA was continuously increased and was 5.27 and 30 times more than that at the planktonic phase (B1) after 24 h, respectively. So, the expression reduction rate for sinR (3 times) and the expression increasing rate for tasA (6 times) were significantly higher in FB conditions than the B ones. The relative expression of sinR in FB1 (planktonic phase), FB2 (8 h), FB3(12 h), and FB4 (24 h) times was 0.65, 0.44, 0.35, and 0.29, whereas the tasA gene expression was 2.98, 3.44, 4.37, and 5.63-fold of the one at coordinate time points in B conditions, respectively. The significant expression reduction of sinR and increase of tasA confirmed that the presence of pathogen could stimulate biofilm formation in the antagonistic bacterium. PMID:26887226

  4. Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew

    PubMed Central

    Chowdhury, Jamil; Lück, Stefanie; Rajaraman, Jeyaraman; Douchkov, Dimitar; Shirley, Neil J.; Schwerdt, Julian G.; Schweizer, Patrick; Fincher, Geoffrey B.; Burton, Rachel A.; Little, Alan

    2017-01-01

    Heteroxylan has recently been identified as an important component of papillae, which are formed during powdery mildew infection of barley leaves. Deposition of heteroxylan near the sites of attempted fungal penetration in the epidermal cell wall is believed to enhance the physical resistance to the fungal penetration peg and hence to improve pre-invasion resistance. Several glycosyltransferase (GT) families are implicated in the assembly of heteroxylan in the plant cell wall, and are likely to work together in a multi-enzyme complex. Members of key GT families reported to be involved in heteroxylan biosynthesis are up-regulated in the epidermal layer of barley leaves during powdery mildew infection. Modulation of their expression leads to altered susceptibility levels, suggesting that these genes are important for penetration resistance. The highest level of resistance was achieved when a GT43 gene was co-expressed with a GT47 candidate gene, both of which have been predicted to be involved in xylan backbone biosynthesis. Altering the expression level of several candidate heteroxylan synthesis genes can significantly alter disease susceptibility. This is predicted to occur through changes in the amount and structure of heteroxylan in barley papillae.

  5. Temperature stress affects the expression of immune response genes in the alfalfa leafcutting bee (Megachile rotundata)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The alfalfa leafcutting bee (Megachile rotundata) is affected by a fungal disease called chalkbrood. In several species of bees, chalkbrood is more likely to occur in larvae kept at 25-30 C than at 35 C. We found that both high and low temperature stress increased the expression of immune response g...

  6. Temperature stress affects the expression of immune response genes in the alfalfa leafcutting bee, Megachile rotundata.

    PubMed

    Xu, J; James, Rosalind R

    2012-04-01

    Environmental stresses are thought to be associated with increases in disease suceptibility, attributable to evolutionary trade-offs between the energy demands required to deal with stress vs pathogens. We compared the effects of temperature stress and pathogen exposure on the immune response of a solitary bee, Megachile rotundata. Using an oligonucleotide microarray with 125 genes (375 probes), we determined that both high and low temperatures increased the expression of immune response genes in M. rotundata and reduced levels of a disease called chalkbrood. In the absence of the pathogen, trypsin-like serine and pathogen recognition proteases were most highly expressed at the lowest rearing temperature (20°C), while immune response signalling pathways and melanization were highly expressed at the warmest temperature tested (35°C). In pathogen-exposed bees, immune response genes tended to be most highly expressed at moderate temperatures, where we also saw the greatest infection levels. Temperature stress appears to have activated immunity before the pathogen elicited a response from the host, and this early activity prevented infection under stressful conditions. In this insect, the trade-off in energetic costs associated with stress and infection may be partially avoided by the use of conserved responses that reduce the effects of both.

  7. Oral pathogens change proliferation properties of oral tumor cells by affecting gene expression of human defensins.

    PubMed

    Hoppe, T; Kraus, D; Novak, N; Probstmeier, R; Frentzen, M; Wenghoefer, M; Jepsen, S; Winter, J

    2016-10-01

    The impact of oral pathogens onto the generation and variability of oral tumors has only recently been investigated. To get further insights, oral cancer cells were treated with pathogens and additionally, as a result of this bacterial cellular infection, with human defensins, which are as anti-microbial peptide members of the innate immune system. After cell stimulation, proliferation behavior, expression analysis of oncogenic relevant defensin genes, and effects on EGFR signaling were investigated. The expression of oncogenic relevant anti-microbial peptides was analyzed with real-time PCR and immunohistochemistry. Cell culture experiments were performed to examine cellular impacts caused by stimulation, i.e., altered gene expression, proliferation rate, and EGF receptor-dependent signaling. Incubation of oral tumor cells with an oral pathogen (Porphyromonas gingivalis) and human α-defensins led to an increase in cell proliferation. In contrast, another oral bacterium used, Aggregatibacter actinomycetemcomitans, enhanced cell death. The bacteria and anti-microbial peptides exhibited diverse effects on the transcript levels of oncogenic relevant defensin genes and epidermal growth factor receptor signaling. These two oral pathogens exhibited opposite primary effects on the proliferation behavior of oral tumor cells. Nevertheless, both microbe species led to similar secondary impacts on the proliferation rate by modifying expression levels of oncogenic relevant α-defensin genes. In this respect, oral pathogens exerted multiplying effects on tumor cell proliferation. Additionally, human defensins were shown to differently influence epidermal growth factor receptor signaling, supporting the hypothesis that these anti-microbial peptides serve as ligands of EGFR, thus modifying the proliferation behavior of oral tumor cells.

  8. Extremely low-frequency electromagnetic fields do not affect DNA damage and gene expression profiles of yeast and human lymphocytes.

    PubMed

    Luceri, Cristina; De Filippo, Carlotta; Giovannelli, Lisa; Blangiardo, Marta; Cavalieri, Duccio; Aglietti, Filippo; Pampaloni, Monica; Andreuccetti, Daniele; Pieri, Lapo; Bambi, Franco; Biggeri, Annibale; Dolara, Piero

    2005-09-01

    We studied the effects of extremely low-frequency (50 Hz) electromagnetic fields (EMFs) on peripheral human blood lymphocytes and DBY747 Saccharomyces cerevisiae. Graded exposure to 50 Hz magnetic flux density was obtained with a Helmholtz coil system set at 1, 10 or 100 microT for 18 h. The effects of EMFs on DNA damage were studied with the single-cell gel electrophoresis assay (comet assay) in lymphocytes. Gene expression profiles of EMF-exposed human and yeast cells were evaluated with DNA microarrays containing 13,971 and 6,212 oligonucleotides, respectively. After exposure to the EMF, we did not observe an increase in the amount of strand breaks or oxidated DNA bases relative to controls or a variation in gene expression profiles. The results suggest that extremely low-frequency EMFs do not induce DNA damage or affect gene expression in these two different eukaryotic cell systems.

  9. Methyl jasmonate affects phenolic metabolism and gene expression in blueberry (Vaccinium corymbosum).

    PubMed

    Cocetta, Giacomo; Rossoni, Mara; Gardana, Claudio; Mignani, Ilaria; Ferrante, Antonio; Spinardi, Anna

    2015-02-01

    Blueberry (Vaccinium corymbosum) is a fruit very much appreciated by consumers for its antioxidant potential and health-promoting traits. Its beneficial potential properties are mainly due to a high content of anthocyanins and their amount can change after elicitation with methyl jasmonate. The aim of this work is to evaluate the changes in expression of several genes, accumulation of phenolic compounds and alterations in antioxidant potential in two different blueberry cultivars ('Duke' and 'Blueray') in response to methyl jasmonate (0.1 mM). Results showed that 9 h after treatment, the expression of phenylalanine ammonium lyase, chalcone synthase and anthocyanidin synthase genes was stimulated more in the 'Blueray' variety. Among the phenols measured an increase was recorded also for epicatechin and anthocyanin concentrations. 'Duke' is a richer sourche of anthocyanins compared to 'Blueray', treatment with methyl jasmonate promoted in 'Blueray' an increase in pigments as well as in the antioxidant potential, especially in fully ripe berries, but treated 'Duke' berries had greater levels, which were not induced by methyl jasmonate treatment. In conclusion, methyl jasmonate was, in some cases, an effective elicitor of phenolic metabolism and gene expression in blueberry, though with different intensity between cultivars.

  10. The Light Wavelength Affects the Ontogeny of Clock Gene Expression and Activity Rhythms in Zebrafish Larvae.

    PubMed

    Di Rosa, Viviana; Frigato, Elena; López-Olmeda, José F; Sánchez-Vázquez, Francisco J; Bertolucci, Cristiano

    2015-01-01

    Light plays a key role in synchronizing rhythms and setting the phase of early development. However, to date, little is known about the impact of light wavelengths during the ontogeny of the molecular clock and the behavioural rhythmicity. The aim of this research was to determine the effect of light of different wavelengths (white, blue and red) on the onset of locomotor activity and clock gene (per1b, per2, clock1, bmal1 and dbp) expression rhythms. For this purpose, 4 groups of zebrafish embryo/larvae were raised from 0 to 7 days post-fertilization (dpf) under the following lighting conditions: three groups maintained under light:dark (LD) cycles with white (full visible spectrum, LDW), blue (LDB), or red light (LDR), and one group raised under constant darkness (DD). The results showed that lighting conditions influenced activity rhythms. Larvae were arrhythmic under DD, while under LD cycles they developed wavelength-dependent daily activity rhythms which appeared earlier under LDB (4 dpf) than under LDW or LDR (5 dpf). The results also revealed that development and lighting conditions influenced clock gene expression. While clock1 rhythmic expression appeared in all lighting conditions at 7 dpf, per1b, per2 and dbp showed daily variations already at 3 dpf. Curiously, bmal1 showed consistent rhythmic expression from embryonic stage (0 dpf). Summarizing, the data revealed that daily rhythms appeared earlier in the larvae reared under LDB than in those reared under LDW and LDR. These results emphasize the importance of lighting conditions and wavelengths during early development for the ontogeny of daily rhythms of gene expression and how these rhythms are reflected on the behavioural rhythmicity of zebrafish larvae.

  11. Grafting of Beads into Developing Chicken Embryo Limbs to Identify Signal Transduction Pathways Affecting Gene Expression.

    PubMed

    Mohammed, Rabeea H; Sweetman, Dylan

    2016-01-17

    Using chicken embryos it is possible to test directly the effects of either growth factors or specific inhibitors of signaling pathways on gene expression and activation of signal transduction pathways. This technique allows the delivery of signaling molecules at precisely defined developmental stages for specific times. After this embryos can be harvested and gene expression examined, for example by in situ hybridization, or activation of signal transduction pathways observed with immunostaining. In this video heparin beads soaked in FGF18 or AG 1-X2 beads soaked in U0126, a MEK inhibitor, are grafted into the limb bud in ovo. This shows that FGF18 induces expression of MyoD and ERK phosphorylation and both endogenous and FGF18 induced MyoD expression is inhibited by U0126. Beads soaked in a retinoic acid antagonist can potentiate premature MyoD induction by FGF18. This approach can be used with a wide range of different growth factors and inhibitors and is easily adapted to other tissues in the developing embryo.

  12. Gene expression in primary cultured astrocytes affected by aluminum: alteration of chaperons involved in protein folding

    PubMed Central

    Aremu, David A.; Ezomo, Ojeiru F.

    2010-01-01

    Objectives Aluminum is notorious as a neurotoxic metal. The aim of our study was to determine whether endoplasmic reticulum (ER) stress is involved in aluminum-induced apoptosis in astrocytes. Methods Mitochondrial RNA (mRNA) was analyzed by reverse transcription (RT)-PCR following pulse exposure of aluminum glycinate to primary cultured astrocytes. Tunicamycin was used as a positive control. Results Gene expression analysis revealed that Ire1β was up-regulated in astrocytes exposed to aluminum while Ire1α was up-regulated by tunicamycin. Exposure to aluminum glycinate, in contrast to tunicamycin, seemed to down-regulate mRNA expression of many genes, including the ER resident molecular chaperone BiP/Grp78 and Ca2+-binding chaperones (calnexin and calreticulin), as well as stanniocalcin 2 and OASIS. The down-regulation or non-activation of the molecular chaperons, whose expressions are known to be protective by increasing protein folding, may spell doom for the adaptive response. Exposure to aluminum did not have any significant effects on the expression of Bax and Bcl2 in astrocytes. Conclusions The results of this study demonstrate that aluminum may induce apoptosis in astrocytes via ER stress by impairing the protein-folding machinery. PMID:21432213

  13. Interplay of gene expression noise and ultrasensitive dynamics affects bacterial operon organization.

    PubMed

    Ray, J Christian J; Igoshin, Oleg A

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes.

  14. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    PubMed

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer.

  15. Temperature and water loss affect ADH activity and gene expression in grape berry during postharvest dehydration.

    PubMed

    Cirilli, Marco; Bellincontro, Andrea; De Santis, Diana; Botondi, Rinaldo; Colao, Maria Chiara; Muleo, Rosario; Mencarelli, Fabio

    2012-05-01

    Clusters of Aleatico wine grape were picked at 18°Brix and placed at 10, 20, or 30°C, 45% relative humidity (RH) and 1.5m/s of air flow to dehydrate the berries up to 40% of loss of initial fresh weight. Sampling was done at 0%, 10%, 20%, 30%, and 40% weight loss (wl). ADH (alcohol dehydrogenase) gene expression, enzyme activity, and related metabolites were analysed. At 10°C, acetaldehyde increased rapidly and then declined, while ethanol continued to rise. At 20°C, acetaldehyde and ethanol increased significantly with the same pattern and declined at 40%wl. At 30°C, acetaldehyde did not increase but ethanol increased rapidly already at 10%wl. At the latter temperature, a significant increase in acetic acid and ethyl acetate occurred, while at 10°C their values were low. At 30°C, the ADH activity (ethanol to acetaldehyde direction), increased rapidly but acetaldehyde did not rise because of its oxidation to acetic acid, which increased together with ethyl acetate. At 10°C, the ADH activity increased at 20%wl and continued to rise even at 40%wl, meaning that ethanol oxidation was delayed. At 20°C, the behaviour was intermediate to the other temperatures. The relative expression of the VvAdh2 gene was the highest at 10°C already at 10%wl in a synchrony with the ADH activity, indicating a rapid response likely due to low temperature. The expression subsequently declined. At 20 and 30°C, the expression was lower and increased slightly during dehydration in combination with the ADH activity. This imbalance between gene expression and ADH activity at 10°C, as well as the unexpected expression of the carotenoid cleavage dioxygenase 1 (CCD1) gene, opens the discussion on the stress sensitivity and transcription event during postharvest dehydration, and the importance of carefully monitoring temperature during dehydration.

  16. Iron Content Affects Lipogenic Gene Expression in the Muscle of Nelore Beef Cattle

    PubMed Central

    Diniz, Wellison Jarles da Silva; Coutinho, Luiz Lehmann; Tizioto, Polyana Cristine; Cesar, Aline Silva Mello; Gromboni, Caio Fernando; Nogueira, Ana Rita Araújo; de Oliveira, Priscila Silva Neubern; de Souza, Marcela Maria

    2016-01-01

    Iron (Fe) is an essential mineral for metabolism and plays a central role in a range of biochemical processes. Therefore, this study aimed to identify differentially expressed (DE) genes and metabolic pathways in Longissimus dorsi (LD) muscle from cattle with divergent iron content, as well as to investigate the likely role of these DE genes in biological processes underlying beef quality parameters. Samples for RNA extraction for sequencing and iron, copper, manganese, and zinc determination were collected from LD muscles at slaughter. Eight Nelore steers, with extreme genomic estimated breeding values for iron content (Fe-GEBV), were selected from a reference population of 373 animals. From the 49 annotated DE genes (FDR<0.05) found between the two groups, 18 were up-regulated and 31 down-regulated for the animals in the low Fe-GEBV group. The functional enrichment analyses identified several biological processes, such as lipid transport and metabolism, and cell growth. Lipid metabolism was the main pathway observed in the analysis of metabolic and canonical signaling pathways for the genes identified as DE, including the genes FASN, FABP4, and THRSP, which are functional candidates for beef quality, suggesting reduced lipogenic activities with lower iron content. Our results indicate metabolic pathways that are partially influenced by iron, contributing to a better understanding of its participation in skeletal muscle physiology. PMID:27532424

  17. Mutations affecting the expression of the MOX gene encoding peroxisomal methanol oxidase in Hansenula polymorpha.

    PubMed

    Vallini, V; Berardi, E; Strabbioli, R

    2000-11-01

    In this study, aimed at identifying genetic factors acting positively upon the MOX gene, we report the isolation and characterisation of several methanol utilisation-defective (Mut-) mutants of Hansenula polymorpha. These fall into 12 complementation groups, eight of which show significant reductions in alcohol (methanol) oxidase activity in methanol. Three of these groups, identifying the MUT3, MUT5 and MUT10 loci, exhibit extremely low levels of MOX promoter activity, not only in methanol medium, but also during growth in glycerol or methylamine. We suggest that these loci play a significant role in the derepression of the MOX gene expression. One of these genes (MUT10) also seems to be involved in the utilisation of carbon sources other than methanol, and it is apparent that the same gene plays some role in the biogenesis or in the enlargement of the peroxisome. Three other genes (MUT7, MUT8 and MUT9) appear to be involved in peroxisome biogenesis, whereas most other mutants harbour lesions that leave the peroxisome biogenesis and proliferation unaffected.

  18. Light affects ascorbate content and ascorbate-related gene expression in tomato leaves more than in fruits.

    PubMed

    Massot, Capucine; Stevens, Rebecca; Génard, Michel; Longuenesse, Jean-Jacques; Gautier, Hélène

    2012-01-01

    Little is known about the light regulation of vitamin C synthesis in fruits. In contrast, previous studies in leaves revealed that VTC2 (coding for GDP-L: -galactose phosphorylase) was one of the key genes up-regulated by light in leaves. Our objective was to determine how the expression of ascorbate (AsA) synthesis genes in tomato (Solanum lycopersicum) was modified according to light irradiance in both leaves and fruits. Seven days of shading strongly decreased total ascorbate (reduced and oxidized form) content in leaves (50%) and to a lesser extent in fruits (10%). Among the last six steps of AsA biosynthesis, only two genes, VTC2 and GPP1 (one of the two unigenes coding for L: -galactose-1-P phosphatase in tomato), were down-regulated by long-term shading in red ripe fruits, compared to seven genes regulated in leaves. This underlines that light affects AsA-related gene expression more in leaves than in ripening fruits. Moreover, this study reveals strong daily changes in transcript levels of enzymes of the AsA biosynthetic pathway in leaves (11 of the 12 studied genes showed significant changes in their expression pattern). Among those genes, we found that diurnal variation in transcript levels of VTC2 and GME1 correlated to leaf AsA content measured 8 h later. This study provides a new hypothesis on the role of GME1 in addition to VTC2 in light-regulated AsA biosynthesis.

  19. Differential gene expression and apoptosis markers in presymptomatic scrapie affected sheep.

    PubMed

    Hedman, Carlos; Lyahyai, Jaber; Filali, Hicham; Marín, Belén; Serrano, Carmen; Monleón, Eva; Moreno, Bernardino; Zaragoza, Pilar; Badiola, Juan José; Martín-Burriel, Inmaculada; Bolea, Rosa

    2012-09-14

    Neuronal loss is one of the characteristics of scrapie neuropathology. Previous analysis of brains from sheep naturally infected with scrapie that were in a terminal stage did not detect a clear induction of apoptosis, although molecular changes were evidenced. As neuronal death could be occurring early in scrapie, we developed a neuropathological and gene expression study of sheep infected with scrapie in a presymptomatic stage. The histopathology, immunolabelling of PrP(Sc), Bax and activated caspase-3, and the analysis of the expression of 7 genes involved in the regulation of the mitochondrial pathway of apoptosis were investigated in the following 4 central nervous system areas: medulla oblongata, diencephalon, frontal cortex and cerebellum. Moreover, TUNEL and NeuN immunolabelling was performed in the medulla oblongata. The PrP(Sc) immunolabelling in the four areas, as well as a neuropil spongiform change, were more evident in the terminal stage than in presymptomatic animals. Cytoplasmic Bax immunostaining was observed in the presymptomatic medulla oblongata. In contrast to symptomatic animals, the immunostaining was not extended to the hypothalamus, indicating the progression of Bax induction during the course of the disease. Although neither caspase-3 immunostaining nor the TUNEL technique detected neurons with apoptosis, NeuN-immunolabelled cell counting determined that presymptomatic animals have already suffered neuronal loss in a lower or equal degree than symptomatic animals. Finally, the gene expression profiles indicated that the mitochondrial pathway of apoptosis was activated with higher intensity in presymptomatic animals than in symptomatic sheep and confirmed the implication of genes such as BAX or AIF in the disease.

  20. Heat Stress Affects Pi-related Genes Expression and Inorganic Phosphate Deposition/Accumulation in Barley

    PubMed Central

    Pacak, Andrzej; Barciszewska-Pacak, Maria; Swida-Barteczka, Aleksandra; Kruszka, Katarzyna; Sega, Pawel; Milanowska, Kaja; Jakobsen, Iver; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

    2016-01-01

    Phosphorus (P) in plants is taken from soil as an inorganic phosphate (Pi) and is one of the most important macroelements in growth and development. Plants actively react to Pi starvation by the induced expression of Pi transporters, MIR399, MIR827, and miR399 molecular sponge – IPS1 genes and by the decreased expression of the ubiquitin-conjugating enzyme E2 (PHOSPHATE2 – PHO2) and Pi sensing and transport SPX-MFS genes. The PHO2 protein is involved in the degradation of Pi transporters PHT1;1 (from soil to roots) and PHO1 (from roots to shoots). The decreased expression of PHO2 leads to Pi accumulation in shoots. In contrast, the pho1 mutant shows a decreased level of Pi concentration in shoots. Finally, Pi starvation leads to decreased Pi concentration in all plant tissues. Little is known about plant Pi homeostasis in other abiotic stress conditions. We found that, during the first hour of heat stress, Pi accumulated in barley shoots but not in the roots, and transcriptomic data analysis as well as RT-qPCR led us to propose an explanation for this phenomenon. Pi transport inhibition from soil to roots is balanced by lower Pi efflux from roots to shoots directed by the PHO1 transporter. In shoots, the PHO2 mRNA level is decreased, leading to an increased Pi level. We concluded that Pi homeostasis in barley during heat stress is maintained by dynamic changes in Pi-related genes expression. PMID:27446155

  1. Heat Stress Affects Pi-related Genes Expression and Inorganic Phosphate Deposition/Accumulation in Barley.

    PubMed

    Pacak, Andrzej; Barciszewska-Pacak, Maria; Swida-Barteczka, Aleksandra; Kruszka, Katarzyna; Sega, Pawel; Milanowska, Kaja; Jakobsen, Iver; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

    2016-01-01

    Phosphorus (P) in plants is taken from soil as an inorganic phosphate (Pi) and is one of the most important macroelements in growth and development. Plants actively react to Pi starvation by the induced expression of Pi transporters, MIR399, MIR827, and miR399 molecular sponge - IPS1 genes and by the decreased expression of the ubiquitin-conjugating enzyme E2 (PHOSPHATE2 - PHO2) and Pi sensing and transport SPX-MFS genes. The PHO2 protein is involved in the degradation of Pi transporters PHT1;1 (from soil to roots) and PHO1 (from roots to shoots). The decreased expression of PHO2 leads to Pi accumulation in shoots. In contrast, the pho1 mutant shows a decreased level of Pi concentration in shoots. Finally, Pi starvation leads to decreased Pi concentration in all plant tissues. Little is known about plant Pi homeostasis in other abiotic stress conditions. We found that, during the first hour of heat stress, Pi accumulated in barley shoots but not in the roots, and transcriptomic data analysis as well as RT-qPCR led us to propose an explanation for this phenomenon. Pi transport inhibition from soil to roots is balanced by lower Pi efflux from roots to shoots directed by the PHO1 transporter. In shoots, the PHO2 mRNA level is decreased, leading to an increased Pi level. We concluded that Pi homeostasis in barley during heat stress is maintained by dynamic changes in Pi-related genes expression.

  2. Chronic diclofenac exposure affects gill integrity and pituitary gene expression and displays estrogenic activity in nile tilapia (Oreochromis niloticus).

    PubMed

    Gröner, Frederike; Höhne, Christin; Kleiner, Wibke; Kloas, Werner

    2017-01-01

    Oreochromis niloticus has been exposed to diclofenac (DCF), a nonsteroidal anti-inflammatory drug prevalent in the aquatic environment, for 80 days post-hatch (dph). Concentrations ranged from environmentally relevant (0.1 μg L(-1) and 1 μg L(-1) DCF) up to 100-fold thereof. Population relevant endpoints (hatching, survival, growth) as well as gill histopathology were analyzed. On this level of examination only gills exhibited mild to moderate alterations. On the contrary, biomarkers associated with reproduction were affected due to DCF exposure, indicating the potential to affect sexual differentiation and gametogenesis by acting as an estrogenic endocrine disrupting compound (EDC) in tilapia. Vitellogenin (VTG) gene expression was significantly induced at 1 μg L(-1) DCF. In order to find an explanation, gene expression patterns of key enzymes of the biotransformation phases I, II, and III have been analyzed. It seems very likely that the detoxification metabolism is induced in a dose dependent manner at higher concentrations of DCF leading to the expression pattern of VTG mRNA. Our results suggest that DCF at environmentally relevant concentrations adversely affects O. niloticus gill histopathology and pituitary gene expression, and has the potential to act as an estrogenic EDC. The sensitivity of various endpoints, however, differs and therefore these endpoints should be linked.

  3. Sub-toxic nicotine concentrations affect extracellular matrix and growth factor signaling gene expressions in human osteoblasts.

    PubMed

    Marinucci, Lorella; Bodo, Maria; Balloni, Stefania; Locci, Paola; Baroni, Tiziano

    2014-12-01

    Exposure to nicotine and other compounds contained in cigarette smoking affects human health. This study examined the effects of exposure to a single or multiple sub-toxic nicotine concentrations on human osteoblasts. Cell growth and expression of genes involved in bone differentiation, extracellular matrix (ECM) metabolism, and growth factor signaling pathways were investigated in nicotine-treated cells compared to untreated cells. Depending on osteoblast concentration and maturation stages, nicotine differently regulated cell growth. Real-time PCR showed regulated expressions of genes expressed by nicotine-treated osteoblasts compared to untreated cells. Among ECM genes, type I collagen was down-regulated and osteonectin was up-regulated in nicotine-treated osteoblasts; similarly, fibroblast growth factor-1 (FGF1) and fibroblast growth factor-2 (FGF2), two members of FGF signaling system, were discordantly modulated; genes involved in osteoblast maturation and differentiation such as alkaline phosphatase (ALP), runt-related transcription factor-2 (RUNX2), and bone sialoprotein (BSP) were over-expressed after drug treatment. Our results show a positive association between nicotine exposure and osteoblast phenotype and illustrate for the first time a mechanism whereby acute or chronic exposure to sub-toxic nicotine concentrations may affect bone formation through the impairment of growth factor signaling system and ECM metabolism.

  4. HMGB4 is expressed by neuronal cells and affects the expression of genes involved in neural differentiation

    PubMed Central

    Rouhiainen, Ari; Zhao, Xiang; Vanttola, Päivi; Qian, Kui; Kulesskiy, Evgeny; Kuja-Panula, Juha; Gransalke, Kathleen; Grönholm, Mikaela; Unni, Emmanual; Meistrich, Marvin; Tian, Li; Auvinen, Petri; Rauvala, Heikki

    2016-01-01

    HMGB4 is a new member in the family of HMGB proteins that has been characterized in sperm cells, but little is known about its functions in somatic cells. Here we show that HMGB4 and the highly similar rat Transition Protein 4 (HMGB4L1) are expressed in neuronal cells. Both proteins had slow mobility in nucleus of living NIH-3T3 cells. They interacted with histones and their differential expression in transformed cells of the nervous system altered the post-translational modification statuses of histones in vitro. Overexpression of HMGB4 in HEK 293T cells made cells more susceptible to cell death induced by topoisomerase inhibitors in an oncology drug screening array and altered variant composition of histone H3. HMGB4 regulated over 800 genes in HEK 293T cells with a p-value ≤0.013 (n = 3) in a microarray analysis and displayed strongest association with adhesion and histone H2A –processes. In neuronal and transformed cells HMGB4 regulated the expression of an oligodendrocyte marker gene PPP1R14a and other neuronal differentiation marker genes. In conclusion, our data suggests that HMGB4 is a factor that regulates chromatin and expression of neuronal differentiation markers. PMID:27608812

  5. Adolescent Experience Affects Postnatal Ultrasonic Vocalizations and Gene Expression in Future Offspring

    PubMed Central

    Bodi, Caroline M.; Vassoler, Fair M.; Byrnes, Elizabeth M.

    2017-01-01

    The present study measured postnatal ultrasonic vocalization (USV) and gene expression to examine potential changes in communication and/or attachment in the offspring of mothers exposed to morphine during adolescence. Offspring of morphine-exposed (Mor-F1), saline-exposed (Sal-F1), or non-handled control (Con-F1) female Sprague–Dawley rats were tested for separation-induced distress calls and maternal potentiation of distress calls during early postnatal development. We also examined relative expression of dopamine D2 receptor and mu opioid receptor (oprm1) mRNA in the nucleus accumbens and hypothalamus in these offspring, as their activity has been implicated in the regulation of postnatal USV in response to maternal separation. The findings indicate that adolescent experiences of future mothers, including their 10 daily saline or morphine injections, can result in significant region-specific differences in gene expression. In addition, these experiences resulted in fewer numbers of separation-induced distress calls produced by offspring. In contrast, augmented maternal potentiation was only observed in Mor-F1 offspring. PMID:26999300

  6. Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells.

    PubMed

    Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng

    Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes.

  7. The Interaction between Fluid Wall Shear Stress and Solid Circumferential Strain Affects Endothelial Gene Expression.

    PubMed

    Amaya, Ronny; Pierides, Alexis; Tarbell, John M

    2015-01-01

    Endothelial cells lining the walls of blood vessels are exposed simultaneously to wall shear stress (WSS) and circumferential stress (CS) that can be characterized by the temporal phase angle between WSS and CS (stress phase angle - SPA). Regions of the circulation with highly asynchronous hemodynamics (SPA close to -180°) such as coronary arteries are associated with the development of pathological conditions such as atherosclerosis and intimal hyperplasia whereas more synchronous regions (SPA closer to 0°) are spared of disease. The present study evaluates endothelial cell gene expression of 42 atherosclerosis-related genes under asynchronous hemodynamics (SPA=-180 °) and synchronous hemodynamics (SPA=0 °). This study used a novel bioreactor to investigate the cellular response of bovine aortic endothelial cells (BAECS) exposed to a combination of pulsatile WSS and CS at SPA=0 or SPA=-180. Using a PCR array of 42 genes, we determined that BAECS exposed to non-reversing sinusoidal WSS (10±10 dyne/cm2) and CS (4 ± 4%) over a 7 hour testing period displayed 17 genes that were up regulated by SPA = -180 °, most of them pro-atherogenic, including NFκB and other NFκB target genes. The up regulation of NFκB p50/p105 and p65 by SPA =-180° was confirmed by Western blots and immunofluorescence staining demonstrating the nuclear translocation of NFκB p50/p105 and p65. These data suggest that asynchronous hemodynamics (SPA=-180 °) can elicit proatherogenic responses in endothelial cells compared to synchronous hemodynamics without shear stress reversal, indicating that SPA may be an important parameter characterizing arterial susceptibility to disease.

  8. GABA, Selank, and Olanzapine Affect the Expression of Genes Involved in GABAergic Neurotransmission in IMR-32 Cells

    PubMed Central

    Filatova, Elena; Kasian, Anastasiya; Kolomin, Timur; Rybalkina, Ekaterina; Alieva, Anelya; Andreeva, Lyudmila; Limborska, Svetlana; Myasoedov, Nikolay; Pavlova, Galina; Slominsky, Petr; Shadrina, Maria

    2017-01-01

    Clinical studies have shown that Selank had an anxiolytic effect comparable to that of classical benzodiazepine drugs, which can enhance the inhibitory effect of GABA by allosteric modulation of GABAA receptors. These data suggest that the molecular mechanism of the effect of Selank may also be related to its ability to affect the performance of the GABAergic system. To test this hypothesis, we studied the changes in expression of 84 genes involved in the functioning of the GABAergic system and in the processes of neurotransmission in the culture of neuroblastoma IMR-32 cells using qPCR method. As test substances, in addition to Selank, we selected the major GABAA receptor ligand, GABA, the atypical antipsychotic, olanzapine, and combinations of these compounds (Selank and GABA; Selank and olanzapine). We found no changes in the mRNA levels of the genes studied under the effect of Selank. The combined effect of GABA and Selank led to nearly complete suppression of changes in expression of genes in which mRNA levels changed under the effect of GABA. When Selank was used in conjunction with olanzapine, the expression alterations of more genes were observed compared with olanzapine alone. The data obtained indicate that Selank has no direct effect on the mRNA levels of the GABAergic system genes in neuroblastoma IMR-32 cells. At the same time, our results partially confirm the hypothesis that the peptide may affect the interaction of GABA with GABAA receptors. Our data also suggest that Selank may enhance the effect of olanzapine on the expression of the genes studied. PMID:28293190

  9. Common inversion polymorphism at 17q21.31 affects expression of multiple genes in tissue-specific manner

    PubMed Central

    2012-01-01

    Background Chromosome 17q21.31 contains a common inversion polymorphism of approximately 900 kb in populations with European ancestry. Two divergent MAPT haplotypes, H1 and H2 are described with distinct linkage disequilibrium patterns across the region reflecting the inversion status at this locus. The MAPT H1 haplotype has been associated with progressive supranuclear palsy, corticobasal degeneration, Parkinson’s disease and Alzheimer’s disease, while the H2 is linked to recurrent deletion events associated with the 17q21.31 microdeletion syndrome, a disease characterized by developmental delay and learning disability. Results In this study, we investigate the effect of the inversion on the expression of genes in the 17q21.31 region. We find the expression of several genes in and at the borders of the inversion to be affected; specific either to whole blood or different regions of the human brain. The H1 haplotype was found to be associated with an increased expression of LRRC37A4, PLEKH1M and MAPT. In contrast, a decreased expression of MGC57346, LRRC37A and CRHR1 was associated with H1. Conclusions Studies thus far have focused on the expression of MAPT in the inversion region. However, our results show that the inversion status affects expression of other genes in the 17q21.31 region as well. Given the link between the inversion status and different neurological diseases, these genes may also be involved in disease pathology, possibly in a tissue-specific manner. PMID:22950410

  10. Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations.

    PubMed

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M A; Bramley, Peter M; Fraser, Paul D

    2013-11-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed.

  11. Simulated microgravity affects ciprofloxacin susceptibility and expression of acrAB-tolC genes in E. coli ATCC25922

    PubMed Central

    Xu, Bingxin; Li, Chenglin; Zheng, Yanhua; Si, Shaoyan; Shi, Yuhua; Huang, Yuling; Zhang, Jianzhong; Cui, Yan; Cui, Yimin

    2015-01-01

    As a representative fluoroquinolone antibacterial, ciprofloxacin is frequently used to treat infections caused by bacteria such as E. coli. It is much meaningful to explore ciprofloxacin susceptibility and investigate a possible mechanism of drug susceptibility changes in E. coli ATCC25922 exposed to the environmental stress of simulated microgravity. The subculture of E. coli lasted for 7 days under simulated microgravity conditions (SMG) and normal microgravity (NG) conditions. On the 8th day, the cultures were divided into three groups: (1) NG group (continuous NG cultures); (2) SMG group (continuous SMG cultures); (3) SMCNG group (simulated microgravity change into normal gravity cultures). Ciprofloxacin (a final concentration of 0.125 μg/ml) sensitivity and expression of acrAB-tolC genes were detected in E. coli cells. The count and percentage of viable cells in the SMG cultures bacteria exposed to ciprofloxacin were higher than that in NG cultures and reduced to the levels of NG group when they were subcultivated from SMG to NG. The expressions of efflux pump genes (acrA, acrB and tolC) were upregulated in SMG culture and downregulated to the levels of NG group when they were subcultivated from SMG to NG. Susceptibility to ciprofloxacin and expression of acrAB-tolC genes in E. coli could be reversibly affected by SMG conditions. Over expression of efflux pump genes acrAB-tolC perhaps played an important role in decreased CIP susceptibility under SMG. PMID:26339360

  12. Simulated microgravity affects ciprofloxacin susceptibility and expression of acrAB-tolC genes in E. coli ATCC25922.

    PubMed

    Xu, Bingxin; Li, Chenglin; Zheng, Yanhua; Si, Shaoyan; Shi, Yuhua; Huang, Yuling; Zhang, Jianzhong; Cui, Yan; Cui, Yimin

    2015-01-01

    As a representative fluoroquinolone antibacterial, ciprofloxacin is frequently used to treat infections caused by bacteria such as E. coli. It is much meaningful to explore ciprofloxacin susceptibility and investigate a possible mechanism of drug susceptibility changes in E. coli ATCC25922 exposed to the environmental stress of simulated microgravity. The subculture of E. coli lasted for 7 days under simulated microgravity conditions (SMG) and normal microgravity (NG) conditions. On the 8th day, the cultures were divided into three groups: (1) NG group (continuous NG cultures); (2) SMG group (continuous SMG cultures); (3) SMCNG group (simulated microgravity change into normal gravity cultures). Ciprofloxacin (a final concentration of 0.125 μg/ml) sensitivity and expression of acrAB-tolC genes were detected in E. coli cells. The count and percentage of viable cells in the SMG cultures bacteria exposed to ciprofloxacin were higher than that in NG cultures and reduced to the levels of NG group when they were subcultivated from SMG to NG. The expressions of efflux pump genes (acrA, acrB and tolC) were upregulated in SMG culture and downregulated to the levels of NG group when they were subcultivated from SMG to NG. Susceptibility to ciprofloxacin and expression of acrAB-tolC genes in E. coli could be reversibly affected by SMG conditions. Over expression of efflux pump genes acrAB-tolC perhaps played an important role in decreased CIP susceptibility under SMG.

  13. Genetic and environmental factors affecting allergen-related gene expression in apple fruit (Malus domestica L. Borkh).

    PubMed

    Botton, Alessandro; Lezzer, Paolo; Dorigoni, Alberto; Barcaccia, Gianni; Ruperti, Benedetto; Ramina, Angelo

    2008-08-13

    Freshly consumed apples can cause allergic reactions because of the presence of four classes of allergens, namely, Mal d 1, Mal d 2, Mal d 3, and Mal d 4, and their cross-reactivity with sensitizing allergens of other species. Knowledge of environmental and endogenous factors affecting the allergenic potential of apples would provide important information to apple breeders, growers, and consumers for the selection of hypoallergenic genotypes, the adoption of agronomical practices decreasing the allergenic potential, and the consumption of fruits with reduced amount of allergens. In the present research, expression studies were performed by means of real-time PCR for all the known allergen-encoding genes in apple. Fruit samples were collected from 15 apple varieties and from fruits of three different trials, set up to assess the effect of shadowing, elevation, storage, and water stress on the expression of allergen genes. Principal components analysis (PCA) was performed for the classification of varieties according to gene expression values, pointing out that the cultivars Fuji and Brina were two good hypoallergenic candidates. Shadowing, elevation, and storage significantly affected the transcription of the allergen-encoding genes, whereas water stress slightly influenced the expression of only two genes, in spite of the dramatic effect on both fruit size and vegetative growth of the trees. In particular, shadowing may represent an important cultural practice aimed at reducing apple cortex allergenicity. Moreover, elevation and storage may be combined to reduce the allergenic potential of apple fruits. The possible implications of the results for breeders, growers, and consumers are discussed critically.

  14. Down-regulation of GhADF1 gene expression affects cotton fibre properties.

    PubMed

    Wang, Hai-Yun; Wang, Juan; Gao, Peng; Jiao, Gai-Li; Zhao, Pi-Ming; Li, Yan; Wang, Gui-Ling; Xia, Gui-Xian

    2009-01-01

    Cotton fibre is the most important natural fibres for textile industry. To date, the mechanism that governs the development of fibre traits is largely unknown. In this study, we have characterized the function of a member of the actin depolymerizing factor (ADF) family in Gossypium hirsutum by down-regulation of the gene (designated as GhADF1) expression in the transgenic cotton plants. We observed that both the fibre length and strength of the GhADF1-underexpressing plants increased as compared to the wild-type fibre, and transgenic fibres contained more abundant F-actin filaments in the cortical region of the cells. Moreover, the secondary cell wall of the transgenic fibre appeared thicker and the cellulose content was higher than that of the control fibre. Our results suggest that organization of actin cytoskeleton regulated by actin-associated proteins such as GhADF1 plays a critical role in the processes of elongation and secondary cell wall formation during fibre development. Additionally, our study provided a candidate intrinsic gene for the improvement of fibre traits via genetic engineering.

  15. Dietary protein intake affects expression of genes for lipid metabolism in porcine skeletal muscle in a genotype-dependent manner.

    PubMed

    Liu, Yingying; Li, Fengna; He, Lingyun; Tan, Bie; Deng, Jinping; Kong, Xiangfeng; Li, Yinghui; Geng, Meimei; Yin, Yulong; Wu, Guoyao

    2015-04-14

    Skeletal muscle is a major site for the oxidation of fatty acids (FA) in mammals, including humans. Using a swine model, we tested the hypothesis that dietary protein intake regulates the expression of key genes for lipid metabolism in skeletal muscle. A total of ninety-six barrows (forty-eight pure-bred Bama mini-pigs (fatty genotype) and forty-eight Landrace pigs (lean genotype)) were fed from 5 weeks of age to market weight. Pigs of fatty or lean genotype were randomly assigned to one of two dietary treatments (low- or adequate-protein diet), with twenty-four individually fed pigs per treatment. Our data showed that dietary protein levels affected the expression of genes involved in the anabolism and catabolism of lipids in the longissimus dorsi and biceps femoris muscles in a genotype-dependent manner. Specifically, Bama mini-pigs had more intramuscular fat, SFA and MUFA, as well as elevated mRNA expression levels of lipogenic genes, compared with Landrace pigs. In contrast, Bama mini-pigs had lower mRNA expression levels of lipolytic genes than Landrace pigs fed an adequate-protein diet in the growing phase. These data are consistent with higher white-fat deposition in Bama mini-pigs than in Landrace pigs. In conclusion, adequate provision of dietary protein (amino acids) plays an important role in regulating the expression of key lipogenic genes, and the growth of white adipose tissue, in a genotype- and tissue-specific manner. These findings have important implications for developing novel dietary strategies in pig production.

  16. Algal symbiont type affects gene expression in juveniles of the coral Acropora tenuis exposed to thermal stress.

    PubMed

    Yuyama, Ikuko; Harii, Saki; Hidaka, Michio

    2012-05-01

    Reef-building corals harbor symbiotic dinoflagellates, Symbiodinium spp., which are currently divided into several clades. The responses of corals associated with different Symbiodinium clades to thermal stress are not well understood, especially at a gene expression level. Juveniles of the coral Acropora tenuis inoculated with different algal types (clade A or D) were exposed to thermal stress and the expression levels of four putative stress-responsive genes, including genes coding green and red fluorescent proteins, an oxidative stress-responsive protein, and an ascorbic acid transporter, were analyzed by quantitative real-time PCR. The expression levels of the four genes decreased at high temperatures if juveniles were associated with clade A symbionts but increased if the symbionts were in clade D. The intensity of green fluorescence increased with temperature in clade D symbionts harboring juveniles, but not in juveniles associated with clade A symbionts. The present results suggest that genotypes of endosymbiotic algae affect the thermal stress responses of the coral juveniles.

  17. Expression of the Saccharomyces cerevisiae inositol-1-phosphate synthase (INO1) gene is regulated by factors that affect phospholipid synthesis.

    PubMed Central

    Hirsch, J P; Henry, S A

    1986-01-01

    The INO1 gene of Saccharomyces cerevisiae encodes the regulated enzyme inositol-1-phosphate synthase, which catalyzes the first committed step in the synthesis of inositol-containing phospholipids. The expression of this gene was analyzed under conditions known to regulate phospholipid synthesis. RNA blot hybridization with a genomic clone for INO1 detected two RNA species of 1.8 and 0.6 kb. The abundance of the 1.8-kb RNA was greatly decreased when the cells were grown in the presence of the phospholipid precursor inositol, as was the enzyme activity of the synthase. Complementation analysis showed that this transcript encoded the INO1 gene product. The level of INO1 RNA was repressed 12-fold when the cells were grown in medium containing inositol, and it was repressed 33-fold when the cells were grown in the presence of inositol and choline together. The INO1 transcript was present at a very low level in cells containing mutations (ino2 and ino4) in regulatory genes unlinked to INO1 that result in inositol auxotrophy. The transcript was constitutively overproduced in cells containing a mutation (opi1) that causes constitutive expression of inositol-1-phosphate synthase and results in excretion of inositol. The expression of INO1 RNA was also examined in cells containing a mutation (cho2) affecting the synthesis of phosphatidylcholine. In contrast to what was observed in wild-type cells, growth of cho2 cells in medium containing inositol did not result in a significant decrease in INO1 RNA abundance. Inositol and choline together were required for repression of the INO1 transcript in these cells, providing evidence for a regulatory link between the synthesis of inositol- and choline-containing lipids. The level of the 0.6-kb RNA was affected, although to a lesser degree, by many of the same factors that influence INO1 expression. Images PMID:3025587

  18. Effects of the oestrogen receptor antagonist Fulvestrant on expression of genes that affect organization of the epididymal epithelium.

    PubMed

    Pereira, M F N; Fernandes, S A F; Nascimento, A R; Siu, E R; Hess, R A; Oliveira, C A; Porto, C S; Lazari, M F M

    2014-07-01

    The role of oestrogens in epididymal function is still unclear. Knockout of the oestrogen receptor ESR1 (Esr1(-/-) ) or treatment with the anti-oestrogen Fulvestrant affect epididymal milieu and sperm motility. We investigated the effect of in vivo treatment of rats with Fulvestrant on: (i) expression of genes that may be important for the architecture and function of the epididymal epithelium: prominins 1 and 2, metalloproteinase 7, claudin 7, beta-catenin and cadherin 13, and (ii) levels of oestradiol and testosterone, and expression of oestrogen and androgen receptors, in the initial segment (IS), caput, corpus and cauda epididymis. Fulvestrant (i) reduced gene expression of prominin 1 (variant 1) in the caput, reduced prominin 1 protein content in the caput epididymis and in the efferent ductules, and increased the localization of prominin 1 in microvilli of the caput and corpus; (ii) reduced gene expression of prominin 2 in the corpus and cauda epididymis; (iii) increased the metalloproteinase 7 content in the apical region of principal cells from IS/caput; (iv) reduced in the corpus epididymis, but increased in the efferent ductules, the cadherin 13 mRNA level; (v) reduced testosterone but increased oestradiol levels in the corpus and cauda; (vi) increased the androgen receptor protein content in all regions of the epididymis, and the oestrogen receptor GPER in the corpus and cauda epididymis. In conclusion, treatment with Fulvestrant induced regional-specific changes in hormonal and steroid receptor content, and affected expression of proteins important for epithelial organization and absorption/secretion. The mechanisms of oestrogen action may differ among epididymal regions, which may contribute to determine region-specific sperm functions.

  19. Developmental methoxychlor exposure affects multiple reproductive parameters and ovarian folliculogenesis and gene expression in adult rats

    SciTech Connect

    Armenti, AnnMarie E.; Zama, Aparna Mahakali; Passantino, Lisa; Uzumcu, Mehmet

    2008-12-01

    Methoxychlor (MXC) is an organochlorine pesticide with estrogenic, anti-estrogenic, and anti-androgenic properties. To investigate whether transient developmental exposure to MXC could cause adult ovarian dysfunction, we exposed Fischer rats to 20 {mu}g/kg/day (low dose; environmentally relevant dose) or 100 mg/kg/day (high dose) MXC between 19 days post coitum and postnatal day 7. Multiple reproductive parameters, serum hormone levels, and ovarian morphology and molecular markers were examined from prepubertal through adult stages. High dose MXC accelerated pubertal onset and first estrus, reduced litter size, and increased irregular cyclicity (P < 0.05). MXC reduced superovulatory response to exogenous gonadotropins in prepubertal females (P < 0.05). Rats exposed to high dose MXC had increasing irregular estrous cyclicity beginning at 4 months of age, with all animals showing abnormal cycles by 6 months. High dose MXC reduced serum progesterone, but increased luteinizing hormone (LH). Follicular composition analysis revealed an increase in the percentage of preantral and early antral follicles and a reduction in the percentage of corpora lutea in high dose MXC-treated ovaries (P < 0.05). Immunohistochemical staining and quantification of the staining intensity showed that estrogen receptor {beta} was reduced by high dose MXC while anti-Mullerian hormone was upregulated by both low- and high dose MXC in preantral and early antral follicles (P < 0.05). High dose MXC significantly reduced LH receptor expression in large antral follicles (P < 0.01), and down-regulated cytochrome P450 side-chain cleavage. These results demonstrated that developmental MXC exposure results in reduced ovulation and fertility and premature aging, possibly by altering ovarian gene expression and folliculogenesis.

  20. Post-Weaning Diet Affects Faecal Microbial Composition but Not Selected Adipose Gene Expression in the Cat (Felis catus)

    PubMed Central

    Bermingham, Emma N.; Kittelmann, Sandra; Young, Wayne; Kerr, Katherine R.; Swanson, Kelly S.; Roy, Nicole C.; Thomas, David G.

    2013-01-01

    The effects of pre- (i.e., gestation and during lactation) and post-weaning diet on the composition of faecal bacterial communities and adipose expression of key genes in the glucose and insulin pathways were investigated in the cat. Queens were maintained on a moderate protein:fat:carbohydrate kibbled (“Diet A”; 35:20:28% DM; n  =  4) or high protein:fat:carbohydrate canned (“Diet B”; 45:37:2% DM; n = 3) diet throughout pregnancy and lactation. Offspring were weaned onto these diets in a nested design (n  =  5 per treatment). Faecal samples were collected at wk 8 and 17 of age. DNA was isolated from faeces and bacterial 16S rRNA gene amplicons were analysed by pyrosequencing. RNA was extracted from blood (wk 18) and adipose tissue and ovarian/testicular tissues (wk 24) and gene expression levels determined using RT-qPCR. Differences (P<0.05) in composition of faecal bacteria were observed between pregnant queens fed Diet A or B. However, pre-weaning diet had little effect on faecal bacterial composition in weaned kittens. In contrast, post-weaning diet altered bacterial population profiles in the kittens. Increased (P<0.05) abundance of Firmicutes (77% vs 52% of total reads) and Actinobacteria (0.8% vs 0.2% of total reads), and decreased (P<0.05) abundance of Fusobacteria (1.6% vs 18.4% of total reads) were observed for kittens fed the Diet A compared to those fed Diet B post-weaning. Feeding Diet B pre-weaning increased (P<0.05) the expression levels of INRS, LEPT, PAI-1 and tended to increase GLUT1, while the expression levels of IRS-1 in blood increased in kittens fed Diet A pre-weaning. Post-weaning diet had no effect on expression levels of target genes. Correlations between the expression levels of genes involved in glucose and insulin pathways and faecal Bacteriodetes and Firmicutes phyla were identified. The reasons for why post-weaning diet affects microbial populations and not gene expression levels are of interest. PMID:24312255

  1. Nutritional state affects the expression of the obesity-associated genes Etv5, Faim2, Fto, and Negr1.

    PubMed

    Boender, Arjen J; van Rozen, Andrea J; Adan, Roger A H

    2012-12-01

    Obesity is a risk factor for type II diabetes, atherosclerosis, and some forms of cancer. Variation in common measures of obesity (e.g., BMI, waist/hip ratio) is largely explained by heritability. The advent of genome-wide association studies (GWAS) has made it possible to identify several genetic variants that associate with measures of obesity, but how exactly these genetic variants contribute to overweight has remained largely unresolved. One first hint is given by the fact that many of the associated variants reside in or near genes that act in the central nervous system, which implicates neuronal signaling in the etiology of obesity. Although the brain controls both energy intake and expenditure, it has more capacity to regulate energy intake rather than energy expenditure. In environments where food is abundant, this renders the body prone to weight increases. To gain more insight into the neurobiological mechanisms involved, we set out to investigate the effect of dietary exposure on the expression levels of obesity-associated genes in the ventro-medial hypothalamus (VMH)/arcuate nucleus (ARC) and the substantia nigra (SN)/ventral tegmental area (VTA), two brain regions that are implicated in feeding behavior. We show that the expression of Etv5, Faim2, Fto, Negr1 but not Sh2b1 is affected by nutritional state in these two areas, thereby providing insight into the relationship between nutritional state and expression levels of obesity-associated genes in two brain areas relevant to feeding.

  2. Rice stripe virus affects the viability of its vector offspring by changing developmental gene expression in embryos

    PubMed Central

    Li, Shuo; Wang, Shijuan; Wang, Xi; Li, Xiaoli; Zi, Jinyan; Ge, Shangshu; Cheng, Zhaobang; Zhou, Tong; Ji, Yinghua; Deng, Jinhua; Wong, Sek-Man; Zhou, Yijun

    2015-01-01

    Plant viruses may affect the viability and development process of their herbivore vectors. Small brown planthopper (SBPH) is main vector of Rice stripe virus (RSV), which causes serious rice stripe disease. Here, we reported the effects of RSV on SBPH offspring by crossing experiments between viruliferous and non-viruliferous strains. The life parameters of offspring from different cross combinations were compared. The hatchability of F1 progeny from viruliferous parents decreased significantly, and viruliferous rate was completely controlled by viruliferous maternal parent. To better elucidate the underlying biological mechanisms, the morphology of eggs, viral propagation and distribution in the eggs and expression profile of embryonic development genes were investigated. The results indicated that RSV replicated and accumulated in SBPH eggs resulting in developmental stunt or delay of partial eggs; in addition, RSV was only able to infect ovum but not sperm. According to the expression profile, expression of 13 developmental genes was regulated in the eggs from viruliferous parents, in which two important regulatory genes (Ls-Dorsal and Ls-CPO) were most significantly down-regulated. In general, RSV exerts an adverse effect on SBPH, which is unfavourable for the expansion of viruliferous populations. The viewpoint is also supported by systematic monitoring of SBPH viruliferous rate. PMID:25601039

  3. The Garlic Allelochemical Diallyl Disulfide Affects Tomato Root Growth by Influencing Cell Division, Phytohormone Balance and Expansin Gene Expression

    PubMed Central

    Cheng, Fang; Cheng, Zhihui; Meng, Huanwen; Tang, Xiangwei

    2016-01-01

    Diallyl disulfide (DADS) is a volatile organosulfur compound derived from garlic (Allium sativum L.), and it is known as an allelochemical responsible for the strong allelopathic potential of garlic. The anticancer properties of DADS have been studied in experimental animals and various types of cancer cells, but to date, little is known about its mode of action as an allelochemical at the cytological level. The current research presents further studies on the effects of DADS on tomato (Solanum lycopersicum L.) seed germination, root growth, mitotic index, and cell size in root meristem, as well as the phytohormone levels and expression profile of auxin biosynthesis genes (FZYs), auxin transport genes (SlPINs), and expansin genes (EXPs) in tomato root. The results showed a biphasic, dose-dependent effect on tomato seed germination and root growth under different DADS concentrations. Lower concentrations (0.01–0.62 mM) of DADS significantly promoted root growth, whereas higher levels (6.20–20.67 mM) showed inhibitory effects. Cytological observations showed that the cell length of root meristem was increased and that the mitotic activity of meristematic cells in seedling root tips was enhanced at lower concentrations of DADS. In contrast, DADS at higher concentrations inhibited root growth by affecting both the length and division activity of meristematic cells. However, the cell width of the root meristem was not affected. Additionally, DADS increased the IAA and ZR contents of seedling roots in a dose-dependent manner. The influence on IAA content may be mediated by the up-regulation of FZYs and PINs. Further investigation into the underlying mechanism revealed that the expression levels of tomato EXPs were significantly affected by DADS. The expression levels of EXPB2 and beta-expansin precursor were increased after 3 d, and those of EXP1, EXPB3 and EXLB1 were increased after 5 d of DADS treatment (0.41 mM). This result suggests that tomato root growth may be

  4. Expression of isopentenyl transferase gene (ipt) in leaf and stem delayed leaf senescence without affecting root growth.

    PubMed

    Ma, Qing-Hu; Liu, Yun-Chao

    2009-11-01

    A cytokinin biosynthetic gene encoding isopentenyl transferase (ipt) was cloned with its native promoter from Agrobacterium tumefaciens and introduced into tobacco plants. Indolebutyric acid was applied in rooting medium and morphologically normal transgenic tobacco plants were regenerated. Genetic analysis of self-fertilized progeny showed that a single copy of intact ipt gene had been integrated, and T(2) progeny had become homozygous for the transgene. Stable inheritance of the intact ipt gene in T(2) progeny was verified by Southern hybridization. Northern blot hybridization revealed that the expression of this ipt gene was confined in leaves and stems but undetectable in roots of the transgenic plants. Endogenous cytokinin levels in the leaves and stems of the transgenic tobaccos were two to threefold higher than that of control, but in roots, both the transgenic and control tobaccos had similar cytokinin levels. The elevated cytokinin levels in the transgenic tobacco leaves resulted in delayed leaf senescence in terms of chlorophyll content without affecting the net photosynthetic rate. The root growth and morphology of the plant were not affected in the transgenic tobacco.

  5. Ethylene could influence ferric reductase, iron transporter, and H+-ATPase gene expression by affecting FER (or FER-like) gene activity.

    PubMed

    Lucena, Carlos; Waters, Brian M; Romera, F Javier; García, María José; Morales, María; Alcántara, Esteban; Pérez-Vicente, Rafael

    2006-01-01

    In previous works, it has been shown, by using ethylene inhibitors and precursors, that ethylene could participate in the regulation of the enhanced ferric reductase activity of Fe-deficient Strategy I plants. However, it was not known whether ethylene regulates the ferric reductase gene expression or other aspects related to this activity. This paper is a study of the effects of ethylene inhibitors and precursors on the expression of the genes encoding the ferric reductases and iron transporters of Arabidopsis thaliana (FRO2 and IRT1) and Lycopersicon esculentum (=Solanum lycopersicum) (FRO1 and IRT1) plants. The effects of ethylene inhibitors and precursors on the activity of the iron reductase and the iron transporter have been examined in parallel. Also studied were the effects of ethylene inhibitors and precursors on the expression of the H(+)-ATPase genes of cucumber (CsHA1 and CsHA2) and the transcription factor genes of tomato (LeFER) and Arabidopsis (AtFRU or AtFIT1, an LeFER homologue) that regulate ferric reductase, iron transporter, and H(+)-ATPse activity. The results obtained suggest that ethylene participates in the regulation of ferric reductase, the iron transporter, and H(+)-ATPase gene expression by affecting the FER (or FER-like) levels.

  6. Exposure to atrazine affects the expression of key genes in metabolic pathways integral to energy homeostasis in Xenopus laevis tadpoles.

    PubMed

    Zaya, Renee M; Amini, Zakariya; Whitaker, Ashley S; Ide, Charles F

    2011-08-01

    In our laboratory, Xenopus laevis tadpoles exposed throughout development to 200 or 400 μg/L atrazine, concentrations reported to periodically occur in puddles, vernal ponds and runoff soon after application, were smaller and had smaller fat bodies (the tadpole's lipid storage organ) than controls. It was hypothesized that these changes were due to atrazine-related perturbations of energy homeostasis. To investigate this hypothesis, selected metabolic responses to exposure at the transcriptional and biochemical levels in atrazine-exposed tadpoles were measured. DNA microarray technology was used to determine which metabolic pathways were affected after developmental exposure to 400 μg/L atrazine. From these data, genes representative of the affected pathways were selected for assay using quantitative real time polymerase chain reaction (qRT-PCR) to measure changes in expression during a 2-week exposure to 400 μg/L. Finally, ATP levels were measured from tadpoles both early in and at termination of exposure to 200 and 400 μg/L. Microarray analysis revealed significant differential gene expression in metabolic pathways involved with energy homeostasis. Pathways with increased transcription were associated with the conversion of lipids and proteins into energy. Pathways with decreased transcription were associated with carbohydrate metabolism, fat storage, and protein synthesis. Using qRT-PCR, changes in gene expression indicative of an early stress response to atrazine were noted. Exposed tadpoles had significant decreases in acyl-CoA dehydrogenase (AD) and glucocorticoid receptor protein (GR) mRNA after 24 h of exposure, and near-significant (p=0.07) increases in peroxisome proliferator-activated receptor β (PPAR-β) mRNA by 72 h. Decreases in AD suggested decreases in fatty acid β-oxidation while decreases in GR may have been a receptor desensitization response to a glucocorticoid surge. Involvement of PPAR-β, an energy homeostasis regulatory molecule, also

  7. Dietary fatty acids affect mitochondrial phospholipid compositions and mitochondrial gene expression of rainbow trout liver at different ages.

    PubMed

    Almaida-Pagán, P F; De Santis, C; Rubio-Mejía, O L; Tocher, D R

    2015-01-01

    Mitochondria are among the first responders to various stressors that challenge the homeostasis of cells and organisms. Mitochondrial decay is generally associated with impairment in the organelle bioenergetics function and increased oxidative stress, and it appears that deterioration of mitochondrial inner membrane phospholipids (PL), particularly cardiolipin (CL), and accumulation of mitochondrial DNA (mtDNA) mutations are among the main mechanisms involved in this process. In the present study, liver mitochondrial membrane PL compositions, lipid peroxidation, and mtDNA gene expression were analyzed in rainbow trout fed three diets with the same base formulation but with lipid supplied either by fish oil (FO), rapeseed oil (RO), or high DHA oil (DHA) during 6 weeks. Specifically, two feeding trials were performed using fish from the same population of two ages (1 and 3 years), and PL class compositions of liver mitochondria, fatty acid composition of individual PL classes, TBARS content, and mtDNA expression were determined. Dietary fatty acid composition strongly affected mitochondrial membrane composition from trout liver but observed changes did not fully reflect the diet, particularly when it contained high DHA. The changes were PL specific, CL being particularly resistant to changes in DHA. Some significant differences observed in expression of mtDNA with diet may suggest long-term dietary effects in mitochondrial gene expression which could affect electron transport chain function. All the changes were influenced by fish age, which could be related to the different growth rates observed between 1- and 3-year-old trout but that could also indicate age-related changes in the ability to maintain structural homeostasis of mitochondrial membranes.

  8. The Role of Genetic Sex in Affect Regulation and Expression of GABA-Related Genes Across Species

    PubMed Central

    Seney, Marianne L.; Chang, Lun-Ching; Oh, Hyunjung; Wang, Xingbin; Tseng, George C.; Lewis, David A.; Sibille, Etienne

    2013-01-01

    Although circulating hormones and inhibitory gamma-aminobutyric acid (GABA)-related factors are known to affect mood, considerable knowledge gaps persist for biological mechanisms underlying the female bias in mood disorders. Here, we combine human and mouse studies to investigate sexual dimorphism in the GABA system in the context of major depressive disorder (MDD) and then use a genetic model to dissect the role of sex-related factors in GABA-related gene expression and anxiety-/depressive-like behaviors in mice. First, using meta-analysis of gene array data in human postmortem brain (N = 51 MDD subjects, 50 controls), we show that the previously reported down-regulation in MDD of somatostatin (SST), a marker of a GABA neuron subtype, is significantly greater in women with MDD. Second, using gene co-expression network analysis in control human subjects (N = 214; two frontal cortex regions) and expression quantitative trait loci mapping (N = 170 subjects), we show that expression of SST and the GABA-synthesizing enzymes glutamate decarboxylase 67 (GAD67) and GAD65 are tightly co-regulated and influenced by X-chromosome genetic polymorphisms. Third, using a rodent genetic model [Four Core Genotypes (FCG) mice], in which genetic and gonadal sex are artificially dissociated (N ≥ 12/group), we show that genetic sex (i.e., X/Y-chromosome) influences both gene expression (lower Sst, Gad67, Gad65 in XY mice) and anxiety-like behaviors (higher in XY mice). This suggests that in an intact male animal, the observed behavior represents the outcomes of male genetic sex increasing and male-like testosterone decreasing anxiety-like behaviors. Gonadal sex was the only factor influencing depressive-like behavior (gonadal males < gonadal females). Collectively, these combined human and mouse studies provide mechanistic insight into sexual dimorphism in mood disorders, and specifically demonstrate an unexpected role of male-like factors (XY genetic sex) on

  9. Aging affects epidermal Langerhans cell development and function and alters their miRNA gene expression profile.

    PubMed

    Xu, Ying-Ping; Qi, Rui-Qun; Chen, Wenbin; Shi, Yuling; Cui, Zhi-Zhong; Gao, Xing-Hua; Chen, Hong-Duo; Zhou, Li; Mi, Qing-Sheng

    2012-11-01

    Immunosenescence is a result of progressive decline in immune system function with advancing age. Epidermal Langerhans cells (LCs), belonging to the dendritic cell (DC) family, act as sentinels to play key roles in the skin immune responses. However, it has not been fully elucidated how aging affects development and function of LCs. Here, we systemically analyzed LC development and function during the aging process in C57BL/6J mice, and performed global microRNA (miRNA) gene expression profiles in aged and young LCs. We found that the frequency and maturation of epidermal LCs were significantly reduced in aged mice starting at 12 months of age, while the Langerin expression and ability to phagocytose Dextran in aged LCs were increased compared to LCs from < 6 month old mice. The migration of LCs to draining lymph nodes was comparable between aged and young mice. Functionally, aged LCs were impaired in their capacity to induce OVA-specific CD4+ and CD8+ T cell proliferation. Furthermore, the expression of miRNAs in aged epidermal LCs showed a distinct profile compared to young LCs. Most interestingly, aging-regulated miRNAs potentially target TGF-β-dependent and non- TGF-β-dependent signal pathways related to LCs. Overall, our data suggests that aging affects LCs development and function, and that age-regulated miRNAs may contribute to the LC developmental and functional changes in aging.

  10. Phenotypes and gene expression profiles of Saccharopolyspora erythraea rifampicin-resistant (rif) mutants affected in erythromycin production

    PubMed Central

    Carata, Elisabetta; Peano, Clelia; Tredici, Salvatore M; Ferrari, Francesco; Talà, Adelfia; Corti, Giorgio; Bicciato, Silvio; De Bellis, Gianluca; Alifano, Pietro

    2009-01-01

    Background There is evidence from previous works that bacterial secondary metabolism may be stimulated by genetic manipulation of RNA polymerase (RNAP). In this study we have used rifampicin selection as a strategy to genetically improve the erythromycin producer Saccharopolyspora erythraea. Results Spontaneous rifampicin-resistant (rif) mutants were isolated from the parental strain NRRL2338 and two rif mutations mapping within rpoB, S444F and Q426R, were characterized. With respect to the parental strain, S444F mutants exhibited higher respiratory performance and up to four-fold higher final erythromycin yields; in contrast, Q426R mutants were slow-growing, developmental-defective and severely impaired in erythromycin production. DNA microarray analysis demonstrated that these rif mutations deeply changed the transcriptional profile of S. erythraea. The expression of genes coding for key enzymes of carbon (and energy) and nitrogen central metabolism was dramatically altered in turn affecting the flux of metabolites through erythromycin feeder pathways. In particular, the valine catabolic pathway that supplies propionyl-CoA for biosynthesis of the erythromycin precursor 6-deoxyerythronolide B was strongly up-regulated in the S444F mutants, while the expression of the biosynthetic gene cluster of erythromycin (ery) was not significantly affected. In contrast, the ery cluster was down-regulated (<2-fold) in the Q426R mutants. These strains also exhibited an impressive stimulation of the nitrogen regulon, which may contribute to lower erythromycin yields as erythromycin production was strongly inhibited by ammonium. Conclusion Rifampicin selection is a simple and reliable tool to investigate novel links between primary and secondary metabolism and morphological differentiation in S. erythraea and to improve erythromycin production. At the same time genome-wide analysis of expression profiles using DNA microarrays allowed information to be gained about the mechanisms

  11. Early life stress affects mortality rate more than social behavior, gene expression or oxidative damage in honey bee workers.

    PubMed

    Rueppell, Olav; Yousefi, Babak; Collazo, Juan; Smith, Daniel

    2017-04-01

    Early life stressors can affect aging and life expectancy in positive or negative ways. Individuals can adjust their behavior and molecular physiology based on early life experiences but relatively few studies have connected such mechanisms to demographic patterns in social organisms. Sociality buffers individuals from environmental influences and it is unclear how much early life stress affects later life history. Workers of the honey bee (Apis mellifera L.) were exposed to two stressors, Varroa parasitism and Paraquat exposure, early in life. Consequences were measured at the molecular, behavioral, and demographic level. While treatments did not significantly affect levels of oxidative damage, expression of select genes, and titers of the common deformed wing virus, most of these measures were affected by age. Some of the age effects, such as declining levels of deformed wing virus and oxidative damage, were opposite to our predictions but may be explained by demographic selection. Further analyses suggested some influences of worker behavior on mortality and indicated weak treatment effects on behavior. The latter effects were inconsistent among the two experiments. However, mortality rate was consistently reduced by Varroa mite stress during development. Thus, mortality was more responsive to early life stress than our other response variables. The lack of treatment effects on these measures may be due to the social organization of honey bees that buffers the individual from the impact of stressful developmental conditions.

  12. Identification of the Bile Acid Transporter Slco1a6 as a Candidate Gene That Broadly Affects Gene Expression in Mouse Pancreatic Islets.

    PubMed

    Tian, Jianan; Keller, Mark P; Oler, Angie T; Rabaglia, Mary E; Schueler, Kathryn L; Stapleton, Donald S; Broman, Aimee Teo; Zhao, Wen; Kendziorski, Christina; Yandell, Brian S; Hagenbuch, Bruno; Broman, Karl W; Attie, Alan D

    2015-11-01

    We surveyed gene expression in six tissues in an F2 intercross between mouse strains C57BL/6J (abbreviated B6) and BTBR T(+) tf/J (abbreviated BTBR) made genetically obese with the Leptin(ob) mutation. We identified a number of expression quantitative trait loci (eQTL) affecting the expression of numerous genes distal to the locus, called trans-eQTL hotspots. Some of these trans-eQTL hotspots showed effects in multiple tissues, whereas some were specific to a single tissue. An unusually large number of transcripts (∼8% of genes) mapped in trans to a hotspot on chromosome 6, specifically in pancreatic islets. By considering the first two principal components of the expression of genes mapping to this region, we were able to convert the multivariate phenotype into a simple Mendelian trait. Fine mapping the locus by traditional methods reduced the QTL interval to a 298-kb region containing only three genes, including Slco1a6, one member of a large family of organic anion transporters. Direct genomic sequencing of all Slco1a6 exons identified a nonsynonymous coding SNP that converts a highly conserved proline residue at amino acid position 564 to serine. Molecular modeling suggests that Pro564 faces an aqueous pore within this 12-transmembrane domain-spanning protein. When transiently overexpressed in HEK293 cells, BTBR organic anion transporting polypeptide (OATP)1A6-mediated cellular uptake of the bile acid taurocholic acid (TCA) was enhanced compared to B6 OATP1A6. Our results suggest that genetic variation in Slco1a6 leads to altered transport of TCA (and potentially other bile acids) by pancreatic islets, resulting in broad gene regulation.

  13. Identification of the Bile Acid Transporter Slco1a6 as a Candidate Gene That Broadly Affects Gene Expression in Mouse Pancreatic Islets

    PubMed Central

    Tian, Jianan; Keller, Mark P.; Oler, Angie T.; Rabaglia, Mary E.; Schueler, Kathryn L.; Stapleton, Donald S.; Broman, Aimee Teo; Zhao, Wen; Kendziorski, Christina; Yandell, Brian S.; Hagenbuch, Bruno; Broman, Karl W.; Attie, Alan D.

    2015-01-01

    We surveyed gene expression in six tissues in an F2 intercross between mouse strains C57BL/6J (abbreviated B6) and BTBR T+ tf/J (abbreviated BTBR) made genetically obese with the Leptinob mutation. We identified a number of expression quantitative trait loci (eQTL) affecting the expression of numerous genes distal to the locus, called trans-eQTL hotspots. Some of these trans-eQTL hotspots showed effects in multiple tissues, whereas some were specific to a single tissue. An unusually large number of transcripts (∼8% of genes) mapped in trans to a hotspot on chromosome 6, specifically in pancreatic islets. By considering the first two principal components of the expression of genes mapping to this region, we were able to convert the multivariate phenotype into a simple Mendelian trait. Fine mapping the locus by traditional methods reduced the QTL interval to a 298-kb region containing only three genes, including Slco1a6, one member of a large family of organic anion transporters. Direct genomic sequencing of all Slco1a6 exons identified a nonsynonymous coding SNP that converts a highly conserved proline residue at amino acid position 564 to serine. Molecular modeling suggests that Pro564 faces an aqueous pore within this 12-transmembrane domain-spanning protein. When transiently overexpressed in HEK293 cells, BTBR organic anion transporting polypeptide (OATP)1A6-mediated cellular uptake of the bile acid taurocholic acid (TCA) was enhanced compared to B6 OATP1A6. Our results suggest that genetic variation in Slco1a6 leads to altered transport of TCA (and potentially other bile acids) by pancreatic islets, resulting in broad gene regulation. PMID:26385979

  14. Glucocorticoids affect 24 h clock genes expression in human adipose tissue explant cultures

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To examine firstly whether CLOCK exhibits a circadian expression in human visceral (V) and subcutaneous (S) adipose tissue (AT) in vitro as compared with BMAL1 and PER2, and secondly to investigate the possible effect of the glucocorticoid analogue dexamethasone (DEX) on positive and negative clock ...

  15. RNASET2 silencing affects miRNAs and target gene expression pattern in a human ovarian cancer cell model.

    PubMed

    Turconi, Giovanna; Scaldaferri, Debora; Fabbri, Marco; Monti, Laura; Lualdi, Marta; Pedrini, Edoardo; Gribaldo, Laura; Taramelli, Roberto; Acquati, Francesco

    2016-12-01

    Ribonucleases (RNases) are hydrolytic enzymes endowed with the ability to either process or degrade ribonucleic acids. Among the many biological functions assigned to RNases, a growing attention has been recently devoted to the control of cancer growth, in the attempt to bring novel therapeutic approaches to clinical oncology. Indeed, several enzymes belonging to different ribonuclease families have been reported in the last decade to display a marked oncosuppressive activity in a wide range of experimental models. The human RNASET2 gene, the only member of the highly conserved T2/Rh/S family of endoribonucleolytic enzymes described in our species, has been shown to display oncosuppressive roles in both in vitro and in vivo models representing several human malignancies. In the present study, we extend previous findings obtained in ovarian cancer models to shed further light on the cell-autonomous roles played by this gene in the context of its oncosuppresive role and to show that RNASET2 silencing can significantly affect the transcriptional output in one of the most thoroughly investigated human ovarian cancer cell lines. Moreover, we report for the first time that RNASET2-mediated changes in the cell transcriptome are in part mediated by its apparent ability to affect the cell's microRNA expression pattern.

  16. Alterations in seed development gene expression affect size and oil content of Arabidopsis seeds.

    PubMed

    Fatihi, Abdelhak; Zbierzak, Anna Maria; Dörmann, Peter

    2013-10-01

    Seed endosperm development in Arabidopsis (Arabidopsis thaliana) is under control of the polycomb group complex, which includes Fertilization Independent Endosperm (FIE). The polycomb group complex regulates downstream factors, e.g. Pheres1 (PHE1), by genomic imprinting. In heterozygous fie mutants, an endosperm develops in ovules carrying a maternal fie allele without fertilization, finally leading to abortion. Another endosperm development pathway depends on MINISEED3 (a WRKY10 transcription factor) and HAIKU2 (a leucine-rich repeat kinase). While the role of seed development genes in the embryo and endosperm establishment has been studied in detail, their impact on metabolism and oil accumulation remained unclear. Analysis of oil, protein, and sucrose accumulation in mutants and overexpression plants of the four seed development genes revealed that (1) seeds carrying a maternal fie allele accumulate low oil with an altered composition of triacylglycerol molecular species; (2) homozygous mutant seeds of phe1, mini3, and iku2, which are smaller, accumulate less oil and slightly less protein, and starch, which accumulates early during seed development, remains elevated in mutant seeds; (3) embryo-specific overexpression of FIE, PHE1, and MINI3 has no influence on seed size and weight, nor on oil, protein, or sucrose content; and (4) overexpression of IKU2 results in seeds with increased size and weight, and oil content of overexpressed IKU2 seeds is increased by 35%. Thus, IKU2 overexpression represents a novel strategy for the genetic manipulation of the oil content in seeds.

  17. TORC1 signaling inhibition by rapamycin and caffeine affect lifespan, global gene expression, and cell proliferation of fission yeast.

    PubMed

    Rallis, Charalampos; Codlin, Sandra; Bähler, Jürg

    2013-08-01

    Target of rapamycin complex 1 (TORC1) is implicated in growth control and aging from yeast to humans. Fission yeast is emerging as a popular model organism to study TOR signaling, although rapamycin has been thought to not affect cell growth in this organism. Here, we analyzed the effects of rapamycin and caffeine, singly and combined, on multiple cellular processes in fission yeast. The two drugs led to diverse and specific phenotypes that depended on TORC1 inhibition, including prolonged chronological lifespan, inhibition of global translation, inhibition of cell growth and division, and reprograming of global gene expression mimicking nitrogen starvation. Rapamycin and caffeine differentially affected these various TORC1-dependent processes. Combined drug treatment augmented most phenotypes and effectively blocked cell growth. Rapamycin showed a much more subtle effect on global translation than did caffeine, while both drugs were effective in prolonging chronological lifespan. Rapamycin and caffeine did not affect the lifespan via the pH of the growth media. Rapamycin prolonged the lifespan of nongrowing cells only when applied during the growth phase but not when applied after cells had stopped proliferation. The doses of rapamycin and caffeine strongly correlated with growth inhibition and with lifespan extension. This comprehensive analysis will inform future studies into TORC1 function and cellular aging in fission yeast and beyond.

  18. Post-entrapment genome engineering: first exon size does not affect the expression of fusion transcripts generated by gene entrapment.

    PubMed

    Osipovich, Anna B; Singh, Aparna; Ruley, H Earl

    2005-03-01

    Gene trap mutagenesis in mouse embryonic stem cells has been widely used for genome-wide studies of mammalian gene function. However, while large numbers of genes can be disrupted, individual mutations may suffer from limitations due to the structure and/or placement of targeting vector. To extend the utility of gene trap mutagenesis, replaceable 3' [or poly(A)] gene trap vectors were developed that permit sequences inserted in individual entrapment clones to be engineered by Cre-mediated recombination. 3' traps incorporating different drug resistance genes could be readily exchanged, simply by selecting for the drug-resistance gene of the replacement vector. By substituting different 3' traps, we show that otherwise identical fusion genes containing a large first exon (804 nt) are not expressed at appreciably lower levels than genes expressing small first exons (384 and 151 nt). Thus, size appears to have less effect on the expression and processing of first exons than has been reported for internal exons. Finally, a retroviral poly(A) trap (consisting of a RNA polymerase II promoter, a neomycin-resistance gene, and 5'-splice site) typically produced mutagenized clones in which vector sequences spliced to the 3'-terminal exons of cellular transcription units, suggesting strong selection for fusion transcripts that evade nonsense-mediated decay. The efficient exchange of poly(A) traps should greatly extend the utility of mutant libraries generated by gene entrapment and provides new strategies to study the rules that govern the expression of exons inserted throughout the genome.

  19. Nrf2-dependent gene expression is affected by the proatherogenic apoE4 genotype-studies in targeted gene replacement mice.

    PubMed

    Graeser, Anne-Christin; Boesch-Saadatmandi, Christine; Lippmann, Jana; Wagner, Anika E; Huebbe, Patricia; Storm, Niels; Höppner, Wolfgang; Wiswedel, Ingrid; Gardemann, Andreas; Minihane, Anne M; Döring, Frank; Rimbach, Gerald

    2011-10-01

    An apoE4 genotype is an important risk factor for cardiovascular and other chronic diseases. The higher cardiovascular disease risk of apoE4 carriers as compared to the apoE3 genotype has been mainly attributed to the differences in blood lipids between the two genotype subgroups. Recently, a potential protective role of the transcription factor Nrf2 in cardiovascular disease prevention has been suggested. In this study, we show that Nrf2-dependent gene expression is affected by the apoE genotype. ApoE4 vs. apoE3 mice exhibited lower hepatic Nrf2 nuclear protein levels. Furthermore, mRNA and protein levels of Nrf2 target genes including glutathione-S-transferase, heme oxygenase-1 and NAD(P)H dehydrogenase, quinone 1 were significantly lower in apoE4 as compared to apoE3 mice. Lower hepatic mRNA levels of phase II enzymes, as observed in apoE4 vs. apoE3 mice, were accompanied by higher mRNA levels of phase I enzymes including Cyp26a1 and Cyp3a16. Furthermore, miRNA-144, miRNA-125b, and miRNA-29a involved in Nrf2 signaling, inflammation, and regulation of phase I enzyme gene expression were affected by the apoE genotype. We provide first evidence that Nrf2 is differentially regulated in response to the apoE genotype.

  20. Embryonic development and skeletogenic gene expression affected by X-rays in the Mediterranean sea urchin Paracentrotus lividus.

    PubMed

    Matranga, Valeria; Zito, Francesca; Costa, Caterina; Bonaventura, Rosa; Giarrusso, Salvatore; Celi, Filippo

    2010-03-01

    International concern over environmental nuclear contamination of salt water fisheries and coastal resources has attracted the interests of ecologists, marine biologists and stakeholders. There are not many studies on the effects of X-rays, a component of radionuclides emissions, on embryonic development and gene expression. The sea urchin embryo is emerging as a useful model system for environmental and eco-toxicological studies. Here, we describe how X-rays affect development and gene expression in embryos of the Mediterranean sea urchin Paracentrotus lividus. Cleavage embryos were exposed to doses from 0.1 to 5 Gy, using an Ag source of X radiation. We found a dose-dependent increase in developmental delays and severe morphological defects in embryos microscopically inspected at two endpoints, 24 and 48 h after irradiation. By analogy with classical toxicity tests parameters we defined the No Observed Effect Dose at 0.1 Gy, the Lowest Observed Effect Dose at 0.5 Gy and ED50 at 1.0 Gy. Major perturbations concerned primitive intestine and skeleton differentiation and development: X-rays exposed embryos had both no gut and arms or poorly and abnormally developed ones. We found a dose-dependent reduction in the mRNA levels of two skeleton-specific genes, Pl-SM30 (spicule matrix 30) and Pl-msp130 (matrix spicule protein 130), as measured by semi-quantitative RT-PCR and whole mount in situ hybridization, respectively. These findings indicate the sea urchin embryo as a sensible bioindicator of X-radiation and propose its use as an alternative model, emphasizing the need for further investigation aimed to protect ecosystem health.

  1. Soil type affects plant colonization, activity and catabolic gene expression of inoculated bacterial strains during phytoremediation of diesel.

    PubMed

    Afzal, Muhammad; Yousaf, Sohail; Reichenauer, Thomas G; Kuffner, Melanie; Sessitsch, Angela

    2011-02-28

    The combined use of plants and associated microorganisms has great potential for cleaning up soils contaminated with petroleum hydrocarbons. Apart from environmental conditions the physicochemical properties of the soil are the main factors influencing the survival and activity of an inoculated strain as well as the growth of plants. This study examined the effect of different soil types (sandy, loamy sand and loam) on the survival, gene abundance and catabolic gene expression of two inoculated strains (Pseudomonas sp. strain ITRI53 and Pantoea sp. strain BTRH79) in the rhizosphere and shoot interior of Italian ryegrass vegetated in diesel contaminated soils. High colonization, gene abundance and expression in loamy soils were observed. By contrast, low colonization, gene abundance and absence of gene expression in sandy soil were found. The highest levels of genes expression and hydrocarbon degradation were seen in loamy soil that had been inoculated with BTRH79 and were significantly higher compared to those in other soils. A positive correlation was observed between gene expression and hydrocarbon degradation indicating that catabolic gene expression is necessary for contaminant degradation. These results suggest that soil type influences the bacterial colonization and microbial activities and subsequently the efficiency of contaminant degradation.

  2. Genetic interactions affecting human gene expression identified by variance association mapping

    PubMed Central

    Brown, Andrew Anand; Buil, Alfonso; Viñuela, Ana; Lappalainen, Tuuli; Zheng, Hou-Feng; Richards, J Brent; Small, Kerrin S; Spector, Timothy D; Dermitzakis, Emmanouil T; Durbin, Richard

    2014-01-01

    Non-additive interaction between genetic variants, or epistasis, is a possible explanation for the gap between heritability of complex traits and the variation explained by identified genetic loci. Interactions give rise to genotype dependent variance, and therefore the identification of variance quantitative trait loci can be an intermediate step to discover both epistasis and gene by environment effects (GxE). Using RNA-sequence data from lymphoblastoid cell lines (LCLs) from the TwinsUK cohort, we identify a candidate set of 508 variance associated SNPs. Exploiting the twin design we show that GxE plays a role in ∼70% of these associations. Further investigation of these loci reveals 57 epistatic interactions that replicated in a smaller dataset, explaining on average 4.3% of phenotypic variance. In 24 cases, more variance is explained by the interaction than their additive contributions. Using molecular phenotypes in this way may provide a route to uncovering genetic interactions underlying more complex traits. DOI: http://dx.doi.org/10.7554/eLife.01381.001 PMID:24771767

  3. Subinhibitory Concentrations of Perilla Oil Affect the Expression of Secreted Virulence Factor Genes in Staphylococcus aureus

    PubMed Central

    Luo, Mingjing; Li, Hongen; Dong, Jing; Wang, Jianfeng; Leng, Bingfeng; Wang, Xiaoliang; Feng, Haihua; Ren, Wenzhi; Deng, Xuming

    2011-01-01

    Background The pathogenicity of staphylococcus aureus is dependent largely upon its ability to secrete a number of virulence factors, therefore, anti-virulence strategy to combat S. aureus-mediated infections is now gaining great interest. It is widely recognized that some plant essential oils could affect the production of staphylococcal exotoxins when used at subinhibitory concentrations. Perilla [Perilla frutescens (L.) Britton], a natural medicine found in eastern Asia, is primarily used as both a medicinal and culinary herb. Its essential oil (perilla oil) has been previously demonstrated to be active against S. aureus. However, there are no data on the influence of perilla oil on the production of S. aureus exotoxins. Methodology/Principal Findings A broth microdilution method was used to determine the minimum inhibitory concentrations (MICs) of perilla oil against S. aureus strains. Hemolysis, tumour necrosis factor (TNF) release, Western blot, and real-time RT-PCR assays were performed to evaluate the effects of subinhibitory concentrations of perilla oil on exotoxins production in S. aureus. The data presented here show that perilla oil dose-dependently decreased the production of α-toxin, enterotoxins A and B (the major staphylococcal enterotoxins), and toxic shock syndrome toxin 1 (TSST-1) in both methicillin-sensitive S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA). Conclusions/Significance The production of α-toxin, SEA, SEB, and TSST-1 in S. aureus was decreased by perilla oil. These data suggest that perilla oil may be useful for the treatment of S. aureus infections when used in combination with β-lactam antibiotics, which can increase exotoxins production by S. aureus at subinhibitory concentrations. Furthermore, perilla oil could be rationally applied in food systems as a novel food preservative both to inhibit the growth of S. aureus and to repress the production of exotoxins, particularly staphylococcal enterotoxins. PMID:21283822

  4. Perfluorooctane sulfonate (PFOS) affects hormone receptor activity, steroidogenesis, and expression of endocrine-related genes in vitro and in vivo.

    PubMed

    Du, Guizhen; Hu, Jialei; Huang, Hongyu; Qin, Yufeng; Han, Xiumei; Wu, Di; Song, Ling; Xia, Yankai; Wang, Xinru

    2013-02-01

    Perfluorooctane sulfonate (PFOS) is a widespread and persistent chemical in the environment. We investigated the endocrine-disrupting effects of PFOS using a combination of in vitro and in vivo assays. Reporter gene assays were used to detect receptor-mediated (anti-)estrogenic, (anti-)androgenic, and (anti-)thyroid hormone activities. The effect of PFOS on steroidogenesis was assessed both at hormone levels in the supernatant and at expression levels of hormone-induced genes in the H295R cell. A zebrafish-based short-term screening method was developed to detect the effect of PFOS on endocrine function in vivo. The results indicate that PFOS can act as an estrogen receptor agonist and thyroid hormone receptor antagonist. Exposure to PFOS decreased supernatant testosterone (T), increased estradiol (E2) concentrations in H295R cell medium and altered the expression of several genes involved in steroidogenesis. In addition, PFOS increased early thyroid development gene (hhex and pax8) expression in a concentration-dependent manner, decreased steroidogenic enzyme gene (CYP17, CYP19a, CYP19b) expression, and changed the expression pattern of estrogen receptor production genes (esr1, esr2b) after 500 µg/L PFOS treatment in zebrafish embryos. These results indicate that PFOS has the ability to act as an endocrine disruptor both in vitro and in vivo by disrupting the function of nuclear hormone receptors, interfering with steroidogenesis, and altering the expression of endocrine-related genes in zebrafish embryo.

  5. Dietary conjugated linoleic acid affects blood parameters, liver morphology and expression of selected hepatic genes in laying hens.

    PubMed

    Koronowicz, A A; Banks, P; Szymczyk, B; Leszczyńska, T; Master, A; Piasna, E; Szczepański, W; Domagała, D; Kopeć, A; Piątkowska, E; Laidler, P

    2016-10-01

    The objective of this research were to investigate the effect of a conjugated linoleic acid (CLA)-enriched diet on Isa Brown laying hen health status and to provide a comprehensive analysis of changes in blood parameters, liver morphology and selected hepatic gene expression. Hens were allocated to the control and experimental group (diet enriched with 0.75% CLA) for a total period of 4 m. At the end of the experiment half of the hens from each group were slaughtered for analyses. The remaining hens were transferred to an organic farm for the next 5 m and fed on the diet without CLA supplementation. The CLA-enriched diet resulted in significant changes in blood and serum parameters; specifically, haematocrit (HCT), mean corpuscular volume (MCV) and white blood cells (WBC) count were decreased compared to the control. The total cholesterol (TC) was not significantly affected while the triacylglycerol's (TG) concentration was elevated. The activity of alanine aminotransferase (ALT) was significantly increased in the CLA-supplemented group, while aspartate aminotransferase (AST) showed an increasing tendency. Liver biopsies showed pathological changes classified as non-alcoholic fatty liver disease (NAFLD). Additionally, the expression of hepatic genes involved in fatty acids synthesis (ME1, ACLY, ACC, FASN, SCD1), oxidation (CPT1α, PPARA), detoxification processes (Cytochrome P450, CYP, Flavin-containing monooxygenase, FMO3), oxidative stress (NOX4, XbP1) and inflammation (IL6, TNFα) were elevated. Cessation of CLA supplementation for 5 m of organic farming resulted in normalisation of blood and hepatic parameters to the levels observed in control hens. The results of this study indicate that dietary CLA triggers an integrated stress response in laying hens and activates mechanisms involved in liver detoxification.

  6. The peptide semax affects the expression of genes related to the immune and vascular systems in rat brain focal ischemia: genome-wide transcriptional analysis

    PubMed Central

    2014-01-01

    Background The nootropic neuroprotective peptide Semax (Met-Glu-His-Phe-Pro-Gly-Pro) has proved efficient in the therapy of brain stroke; however, the molecular mechanisms underlying its action remain obscure. Our genome-wide study was designed to investigate the response of the transcriptome of ischemized rat brain cortex tissues to the action of Semax in vivo. Results The gene-expression alteration caused by the action of the peptide Semax was compared with the gene expression of the “ischemia” group animals at 3 and 24 h after permanent middle cerebral artery occlusion (pMCAO). The peptide predominantly enhanced the expression of genes related to the immune system. Three hours after pMCAO, Semax influenced the expression of some genes that affect the activity of immune cells, and, 24 h after pMCAO, the action of Semax on the immune response increased considerably. The genes implicated in this response represented over 50% of the total number of genes that exhibited Semax-induced altered expression. Among the immune-response genes, the expression of which was modulated by Semax, genes that encode immunoglobulins and chemokines formed the most notable groups. In response to Semax administration, 24 genes related to the vascular system exhibited altered expression 3 h after pMCAO, whereas 12 genes were changed 24 h after pMCAO. These genes are associated with such processes as the development and migration of endothelial tissue, the migration of smooth muscle cells, hematopoiesis, and vasculogenesis. Conclusions Semax affects several biological processes involved in the function of various systems. The immune response is the process most markedly affected by the drug. Semax altered the expression of genes that modulate the amount and mobility of immune cells and enhanced the expression of genes that encode chemokines and immunoglobulins. In conditions of rat brain focal ischemia, Semax influenced the expression of genes that promote the formation and

  7. Post-entrapment genome engineering: First exon size does not affect the expression of fusion transcripts generated by gene entrapment

    PubMed Central

    Osipovich, Anna B.; Singh, Aparna; Ruley, H. Earl

    2005-01-01

    Gene trap mutagenesis in mouse embryonic stem cells has been widely used for genome-wide studies of mammalian gene function. However, while large numbers of genes can be disrupted, individual mutations may suffer from limitations due to the structure and/or placement of targeting vector. To extend the utility of gene trap mutagenesis, replaceable 3′ [or poly(A)] gene trap vectors were developed that permit sequences inserted in individual entrapment clones to be engineered by Cre-mediated recombination. 3′ traps incorporating different drug resistance genes could be readily exchanged, simply by selecting for the drug-resistance gene of the replacement vector. By substituting different 3′ traps, we show that otherwise identical fusion genes containing a large first exon (804 nt) are not expressed at appreciably lower levels than genes expressing small first exons (384 and 151 nt). Thus, size appears to have less effect on the expression and processing of first exons than has been reported for internal exons. Finally, a retroviral poly(A) trap (consisting of a RNA polymerase II promoter, a neomycin-resistance gene, and 5′-splice site) typically produced mutagenized clones in which vector sequences spliced to the 3′-terminal exons of cellular transcription units, suggesting strong selection for fusion transcripts that evade nonsense-mediated decay. The efficient exchange of poly(A) traps should greatly extend the utility of mutant libraries generated by gene entrapment and provides new strategies to study the rules that govern the expression of exons inserted throughout the genome. PMID:15741512

  8. Poly(Dimethylsiloxane) (PDMS) Affects Gene Expression in PC12 Cells Differentiating into Neuronal-Like Cells

    PubMed Central

    Łopacińska, Joanna M.; Emnéus, Jenny; Dufva, Martin

    2013-01-01

    Introduction Microfluidics systems usually consist of materials like PMMA - poly(methyl methacrylate) and PDMS - poly(dimethylsiloxane) and not polystyrene (PS), which is usually used for cell culture. Cellular and molecular responses in cells grown on PS are well characterized due to decades of accumulated research. In contrast, the experience base is limited for materials used in microfludics chip fabrication. Methods The effect of different materials (PS, PMMA and perforated PMMA with a piece of PDMS underneath) on the growth and differentiation of PC12 (adrenal phaeochromocytoma) cells into neuronal-like cells was investigated using cell viability, cell cycle distribution, morphology, and gene expression analysis. Results/Conclusions After differentiation, the morphology, viability and cell cycle distribution of PC12 cells grown on PS, PMMA with and without PDMS underneath was the same. By contrast, 41 genes showed different expression for PC12 cells differentiating on PMMA as compared to on PS. In contrast, 677 genes showed different expression on PMMA with PDMS underneath as compared with PC12 cells on PS. The differentially expressed genes are involved in neuronal cell development and function. However, there were also many markers for neuronal cell development and functions that were expressed similarly in cells differentiating on PS, PMMA and PMMA with PDMS underneath. In conclusion, it was shown that PMMA has a minor impact and PDMS a major impact on gene expression in PC12 cells. PMID:23301028

  9. Early exposure to caffeine affects gene expression of adenosine receptors, DARPP-32 and BDNF without affecting sensibility and morphology of developing zebrafish (Danio rerio).

    PubMed

    Capiotti, Katiucia Marques; Menezes, Fabiano Peres; Nazario, Luiza Reali; Pohlmann, Julhana Bianchini; de Oliveira, Giovanna M T; Fazenda, Lidiane; Bogo, Maurício Reis; Bonan, Carla Denise; Da Silva, Rosane Souza

    2011-01-01

    Adenosine receptors are the most important biochemical targets of caffeine, a common trimethylxanthine found in food and beverages. Adenosine plays modulatory action during the development through adenosine receptors and their intracellular pathways activation. In this study, we aimed to evaluate if caffeine gave to zebrafish in the very first steps of development is able to affect its direct targets, through the adenosine receptors mRNA expression evaluation, and latter indirect targets, through evaluation of the pattern of dopamine and cAMP-regulated phosphoprotein and brain-derived neurotrophic factor (BDNF) mRNA expression. Here, we demonstrate that zebrafish express adenosine receptor subtypes (A1, A2A1, A2A2 and A2B) since 24h post-fertilization (hpf) and that caffeine exposure is able to affect the expression of these receptors. Caffeine exposure from 1 hpf is able to increase A1 expression at 72-96 hpf and A2A1 expression at 72 hpf. No alterations occurred in A2A2 and A2B expression after caffeine treatment. DARPP-32, a phosphoprotein involved in adenosine intracellular pathway is also expressed since 24 hpf and early exposure to caffeine increased DARPP-32 expression at 168 hpf. We also evaluate the expression of BDNF as one of the targets of adenosine intracellular pathway activation. BDNF was also expressed since 24 hpf and caffeine treatment increased its expression at 48 and 72 hpf. No morphological alterations induced by caffeine treatment were registered by the check of general body features and total body length. Assessment of tactile sensibility also demonstrated no alterations by caffeine treatment. Altogether, these results suggest that caffeine is able to affect expression of its cellular targets since early phases of development in zebrafish without affect visible features. The up-regulation of direct and indirect targets of caffeine presents as a compensatory mechanism of maintenance of adenosinergic modulation during the developmental phase.

  10. Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: Insights from zebrafish model.

    PubMed

    Hoseinifar, Seyed Hossein; Safari, Roghieh; Dadar, Maryam

    2017-03-01

    Propionate is a short-chain fatty acid (SCFA) that improves physiological and pathophysiological properties. However, there is limited information available about the effects of SCFAs on mucosal immune parameters as well as growth and appetite related genes expression. The aim of the present study was to evaluate the effect of sodium propionate (SP) intake on the mucosal immune parameters, growth and appetite related genes expression using zebrafish (Danio rerio) as model organism. Zebrafish fed control or diet supplemented with different levels (0.5, 1 and 2%) of SP for 8weeks. At the end of feeding trial, the expression of the key genes related to growth and appetite (GH, IGF1, MYSTN and Ghrl) was evaluated. Also, mucosal immune parameters (Total Ig, lysozyme and protease activity) were studied in skin mucus of zebrafish. The results showed that dietary administration of SP significantly (P<0.05) up-regulated the expression of GH, IGF1 and down-regulated MYSTN gene. Also, feeding zebrafish with SP supplemented diet significantly increased appetite related gene expression (P<0.05) with a more pronounced effect in higher inclusion levels. Compared with control group, the expression of appetite related gene (Ghrl) was remarkably (P<0.05) higher in SP fed zebrafish. Also, elevated mucosal immune parameters was observed in zebrafish fed SP supplemented diet. The present results revealed beneficial effects of dietary SP on mucosal immune response and growth and appetite related genes expression. These results also highlighted the potential use of SP as additive in human diets.

  11. Low frequency pulsed electromagnetic field affects proliferation, tissue-specific gene expression, and cytokines release of human tendon cells.

    PubMed

    de Girolamo, L; Stanco, D; Galliera, E; Viganò, M; Colombini, A; Setti, S; Vianello, E; Corsi Romanelli, M M; Sansone, V

    2013-07-01

    Low frequency pulsed electromagnetic field (PEMF) has proven to be effective in the modulation of bone and cartilage tissue functional responsiveness, but its effect on tendon tissue and tendon cells (TCs) is still underinvestigated. PEMF treatment (1.5 mT, 75 Hz) was assessed on primary TCs, harvested from semitendinosus and gracilis tendons of eight patients, under different experimental conditions (4, 8, 12 h). Quantitative PCR analyses were conducted to identify the possible effect of PEMF on tendon-specific gene transcription (scleraxis, SCX and type I collagen, COL1A1); the release of pro- and anti-inflammatory cytokines and of vascular endothelial growth factor (VEGF) was also assessed. Our findings show that PEMF exposure is not cytotoxic and is able to stimulate TCs' proliferation. The increase of SCX and COL1A1 in PEMF-treated cells was positively correlated to the treatment length. The release of anti-inflammatory cytokines in TCs treated with PEMF for 8 and 12 h was significantly higher in comparison with untreated cells, while the production of pro-inflammatory cytokines was not affected. A dramatically higher increase of VEGF-A mRNA transcription and of its related protein was observed after PEMF exposure. Our data demonstrated that PEMF positively influence, in a dose-dependent manner, the proliferation, tendon-specific marker expression, and release of anti-inflammatory cytokines and angiogenic factor in a healthy human TCs culture model.

  12. Abiotic stresses affect differently the intron splicing and expression of chloroplast genes in coffee plants (Coffea arabica) and rice (Oryza sativa).

    PubMed

    Nguyen Dinh, Sy; Sai, Than Zaw Tun; Nawaz, Ghazala; Lee, Kwanuk; Kang, Hunseung

    2016-08-20

    Despite the increasing understanding of the regulation of chloroplast gene expression in plants, the importance of intron splicing and processing of chloroplast RNA transcripts under stress conditions is largely unknown. Here, to understand how abiotic stresses affect the intron splicing and expression patterns of chloroplast genes in dicots and monocots, we carried out a comprehensive analysis of the intron splicing and expression patterns of chloroplast genes in the coffee plant (Coffea arabica) as a dicot and rice (Oryza sativa) as a monocot under abiotic stresses, including drought, cold, or combined drought and heat stresses. The photosynthetic activity of both coffee plants and rice seedlings was significantly reduced under all stress conditions tested. Analysis of the transcript levels of chloroplast genes revealed that the splicing of tRNAs and mRNAs in coffee plants and rice seedlings were significantly affected by abiotic stresses. Notably, abiotic stresses affected differently the splicing of chloroplast tRNAs and mRNAs in coffee plants and rice seedlings. The transcript levels of most chloroplast genes were markedly downregulated in both coffee plants and rice seedlings upon stress treatment. Taken together, these results suggest that coffee and rice plants respond to abiotic stresses via regulating the intron splicing and expression of different sets of chloroplast genes.

  13. Dyslipidemia rather than Type 2 Diabetes Mellitus or Chronic Periodontitis Affects the Systemic Expression of Pro- and Anti-Inflammatory Genes

    PubMed Central

    Corbi, Sâmia Cruz Tfaile; Bastos, Alliny De Souza; Dos Santos, Raquel Alves; Orrico, Silvana Regina Perez

    2017-01-01

    A high percentage of type 2 diabetes mellitus (T2D) patients are also affected by dyslipidemia and chronic periodontitis (CP), but no studies have determined the gene expression in patients that are simultaneously affected by all three diseases. We investigated the systemic expression of immune-related genes in T2D, dyslipidemia, and CP patients. One hundred and fifty patients were separated into five groups containing 30 individuals each: (G1) poorly controlled T2D with dyslipidemia and CP; (G2) well-controlled T2D with dyslipidemia and CP; (G3) normoglycemic individuals with dyslipidemia and CP; (G4) healthy individuals with CP; (G5) systemic and periodontally healthy individuals. Blood analyses of lipid and glycemic profiles were carried out. The expression of genes, including IL10, JAK1, STAT3, SOCS3, IP10, ICAM1, IFNA, IFNG, STAT1, and IRF1, was investigated by RT-qPCR. Patients with dyslipidemia demonstrated statistically higher expression of the IL10 and IFNA genes, while IFNG, IP10, IRF1, JAK1, and STAT3 were lower in comparison with nondyslipidemic patients. Anti-inflammatory genes, such as IL10, positively correlated with parameters of glucose, lipid, and periodontal profiles, while proinflammatory genes, such as IFNG, were negatively correlated with these parameters. We conclude that dyslipidemia appears to be the primary disease that is associated with gene expression of immune-related genes, while parameters of T2D and CP were correlated with the expression of these important immune genes. PMID:28316372

  14. Neutron Radiation Affects the Expression of Genes Involved in the Response to Auxin, Senescence and Oxidative Stress in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Fortunati, A.; Tassone, P.; Migliaccio, F.

    2008-06-01

    Researches were conducted on the effect of neutron radiation on the expression of genes auxin activated or connected with the process of senescence in Arabidopsis plants. The research was done by applying the real-time polymerase chain reaction (PCR) technique. The results indicated that the auxin response factors (ARFs) genes are clearly downregulated, whereas the indolacetic acid-induced (Aux/IAAs) genes in some cases were upregulated. By contrast in the mutants for auxin transport aux1 and eir1 the ARFs genes were upregulated. In addition, both in the wildtype and mutants, some already known genes activated by stress and senescence were significantly upregulated. On the basis of these researches we conclude that the process of senescence induced by irradiation is, at least in part, controlled by the physiology of the hormone auxin.

  15. Water deficit-induced oxidative stress affects artemisinin content and expression of proline metabolic genes in Artemisia annua L.

    PubMed

    Soni, Priyanka; Abdin, Malik Z

    2017-03-01

    Water stress is one of the most critical abiotic stresses that restricts growth, development, and alters physiological and biochemical mechanisms of plant. The effects of long-term water shortage-induced oxidative stress on morphophysiological parameters, proline metabolic genes, and artemisinin content were studied in Artemisia annua L. under greenhouse conditions. Plant growth, biomass accumulation, relative water content, and chlorophyll content were reduced under drought. Leaf water potential ranged from -0.3248 MPa to -1.22 MPa in stress conditions. Increased levels of proline accumulation, protein concentration, and lipid peroxidation were detected in water-stressed plants. Stage-dependent increases in activity of antioxidants including superoxide dismutase, ascorbate peroxidase, glutathione reductase, monodehydroascorbate reductase, and dehydroascorbate reductase were observed. The expression of proline biosynthetic genes including pyrroline-5-carboxylase synthase1, 1-pyrroline-5-carboxylase synthase2, and 1-pyrroline-5-carboxylase reductase was induced, while the ornithine aminotransferase transcript showed a variable response and the expression of proline catabolic genes including proline dehydrogenase1, proline dehydrogenase1, and proline 5-carboxylate dehydrogenase was reduced by water stress. Our results indicate that the glutamine pathway is predominant under drought stress in A. annua and a reduction of catabolic gene expression is adopted as a defense strategy in adverse conditions. Higher expression of biosynthetic genes and lower expression of catabolic genes at the preflowering stage confirmed the important role of proline in flower development. Artemisinin content decreased owing to water stress, but the slightly higher amounts were detected in leaves of severely stressed plants compared with moderately stressed plants. The artemisinin content of A. annua might be regulated by controlling irrigation regimes.

  16. A Trans-Acting Regulatory Gene That Inversely Affects the Expression of the White, Brown and Scarlet Loci in Drosophila

    PubMed Central

    Rabinow, L.; Nguyen-Huynh, A. T.; Birchler, J. A.

    1991-01-01

    A trans-acting regulatory gene, Inr-a, that alters the level of expression of the white eye color locus as an inverse function of the number of its functional copies is described. Several independent lines of evidence demonstrate that this regulatory gene interacts with white via the promoter sequences. Among these are the observations that the inverse regulatory effect is conferred to the Adh gene when fused to the white promoter and that cis-regulatory mutants of white fail to respond. The phenotypic response to Inr-a is found in all tissues in which white is expressed, and mutants of the regulator exhibit a recessive lethality during larval periods. Increased white messenger RNA levels in pupal stages are found in Inr-a/+ individuals versus +/+ and a coordinate response is observed for mRNA levels from the brown and scarlet loci. All are structurally related and participate in pigment deposition. These experiments demonstrate that a single regulatory gene can exert an inverse effect on a target structural locus, a situation postulated from segmental aneuploid studies of gene expression and dosage compensation. PMID:1743487

  17. PLIN1 deficiency affects testicular gene expression at the meiotic stage in the first wave of spermatogenesis.

    PubMed

    Chen, Min; Wang, Hong; Li, Xiangdong; Li, Ning; Xu, Guoheng; Meng, Qingyong

    2014-06-15

    PLIN1, a lipid droplet associated protein, has been implicated in playing a key role in the regulation of lipolysis and lipid storage in adipocytes. PLIN1 is found to be highly expressed in Leydig cells of testis, suggesting a potential role in steroidogenesis and spermatogenesis. In this study, we showed that PLIN1 was expressed in testis and that its mRNA levels declined significantly with development. To investigate the role of PLIN1, we take advantage of PLIN1-null mice. We found that the number of seminiferous tubules containing round spermatids was significantly increased at P21 (postnatal day 21). Furthermore, microarray analysis showed that there were 538 differentially expressed genes between PLIN1-null and wild-type mice at P21. The up-regulated genes in knockout mice were enriched in spermatogenesis by Gene Ontology classification. Among them, Prm1 and Wbp2nl are important for spermatogenesis which were confirmed by real-time PCR. Unexpectedly, the levels of serum testosterone and serum 17β-estradiol as well as steroidogenic genes are not altered in the PLIN1-null mice. Compared to the wild-type mice, no significant difference of fertility was found in the PLIN1-null mice. Therefore, these findings indicated that PLIN1 disruption leads to the increase of round spermatid-containing seminiferous tubules at the meiotic stage of the first wave of spermatogenesis through regulating spermatogenic related genes.

  18. Methanobactin from Methylocystis sp. strain SB2 affects gene expression and methane monooxygenase activity in Methylosinus trichosporium OB3b.

    PubMed

    Farhan Ul-Haque, Muhammad; Kalidass, Bhagyalakshmi; Vorobev, Alexey; Baral, Bipin S; DiSpirito, Alan A; Semrau, Jeremy D

    2015-04-01

    Methanotrophs can express a cytoplasmic (soluble) methane monooxygenase (sMMO) or membrane-bound (particulate) methane monooxygenase (pMMO). Expression of these MMOs is strongly regulated by the availability of copper. Many methanotrophs have been found to synthesize a novel compound, methanobactin (Mb), that is responsible for the uptake of copper, and methanobactin produced by Methylosinus trichosporium OB3b plays a key role in controlling expression of MMO genes in this strain. As all known forms of methanobactin are structurally similar, it was hypothesized that methanobactin from one methanotroph may alter gene expression in another. When Methylosinus trichosporium OB3b was grown in the presence of 1 μM CuCl2, expression of mmoX, encoding a subunit of the hydroxylase component of sMMO, was very low. mmoX expression increased, however, when methanobactin from Methylocystis sp. strain SB2 (SB2-Mb) was added, as did whole-cell sMMO activity, but there was no significant change in the amount of copper associated with M. trichosporium OB3b. If M. trichosporium OB3b was grown in the absence of CuCl2, the mmoX expression level was high but decreased by several orders of magnitude if copper prebound to SB2-Mb (Cu-SB2-Mb) was added, and biomass-associated copper was increased. Exposure of Methylosinus trichosporium OB3b to SB2-Mb had no effect on expression of mbnA, encoding the polypeptide precursor of methanobactin in either the presence or absence of CuCl2. mbnA expression, however, was reduced when Cu-SB2-Mb was added in both the absence and presence of CuCl2. These data suggest that methanobactin acts as a general signaling molecule in methanotrophs and that methanobactin "piracy" may be commonplace.

  19. Local overexpression of Su(H)-MAPK variants affects Notch target gene expression and adult phenotypes in Drosophila

    PubMed Central

    Auer, Jasmin S.; Nagel, Anja C.; Schulz, Adriana; Wahl, Vanessa; Preiss, Anette

    2015-01-01

    In Drosophila, Notch and EGFR signalling pathways are closely intertwined. Their relationship is mostly antagonistic, and may in part be based on the phosphorylation of the Notch signal transducer Suppressor of Hairless [Su(H)] by MAPK. Su(H) is a transcription factor that together with several cofactors regulates the expression of Notch target genes. Here we address the consequences of a local induction of three Su(H) variants on Notch target gene expression. To this end, wild-type Su(H), a phospho-deficient Su(H)MAPK-ko and a phospho-mimetic Su(H)MAPK-ac isoform were overexpressed in the central domain of the wing anlagen. The expression of the Notch target genes cut, wingless, E(spl)m8-HLH and vestigial, was monitored. For the latter two, reporter genes were used (E(spl)m8-lacZ, vgBE-lacZ). In general, Su(H)MAPK-ko induced a stronger response than wild-type Su(H), whereas the response to Su(H)MAPK-ac was very weak. Notch target genes cut, wingless and vgBE-lacZ were ectopically activated, whereas E(spl)m8-lacZ was repressed by overexpression of Su(H) proteins. In addition, in epistasis experiments an activated form of the EGF-receptor (DERact) or the MAPK (rlSEM) and individual Su(H) variants were co-overexpressed locally, to compare the resultant phenotypes in adult flies (thorax, wings and eyes) as well as to assay the response of the Notch target gene cut in cell clones. PMID:26702412

  20. Expression-based GWAS identifies variants, gene interactions and key regulators affecting intramuscular fatty acid content and composition in porcine meat

    PubMed Central

    Puig-Oliveras, Anna; Revilla, Manuel; Castelló, Anna; Fernández, Ana I.; Folch, Josep M.; Ballester, Maria

    2016-01-01

    The aim of this work is to better understand the genetic mechanisms determining two complex traits affecting porcine meat quality: intramuscular fat (IMF) content and its fatty acid (FA) composition. With this purpose, expression Genome-Wide Association Study (eGWAS) of 45 lipid-related genes associated with meat quality traits in swine muscle (Longissimus dorsi) of 114 Iberian × Landrace backcross animals was performed. The eGWAS identified 241 SNPs associated with 11 genes: ACSM5, CROT, FABP3, FOS, HIF1AN, IGF2, MGLL, NCOA1, PIK3R1, PLA2G12A and PPARA. Three expression Quantitative Trait Loci (eQTLs) for IGF2, ACSM5 and MGLL were identified, showing cis-acting effects, whereas 16 eQTLs had trans regulatory effects. A polymorphism in the ACSM5 promoter region associated with its expression was identified. In addition, strong candidate genes regulating ACSM5, FOS, PPARA, PIK3R1, PLA2G12A and HIF1AN gene expression were also seen. Notably, the analysis highlighted the NR3C1 transcription factor as a strong candidate gene involved in the regulation of the 45 genes analysed. Finally, the IGF2, MGLL, MC2R, ARHGAP6, and NR3C1 genes were identified as potential regulators co-localizing within QTLs for fatness and growth traits in the IBMAP population. The results obtained increase our knowledge in the functional regulatory mechanisms involved in these complex traits. PMID:27666082

  1. Promoter methylation and histone modifications affect the expression of the exogenous DsRed gene in transgenic goats.

    PubMed

    Nuo, M T; Yuan, J L; Yang, W L; Gao, X Y; He, N; Liang, H; Cang, M; Liu, D J

    2016-08-29

    Transgene silencing, which is common in transgenic plants and animals, limits the generation and application of genetically modified organisms, and is associated with the exogenous gene copy number, the methylation status of its promoters, and histone modification abnormalities. Here, we analyzed the expression of the exogenous gene DsRed and the methylation status of its cytomegalovirus (CMV) promoter in six healthy transgenic cashmere goats and transgenic nuclear donor cells. The CMV promoter exhibited high methylation levels (74.4-88.2%) in four of the goats, a moderate methylation level (58.7%) in one, and a low methylation level (21.2%) in one, while the methylation level of the transgenic nuclear donor cells was comparatively low (14.3%). DsRed expression was negatively correlated with promoter methylation status. Transgenic cashmere goats carried one to three copies of the CMV promoter fragment and one to six copies of the DsRed fragment, but copy number showed no obvious correlation with DsRed expression. After treatment with the methylation inhibitor 5-azacytidine, DsRed expression in transgenic goat cells significantly increased and CMV promoter methylation significantly decreased; this indicated an inverse correlation between promoter methylation status and DsRed expression. After treatment with the histone deacetylase inhibitor trichostatin A, DsRed expression increased, indicating that an abnormal histone modification in transgenic goats is also involved in exogenous gene silencing. These findings indicate the potential of trichostatin A and 5-azacytidine to rescue the biological activity of silenced exogenous transgenes in adult-derived transgenic cells under culture conditions.

  2. Discovering modulators of gene expression

    PubMed Central

    Babur, Özgün; Demir, Emek; Gönen, Mithat; Sander, Chris; Dogrusoz, Ugur

    2010-01-01

    Proteins that modulate the activity of transcription factors, often called modulators, play a critical role in creating tissue- and context-specific gene expression responses to the signals cells receive. GEM (Gene Expression Modulation) is a probabilistic framework that predicts modulators, their affected targets and mode of action by combining gene expression profiles, protein–protein interactions and transcription factor–target relationships. Using GEM, we correctly predicted a significant number of androgen receptor modulators and observed that most modulators can both act as co-activators and co-repressors for different target genes. PMID:20466809

  3. DMSA-Coated Iron Oxide Nanoparticles Greatly Affect the Expression of Genes Coding Cysteine-Rich Proteins by Their DMSA Coating.

    PubMed

    Zhang, Ling; Wang, Xin; Zou, Jinglu; Liu, Yingxun; Wang, Jinke

    2015-10-19

    The dimercaptosuccinic acid (DMSA) was widely used to coat iron oxide nanoparticles (FeNPs); however, its intracellular cytotoxicity remains to be adequately elucidated. This study analyzed the differentially expressed genes (DEGs) in four mammalian cells treated by a DMSA-coated magnetite FeNP at various doses at different times. The results revealed that about one-fourth of DEGs coded cysteine-rich proteins (CRPs) in all cells under each treatment, indicating that the nanoparticles greatly affected the expressions of CRP-coding genes. Additionally, about 26% of CRP-coding DEGs were enzyme genes in all cells, indicating that the nanoparticles greatly affected the expression of enzyme genes. Further experiments with the nanoparticles and a polyethylenimine (PEI)-coated magnetite FeNP revealed that the effect mainly resulted from DMSA carried into cells by the nanoparticles. This study thus first reported the cytotoxicity of DMSA at the gene transcription level as coating molecules of FeNPs. This study provides new insight into the molecular mechanism by which the DMSA-coated nanoparticles resulted in the transcriptional changes of many CRP-coding genes in cells. This study draws attention toward the intracellular cytotoxicity of DMSA as a coating molecule of nanoparticles, which has very low toxicity as an orally administered antidote due to its extracellular distribution.

  4. Threonine Affects Intestinal Function, Protein Synthesis and Gene Expression of TOR in Jian Carp (Cyprinus carpio var. Jian)

    PubMed Central

    Feng, Lin; Peng, Yan; Wu, Pei; Hu, Kai; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Li, Shu-Hong; Zhou, Xiao-Qiu

    2013-01-01

    This study aimed to investigate the effects of threonine (Thr) on the digestive and absorptive ability, proliferation and differentiation of enterocytes, and gene expression of juvenile Jian carp (Cyprinus carpio var. Jian). First, seven isonitrogenous diets containing graded levels of Thr (7.4–25.2 g/kg diet) were fed to the fishes for 60 days. Second, enterocyte proliferation and differentiation were assayed by culturing enterocytes with graded levels of Thr (0–275 mg/l) in vitro. Finally, enterocytes were cultured with 0 and 205 mg/l Thr to determine protein synthesis. The percent weight gain (PWG), specific growth rate, feed intake, feed efficiency, protein retention value, activities of trypsin, lipase and amylase, weights and protein contents of hepatopancreas and intestine, folds heights, activities of alkaline phosphatase (AKP), γ- glutamyl transpeptidase and Na+/K+-ATPase in all intestinal segments, glutamate-oxaloacetate transaminase (GOT) and glutamate-pyruvate transaminase (GPT) activities in hepatopancreas, and 4E-BP2 gene expression in muscle, hepatopancreas and intestinal segments were significantly enhanced by Thr (p<0.05). However, the plasma ammonia concentration and TOR gene expression decreased (p<0.05). In vitro, Thr supplement significantly increased cell numbers, protein content, the activities of GOT, GPT, AKP and Na+/K+-ATPase, and protein synthesis rate of enterocytes, and decreased LDH activity and ammonia content in cell medium (p<0.05). In conclusion, Thr improved growth, digestive and absorptive capacity, enterocyte proliferation and differentiation, and protein synthesis and regulated TOR and 4E-BP2 gene expression in juvenile Jian carp. The dietary Thr requirement of juvenile Jian carp was 16.25 g/kg diet (51.3 g/kg protein) based on quadratic regression analysis of PWG. PMID:23922879

  5. Interaction between the Stress Phase Angle (SPA) and the Oscillatory Shear Index (OSI) Affects Endothelial Cell Gene Expression

    PubMed Central

    Amaya, Ronny; Cancel, Limary M.; Tarbell, John M.

    2016-01-01

    Hemodynamic forces play an important role in the non-uniform distribution of atherosclerotic lesions. Endothelial cells are exposed simultaneously to fluid wall shear stress (WSS) and solid circumferential stress (CS). Due to variations in impedance (global factors) and geometric complexities (local factors) in the arterial circulation a time lag arises between these two forces that can be characterized by the temporal phase angle between CS and WSS (stress phase angle–SPA). Asynchronous flows (SPA close to -180°) that are most prominent in coronary arteries have been associated with localization of atherosclerosis. Reversing oscillatory flows characterized by an oscillatory shear index (OSI) that is great than zero are also associated with atherosclerosis localization. In this study we examined the relationship between asynchronous flows and reversing flows in altering the expression of 37 genes relevant to atherosclerosis development. In the case of reversing oscillatory flow, we observed that the asynchronous condition upregulated 8 genes compared to synchronous hemodynamics, most of them proatherogenic. Upregulation of the pro-inflammatory transcription factor NFκB p65 was confirmed by western blot, and nuclear translocation of NFκB p65 was confirmed by immunofluorescence staining. A comparative study between non-reversing flow and reversing flow found that in the case of synchronous hemodynamics, reversing flow altered the expression of 11 genes, while in the case of asynchronous hemodynamics, reversing flow altered the expression of 17 genes. Reversing flow significantly upregulated protein expression of NFκB p65 for both synchronous and asynchronous conditions. Nuclear translocation of NFκB p65 was confirmed for synchronous and asynchronous conditions in the presence of flow reversal. These data suggest that asynchronous hemodynamics and reversing flow can elicit proatherogenic responses in endothelial cells compared to synchronous hemodynamics

  6. Interaction between the Stress Phase Angle (SPA) and the Oscillatory Shear Index (OSI) Affects Endothelial Cell Gene Expression.

    PubMed

    Amaya, Ronny; Cancel, Limary M; Tarbell, John M

    2016-01-01

    Hemodynamic forces play an important role in the non-uniform distribution of atherosclerotic lesions. Endothelial cells are exposed simultaneously to fluid wall shear stress (WSS) and solid circumferential stress (CS). Due to variations in impedance (global factors) and geometric complexities (local factors) in the arterial circulation a time lag arises between these two forces that can be characterized by the temporal phase angle between CS and WSS (stress phase angle-SPA). Asynchronous flows (SPA close to -180°) that are most prominent in coronary arteries have been associated with localization of atherosclerosis. Reversing oscillatory flows characterized by an oscillatory shear index (OSI) that is great than zero are also associated with atherosclerosis localization. In this study we examined the relationship between asynchronous flows and reversing flows in altering the expression of 37 genes relevant to atherosclerosis development. In the case of reversing oscillatory flow, we observed that the asynchronous condition upregulated 8 genes compared to synchronous hemodynamics, most of them proatherogenic. Upregulation of the pro-inflammatory transcription factor NFκB p65 was confirmed by western blot, and nuclear translocation of NFκB p65 was confirmed by immunofluorescence staining. A comparative study between non-reversing flow and reversing flow found that in the case of synchronous hemodynamics, reversing flow altered the expression of 11 genes, while in the case of asynchronous hemodynamics, reversing flow altered the expression of 17 genes. Reversing flow significantly upregulated protein expression of NFκB p65 for both synchronous and asynchronous conditions. Nuclear translocation of NFκB p65 was confirmed for synchronous and asynchronous conditions in the presence of flow reversal. These data suggest that asynchronous hemodynamics and reversing flow can elicit proatherogenic responses in endothelial cells compared to synchronous hemodynamics without

  7. Low-Dose, Long-Wave UV Light Does Not Affect Gene Expression of Human Mesenchymal Stem Cells.

    PubMed

    Wong, Darice Y; Ranganath, Thanmayi; Kasko, Andrea M

    2015-01-01

    Light is a non-invasive tool that is widely used in a range of biomedical applications. Techniques such as photopolymerization, photodegradation, and photouncaging can be used to alter the chemical and physical properties of biomaterials in the presence of live cells. Long-wave UV light (315 nm-400 nm) is an easily accessible and commonly used energy source for triggering biomaterial changes. Although exposure to low doses of long-wave UV light is generally accepted as biocompatible, most studies employing this wavelength only establish cell viability, ignoring other possible (non-toxic) effects. Since light exposure of wavelengths longer than 315 nm may potentially induce changes in cell behavior, we examined changes in gene expression of human mesenchymal stem cells exposed to light under both 2D and 3D culture conditions, including two different hydrogel fabrication techniques, decoupling UV exposure and radical generation. While exposure to long-wave UV light did not induce significant changes in gene expression regardless of culture conditions, significant changes were observed due to scaffold fabrication chemistry and between cells plated in 2D versus encapsulated in 3D scaffolds. In order to facilitate others in searching for more specific changes between the many conditions, the full data set is available on Gene Expression Omnibus for querying.

  8. Expression of the Gene for Autotransporter AutB of Neisseria meningitidis Affects Biofilm Formation and Epithelial Transmigration

    PubMed Central

    Arenas, Jesús; Paganelli, Fernanda L.; Rodríguez-Castaño, Patricia; Cano-Crespo, Sara; van der Ende, Arie; van Putten, Jos P. M.; Tommassen, Jan

    2016-01-01

    Neisseria meningitidis is a Gram-negative bacterium that resides as a commensal in the upper respiratory tract of humans, but occasionally, it invades the host and causes sepsis and/or meningitis. The bacterium can produce eight autotransporters, seven of which have been studied to some detail. The remaining one, AutB, has not been characterized yet. Here, we show that the autB gene is broadly distributed among pathogenic Neisseria spp. The gene is intact in most meningococcal strains. However, its expression is prone to phase variation due to slipped-strand mispairing at AAGC repeats located within the DNA encoding the signal sequence and is switched off in the vast majority of these strains. Moreover, various genetic disruptions prevent autB expression in most of the strains in which the gene is in phase indicating a strong selection against AutB synthesis. We observed that autB is expressed in two of the strains examined and that AutB is secreted and exposed at the cell surface. Functionality assays revealed that AutB synthesis promotes biofilm formation and delays the passage of epithelial cell layers in vitro. We hypothesize that this autotransporter is produced during the colonization process only in specific niches to facilitate microcolony formation, but its synthesis is switched off probably to evade the immune system and facilitate human tissue invasion. PMID:27921012

  9. Low-Dose, Long-Wave UV Light Does Not Affect Gene Expression of Human Mesenchymal Stem Cells

    PubMed Central

    Wong, Darice Y.; Ranganath, Thanmayi; Kasko, Andrea M.

    2015-01-01

    Light is a non-invasive tool that is widely used in a range of biomedical applications. Techniques such as photopolymerization, photodegradation, and photouncaging can be used to alter the chemical and physical properties of biomaterials in the presence of live cells. Long-wave UV light (315 nm–400 nm) is an easily accessible and commonly used energy source for triggering biomaterial changes. Although exposure to low doses of long-wave UV light is generally accepted as biocompatible, most studies employing this wavelength only establish cell viability, ignoring other possible (non-toxic) effects. Since light exposure of wavelengths longer than 315 nm may potentially induce changes in cell behavior, we examined changes in gene expression of human mesenchymal stem cells exposed to light under both 2D and 3D culture conditions, including two different hydrogel fabrication techniques, decoupling UV exposure and radical generation. While exposure to long-wave UV light did not induce significant changes in gene expression regardless of culture conditions, significant changes were observed due to scaffold fabrication chemistry and between cells plated in 2D versus encapsulated in 3D scaffolds. In order to facilitate others in searching for more specific changes between the many conditions, the full data set is available on Gene Expression Omnibus for querying. PMID:26418040

  10. Generation of a Genome Scale Lentiviral Vector Library for EF1α Promoter-Driven Expression of Human ORFs and Identification of Human Genes Affecting Viral Titer

    PubMed Central

    Škalamera, Dubravka; Dahmer, Mareike; Purdon, Amy S.; Wilson, Benjamin M.; Ranall, Max V.; Blumenthal, Antje; Gabrielli, Brian; Gonda, Thomas J.

    2012-01-01

    The bottleneck in elucidating gene function through high-throughput gain-of-function genome screening is the limited availability of comprehensive libraries for gene overexpression. Lentiviral vectors are the most versatile and widely used vehicles for gene expression in mammalian cells. Lentiviral supernatant libraries for genome screening are commonly generated in the HEK293T cell line, yet very little is known about the effect of introduced sequences on the produced viral titer, which we have shown to be gene dependent. We have generated an arrayed lentiviral vector library for the expression of 17,030 human proteins by using the GATEWAY® cloning system to transfer ORFs from the Mammalian Gene Collection into an EF1alpha promoter-dependent lentiviral expression vector. This promoter was chosen instead of the more potent and widely used CMV promoter, because it is less prone to silencing and provides more stable long term expression. The arrayed lentiviral clones were used to generate viral supernatant by packaging in the HEK293T cell line. The efficiency of transfection and virus production was estimated by measuring the fluorescence of IRES driven GFP, co-expressed with the ORFs. More than 90% of cloned ORFs produced sufficient virus for downstream screening applications. We identified genes which consistently produced very high or very low viral titer. Supernatants from select clones that were either high or low virus producers were tested on a range of cell lines. Some of the low virus producers, including two previously uncharacterized proteins were cytotoxic to HEK293T cells. The library we have constructed presents a powerful resource for high-throughput gain-of-function screening of the human genome and drug-target discovery. Identification of human genes that affect lentivirus production may lead to improved technology for gene expression using lentiviral vectors. PMID:23251614

  11. Zearalenone Mycotoxin Affects Immune Mediators, MAPK Signalling Molecules, Nuclear Receptors and Genome-Wide Gene Expression in Pig Spleen

    PubMed Central

    Pistol, Gina Cecilia; Braicu, Cornelia; Motiu, Monica; Gras, Mihail Alexandru; Marin, Daniela Eliza; Stancu, Mariana; Calin, Loredana; Israel-Roming, Florentina; Berindan-Neagoe, Ioana; Taranu, Ionelia

    2015-01-01

    The toxicity of zearalenone (ZEA) was evaluated in swine spleen, a key organ for the innate and adaptative immune response. Weaned pigs were fed for 18 days with a control or a ZEA contaminated diet. The effect of ZEA was assessed on wide genome expression, pro- (TNF-α, IL-8, IL-6, IL-1β, IFN-γ) and anti-inflammatory (IL-10, IL-4) cytokines, other molecules involved in inflammatory processes (MMPs/TIMPs), as well as signaling molecules, (p38/JNK1/JNK2-MAPKs) and nuclear receptors (PPARγ/NFkB/AP-1/STAT3/c-JUN). Microarray analysis showed that 46% of total number of differentially expressed genes was involved in cellular signaling pathway, 13% in cytokine network and 10% in the inflammatory response. ZEA increased expression and synthesis of pro- inflammatory (TNF-α, IL-8, IL-6, IL-1β) and had no effect on IFN-γ, IL-4 and IL-10 cytokines in spleen. The inflammatory stimulation might be a consequence of JNK pathway activation rather than of p-38MAPK and NF-kB involvement whose gene and protein expression were suppressed by ZEA action. In summary, our findings indicated the role of ZEA as an immune disruptor at spleen level. PMID:26011631

  12. Decoding Children's Expressions of Affect.

    ERIC Educational Resources Information Center

    Feinman, Joel A.; Feldman, Robert S.

    1982-01-01

    Mothers' ability to decode their children's nonverbal expressions of four affects (happiness, sadness, fear, and anger) was contrasted with the decoding ability of a matched group of nonmothers. Results indicate that mothers were accurately able to decode expressions of happiness but had relative difficulty with decoding expressions of sadness,…

  13. Epilepsy-causing sequence variations in SIK1 disrupt synaptic activity response gene expression and affect neuronal morphology.

    PubMed

    Pröschel, Christoph; Hansen, Jeanne N; Ali, Adil; Tuttle, Emily; Lacagnina, Michelle; Buscaglia, Georgia; Halterman, Marc W; Paciorkowski, Alex R

    2017-02-01

    SIK1 syndrome is a newly described developmental epilepsy disorder caused by heterozygous mutations in the salt-inducible kinase SIK1. To better understand the pathophysiology of SIK1 syndrome, we studied the effects of SIK1 pathogenic sequence variations in human neurons. Primary human fetal cortical neurons were transfected with a lentiviral vector to overexpress wild-type and mutant SIK1 protein. We evaluated the transcriptional activity of known downstream gene targets in neurons expressing mutant SIK1 compared with wild type. We then assayed neuronal morphology by measuring neurite length, number and branching. Truncating SIK1 sequence variations were associated with abnormal MEF2C transcriptional activity and decreased MEF2C protein levels. Epilepsy-causing SIK1 sequence variations were associated with significantly decreased expression of ARC (activity-regulated cytoskeletal-associated) and other synaptic activity response element genes. Assay of mRNA levels for other MEF2C target genes NR4A1 (Nur77) and NRG1, found significantly, decreased the expression of these genes as well. The missense p.(Pro287Thr) SIK1 sequence variation was associated with abnormal neuronal morphology, with significant decreases in mean neurite length, mean number of neurites and a significant increase in proximal branches compared with wild type. Epilepsy-causing SIK1 sequence variations resulted in abnormalities in the MEF2C-ARC pathway of neuronal development and synapse activity response. This work provides the first insights into the mechanisms of pathogenesis in SIK1 syndrome, and extends the ARX-MEF2C pathway in the pathogenesis of developmental epilepsy.

  14. Transitions from mono- to co- to tri-culture uniquely affect gene expression in breast cancer, stromal, and immune compartments

    PubMed Central

    Weinberger, Emma M.; Regehr, Keil J.; Berry, Scott M.; Beebe, David J.; Alarid, Elaine T.

    2016-01-01

    Heterotypic interactions in cancer microenvironments play important roles in disease initiation, progression, and spread. Co-culture is the predominant approach used in dissecting paracrine interactions between tumor and stromal cells, but functional results from simple co-cultures frequently fail to correlate to in vivo conditions. Though complex heterotypic in vitro models have improved functional relevance, there is little systematic knowledge of how multi-culture parameters influence this recapitulation. We therefore have employed a more iterative approach to investigate the influence of increasing model complexity; increased heterotypic complexity specifically. Here we describe how the compartmentalized and microscale elements of our multi-culture device allowed us to obtain gene expression data from one cell type at a time in a heterotypic culture where cells communicated through paracrine interactions. With our device we generated a large dataset comprised of cell type specific gene-expression patterns for cultures of increasing complexity (three cell types in mono-, co-, or tri-culture) not readily accessible in other systems. Principal component analysis indicated that gene expression was changed in co-culture but was often more strongly altered in tri-culture as compared to mono-culture. Our analysis revealed that cell type identity and the complexity around it (mono-, co-, or tri-culture) influence gene regulation. We also observed evidence of complementary regulation between cell types in the same heterotypic culture. Here we demonstrate the utility of our platform in providing insight into how tumor and stromal cells respond to microenvironments of varying complexities highlighting the expanding importance of heterotypic cultures that go beyond conventional co-culture. PMID:27432323

  15. The SNF5 protein of Saccharomyces cerevisiae is a glutamine- and proline-rich transcriptional activator that affects expression of a broad spectrum of genes.

    PubMed Central

    Laurent, B C; Treitel, M A; Carlson, M

    1990-01-01

    The Saccharomyces cerevisiae SNF5 gene affects expression of both glucose- and phosphate-regulated genes and appears to function in transcription. We report the nucleotide sequence, which predicts that SNF5 encodes a 102,536-dalton protein. The N-terminal third of the protein is extremely rich in glutamine and proline. Mutants carrying a deletion of the coding sequence were viable but grew slowly, indicating that the SNF5 gene is important but not essential. Evidence that SNF5 affects expression of the cell type-specific genes MF alpha 1 and BAR1 at the RNA level extends the known range of SNF5 function. SNF5 is apparently required for expression of a wide variety of differently regulated genes. A bifunctional SNF5-beta-galactosidase fusion protein was localized in the nucleus by immunofluorescence. No DNA-binding activity was detected for SNF5. A LexA-SNF5 fusion protein, when bound to a lexA operator, functioned as a transcriptional activator. Images PMID:2233708

  16. Selenium Deficiency Affects the mRNA Expression of Inflammatory Factors and Selenoprotein Genes in the Kidneys of Broiler Chicks.

    PubMed

    Zhang, Jiu-Li; Xu, Bo; Huang, Xiao-Dan; Gao, Yu-Hong; Chen, Yu; Shan, An-Shan

    2016-05-01

    The aim of this study was to investigate the influence of Se deficiency on the transcription of inflammatory factors and selenoprotein genes in the kidneys of broiler chicks. One hundred fifty 1-day-old broiler chicks were randomly assigned to two groups fed with either a low-Se diet (L group, 0.033 mg/kg Se) or an adequate Se diet (C group, 0.2 mg/kg Se). The levels of uric acid (UA) and creatinine (Cr) in the serum and the mRNA levels of 6 inflammatory factors and 25 selenoprotein genes in the kidneys were measured as the clinical signs of Se deficiency occurred at 20 days old. The results indicated that the contents of UA and Cr in the serum increased in L group (p < 0.05), and the mRNA levels of the inflammatory factors (NF-κB, iNOS, COX-2, and TNF-α) increased in L group (p < 0.05). Meanwhile, the mRNA levels of PTGEs and HO-1 were not changed. In addition, 25 selenoprotein transcripts displayed ubiquitous expression in the kidneys of the chicks. The mRNA levels of 14 selenoprotein genes (Dio1, Dio2, GPx3, Sepp1, SelH, SelI, SelK, Sepn1, SelO, SelW, Sep15, SelT, SelU, and SelS) decreased, and 9 selenoprotein genes (GPx1, GPx2, GPx4, SelPb, Txnrd1, Txnrd2, Txnrd3, SPS2, and SelM) increased in L group (p < 0.05), but the Dio3 and Sepx1 mRNA levels did not change. The results indicated that Se deficiency resulted in kidney dysfunction, activation of the NF-κB pathway, and a change in selenoprotein gene expression. The changes of inflammatory factor and selenoprotein gene expression levels were directly related to the abnormal renal functions induced by Se deficiency.

  17. Expression of TaCYP78A3, a gene encoding cytochrome P450 CYP78A3 protein in wheat (Triticum aestivum L.), affects seed size.

    PubMed

    Ma, Meng; Wang, Qian; Li, Zhanjie; Cheng, Huihui; Li, Zhaojie; Liu, Xiangli; Song, Weining; Appels, Rudi; Zhao, Huixian

    2015-07-01

    Several studies have described quantitative trait loci (QTL) for seed size in wheat, but the relevant genes and molecular mechanisms remain largely unknown. Here we report the functional characterization of the wheat TaCYP78A3 gene and its effect on seed size. TaCYP78A3 encoded wheat cytochrome P450 CYP78A3, and was specifically expressed in wheat reproductive organs. TaCYP78A3 activity was positively correlated with the final seed size. Its silencing caused a reduction of cell number in the seed coat, resulting in an 11% decrease in wheat seed size, whereas TaCYP78A3 over-expression induced production of more cells in the seed coat, leading to an 11-48% increase in Arabidopsis seed size. In addition, the cell number in the final seed coat was determined by the TaCYP78A3 expression level, which affected the extent of integument cell proliferation in the developing ovule and seed. Unfortunately, TaCYP78A3 over-expression in Arabidopsis caused a reduced seed set due to an ovule developmental defect. Moreover, TaCYP78A3 over-expression affected embryo development by promoting embryo integument cell proliferation during seed development, which also ultimately affected the final seed size in Arabidopsis. In summary, our results indicated that TaCYP78A3 plays critical roles in influencing seed size by affecting the extent of integument cell proliferation. The present study provides direct evidence that TaCYP78A3 affects seed size in wheat, and contributes to an understanding of the cellular basis of the gene influencing seed development.

  18. Identification of residues of SARS-CoV nsp1 that differentially affect inhibition of gene expression and antiviral signaling.

    PubMed

    Jauregui, Andrew R; Savalia, Dhruti; Lowry, Virginia K; Farrell, Cara M; Wathelet, Marc G

    2013-01-01

    An epidemic of Severe Acute Respiratory Syndrome (SARS) led to the identification of an associated coronavirus, SARS-CoV. This virus evades the host innate immune response in part through the expression of its non-structural protein (nsp) 1, which inhibits both host gene expression and virus- and interferon (IFN)-dependent signaling. Thus, nsp1 is a promising target for drugs, as inhibition of nsp1 would make SARS-CoV more susceptible to the host antiviral defenses. To gain a better understanding of nsp1 mode of action, we generated and analyzed 38 mutants of the SARS-CoV nsp1, targeting 62 solvent exposed residues out of the 180 amino acid protein. From this work, we identified six classes of mutants that abolished, attenuated or increased nsp1 inhibition of host gene expression and/or antiviral signaling. Each class of mutants clustered on SARS-CoV nsp1 surface and suggested nsp1 interacts with distinct host factors to exert its inhibitory activities. Identification of the nsp1 residues critical for its activities and the pathways involved in these activities should help in the design of drugs targeting nsp1. Significantly, several point mutants increased the inhibitory activity of nsp1, suggesting that coronaviruses could evolve a greater ability to evade the host response through mutations of such residues.

  19. The Arabidopsis DELAY OF GERMINATION 1 gene affects ABSCISIC ACID INSENSITIVE 5 (ABI5) expression and genetically interacts with ABI3 during Arabidopsis seed development.

    PubMed

    Dekkers, Bas J W; He, Hanzi; Hanson, Johannes; Willems, Leo A J; Jamar, Diaan C L; Cueff, Gwendal; Rajjou, Loïc; Hilhorst, Henk W M; Bentsink, Leónie

    2016-02-01

    The seed expressed gene DELAY OF GERMINATION (DOG) 1 is absolutely required for the induction of dormancy. Next to a non-dormant phenotype, the dog1-1 mutant is also characterized by a reduced seed longevity suggesting that DOG1 may affect additional seed processes as well. This aspect however, has been hardly studied and is poorly understood. To uncover additional roles of DOG1 in seeds we performed a detailed analysis of the dog1 mutant using both transcriptomics and metabolomics to investigate the molecular consequences of a dysfunctional DOG1 gene. Further, we used a genetic approach taking advantage of the weak aba insensitive (abi) 3-1 allele as a sensitized genetic background in a cross with dog1-1. DOG1 affects the expression of hundreds of genes including LATE EMBRYOGENESIS ABUNDANT and HEAT SHOCK PROTEIN genes which are affected by DOG1 partly via control of ABI5 expression. Furthermore, the content of a subset of primary metabolites, which normally accumulate during seed maturation, was found to be affected in the dog1-1 mutant. Surprisingly, the abi3-1 dog1-1 double mutant produced green seeds which are highly ABA insensitive, phenocopying severe abi3 mutants, indicating that dog1-1 acts as an enhancer of the weak abi3-1 allele and thus revealing a genetic interaction between both genes. Analysis of the dog1 and dog1 abi3 mutants revealed additional seed phenotypes and therefore we hypothesize that DOG1 function is not limited to dormancy but that it is required for multiple aspects of seed maturation, in part by interfering with ABA signalling components.

  20. Exposure of Lactating Dairy Cows to Acute Pre-Ovulatory Heat Stress Affects Granulosa Cell-Specific Gene Expression Profiles in Dominant Follicles

    PubMed Central

    Vanselow, Jens; Vernunft, Andreas; Koczan, Dirk; Spitschak, Marion; Kuhla, Björn

    2016-01-01

    High environmental temperatures induce detrimental effects on various reproductive processes in cattle. According to the predicted global warming the number of days with unfavorable ambient temperatures will further increase. The objective of this study was to investigate effects of acute heat stress during the late pre-ovulatory phase on morphological, physiological and molecular parameters of dominant follicles in cycling cows during lactation. Eight German Holstein cows in established lactation were exposed to heat stress (28°C) or thermoneutral conditions (15°C) with pair-feeding for four days. After hormonal heat induction growth of the respective dominant follicles was monitored by ultrasonography for two days, then an ovulatory GnRH dose was given and follicular steroid hormones and granulosa cell-specific gene expression profiles were determined 23 hrs thereafter. The data showed that the pre-ovulatory growth of dominant follicles and the estradiol, but not the progesterone concentrations tended to be slightly affected. mRNA microarray and hierarchical cluster analysis revealed distinct expression profiles in granulosa cells derived from heat stressed compared to pair-fed animals. Among the 255 affected genes heatstress-, stress- or apoptosis associated genes were not present. But instead, we found up-regulation of genes essentially involved in G-protein coupled signaling pathways, extracellular matrix composition, and several members of the solute carrier family as well as up-regulation of FST encoding follistatin. In summary, the data of the present study show that acute pre-ovulatory heat stress can specifically alter gene expression profiles in granulosa cells, however without inducing stress related genes and pathways and suggestively can impair follicular growth due to affecting the activin-inhibin-follistatin system. PMID:27532452

  1. Pre-Slaughter Stress Affects Ryanodine Receptor Protein Gene Expression and the Water-Holding Capacity in Fillets of the Nile Tilapia

    PubMed Central

    Lara, Jorge A. F.; Gasparino, Eliane; Del Vesco, Ana P.; Goes, Marcio D.; Alexandre Filho, Luiz

    2015-01-01

    Current study evaluated the effect of pre-slaughter stress on serum cortisol levels, pH, colorimetry, water-holding capacity (WHC) and gene expression of ryanodine receptors (RyR1 and RyR3) in the Nile tilapia. A 3x4 factorial scheme experiment was conducted comprising three densities (100, 200, 400 kg/m³) with four transportation times (60, 120, 180, and 240 minutes).Transportation times alone reduced cortisol levels up to 180 minutes, followed by increased WHC and mRNA expression, RyR1 and RyR3 (200 kg/m³ density). No effect of density x transportation time interacted on the evaluated parameters. Results provided the first evidence that pre-slaughter stress affected ryanodine gene expression receptors and, consequently, the water-holding capacity in tilapia fillets. PMID:26053858

  2. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD

    PubMed Central

    De la Cruz, Miguel A.; Pérez-Morales, Deyanira; Palacios, Irene J.; Fernández-Mora, Marcos; Calva, Edmundo; Bustamante, Víctor H.

    2015-01-01

    Salmonella enterica can cause intestinal or systemic infections in humans and animals mainly by the presence of pathogenicity islands SPI-1 and SPI-2, containing 39 and 44 genes, respectively. The AraC-like regulator HilD positively controls the expression of the SPI-1 genes, as well as many other Salmonella virulence genes including those located in SPI-2. A previous report indicates that the two-component system CpxR/A regulates the SPI-1 genes: the absence of the sensor kinase CpxA, but not the absence of its cognate response regulator CpxR, reduces their expression. The presence and absence of cell envelope stress activates kinase and phosphatase activities of CpxA, respectively, which in turn controls the level of phosphorylated CpxR (CpxR-P). In this work, we further define the mechanism for the CpxR/A-mediated regulation of SPI-1 genes. The negative effect exerted by the absence of CpxA on the expression of SPI-1 genes was counteracted by the absence of CpxR or by the absence of the two enzymes, AckA and Pta, which render acetyl-phosphate that phosphorylates CpxR. Furthermore, overexpression of the lipoprotein NlpE, which activates CpxA kinase activity on CpxR, or overexpression of CpxR, repressed the expression of SPI-1 genes. Thus, our results provide several lines of evidence strongly supporting that the absence of CpxA leads to the phosphorylation of CpxR via the AckA/Pta enzymes, which represses both the SPI-1 and SPI-2 genes. Additionally, we show that in the absence of the Lon protease, which degrades HilD, the CpxR-P-mediated repression of the SPI-1 genes is mostly lost; moreover, we demonstrate that CpxR-P negatively affects the stability of HilD and thus decreases the expression of HilD-target genes, such as hilD itself and hilA, located in SPI-1. Our data further expand the insight on the different regulatory pathways for gene expression involving CpxR/A and on the complex regulatory network governing virulence in Salmonella. PMID:26300871

  3. The Shwachman-Bodian-Diamond syndrome associated protein interacts with HsNip7 and its down-regulation affects gene expression at the transcriptional and translational levels

    SciTech Connect

    Hesling, Cedric; Oliveira, Carla C.; Castilho, Beatriz A.; Zanchin, Nilson I.T.

    2007-12-10

    The Shwachman-Bodian-Diamond syndrome (SDS) is an autosomal disorder with pleiotropic phenotypes including pancreatic, skeletal and bone marrow deficiencies and predisposition to hematological dysfunctions. SDS has been associated to mutations in the SBDS gene, encoding a highly conserved protein that was shown to function in ribosome biogenesis in yeast. In this work, we show that SBDS is found in complexes containing the human Nip7 ortholog. Analysis of pre-rRNA processing in a stable SBDS knock-down HEK293-derivative cell line revealed accumulation of a small RNA which is a further indication of SBDS involvement in rRNA biosynthesis. Global transcription and polysome-bound mRNA profiling revealed that SBDS knock-down affects expression of critical genes involved in brain development and function, bone morphogenesis, blood cell proliferation and differentiation, and cell adhesion. Expression of a group of growth and signal transduction factors and of DNA damage response genes is also affected. In SBDS knock-down cells, 34 mRNAs showed decreased and 55 mRNAs showed increased association to polysomes, among which is a group encoding proteins involved in alternative splicing and RNA modification. These results indicate that SBDS is required for accurate expression of genes important for proper brain, skeletal, and blood cell development.

  4. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  5. The parvovirus H-1 NS2 protein affects viral gene expression through sequences in the 3' untranslated region.

    PubMed

    Li, X; Rhode, S L

    1993-05-01

    We reported previously that an NS2 null mutant of parvovirus H-1 (H-1SA) was capable of lytic growth in human and hamster cells, but not in rat cells (Li and Rhode, 1991). The host-range phenotype of H-1SA was also manifested in newborn rats and was associated with a reduction of viral protein synthesis to about 10% of wild-type virus and an absence of virions in cultured rat fibroblasts. However, the H-1SA mRNAs for NS1 and capsid proteins, R1 and R3, accumulated to wild-type levels and translated well with a cell free rabbit reticulocyte lysate. These results indicate that NS2 plays an important role in the regulation of viral protein synthesis in rat cells in vivo and in vitro, but NS2 is largely dispensable in other types of cells, such as human and hamster cells. To analyze whether the 5' and 3' untranslated regions (UTR) of viral RNA are involved in the regulation by NS2, the viral VP2 gene was replaced by a reporter gene, firefly luciferase, in a plasmid clone of viral sequences and the protein synthesis under the control of P38 was evaluated by luciferase assay. Cells were transfected with luciferase expressing plasmids and subsequently infected with wild-type H-1 or H-1SA. We were able to mimic the defect in expression that we observed in cultured cells and animals with virus infection. Luciferase activity in H- 1SA-infected rat cells was about 10-fold lower than that in H-1-infected rat cells, but only 2-fold lower or less in H-1SA-infected human cells and hamster cells compared to wild-type H-1. These results are consistent with our previous data that NS2 has a host-range phenotype in the natural host of H-1, the rat. Deletion of 5' UTR sequences from P38 transcripts reduced the overall P38-luc expression but expression was NS2 independent, whereas deletion of the terminal 3' UTR sequences of viral RNA reduced NS2-dependent expression in rat cells. These results suggest that the regulation of viral protein synthesis by NS2 depends on RNA sequences in the

  6. Forage preservation (grazing vs. hay) fed to ewes affects the fatty acid profile of milk and CPT1B gene expression in the sheep mammary gland

    PubMed Central

    2012-01-01

    Background Alterations in lipid metabolism occur when animals are exposed to different feeding systems. In the last few decades, the characterisation of genes involved in fat metabolism and technological advances have enabled the study of the effect of diet on the milk fatty acid (FA) profile in the mammary gland and aided in the elucidation of the mechanisms of the response to diet. The aim of this study was to evaluate the effect of different forage diets (grazing vs. hay) near the time of ewe parturition on the relationship between the fatty acid profile and gene expression in the mammary gland of the Churra Tensina sheep breed. Results In this study, the forage type affected the C18:2 cis-9 trans-11 (CLA) and long-chain saturated fatty acid (LCFA) content, with higher percentages during grazing than during hay feeding. This may suggest that these FAs act as regulatory factors for the transcriptional control of the carnitine palmitoyltransferase 1B (CPT1B) gene, which was more highly expressed in the grazing group (GRE). The most highly expressed gene in the mammary gland at the fifth week of lactation is CAAT/ enhancer- binding protein beta (CEBPB), possibly due to its role in milk fat synthesis in the mammary gland. More stable housekeeping genes in the ovine mammary gland that would be appropriate for use in gene expression studies were ribosomal protein L19 (RPL19) and glyceraldehyde- 3- phosphate dehydrogenase (GAPDH). Conclusions Small changes in diet, such as the forage preservation (grazing vs. hay), can affect the milk fatty acid profile and the expression of the CPT1B gene, which is associated with the oxidation of fatty acids. When compared to hay fed indoors, grazing fresh low mountain pastures stimulates the milk content of CLA and LCFA via mammary uptake. In this sense, LCFA in milk may be acting as a regulatory factor for transcriptional control of the CPT1B gene, which was more highly expressed in the grazing group. PMID:22776723

  7. Carbohydrate Stress Affecting Fruitlet Abscission and Expression of Genes Related to Auxin Signal Transduction Pathway in Litchi

    PubMed Central

    Kuang, Jian-Fei; Wu, Jian-Yang; Zhong, Hai-Ying; Li, Cai-Qin; Chen, Jian-Ye; Lu, Wang-Jin; Li, Jian-Guo

    2012-01-01

    Auxin, a vital plant hormone, regulates a variety of physiological and developmental processes. It is involved in fruit abscission through transcriptional regulation of many auxin-related genes, including early auxin responsive genes (i.e., auxin/indole-3-acetic acid (AUX/IAA), Gretchen Hagen3 (GH3) and small auxin upregulated (SAUR)) and auxin response factors (ARF), which have been well characterized in many plants. In this study, totally five auxin-related genes, including one AUX/IAA (LcAUX/IAA1), one GH3 (LcGH3.1), one SAUR (LcSAUR1) and two ARFs (LcARF1 and LcARF2), were isolated and characterized from litchi fruit. LcAUX/IAA1, LcGH3.1, LcSAUR1, LcARF1 and LcARF2 contain open reading frames (ORFs) encoding polypeptides of 203, 613, 142, 792 and 832 amino acids, respectively, with their corresponding molecular weights of 22.67, 69.20, 11.40, 88.20 and 93.16 kDa. Expression of these genes was investigated under the treatment of girdling plus defoliation which aggravated litchi fruitlet abscission due to the blockage of carbohydrates transport and the reduction of endogenous IAA content. Results showed that transcript levels of LcAUX/IAA1, LcGH3.1 and LcSAUR1 mRNAs were increased after the treatment in abscission zone (AZ) and other tissues, in contrast to the decreasing accumulation of LcARF1 mRNA, suggesting that LcAUX/IAA1, LcSAUR1 and LcARF1 may play more important roles in abscission. Our results provide new insight into the process of fruitlet abscission induced by carbohydrate stress and broaden our understanding of the auxin signal transduction pathway in this process at the molecular level. PMID:23443112

  8. The synthetic gestagen Levonorgestrel disrupts sexual development in Xenopus laevis by affecting gene expression of pituitary gonadotropins and gonadal steroidogenic enzymes.

    PubMed

    Lorenz, Claudia; Contardo-Jara, Valeska; Trubiroha, Achim; Krüger, Angela; Viehmann, Viola; Wiegand, Claudia; Pflugmacher, Stephan; Nützmann, Gunnar; Lutz, Ilka; Kloas, Werner

    2011-12-01

    In the present study, Xenopus laevis tadpoles were chronically exposed to four concentrations of the synthetic gestagen Levonorgestrel (LNG; 10(-11), 10(-10), 10(-9), and 10(-8)M) starting at Nieuwkoop and Faber (NF) stage 48 until completion of metamorphosis. At NF 58 and 66, brain-pituitary and gonad samples were taken for gene expression analyses of gonadotropins and gonadal steroidogenic enzymes. Exposure to 10(-9) and 10(-8)M LNG until NF 58 repressed messenger RNA (mRNA) expression of luteinizing hormone (LH) β in both genders. This decrease was persistent after further treatment until NF 66 in the 10(-8)M LNG treatment. Expression of follicle-stimulating hormone (FSH) β was affected sex-specifically. No effect was present in NF 58 females, whereas LNG at 10(-9) and 10(-8)M significantly increased FSHβ mRNA levels in males. In NF 66 females, 10(-9)M LNG treatment increased FSHβ gene expression, whereas a decrease was observed in NF 66 males exposed to 10(-8)M LNG. In gonads, expression of steroid-5-alpha-reductase was affected sex-specifically with increased mRNA levels in females but repressed levels in males. Gene expression of further gonadal steroidogenic factors was decreased by 10(-8)M LNG in both genders at NF 66. Assessment of gonad gross morphology and histology revealed poorly developed testes in the 10(-8)M LNG treatment. Our results reveal considerable effects of chronic LNG exposure on sexual development of amphibians. The persistent inhibition of LHβ expression concomitant with decreased mRNA levels of gonadal steroidogenic enzymes is suggested to result in the disruption of reproduction in adult amphibians.

  9. Formation and Deposition of Amylose in the Potato Tuber Starch Granule Are Affected by the Reduction of Granule-Bound Starch Synthase Gene Expression.

    PubMed Central

    Kuipers, AGJ.; Jacobsen, E.; Visser, RGF.

    1994-01-01

    The synthesis of amylose in amyloplasts is catalyzed by granule-bound starch synthase (GBSS). GBSS gene expression was inhibited via antisense RNA in Agrobacterium rhizogenes-transformed potato plants. Analysis of starch production and starch granule composition in transgenic tubers revealed that reduction of GBSS activity always resulted in a reduction of the production of amylose. Field experiments, performed over a 2-year period, showed that stable inhibition of GBSS gene expression can be obtained. Microscopic evaluation of iodine-stained starch granules was shown to be a sensitive system for qualitative and quantitative examination of amylose formation in starch granules of transgenic potato tubers. In plants showing inhibition of GBSS gene expression, the reduced amylose content in tuber starch was not a consequence of a lower amylose content throughout the entire starch granule. Starch granules of transgenic tubers were found to contain amylose at a percentage similar to wild-type starch in a core of varying size at the hilum of each granule. This indicated that reduced GBSS gene expression results in amylose formation in a restricted zone of the granules. The size of this zone is suggested to be dependent on the GBSS protein level. During development of the granules, the available GBSS protein is thought to become limiting, resulting in the formation of starch that lacks amylose. RNA gel blot analysis of tuber tissue showed that inhibition of GBSS gene expression resulted in a reduced GBSS mRNA level but did not affect the expression level of other starch synthesizing enzymes. Antisense RNA could only be detected in leaf tissue of the transgenic plants. PMID:12244219

  10. The Fusarium verticillioides FUM Gene Cluster Encodes a Zn(II)2Cys6 Protein That Affects FUM Gene Expression and Fumonisin Production▿

    PubMed Central

    Brown, Daren W.; Butchko, Robert A. E.; Busman, Mark; Proctor, Robert H.

    2007-01-01

    Fumonisins are mycotoxins produced by some Fusarium species and can contaminate maize or maize products. Ingestion of fumonisins is associated with diseases, including cancer and neural tube defects, in humans and animals. In fungi, genes involved in the synthesis of mycotoxins and other secondary metabolites are often located adjacent to each other in gene clusters. Such genes can encode structural enzymes, regulatory proteins, and/or proteins that provide self-protection. The fumonisin biosynthetic gene cluster includes 16 genes, none of which appear to play a role in regulation. In this study, we identified a previously undescribed gene (FUM21) located adjacent to the fumonisin polyketide synthase gene, FUM1. The presence of a Zn(II)2Cys6 DNA-binding domain in the predicted protein suggested that FUM21 was involved in transcriptional regulation. FUM21 deletion (Δfum21) mutants produce little to no fumonisin in cracked maize cultures but some FUM1 and FUM8 transcripts in a liquid GYAM medium. Complementation of a Δfum21 mutant with a wild-type copy of the gene restored fumonisin production. Analysis of FUM21 cDNAs identified four alternative splice forms (ASFs), and microarray analysis indicated the ASFs were differentially expressed. Based on these data, we present a model for how FUM21 ASFs may regulate fumonisin biosynthesis. PMID:17483290

  11. Maternal epigenetics and methyl supplements affect agouti gene expression in A{sup vy}/a mice

    SciTech Connect

    Wolff, G.L.

    1998-08-01

    Viable yellow (A{sup vy}/a) mice are larger, obese, hyperinsulinemic, more susceptible to cancer, and, on average, shorter lived than their non-yellow siblings. They are epigenetic mosaics ranging from a yellow phenotype with maximum ectopic agouti overexpression, through a continuum of mottled agouti/yellow phenotypes with partial agouti overexpression, to a pseudoagouti phenotype with minimal ectopic expression. Pseudoagouti A{sup vy}/a mice are lean, healthy, and longer lived than their yellow siblings. Here the authors report that feeding pregnant black a/a dams methyl-supplemented diets alters epigenetic regulation of agouti expression in their offspring, as indicated by increased agouti/black mottling in the direction of the pseudoagouti phenotype. They also present confirmatory evidence that epigenetic phenotypes are maternally heritable. Thus A{sup vy} expression, already known to be modulated by imprinting, strain-specific modification, and maternal epigenetic inheritance, is also modulated by maternal diet. These observations suggest, at least in this special case, that maternal dietary supplementation may positively affect health and longevity of the offspring. Therefore, this experimental system should be useful for identifying maternal factors that modulate epigenetic mechanisms, especially DNA methylation, in developing embryos.

  12. Neighboring Genes Show Correlated Evolution in Gene Expression.

    PubMed

    Ghanbarian, Avazeh T; Hurst, Laurence D

    2015-07-01

    When considering the evolution of a gene's expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking.

  13. The expression patterns of the clock genes period and timeless are affected by photoperiod in the Mediterranean corn stalk borer, Sesamia nonagrioides.

    PubMed

    Kontogiannatos, Dimitrios; Gkouvitsas, Theodoros; Kourti, Anna

    2017-01-01

    To obtain clues to the link between the molecular mechanism of circadian and photoperiod clocks, we cloned two circadian clock genes, period (per) and timeless (tim) from the moth Sesamia nonagrioides, which undergoes facultative diapause controlled by photoperiod. Sequence analysis revealed a high degree of conservation among the compared insects fοr both genes. We also investigated the expression patterns of per and tim in brains of larvae growing under 16L:8D (long days), constant darkness (DD) and 10L:14D (short days) conditions by qPCR assays. The results showed that mRNA accumulations encoding both genes exhibited diel oscillations under different photoperiods. The oscillation of per and tim mRNA, under short-day photoperiod differed from long-day. The difference between long-day and short-day conditions in the pattern of mRNA levels of per and tim appears to distinguish photoperiodic conditions clearly and both genes were influenced by photoperiod in different ways. We infer that not all photoperiodic clocks of insects interact with circadian clocks in the same fashion. Our results suggest that transcriptional regulations of the both clock genes act in the diapause programing in S. nonagrioides. The expression patterns of these genes are affected by photoperiod but runs with 24 h by entrainment to daily environmental cues.

  14. An event of alternative splicing affects the expression of the NTRC gene, encoding NADPH-thioredoxin reductase C, in seed plants.

    PubMed

    Nájera, Victoria A; González, María Cruz; Pérez-Ruiz, Juan Manuel; Cejudo, Francisco Javier

    2017-05-01

    The NTRC gene encodes a NADPH-dependent thioredoxin reductase with a joint thioredoxin domain, exclusive of photosynthetic organisms. An updated search shows that although most species harbor a single copy of the NTRC gene, two copies were identified in different species of the genus Solanum, Glycine max and the moss Physcomitrella patens. The phylogenetic analysis of NTRCs from different sources produced a tree with the major groups of photosynthetic organisms: cyanobacteria, algae and land plants, indicating the evolutionary success of the NTRC gene among photosynthetic eukaryotes. An event of alternative splicing affecting the expression of the NTRC gene was identified, which is conserved in seed plants but not in algae, bryophytes and lycophytes. The alternative splicing event results in a transcript with premature stop codon, which would produce a truncated form of the enzyme. The standard splicing/alternative splicing (SS/AS) transcripts ratio was higher in photosynthetic tissues from Arabidopsis, Brachypodium and tomato, in line with the higher content of the NTRC polypeptide in these tissues. Moreover, environmental stresses such as cold or high salt affected the SS/AS ratio of the NTRC gene transcripts in Brachypodium seedlings. These results suggest that the alternative splicing of the NTRC gene might be an additional mechanism for modulating the content of NTRC in photosynthetic and non-photosynthetic tissues of seed plants.

  15. Hypothalamic neuropeptide Y (NPY) gene expression is not affected by central serotonin in the rainbow trout (Oncorhynchus mykiss).

    PubMed

    Mancebo, María J; Ceballos, Francisco C; Pérez-Maceira, Jorge; Aldegunde, Manuel

    2013-09-01

    Mammalian studies have shown a link between serotonin (5-HT) and neuropeptide Y (NPY) in the acute regulation of feeding and energy homeostasis. Taking into account that the actions of 5-HT and NPY on food intake in fish are similar to those observed in mammals, the objective of this study was to characterize a possible short-term interaction between hypothalamic 5-HT and NPY, by examining whether 5-HT regulates NPY gene expression, to help clarify the mechanism underlying the observed anorexigenic action of central 5-HT in the rainbow trout. We used qRT-PCR to determine the levels of NPY mRNA in the hypothalamus-preoptic area (HPA) of rainbow trout after intraperitoneal (i.p.) injection of a single dose of dexfenfluramine (dFF, 3mgkg(-1); 24h-fasted and fed fish) or intracerebroventricular (i.c.v.) administration of 5-HT (100μgkg(-1); 24h-fasted fish). Significant suppression of food intake was observed after administration of 5-HT and dFF. No significant changes in NPY gene expression were obtained 150min after administration of 5-HT or dFF. However, administration of the 5HT1B receptor agonist anpirtoline did not have any significant effect on food intake in rainbow trout. The results suggest that in fish, unlike in mammals, neither the NPY neurons of the HPA nor the 5-HT1B receptor subtype participate in the neural circuitry involved in the inhibition of food intake induced by central serotoninergic activation.

  16. T box RNA decodes both the information content and geometry of tRNA to affect gene expression.

    PubMed

    Grigg, Jason C; Chen, Yujie; Grundy, Frank J; Henkin, Tina M; Pollack, Lois; Ke, Ailong

    2013-04-30

    The T box leader sequence is an RNA element that controls gene expression by binding directly to a specific tRNA and sensing its aminoacylation state. This interaction controls expression of amino acid-related genes in a negative feedback loop. The T box RNA structure is highly conserved, but its tRNA binding mechanism is only partially understood. Known sequence elements are the specifier sequence, which recognizes the tRNA anticodon, and the antiterminator bulge, which base pairs with the tRNA acceptor end. Here, we reveal the crucial function of the highly conserved stem I distal region in tRNA recognition and report its 2.65-Å crystal structure. The apex of this region contains an intricately woven loop-loop interaction between two conserved motifs, the Adenine-guanine (AG) bulge and the distal loop. This loop-loop structure presents a base triple on its surface that is optimally positioned for base-stacking interactions. Mutagenesis, cross-linking, and small-angle X-ray scattering data demonstrate that the apical base triple serves as a binding platform to dock the tRNA D- and T-loops. Strikingly, the binding platform strongly resembles the D- and T-loop binding elements from RNase P and the ribosome exit site, suggesting that this loop-loop structure may represent a widespread tRNA recognition platform. We propose a two-checkpoint molecular ruler model for tRNA decoding in which the information content of tRNA is first examined through specifier sequence-anticodon interaction, and the length of the tRNA anticodon arm is then measured by the distal loop-loop platform. When both conditions are met, tRNA is secured, and its aminoacylation state is sensed.

  17. The diageotropica mutation and synthetic auxins differentially affect the expression of auxin-regulated genes in tomato.

    PubMed Central

    Mito, N; Bennett, A B

    1995-01-01

    The effect of a tomato (Lycopersicon esculentum) mutation, diageotropica (dgt), on the accumulation of mRNA corresponding to tomato homologs of three auxin-regulated genes, LeAux, LeSAUR, and Lepar, was examined. The dgt mutation inhibited the induction of LeAux and LeSAUR mRNA accumulation by naphthalene acetic acid (NAA) but had no effect on NAA-induced Lepar mRNA accumulation. The effect of two synthetic auxins, NAA and 3,7-dichloro-8-quinoline carboxylic acid (quinclorac), on the accumulation of LeAux, LeSAUR, and Lepar mRNA was also examined. Quinclorac induced the expression of each of the auxin-regulated genes, confirming its proposed mode of herbicidal action as an auxin-type herbicide. Concentrations of quinclorac at least 100-fold higher than NAA were required to induce LeAux and LeSAUR mRNA accumulation to similar levels, whereas Lepar mRNA accumulation was induced by similar concentrations of NAA and quinclorac. Collectively, these data suggest the presence of two auxin-dependent signal transduction pathways: one that regulates LeSAUR and LeAux mRNA accumulation and is interrupted by the dgt mutation and a second that regulates Lepar mRNA accumulation and is not defective in dgt tomato hypocotyls. These two auxin-regulated signal transduction pathways can be further discriminated by the action of two synthetic auxins, NAA and quinclorac. PMID:7480327

  18. Short-term UV-B radiation affects photosynthetic performance and antioxidant gene expression in highbush blueberry leaves.

    PubMed

    Inostroza-Blancheteau, Claudio; Acevedo, Patricio; Loyola, Rodrigo; Arce-Johnson, Patricio; Alberdi, Miren; Reyes-Díaz, Marjorie

    2016-10-01

    The impact of increased artificial UV-B radiation on photosynthetic performance, antioxidant and SOD activities and molecular antioxidant metabolism responses in leaves of two highbush blueberry (Vaccinium corymbosum L. cv. Brigitta and Bluegold) genotypes was studied. Plants were grown in a solid substrate and exposed to 0, 0.07, 0.12 and 0.19 W m(-2) of biologically-effective UV-B irradiance for 0-72 h. Our findings show that net photosynthesis (Pn) decreased significantly in Bluegold, accompanied by a reduction in the effective quantum yield (ФPSII) and electron transport rate (ETR), especially at the highest UV-B irradiation. On the other hand, Brigitta showed a better photosynthetic performance, as well as a clear increment in the antioxidant activity response that could be associated with increased superoxide dismutase activity (SOD) in the early hours of induced UV-B stress in all treatments. At the molecular level, the expression of the three antioxidant genes evaluated in both genotypes had a similar tendency. However, ascorbate peroxidase (APX) expression was significantly increased (6-fold) in Bluegold compared to Brigitta. Thus, the reduction of Pn concomitant with a lower photochemical performance and a reduced response of antioxidant metabolism suggest that the Bluegold genotype is more sensitive to UV-B radiation, while Brigitta appears to tolerate better moderate UV-B irradiance in a short-term experiment.

  19. Polychlorinated biphenyl 126 affects expression of genes involved in stress-immune interaction in primary cultures of rainbow trout anterior kidney cells.

    PubMed

    Quabius, Elgar Susanne; Krupp, Guido; Secombes, Christopher J

    2005-12-01

    Stress and immune function are linked in all vertebrates, including teleost fish. Polychlorinated biphenyls (PCBs) are immunotoxic and impair the ability of fish to respond to additional stressors. In this study, we investigated the effects of PCB126 on stress and immune function and the interaction of these systems in fish using primary cultures of rainbow trout anterior kidney cells as a model. Gene expression levels of cytochrome P4501A (CYP1A), interleukin-1beta (IL-1beta), and glucocorticoid receptor (GR) were measured by real-time quantitative polymerase chain reaction. These genes play important roles in detoxification and immune and stress homeostasis, respectively. Incubation with PCB126 led to increased IL-1beta expression between 30 min and 2 h of exposure, with expression back to basal levels after 6 h. Lipopolysaccharide (LPS) incubation evoked normal IL-1beta responses after 2 and 24 h PCB incubation. Gene expression levels of GR and CYP1A increased in a time- and dose-dependent manner, reaching a plateau after 12 h of incubation. Preincubation with cortisol resulted in decreased IL-1beta expression, increased expression of CYP1A and GR, and was accompanied by an abolished PCB responsiveness after more than 4 h of cortisol incubation. We conclude that PCB126 exposure is not "stressful," as increased cortisol levels would result in depressed IL-1beta expression. Incubation with PCB126 evokes a transient stimulation rather than permanent damage of the immune system, as LPS stimulation resulted in increased IL-1beta expression after PCB incubation. Prolonged cortisol preincubation, resembling a chronic stress paradigm, negatively affects the immune responsiveness of the cells as well as their capacity for toxicant metabolization.

  20. RNase E affects the expression of the acyl-homoserine lactone synthase gene sinI in Sinorhizobium meliloti.

    PubMed

    Baumgardt, Kathrin; Charoenpanich, Pornsri; McIntosh, Matthew; Schikora, Adam; Stein, Elke; Thalmann, Sebastian; Kogel, Karl-Heinz; Klug, Gabriele; Becker, Anke; Evguenieva-Hackenberg, Elena

    2014-04-01

    Quorum sensing of Sinorhizobium meliloti relies on N-acyl-homoserine lactones (AHLs) as autoinducers. AHL production increases at high population density, and this depends on the AHL synthase SinI and two transcriptional regulators, SinR and ExpR. Our study demonstrates that ectopic expression of the gene rne, coding for RNase E, an endoribonuclease that is probably essential for growth, prevents the accumulation of AHLs at detectable levels. The ectopic rne expression led to a higher level of rne mRNA and a lower level of sinI mRNA independently of the presence of ExpR, the AHL receptor, and AHLs. In line with this, IPTG (isopropyl-β-D-thiogalactopyranoside)-induced overexpression of rne resulted in a shorter half-life of sinI mRNA and a strong reduction of AHL accumulation. Moreover, using translational sinI-egfp fusions, we found that sinI expression is specifically decreased upon induced overexpression of rne, independently of the presence of the global posttranscriptional regulator Hfq. The 28-nucleotide 5' untranslated region (UTR) of sinI mRNA was sufficient for this effect. Random amplification of 5' cDNA ends (5'-RACE) analyses revealed a potential RNase E cleavage site at position +24 between the Shine-Dalgarno site and the translation start site. We postulate therefore that RNase E-dependent degradation of sinI mRNA from the 5' end is one of the steps mediating a high turnover of sinI mRNA, which allows the Sin quorum-sensing system to respond rapidly to changes in transcriptional control of AHL production.

  1. Expression of the MYB transcription factor gene BplMYB46 affects abiotic stress tolerance and secondary cell wall deposition in Betula platyphylla.

    PubMed

    Guo, Huiyan; Wang, Yucheng; Wang, Liuqiang; Hu, Ping; Wang, Yanmin; Jia, Yuanyuan; Zhang, Chunrui; Zhang, Yu; Zhang, Yiming; Wang, Chao; Yang, Chuanping

    2017-01-01

    Plant MYB transcription factors control diverse biological processes, such as differentiation, development and abiotic stress responses. In this study, we characterized BplMYB46, an MYB gene from Betula platyphylla (birch) that is involved in both abiotic stress tolerance and secondary wall biosynthesis. BplMYB46 can act as a transcriptional activator in yeast and tobacco. We generated transgenic birch plants with overexpressing or silencing of BplMYB46 and subjected them to gain- or loss-of-function analysis. The results suggest that BplMYB46 improves salt and osmotic tolerance by affecting the expression of genes including SOD, POD and P5CS to increase both reactive oxygen species scavenging and proline levels. In addition, BplMYB46 appears to be involved in controlling stomatal aperture to reduce water loss. Overexpression of BplMYB46 increases lignin deposition, secondary cell wall thickness and the expression of genes in secondary cell wall formation. Further analysis indicated that BplMYB46 binds to MYBCORE and AC-box motifs and may directly activate the expression of genes involved in abiotic stress responses and secondary cell wall biosynthesis whose promoters contain these motifs. The transgenic BplMYB46-overexpressing birch plants, which have improved salt and osmotic stress tolerance, higher lignin and cellulose content and lower hemicellulose content than the control, have potential applications in the forestry industry.

  2. Screening to Identify Commonly Used Chinese Herbs That Affect ERBB2 and ESR1 Gene Expression Using the Human Breast Cancer MCF-7 Cell Line

    PubMed Central

    Chang, Chun-Ju; Wu, Jing-Chong; Wen, Che-Sheng; Chen, Jiun-Liang; Chen, Wei-Shone; Shyr, Yi-Ming

    2014-01-01

    Aim. Our aim the was to screen the commonly used Chinese herbs in order to detect changes in ERBB2 and ESR1 gene expression using MCF-7 cells. Methods. Using the MCF-7 human breast cancer cell line, cell cytotoxicity and proliferation were evaluated by MTT and trypan blue exclusion assays, respectively. A luciferase reporter assay was established by transient transfecting MCF-7 cells with plasmids containing either the ERBB2 or the ESR1 promoter region linked to the luciferase gene. Chinese herbal extracts were used to treat the cells at 24 h after transfection, followed by measurement of their luciferase activity. The screening results were verified by Western blotting to measure HER2 and ERα protein expression. Results. At concentrations that induced little cytotoxicity, thirteen single herbal extracts and five compound recipes were found to increase either ERBB2 or ESR1 luciferase activity. By Western blotting, Si-Wu-Tang, Kuan-Shin-Yin, and Suan-Tsao-Ren-Tang were found to increase either HER2 or ERα protein expression. In addition, Ligusticum chuanxiong was shown to have a great effect on ERBB2 gene expression and synergistically with estrogen to stimulate MCF-7 cell growth. Conclusion. Our results provide important information that should affect clinical treatment strategies among breast cancer patients who are receiving hormonal or targeted therapies. PMID:24987437

  3. Epstein-Barr virus IL-10 gene expression by a recombinant murine gammaherpesvirus in vivo enhances acute pathogenicity but does not affect latency or reactivation

    PubMed Central

    2014-01-01

    Background Many viral genes affect cytokine function within infected hosts, with interleukin 10 (IL-10) as a commonly targeted mediator. Epstein-Barr virus (EBV) encodes an IL-10 homologue (vIL-10) expressed during productive (lytic) infection and induces expression of cellular IL-10 (cIL-10) during latency. This study explored the role of vIL-10 in a murine gammaherpesvirus (MHV) model of viral infection. Methods The EBV vIL-10 gene was inserted into MHV-76, a strain which lacks the ability to induce cIL-10, by recombination in transfected mouse cells. Mice were infected intranasally with the recombinant, vIL-10-containing MHV-76 or control virus strains and assayed at various days post infection for lung virus titer, spleen cell number, percentage of latently infected spleen cells and ability to reactivate virus from spleen cells. Results Recombinant murine gammaherpesvirus expressing EBV vIL-10 rose to significantly higher titers in lungs and promoted an increase in spleen cell number in infected mice in comparison to MHV strains lacking the vIL-10 gene. However, vIL-10 expression did not alter the quantity of latent virus in the spleen or its ability to reactivate. Conclusions In this mouse model of gammaherpesvirus infection, EBV vIL-10 appears to influence acute-phase pathogenicity. Given that EBV and MHV wild-type strains contain other genes that induce cIL-10 expression in latency (e.g. LMP-1 and M2, respectively), vIL-10 may have evolved to serve the specific role in acute infection of enlarging the permissive host cell population, perhaps to facilitate initial survival and dissemination of viral-infected cells. PMID:25324959

  4. Low-shear modeled microgravity: a global environmental regulatory signal affecting bacterial gene expression, physiology, and pathogenesis

    NASA Technical Reports Server (NTRS)

    Nickerson, Cheryl A.; Ott, C. Mark; Wilson, James W.; Ramamurthy, Rajee; LeBlanc, Carly L.; Honer zu Bentrup, Kerstin; Hammond, Timothy; Pierson, Duane L.

    2003-01-01

    Bacteria inhabit an impressive variety of ecological niches and must adapt constantly to changing environmental conditions. While numerous environmental signals have been examined for their effect on bacteria, the effects of mechanical forces such as shear stress and gravity have only been investigated to a limited extent. However, several important studies have demonstrated a key role for the environmental signals of low shear and/or microgravity in the regulation of bacterial gene expression, physiology, and pathogenesis [Chem. Rec. 1 (2001) 333; Appl. Microbiol. Biotechnol. 54 (2000) 33; Appl. Environ. Microbiol. 63 (1997) 4090; J. Ind. Microbiol. 18 (1997) 22; Curr. Microbiol. 34(4) (1997) 199; Appl. Microbiol. Biotechnol. 56(3-4) (2001) 384; Infect Immun. 68(6) (2000) 3147; Cell 109(7) (2002) 913; Appl. Environ. Microbiol. 68(11) (2002) 5408; Proc. Natl. Acad. Sci. U. S. A. 99(21) (2002) 13807]. The response of bacteria to these environmental signals, which are similar to those encountered during prokaryotic life cycles, may provide insight into bacterial adaptations to physiologically relevant conditions. This review focuses on the current and potential future research trends aimed at understanding the effect of the mechanical forces of low shear and microgravity analogues on different bacterial parameters. In addition, this review also discusses the use of microgravity technology to generate physiologically relevant human tissue models for research in bacterial pathogenesis.

  5. Low-shear modeled microgravity: a global environmental regulatory signal affecting bacterial gene expression, physiology, and pathogenesis.

    PubMed

    Nickerson, Cheryl A; Ott, C Mark; Wilson, James W; Ramamurthy, Rajee; LeBlanc, Carly L; Höner zu Bentrup, Kerstin; Hammond, Timothy; Pierson, Duane L

    2003-07-01

    Bacteria inhabit an impressive variety of ecological niches and must adapt constantly to changing environmental conditions. While numerous environmental signals have been examined for their effect on bacteria, the effects of mechanical forces such as shear stress and gravity have only been investigated to a limited extent. However, several important studies have demonstrated a key role for the environmental signals of low shear and/or microgravity in the regulation of bacterial gene expression, physiology, and pathogenesis [Chem. Rec. 1 (2001) 333; Appl. Microbiol. Biotechnol. 54 (2000) 33; Appl. Environ. Microbiol. 63 (1997) 4090; J. Ind. Microbiol. 18 (1997) 22; Curr. Microbiol. 34(4) (1997) 199; Appl. Microbiol. Biotechnol. 56(3-4) (2001) 384; Infect Immun. 68(6) (2000) 3147; Cell 109(7) (2002) 913; Appl. Environ. Microbiol. 68(11) (2002) 5408; Proc. Natl. Acad. Sci. U. S. A. 99(21) (2002) 13807]. The response of bacteria to these environmental signals, which are similar to those encountered during prokaryotic life cycles, may provide insight into bacterial adaptations to physiologically relevant conditions. This review focuses on the current and potential future research trends aimed at understanding the effect of the mechanical forces of low shear and microgravity analogues on different bacterial parameters. In addition, this review also discusses the use of microgravity technology to generate physiologically relevant human tissue models for research in bacterial pathogenesis.

  6. Can intermediate-frequency magnetic fields affect memory function-related gene expressions in hippocampus of C57BL/6J mice?

    PubMed

    Win-Shwe, Tin-Tin; Ohtani, Shin; Ushiyama, Akira; Fujimaki, Hidekazu; Kunugita, Naoki

    2013-01-01

    Recently, a cooking appliance based on the principle of electromagnetic induction has come to be used domestically on a widespread basis; this induction heating cooking hob mainly generates intermediate-frequency magnetic fields (IF-MF). However, whether electromagnetic fields originating from household appliances represent a health risk remains uncertain. We investigated the effect of IF-MF on the expressions of memory function-related genes and related transduction molecules in the mouse hippocampus. Male and female C57BL/6J mice were allotted to a control (sham-exposed), an exposure, or a recovery (one week after exposure) group and were exposed to IF-MF (21 kHz, 3.8 mT) one hour per day for 2 weeks. Twenty-four hour after final exposure, the expression levels of memory function-related genes and the mRNA levels for signal transduction pathway molecules in the hippocampi were examined using real-time RT-PCR. The relative mRNA expression levels of the N-methyl-D aspartate (NMDA) receptor subunits NR1, NR2A, and NR2B as well as transcription factors (calcium/calmodulin-dependent protein kinase (CaMK) -IV, cyclic AMP responsive element binding protein (CREB) -1) and neurotrophins (nerve growth factor (NGF), and brain-derived neurotrophic factors (BDNF)) were not significantly altered in the IF-MF-exposed mice. We also examined the morphology of the hippocampus using a histological analysis, but no changes in the IF-MF-exposed mice were seen. This is the first in vivo study to show that IF-MF exposure did not affect the expression levels of memory function-related genes in the hippocampus of C57BL/6J mice. The present findings suggest that IF-MF exposure may not affect cognitive function in the present animal model.

  7. The murine homologue of HIRA, a DiGeorge syndrome candidate gene, is expressed in embryonic structures affected in human CATCH22 patients.

    PubMed

    Wilming, L G; Snoeren, C A; van Rijswijk, A; Grosveld, F; Meijers, C

    1997-02-01

    A wide spectrum of birth defects is caused by deletions of the DiGeorge syndrome chromosomal region at 22q11. Characteristic features include cranio-facial, cardiac and thymic malformations, which are thought to arise form disturbances in the interactions between hindbrain neural crest cells and the endoderm of the pharyngeal pouches. Several genes have been identified in the shortest region of deletion overlap at 22q11, but nothing is known about the expression of these genes in mammalian embryos. We report here the isolation of several murine embryonic cDNAs of the DiGeorge syndrome candidate gene HIRA. We identified several alternatively spliced transcripts. Sequence analysis reveals that Hira bears homology to the p60 subunit of the human Chromatin Assembly Factor I and yeast hir1p and Hir2p, suggesting that Hira might have some role in chromatin assembly and/or histone regulation. Whole mount in situ hybridization of mouse embryos at various stages of development show that Hira is ubiquitously expressed. However, higher levels of transcripts are detected in the cranial neural folds, frontonasal mass, first two pharyngeal arches, circumpharyngeal neural crest and the limb buds. Since many of the structures affected in DiGeorge syndrome derive from these Hira expressing cell populations we propose that haploinsufficiency of HIRA contributes to at least some of the features of the DiGeorge phenotype.

  8. Phytotoxic cyanamide affects maize (Zea mays) root growth and root tip function: from structure to gene expression.

    PubMed

    Soltys, Dorota; Rudzińska-Langwald, Anna; Kurek, Wojciech; Szajko, Katarzyna; Sliwinska, Elwira; Bogatek, Renata; Gniazdowska, Agnieszka

    2014-05-01

    Cyanamide (CA) is a phytotoxic compound produced by four Fabaceae species: hairy vetch, bird vetch, purple vetch and black locust. Its toxicity is due to complex activity that involves the modification of both cellular structures and physiological processes. To date, CA has been investigated mainly in dicot plants. The goal of this study was to investigate the effects of CA in the restriction of the root growth of maize (Zea mays), representing the monocot species. CA (3mM) reduced the number of border cells in the root tips of maize seedlings and degraded their protoplasts. However, CA did not induce any significant changes in the organelle structure of other root cells, apart from increased vacuolization. CA toxicity was also demonstrated by its effect on cell cycle activity, endoreduplication intensity, and modifications of cyclins CycA2, CycD2, and histone HisH3 gene expression. In contrast, the arrangement of microtubules was not altered by CA. Treatment of maize seedlings with CA did not completely arrest mitotic activity, although the frequency of dividing cells was reduced. Furthermore, prolonged CA treatment increased the proportion of endopolyploid cells in the root tip. Cytological malformations were accompanied by an induction of oxidative stress in root cells, which manifested as enhanced accumulation of H2O2. Exposure of maize seedlings to CA resulted in an increased concentration of auxin and stimulated ethylene emission. Taken together, these findings suggested that the inhibition of root growth by CA may be a consequence of stress-induced morphogenic responses.

  9. Integration of H-2Z1, a somatosensory cortex-expressed transgene, interferes with the expression of the Satb1 and Tbc1d5 flanking genes and affects the differentiation of a subset of cortical interneurons.

    PubMed

    Narboux-Nême, Nicolas; Goïame, Rosette; Mattéi, Marie-Geneviève; Cohen-Tannoudji, Michel; Wassef, Marion

    2012-05-23

    H-2Z1 is an enhancer trap transgenic mouse line in which the lacZ reporter delineates the somatosensory area of the cerebral cortex where it is expressed in a subset of layer IV neurons. In the search of somatosensory specific genes or regulatory sequences, we mapped the H-2Z1 transgene insertion site to chromosome 17, 100 and 460 kb away from Tbc1d5 and Satb1 flanking genes. We show here that insertion of the H-2Z1 transgene results in three distinct outcomes. First, a genetic background-sensitive expression of lacZ in several brain and body structures. While four genes in a 1 Mb region around the insertion are expressed in the barrel cortex, H-2Z1 expression resembles more that of its two direct neighbors. Moreover, H-2Z1 closely reports most of the body and brain expression sites of the Satb1 chromatin remodeling gene including tooth buds, thymic epithelium, pontine nuclei, fastigial cerebellar nuclei, and cerebral cortex. Second, the H-2Z1 transgene causes insertional mutagenesis of Tbc1d5 and Satb1, leading to a strong decrease in their expressions. Finally, insertion of H-2Z1 affects the differentiation of a subset of cortical GABAergic interneurons, a possible consequence of downregulation of Satb1 expression. Thus, the H-2Z1 "somatosensory" transgene is inserted in the regulatory landscape of two genes highly expressed in the developing somatosensory cortex and reports for a subdomain of their expression profiles. Together, our data suggest that regulation of H-2Z1 expression results from local and remote genetic interactions.

  10. The absence of Ser389 phosphorylation in p53 affects the basal gene expression level of many p53-dependent genes and alters the biphasic response to UV exposure in mouse embryonic fibroblasts.

    PubMed

    Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J; Zwart, Edwin; van der Hoeven, Tessa V; Pennings, Jeroen L A; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M

    2008-03-01

    Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the underlying cellular processes by time-series analysis of UV-induced gene expression responses in wild-type, p53.S389A, and p53(-/-) mouse embryonic fibroblasts. The absence of p53.S389 phosphorylation already causes small endogenous gene expression changes for 2,253, mostly p53-dependent, genes. These genes showed basal gene expression levels intermediate to the wild type and p53(-/-), possibly to readjust the p53 network. Overall, the p53.S389A mutation lifts p53-dependent gene repression to a level similar to that of p53(-/-) but has lesser effect on p53-dependently induced genes. In the wild type, the response of 6,058 genes to UV irradiation was strictly biphasic. The early stress response, from 0 to 3 h, results in the activation of processes to prevent the accumulation of DNA damage in cells, whereas the late response, from 12 to 24 h, relates more to reentering the cell cycle. Although the p53.S389A UV gene response was only subtly changed, many cellular processes were significantly affected. The early response was affected the most, and many cellular processes were phase-specifically lost, gained, or altered, e.g., induction of apoptosis, cell division, and DNA repair, respectively. Altogether, p53.S389 phosphorylation seems essential for many p53 target genes and p53-dependent processes.

  11. Postnatal exposure to flutamide affects CDH1 and CTNNB1 gene expression in adult pig epididymis and prostate and alters metabolism of testosterone.

    PubMed

    Gorowska, E; Zarzycka, M; Chojnacka, K; Bilinska, B; Hejmej, A

    2014-03-01

    In both epididymis and prostate the dynamic cross-talk between the cells is hormonally regulated and, in part, through direct cell-to-cell interactions. Functionality of the male reproductive organs may be affected by exposure to specific chemicals, so-called 'reprotoxicants'. In this study we tested whether early postnatal and prepubertal exposure to anti-androgen flutamide altered the expression of adherens junction genes encoding E-cadherin (CDH1) and β-catenin (CTNNB1) in adult pig epididymis and prostate. In addition, the expression of mRNAs and proteins for 5α-reductase (ST5AR2) and aromatase (CYP19A1) were examined to show whether flutamide alters metabolism of testosterone. Thus, flutamide was injected into male piglets between Days 2 and 10 and between Days 90 and 98 postnatally (PD2 and PD90; 50 mg/kg bw), tissues that were obtained on postnatal Day 270. To assess the expression of the genes and proteins, real-time RT-PCR and Western blot were performed respectively. Moreover, adherens junction proteins were localized by immunohistochemistry. In response to flutamide, CDH1 and CTNNB1 expressions were down-regulated along the epididymis, mostly in PD2 group (p < 0.001, p < 0.01). In the prostate, CDH1 mRNA and protein expressions were significantly down-regulated (p < 0.01), whereas CTNNB1 mRNA was slightly up-regulated in both flutamide-treated groups. CTNNB1 protein level was markedly elevated in both PD2 (p < 0.001) and PD90 (p < 0.01) groups. In the epididymis, the expression of ST5AR2 and CYP19A1 was down- and up-regulated, respectively (p < 0.05), whereas in the prostate evident decrease in CYP19A1 expression (p < 0.001, p < 0.01, p < 0.05) was demonstrated. In both tissues, membranous immunolocalization of CTNNB1 suggests its involvement in cell-cell adhesion. Overall, flutamide administration resulted in suppression of androgen action in the epididymis and prostate leading to deregulation of CDH1 and CTNNB1 gene expressions which is probably

  12. Impairment of NtAQP1 gene expression in tobacco plants does not affect root colonisation pattern by arbuscular mycorrhizal fungi but decreases their symbiotic efficiency under drought.

    PubMed

    Porcel, Rosa; Gómez, Manuel; Kaldenhoff, Ralf; Ruiz-Lozano, Juan Manuel

    2005-09-01

    We investigated in two tobacco (Nicotiana tabacum) plant lines (wildtype or antisense mutant) whether impairment in expression of the plasma membrane aquaporin gene (NtAQP1) affects the arbuscular mycorrhizal (AM) fungal colonisation pattern or the symbiotic efficiency of AM fungi. These two objectives were investigated under well-watered and drought stress conditions. Both plant lines had a similar pattern of root colonisation under well-watered and drought stress conditions. In contrast, under drought stress, AM wildtype plants grew faster than mycorrhizal antisense plants. Plant gas exchange also appeared to depend on the expression of NtAQP1 and parallelled the determined growth increments. The implications of enhanced symplastic water transport via NtAQP1 for the efficiency of the AM symbiosis under drought stress conditions are further discussed.

  13. Arsenic metabolites affect expression of the neurofilament and tau genes: an in-vitro study into the mechanism of arsenic neurotoxicity.

    PubMed

    Vahidnia, A; van der Straaten, R J H M; Romijn, F; van Pelt, J; van der Voet, G B; de Wolff, F A

    2007-09-01

    Neurological studies indicate that the central (CNS) and peripheral nervous system (PNS) may be affected by arsenic (As). As-exposed patients show significantly lower nerve conduction velocities (NCVs) in their peripheral nerves in comparison to healthy subjects. As may play a role in the disruption of neuroskeletal integrity, but the mechanisms by which it exerts a toxic effect on the peripheral and central nervous system are still unclear. In the present study, we examined the neurotoxic effects of various arsenic metabolites (iAs(III), iAs(V), MMA(V) and DMA(V)) on two different cell lines derived from the peripheral (ST-8814) and central (SK-N-SH) nervous system. The effects of the arsenic metabolites were examined on the relative quantification levels of the cytoskeletal genes, neurofilament-light (NEFL), neurofilament-medium (NEF3), neurofilament-heavy (NEFH) and microtubule-associated protein-tau (MAPT), using real-time PCR. Our results show that iAs(III) and iAs(V) have no significant effects on either cell lines. On the other hand, MMA(V) and DMA(V) cause significant changes in expression levels of NEF3 and NEFL genes, while the expression level of the NEFH gene is significantly increased in both cell lines.

  14. Rice folate enhancement through metabolic engineering has an impact on rice seed metabolism, but does not affect the expression of the endogenous folate biosynthesis genes.

    PubMed

    Blancquaert, Dieter; Van Daele, Jeroen; Storozhenko, Sergei; Stove, Christophe; Lambert, Willy; Van Der Straeten, Dominique

    2013-11-01

    Folates are key-players in one-carbon metabolism in all organisms. However, only micro-organisms and plants are able to synthesize folates de novo and humans rely entirely on their diet as a sole folate source. As a consequence, folate deficiency is a global problem. Although different strategies are currently implemented to fight folate deficiency, up until now, all of them have their own drawbacks. As an alternative and complementary means to those classical strategies, folate biofortification of rice by metabolic engineering was successfully achieved a couple of years ago. To gain more insight into folate biosynthesis regulation and the effect of folate enhancement on general rice seed metabolism, a transcriptomic study was conducted in developing transgenic rice seeds, overexpressing 2 genes of the folate biosynthetic pathway. Upon folate enhancement, the expression of 235 genes was significantly altered. Here, we show that rice folate biofortification has an important effect on folate dependent, seed developmental and plant stress response/defense processes, but does not affect the expression of the endogenous folate biosynthesis genes.

  15. Dietary linseed oil in the maternal diet affects immunoglobulins, tissue fatty acid composition and expression of lipid metabolism-related genes in piglets.

    PubMed

    Chen, X L; Wang, N; Tian, M L; Wang, L; Liu, T; Zhang, X W; Shi, B M; Shan, A S

    2016-11-21

    This experiment investigated the effects of supplementing the maternal diet with linseed oil (LSO) and soya bean oil (SBO) on immunoglobulins, the fatty acid composition and hepatic expression of lipid metabolism-related genes in piglets. Multiparous sows (twenty-four per diet) were fed on diets containing a supplement of either SBO or LSO during last week of gestation and lactation. The results indicated that supplementation of maternal diet with LSO could improve the weaning weight of piglets and average daily gain (ADG) (p < 0.05). The concentration of immunoglobulin G (IgG) and immunoglobulin A (IgA) was enhanced in sow plasma, colostrum and milk by the addition of LSO (p < 0.05). In addition, the concentration of 18: 3n-3 fatty acids was higher in the milk of LSO sows. Meanwhile, maternal supplementation with LSO increased the levels of plasma IgG, IgA and the tissues n-3 polyunsaturated fatty acid (PUFA) in piglets (p < 0.05). Correspondingly, the mRNA expression levels of hepatic ∆5-desaturase (D5D) and ∆6-desaturase (D6D) were higher, and fatty acid synthase (FAS) was lower in piglets from LSO-fed sows when compared with that in the SBO group. In conclusion, LSO supplementation of the maternal diet increases immunoglobulins, modifies the fatty acid composition and affects the gene of D5D and D6D expression of piglets.

  16. Colored light-quality selective plastic films affect anthocyanin content, enzyme activities, and the expression of flavonoid genes in strawberry (Fragaria × ananassa) fruit.

    PubMed

    Miao, Lixiang; Zhang, Yuchao; Yang, Xiaofang; Xiao, Jinping; Zhang, Huiqin; Zhang, Zuofa; Wang, Yuezhi; Jiang, Guihua

    2016-09-15

    The influence of colored light-quality selective plastic films (red, yellow, green, blue, and white) on the content of anthocyanin, the activities of the related enzymes and the transcripts of the flavonoid gene was studied in developing strawberry fruit. The results indicated that colored films had highly significant effects on the total anthocyanin content (TAC) and proportions of individual anthocyanins. Compared with the white control film, the red and yellow films led to the significant increase of TAC, while the green and blue films caused a decrease of TAC. Colored film treatments also significantly affected the related enzyme activity and the expression of structural genes and transcription factor genes, which suggested that the enhancement of TAC by the red and yellow films might have resulted from the activation of related enzymes and transcription factor genes in the flavonoid pathway. Treatment with red and yellow light-quality selective plastic films might be useful as a supplemental cultivation practice for enhancing the anthocyanin content in developing strawberry fruit.

  17. The expression of Hedgehog genes (Ihh, Dhh) and Hedgehog target genes (Ptc1, Gli1, Coup-TfII) is affected by estrogenic stimuli in the uterus of immature female rats

    SciTech Connect

    Katayama, Seiichi . E-mail: katayama@ankaken.co.jp; Ashizawa, Koji; Gohma, Hiroshi; Fukuhara, Tadahiro; Narumi, Kazunori; Tsuzuki, Yasuhiro; Tatemoto, Hideki; Nakada, Tadashi; Nagai, Kenji

    2006-12-15

    The objective of this study was to investigate the effects of estrogen receptor (ER) agonists and an ER antagonist on the expression of Hedgehog genes (Indian hedgehog: Ihh; Desert hedgehog: Dhh) and Hedgehog target genes (Patched 1: Ptc1; glioma-associated oncogene homolog 1: Gli1; chicken ovalbumin upstream promoter transcription factor II: Coup-TfII) in the rat uterus. Immature female rats were administered once with 17{alpha}-ethynyl estradiol (EE, an ER agonist), propyl pyrazole triole (PPT, an ER{alpha}-selective agonist), diarylpropionitrile (DPN, an ER{beta}-selective agonist), or ICI 182,780 (an ER antagonist). Expression of mRNA for Ihh, Dhh, and Ptc1 was dose-dependently downregulated by EE in the uterus of immature rats, mediated by ER as confirmed by coadministration of ICI 182,780. The mRNA expression levels of Ptc1, Gli1, and Coup-TfII were simultaneously downregulated during the period in which the mRNA expression levels of Ihh and Dhh were downregulated in the uterus after administration of EE. PPT downregulated the transcription of Ihh, Dhh, Ptc1, Gli1, and Coup-TfII, indicating that expression of these genes was regulated by the ER{alpha}-dependent pathway. DPN also downregulated the transcription of Ihh and Dhh, although the effect was weaker than that of PPT, indicating that the regulation of uterine Ihh and Dhh transcription was also affected by the ER{beta}-dependent pathway. These results suggest that the expression of Hedgehog genes (Ihh, Dhh) and Hedgehog target genes (Ptc1, Gli1, Coup-TfII) is affected by estrogenic stimuli in the uterus of immature female rats.

  18. Ectopic expression a tomato KNOX Gene Tkn4 affects the formation and the differentiation of meristems and vasculature.

    PubMed

    Yan, Fang; Hu, Guojian; Ren, Zhenxin; Deng, Wei; Li, Zhengguo

    2015-12-01

    The KNOTTED-LIKE HOMEODOMAIN genes are involved in maintenance of the shoot apical meristem which produces the whole above-ground body of vascular plants. In this report, a tomato homolog gene, named as Tkn4 (a nucleus targeted transcription factor) was identified and characterized. By performing RT-PCR, the transcript level of Tkn4 was separately found in stem, root, stamen, stigma, fruit and sepal but hardly visible in the leaf. Besides, Tkn4 was induced by a series of plant hormones. Overexpression of Tkn4 gene in tomato resulted in dwarf phenotype and strongly repressed the formation of shoot apical meristem, lateral meristem and cambiums in transgenic lines. The transgenic lines had wrinkled leaves and anatomic analysis showed that there was no obvious palisade tissues in the leaves and the layer of cells changed in vascular tissue (xylem and phloem). To explore the regulation network of Tkn4, RNA-sequencing was performed in overexpression lines and wild type plants, by which many genes related to the synthesis and the signal transduction of cytokinin, auxin, gibberellin, ethylene, abscisic acid, and tracheary element differentiation or extracellular matrix synthesis were significantly regulated. Taken together, our results demonstrate that Tkn4 plays important roles in regulating the biosynthesis and signal transduction of diverse plant hormones, and the formation and differentiation of meristems and vasculature in tomato.

  19. Dietary lysine affected the expression of genes related to lipid metabolism in skeletal muscle of finishing pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    It has been reported that some amino acids can function as signaling molecules to regulate skeletal muscle growth in mammals. This study was conducted to identify those genes that may be regulated by amino acid lysine and responsible for muscle growth and meat quality of pigs. Nine crossbred barrows...

  20. Increasing levels of dietary crystalline methionine affect plasma methionine profiles, ammonia excretion, and the expression of genes related to the hepatic intermediary metabolism in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Rolland, Marine; Skov, Peter V; Larsen, Bodil K; Holm, Jørgen; Gómez-Requeni, Pedro; Dalsgaard, Johanne

    2016-08-01

    Strictly carnivorous fish with high requirements for dietary protein, such as rainbow trout (Oncorhynchus mykiss) are interesting models for studying the role of amino acids as key regulators of intermediary metabolism. Methionine is an essential amino acid for rainbow trout, and works as a signalling factor in different metabolic pathways. The study investigated the effect of increasing dietary methionine intake on the intermediary metabolism in the liver of juvenile rainbow trout. For this purpose, five diets were formulated with increasing methionine levels from 0.60 to 1.29% dry matter. The diets were fed in excess for six weeks before three sampling campaigns carried out successively to elucidate (i) the hepatic expression of selected genes involved in lipid, glucose and amino acid metabolism; (ii) the postprandial ammonia excretion; and (iii) the postprandial plasma methionine concentrations. The transcript levels of enzymes involved in lipid metabolism (fatty acid synthase, glucose 6 phosphate dehydrogenase and carnitine palmitoyl transferase 1 a), gluconeogenesis (fructose-1,6-biphosphatase) and amino acid catabolism (alanine amino transferase and glutamate dehydrogenase) were significantly affected by the increase in dietary methionine. Changes in gene expression reflected to some extent the decrease in ammonia excretion (P=0.022) and in the hepatosomatic index (HSI; P<0.001) when dietary methionine increased. Postprandial plasma methionine concentrations correlated positively with the dietary level (P<0.001) at the different sampling points. The study shows that the expression of several genes related to the hepatic intermediary metabolism in rainbow trout responded in a dose-dependent manner to increasing levels of dietary methionine.

  1. Down-regulation of muscarinic acetylcholine receptor M2 adversely affects the expression of Alzheimer's disease-relevant genes and proteins.

    PubMed

    Zuchner, Thole; Schliebs, Reinhard; Perez-Polo, J Regino

    2005-10-01

    Beta-amyloid peptides play a major role in the pathogenesis of Alzheimer's disease (AD). Therefore, preventing beta-amyloid formation by inhibition of the beta site amyloid precursor protein-cleaving enzyme (BACE) 1 is considered as a potential strategy to treat AD. Cholinergic mechanisms have been shown to control amyloid precursor protein processing and the number of muscarinic M2-acetylcholine receptors is decreased in brain regions of patients with AD enriched with senile plaques. Therefore, the present study investigates the effect of this M2 muscarinic receptor down-regulation by siRNA on total gene expression and on regulation of BACE1 in particular in SK-SH-SY5Y cells. This model system was used for microarray analysis after carbachol stimulation of siRNA-treated cells compared with carbachol stimulated, non-siRNA-treated cells. The same model system was used to elucidate changes at the protein level by using two-dimensional gels followed by Matrix Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF) analysis. Taken together, the results indicate that the M2 acetylcholine receptor down-regulation in brains of patients with AD has important effects on the expression of several genes and proteins with major functions in the pathology of AD. This includes beta-secretase BACE1 as well as several modulators of the tau protein and other AD-relevant genes and proteins. Moreover, most of these genes and proteins are adversely affected against the background of AD.

  2. Selenoprotein Gene Expression in Thyroid and Pituitary of Young Pigs Is Not Affected by Dietary Selenium Deficiency or Excess1–3

    PubMed Central

    Zhou, Ji-Chang; Zhao, Hua; Li, Jun-Gang; Xia, Xin-Jie; Wang, Kang-Ning; Zhang, Ya-Jun; Liu, Yan; Zhao, Ying; Lei, Xin Gen

    2009-01-01

    Expression and function of selenoproteins in endocrine tissues remain unclear, largely due to limited sample availability. Pigs have a greater metabolic similarity and tissue size than rodents as a model of humans for that purpose. We conducted 2 experiments: 1) we cloned 5 novel porcine selenoprotein genes; and 2) we compared the effects of dietary selenium (Se) on mRNA levels of 12 selenoproteins, activities of 4 antioxidant enzymes, and Se concentrations in testis, thyroid, and pituitary with those in liver of pigs. In Experiment 1, porcine Gpx2, Sephs2, Sep15, Sepn1, and Sepp1 were cloned and demonstrated 84–94% of coding sequence homology to human genes. In Experiment 2, weanling male pigs (n = 30) were fed a Se-deficient (0.02 mg Se/kg) diet added with 0, 0.3, or 3.0 mg Se/kg as Se-enriched yeast for 8 wk. Although dietary Se resulted in dose-dependent increases (P < 0.05) in Se concentrations and GPX activities in all 4 tissues, it did not affect the mRNA levels of any selenoprotein gene in thyroid or pituitary. Testis mRNA levels of Txnrd1 and Sep15 were decreased (P < 0.05) by increasing dietary Se from 0.3 to 3.0 mg/kg. Comparatively, expressions of Gpx2, Gpx4, Dio3, and Sep15 were high in pituitary and Dio1, Sepp1, Sephs2, and Gpx1 were high in liver. In conclusion, the mRNA abundances of the 12 selenoprotein genes in thyroid and pituitary of young pigs were resistant to dietary Se deficiency or excess. PMID:19357213

  3. Cinnamon polyphenol extract affects immune responses by regulating anti- and proinflammatory and glucose transporter gene expression in mouse macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tristetraprolin (TTP/TIS11/ZFP36) family proteins have anti-inflammatory effects by polyphenoldestabilizing pro-inflammatory mRNAs. TTP expression is induced by insulin and cinnamon extract (CPE) in adipocytes, by lipopolysaccharide (LPS) in macrophages, and by green tea extract in rats. This study ...

  4. Aging and walnut-rich diet supplementation affects the expression of immediate-early genes in critical brain regions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emerging evidence indicates a direct link between age-associated changes in epigenetic mechanisms and onset of neurodegenerative diseases, and that these genomic modulations are directly affected by diet. Diets deficient in folate, choline and methionine, or the trace elements zinc and selenium, are...

  5. Alterations in Seed Development Gene Expression Affect Size and Oil Content of Arabidopsis Seeds1[C][W][OPEN

    PubMed Central

    Fatihi, Abdelhak; Zbierzak, Anna Maria; Dörmann, Peter

    2013-01-01

    Seed endosperm development in Arabidopsis (Arabidopsis thaliana) is under control of the polycomb group complex, which includes Fertilization Independent Endosperm (FIE). The polycomb group complex regulates downstream factors, e.g. Pheres1 (PHE1), by genomic imprinting. In heterozygous fie mutants, an endosperm develops in ovules carrying a maternal fie allele without fertilization, finally leading to abortion. Another endosperm development pathway depends on MINISEED3 (a WRKY10 transcription factor) and HAIKU2 (a leucine-rich repeat kinase). While the role of seed development genes in the embryo and endosperm establishment has been studied in detail, their impact on metabolism and oil accumulation remained unclear. Analysis of oil, protein, and sucrose accumulation in mutants and overexpression plants of the four seed development genes revealed that (1) seeds carrying a maternal fie allele accumulate low oil with an altered composition of triacylglycerol molecular species; (2) homozygous mutant seeds of phe1, mini3, and iku2, which are smaller, accumulate less oil and slightly less protein, and starch, which accumulates early during seed development, remains elevated in mutant seeds; (3) embryo-specific overexpression of FIE, PHE1, and MINI3 has no influence on seed size and weight, nor on oil, protein, or sucrose content; and (4) overexpression of IKU2 results in seeds with increased size and weight, and oil content of overexpressed IKU2 seeds is increased by 35%. Thus, IKU2 overexpression represents a novel strategy for the genetic manipulation of the oil content in seeds. PMID:24014578

  6. Iron Supply Affects Anthocyanin Content and Related Gene Expression in Berries of Vitis vinifera cv. Cabernet Sauvignon.

    PubMed

    Shi, Pengbao; Li, Bing; Chen, Haiju; Song, Changzheng; Meng, Jiangfei; Xi, Zhumei; Zhang, Zhenwen

    2017-02-14

    Anthocyanins are important compounds for red grape and red wine quality, and can be influenced by supply of nutrients such as nitrogen, phosphorus, potassium, zinc, and iron. The present work aims to gain a better understanding of the effect of iron supply on anthocyanins concentration in grape berries. To this end, own-rooted four-year-old Cabernet Sauvignon grapevines (Vitis vinifera) were fertigated every three days with 0, 23, 46, 92, and 184 μM iron (Fe) from ferric ethylenediamine di (o-hydroxyphenylacetic) acid (Fe-EDDHA) in a complete nutrient solution. Fe deficiency or excess generally led to higher concentrations of titratable acidity and skin/berry ratio, and to lower reducing sugar content, sugar/acid ratio, pH, berry weight, and concentration of anthocyanins. Most of the individual anthocyanins detected in this study, except cyanidin-3-O-glucoside, delphinidin-3-O-glucoside, and cyanidin-3-O-(6-O-coumaryl)-glucoside, in moderate Fe treatment (46 μM) grapes were significantly higher than those of other treatments. Genes encoding chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), leucoanthocyanidin dioxygenase (LDOX), and anthocyanin O-methyltransferase (AOMT) exhibited higher transcript levels in berries from plants cultivated with 46 μM Fe compared to the ones cultivated with other Fe concentrations. We suggest that grape sugar content, anthocyanins content, and transcriptions of genes involved in anthocyanin biosynthesis were correlated with Fe supply concentrations.

  7. Exposure time to caffeine affects heartbeat and cell damage-related gene expression of zebrafish Danio rerio embryos at early developmental stages.

    PubMed

    Abdelkader, Tamer Said; Chang, Seo-Na; Kim, Tae-Hyun; Song, Juha; Kim, Dong Su; Park, Jae-Hak

    2013-11-01

    Caffeine is white crystalline xanthine alkaloid that is naturally found in some plants and can be produced synthetically. It has various biological effects, especially during pregnancy and lactation. We studied the effect of caffeine on heartbeat, survival and the expression of cell damage related genes, including oxidative stress (HSP70), mitochondrial metabolism (Cyclin G1) and apoptosis (Bax and Bcl2), at early developmental stages of zebrafish embryos. We used 100 µm concentration based on the absence of locomotor effects. Neither significant mortality nor morphological changes were detected. We monitored hatching at 48 h post-fertilization (hpf) to 96 hpf. At 60 and 72 hpf, hatching decreased significantly (P < 0.05); however, the overall hatching rate at 96 hpf was 94% in control and 93% in caffeine treatment with no significant difference (P > 0.05). Heartbeats per minute were 110, 110 and 112 in control at 48, 72 and 96 hpf, respectively. Caffeine significantly increased heartbeat - 122 and 136 at 72 and 96 hpf, respectively. Quantitative RT-PCR showed significant up-regulation after caffeine exposure in HSP70 at 72 hpf; in Cyclin G1 at 24, 48 and 72 hpf; and in Bax at 48 and 72 hpf. Significant down-regulation was found in Bcl2 at 48 and 72 hpf. The Bax/Bcl2 ratio increased significantly at 48 and 72 hpf. We conclude that increasing exposure time to caffeine stimulates oxidative stress and may trigger apoptosis via a mitochondrial-dependent pathway. Also caffeine increases heartbeat from early phases of development without affecting the morphology and survival but delays hatching. Use of caffeine during pregnancy and lactation may harm the fetus by affecting the expression of cell-damage related genes.

  8. Testosterone Affects Neural Gene Expression Differently in Male and Female Juncos: A Role for Hormones in Mediating Sexual Dimorphism and Conflict

    PubMed Central

    Peterson, Mark P.; Rosvall, Kimberly A.; Choi, Jeong-Hyeon; Ziegenfus, Charles; Tang, Haixu; Colbourne, John K.; Ketterson, Ellen D.

    2013-01-01

    Despite sharing much of their genomes, males and females are often highly dimorphic, reflecting at least in part the resolution of sexual conflict in response to sexually antagonistic selection. Sexual dimorphism arises owing to sex differences in gene expression, and steroid hormones are often invoked as a proximate cause of sexual dimorphism. Experimental elevation of androgens can modify behavior, physiology, and gene expression, but knowledge of the role of hormones remains incomplete, including how the sexes differ in gene expression in response to hormones. We addressed these questions in a bird species with a long history of behavioral endocrinological and ecological study, the dark-eyed junco (Junco hyemalis), using a custom microarray. Focusing on two brain regions involved in sexually dimorphic behavior and regulation of hormone secretion, we identified 651 genes that differed in expression by sex in medial amygdala and 611 in hypothalamus. Additionally, we treated individuals of each sex with testosterone implants and identified many genes that may be related to previously identified phenotypic effects of testosterone treatment. Some of these genes relate to previously identified effects of testosterone-treatment and suggest that the multiple effects of testosterone may be mediated by modifying the expression of a small number of genes. Notably, testosterone-treatment tended to alter expression of different genes in each sex: only 4 of the 527 genes identified as significant in one sex or the other were significantly differentially expressed in both sexes. Hormonally regulated gene expression is a key mechanism underlying sexual dimorphism, and our study identifies specific genes that may mediate some of these processes. PMID:23613935

  9. Replacement of dietary fish oil by vegetable oils affects humoral immunity and expression of pro-inflammatory cytokines genes in gilthead sea bream Sparus aurata.

    PubMed

    Montero, D; Mathlouthi, F; Tort, L; Afonso, J M; Torrecillas, S; Fernández-Vaquero, A; Negrin, D; Izquierdo, M S

    2010-12-01

    Commercial gilthead sea bream feeds are highly energetic, fish oil traditionally being the main lipid source. But the decreased fish oil production together with the increased prices of this oil encourages its substitution by vegetable oils, imposing new nutritional habits to aquaculture species. Partial replacement of fish oil by vegetable oils in diets for marine species allows good feed utilization and growth but may affect fish health, since imbalances in dietary fatty acids may alter fish immunological status. The effect of dietary oils on different aspects of fish immune system has been reported for some species, but very little is known about the effect of dietary oils on immune-related genes expression in fish. Thus, the objective of this study was to elucidate the role of dietary oils on the expression of two pro-inflammatory cytokines, Tumor Necrosis Factor-α (TNF-α) and Interleukine 1β (IL-1β) on intestine and head kidney after exposure to the bacterial pathogen Photobacterium damselae sp. piscicida. For that purpose, 5 iso-nitrogenous and iso-lipidic diets (45% crude protein, 22% crude lipid content) were formulated. Anchovy oil was the only lipid source used in the control diet (FO), but in the other diets, fish oil was totally (100%) or partially (70%) substituted by linseed (rich in n-3 fatty acids) or soybean (rich in n-6 fatty acids) (100L, 100S, 70L, 70S). Fish were fed experimental diets during 80 days and after this period were exposed to an experimental intestinal infection with the pathogen. Serum and tissue samples were obtained at pre-infection and after 1, 3 and 7 days of infection. RNA was extracted and cDNA was synthesized by reverse transcription from intestine and head kidney and the level expression of TNF-α and IL-1β were assayed by using quantitative real time PCR. The expression level of genes analysed was represented as relative value, using the comparative Ct method (2(-ΔΔCt)). Serum anti-bacterial activity was measured as

  10. Cadmium exposure affects mitochondrial bioenergetics and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica Gmelin (Bivalvia: Ostreidae).

    PubMed

    Sokolova, Inna M; Sokolov, Eugene P; Ponnappa, Kavita M

    2005-07-01

    Cadmium is a ubiquitous and extremely toxic metal, which strongly affects mitochondrial function of aquatic organisms in vitro; however, nothing is known about the in vivo effects of sublethal concentrations of this metal on mitochondrial bioenergetics. We have studied the effects of exposure to 0 (control) or 25 microg L-1 (Cd-exposed) Cd2+ on mitochondrial function and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica. Cadmium exposure in vivo resulted in considerable accumulation of cadmium in oyster mitochondria and in a significant decrease of ADP-stimulated respiration (state 3) by 30% indicating impaired capacity for ATP production. The decrease in state 3 respiration was similar to the level of inhibition expected from the direct effects of cadmium accumulated in oyster mitochondria. On the other hand, while no effect on proton leak was expected based on the mitochondrial accumulation of cadmium, Cd-exposed oysters in fact showed a significant decline of the proton leak rate (state 4+respiration) by 40%. This suggested a downregulation of proton leak, which correlated with a decrease in mRNA expression of a mitochondrial uncoupling protein UCP6 and two other potential uncouplers, mitochondrial substrate carriers MSC-1 and MSC-2. Expression of other key mitochondrial proteins including cytochrome c oxidase, adenine nucleotide transporter and voltage dependent anion channel was not affected by cadmium exposure. Adenylate energy charge (AEC) was significantly lower in Cd-exposed oysters; however, this was due to higher steady state ADP levels and not to the decrease in tissue ATP levels. Our data show that adjustment of the proton leak in cadmium-exposed oysters may be a compensatory mechanism, which allows them to maintain normal mitochondrial coupling and ATP levels despite the cadmium-induced inhibition of capacity for ATP production.

  11. P elements inserted in the vicinity of or within the Drosophila snRNP SmD3 gene nested in the first intron of the Ornithine Decarboxylase Antizyme gene affect only the expression of SmD3.

    PubMed Central

    Schenkel, Heide; Hanke, Susanne; De Lorenzo, Cécilia; Schmitt, Rolf; Mechler, Bernard M

    2002-01-01

    The Drosophila gene for snRNP SmD3 (SmD3) is contained in reverse orientation within the first intron of the Ornithine Decarboxylase Antizyme (AZ) gene. Previous studies show that two closely linked P elements cause the gutfeeling phenotype characterized by embryonic lethality and aberrant neuronal and muscle cell differentiation. However, the exact nature of the gene(s) affected in the gutfeeling phenotype remained unknown. This study shows that a series of P inserts located within the 5'-untranslated region (5'-UTR) of SmD3 or its promoter affects only the expression of SmD3. Our analysis reveals that the gutfeeling phenotype associated with P elements inserted in the 5'-UTR of SmD3 results from amorphic or strongly hypomorphic mutations. In contrast, P inserts in the SmD3 promoter region reduce the expression of SmD3 without abolishing it and produce larval lethality with overgrown imaginal discs, brain hemispheres, and hematopoietic organs. The lethality of these mutations could be rescued by an SmD3+ transgene. Finally, inactivation of AZ was obtained by complementing with SmD3+ the deficiency Df(2R)guf(lex47) that uncovers both SmD3 and AZ. Interestingly, AZ inactivation causes a new phenotype characterized by late larval lethality and atrophy of the brain, imaginal discs, hematopoietic organs, and salivary glands. PMID:12072471

  12. Molecular insights into how a deficiency of amylose affects carbon allocation – carbohydrate and oil analyses and gene expression profiling in the seeds of a rice waxy mutant

    PubMed Central

    2012-01-01

    Background Understanding carbon partitioning in cereal seeds is of critical importance to develop cereal crops with enhanced starch yields for food security and for producing specified end-products high in amylose, β-glucan, or fructan, such as functional foods or oils for biofuel applications. Waxy mutants of cereals have a high content of amylopectin and have been well characterized. However, the allocation of carbon to other components, such as β-glucan and oils, and the regulation of the altered carbon distribution to amylopectin in a waxy mutant are poorly understood. In this study, we used a rice mutant, GM077, with a low content of amylose to gain molecular insight into how a deficiency of amylose affects carbon allocation to other end products and to amylopectin. We used carbohydrate analysis, subtractive cDNA libraries, and qPCR to identify candidate genes potentially responsible for the changes in carbon allocation in GM077 seeds. Results Carbohydrate analysis indicated that the content of amylose in GM077 seeds was significantly reduced, while that of amylopectin significantly rose as compared to the wild type BP034. The content of glucose, sucrose, total starch, cell-wall polysaccharides and oil were only slightly affected in the mutant as compared to the wild type. Suppression subtractive hybridization (SSH) experiments generated 116 unigenes in the mutant on the wild-type background. Among the 116 unigenes, three, AGP, ISA1 and SUSIBA2-like, were found to be directly involved in amylopectin synthesis, indicating their possible roles in redirecting carbon flux from amylose to amylopectin. A bioinformatics analysis of the putative SUSIBA2-like binding elements in the promoter regions of the upregulated genes indicated that the SUSIBA2-like transcription factor may be instrumental in promoting the carbon reallocation from amylose to amylopectin. Conclusion Analyses of carbohydrate and oil fractions and gene expression profiling on a global scale in the

  13. Expression pattern of cellulolytic and xylanolytic genes regulated by transcriptional factors XYR1 and CRE1 are affected by carbon source in Trichoderma reesei.

    PubMed

    Castro, Lilian dos Santos; Antoniêto, Amanda Cristina Campos; Pedersoli, Wellington Ramos; Silva-Rocha, Rafael; Persinoti, Gabriela F; Silva, Roberto Nascimento

    2014-03-01

    Trichoderma reesei is the most important fungus for the industrial production of enzymes to biomass deconstruction. Most of the genes encoding cellulases and hemicellulases are regulated by the transcription factors CRE1 and XYR1. In this work, the regulation of 22 genes of cellulases and xylanases by these transcription factors was investigated under three different carbon sources. Analysis of gene expression and enzymatic profiles of CMCase, β-glucosidase, and xylanases showed different regulation that was depended of the carbon source in both Δxyr1 and Δcre1 mutants. In the presence of glucose, the majority of genes evaluated (82%) showed increased expression levels in the Δcre1 mutant compared to the parental QM9414 strain. In the Δxyr1 mutant, it was observed that expression of cellulase and xylanase genes was reduced compared to the parental QM9414 strain, when cultured in the presence of cellulose or sophorose. Interesting, in the presence of glucose, approximately 60% of the analyzed genes had increased expression in the Δxyr1 mutant compared to parental strain. Furthermore, no correlation between gene expression and the number of putative binding sites of XYR1 and CRE1 to promoter region of cellulolytic and xylanolytic studied genes was observed. Therefore, these results demonstrated that the regulation of cellulase and xylanase by the transcription factors CRE1 and XYR1 is influenced by different carbon sources.

  14. Egg storage duration and hatch window affect gene expression of nutrient transporters and intestine morphological parameters of early hatched broiler chicks.

    PubMed

    Yalcin, S; Gursel, I; Bilgen, G; Izzetoglu, G T; Horuluoglu, B H; Gucluer, G

    2016-05-01

    In recent years, researchers have given emphasis on the differences in physiological parameters between early and late hatched chicks within a hatch window. Considering the importance of intestine development in newly hatched chicks, however, changes in gene expression of nutrient transporters in the jejunum of early hatched chicks within a hatch window have not been studied yet. This study was conducted to determine the effects of egg storage duration before incubation and hatch window on intestinal development and expression of PepT1 (H+-dependent peptide transporter) and SGLT1 (sodium-glucose co-transporter) genes in the jejunum of early hatched broiler chicks within a 30 h of hatch window. A total of 1218 eggs obtained from 38-week-old Ross 308 broiler breeder flocks were stored for 3 (ES3) or 14 days (ES14) and incubated at the same conditions. Eggs were checked between 475 and 480 h of incubation and 40 chicks from each egg storage duration were weighed; chick length and rectal temperature were measured. The chicks were sampled to evaluate morphological parameters and PepT1 and SGLT1 expression. The remaining chicks that hatched between 475 and 480 h were placed back in the incubator and the same measurements were conducted with those chicks at the end of hatch window at 510 h of incubation. Chick length, chick dry matter content, rectal temperature and weight of small intestine segments increased, whereas chick weight decreased during the hatch window. The increase in the jejunum length and villus width and area during the hatch window were higher for ES3 than ES14 chicks. PepT1 expression was higher for ES3 chicks compared with ES14. There was a 10.2 and 17.6-fold increase in PepT1 and SGLT1 expression of ES3 chicks at the end of hatch window, whereas it was only 2.3 and 3.3-fold, respectively, for ES14 chicks. These results suggested that egg storage duration affected development of early hatched chicks during 30 h of hatch window. It can be concluded that

  15. Conditional loss of ErbB3 delays mammary gland hyperplasia induced by mutant PIK3CA without affecting mammary tumor latency, gene expression, or signaling.

    PubMed

    Young, Christian D; Pfefferle, Adam D; Owens, Philip; Kuba, María G; Rexer, Brent N; Balko, Justin M; Sánchez, Violeta; Cheng, Hailing; Perou, Charles M; Zhao, Jean J; Cook, Rebecca S; Arteaga, Carlos L

    2013-07-01

    Mutations in PIK3CA, the gene encoding the p110α catalytic subunit of phosphoinositide 3-kinase (PI3K), have been shown to transform mammary epithelial cells (MEC). Studies suggest this transforming activity requires binding of mutant p110α via p85 to phosphorylated YXXM motifs in activated receptor tyrosine kinases (RTK) or adaptors. Using transgenic mice, we examined if ErbB3, a potent activator of PI3K, is required for mutant PIK3CA-mediated transformation of MECs. Conditional loss of ErbB3 in mammary epithelium resulted in a delay of PIK3CA(H1047R)-dependent mammary gland hyperplasia, but tumor latency, gene expression, and PI3K signaling were unaffected. In ErbB3-deficient tumors, mutant PI3K remained associated with several tyrosyl phosphoproteins, potentially explaining the dispensability of ErbB3 for tumorigenicity and PI3K activity. Similarly, inhibition of ErbB RTKs with lapatinib did not affect PI3K signaling in PIK3CA(H1047R)-expressing tumors. However, the p110α-specific inhibitor BYL719 in combination with lapatinib impaired mammary tumor growth and PI3K signaling more potently than BYL719 alone. Furthermore, coinhibition of p110α and ErbB3 potently suppressed proliferation and PI3K signaling in human breast cancer cells harboring PIK3CA(H1047R). These data suggest that PIK3CA(H1047R)-driven tumor growth and PI3K signaling can occur independently of ErbB RTKs. However, simultaneous blockade of p110α and ErbB RTKs results in superior inhibition of PI3K and mammary tumor growth, suggesting a rational therapeutic combination against breast cancers harboring PIK3CA activating mutations.

  16. Addition of ammonia or amino acids to a nitrogen-depleted medium affects gene expression patterns in yeast cells during alcoholic fermentation.

    PubMed

    Jiménez-Martí, Elena; del Olmo, Marcel Lí

    2008-03-01

    Yeast cells require nitrogen and are capable of selectively using good nitrogen sources in preference to poor ones by means of the regulatory mechanism known as nitrogen catabolite repression (NCR). Herein, the effect of ammonia or amino acid addition to nitrogen-depleted medium on global yeast expression patterns in yeast cells was studied using alcoholic fermentation as a system. The results indicate that there is a differential reprogramming of the gene expression depending on the nitrogen source added. Ammonia addition resulted in a higher expression of genes involved in amino acids biosynthesis while amino acid addition prepares the cells for protein biosynthesis. Therefore, a high percentage of the genes regulated by the transcription factors involved in the regulation of amino acid biosynthesis are more expressed during the first hours after ammonia addition compared with amino acid addition. The opposite occurs for those genes regulated by the transcription factor Sfp1p, related to ribosome biosynthesis. Although both additions include rich nitrogen sources, most NCR-regulated genes are more expressed after adding ammonia than amino acids. One of the differentially expressed genes, YBR174W, is required for optimal growth in synthetic medium.

  17. Tetracapsuloides bryosalmonae infection affects the expression of genes involved in cellular signal transduction and iron metabolism in the kidney of the brown trout Salmo trutta.

    PubMed

    Kumar, Gokhlesh; Sarker, Subhodeep; Menanteau-Ledouble, Simon; El-Matbouli, Mansour

    2015-06-01

    Tetracapsuloides bryosalmonae is an enigmatic endoparasite which causes proliferative kidney disease in various species of salmonids in Europe and North America. The life cycle of the European strain of T. bryosalmonae generally completes in an invertebrate host freshwater bryozoan and vertebrate host brown trout (Salmo trutta) Linnaeus, 1758. Little is known about the gene expression in the kidney of brown trout during the developmental stages of T. bryosalmonae. In the present study, quantitative real-time PCR was applied to quantify the target genes of interest in the kidney of brown trout at different time points of T. bryosalmonae development. PCR primers specific for target genes were designed and optimized, and their gene expression levels were quantified in the cDNA kidney samples using SYBR Green Supermix. Expression of Rab GDP dissociation inhibitor beta, integral membrane protein 2B, NADH dehydrogenase 1 beta subcomplex subunit 6, and 26S protease regulatory subunit S10B were upregulated significantly in infected brown trout, while the expression of the ferritin M middle subunit was downregulated significantly. These results suggest that host genes involved in cellular signal transduction, proteasomal activities, including membrane transporters and cellular iron storage, are differentially upregulated or downregulated in the kidney of brown trout during parasite development. The gene expression pattern of infected renal tissue may support the development of intraluminal sporogonic stages of T. bryosalmonae in the renal tubular lumen of brown trout which may facilitate the release of viable parasite spores to transmit to the invertebrate host bryozoan.

  18. Expression and knockdown of the PEPC1 gene affect carbon flux in the biosynthesis of triacylglycerols by the green alga Chlamydomonas reinhardtii.

    PubMed

    Deng, Xiaodong; Cai, Jiajia; Li, Yajun; Fei, Xiaowen

    2014-11-01

    The regulation of lipid biosynthesis is important in photosynthetic eukaryotic cells. This regulation is facilitated by the direct synthesis of fatty acids and triacylglycerol (TAG), and by other controls of the main carbon metabolic pathway. In this study, knockdown of the mRNA expression of the Chlamydomonas phosphoenolpyruvate carboxylase isoform 1 (CrPEPC1) gene by RNA interference increased TAG level by 20 % but decreased PEPC activities in the corresponding transgenic algae by 39-50 %. The decrease in CrPEPC1 expression increased the expression of TAG biosynthesis-related genes, such as acyl-CoA:diacylglycerol acyltransferase and phosphatidate phosphatase. Conversely, CrPEPC1 over-expression decreased TAG level by 37 % and increased PEPC activities by 157-184 %. These observations suggest that the lipid content of algal cells can be controlled by regulating the CrPEPC1 gene.

  19. Expression of the Arginine Deiminase Pathway Genes in Lactobacillus sakei Is Strain Dependent and Is Affected by the Environmental pH

    PubMed Central

    Rimaux, T.; Rivière, A.; Illeghems, K.; Weckx, S.; De Vuyst, L.

    2012-01-01

    The adaptation of Lactobacillus sakei to a meat environment is reflected in its metabolic potential. For instance, the ability to utilize arginine through the arginine deiminase (ADI) pathway, resulting in additional ATP, represents a competitive benefit. In L. sakei CTC 494, the arc operon (arcABCTDR) shows the same gene order and organization as that in L. sakei 23K, the genome sequence of which is known. However, differences in relative gene expression were found, and these seemed to be optimal in different growth phases, namely, the highest relative gene expression level was in the end exponential growth phase in the case of L. sakei CTC 494 and in the mid-exponential growth phase of L. sakei 23K. Also, the environmental pH influenced the relative expression level of the arc operon, as shown for L. sakei CTC 494, with the highest relative expression level occurring at the optimal pH for growth (pH 6.0). Deviations from this optimal pH (pH 5.0 and pH 7.0) resulted in an overall decline of the relative expression level of all genes of the arc operon. Furthermore, a differential relative expression of the individual genes of the arc operon was found, with the highest relative gene expression occurring for the first two genes of the arc operon (arcA and arcB). Finally, it was shown that some L. sakei strains were able to convert agmatine into putrescine, suggesting an operational agmatine deiminase pathway in these strains, a metabolic trait that is undesirable in meat fermentations. This study shows that this metabolic trait is most probably encoded by a previously erroneously annotated second putative arc operon. PMID:22544250

  20. Expression of the arginine deiminase pathway genes in Lactobacillus sakei is strain dependent and is affected by the environmental pH.

    PubMed

    Rimaux, T; Rivière, A; Illeghems, K; Weckx, S; De Vuyst, L; Leroy, F

    2012-07-01

    The adaptation of Lactobacillus sakei to a meat environment is reflected in its metabolic potential. For instance, the ability to utilize arginine through the arginine deiminase (ADI) pathway, resulting in additional ATP, represents a competitive benefit. In L. sakei CTC 494, the arc operon (arcABCTDR) shows the same gene order and organization as that in L. sakei 23K, the genome sequence of which is known. However, differences in relative gene expression were found, and these seemed to be optimal in different growth phases, namely, the highest relative gene expression level was in the end exponential growth phase in the case of L. sakei CTC 494 and in the mid-exponential growth phase of L. sakei 23K. Also, the environmental pH influenced the relative expression level of the arc operon, as shown for L. sakei CTC 494, with the highest relative expression level occurring at the optimal pH for growth (pH 6.0). Deviations from this optimal pH (pH 5.0 and pH 7.0) resulted in an overall decline of the relative expression level of all genes of the arc operon. Furthermore, a differential relative expression of the individual genes of the arc operon was found, with the highest relative gene expression occurring for the first two genes of the arc operon (arcA and arcB). Finally, it was shown that some L. sakei strains were able to convert agmatine into putrescine, suggesting an operational agmatine deiminase pathway in these strains, a metabolic trait that is undesirable in meat fermentations. This study shows that this metabolic trait is most probably encoded by a previously erroneously annotated second putative arc operon.

  1. Cytosine deaminase as a negative selectable marker for the microalgal chloroplast: a strategy for the isolation of nuclear mutations that affect chloroplast gene expression.

    PubMed

    Young, Rosanna E B; Purton, Saul

    2014-12-01

    Negative selectable markers are useful tools for forward-genetic screens aimed at identifying trans-acting factors that are required for expression of specific genes. Transgenic lines harbouring the marker fused to a gene element, such as a promoter, may be mutagenized to isolate loss-of-function mutants able to survive under selection. Such a strategy allows the molecular dissection of factors that are essential for expression of the gene. Expression of individual chloroplast genes in plants and algae typically requires one or more nuclear-encoded factors that act at the post-transcriptional level, often through interaction with the 5' UTR of the mRNA. To study such nuclear control further, we have developed the Escherichia coli cytosine deaminase gene codA as a conditional negative selectable marker for use in the model green alga Chlamydomonas reinhardtii. We show that a codon-optimized variant of codA with three amino acid substitutions confers sensitivity to 5-fluorocytosine (5-FC) when expressed in the chloroplast under the control of endogenous promoter/5' UTR elements from the photosynthetic genes psaA or petA. UV mutagenesis of the psaA transgenic line allowed recovery of 5-FC-resistant, photosynthetically deficient lines harbouring mutations in the nuclear gene for the factor TAA1 that is required for psaA translation. Similarly, the petA line was used to isolate mutants of the petA mRNA stability factor MCA1 and the translation factor TCA1. The codA marker may be used to identify critical residues in known nuclear factors and to aid the discovery of additional factors required for expression of chloroplast genes.

  2. The Global Regulatory hns Gene Negatively Affects Adhesion to Solid Surfaces by Anaerobically Grown Escherichia coli by Modulating Expression of Flagellar Genes and Lipopolysaccharide Production

    PubMed Central

    Landini, Paolo; Zehnder, Alexander J. B.

    2002-01-01

    The initial binding of bacterial cells to a solid surface is a critical and essential step in biofilm formation. In this report we show that stationary-phase cultures of Escherichia coli W3100 (a K-12 strain) can efficiently attach to sand columns when they are grown in Luria broth medium at 28°C in fully aerobic conditions. In contrast, growth in oxygen-limited conditions results in a sharp decrease in adhesion to hydrophilic substrates. We show that the production of lipopolysaccharide (LPS) and of flagella, as well as the transcription of the fliC gene, encoding the major flagellar subunit, increases under oxygen-limited conditions. Inactivation of the global regulatory hns gene counteracts increased production of LPS and flagella in response to anoxia and allows E. coli W3100 to attach to sand columns even when it is grown under oxygen-limited conditions. We propose that increased production of the FliC protein and of LPS in response to oxygen limitation results in the loss of the ability of E. coli W3100 to adhere to hydrophilic surfaces. Indeed, overexpression of the fliC gene results in a decreased adhesion to sand even when W3100 is grown in fully aerobic conditions. Our observations strongly suggest that anoxia is a negative environmental signal for adhesion in E. coli. PMID:11872702

  3. The forage type (grazing versus hay pasture) fed to ewes and the lamb sex affect fatty acid profile and lipogenic gene expression in the longissimus muscle of suckling lambs.

    PubMed

    Dervishi, E; Joy, M; Alvarez-Rodriguez, J; Serrano, M; Calvo, J H

    2012-01-01

    Meat intramuscular fat (IMF) contributes to meat quality and consumer acceptance. Molecular events that occur during IMF deposition and the identification of genes that are differentially expressed during this process are important to the design of an optimal nutrition plan for animals. In the present study, we examined the effect of the forage type (grazing vs. hay pasture) fed to ewes and the effect of lamb sex on the LM fatty acid (FA) profile and gene expression of suckling lambs (10 to 12 kg of BW at slaughter); ewes received pasture hay (PH) or grazed pasture (GRE). Forage type had a significant effect on IMF FA profile. Ewes grazing green forage (GRE) promoted the formation and deposition of vaccenic acid (C18:1n-7), CLA, and PUFA n-3 in LM from their suckling lambs (P < 0.05). We found that forage type affected the expression of the sterol regulatory element binding transcription factor 1 (SREBF1) gene in females. However, in males, it modulated stearoyl CoA desaturase (SCD) gene expression (P < 0.05). Moreover, our results showed that females, independent of the diet of the ewes (PH or GRE), are predisposed to develop fat and to upregulate the expression of key genes of transcriptional factors PPARA, CEBPB, SREBF1, and lipoprotein lipase (LPL) and SCD (P < 0.05). The data suggest that SREBF1, SCD, and most likely CEBPB gene expression in young suckling lambs is modulated by both lamb sex and forage type fed to ewes. Fatty acid indicators PUFA, n-6/n-3, CLA, and SFA are closely related to LPL, SCD, PPARA, and CEBPB gene expression depending on animal sex or the diet of ewes. This study suggests that grazing pasture affects FA composition promoting greater vaccenic, CLA, and total PUFA n-3 FA in female and male suckling lambs, and it is mediated through the regulation of lipogenic enzyme expression.

  4. Decoding Children's Expressions of Affect.

    ERIC Educational Resources Information Center

    Feinman, Joel A.; Feldman, Robert S.

    Mothers' ability to decode the emotional expressions of their male and female children was compared to the decoding ability of non-mothers. Happiness, sadness, fear and anger were induced in children in situations that varied in terms of spontaneous and role-played encoding modes. It was hypothesized that mothers would be more accurate decoders of…

  5. Constitutive expression of two apple (Malus x domestica Borkh.) homolog genes of LIKE HETEROCHROMATIN PROTEIN1 affects flowering time and whole-plant growth in transgenic Arabidopsis.

    PubMed

    Mimida, Naozumi; Kidou, Shin-Ichiro; Kotoda, Nobuhiro

    2007-09-01

    Fruit trees, such as apple (Malus x domestica Borkh.), are woody perennial plants with a long juvenile phase. The biological analysis for the regulation of flowering time provides insights into the reduction of juvenile phase and the acceleration of breeding in fruit trees. In Arabidopsis, LIKE HETEROCHROMATIN PROTEIN1 (LHP1) is involved in epigenetic silencing of the target genes such as flowering genes. We isolated and characterized twin apple LHP1 homolog genes, MdLHP1a and MdLHP1b. These genes may have been generated as a result of ancient genome duplication. Although the putative MdLHP1 proteins showed lower similarity to any other known plant LHP1 homologs, a chromo domain, a chromo shadow domain, and the nuclear localization signal motifs were highly conserved among them. RT-PCR analysis showed that MdLHP1a and MdLHP1b were expressed constantly in developing shoot apices of apple trees throughout the growing season. Constitutive expression of MdLHP1a or MdLHP1b could compensate for the pleiotropic phenotype of lhp1/tfl2 mutant, suggesting that apple LHP1 homolog genes are involved in the regulation of flowering time and whole-plant growth. Based on these results, LHP1 homolog genes might have rapidly evolved among plant species, but the protein functions were conserved, at least between Arabidopsis and apple.

  6. Tuberous sclerosis complex protein 1 expression is affected by VHL Gene alterations and HIF-1α production in sporadic clear-cell renal cell carcinoma.

    PubMed

    Damjanovic, Svetozar S; Ilic, Bojana B; Beleslin Cokic, Bojana B; Antic, Jadranka A; Bankovic, Jovana Z; Milicevic, Ivana T; Rodic, Gordana S; Ilic, Dusan S; Todorovic, Vera N; Puskas, Nela; Tulic, Cane D

    2016-12-01

    Alterations in von Hippel-Lindau gene (VHL) do not determine deregulation of hypoxia-inducible factors (HIFs) in clear-cell renal carcinoma (ccRCC). Their effects on tuberous sclerosis proteins (TSC1/2) and heat shock protein 90 (Hsp90) expressions in sporadic ccRCC are unknown. Therefore, we analyze the impact of VHL alterations and HIF-α production on the expression of TSC proteins and Hsp90 in these tumors. Alterations in VHL gene region exhibited 37/47 (78.7%) tumors. Monoallelic inactivation (intragenic mutation or LOH) was found in 10 (21.3%) and biallelic inactivation (intragenic mutation plus LOH) in 27 (57.4%) ccRCCs. Tumorous expression of HIF-α mRNAs, HIF-α, Hsp90 and TSC2 were VHL independent; TSC2 was underexpressed in all tumors by immunostaining (P<0.001). Immunoblotting revealed that TSC1 production was lower in tumors with monoallelic VHL inactivation than in control (P=0.01) and tissues with biallelic VHL inactivation (P=0.019), while tumors lacking HIF-1α (16/47) concurrently overexpressed HIF-2α and underexpressed TSC1 in comparison to controls (P=0.01 for both) and HIF-1α positive tumors (P=0.015 and P=0.050). Significant portion of variability (56.4%) in tumor diameter was explained by oscillations in nuclear grade, and TSC1 and HIF-2α expression in VHL altered tumors. In conclusion, while TSC2 is broadly downregulated in sporadic ccRCC, TSC1 expression is reduced in two subsets of these tumors, those with monoallelic VHL gene inactivation and those with concurrent low HIF-1α and high HIF-2α expression. Hence, the involvement of nuclear grade, TSC1 and HIF-2α in the progression of VHL altered tumors, implies the interplay between pVHL and TSC1.

  7. Expression of the short stature homeobox gene Shox is restricted by proximal and distal signals in chick limb buds and affects the length of skeletal elements.

    PubMed

    Tiecke, Eva; Bangs, Fiona; Blaschke, Rudiger; Farrell, Elizabeth R; Rappold, Gudrun; Tickle, Cheryll

    2006-10-15

    SHOX is a homeobox-containing gene, highly conserved among species as diverse as fish, chicken and humans. SHOX gene mutations have been shown to cause idiopathic short stature and skeletal malformations frequently observed in human patients with Turner, Leri-Weill and Langer syndromes. We cloned the chicken orthologue of SHOX, studied its expression pattern and compared this with expression of the highly related Shox2. Shox is expressed in central regions of early chick limb buds and proximal two thirds of later limbs, whereas Shox2 is expressed more posteriorly in the proximal third of the limb bud. Shox expression is inhibited distally by signals from the apical ectodermal ridge, both Fgfs and Bmps, and proximally by retinoic acid signaling. We tested Shox functions by overexpression in embryos and micromass cultures. Shox-infected chick limbs had normal proximo-distal patterning but the length of skeletal elements was consistently increased. Primary chick limb bud cell cultures infected with Shox showed an initial increase in cartilage nodules but these did not enlarge. These results fit well with the proposed role of Shox in cartilage and bone differentiation and suggest chick embryos as a useful model to study further the role of Shox in limb development.

  8. Mutagenesis of a novel gene in the prcA-prtP protease locus affects expression of Treponema denticola membrane complexes.

    PubMed

    Bian, Xue-Lin; Wang, Hong-Tao; Ning, Yu; Lee, Si Young; Fenno, J Christopher

    2005-02-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue.

  9. Mutagenesis of a Novel Gene in the prcA-prtP Protease Locus Affects Expression of Treponema denticola Membrane Complexes

    PubMed Central

    Bian, Xue-lin; Wang, Hong-tao; Ning, Yu; Lee, Si Young; Fenno, J. Christopher

    2005-01-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue. PMID:15664975

  10. Phytochrome B Negatively Affects Cold Tolerance by Regulating OsDREB1 Gene Expression through Phytochrome Interacting Factor-Like Protein OsPIL16 in Rice

    PubMed Central

    He, Yanan; Li, Yaping; Cui, Lixin; Xie, Lixia; Zheng, Chongke; Zhou, Guanhua; Zhou, Jinjun; Xie, Xianzhi

    2016-01-01

    Cross talk between light signaling and cold signaling has been elucidated in the model plant Arabidopsis and tomato, but little is known about their relationship in rice. Here, we report that phytochrome B (phyB) mutants exhibit improved cold tolerance compared with wild type (WT) rice (Oryza sativa L. cv. Nipponbare). The phyB mutants had a lower electrolyte leakage index and malondialdehyde concentration than the WT, suggesting that they had greater cell membrane integrity and less lipid peroxidation. Real-time PCR analysis revealed that the expression levels of dehydration-responsive element binding protein 1 (OsDREB1) family genes, which functions in the cold stress response in rice, were increased in the phyB mutant under normal and cold stress conditions. PIFs are central players in phytochrome-mediated light signaling networks. To explore the relationship between rice PIFs and OsDREB1 gene expression, we produced overexpression lines of rice PIF genes. OsDREB1 family genes were up-regulated in OsPIL16-overexpression lines, which had improved cold tolerance relative to the WT. Chromatin immunoprecipitation (ChIP)-qPCR assay revealed that OsPIL16 can bind to the N-box region of OsDREB1B promoter. Expression pattern analyses revealed that OsPIL16 transcripts were induced by cold stress and was significantly higher in the phyB mutant than in the WT. Moreover, yeast two-hybrid assay showed that OsPIL16 can bind to rice PHYB. Based on these results, we propose that phyB deficiency positively regulates OsDREB1 expression through OsPIL16 to enhance cell membrane integrity and to reduce the malondialdehyde concentration, resulting in the improved cold tolerance of the phyB mutants. PMID:28083003

  11. Method of controlling gene expression

    DOEpatents

    Peters, Norman K.; Frost, John W.; Long, Sharon R.

    1991-12-03

    A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

  12. The flow of gene expression.

    PubMed

    Misteli, Tom

    2004-03-01

    Gene expression is a highly interconnected multistep process. A recent meeting in Iguazu Falls, Argentina, highlighted the need to uncover both the molecular details of each single step as well as the mechanisms of coordination among processes in order to fully understand the expression of genes.

  13. Copper toxicity in Chinese cabbage is not influenced by plant sulphur status, but affects sulphur metabolism-related gene expression and the suggested regulatory metabolites.

    PubMed

    Shahbaz, M; Stuiver, C E E; Posthumus, F S; Parmar, S; Hawkesford, M J; De Kok, L J

    2014-01-01

    The toxicity of high copper (Cu) concentrations in the root environment of Chinese cabbage (Brassica pekinensis) was little influenced by the sulphur nutritional status of the plant. However, Cu toxicity removed the correlation between sulphur metabolism-related gene expression and the suggested regulatory metabolites. At high tissue Cu levels, there was no relation between sulphur metabolite levels viz. total sulphur, sulphate and water-soluble non-protein thiols, and the expression and activity of sulphate transporters and expression of APS reductase under sulphate-sufficient or-deprived conditions, in the presence or absence of H2 S. This indicated that the regulatory signal transduction pathway of sulphate transporters was overruled or by-passed upon exposure to elevated Cu concentrations.

  14. An S18 ribosomal protein gene copy at the Arabidopsis PFL locus affects plant development by its specific expression in meristems.

    PubMed Central

    Van Lijsebettens, M; Vanderhaeghen, R; De Block, M; Bauw, G; Villarroel, R; Van Montagu, M

    1994-01-01

    In Arabidopsis, mutation at PFL causes pointed first leaves, reduced fresh weight and growth retardation. We have cloned the wild-type PFL gene by T-DNA tagging, and demonstrate that it complements the mutant phenotype. PFL codes for ribosomal protein S18, based on the high homology with rat S18 and on purification of S18-equivalent peptides from plant ribosomes. pfl represents the first mutation in eukaryotic S18 proteins or their S13 prokaryotic counterparts, involved in translation initiation. Arabidopsis contains three S18 gene copies dispersed in the genetic map; they are all transcribed and code for completely identical proteins. No transcript is detected from the mutated gene, S18A. The activity of the S18A promoter is restricted to meristems, with a markedly high expression at the embryonic heart stage, and to wounding sites. This means that plants activate an extra copy of this ribosomal protein gene in tissues with cell division activity. We postulate that in meristematic tissues plants use transcriptional control to synthesize extra ribosomes to increase translational efficiency. In analogy with this, an additional, developmentally regulated gene copy might be expected for all ribosomal proteins. Images PMID:7913892

  15. Virus-induced gene silencing of PEAM4 affects floral morphology by altering the expression pattern of PsSOC1a and PsPVP in pea.

    PubMed

    Chen, Zhe-Hao; Jia, Fei-Fei; Hu, Jiang-Qin; Pang, Ji-Liang; Xu, Lei; Wang, Li-Lin

    2014-01-15

    pea-MADS4 (PEAM4) regulates floral morphology in Pisum sativum L., however, its molecular mechanisms still remain unclear. Virus-induced gene silencing (VIGS) is a recently developed reverse genetic approach that facilities an easier and more rapid study of gene functions. In this study, the PEAM4 gene was effectively silenced by VIGS using a pea early browning virus (PEBV) in wild type pea JI992. The infected plants showed abnormal phenotypes, as the floral organs, especially the sepals and petals changed in both size and shape, which made the corolla less closed. The petals changed in morphology and internal symmetry with, the stamens reduced and carpel dehisced. Larger sepals and longer tendrils with small cauline leaves appeared, with some sepals turning into bracts, and secondary inflorescences with fused floral organs were formed, indicating a flower-to-inflorescence change. The infected plants also displayed a delayed and prolonged flowering time. The PEAM4-VIGS plants with altered floral morphology were similar to the pim (proliferating inflorescence meristem) mutant and also mimicked the phenotypes of ap1 mutants in Arabidopsis. The expression pattern of the homologous genes PsSOC1a and PsSVP, which were involved in flowering time and florescence morphological control downstream of PEAM4, were analyzed by real-time RT-PCR and mRNA in situ hybridization. PsSOC1a and PsSVP were ectopically expressed and enhanced in the floral meristems from PEAM4-silenced plants. Our data suggests that PEAM4 may have a similar molecular mechanism as AtAP1, which inhibits the expression of PsSOC1a and PsSVP in the floral meristem from the early stages of flower development. As such, in this way PEAM4 plays a crucial role in maintaining floral organ identity and flower development in pea.

  16. In vivo and in vitro maturation of rabbit oocytes differently affects the gene expression profile, mitochondrial distribution, apoptosis and early embryo development.

    PubMed

    Arias-Álvarez, M; García-García, R M; López-Tello, J; Rebollar, P G; Gutiérrez-Adán, A; Lorenzo, P L

    2016-09-28

    In vivo-matured cumulus-oocyte complexes are valuable models in which to assess potential biomarkers of rabbit oocyte quality that contribute to enhanced IVM systems. In the present study we compared some gene markers of oocytes and cumulus cells (CCs) from immature, in vivo-matured and IVM oocytes. Moreover, apoptosis in CCs, nuclear maturation, mitochondrial reallocation and the developmental potential of oocytes after IVF were assessed. In relation to cumulus expansion, gene expression of gap junction protein, alpha 1, 43 kDa (Gja1) and prostaglandin-endoperoxide synthase 2 (Ptgs2) was significantly lower in CCs after in vivo maturation than IVM. In addition, there were differences in gene expression after in vivo maturation versus IVM in both oocytes and CCs for genes related to cell cycle regulation and apoptosis (V-Akt murine thymoma viral oncogene homologue 1 (Akt1), tumour protein 53 (Tp53), caspase 3, apoptosis-related cysteine protease (Casp3)), oxidative response (superoxide dismutase 2, mitochondrial (Sod2)) and metabolism (glucose-6-phosphate dehydrogenase (G6pd), glyceraldehyde-3-phosphate dehydrogenase (Gapdh)). In vivo-matured CCs had a lower apoptosis rate than IVM and immature CCs. Meiotic progression, mitochondrial migration to the periphery and developmental competence were higher for in vivo-matured than IVM oocytes. In conclusion, differences in oocyte developmental capacity after IVM or in vivo maturation are accompanied by significant changes in transcript abundance in oocytes and their surrounding CCs, meiotic rate, mitochondrial distribution and apoptotic index. Some of the genes investigated, such as Gja1, could be potential biomarkers for oocyte developmental competence in the rabbit model, helping improve in vitro culture systems in these species.

  17. Mutation in the Arabidopisis thaliana DEK1 calpain gene perturbs endosperm and embryo development while over-expression affects organ development globally.

    PubMed

    Lid, Stein Erik; Olsen, Lene; Nestestog, Ragnhild; Aukerman, Milo; Brown, Roy C; Lemmon, Betty; Mucha, Mark; Opsahl-Sorteberg, Hilde-Gunn; Olsen, Odd-Arne

    2005-06-01

    A T-DNA insertion in the Arabidopsis thaliana DEK1 gene, encoding a calpain-like cysteine proteinase with a predicted membrane anchor, causes unorganized embryo development displaying irregular mitotic divisions in the embryo proper and suspensor. Embryo development is arrested at the globular stage, and the embryo proper lacks a defined protoderm. In the endosperm, the aleurone-like peripheral cell layer is partly or completely lacking. The Arabidopsis DEK1 wild-type transcript is expressed evenly throughout the endosperm and the embryo in developing seed as determined using in situ hybridization. The conclusion that the observed phenotype is caused by a T-DNA insertion in the Arabidopsis DEK1 gene is confirmed by complementation with the Arabidopisis DEK1 genomic sequence, as well as analysis of a second T-DNA insertion allele. Over-expression of the Arabidopsis DEK1 gene coding sequence under the control of the 35S promoter causes a number of developmental phenotypes, including a global lack of trichomes, leaves exhibiting improper dorsiventral symmetry and aberrant cell organization in flowers. We interpret the data to suggest a role for DEK1 in providing cells with positional clues for an appropriate developmental context within plant tissues.

  18. The Nuclear Gene Rf3 Affects the Expression of the Mitochondrial Chimeric Sequence R Implicated in S-Type Male Sterility in Maize

    PubMed Central

    Zabala, G.; Gabay-Laughnan, S.; Laughnan, J. R.

    1997-01-01

    The mitochondrial genomes of maize plants exhibiting S-type cytoplasmic male sterility (cms-S) contain a repeated DNA region designated R. This region was found to be rearranged in the mitochondria of all cms-S cytoplasmically revertant fertile plants in all nuclear backgrounds analyzed. A 1.6-kb mRNA transcribed from the R region in mitochondria of sterile plants was absent from all cytoplasmic revertants examined. The nuclear gene Rf3, which suppresses the cms-S phenotype, was found to have a specific effect on the expression of the R sequence; the abundance of the major R transcripts, including the cms-S-specific 1.6-kb mRNA, is decreased in mitochondria of restored plants. Nucleotide sequence analysis of R has revealed similarities to the R1 plasmid found in some South American maize races with RU cytoplasm, to the M1 plasmid found in one source of Zea luxurians teosinte, to the atp9 mitochondrial gene and its 3' flanking sequence, and also to a region 3' to the orf221 gene. The derived amino acid sequence of the R region predicts two open reading frames (ORFs). These ORFs contain the similarities to R1, M1, atp9 and orf221. The present report reveals the chimeric nature of the R region, describes the complex effect of Rf3 on the expression of the R sequence and implicates R in the sterile phenotype of cms-S maize. PMID:9335619

  19. Arsenic and fluoride co-exposure affects the expression of apoptotic and inflammatory genes and proteins in mononuclear cells from children.

    PubMed

    Estrada-Capetillo, B L; Ortiz-Pérez, M D; Salgado-Bustamante, M; Calderón-Aranda, E; Rodríguez-Pinal, C J; Reynaga-Hernández, E; Corral-Fernández, N E; González-Amaro, R; Portales-Pérez, D P

    2014-02-01

    Humans may be exposed to arsenic (As) and fluoride (F) through water consumption. However, the interaction between these two elements and gene expression in apoptosis or inflammatory processes in children has not been thoroughly investigated. Herein, the expression of cIAP-1, XIAP, TNF-α, ENA-78, survivin, CD25, and CD40 was evaluated by RT-PCR. Additionally, the surface expression of CD25, CD40, and CD40L on peripheral blood mononuclear cells was analyzed by flow cytometry, and TNF-α was measured by Western blotting. This study examined 72 children aged 6-12 years who were chronically exposed to As (154.2μg/L) and F (5.3mg/L) in drinking water and in food cooked with the same water. The urine concentrations of As (6.9-122.4μg/L) were positively correlated with the urine concentrations of F (1.0-8.8mg/L) (r(2)=0.413, p<0.0001). The CD25 gene expression levels and urine concentrations of As and F were negatively correlated, though the CD40 expression levels were negatively correlated only with the As concentration. Age and height influenced the expression of cIAP-1, whereas XIAP expression was correlated only with age. Additionally, there was a lower percentage of CD25- and CD40-positive cells in the group of 6- to 8-year-old children exposed to the highest concentrations of both As and F when compared to the 9- to 12-year-old group (CD25: 0.7±0.8 vs. 1.1±0.9, p<0.0014; CD40: 16.0±7.0 vs. 21.8±5.8, p<0.0003). PHA-stimulated lymphocytes did not show any changes in the induction of CD25, CD69, or CD95. In summary, high concentrations of As and F alter the expression patterns of CD25 and CD40 at both the genetic and protein levels. These changes could decrease immune responses in children exposed to As and F.

  20. Prolonged Dietary Selenium Deficiency or Excess Does Not Globally Affect Selenoprotein Gene Expression and/or Protein Production in Various Tissues of Pigs123

    PubMed Central

    Liu, Yan; Zhao, Hua; Zhang, Qiaoshan; Tang, Jiayong; Li, Ke; Xia, Xin-Jie; Wang, Kang-Ning; Li, Kui; Lei, Xin Gen

    2012-01-01

    We previously determined the effects of dietary selenium (Se) deficiency or excess on mRNA abundance of 12 selenoprotein genes in pig tissues. In this study, we determined the effect of dietary Se on mRNA levels of the remaining porcine selenoprotein genes along with protein production of 4 selenoproteins (Gpx1, Sepp1, Selh, and Sels) and body glucose homeostasis. Weanling male pigs (n = 24) were fed a Se-deficient (<0.02 mg Se/kg), basal diet supplemented with 0, 0.3, or 3.0 mg Se/kg as Se-enriched yeast (Angel Yeast) for 16 wk. Although mRNA abundance of the 13 selenoproteins in 10 tissues responded to dietary Se in 3 patterns, there was no common regulation for any given gene across all tissues or for any given tissue across all genes. Dietary Se affected (P < 0.05) 2, 3, 3, 5, 6, 7, 7, and 8 selenoprotein genes in muscle, hypothalamus, liver, kidney, heart, spleen, thyroid, and pituitary, respectively. Protein abundance of Gpx1, Sepp1, Selh, and Sels in 6 tissues was regulated (P < 0.05) by dietary Se concentrations in 3 ways. Compared with those fed 0.3 mg Se/kg, pigs fed 3.0 mg Se/kg became hyperinsulinemic (P < 0.05) and had lower (P < 0.05) tissue levels of serine/threonine protein kinase. In conclusion, dietary Se exerted no global regulation of gene transcripts or protein levels of individual selenoproteins across porcine tissues. Pigs may be a good model for studying mechanisms related to the potential prodiabetic risk of high-Se intake in humans. PMID:22739382

  1. Audio-visual affective expression recognition

    NASA Astrophysics Data System (ADS)

    Huang, Thomas S.; Zeng, Zhihong

    2007-11-01

    Automatic affective expression recognition has attracted more and more attention of researchers from different disciplines, which will significantly contribute to a new paradigm for human computer interaction (affect-sensitive interfaces, socially intelligent environments) and advance the research in the affect-related fields including psychology, psychiatry, and education. Multimodal information integration is a process that enables human to assess affective states robustly and flexibly. In order to understand the richness and subtleness of human emotion behavior, the computer should be able to integrate information from multiple sensors. We introduce in this paper our efforts toward machine understanding of audio-visual affective behavior, based on both deliberate and spontaneous displays. Some promising methods are presented to integrate information from both audio and visual modalities. Our experiments show the advantage of audio-visual fusion in affective expression recognition over audio-only or visual-only approaches.

  2. Expression of a desaturase gene, desat1, in neural and nonneural tissues separately affects perception and emission of sex pheromones in Drosophila

    PubMed Central

    Bousquet, François; Nojima, Tetsuya; Houot, Benjamin; Chauvel, Isabelle; Chaudy, Sylvie; Dupas, Stéphane; Yamamoto, Daisuke; Ferveur, Jean-François

    2012-01-01

    Animals often use sex pheromones for mate choice and reproduction. As for other signals, the genetic control of the emission and perception of sex pheromones must be tightly coadapted, and yet we still have no worked-out example of how these two aspects interact. Most models suggest that emission and perception rely on separate genetic control. We have identified a Drosophila melanogaster gene, desat1, that is involved in both the emission and the perception of sex pheromones. To explore the mechanism whereby these two aspects of communication interact, we investigated the relationship between the molecular structure, tissue-specific expression, and pheromonal phenotypes of desat1. We characterized the five desat1 transcripts—all of which yielded the same desaturase protein—and constructed transgenes with the different desat1 putative regulatory regions. Each region was used to target reporter transgenes with either (i) the fluorescent GFP marker to reveal desat1 tissue expression, or (ii) the desat1 RNAi sequence to determine the effects of genetic down-regulation on pheromonal phenotypes. We found that desat1 is expressed in a variety of neural and nonneural tissues, most of which are involved in reproductive functions. Our results suggest that distinct desat1 putative regulatory regions independently drive the expression in nonneural and in neural cells, such that the emission and perception of sex pheromones are precisely coordinated in this species. PMID:22114190

  3. Whole intact rapeseeds or sunflower oil in high-forage or high-concentrate diets affects milk yield, milk composition, and mammary gene expression profile in goats.

    PubMed

    Ollier, S; Leroux, C; de la Foye, A; Bernard, L; Rouel, J; Chilliard, Y

    2009-11-01

    This study aimed to ascertain the response of goat mammary metabolic pathways to concentrate and lipid feeding in relation to milk fatty acid (FA) composition and secretion. Sixteen midlactation multiparous goats received diets differing in forage-to-concentrate ratio [high forage (HF) 64:36, and low forage (LF) 43:57] supplemented or not with lipids [HF with 130 g/d of oil from whole intact rapeseeds (RS) and LF with 130 g/d of sunflower oil (SO)] in a 4 x 4 Latin square design. Milk yield, milk composition, FA profile, and FA secretion were measured, as well as the expression profiles of key genes in mammary metabolism and of 8,382 genes, using a bovine oligonucleotide microarray. After 3 wk of treatment, milk, lactose, and protein yields were lower with HF-RS than with the other diets, whereas treatment had no effect on milk protein content. Milk fat content was higher with the HF-RS and LF-SO diets than with the HF and LF diets, and SO supplementation increased milk fat yield compared with the LF diet. Decreasing the forage-to-concentrate ratio from 64:36 to 43:57 had a limited effect on goat milk FA concentrations and secretions. Supplementing the LF diet with SO changed almost all the FA concentrations, including decreases in medium-chain saturated FA and large increases in trans C18:1 and C18:2 isomers (particularly trans-11 C18:1 and cis-9, trans-11 conjugated linoleic acid), without significant changes in C18:0 and cis-9 C18:1, whereas supplementing the HF diet with RS led to a strong decrease in short- and medium-chain saturated FA and a very strong increase in C18:0 and cis-9 C18:1, without significant changes in trans C18:1 and conjugated linoleic acid. Despite the decreases in milk lactose and protein yields observed with HF-RS, and despite the decrease in milk medium-chain FA and the increase in C18 FA secretion with RS or SO supplementation, none of the dietary treatments had any effect on mammary mRNA expression of the key genes involved in lactose

  4. Digital gene expression signatures for maize development.

    PubMed

    Eveland, Andrea L; Satoh-Nagasawa, Namiko; Goldshmidt, Alexander; Meyer, Sandra; Beatty, Mary; Sakai, Hajime; Ware, Doreen; Jackson, David

    2010-11-01

    Genome-wide expression signatures detect specific perturbations in developmental programs and contribute to functional resolution of key regulatory networks. In maize (Zea mays) inflorescences, mutations in the RAMOSA (RA) genes affect the determinacy of axillary meristems and thus alter branching patterns, an important agronomic trait. In this work, we developed and tested a framework for analysis of tag-based, digital gene expression profiles using Illumina's high-throughput sequencing technology and the newly assembled B73 maize reference genome. We also used a mutation in the RA3 gene to identify putative expression signatures specific to stem cell fate in axillary meristem determinacy. The RA3 gene encodes a trehalose-6-phosphate phosphatase and may act at the interface between developmental and metabolic processes. Deep sequencing of digital gene expression libraries, representing three biological replicate ear samples from wild-type and ra3 plants, generated 27 million 20- to 21-nucleotide reads with frequencies spanning 4 orders of magnitude. Unique sequence tags were anchored to 3'-ends of individual transcripts by DpnII and NlaIII digests, which were multiplexed during sequencing. We mapped 86% of nonredundant signature tags to the maize genome, which associated with 37,117 gene models and unannotated regions of expression. In total, 66% of genes were detected by at least nine reads in immature maize ears. We used comparative genomics to leverage existing information from Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) in functional analyses of differentially expressed maize genes. Results from this study provide a basis for the analysis of short-read expression data in maize and resolved specific expression signatures that will help define mechanisms of action for the RA3 gene.

  5. Oxygen tension affects lubricin expression in chondrocytes.

    PubMed

    Hatta, Taku; Kishimoto, Koshi N; Okuno, Hiroshi; Itoi, Eiji

    2014-10-01

    We assessed the effects of oxygen tension on lubricin expression in bovine chondrocytes and cartilage explants and a role for hypoxia-inducible transcription factor (HIF)-1α in regulating lubricin expression was investigated using a murine chondroprogenitor cell line, ATDC5, and bovine chondrocytes isolated from superficial and middle/deep zones of femoral cartilage. ATDC5 cells and bovine chondrocytes were cultured in micromass under different oxygen tensions (21%, 5%, and 1%). ATDC5 cells and middle/deep zone chondrocytes that initially had low lubricin expression levels were also cultured with or without transforming growth factor (TGF)-β1. Quantitative reverse transcription (RT)-PCR was used to determine lubricin and chondrogenic marker gene mRNA levels and immunohistochemistry was used to assess lubricin protein expression. Explant cartilage plugs cultured under different oxygen tensions were also subjected to immunohistological analysis for lubricin. HIF-1α gene silencing was achieved by electroporatic transfer into ATDC5 cells. A low oxygen tension reduced lubricin gene expression levels in bovine superficial chondrocytes, TGF-β1-treated middle/deep zone chondrocytes, and TGF-β1-treated ATDC5 cells. Lubricin expression in explant cartilage was also suppressed under hypoxia. HIF-1α gene silencing in ATDC5 cells attenuated the lubricin expression response to the oxygen tension. These results corroborate with previous studies that the oxygen tension regulates lubricin gene expression and suggest that HIF-1α plays an important role in this regulation. The normal distribution of lubricin in articular cartilage may be due to the hypoxic oxygen environment of cartilage as it is an avascular tissue. An oxygen tension gradient may be a key factor for engineering cartilage tissue with a layered morphology.

  6. Human Lacrimal Gland Gene Expression

    PubMed Central

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian

    2017-01-01

    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151

  7. Abiotic stresses differentially affect the expression of O-methyltransferase genes related to methoxypyrazine biosynthesis in seeded and parthenocarpic fruits of Vitis vinifera (L.).

    PubMed

    Vallarino, José G; Gainza-Cortés, Felipe; Verdugo-Alegría, Claudio; González, Enrique; Moreno, Yerko M

    2014-07-01

    MPs (3-alkyl-2-methoxypyrazines) are grape-derived aroma compounds that are associated with detrimental herbaceous flavours in some wines. It is well known that several viticultural and environmental parameters can modulate MP concentrations in grapes, although comprehensive molecular studies have not been conducted in this field. Although the biosynthesis pathway of MPs has not been fully elucidated, four Vitis vinifera O-methyltransferase genes (VvOMT1-4) have been related to be involved in MP biosynthesis. We assessed whether different abiotic stresses induction have an impact on MP levels in grapes and wines from seeded and parthenocarpic fruits. Our results show that the timing of VvOMT3 expression is associated with the period of MPs accumulation in seeded fruits during both abiotic stresses, whereas no association was found in parthenocarpic fruits. These results are discussed in the context of how different viticultural practices can modulate VvOMT gene expression, which has a direct impact on MPs levels in wines.

  8. Digital gene expression signatures for maize development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genome-wide expression signatures detect specific perturbations in developmental programs and contribute to functional resolution of key regulatory networks. In maize (Zea mays) inflorescences, mutations in the RAMOSA (RA) genes affect determinacy of axillary meristems and thus alter branching patt...

  9. Wakame and Nori in restructured meats included in cholesterol-enriched diets affect the antioxidant enzyme gene expressions and activities in Wistar rats.

    PubMed

    Moreira, Adriana Schultz; González-Torres, Laura; Olivero-David, Raul; Bastida, Sara; Benedi, Juana; Sánchez-Muniz, Francisco J

    2010-09-01

    The effects of diets including restructured meats (RM) containing Wakame or Nori on total liver glutathione status, and several antioxidant enzyme gene expressions and activities were tested. Six groups of ten male growing Wistar rats each were fed a mix of 85% AIN-93 M diet and 15% freeze-dried RM for 35 days. The control group (C) consumed control RM, the Wakame (W) and the Nori (N) groups, RM with 5% Wakame and 5% Nori, respectively. Animals on added cholesterol diets (CC, CW, and CN) consumed their corresponding basal diets added with cholesterol (2%) and cholic acid (0.4%). Alga and dietary cholesterol significantly interact (P < 0.002) influencing all enzyme expressions but not activities. The cholesterol supplement decreased most enzyme expression and activity. W-RM vs. C-RM increased (P < 0.05) expression of GPx, GR, Mn-SOD, and Cu,Zn-SOD and decreased that of catalase. N-RM vs. C-RM increased (P < 0.05) expression of catalase and Mn-SOD. GR activity increased in W-RM rats while SOD activity increased, but that of Se-GPx decreased in N animals. W-RM increased total and reduced glutathione and decreased the redox index. CN diet induced significantly lower plasma cholesterol levels (P < 0.001) than the CW diet. In conclusion, Nori-RM is a hypocholesterolemic food while Wakame-RM is an antioxidant food. This should be taken into account when including this kind of RM as potential functional foods in human.

  10. Evidence for regulatory genes on mouse chromosome 7 that affect the quantitative expression of proteins in the fetal and newborn liver.

    PubMed Central

    Giometti, C S; Gemmell, M A; Taylor, J; Tollaksen, S L; Angeletti, R; Gluecksohn-Waelsch, S

    1992-01-01

    A series of deletions around the albino locus on mouse chromosome 7 is believed to include one or more regulatory genes that control the activities of a cluster of liver enzymes. To further characterize the functions of this region of the mouse genome, we have used quantitative two-dimensional electrophoresis to analyze the effects of two of these deletions, c3H and c14CoS, on the expression of liver proteins. More than 400 distinct protein gene products were quantitated in livers from fetal and newborn wild-type homozygous (cch/cch), heterozygous (cch/c3H or cch/c14CoS), and deletion homozygous (c3H/c3H or c14CoS/c14CoS) mice. Livers of fetal and newborn c3H heterozygotes and homozygous wild-type littermates produced qualitatively identical protein patterns after two-dimensional electrophoresis. In livers of c3H homozygous fetuses, however, abnormal amounts (either increased or decreased relative to homozygous wild-type and heterozygous littermates) of 29 proteins were found. Twenty-eight of these 29 protein anomalies were also found in livers of newborn c3H homozygotes. Livers of fetal and newborn mice homozygous for the c14CoS deletion, which overlaps the c3H deletion and produces a similar phenotype, expressed normal amounts of these proteins. One of the 29 proteins (MSN807) has an amino-terminal sequence similar to a 23-kDa translationally controlled protein abundant in mouse erythroleukemia and sarcoma-180 cells. These results suggest that normal chromosome 7 contains genes, located within the region of the c3H but not the c14CoS deletion, that regulate the abundance of specific proteins in the liver. These proteins cannot be related to the phenotypic alterations shared by the c3H and c14CoS deletions. Images PMID:1549608

  11. Cinnamaldehyde, Carvacrol and Organic Acids Affect Gene Expression of Selected Oxidative Stress and Inflammation Markers in IPEC-J2 Cells Exposed to Salmonella typhimurium.

    PubMed

    Burt, Sara A; Adolfse, Simone J M; Ahad, Dina S A; Tersteeg-Zijderveld, Monique H G; Jongerius-Gortemaker, Betty G M; Post, Jan A; Brüggemann, Holger; Santos, Regiane R

    2016-12-01

    Essential oils and organic acids are used as feed additives to improve health status and reduce colonization with pathogens. Although bactericidal in vitro, concentrations achieved in the animal gut are probably not lethal to pathogens. The aim of this study was to investigate the effects of cinnamaldehyde, carvacrol and cinnamic, lactic and propionic acids on the ability of Salmonella typhimurium ATCC 14028 (ST) to invade intestinal epithelial cells (IPEC-J2) and on the expression levels of immune related genes in the cells. The minimum inhibitory concentration (MIC) and non-inhibitory concentration (NIC) were determined and influence on the invasion capacity of ST was investigated. The structure of fimbriae and flagella was analysed by electron microscopy, and expression levels of HSP70, IkBa, IL-8 and IL-10 in the IPEC-J2 cells were carried out by q-PCR. Cinnamaldehyde, carvacrol and cinnamic and propionic acids inhibited ST invasion but not cell viability, bacterial viability and motility or the development of flagella. Propionic acid and cinnamaldehyde in combination with cinnamic acid caused structural impairment of fimbriae. Cinnamaldehyde up-regulated expression of HSP70 irrespective of the presence of organic acids or ST; exposure to carvacrol induced HSP70 only in the presence of propionic acid and ST. © 2016 The Authors. Phytotherapy Research published by John Wiley & Sons Ltd.

  12. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C

    2000-01-01

    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  13. Developmental stimuli and stress factors affect expression of ClGLP1, an emerging allergen-related gene in Citrus limon.

    PubMed

    Bruno, Leonardo; Spadafora, Natasha Damiana; Iaria, Domenico; Chiappetta, Adriana; Bitonti, Maria Beatrice

    2014-06-01

    Germins and germin-like proteins (GLPs) constitute an ubiquitous family of plant proteins that seem to be involved in many developmental and stress related processes. A novel GLP cDNA was isolated from Citrus limon and structural features and genomic organization were investigated by in silico and Southern blots analysis. In lemon, the ClGLP1 encodes a 24.38 kDa which possesses a conserved motif of plant GLPs proteins. A phylogetic analysis mapped ClGLP1 as belonging to the GER3 subfamily into the GLP1 group of large GLP family. ClGLP1 was differentially expressed in the various organs and was highest in mature fruit. Moreover, expression in the fruit was tissue- and stage-related as well as dependent on agricultural practice (organic vs conventional). ClGLP1 transcripts increased during the transition from the green (180 days after blooming) to the yellow (240 days after blooming) mature fruit and were strongly enhanced in yellow mature fruit from organic compared with conventional culture. A sudden and systemic increase in ClGLP1 expression level was observed in leaves injured by wounding, together with an increase of endogenous H2O2 amount. Notably, an enhancement of H202 was observed in fruit peel during transition from green to yellow fruit stage. All together our data showed that ClGLP1 expression can be modulated in relation to both developmental stimuli and culture practices; evidence is also provided that through an oxidase activity this gene could play a role in fruit maturation as well as in stress responses.

  14. Monoallelic Gene Expression in Mammals.

    PubMed

    Chess, Andrew

    2016-11-23

    Monoallelic expression not due to cis-regulatory sequence polymorphism poses an intriguing problem in epigenetics because it requires the unequal treatment of two segments of DNA that are present in the same nucleus and that can indeed have absolutely identical sequences. Here, I focus on a few recent developments in the field of monoallelic expression that are of particular interest and raise interesting questions for future work. One development is regarding analyses of imprinted genes, in which recent work suggests the possibility that intriguing networks of imprinted genes exist and are important for genetic and physiological studies. Another issue that has been raised in recent years by a number of publications is the question of how skewed allelic expression should be for it to be designated as monoallelic expression and, further, what methods are appropriate or inappropriate for analyzing genomic data to examine allele-specific expression. Perhaps the most exciting recent development in mammalian monoallelic expression is a clever and carefully executed analysis of genetic diversity of autosomal genes subject to random monoallelic expression (RMAE), which provides compelling evidence for distinct evolutionary forces acting on random monoallelically expressed genes.

  15. Tuning noise in gene expression.

    PubMed

    Tyagi, Sanjay

    2015-05-05

    The relative contribution of promoter architecture and the associated chromatin environment in regulating gene expression noise has remained elusive. In their recent work, Arkin, Schaffer and colleagues (Dey et al, 2015) show that mean expression and noise for a given promoter at different genomic loci are uncorrelated and influenced by the local chromatin environment.

  16. Temperature affects sexual maturation through the control of kisspeptin, kisspeptin receptor, GnRH and GTH subunit gene expression in the grass puffer during the spawning season.

    PubMed

    Shahjahan, Md; Kitahashi, Takashi; Ando, Hironori

    2017-03-01

    Water temperature is an environmental factor of primary importance that influences reproductive function in fish. To understand the molecular and physiological mechanisms underlying the regulation of reproduction by temperature, we examined changes in expression of genes encoding kisspeptin (kiss2), kisspeptin receptor (kiss2r) and three gonadotropin-releasing hormones (gnrh1, gnrh2 and gnrh3) in the brain and genes encoding gonadotropin (GTH) subunits (gpa, fshb and lhb) in the pituitary of grass puffer exposed to a low temperature (14°C), normal temperature (21°C) and high temperature (28°C) for 7days. In addition, the plasma levels of cortisol were examined after exposed to three temperature conditions. The gonadosomatic index was significantly decreased in both low and high temperature conditions. The levels of kiss2 and kiss2r mRNAs were significantly decreased at both low and high temperature conditions compared to normal temperature (control) condition. gnrh1 but not gnrh2 were significantly decreased in both temperature conditions, while gnrh3 showed a decreasing tendency in low temperature. Consequently, the levels of fshb and lhb mRNAs were significantly decreased in both low and high temperature conditions. Interestingly, the plasma levels of cortisol were significantly increased in low temperature but remain unchanged in high temperature, suggesting that the fish were under stress in the low temperature conditions but not in the high temperature conditions. Taken together, the present results indicate that anomalous temperature have an inhibitory effect on reproductive function through suppressing kiss2/kiss2r/gnrh1/fshb and lhb expression and these changes may occur in a normal physiological response as well as in a malfunctional stress response.

  17. ZFP57 maintains the parent-of-origin-specific expression of the imprinted genes and differentially affects non-imprinted targets in mouse embryonic stem cells

    PubMed Central

    Riso, Vincenzo; Cammisa, Marco; Kukreja, Harpreet; Anvar, Zahra; Verde, Gaetano; Sparago, Angela; Acurzio, Basilia; Lad, Shraddha; Lonardo, Enza; Sankar, Aditya; Helin, Kristian; Feil, Robert; Fico, Annalisa; Angelini, Claudia; Grimaldi, Giovanna; Riccio, Andrea

    2016-01-01

    ZFP57 is necessary for maintaining repressive epigenetic modifications at Imprinting control regions (ICRs). In mouse embryonic stem cells (ESCs), ZFP57 binds ICRs (ICRBS) and many other loci (non-ICRBS). To address the role of ZFP57 on all its target sites, we performed high-throughput and multi-locus analyses of inbred and hybrid mouse ESC lines carrying different gene knockouts. By using an allele-specific RNA-seq approach, we demonstrate that ZFP57 loss results in derepression of the imprinted allele of multiple genes in the imprinted clusters. We also find marked epigenetic differences between ICRBS and non-ICRBS suggesting that different cis-acting regulatory functions are repressed by ZFP57 at these two classes of target loci. Overall, these data demonstrate that ZFP57 is pivotal to maintain the allele-specific epigenetic modifications of ICRs that in turn are necessary for maintaining the imprinted expression over long distances. At non-ICRBS, ZFP57 inactivation results in acquisition of epigenetic features that are characteristic of poised enhancers, suggesting that another function of ZFP57 in early embryogenesis is to repress cis-acting regulatory elements whose activity is not yet required. PMID:27257070

  18. A nuclear-localized protein, KOLD SENSITIV-1, affects the expression of cold-responsive genes during prolonged chilling in Arabidopsis.

    PubMed

    Purdy, Sarah J; Bussell, John D; Nelson, David C; Villadsen, Dorthe; Smith, Steven M

    2011-02-15

    Plants respond to cold by transcriptional and metabolic responses which underlie tolerance and acclimation mechanisms, but details at the molecular level are incomplete. Here we describe KOLD SENSITIV-1 (KOS1), a new gene required for responses to cold. KOS1 protein is predicted to have coiled-coil, Structural Maintenance of Chromosomes and nuclear-targeting domains. GFP-labeled KOS1 localizes to the nucleus. Null mutants could not be isolated but two independent knockdown T-DNA mutants were obtained. Growth and development of kos1 knockdown mutant plants was comparable to wild type when grown at 21°C. However, when grown at 4°C these mutants exhibited accelerated leaf yellowing and smaller rosette size than wild type. Quantitative RT-PCR revealed that in the cold kos1 mutants had reduced expression of cold-responsive transcripts COR15A, COR15B, BAM3 and AMY3. Metabolite profiling revealed that ascorbate levels were lower in the mutants in the cold relative to wild type. KOS1 therefore represents a new gene that influences the regulation of transcript and metabolite levels in response to prolonged chilling temperatures.

  19. Fto-Deficiency Affects the Gene and MicroRNA Expression Involved in Brown Adipogenesis and Browning of White Adipose Tissue in Mice.

    PubMed

    Ronkainen, Justiina; Mondini, Eleonora; Cinti, Francesca; Cinti, Saverio; Sebért, Sylvain; Savolainen, Markku J; Salonurmi, Tuire

    2016-11-07

    Genetic variants in the fat mass- and obesity-associated gene Fto are linked to the onset of obesity in humans. The causal role of the FTO protein in obesity is supported by evidence obtained from transgenic mice; however, the underlying molecular pathways pertaining to the role of FTO in obesity have yet to be established. In this study, we investigate the Fto gene in mouse brown adipose tissue and in the browning process of white adipose tissue. We analyze distinct structural and molecular factors in brown and white fat depots of Fto-deficient mice under normal and obesogenic conditions. We report significant alterations in the morphology of adipose tissue depots and the expression of mRNA and microRNA related to brown adipogenesis and metabolism in Fto-deficient mice. Furthermore, we show that high-fat feeding does not attenuate the browning process of Fto-deficient white adipose tissue as observed in wild-type tissue, suggesting a triggering effect of the FTO pathways by the dietary environment.

  20. Nitrate affects sensu-stricto germination of after-ripened Sisymbrium officinale seeds by modifying expression of SoNCED5, SoCYP707A2 and SoGA3ox2 genes.

    PubMed

    Carrillo-Barral, Néstor; Matilla, Angel J; Rodríguez-Gacio, María del Carmen; Iglesias-Fernández, Raquel

    2014-03-01

    The influence of nitrate upon the germination of Sisymbrium officinale seeds is not entirely controlled by after-ripening (AR), a process clearly influenced by nitrate. Recently, we have reported that nitrate affects sensu-stricto germination of non-AR (AR0) seeds by modifying the expression of crucial genes involved in the metabolism of GA and ABA. In this study, we demonstrate that nitrate affects also the germination of AR seeds because: (i) the AR negatively alters the ABA sensitivity being the seed more ABA-sensible as the AR is farthest from optimal (AR0 and AR20 versus AR7); in the presence of diniconazole (DZ), a competitive inhibitor of ABA 8'-hydroxylase, testa rupture is affected while the endosperm rupture is not. (ii) AR7 seed-coat rupture is not inhibited by paclobutrazol (PBZ) suggesting that nitrate can act by a mechanism GA-independent. (iii) The germination process is accelerated by nitrate, most probably by the increase in the expression of SoNCED5, SoCYP707A2 and SoGA3ox2 genes. Taken together, these and previous results demonstrate that nitrate promotes germination of AR and non-AR seeds through transcriptional changes of different genes involved in ABA and GA metabolism.

  1. Ectopic expression of foxtail millet zip-like gene, SiPf40, in transgenic rice plants causes a pleiotropic phenotype affecting tillering, vascular distribution and root development.

    PubMed

    Luan, Yunxia; Wang, Baosheng; Zhao, Qian; Ao, Guangming; Yu, Jingjuan

    2010-12-01

    Plant architecture determines grain production in rice (Oryza sativa) and is affected by important agronomic traits such as tillering, plant height, and panicle morphology. Many key genes involved in controlling the initiation and outgrowth of axillary buds, the elongation of stems, and the architecture of inflorescences have been isolated and analyzed. Previous studies have shown that SiPf40, which was identified from a foxtail millet (Setaria italica) immature seed cDNA library, causes extra branches and tillers in SiPf40-transgenic tobacco and foxtail millet, respectively. To reconfirm its function, we generated transgenic rice plants overexpressing SiPf40 under the control of the ubiquitin promoter. SiPf40-overexpressing transgenic plants have a greater tillering number and a wider tiller angle than wild-type plants. Their root architecture is modified by the promotion of lateral root development, and the distribution of xylem and phloem in the vascular bundle is affected. Analysis of hormone levels showed that the ratios of indole-3-acetic acid/zeatin (IAA/ZR) and IAA/gibberellic acid (IAA/GA) decreased in SiPf40-transgenic plants compared with wild-type plants. These findings strongly suggest that SiPf40 plays an important role in plant architecture.

  2. Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy

    PubMed Central

    Voogd, Charlotte; Wang, Tianchi; Varkonyi-Gasic, Erika

    2015-01-01

    The MADS-domain transcription factor SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1) is one of the key integrators of endogenous and environmental signals that promote flowering in the annual species Arabidopsis thaliana. In the deciduous woody perennial vine kiwifruit (Actinidia spp.), environmental signals are integrated to regulate annual cycles of growth and dormancy. Accumulation of chilling during winter is required for dormancy break and flowering in spring. In order to understand the regulation of dormancy and flowering in kiwifruit, nine kiwifruit SOC1-like genes were identified and characterized. All genes affected flowering time of A. thaliana Col-0 and were able to rescue the late flowering phenotype of the soc1-2 mutant when ectopically expressed. A differential capacity for homodimerization was observed, but all proteins were capable of strong interactions with SHORT VEGETATIVE PHASE (SVP) MADS-domain proteins. Largely overlapping spatial domains but distinct expression profiles in buds were identified between the SOC1-like gene family members. Ectopic expression of AcSOC1e, AcSOC1i, and AcSOC1f in Actinidia chinensis had no impact on establishment of winter dormancy and failed to induce precocious flowering, but AcSOC1i reduced the duration of dormancy in the absence of winter chilling. These findings add to our understanding of the SOC1-like gene family and the potential diversification of SOC1 function in woody perennials. PMID:25979999

  3. Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy.

    PubMed

    Voogd, Charlotte; Wang, Tianchi; Varkonyi-Gasic, Erika

    2015-08-01

    The MADS-domain transcription factor SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1) is one of the key integrators of endogenous and environmental signals that promote flowering in the annual species Arabidopsis thaliana. In the deciduous woody perennial vine kiwifruit (Actinidia spp.), environmental signals are integrated to regulate annual cycles of growth and dormancy. Accumulation of chilling during winter is required for dormancy break and flowering in spring. In order to understand the regulation of dormancy and flowering in kiwifruit, nine kiwifruit SOC1-like genes were identified and characterized. All genes affected flowering time of A. thaliana Col-0 and were able to rescue the late flowering phenotype of the soc1-2 mutant when ectopically expressed. A differential capacity for homodimerization was observed, but all proteins were capable of strong interactions with SHORT VEGETATIVE PHASE (SVP) MADS-domain proteins. Largely overlapping spatial domains but distinct expression profiles in buds were identified between the SOC1-like gene family members. Ectopic expression of AcSOC1e, AcSOC1i, and AcSOC1f in Actinidia chinensis had no impact on establishment of winter dormancy and failed to induce precocious flowering, but AcSOC1i reduced the duration of dormancy in the absence of winter chilling. These findings add to our understanding of the SOC1-like gene family and the potential diversification of SOC1 function in woody perennials.

  4. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O

    2005-01-01

    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  5. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  6. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  7. The expression of cell proliferation-related genes in early developing flowers is affected by a fruit load reduction in tomato plants.

    PubMed

    Baldet, Pierre; Hernould, Michel; Laporte, Frédéric; Mounet, Fabien; Just, Daniel; Mouras, Armand; Chevalier, Christian; Rothan, Christophe

    2006-01-01

    Changes in photoassimilate partitioning between source and sink organs significantly affect fruit development and size. In this study, a comparison was made of tomato plants (Solanum lycopersicum L.) grown under a low fruit load (one fruit per truss, L1 plants) and under a standard fruit load (five fruits per truss, L5 plants), at morphological, biochemical, and molecular levels. Fruit load reduction resulted in increased photoassimilate availability in the plant and in increased growth rates in all plant organs analysed (root, stem, leaf, flower, and fruit). Larger flower and fruit size in L1 plants were correlated with higher cell number in the pre-anthesis ovary. This was probably due to the acceleration of the flower growth rate since other flower developmental parameters (schedule and time-course) remained otherwise unaffected. Using RT-PCR, it was shown that the transcript levels of CYCB2;1 (cyclin) and CDKB2;1 (cyclin-dependent kinase), two mitosis-specific genes, strongly increased early in developing flower buds. Remarkably, the transcript abundance of CYCD3;1, a D-type cyclin potentially involved in cell cycle regulation in response to mitogenic signals, also increased by more than 5-fold at very early stages of L1 flower development. By contrast, transcripts from fw2.2, a putative negative regulator of cell division in tomato fruit, strongly decreased in developing flower bud, as confirmed by in situ hybridization studies. Taken together, these results suggest that changes in carbohydrate partitioning could control fruit size through the regulation of cell proliferation-related genes at very early stages of flower development.

  8. Affective Scaffolds, Expressive Arts, and Cognition

    PubMed Central

    Maiese, Michelle

    2016-01-01

    Some theorists have argued that elements of the surrounding world play a crucial role in sustaining and amplifying both cognition and emotion. Such insights raise an interesting question about the relationship between cognitive and affective scaffolding: in addition to enabling the realization of specific affective states, can an affective niche also enable the realization of certain cognitive capacities? In order to gain a better understanding of this relationship between affective niches and cognition, I will examine the use of expressive arts in the context of psychotherapy and peacebuilding. In these settings, environmental resources and interpersonal scaffolds not only evoke emotion and encourage the adoption of particular bodily affective styles, but also support the development of capacities for self-awareness and interpersonal understanding. These affective scaffolds play a crucial role in therapy and peacebuilding, in fact, insofar as they facilitate the development of self-knowledge, enhance capacities associated with social cognition, and build positive rapport and trust among participants. I will argue that this is because affectivity is linked to the way that subjects frame and attend to their surroundings. Insofar as the regulation and modification of emotion goes hand in hand with opening up new interpretive frames and establishing new habits of mind, the creation of an affective niche can contribute significantly to various modes of cognition. PMID:27014164

  9. Transgenic Arabidopsis Gene Expression System

    NASA Technical Reports Server (NTRS)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  10. Zipf's Law in Gene Expression

    NASA Astrophysics Data System (ADS)

    Furusawa, Chikara; Kaneko, Kunihiko

    2003-02-01

    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  11. Sodium perchlorate disrupts development and affects metamorphosis- and growth-related gene expression in tadpoles of the wood frog (Lithobates sylvaticus).

    PubMed

    Bulaeva, Elizabeth; Lanctôt, Chantal; Reynolds, Leslie; Trudeau, Vance L; Navarro-Martín, Laia

    2015-10-01

    Numerous endocrine disrupting chemicals can affect the growth and development of amphibians. We investigated the effects of a targeted disruption of the endocrine axes modulating development and somatic growth. Wood frog (Lithobates sylvaticus) tadpoles were exposed for 2weeks (from developmental Gosner stage (Gs) 25 to Gs30) to sodium perchlorate (SP, thyroid inhibitor, 14mg/L), estradiol (E2, known to alter growth and development, 200nM) and a reduced feeding regime (RF, to affect growth and development in a chemically-independent manner). All treatments experienced developmental delay, and animals exposed to SP or subjected to RF respectively reached metamorphic climax (Gs42) approximately 11(±3) and 17(±3) days later than controls. At Gs42, only SP-treated animals showed increased weight and snout-vent length (P<0.05) relative to controls. Tadpoles treated with SP had 10-times higher levels of liver igf1 mRNA after 4days of exposure (Gs28) compared to controls. Tadpoles in the RF treatment expressed 6-times lower levels of liver igf1 mRNA and 2-times higher liver igf1r mRNA (P<0.05) at Gs30. Tadpoles treated with E2 exhibited similar developmental and growth patterns as controls, but had increased liver igf1 mRNA levels at Gs28, and tail igf1r at Gs42. Effects on tail trβ mRNA levels were detected in SP-treated tadpoles at Gs42, 40days post-exposure, suggesting that the chemical inhibition of thyroid hormone production early in development can have long-lasting effects. The growth effects observed in the SP-exposed animals suggest a relationship between TH-dependent development and somatic growth in L. sylvaticus tadpoles.

  12. Major genes affecting ovulation rate in sheep

    PubMed Central

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection. PMID:15601592

  13. Major genes affecting ovulation rate in sheep.

    PubMed

    Davis, George Henry

    2005-01-01

    Research conducted since 1980 in relation to inheritance patterns and DNA testing of major genes for prolificacy has shown that major genes have the potential to significantly increase the reproductive performance of sheep flocks throughout the world. Mutations that increase ovulation rate have been discovered in the BMPR-1B, BMP15 and GDF9 genes, and others are known to exist from the expressed inheritance patterns although the mutations have not yet been located. In the case of BMP15, four different mutations have been discovered but each produces the same phenotype. The modes of inheritance of the different prolificacy genes include autosomal dominant genes with additive effects on ovulation rate (BMPR-1B; Lacaune), autosomal over-dominant genes with infertility in homozygous females (GDF9), X-linked over-dominant genes with infertility in homozygous females (BMP15), and X-linked maternally imprinted genes (FecX2). The size of the effect of one copy of a mutation on ovulation rate ranges from an extra 0.4 ovulations per oestrus for the FecX2 mutation to an extra 1.5 ovulations per oestrus for the BMPR-1B mutation. A commercial DNA testing service enables some of these mutations to be used in genetic improvement programmes based on marker assisted selection.

  14. Darkness affects differentially the expression of plastid-encoded genes and delays the senescence-induced down-regulation of chloroplast transcription in cotyledons of Cucurbita pepo L. (Zucchini).

    PubMed

    Mishev, Kiril; Dimitrova, Anna; Ananiev, Evguéni D

    2011-01-01

    In contrast to differentiated leaves, the regulatory mechanisms of chloroplast gene expression in darkened cotyledons have not been elucidated. Although some results have been reported indicating accelerated senescence in Arabidopsis upon reillumination, the capacity of cotyledons to recover after dark stress remains unclear. We analysed the effect of two-days dark stress, applied locally or at the whole-plant level, on plastid gene expression in zucchini cotyledons. Our results showed that in the dark the overall chloroplast transcription rate was much more inhibited than the nuclear run-on transcription. While the activities of the plastid-encoded RNA polymerase (PEP) and nuclear RNA polymerase II were strongly reduced, the activities of the nuclear-encoded plastid RNA polymerase (NEP) and nuclear RNA polymerase I were less affected. During recovery upon reillumination, chloroplast transcription in the cotyledons was strongly stimulated (3-fold) compared with the naturally senescing controls, suggesting delayed senescence. Northern blot and dot blot analyses of the expression of key chloroplast-encoded photosynthetic genes showed that in contrast to psbA, which remained almost unaffected, both the transcription rate and mRNA content of psaB and rbcL were substantially decreased.

  15. The nature of the nitrogen source added to nitrogen depleted vinifications conducted by a Saccharomyces cerevisiae strain in synthetic must affects gene expression and the levels of several volatile compounds.

    PubMed

    Jiménez-Martí, Elena; Aranda, Agustín; Mendes-Ferreira, Alexandra; Mendes-Faia, Arlete; del Olmo, Marcel Lí

    2007-07-01

    Nitrogen starvation may lead to stuck and sluggish fermentations. These undesirable situations result in wines with high residual sugar, longer vinification times, and risks of microbial contamination. The typical oenological method to prevent these problems is the early addition of ammonium salts to the grape juice, although excessive levels of these compounds may lead to negative consequences for the final product. This addition reduces the overall fermentation time, regardless of the time of addition, but the effect is more significant when nitrogen is added during the yeast exponential phase. In this work we analysed the effect of adding different nitrogen sources (ammonia, amino acids or a combination of both) under nitrogen depletion in order to understand yeast metabolic changes that lead to the adaptation to the new conditions. These studies were carried out in a synthetic must that mimics the composition of the natural must. Furthermore, we studied how this addition affects fermentative behaviour, the levels of several yeast volatile compounds in the final product, arginase activity, and the expression of several genes involved in stress response and nitrogen metabolism during vinification. We found that the nature of the nitrogen source added during yeast late exponential growth phase introduces changes to the volatile compounds profile and to the gene expression. On the other hand, arginase activity and the expression of the stress response gene ACA1 are useful to monitor nitrogen depletion/addition during growth of the wine yeast considered under our vinification conditions.

  16. [Imprinting genes and it's expression in Arabidopsis].

    PubMed

    Zhang, Hong-Yu; Xu, Pei-Zhou; Yang, Hua; Wu, Xian-Jun

    2010-07-01

    Genomic imprinting refers to the phenomenon that the expression of a gene copy depends on its parent of origin. The Arabidopsis imprinted FIS (Fertilisation-independent seed) genes, mea, fis2, and fie, play essential roles in the repression of central cell and the regulation of early endosperm development. fis mutants display two phenotypes: autonomous diploid endosperm development when fertilization is absent and un-cellularised endosperm formation when fertilization occurs. The FIS Polycomb protein complex including the above three FIS proteins catalyzes histone H3 K27 tri-methylation on target loci. DME (DEMETER), a DNA glycosylase, and AtMET1 (Methyltransferase1), a DNA methyltransferase, are involved in the regulation of imprinted expression of both mea and fis2. This review summarizes the studies on the Arabidopsis imprinted FIS genes and other related genes. Recent works have shown that the insertion of transposons may affect nearby gene expression, which may be the main driving force behind the evolution of genomic imprinting. This summary covers the achievements on Arabidopsis imprinted genes will provide important information for studies on genomic imprinting in the important crops such as rice and maize.

  17. Paternal exposure to testis cancer chemotherapeutics alters sperm fertilizing capacity and affects gene expression in the eight-cell stage rat embryo.

    PubMed

    Maselli, J; Hales, B F; Robaire, B

    2014-03-01

    Treatment of testicular cancer includes the coadministration of bleomycin, etoposide and cis-platinum (BEP); however, along with its therapeutic benefit, BEP exposure results in extensive reproductive chemotoxic effects, including alterations to sperm chromatin integrity. As an intact paternal genome is essential for successful fertilization and embryogenesis, we assessed the effect of paternal exposure to BEP on sperm fertilization capacity and the resulting consequences on early embryonic gene expression. Adult male Brown Norway rats received a 9-week treatment with BEP or saline and then were sacrificed immediately or subject to a 9-week recovery period. HSP90AA1, HSP90B1 and PDIA3, involved in spermatozoa-egg interactions, were overexpressed in BEP-exposed spermatozoa after the 9-week treatment period; overexpression was also observed in spermatozoa from BEP-treated rats after 9 weeks of recovery. These proteins were localized to the plasma membrane of the sperm head; this localization may facilitate their role in spermatozoa-egg interactions as the highest staining intensities were observed in capacitated spermatozoa. The fertilization potential of spermatozoa was determined by in vitro fertilization with oocytes from unexposed naturally cycling female rats. Interestingly, the fertilization potential of spermatozoa following a 9-week recovery period from BEP treatment was significantly enhanced compared with controls. Moreover, stem cell transcription factors, involved in the regulation of a plethora of early embryonic events, were upregulated by more than twofold in eight-cell stage embryos sired by BEP recovery males compared with controls; this suggests that there are potential deleterious effects on embryo development well after termination of BEP exposure.

  18. Regulation of ABO gene expression.

    PubMed

    Kominato, Yoshihiko; Hata, Yukiko; Matsui, Kazuhiro; Takizawa, Hisao

    2005-07-01

    The ABO blood group system is important in blood transfusions and in identifying individuals during criminal investigations. Two carbohydrate antigens, the A and B antigens, and their antibodies constitute this system. Although biochemical and molecular genetic studies have demonstrated the molecular basis of the histo-blood group ABO system, some aspects remain to be elucidated. To explain the molecular basis of how the ABO genes are controlled in cell type-specific expression, during normal cell differentiation, and in cancer cells with invasive and metastatic potential that lack A/B antigens, it is essential to understand the regulatory mechanism of ABO gene transcription. We review the transcriptional regulation of the ABO gene, including positive and negative elements in the upstream region of the gene, and draw some inferences that help to explain the phenomena described above.

  19. Gene expression profile of pulpitis

    PubMed Central

    Galicia, Johnah C.; Henson, Brett R.; Parker, Joel S.; Khan, Asma A.

    2016-01-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the Significance Analysis of Microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (≥30mm on VAS) compared to those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology. PMID:27052691

  20. Gene expression profile of pulpitis.

    PubMed

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A

    2016-06-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology.

  1. Engineering Genes for Predictable Protein Expression

    PubMed Central

    Gustafsson, Claes; Minshull, Jeremy; Govindarajan, Sridhar; Ness, Jon; Villalobos, Alan; Welch, Mark

    2013-01-01

    The DNA sequence used to encode a polypeptide can have dramatic effects on its expression. Lack of readily available tools has until recently inhibited meaningful experimental investigation of this phenomenon. Advances in synthetic biology and the application of modern engineering approaches now provide the tools for systematic analysis of the sequence variables affecting heterologous expression of recombinant proteins. We here discuss how these new tools are being applied and how they circumvent the constraints of previous approaches, highlighting some of the surprising and promising results emerging from the developing field of gene engineering. PMID:22425659

  2. Engineering genes for predictable protein expression.

    PubMed

    Gustafsson, Claes; Minshull, Jeremy; Govindarajan, Sridhar; Ness, Jon; Villalobos, Alan; Welch, Mark

    2012-05-01

    The DNA sequence used to encode a polypeptide can have dramatic effects on its expression. Lack of readily available tools has until recently inhibited meaningful experimental investigation of this phenomenon. Advances in synthetic biology and the application of modern engineering approaches now provide the tools for systematic analysis of the sequence variables affecting heterologous expression of recombinant proteins. We here discuss how these new tools are being applied and how they circumvent the constraints of previous approaches, highlighting some of the surprising and promising results emerging from the developing field of gene engineering.

  3. Regulation of Calreticulin Gene Expression by Calcium

    PubMed Central

    Waser, Mathilde; Mesaeli, Nasrin; Spencer, Charlotte; Michalak, Marek

    1997-01-01

    We have isolated and characterized a 12-kb mouse genomic DNA fragment containing the entire calreticulin gene and 2.14 kb of the promoter region. The mouse calreticulin gene consists of nine exons and eight introns, and it spans 4.2 kb of genomic DNA. A 1.8-kb fragment of the calreticulin promoter was subcloned into a reporter gene plasmid containing chloramphenicol acetyltransferase. This construct was then used in transient and stable transfection of NIH/ 3T3 cells. Treatment of transfected cells either with the Ca2+ ionophore A23187, or with the ER Ca2+-ATPase inhibitor thapsigargin, resulted in a five- to sevenfold increase of the expression of chloramphenicol acetyltransferase protein. Transactivation of the calreticulin promoter was also increased by fourfold in NIH/3T3 cells treated with bradykinin, a hormone that induces Ca2+ release from the intracellular Ca2+ stores. Analysis of the promoter deletion constructs revealed that A23187- and thapsigargin-responsive regions are confined to two regions (−115 to −260 and −685 to −1,763) in the calreticulin promoter that contain the CCAAT nucleotide sequences. Northern blot analysis of cells treated with A23187, or with thapsigargin, revealed a fivefold increase in calreticulin mRNA levels. Thapsigargin also induced a fourfold increase in calreticulun protein levels. Importantly, we show by nuclear run-on transcription analysis that calreticulin gene transcription is increased in NIH/3T3 cells treated with A23187 and thapsigargin in vivo. This increase in gene expression required over 4 h of continuous incubation with the drugs and was also sensitive to treatment with cycloheximide, suggesting that it is dependent on protein synthesis. Changes in the concentration of extracellular and cytoplasmic Ca2+ did not affect the increased expression of the calreticulin gene. These studies suggest that stress response to the depletion of intracellular Ca2+ stores induces expression of the calreticulin gene in vitro

  4. Gene expression throughout a vertebrate's embryogenesis

    PubMed Central

    2011-01-01

    Background Describing the patterns of gene expression during embryonic development has broadened our understanding of the processes and patterns that define morphogenesis. Yet gene expression patterns have not been described throughout vertebrate embryogenesis. This study presents statistical analyses of gene expression during all 40 developmental stages in the teleost Fundulus heteroclitus using four biological replicates per stage. Results Patterns of gene expression for 7,000 genes appear to be important as they recapitulate developmental timing. Among the 45% of genes with significant expression differences between pairs of temporally adjacent stages, significant differences in gene expression vary from as few as five to more than 660. Five adjacent stages have disproportionately more significant changes in gene expression (> 200 genes) relative to other stages: four to eight and eight to sixteen cell stages, onset of circulation, pre and post-hatch, and during complete yolk absorption. The fewest differences among adjacent stages occur during gastrulation. Yet, at stage 16, (pre-mid-gastrulation) the largest number of genes has peak expression. This stage has an over representation of genes in oxidative respiration and protein expression (ribosomes, translational genes and proteases). Unexpectedly, among all ribosomal genes, both strong positive and negative correlations occur. Similar correlated patterns of expression occur among all significant genes. Conclusions These data provide statistical support for the temporal dynamics of developmental gene expression during all stages of vertebrate development. PMID:21356103

  5. Does FACS perturb gene expression?

    PubMed

    Richardson, Graham M; Lannigan, Joanne; Macara, Ian G

    2015-02-01

    Fluorescence activated cell sorting is the technique most commonly used to separate primary mammary epithelial sub-populations. Many studies incorporate this technique before analyzing gene expression within specific cellular lineages. However, to our knowledge, no one has examined the effects of fluorescence activated cell sorting (FACS) separation on short-term transcriptional profiles. In this study, we isolated a heterogeneous mixture of cells from the mouse mammary gland. To determine the effects of the isolation and separation process on gene expression, we harvested RNA from the cells before enzymatic digestion, following enzymatic digestion, and following a mock FACS sort where the entire cohort of cells was retained. A strict protocol was followed to minimize disruption to the cells, and to ensure that no subpopulations were enriched or lost. Microarray analysis demonstrated that FACS causes minimal disruptions to gene expression patterns, but prior steps in the mammary cell isolation process are followed by upregulation of 18 miRNA's and rapid decreases in their predicted target transcripts. © 2015 International Society for Advancement of Cytometry.

  6. The Gene Expression Omnibus Database.

    PubMed

    Clough, Emily; Barrett, Tanya

    2016-01-01

    The Gene Expression Omnibus (GEO) database is an international public repository that archives and freely distributes high-throughput gene expression and other functional genomics data sets. Created in 2000 as a worldwide resource for gene expression studies, GEO has evolved with rapidly changing technologies and now accepts high-throughput data for many other data applications, including those that examine genome methylation, chromatin structure, and genome-protein interactions. GEO supports community-derived reporting standards that specify provision of several critical study elements including raw data, processed data, and descriptive metadata. The database not only provides access to data for tens of thousands of studies, but also offers various Web-based tools and strategies that enable users to locate data relevant to their specific interests, as well as to visualize and analyze the data. This chapter includes detailed descriptions of methods to query and download GEO data and use the analysis and visualization tools. The GEO homepage is at http://www.ncbi.nlm.nih.gov/geo/.

  7. Classification of genes based on gene expression analysis

    SciTech Connect

    Angelova, M. Myers, C. Faith, J.

    2008-05-15

    Systems biology and bioinformatics are now major fields for productive research. DNA microarrays and other array technologies and genome sequencing have advanced to the point that it is now possible to monitor gene expression on a genomic scale. Gene expression analysis is discussed and some important clustering techniques are considered. The patterns identified in the data suggest similarities in the gene behavior, which provides useful information for the gene functionalities. We discuss measures for investigating the homogeneity of gene expression data in order to optimize the clustering process. We contribute to the knowledge of functional roles and regulation of E. coli genes by proposing a classification of these genes based on consistently correlated genes in expression data and similarities of gene expression patterns. A new visualization tool for targeted projection pursuit and dimensionality reduction of gene expression data is demonstrated.

  8. Combinatorial engineering for heterologous gene expression.

    PubMed

    Zwick, Friederike; Lale, Rahmi; Valla, Svein

    2013-01-01

    Tools for strain engineering with predictable outcome are of crucial importance for the nascent field of synthetic biology. The success of combining different DNA biological parts is often restricted by poorly understood factors deriving from the complexity of the systems. We have previously identified variants for different regulatory elements of the expression cassette XylS/Pm. When such elements are combined they act in a manner consistent with their individual behavior, as long as they affect different functions, such as transcription and translation. Interestingly, sequence context does not seem to influence the final outcome significantly. Expression of reporter gene bla could be increased up to 75 times at the protein level by combining three variants in one cassette. For other tested reporter genes similar results were obtained, except that the stimulatory effect was quantitatively less. Combination of individually characterized DNA parts thus stands as suitable method to achieve a desired phenotype.

  9. Field plot assessments demonstrate that transgenic plums expressing Plum pox virus (PPV) coat protein gene do not affect the PPV strain composition or produce PPV recombinants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The serological and molecular variability of Plum pox virus (PPV) detected in transgenic plum trees harboring PPV capsid gene versus those found in conventional plums were analyzed. Strain characterization was serologically determined by TAS-ELISA using PPV-D and PPV-M specific monoclonal antibodie...

  10. Harnessing gene expression networks to prioritize candidate epileptic encephalopathy genes.

    PubMed

    Oliver, Karen L; Lukic, Vesna; Thorne, Natalie P; Berkovic, Samuel F; Scheffer, Ingrid E; Bahlo, Melanie

    2014-01-01

    We apply a novel gene expression network analysis to a cohort of 182 recently reported candidate Epileptic Encephalopathy genes to identify those most likely to be true Epileptic Encephalopathy genes. These candidate genes were identified as having single variants of likely pathogenic significance discovered in a large-scale massively parallel sequencing study. Candidate Epileptic Encephalopathy genes were prioritized according to their co-expression with 29 known Epileptic Encephalopathy genes. We utilized developing brain and adult brain gene expression data from the Allen Human Brain Atlas (AHBA) and compared this to data from Celsius: a large, heterogeneous gene expression data warehouse. We show replicable prioritization results using these three independent gene expression resources, two of which are brain-specific, with small sample size, and the third derived from a heterogeneous collection of tissues with large sample size. Of the nineteen genes that we predicted with the highest likelihood to be true Epileptic Encephalopathy genes, two (GNAO1 and GRIN2B) have recently been independently reported and confirmed. We compare our results to those produced by an established in silico prioritization approach called Endeavour, and finally present gene expression networks for the known and candidate Epileptic Encephalopathy genes. This highlights sub-networks of gene expression, particularly in the network derived from the adult AHBA gene expression dataset. These networks give clues to the likely biological interactions between Epileptic Encephalopathy genes, potentially highlighting underlying mechanisms and avenues for therapeutic targets.

  11. Pulmonary Gene Expression Profiling of Inhaled Ricin

    DTIC Science & Technology

    2007-11-02

    in which 34 genes had statistically significant changes in gene expression. Transcripts identified by the assay included those that facilitate...gene expression. Transcripts identified by the assay included those that facilitate tissue healing (early growth response gene (egr)-1), regulate...impingement to determine aerosol concentration. Ricin concentrations from impinger samples were measured by protein assay (Pierce, MicroBCA, Rockford

  12. Consumption of endophyte-infected fescue seed during the dry period and lactation affects mammary gland gene expression in dairy cows

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ergot alkaloids in endophyte-infected grasses inhibit prolactin (PRL) secretion and reduce milk production when fed to lactating cows. However, we have shown this affect is temporal in that pre-partum consumption of inflected seed throughout the dry period does not inhibit subsequent milk productio...

  13. Cloning and insertional inactivation of the dye (sfrA) gene, mutation of which affects sex factor F expression and dye sensitivity of Escherichia coli K-12.

    PubMed Central

    Buxton, R S; Drury, L S

    1983-01-01

    Deletions of the Escherichia coli K-12 chromosome between trpR and thr render the bacterium sensitive to the dye toluidine blue (Dye-), and if male (Hfr or F'), the strain is sterile (Fex-), failing to donate F' or chromosomal markers and resistant to male-specific phages as a consequence of its inability to elaborate F pili. A 6-kilobase SalI fragment of E. coli chromosomal DNA cloned into the plasmid pBR322 has been shown to complement both the Dye- and Fex- phenotypes. Insertion of the transposon gamma delta (Tn1000) into a specific part of this plasmid invariably results in both the Dye- and Fex- phenotypes, indicating that these phenotypes derive from mutation in a single gene. Complementation tests between such insertions and sfrA4, a previously isolated mutation resulting in a Fex- phenotype and reported to code for a transcriptional control factor for F (L. Beutin, P. A. Manning, M. Achtman, and N. Willetts, J. Bacteriol. 145:840-844, 1981), indicated that dye and sfrA4 were mutations in a single cistron. It is proposed that the dye (sfrA) gene product is necessary not only for efficient transcription of the F factor genes, but also for some component(s) of the bacterial envelope, loss of which results in sensitivity to toluidine blue. PMID:6304010

  14. Identification of quantitative trait loci affecting ectomycorrhizal symbiosis in an interspecific F1 poplar cross and differential expression of genes in ectomycorrhizas of the two parents: Populus deltoides and Populus trichocarpa

    SciTech Connect

    Labbe, Jessy L; Jorge, Veronique; Vion, Patrice; Marcais, Benoit; Bastien, Catherine; Tuskan, Gerald A; Martin, Francis; Le Tacon, F

    2011-01-01

    A Populus deltoides Populus trichocarpa F1 pedigree was analyzed for quantitative trait loci (QTLs) affecting ectomycorrhizal development and for microarray characterization of gene networks involved in this symbiosis. A 300 genotype progeny set was evaluated for its ability to form ectomycorrhiza with the basidiomycete Laccaria bicolor. The percentage of mycorrhizal root tips was determined on the root systems of all 300 progeny and their two parents. QTL analysis identified four significant QTLs, one on the P. deltoides and three on the P. trichocarpa genetic maps. These QTLs were aligned to the P. trichocarpa genome and each contained several megabases and encompass numerous genes. NimbleGen whole-genome microarray, using cDNA from RNA extracts of ectomycorrhizal root tips from the parental genotypes P. trichocarpa and P. deltoides, was used to narrow the candidate gene list. Among the 1,543 differentially expressed genes (p value 0.05; 5.0-fold change in transcript level) having different transcript levels in mycorrhiza of the two parents, 41 transcripts were located in the QTL intervals: 20 in Myc_d1, 14 in Myc_t1, and seven in Myc_t2, while no significant differences among transcripts were found in Myc_t3. Among these 41 transcripts, 25 were overrepresented in P. deltoides relative to P. trichocarpa; 16 were overrepresented in P. trichocarpa. The transcript showing the highest overrepresentation in P. trichocarpa mycorrhiza libraries compared to P. deltoides mycorrhiza codes for an ethylene-sensitive EREBP-4 protein which may repress defense mechanisms in P. trichocarpa while the highest overrepresented transcripts in P. deltoides code for proteins/genes typically associated with pathogen resistance.

  15. The effect of negative autoregulation on eukaryotic gene expression

    NASA Astrophysics Data System (ADS)

    Nevozhay, Dmitry; Adams, Rhys; Murphy, Kevin; Josic, Kresimir; Balázsi, G. Ábor

    2009-03-01

    Negative autoregulation is a frequent motif in gene regulatory networks, which has been studied extensively in prokaryotes. Nevertheless, some effects of negative feedback on gene expression in eukaryotic transcriptional networks remain unknown. We studied how the strength of negative feedback regulation affects the characteristics of gene expression in yeast cells carrying synthetic transcriptional cascades. We observed a drastic reduction of gene expression noise and a change in the shape of the dose-response curve. We explained these experimentally observed effects by stochastic simulations and a simple set of algebraic equations.

  16. Modulation of R-gene expression across environments

    PubMed Central

    MacQueen, Alice; Bergelson, Joy

    2016-01-01

    Some environments are more conducive to pathogen growth than others, and, as a consequence, plants might be expected to invest more in resistance when pathogen growth is favored. Resistance (R-) genes in Arabidopsis thaliana have unusually extensive variation in basal expression when comparing the same R-gene among accessions collected from different environments. R-gene expression variation was characterized to explore whether R-gene expression is up-regulated in environments favoring pathogen proliferation and down-regulated when risks of infection are low; down-regulation would follow if costs of R-gene expression negatively impact plant fitness in the absence of disease. Quantitative reverse transcription–PCR was used to quantify the expression of 13 R-gene loci in plants grown in eight environmental conditions for each of 12 A. thaliana accessions, and large effects of the environment on R-gene expression were found. Surprisingly, almost every change in the environment—be it a change in biotic or abiotic conditions—led to an increase in R-gene expression, a response that was distinct from the average transcriptome response and from that of other stress response genes. These changes in expression are functional in that environmental change prior to infection affected levels of specific disease resistance to isolates of Pseudomonas syringae. In addition, there are strong latitudinal clines in basal R-gene expression and clines in R-gene expression plasticity correlated with drought and high temperatures. These results suggest that variation in R-gene expression across environments may be shaped by natural selection to reduce fitness costs of R-gene expression in permissive or predictable environments. PMID:26983577

  17. Modulation of R-gene expression across environments.

    PubMed

    MacQueen, Alice; Bergelson, Joy

    2016-03-01

    Some environments are more conducive to pathogen growth than others, and, as a consequence, plants might be expected to invest more in resistance when pathogen growth is favored. Resistance (R-) genes in Arabidopsis thaliana have unusually extensive variation in basal expression when comparing the same R-gene among accessions collected from different environments. R-gene expression variation was characterized to explore whether R-gene expression is up-regulated in environments favoring pathogen proliferation and down-regulated when risks of infection are low; down-regulation would follow if costs of R-gene expression negatively impact plant fitness in the absence of disease. Quantitative reverse transcription-PCR was used to quantify the expression of 13 R-gene loci in plants grown in eight environmental conditions for each of 12 A. thaliana accessions, and large effects of the environment on R-gene expression were found. Surprisingly, almost every change in the environment--be it a change in biotic or abiotic conditions--led to an increase in R-gene expression, a response that was distinct from the average transcriptome response and from that of other stress response genes. These changes in expression are functional in that environmental change prior to infection affected levels of specific disease resistance to isolates of Pseudomonas syringae. In addition, there are strong latitudinal clines in basal R-gene expression and clines in R-gene expression plasticity correlated with drought and high temperatures. These results suggest that variation in R-gene expression across environments may be shaped by natural selection to reduce fitness costs of R-gene expression in permissive or predictable environments.

  18. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium.

    PubMed

    Rekawiecki, Robert; Kowalik, Magdalena K; Kotwica, Jan

    2013-12-01

    The aim of this study was to determine the steady-state expression of 13 selected housekeeping genes in the myometrium of cyclic and pregnant cows. Cells taken from bovine myometrium on days 1-5, 6-10, 11-16 and 17-20 of the oestrous cycle and in weeks 3-5, 6-8 and 9-12 of pregnancy were used. Reverse transcribed RNA was amplified in real-time PCR using designed primers. Reaction efficiency was determined with the Linreg programme. The geNorm and NormFinder programmes were used to select the best housekeeping genes. They calculate the expression stability factor for each used housekeeping gene with the smallest value for most stably expressed genes. According to geNorm, the most stable housekeeping genes in the myometrium were C2orf29, TPB and TUBB2B, while the least stably expressed genes were 18S RNA, HPRT1 and GAPDH. NormFinder identified the best genes in the myometrium as C2orf29, MRPL12 and TBP, while the worst genes were 18S RNA, B2M and SF3A1. Differences in stability factors between the two programmes may also indicate that the physiological status of the female, e.g. pregnancy, affects the stability of expression of housekeeping genes. The different expression stability of housekeeping genes did not affect progesterone receptor expression but it could be important if small differences in gene expression were measured between studies.

  19. Soil water stress affects both cuticular wax content and cuticle-related gene expression in young saplings of maritime pine (Pinus pinaster Ait)

    PubMed Central

    2013-01-01

    Background The cuticle is a hydrophobic barrier located at the aerial surface of all terrestrial plants. Recent studies performed on model plants, such as Arabidopsis thaliana, have suggested that the cuticle may be involved in drought stress adaptation, preventing non-stomatal water loss. Although forest trees will face more intense drought stresses (in duration and intensity) with global warming, very few studies on the role of the cuticle in drought stress adaptation in these long-lived organisms have been so far reported. Results This aspect was investigated in a conifer, maritime pine (Pinus pinaster Ait.), in a factorial design with two genetic units (two half-sib families with different growth rates) and two treatments (irrigated vs non-irrigated), in field conditions. Saplings were grown in an open-sided greenhouse and half were irrigated three times per week for two growing seasons. Needles were sampled three times per year for cuticular wax (composition and content) and transcriptome (of 11 genes involved in cuticle biosynthesis) analysis. Non-irrigated saplings (i) had a higher cuticular wax content than irrigated saplings and (ii) overexpressed most of the genes studied. Both these trends were more marked in the faster growing family. Conclusions The higher cuticular wax content observed in the non-irrigated treatment associated with strong modifications in products from the decarbonylation pathway suggest that cuticular wax may be involved in drought stress adaptation in maritime pine. This study provides also a set of promising candidate genes for future forward genetic studies in conifers. PMID:23815794

  20. [Neuronal plasticity and gene expression].

    PubMed

    Sokolova, O O; Shtark, M B; Lisachev, P D

    2010-01-01

    Neuronal plasticity--a fundamental feature of brain--provides adequate interactions with dynamic environment. One of the most deeply investigated forms of the neuronal plasticity is a long-term potentiation (LTP)--a phenomenon underlying learning and memory. Signal paths activated during LTP converge into the nuclear of the neuron, giving rise to launch of the molecular-genetic programs, which mediate structural and functional remodeling of synapses. In the review data concerning involvement of multilevel gene expression into plastic change under neuronal activation are summarized.

  1. A hammerhead ribozyme inhibits ADE1 gene expression in yeast.

    PubMed

    Ferbeyre, G; Bratty, J; Chen, H; Cedergren, R

    1995-03-21

    To study factors that affect in vivo ribozyme (Rz) activity, a model system has been devised in Saccharomyces cerevisiae based on the inhibition of ADE1 gene expression. This gene was chosen because Rz action can be evaluated visually by the Red phenotype produced when the activity of the gene product is inhibited. Different plasmid constructs allowed the expression of the Rz either in cis or in trans with respect to ADE1. Rz-related inhibition of ADE1 expression was correlated with a Red phenotype and a diminution of ADE1 mRNA levels only when the Rz gene was linked 5' to ADE1. The presence of the expected 3' cleavage fragment was demonstrated using a technique combining RNA ligation and PCR. This yeast system and detection technique are suited to the investigation of general factors affecting Rz-catalyzed inhibition of gene expression under in vivo conditions.

  2. Early-age feed restriction affects viability and gene expression of satellite cells isolated from the gastrocnemius muscle of broiler chicks

    PubMed Central

    2012-01-01

    Background Muscle growth depends on the fusion of proliferate satellite cells to existing myofibers. We reported previously that 0–14 day intermittent feeding led to persistent retardation in myofiber hypertrophy. However, how satellite cells respond to such nutritional insult has not been adequately elucidated. Results One-day-old broiler chicks were allocated to control (Con, ad libitum feeding), intermittent feeding (IF, feed provided on alternate days) and re-feeding (RF, 2 days ad libitum feeding after 12 days of intermittent feeding) groups. Chickens were killed on Day 15 and satellite cells were isolated. When cultured, satellite cells from the IF group demonstrated significant retardation in proliferation and differentiation potential, while RF partly restored the proliferation rate and differentiation potential of the satellite cells. Significant up-regulation of insulin like growth factor I receptor (IGF-IR) (P<0.05) and thyroid hormone receptor α (TRα) (P<0.05), and down-regulation of growth hormone receptor (GHR) (P<0.01) and IGF-I (P<0.01) mRNA expression was observed in freshly isolated IF satellite cells when compared with Con cells. In RF cells, the mRNA expression of IGF-I was higher (P<0.05) and of TRα was lower (P<0.01) than in IF cells, suggesting that RF restored the mRNA expression of TRα and IGF-I, but not of GHR and IGF-IR. The Bax/Bcl-2 ratio tended to increase in the IF group, which was reversed in the RF group (P<0.05), indicating that RF reduced the pro-apoptotic influence of IF. Moreover, no significant effect of T3 was detected on cell survival in IF cells compared with Con (P<0.001) or RF (P<0.05) cells. Conclusions These data suggest that early-age feed restriction inhibits the proliferation and differentiation of satellite cells, induces changes in mRNA expression of the GH/IGF-I and thyroid hormone receptors in satellite cells, as well as blunted sensitivity of satellite cells to T3, and that RF partially reverses these

  3. Expressing genes do not forget their LINEs: transposable elements and gene expression.

    PubMed

    Kines, Kristine J; Belancio, Victoria P

    2012-01-01

    Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue- or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored.

  4. Sex-specific gene expression in the BXD mouse liver.

    PubMed

    Gatti, Daniel M; Zhao, Ni; Chesler, Elissa J; Bradford, Blair U; Shabalin, Andrey A; Yordanova, Roumyana; Lu, Lu; Rusyn, Ivan

    2010-08-01

    Differences in clinical phenotypes between the sexes are well documented and have their roots in differential gene expression. While sex has a major effect on gene expression, transcription is also influenced by complex interactions between individual genetic variation and environmental stimuli. In this study, we sought to understand how genetic variation affects sex-related differences in liver gene expression by performing genetic mapping of genomewide liver mRNA expression data in a genetically defined population of naive male and female mice from C57BL/6J, DBA/2J, B6D2F1, and 37 C57BL/6J x DBA/2J (BXD) recombinant inbred strains. As expected, we found that many genes important to xenobiotic metabolism and other important pathways exhibit sexually dimorphic expression. We also performed gene expression quantitative trait locus mapping in this panel and report that the most significant loci that appear to regulate a larger number of genes than expected by chance are largely sex independent. Importantly, we found that the degree of correlation within gene expression networks differs substantially between the sexes. Finally, we compare our results to a recently released human liver gene expression data set and report on important similarities in sexually dimorphic liver gene expression between mouse and human. This study enhances our understanding of sex differences at the genome level and between species, as well as increasing our knowledge of the molecular underpinnings of sex differences in responses to xenobiotics.

  5. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    PubMed Central

    Yao, Zizhen; Jaeger, Jochen C; Ruzzo, Walter L; Morale, Cecile Z; Emond, Mary; Francke, Uta; Milewicz, Dianna M; Schwartz, Stephen M; Mulvihill, Eileen R

    2007-01-01

    Background Marfan syndrome (MFS) is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value < 3 × 10-6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status). An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater. PMID:17850668

  6. [Visual input affects the expression of the early genes c-Fos and ZENK in auditory telencephalic centers of pied flycatcher nestlings during the acoustically-guided freezing].

    PubMed

    Korneeva, E V; Tiunova, A A; Aleksandrov, L I; Golubeva, T B; Anokhin, K V

    2014-01-01

    The present study analyzed expression of transcriptional factors c-Fos and ZENK in 9-day-old pied flycatcher nestlings' (Ficedula hypoleuca) telencephalic auditory centers (field L, caudomedial nidopallium and caudomedial mesopallium) involved in the acoustically-guided defense behavior. Species-typical alarm call was presented to the young in three groups: 1--intact group (sighted control), 2--nestlings visually deprived just before the experiment for a short time (unsighted control) 3--nestlings visually deprived right after hatching (experimental deprivation). Induction of c-Fos as well as ZENK in nestlings from the experimental deprivation group was decreased in both hemispheres as compared with intact group. In the group of unsighted control, only the decrease of c-Fos induction was observed exclusively in the right hemisphere. These findings suggest that limitation of visual input changes the population of neurons involved into the acoustically-guided behavior, the effect being dependant from the duration of deprivation.

  7. Elongation changes of exploratory and root hair systems induced by aminocyclopropane carboxylic acid and aminoethoxyvinylglycine affect nitrate uptake and BnNrt2.1 and BnNrt1.1 transporter gene expression in oilseed rape.

    PubMed

    Leblanc, Antonin; Renault, Hugues; Lecourt, Julien; Etienne, Philippe; Deleu, Carole; Le Deunff, Erwan

    2008-04-01

    Ethylene is a plant hormone that plays a major role in the elongation of both exploratory and root hair systems. Here, we demonstrate in Brassica napus seedlings that treatments with the ethylene precursor, aminocyclopropane carboxylic acid (ACC) and the ethylene biosynthesis inhibitor, aminoethoxyvinylglycine (AVG), cause modification of the dynamic processes of primary root and root hair elongation in a dose-dependent way. Moreover, restoration of root elongation in AVG-treated seedlings by 1 mm l-glutamate suggested that high concentrations of AVG affect root elongation through nonoverlapping ethylene metabolic pathway involving pyridoxal 5'-P-dependent enzymes of nitrate (N) metabolism. In this respect, treatments with high concentrations of ACC and AVG (10 mum) over 5 d revealed significant differences in relationships between root growth architecture and N uptake capacities. Indeed, if these treatments decreased severely the elongation of the exploratory root system (primary root and lateral roots) they had opposing effects on the root hair system. Although ACC increased the length and number of root hairs, the rate of N uptake and the transcript level of the N transporter BnNrt2.1 were markedly reduced. In contrast, the decrease in root hair length and number in AVG-treated seedlings was overcompensated by an increase of N uptake and BnNrt2.1 gene expression. These root architectural changes demonstrated that BnNrt2.1 expression levels were more correlated to the changes of the exploratory root system than the changes of the root hair system. The difference between treatments in N transporters BnNrt1.1 and BnNrt2.1 gene expression is discussed with regard to presumed transport functions of BnNrt1.1 in relation to root elongation.

  8. Elongation Changes of Exploratory and Root Hair Systems Induced by Aminocyclopropane Carboxylic Acid and Aminoethoxyvinylglycine Affect Nitrate Uptake and BnNrt2.1 and BnNrt1.1 Transporter Gene Expression in Oilseed Rape[W

    PubMed Central

    Leblanc, Antonin; Renault, Hugues; Lecourt, Julien; Etienne, Philippe; Deleu, Carole; Le Deunff, Erwan

    2008-01-01

    Ethylene is a plant hormone that plays a major role in the elongation of both exploratory and root hair systems. Here, we demonstrate in Brassica napus seedlings that treatments with the ethylene precursor, aminocyclopropane carboxylic acid (ACC) and the ethylene biosynthesis inhibitor, aminoethoxyvinylglycine (AVG), cause modification of the dynamic processes of primary root and root hair elongation in a dose-dependent way. Moreover, restoration of root elongation in AVG-treated seedlings by 1 mm l-glutamate suggested that high concentrations of AVG affect root elongation through nonoverlapping ethylene metabolic pathway involving pyridoxal 5′-P-dependent enzymes of nitrate (N) metabolism. In this respect, treatments with high concentrations of ACC and AVG (10 μm) over 5 d revealed significant differences in relationships between root growth architecture and N uptake capacities. Indeed, if these treatments decreased severely the elongation of the exploratory root system (primary root and lateral roots) they had opposing effects on the root hair system. Although ACC increased the length and number of root hairs, the rate of N uptake and the transcript level of the N transporter BnNrt2.1 were markedly reduced. In contrast, the decrease in root hair length and number in AVG-treated seedlings was overcompensated by an increase of N uptake and BnNrt2.1 gene expression. These root architectural changes demonstrated that BnNrt2.1 expression levels were more correlated to the changes of the exploratory root system than the changes of the root hair system. The difference between treatments in N transporters BnNrt1.1 and BnNrt2.1 gene expression is discussed with regard to presumed transport functions of BnNrt1.1 in relation to root elongation. PMID:18287493

  9. A transgenic study on affecting potato tuber yield by expressing the rice sucrose transporter genes OsSUT5Z and OsSUT2M.

    PubMed

    Sun, Aijun; Dai, Yan; Zhang, Xinsheng; Li, Chunmin; Meng, Kun; Xu, Honglin; Wei, Xiaoli; Xiao, Guifang; Ouwerkerk, Pieter B F; Wang, Mei; Zhu, Zhen

    2011-07-01

    In many plants, sucrose transporters are essential for both sucrose exports from sources and imports into sinks, indicating a function in assimilate partitioning. To investigate whether sucrose transporters can improve the yield of starch plant, potato plants (Solanum tuberosum L. cv. Désirée) were transformed with cDNAs of the rice sucrose transporter genes OsSUT5Z and OsSUT2M under the control of a tuber-specific, class-I patatin promoter. Compared to the controls, the average fructose content of OsSUT5Z transgenic tubers significantly increased. However, the content of the sugars and starch in the OsSUT2M transgenic potato tubers showed no obvious difference. Correspondingly, the average tuber yield, average number of tubers per plant and average weight of single tuber showed no significant difference in OsSUT2M transgenic tubers with controls. In the OsSUT5Z transgenic lines, the average tuber yield per plant was 1.9-fold higher than the controls, and the average number of tubers per plant increased by more than 10 tubers on average, whereas the average weight of a single tuber did not increase significantly. These results suggested that the average number of tubers per plant showed more contribution than the average weight of a single tuber to the tuber yield per plant.

  10. Differences in the Ovine HSP90AA1 Gene Expression Rates Caused by Two Linked Polymorphisms at Its Promoter Affect Rams Sperm DNA Fragmentation under Environmental Heat Stress Conditions

    PubMed Central

    González, Carmen; Pérez-Guzmán, M. Dolores; Garde, J. Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H.; Serrano, M. Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram’s fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  11. Mechanoregulation of gene expression in fibroblasts

    PubMed Central

    Wang, James H.-C.; Thampatty, Bhavani P.; Lin, Jeen-Shang; Im, Hee-Jeong

    2010-01-01

    Mechanical loads placed on connective tissues alter gene expression in fibroblasts through mechanotransduction mechanisms by which cells convert mechanical signals into cellular biological events, such as gene expression of extracellular matrix components (e.g., collagen). This mechanical regulation of ECM gene expression affords maintenance of connective tissue homeostasis. However, mechanical loads can also interfere with homeostatic cellular gene expression and consequently cause the pathogenesis of connective tissue diseases such as tendinopathy and osteoarthritis. Therefore, the regulation of gene expression by mechanical loads is closely related to connective tissue physiology and pathology. This article reviews the effects of various mechanical loading conditions on gene regulation in fibroblasts and discusses several mechanotransduction mechanisms. Future research directions in mechanoregulation of gene expression are also suggested. PMID:17331678

  12. Fundamental principles of energy consumption for gene expression

    NASA Astrophysics Data System (ADS)

    Huang, Lifang; Yuan, Zhanjiang; Yu, Jianshe; Zhou, Tianshou

    2015-12-01

    How energy is consumed in gene expression is largely unknown mainly due to complexity of non-equilibrium mechanisms affecting expression levels. Here, by analyzing a representative gene model that considers complexity of gene expression, we show that negative feedback increases energy consumption but positive feedback has an opposite effect; promoter leakage always reduces energy consumption; generating more bursts needs to consume more energy; and the speed of promoter switching is at the cost of energy consumption. We also find that the relationship between energy consumption and expression noise is multi-mode, depending on both the type of feedback and the speed of promoter switching. Altogether, these results constitute fundamental principles of energy consumption for gene expression, which lay a foundation for designing biologically reasonable gene modules. In addition, we discuss possible biological implications of these principles by combining experimental facts.

  13. Does MW Radiation Affect Gene Expression, Apoptotic Level, and Cell Cycle Progression of Human SH-SY5Y Neuroblastoma Cells?

    PubMed

    Kayhan, Handan; Esmekaya, Meric Arda; Saglam, Atiye Seda Yar; Tuysuz, Mehmed Zahid; Canseven, Ayşe Gulnihal; Yagci, Abdullah Munci; Seyhan, Nesrin

    2016-06-01

    Neuroblastoma (NB) is a cancer that occurs in sympathetic nervous system arising from neuroblasts and nerve tissue of the adrenal gland, neck, chest, or spinal cord. It is an embryonal malignancy and affects infants and children. In this study, we investigated the effects of microwave (MW) radiation on apoptotic activity, cell viability, and cell cycle progression in human SH-SY5Y NB cells which can give information about MW radiation effects on neural cells covering the period from the embryonic stages to infants. SH-SY5Y NB cells were exposed to 2.1 GHz W-CDMA modulated MW radiation for 24 h at a specific absorption rate of 0.491 W/kg. Control samples were in the same conditions with MW-exposed samples but they were not exposed to MW radiation. The apoptotic activity of cells was measured by Annexin-V-FITC and propidium iodide staining. Moreover, mRNA levels of proliferative and cell cycle proteins were determined by real-time RT-PCR. The change in cell cycle progression was observed by using CycleTest-Plus DNA reagent. No significant change was observed in apoptotic activity of MW-exposed cells compared to control cells. The mRNA levels of c-myc and cyclin D1 were significantly reduced in MW group (p < 0.05). The percentage of MW-exposed cells in G1 phase was significantly higher than the percentage of control cells in G1 phase. MW radiation caused cell cycle arrest in G1 phase. These results showed that 2.1 GHz W-CDMA modulated MW radiation did not cause apoptotic cell death but changed cell cycle progression.

  14. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  15. Retrotransposons as regulators of gene expression.

    PubMed

    Elbarbary, Reyad A; Lucas, Bronwyn A; Maquat, Lynne E

    2016-02-12

    Transposable elements (TEs) are both a boon and a bane to eukaryotic organisms, depending on where they integrate into the genome and how their sequences function once integrated. We focus on two types of TEs: long interspersed elements (LINEs) and short interspersed elements (SINEs). LINEs and SINEs are retrotransposons; that is, they transpose via an RNA intermediate. We discuss how LINEs and SINEs have expanded in eukaryotic genomes and contribute to genome evolution. An emerging body of evidence indicates that LINEs and SINEs function to regulate gene expression by affecting chromatin structure, gene transcription, pre-mRNA processing, or aspects of mRNA metabolism. We also describe how adenosine-to-inosine editing influences SINE function and how ongoing retrotransposition is countered by the body's defense mechanisms.

  16. Norovirus gene expression and replication.

    PubMed

    Thorne, Lucy G; Goodfellow, Ian G

    2014-02-01

    Noroviruses are small, positive-sense RNA viruses within the family Caliciviridae, and are now accepted widely as a major cause of acute gastroenteritis in both developed and developing countries. Despite their impact, our understanding of the life cycle of noroviruses has lagged behind that of other RNA viruses due to the inability to culture human noroviruses (HuNVs). Our knowledge of norovirus biology has improved significantly over the past decade as a result of numerous technological advances. The use of a HuNV replicon, improved biochemical and cell-based assays, combined with the discovery of a murine norovirus capable of replication in cell culture, has improved greatly our understanding of the molecular mechanisms of norovirus genome translation and replication, as well as the interaction with host cell processes. In this review, the current state of knowledge of the intracellular life of noroviruses is discussed with particular emphasis on the mechanisms of viral gene expression and viral genome replication.

  17. Toxic Diatom Aldehydes Affect Defence Gene Networks in Sea Urchins

    PubMed Central

    Varrella, Stefano; Ruocco, Nadia; Ianora, Adrianna; Bentley, Matt G.; Costantini, Maria

    2016-01-01

    Marine organisms possess a series of cellular strategies to counteract the negative effects of toxic compounds, including the massive reorganization of gene expression networks. Here we report the modulated dose-dependent response of activated genes by diatom polyunsaturated aldehydes (PUAs) in the sea urchin Paracentrotus lividus. PUAs are secondary metabolites deriving from the oxidation of fatty acids, inducing deleterious effects on the reproduction and development of planktonic and benthic organisms that feed on these unicellular algae and with anti-cancer activity. Our previous results showed that PUAs target several genes, implicated in different functional processes in this sea urchin. Using interactomic Ingenuity Pathway Analysis we now show that the genes targeted by PUAs are correlated with four HUB genes, NF-κB, p53, δ-2-catenin and HIF1A, which have not been previously reported for P. lividus. We propose a working model describing hypothetical pathways potentially involved in toxic aldehyde stress response in sea urchins. This represents the first report on gene networks affected by PUAs, opening new perspectives in understanding the cellular mechanisms underlying the response of benthic organisms to diatom exposure. PMID:26914213

  18. Short-term hypertonic exposure enhances in vitro follicle growth and meiotic competence of enclosed oocytes while modestly affecting mRNA expression of aquaporin and steroidogenic genes in the domestic cat model.

    PubMed

    Songsasen, N; Thongkittidilok, C; Yamamizu, K; Wildt, D E; Comizzoli, P

    2017-03-01

    Using the domestic cat as a non-rodent, larger animal model, the objective was to determine the impact of a brief incubation in a hypertonic microenvironment on (1) ovarian follicle and oocyte growth in vitro, (2) developmental capacity of the resident oocyte, and (3) expression of aquaporin (AQP) genes in parallel with genes involved in regulation of folliculogenesis. In Study 1: Secondary or early antral follicles encapsulated in 0.5% alginate were allocated to one of three treatment groups: 1) culture in standard medium at 290 mOsm for 15 d (Control); 2) incubation in 350 mOsm medium for 1 h followed by culture in standard medium for 15 d (Hypertonic-1h); or 3) incubation in 350 mOsm medium for 24 h followed by incubation in standard medium for additional 14 d (Hypertonic-24h). After measuring follicle and oocyte diameters on Day 15, in vitro-grown oocytes were incubated for 24 h before assessing nuclear status. In Study 2: secondary or early antral follicles were subjected to one of the three treatments: 1) culture in standard medium at 290 mOsm for 48 h; 2) incubation in 350 mOsm medium for 1 h followed by culture in standard medium for additional 47 h; or 3) incubation in 350 mOsm medium for 24 h followed by culture in standard medium for additional 24 h. At the end of the culture period, all follicles were assessed for mRNA level of Cyp17a1, Cyp19a1, Star, Aqp1, 3, 5, 7 and 8 as well as Fshr using qPCR. Freshly collected follicles also were subjected to gene expression analysis and served as the 'Non-cultured control'. Hypertonic-24h follicles grew larger (P < 0.05) than the control, whereas those in Hypertonic-1h group exhibited intermediate growth, especially when the culture started at the early antral stage. Oocytes in the Hypertonic-24h group were larger and resumed meiosis at a higher rate than in the other treatments. In vitro culture affected (P < 0.05) mRNA expression of Cyp19a1, Star, Aqp1, and Aqp7 in both the secondary and early

  19. Population and sex differences in Drosophila melanogaster brain gene expression

    PubMed Central

    2012-01-01

    Background Changes in gene regulation are thought to be crucial for the adaptation of organisms to their environment. Transcriptome analyses can be used to identify candidate genes for ecological adaptation, but can be complicated by variation in gene expression between tissues, sexes, or individuals. Here we use high-throughput RNA sequencing of a single Drosophila melanogaster tissue to detect brain-specific differences in gene expression between the sexes and between two populations, one from the ancestral species range in sub-Saharan Africa and one from the recently colonized species range in Europe. Results Relatively few genes (<100) displayed sexually dimorphic expression in the brain, but there was an enrichment of sex-biased genes, especially male-biased genes, on the X chromosome. Over 340 genes differed in brain expression between flies from the African and European populations, with the inter-population divergence being highly correlated between males and females. The differentially expressed genes included those involved in stress response, olfaction, and detoxification. Expression differences were associated with transposable element insertions at two genes implicated in insecticide resistance (Cyp6g1 and CHKov1). Conclusions Analysis of the brain transcriptome revealed many genes differing in expression between populations that were not detected in previous studies using whole flies. There was little evidence for sex-specific regulatory adaptation in the brain, as most expression differences between populations were observed in both males and females. The enrichment of genes with sexually dimorphic expression on the X chromosome is consistent with dosage compensation mechanisms affecting sex-biased expression in somatic tissues. PMID:23170910

  20. Gene expression profiling of mouse embryos with microarrays

    PubMed Central

    Sharov, Alexei A.; Piao, Yulan; Ko, Minoru S. H.

    2011-01-01

    Global expression profiling by DNA microarrays provides a snapshot of cell and tissue status and becomes an essential tool in biological and medical sciences. Typical questions that can be addressed by microarray analysis in developmental biology include: (1) to find a set of genes expressed in a specific cell type; (2) to identify genes expressed commonly in multiple cell types; (3) to follow the time-course changes of gene expression patterns; (4) to demonstrate cell’s identity by showing similarities or differences among two or multiple cell types; (5) to find regulatory pathways and/or networks affected by gene manipulations, such as overexpression or repression of gene expression; (6) to find downstream target genes of transcription factors; (7) to find downstream target genes of cell signaling; (8) to examine the effects of environmental manipulation of cells on gene expression patterns; and (9) to find the effects of genetic manipulation in embryos and adults. Here we describe strategies for executing these experiments and monitoring changes of cell state with gene expression microarrays in application to mouse embryology. Both statistical assessment and interpretation of data are discussed. We also present a protocol for performing microarray analysis on a small amount of embryonic materials. PMID:20699157

  1. Novel recombinant papillomavirus genomes expressing selectable genes

    PubMed Central

    Van Doorslaer, Koenraad; Porter, Samuel; McKinney, Caleb; Stepp, Wesley H.; McBride, Alison A.

    2016-01-01

    Papillomaviruses infect and replicate in keratinocytes, but viral proteins are initially expressed at low levels and there is no effective and quantitative method to determine the efficiency of infection on a cell-to-cell basis. Here we describe human papillomavirus (HPV) genomes that express marker proteins (antibiotic resistance genes and Green Fluorescent Protein), and can be used to elucidate early stages in HPV infection of primary keratinocytes. To generate these recombinant genomes, the late region of the oncogenic HPV18 genome was replaced by CpG free marker genes. Insertion of these exogenous genes did not affect early replication, and had only minimal effects on early viral transcription. When introduced into primary keratinocytes, the recombinant marker genomes gave rise to drug-resistant keratinocyte colonies and cell lines, which maintained the extrachromosomal recombinant genome long-term. Furthermore, the HPV18 “marker” genomes could be packaged into viral particles (quasivirions) and used to infect primary human keratinocytes in culture. This resulted in the outgrowth of drug-resistant keratinocyte colonies containing replicating HPV18 genomes. In summary, we describe HPV18 marker genomes that can be used to quantitatively investigate many aspects of the viral life cycle. PMID:27892937

  2. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K

    2007-01-01

    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  3. Manipulation of hemoglobin expression affects Arabidopsis shoot organogenesis.

    PubMed

    Wang, Yaping; Elhiti, Mohamed; Hebelstrup, Kim H; Hill, Robert D; Stasolla, Claudio

    2011-10-01

    Over the past few years non-symbiotic plant hemoglobins have been described in a variety of plant species where they fulfill several functions ranging from detoxification processes to basic aspects of plant growth and post-embryonic development. To date no information is available on the role of hemoglobins during in vitro morphogenesis. Shoot organogenesis was induced in Arabidopsis lines constitutively expressing class 1, 2 and 3 hemoglobins (GLB1, 2 and 3) and lines in which the respective genes were either downregulated by RNAi (GLB1) or knocked out (GLB2 and GLB3). The process was executed by culturing root explants on an initial auxin-rich callus induction medium (CIM) followed by a transfer onto a cytokinin-containing shoot induction medium (SIM). While the repression of GLB2 inhibited organogenesis the over-expression of GLB1 or GLB2 enhanced the number of shoots produced in culture, and altered the transcript levels of genes participating in cytokinin perception and signalling. The up-regulation of GLB1 or GLB2 activated CKI1 and AHK3, genes encoding cytokinin receptors and affected the transcript levels of cytokinin responsive regulators (ARRs). The expression of Type-A ARRs (ARR4, 5, 7, 15, and 16), feed-back repressors of the cytokinin pathway, was repressed in both hemoglobin over-expressors whereas that of several Type-B ARRs (ARR2, 12, and 13), transcription activators of cytokinin-responsive genes, was induced. Such changes enhanced the sensitivity of the root explants to cytokinin allowing the 35S::GLB1 and 35S::GLB2 lines to produce shoots at low cytokinin concentrations which did not promote organogenesis in the WT line. These results show that manipulation of hemoglobin can modify shoot organogenesis in Arabidopsis and possibly in those systems partially or completely unresponsive to applications of exogenous cytokinins.

  4. Inducible gene expression systems and plant biotechnology.

    PubMed

    Corrado, Giandomenico; Karali, Marianthi

    2009-01-01

    Plant biotechnology relies heavily on the genetic manipulation of crops. Almost invariantly, the gene of interest is expressed in a constitutive fashion, although this may not be strictly necessary for several applications. Currently, there are several regulatable expression systems for the temporal, spatial and quantitative control of transgene activity. These molecular switches are based on components derived from different organisms, which range from viruses to higher eukaryotes. Many inducible systems have been designed for fundamental and applied research and since their initial development, they have become increasingly popular in plant molecular biology. This review covers a broad number of inducible expression systems examining their properties and relevance for plant biotechnology in its various guises, from molecular breeding to pharmaceutical and industrial applications. For each system, we examine some advantages and limitations, also in relation to the strategy on which they rely. Besides being necessary to control useful genes that may negatively affect crop yield and quality, we discuss that inducible systems can be also used to increase public acceptance of GMOs, reducing some of the most common concerns. Finally, we suggest some directions and future developments for their further diffusion in agriculture and biotechnology.

  5. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2012-05-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  6. Methods for monitoring multiple gene expression

    SciTech Connect

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2013-10-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  7. Methods for monitoring multiple gene expression

    DOEpatents

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2008-06-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  8. Arabidopsis gene expression patterns are altered during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, Anna-Lisa; Popp, Michael P.; Gurley, William B.; Guy, Charles; Norwood, Kelly L.; Ferl, Robert J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments results in differential gene expression. A 5-day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β-Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on gene expression patterns initially by using the Adh/GUS transgene to address specifically the possibility that spaceflight induces a hypoxic stress response (Paul, A.L., Daugherty, C.J., Bihn, E.A., Chapman, D.K., Norwood, K.L., Ferl, R.J., 2001. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis, Plant Physiol. 126, 613-621). As a follow-on to the reporter gene analysis, we report here the evaluation of genome-wide patterns of native gene expression within Arabidopsis shoots utilizing the Agilent DNA array of 21,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes was further characterized with quantitative Real-Time RT PCR (ABI - Taqman®). Comparison of the patterns of expression for arrays probed with RNA isolated from plants exposed to spaceflight compared to RNA isolated from ground control plants revealed 182 genes that were differentially expressed in response to the spaceflight mission by more than 4-fold, and of those only 50 genes were expressed at levels chosen to support a conservative change call. None of the genes that are hallmarks of hypoxic stress were induced to this level. However, genes related to heat shock were dramatically induced - but in a pattern and under growth conditions that are not easily explained by elevated temperatures. These gene expression data are discussed in light of current models for plant responses to the spaceflight environment and with regard to potential future spaceflight experiment

  9. Different N-terminal isoforms of Oct-1 control expression of distinct sets of genes and their high levels in Namalwa Burkitt's lymphoma cells affect a wide range of cellular processes

    PubMed Central

    Pankratova, Elizaveta V.; Stepchenko, Alexander G.; Portseva, Tatiana; Mogila, Vladic A.; Georgieva, Sofia G.

    2016-01-01

    Oct-1 transcription factor has various functions in gene regulation. Its expression level is increased in several types of cancer and is associated with poor survival prognosis. Here we identified distinct Oct-1 protein isoforms in human cells and compared gene expression patterns and functions for Oct-1A, Oct-1L, and Oct-1X isoforms that differ by their N-terminal sequences. The longest isoform, Oct-1A, is abundantly expressed and is the main Oct-1 isoform in most of human tissues. The Oct-1L and the weakly expressed Oct-1X regulate the majority of Oct-1A targets as well as additional sets of genes. Oct-1X controls genes involved in DNA replication, DNA repair, RNA processing, and cellular response to stress. The high level of Oct-1 isoforms upregulates genes related to cell cycle progression and activates proliferation both in Namalwa Burkitt's lymphoma cells and primary human fibroblasts. It downregulates expression of genes related to antigen processing and presentation, cytokine-cytokine receptor interaction, oxidative metabolism, and cell adhesion, thus facilitating pro-oncogenic processes. PMID:27407111

  10. Sleep and wakefulness modulate gene expression in Drosophila.

    PubMed

    Cirelli, Chiara; LaVaute, Timothy M; Tononi, Giulio

    2005-09-01

    In the mammalian brain, sleep and wakefulness are associated with widespread changes in gene expression. Sleep in fruit flies shares many features with mammalian sleep, but it is currently unknown to what extent behavioral states affect gene expression in Drosophila. To find out, we performed a comprehensive microarray analysis of gene expression in spontaneously awake, sleep-deprived and sleeping flies. Fly heads were collected at 4 am, after 8 h of spontaneous sleep or sleep deprivation, and at 4 pm, after 8 h of spontaneous wakefulness. As in rats, we found that behavioral state and time of day affect Drosophila gene expression to a comparable extent. As in rats, transcripts with higher expression in wakefulness and in sleep belong to different functional categories, and in several cases these groups overlap with those previously identified in rats. Wakefulness-related genes code for transcription factors and for proteins involved in the stress response, immune response, glutamatergic transmission, and carbohydrate metabolism. Sleep-related transcripts include the glial gene anachronism and several genes involved in lipid metabolism. Finally, the expression of many wakefulness-related and sleep-related Drosophila transcripts is also modulated by the time of day, suggesting an interaction at the molecular level between circadian and homeostatic mechanism of sleep regulation.

  11. Estimation and Testing of Gene Expression Heterosis

    PubMed Central

    Liu, Peng; Nettleton, Dan

    2014-01-01

    Heterosis, also known as the hybrid vigor, occurs when the mean phenotype of hybrid off-spring is superior to that of its two inbred parents. The heterosis phenomenon is extensively utilized in agriculture though the molecular basis is still unknown. In an effort to understand phenotypic heterosis at the molecular level, researchers have begun to compare expression levels of thousands of genes between parental inbred lines and their hybrid offspring to search for evidence of gene expression heterosis. Standard statistical approaches for separately analyzing expression data for each gene can produce biased and highly variable estimates and unreliable tests of heterosis. To address these shortcomings, we develop a hierarchical model to borrow information across genes. Using our modeling framework, we derive empirical Bayes estimators and an inference strategy to identify gene expression heterosis. Simulation results show that our proposed method outperforms the more traditional strategy used to detect gene expression heterosis. This article has supplementary material online. PMID:25435758

  12. Estimation and Testing of Gene Expression Heterosis.

    PubMed

    Ji, Tieming; Liu, Peng; Nettleton, Dan

    2014-09-01

    Heterosis, also known as the hybrid vigor, occurs when the mean phenotype of hybrid off-spring is superior to that of its two inbred parents. The heterosis phenomenon is extensively utilized in agriculture though the molecular basis is still unknown. In an effort to understand phenotypic heterosis at the molecular level, researchers have begun to compare expression levels of thousands of genes between parental inbred lines and their hybrid offspring to search for evidence of gene expression heterosis. Standard statistical approaches for separately analyzing expression data for each gene can produce biased and highly variable estimates and unreliable tests of heterosis. To address these shortcomings, we develop a hierarchical model to borrow information across genes. Using our modeling framework, we derive empirical Bayes estimators and an inference strategy to identify gene expression heterosis. Simulation results show that our proposed method outperforms the more traditional strategy used to detect gene expression heterosis. This article has supplementary material online.

  13. Gene expression-targeted isoflavone therapy.

    PubMed

    Węgrzyn, Alicja

    2012-04-01

    Lysosomal storage diseases (LSD) form a group of inherited metabolic disorders caused by dysfunction of one of the lysosomal proteins, resulting in the accumulation of certain compounds. Although these disorders are among first genetic diseases for which specific treatments were proposed, there are still serious unsolved problems that require development of novel therapeutic procedures. An example is neuronopathy, which develops in most of LSD and cannot be treated efficiently by currently approved therapies. Recently, a new potential therapy, called gene expression-targeted isoflavone therapy (GET IT), has been proposed for a group of LSD named mucopolysaccharidoses (MPS), in which storage of incompletely degraded glycosaminoglycans (GAGs) results in severe symptoms of virtually all tissues and organs, including central nervous system. The idea of this therapy is to inhibit synthesis of GAGs by modulating expression of genes coding for enzymes involved in synthesis of these compounds. Such a modulation is possible by using isoflavones, particularly genistein, which interfere with a signal transduction process necessary for stimulation of expression of certain genes. Results of in vitro experiments and studies on animal models indicated a high efficiency of GET IT, including correction of behavior of affected mice. However, clinical trials, performed with soy isoflavone extracts, revealed only limited efficacy. This caused a controversy about GET IT as a potential, effective treatment of patients suffering from MPS, especially neuronopathic forms of these diseases. It this critical review, I present possible molecular mechanisms of therapeutic action of isoflavones (particularly genistein) and suggest that efficacy of GET IT might be sufficiently high when using relatively high doses of synthetic genistein (which was employed in experiments on cell cultures and mouse models) rather than low doses of soy isoflavone extracts (which were used in clinical trials). This

  14. Gene expression profile analysis of ventilator-associated pneumonia

    PubMed Central

    XU, XIAOLI; YUAN, BO; LIANG, QUAN; HUANG, HUIMIN; YIN, XIANGYI; SHENG, XIAOYUE; NIE, NIUYAN; FANG, HONGMEI

    2015-01-01

    Based on the gene expression profile of patients with ventilator-associated pneumonia (VAP) and patients not affected by the disease, the present study aimed to enhance the current understanding of VAP development using bioinformatics methods. The expression profile GSE30385 was downloaded from the Gene Expression Omnibus database. The Linear Models for Microarray Data package in R language was used to screen and identify differentially expressed genes (DEGs), which were grouped as up- and down-regulated genes. The up- and downregulated genes were functionally enriched using the Database for Annotation, Visualization and Integrated Discovery system and then annotated according to TRANSFAC, Tumor Suppressor Gene and Tumor Associated Gene databases. Subsequently, the protein-protein interaction (PPI) network was constructed, followed by module analysis using CFinder software. A total of 69 DEGs, including 33 up- and 36 downregulated genes were screened out in patients with VAP. Upregulated genes were mainly enriched in functions and pathways associated with the immune response (including the genes ELANE and LTF) and the mitogen-activated protein kinase (MAPK) signaling pathway (including MAPK14). The PPI network comprised 64 PPI pairs and 44 nodes. The top two modules were enriched in different pathways, including the MAPK signaling pathway. Genes including ELANE, LTF and MAPK14 may have important roles in the development of VAP via altering the immune response and the MAPK signaling pathway. PMID:26459786

  15. Gene Expression Patterns in Ovarian Carcinomas

    PubMed Central

    Schaner, Marci E.; Ross, Douglas T.; Ciaravino, Giuseppe; Sørlie, Therese; Troyanskaya, Olga; Diehn, Maximilian; Wang, Yan C.; Duran, George E.; Sikic, Thomas L.; Caldeira, Sandra; Skomedal, Hanne; Tu, I-Ping; Hernandez-Boussard, Tina; Johnson, Steven W.; O'Dwyer, Peter J.; Fero, Michael J.; Kristensen, Gunnar B.; Børresen-Dale, Anne-Lise; Hastie, Trevor; Tibshirani, Robert; van de Rijn, Matt; Teng, Nelson N.; Longacre, Teri A.; Botstein, David; Brown, Patrick O.; Sikic, Branimir I.

    2003-01-01

    We used DNA microarrays to characterize the global gene expression patterns in surface epithelial cancers of the ovary. We identified groups of genes that distinguished the clear cell subtype from other ovarian carcinomas, grade I and II from grade III serous papillary carcinomas, and ovarian from breast carcinomas. Six clear cell carcinomas were distinguished from 36 other ovarian carcinomas (predominantly serous papillary) based on their gene expression patterns. The differences may yield insights into the worse prognosis and therapeutic resistance associated with clear cell carcinomas. A comparison of the gene expression patterns in the ovarian cancers to published data of gene expression in breast cancers revealed a large number of differentially expressed genes. We identified a group of 62 genes that correctly classified all 125 breast and ovarian cancer specimens. Among the best discriminators more highly expressed in the ovarian carcinomas were PAX8 (paired box gene 8), mesothelin, and ephrin-B1 (EFNB1). Although estrogen receptor was expressed in both the ovarian and breast cancers, genes that are coregulated with the estrogen receptor in breast cancers, including GATA-3, LIV-1, and X-box binding protein 1, did not show a similar pattern of coexpression in the ovarian cancers. PMID:12960427

  16. Arabidopsis gene expression patterns during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

  17. Loss of catabolite repression function of HPr, the phosphocarrier protein of the bacterial phosphotransferase system, affects expression of the cry4A toxin gene in Bacillus thuringiensis subsp. israelensis.

    PubMed

    Khan, Sharik R; Banerjee-Bhatnagar, Nirupama

    2002-10-01

    HPr, the phosphocarrier protein of the bacterial phosphotransferase system, mediates catabolite repression of a number of operons in gram-positive bacteria. In order to participate in the regulatory process, HPr is activated by phosphorylation of a conserved serine-46 residue. To study the potential role of HPr in the regulation of Cry4A protoxin synthesis in Bacillus thuringiensis subsp. israelensis, we produced a catabolite repression-negative mutant by replacing the wild-type copy of the ptsH gene with a mutated copy in which the conserved serine residue of HPr was replaced with an alanine. HPr isolated from the mutant strain was not phosphorylated at Ser-45 by HPr kinase, but phosphorylation at His-14 was found to occur normally. The enzyme I and HPr kinase activities of the mutant were not affected. Analysis of the B. thuringiensis subsp. israelensis mutant harboring ptsH-S45A in the chromosome showed that cry4A expression was derepressed from the inhibitory effect of glucose. The mutant strain produced both cry4A and sigma(35) gene transcripts 4 h ahead of the parent strain, but there was no effect on sigma(28) synthesis. In wild-type B. thuringiensis subsp. israelensis cells, cry4A mRNA was observed from 12 h onwards, while in the mutant it appeared at 8 h and was produced for a longer period. The total amount of cry4A transcripts produced by the mutant was higher than by the parent strain. There was a 60 to 70% reduction in the sporulation efficiency of the mutant B. thuringiensis subsp. israelensis strain compared to the wild-type strain.

  18. Senescence-induced ectopic expression of the A. tumefaciens ipt gene in wheat delays leaf senescence, increases cytokinin content, nitrate influx, and nitrate reductase activity, but does not affect grain yield.

    PubMed

    Sykorová, Blanka; Kuresová, Gabriela; Daskalova, Sasha; Trcková, Marie; Hoyerová, Klára; Raimanová, Ivana; Motyka, Václav; Trávnícková, Alena; Elliott, Malcolm C; Kamínek, Miroslav

    2008-01-01

    The manipulation of cytokinin levels by senescence-regulated expression of the Agrobacterium tumefaciens ipt gene through its control by the Arabidopsis SAG12 (senescence-associated gene 12) promoter is an efficient tool for the prolongation of leaf photosynthetic activity which potentially can affect plant productivity. In the present study, the efficiency of this approach was tested on wheat (Triticum aestivum L.)-a monocarpic plant characterized by a fast switch from vegetative to reproductive growth, and rapid translocation of metabolites from leaves to developing grains after anthesis. When compared with the wild-type (WT) control plants, the SAG12::ipt wheat plants exhibited delayed chlorophyll degradation only when grown under limited nitrogen (N) supply. Ten days after anthesis the content of chlorophyll and bioactive cytokinins of the first (flag) leaf of the transgenic plants was 32% and 65% higher, respectively, than that of the control. There was a progressive increase in nitrate influx and nitrate reductase activity. However, the SAG12::ipt and the WT plants did not show differences in yield-related parameters including number of grains and grain weight. These results suggest that the delay of leaf senescence in wheat also delays the translocation of metabolites from leaves to developing grains, as indicated by higher accumulation of ((15)N-labelled) N in spikes of control compared with transgenic plants prior to anthesis. This delay interferes with the wheat reproductive strategy that is based on a fast programmed translocation of metabolites from the senescing leaves to the reproductive sinks shortly after anthesis.

  19. Gut microbiota, host gene expression, and aging.

    PubMed

    Patrignani, Paola; Tacconelli, Stefania; Bruno, Annalisa

    2014-01-01

    Novel concepts of disease susceptibility and development suggest an important role of gastrointestinal microbiota and microbial pathogens. They can contribute to physiological systems and disease processes, even outside of the gastrointestinal tract. There is increasing evidence that genetics of the host influence and interact with gut microbiota. Moreover, aging-associated oxidative stress may cause morphologic alterations of bacterial cells, thus influencing the aggressive potential and virulence markers of an anaerobic bacterium and finally the type of interaction with the host. At the same time, microbiota may influence host gene expression and it is becoming apparent that it may occur through the regulation of microRNAs. They are short single-stranded noncoding RNAs that regulate posttranscriptional gene expression by affecting mRNA stability and/or translational repression of their target mRNAs. The introduction of -omics approaches (such as metagenomics, metaproteomics, and metatranscriptomics) in microbiota research will certainly advance our knowledge of this area. This will lead to greatly deepen our understanding of the molecular targets in the homeostatic interaction between the gut microbiota and the host and, thereby, promises to reveal new ways to treat diseases and maintain health.

  20. Identification of optimal housekeeping genes for examination of gene expression in bovine corpus luteum.

    PubMed

    Rekawiecki, Robert; Rutkowska, Joanna; Kotwica, Jan

    2012-12-01

    The selection of proper housekeeping genes for studies requiring genes expression normalization is an important step in the appropriate interpretation of results. The expression of housekeeping genes is regulated by many factors including age, gender, type of tissue or disease. The aim of the study was to identify optimal housekeeping genes in the corpus luteum obtained from cyclic or pregnant cows. The mRNA expression of thirteen housekeeping genes: C2orf29, SUZ12, TBP, TUBB2B, ZNF131, HPRT1, 18s RNA, GAPDH, SF3A1, SDHA, MRPL12, B2M and ACTB was measured by Real-time PCR. Range of cycle threshold (C(t)) values of the tested genes varied between 12 and 30 cycles, and 18s RNA had the highest coefficient of variation, whereas C2orf29 had the smallest coefficient. GeNorm software demonstrated C2orf29 and TBP as the most stable and 18s RNA and B2M as the most unstable housekeeping genes. Using the proposed cut-off value (0.15), no more than two of the best GeNorm housekeeping genes are proposed to be used in studies requiring gene expression normalization. NormFinder software demonstrated C2orf29 and SUZ12 as the best and 18s RNA and B2M as the worst housekeeping genes. The study indicates that selection of housekeeping genes may essentially affect the quality of the gene expression results.

  1. Red Maca (Lepidium meyenii) did not affect cell viability despite increased androgen receptor and prostate-specific antigen gene expression in the human prostate cancer cell line LNCaP.

    PubMed

    Díaz, P; Cardenas, H; Orihuela, P A

    2016-10-01

    We examined whether aqueous extract of Lepidium meyenii (red Maca) could inhibit growth, potentiate apoptotic activity of two anticancer drugs Taxol and 2-methoxyestradiol (2ME) or change mRNA expression for the androgen target genes, androgen receptor (Ar) and prostate-specific antigen (Psa) in the human prostate cancer cell line LNCaP. Red Maca aqueous extract at 0, 10, 20, 40 or 80 μg/ml was added to LNCaP cells, and viability was evaluated by the MTS assay at 24 or 48 hr after treatment. Furthermore, LNCaP cells were treated with 80 μg/ml of red Maca plus Taxol or 2ME 5 μM and viability was assessed 48 hr later. Finally, LNCaP cells were treated with red Maca 0, 20, 40 or 80 μg/ml, and 12 hr later, mRNA level for Ar or Psa was assessed by real-time PCR. Treatment with red Maca did not affect viability of LNCaP cells. Apoptotic activity induced by Taxol and 2ME in LNCaP cells was not altered with red Maca treatment. Relative expression of the mRNA for Ar and Psa increased with red Maca 20 and 40 μg/ml, but not at 80 μg/ml. We conclude that red Maca aqueous extract does not have toxic effects, but stimulates androgen signalling in LNCaP cells.

  2. Novel redox nanomedicine improves gene expression of polyion complex vector

    NASA Astrophysics Data System (ADS)

    Toh, Kazuko; Yoshitomi, Toru; Ikeda, Yutaka; Nagasaki, Yukio

    2011-12-01

    Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS) affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP) as an ROS scavenger. When polyethyleneimine (PEI)/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI)/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF)-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

  3. Stratified gene expression analysis identifies major amyotrophic lateral sclerosis genes.

    PubMed

    Jones, Ashley R; Troakes, Claire; King, Andrew; Sahni, Vibhu; De Jong, Simone; Bossers, Koen; Papouli, Efterpi; Mirza, Muddassar; Al-Sarraj, Safa; Shaw, Christopher E; Shaw, Pamela J; Kirby, Janine; Veldink, Jan H; Macklis, Jeffrey D; Powell, John F; Al-Chalabi, Ammar

    2015-05-01

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease of motor neurons resulting in progressive paralysis. Gene expression studies of ALS only rarely identify the same gene pathways as gene association studies. We hypothesized that analyzing tissues by matching on degree of disease severity would identify different patterns of gene expression from a traditional case-control comparison. We analyzed gene expression changes in 4 postmortem central nervous system regions, stratified by severity of motor neuron loss. An overall comparison of cases (n = 6) and controls (n = 3) identified known ALS gene, SOX5, as showing differential expression (log2 fold change = 0.09, p = 5.5 × 10(-5)). Analyses stratified by disease severity identified expression changes in C9orf72 (p = 2.77 × 10(-3)), MATR3 (p = 3.46 × 10(-3)), and VEGFA (p = 8.21 × 10(-4)), all implicated in ALS through genetic studies, and changes in other genes in pathways involving RNA processing and immune response. These findings suggest that analysis of gene expression stratified by disease severity can identify major ALS genes and may be more efficient than traditional case-control comparison.

  4. Gene Expression Noise, Fitness Landscapes, and Evolution

    NASA Astrophysics Data System (ADS)

    Charlebois, Daniel

    The stochastic (or noisy) process of gene expression can have fitness consequences for living organisms. For example, gene expression noise facilitates the development of drug resistance by increasing the time scale at which beneficial phenotypic states can be maintained. The present work investigates the relationship between gene expression noise and the fitness landscape. By incorporating the costs and benefits of gene expression, we track how the fluctuation magnitude and timescale of expression noise evolve in simulations of cell populations under stress. We find that properties of expression noise evolve to maximize fitness on the fitness landscape, and that low levels of expression noise emerge when the fitness benefits of gene expression exceed the fitness costs (and that high levels of noise emerge when the costs of expression exceed the benefits). The findings from our theoretical/computational work offer new hypotheses on the development of drug resistance, some of which are now being investigated in evolution experiments in our laboratory using well-characterized synthetic gene regulatory networks in budding yeast. Nserc Postdoctoral Fellowship (Grant No. PDF-453977-2014).

  5. Phenotypic plasticity and divergence in gene expression.

    PubMed

    Healy, Timothy M; Schulte, Patricia M

    2015-07-01

    The extent to which phenotypic plasticity, or the ability of a single genotype to produce different phenotypes in different environments, impedes or promotes genetic divergence has been a matter of debate within evolutionary biology for many decades (see, for example, Ghalambor et al. ; Pfennig et al. ). Similarly, the role of evolution in shaping phenotypic plasticity remains poorly understood (Pigliucci ). In this issue of Molecular Ecology, Dayan et al. () provide empirical data relevant to these questions by assessing the extent of plasticity and divergence in the expression levels of 2272 genes in muscle tissue from killifish (genus Fundulus) exposed to different temperatures. F. heteroclitus (Fig. A) and F. grandis are minnows that inhabit estuarine marshes (Fig. B) along the coasts of the Atlantic Ocean and Gulf of Mexico in North America. These habitats undergo large variations in temperature both daily and seasonally, and these fish are known to demonstrate substantial phenotypic plasticity in response to temperature change (e.g. Fangue et al. ). Furthermore, the range of F. heteroclitus spans a large latitudinal gradient of temperatures, such that northern populations experience temperatures that are on average ~10°C colder than do southern populations (Schulte ). By comparing gene expression patterns between populations of these fish from different thermal habitats held in the laboratory at three different temperatures, Dayan et al. () address two important questions regarding the interacting effects of plasticity and evolution: (i) How does phenotypic plasticity affect adaptive divergence? and (ii) How does adaptive divergence affect plasticity?

  6. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  7. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids.

    PubMed Central

    Wang, Jianlin; Tian, Lu; Madlung, Andreas; Lee, Hyeon-Se; Chen, Meng; Lee, Jinsuk J; Watson, Brian; Kagochi, Trevor; Comai, Luca; Chen, Z Jeffrey

    2004-01-01

    Polyploidization is an abrupt speciation mechanism for eukaryotes and is especially common in plants. However, little is known about patterns and mechanisms of gene regulation during early stages of polyploid formation. Here we analyzed differential expression patterns of the progenitors' genes among successive selfing generations and independent lineages. The synthetic Arabidopsis allotetraploid lines were produced by a genetic cross between A. thaliana and A. arenosa autotetraploids. We found that some progenitors' genes are differentially expressed in early generations, whereas other genes are silenced in late generations or among different siblings within a selfing generation, suggesting that the silencing of progenitors' genes is rapidly and/or stochastically established. Moreover, a subset of genes is affected in autotetraploid and multiple independent allotetraploid lines and in A. suecica, a natural allotetraploid derived from A. thaliana and A. arenosa, indicating locus-specific susceptibility to ploidy-dependent gene regulation. The role of DNA methylation in silencing progenitors' genes is tested in DNA-hypomethylation transgenic lines of A. suecica using RNA interference (RNAi). Two silenced genes are reactivated in both ddm1- and met1-RNAi lines, consistent with the demethylation of centromeric repeats and gene-specific regions in the genome. A rapid and stochastic process of differential gene expression is reinforced by epigenetic regulation during polyploid formation and evolution. PMID:15342533

  8. DAWN: a framework to identify autism genes and subnetworks using gene expression and genetics

    PubMed Central

    2014-01-01

    Background De novo loss-of-function (dnLoF) mutations are found twofold more often in autism spectrum disorder (ASD) probands than their unaffected siblings. Multiple independent dnLoF mutations in the same gene implicate the gene in risk and hence provide a systematic, albeit arduous, path forward for ASD genetics. It is likely that using additional non-genetic data will enhance the ability to identify ASD genes. Methods To accelerate the search for ASD genes, we developed a novel algorithm, DAWN, to model two kinds of data: rare variations from exome sequencing and gene co-expression in the mid-fetal prefrontal and motor-somatosensory neocortex, a critical nexus for risk. The algorithm casts the ensemble data as a hidden Markov random field in which the graph structure is determined by gene co-expression and it combines these interrelationships with node-specific observations, namely gene identity, expression, genetic data and the estimated effect on risk. Results Using currently available genetic data and a specific developmental time period for gene co-expression, DAWN identified 127 genes that plausibly affect risk, and a set of likely ASD subnetworks. Validation experiments making use of published targeted resequencing results demonstrate its efficacy in reliably predicting ASD genes. DAWN also successfully predicts known ASD genes, not included in the genetic data used to create the model. Conclusions Validation studies demonstrate that DAWN is effective in predicting ASD genes and subnetworks by leveraging genetic and gene expression data. The findings reported here implicate neurite extension and neuronal arborization as risks for ASD. Using DAWN on emerging ASD sequence data and gene expression data from other brain regions and tissues would likely identify novel ASD genes. DAWN can also be used for other complex disorders to identify genes and subnetworks in those disorders. PMID:24602502

  9. Social regulation of cortisol receptor gene expression

    PubMed Central

    Korzan, Wayne J.; Grone, Brian P.; Fernald, Russell D.

    2014-01-01

    In many social species, individuals influence the reproductive capacity of conspecifics. In a well-studied African cichlid fish species, Astatotilapia burtoni, males are either dominant (D) and reproductively competent or non-dominant (ND) and reproductively suppressed as evidenced by reduced gonadotropin releasing hormone (GnRH1) release, regressed gonads, lower levels of androgens and elevated levels of cortisol. Here, we asked whether androgen and cortisol levels might regulate this reproductive suppression. Astatotilapia burtoni has four glucocorticoid receptors (GR1a, GR1b, GR2 and MR), encoded by three genes, and two androgen receptors (ARα and ARβ), encoded by two genes. We previously showed that ARα and ARβ are expressed in GnRH1 neurons in the preoptic area (POA), which regulates reproduction, and that the mRNA levels of these receptors are regulated by social status. Here, we show that GR1, GR2 and MR mRNAs are also expressed in GnRH1 neurons in the POA, revealing potential mechanisms for both androgens and cortisol to influence reproductive capacity. We measured AR, MR and GR mRNA expression levels in a microdissected region of the POA containing GnRH1 neurons, comparing D and ND males. Using quantitative PCR (qPCR), we found D males had higher mRNA levels of ARα, MR, total GR1a and GR2 in the POA compared with ND males. In contrast, ND males had significantly higher levels of GR1b mRNA, a receptor subtype with a reduced transcriptional response to cortisol. Through this novel regulation of receptor type, neurons in the POA of an ND male will be less affected by the higher levels of cortisol typical of low status, suggesting GR receptor type change as a potential adaptive mechanism to mediate high cortisol levels during social suppression. PMID:25013108

  10. Gene expression in the etiology of schizophrenia.

    PubMed

    Bray, Nicholas J

    2008-05-01

    Gene expression represents a fundamental interface between genes and environment in the development and ongoing plasticity of the human brain. Individual differences in gene expression are likely to underpin much of human diversity, including psychiatric illness. In the past decade, the development of microarray and proteomic technology has enabled global description of gene expression in schizophrenia. However, it is difficult on the basis of gene expression assays alone to distinguish between those changes that constitute primary etiology and those that reflect secondary pathology, compensatory mechanisms, or confounding influences. In this respect, tests of genetic association with schizophrenia will be instructive because changes in gene expression that result from gene variants that are associated with the disorder are likely to be of primary etiological significance. However, regulatory polymorphism is extremely difficult to recognize on the basis of sequence interrogation alone. Functional assays at the messenger RNA and/or protein level will be essential in elucidating the molecular mechanisms underlying genetic association with schizophrenia and are likely to become increasingly important in the identification of regulatory variants with which to test for association with the disorder and related traits. Once established, etiologically relevant changes in gene expression can be recapitulated in model systems in order to elucidate the molecular and physiological pathways that may ultimately give rise to the condition.

  11. GESearch: An Interactive GUI Tool for Identifying Gene Expression Signature.

    PubMed

    Ye, Ning; Yin, Hengfu; Liu, Jingjing; Dai, Xiaogang; Yin, Tongming

    2015-01-01

    The huge amount of gene expression data generated by microarray and next-generation sequencing technologies present challenges to exploit their biological meanings. When searching for the coexpression genes, the data mining process is largely affected by selection of algorithms. Thus, it is highly desirable to provide multiple options of algorithms in the user-friendly analytical toolkit to explore the gene expression signatures. For this purpose, we developed GESearch, an interactive graphical user interface (GUI) toolkit, which is written in MATLAB and supports a variety of gene expression data files. This analytical toolkit provides four models, including the mean, the regression, the delegate, and the ensemble models, to identify the coexpression genes, and enables the users to filter data and to select gene expression patterns by browsing the display window or by importing knowledge-based genes. Subsequently, the utility of this analytical toolkit is demonstrated by analyzing two sets of real-life microarray datasets from cell-cycle experiments. Overall, we have developed an interactive GUI toolkit that allows for choosing multiple algorithms for analyzing the gene expression signatures.

  12. Noise minimisation in gene expression switches.

    PubMed

    Monteoliva, Diana; McCarthy, Christina B; Diambra, Luis

    2013-01-01

    Gene expression is subject to stochastic variation which leads to fluctuations in the rate of protein production. Recently, a study in yeast at a genomic scale showed that, in some cases, gene expression variability alters phenotypes while, in other cases, these remain unchanged despite fluctuations in the expression of other genes. These studies suggested that noise in gene expression is a physiologically relevant trait and, to prevent harmful stochastic variation in the expression levels of some genes, it can be subject to minimisation. However, the mechanisms for noise minimisation are still unclear. In the present work, we analysed how noise expression depends on the architecture of the cis-regulatory system, in particular on the number of regulatory binding sites. Using analytical calculations and stochastic simulations, we found that the fluctuation level in noise expression decreased with the number of regulatory sites when regulatory transcription factors interacted with only one other bound transcription factor. In contrast, we observed that there was an optimal number of binding sites when transcription factors interacted with many bound transcription factors. This finding suggested a new mechanism for preventing large fluctuations in the expression of genes which are sensitive to the concentration of regulators.

  13. Noise Minimisation in Gene Expression Switches

    PubMed Central

    Monteoliva, Diana; McCarthy, Christina B.; Diambra, Luis

    2013-01-01

    Gene expression is subject to stochastic variation which leads to fluctuations in the rate of protein production. Recently, a study in yeast at a genomic scale showed that, in some cases, gene expression variability alters phenotypes while, in other cases, these remain unchanged despite fluctuations in the expression of other genes. These studies suggested that noise in gene expression is a physiologically relevant trait and, to prevent harmful stochastic variation in the expression levels of some genes, it can be subject to minimisation. However, the mechanisms for noise minimisation are still unclear. In the present work, we analysed how noise expression depends on the architecture of the cis-regulatory system, in particular on the number of regulatory binding sites. Using analytical calculations and stochastic simulations, we found that the fluctuation level in noise expression decreased with the number of regulatory sites when regulatory transcription factors interacted with only one other bound transcription factor. In contrast, we observed that there was an optimal number of binding sites when transcription factors interacted with many bound transcription factors. This finding suggested a new mechanism for preventing large fluctuations in the expression of genes which are sensitive to the concentration of regulators. PMID:24376783

  14. Nucleosome repositioning underlies dynamic gene expression.

    PubMed

    Nocetti, Nicolas; Whitehouse, Iestyn

    2016-03-15

    Nucleosome repositioning at gene promoters is a fundamental aspect of the regulation of gene expression. However, the extent to which nucleosome repositioning is used within eukaryotic genomes is poorly understood. Here we report a comprehensive analysis of nucleosome positions as budding yeast transit through an ultradian cycle in which expression of >50% of all genes is highly synchronized. We present evidence of extensive nucleosome repositioning at thousands of gene promoters as genes are activated and repressed. During activation, nucleosomes are relocated to allow sites of general transcription factor binding and transcription initiation to become accessible. The extent of nucleosome shifting is closely related to the dynamic range of gene transcription and generally related to DNA sequence properties and use of the coactivators TFIID or SAGA. However, dynamic gene expression is not limited to SAGA-regulated promoters and is an inherent feature of most genes. While nucleosome repositioning occurs pervasively, we found that a class of genes required for growth experience acute nucleosome shifting as cells enter the cell cycle. Significantly, our data identify that the ATP-dependent chromatin-remodeling enzyme Snf2 plays a fundamental role in nucleosome repositioning and the expression of growth genes. We also reveal that nucleosome organization changes extensively in concert with phases of the cell cycle, with large, regularly spaced nucleosome arrays being established in mitosis. Collectively, our data and analysis provide a framework for understanding nucleosome dynamics in relation to fundamental DNA-dependent transactions.

  15. Gene Expression Patterns in Human Liver Cancers

    PubMed Central

    Chen, Xin; Cheung, Siu Tim; So, Samuel; Fan, Sheung Tat; Barry, Christopher; Higgins, John; Lai, Kin-Man; Ji, Jiafu; Dudoit, Sandrine; Ng, Irene O.L.; van de Rijn, Matt; Botstein, David; Brown, Patrick O.

    2002-01-01

    Hepatocellular carcinoma (HCC) is a leading cause of death worldwide. Using cDNA microarrays to characterize patterns of gene expression in HCC, we found consistent differences between the expression patterns in HCC compared with those seen in nontumor liver tissues. The expression patterns in HCC were also readily distinguished from those associated with tumors metastatic to liver. The global gene expression patterns intrinsic to each tumor were sufficiently distinctive that multiple tumor nodules from the same patient could usually be recognized and distinguished from all the others in the large sample set on the basis of their gene expression patterns alone. The distinctive gene expression patterns are characteristic of the tumors and not the patient; the expression programs seen in clonally independent tumor nodules in the same patient were no more similar than those in tumors from different patients. Moreover, clonally related tumor masses that showed distinct expression profiles were also distinguished by genotypic differences. Some features of the gene expression patterns were associated with specific phenotypic and genotypic characteristics of the tumors, including growth rate, vascular invasion, and p53 overexpression. PMID:12058060

  16. Effects of moderate drinking during pregnancy on placental gene expression

    PubMed Central

    Rosenberg, Martina J.; Wolff, Christina R.; El-Emawy, Ahmed; Staples, Miranda C.; Perrone-Bizzozero, Nora I.; Savage, Daniel D.

    2013-01-01

    Many children adversely affected by maternal drinking during pregnancy cannot be identified early in life using current diagnostic criteria for fetal alcohol spectrum disorder (FASD). We conducted a preliminary investigation to determine whether ethanol-induced alterations in placental gene expression may have some utility as a diagnostic indicator of maternal drinking during pregnancy and as a prognostic indicator of risk for adverse neurobehavioral outcomes in affected offspring. Pregnant Long-Evans rats voluntarily consumed either a 0 or 5% ethanol solution 4 h each day throughout gestation. Ethanol consumption produced a mean maternal daily intermittent peak serum ethanol concentration of 84 mg/dL. Placentas were harvested on gestational day 20 for gene expression studies. Microarray analysis of more than 28,000 genes revealed that the expression of 304 known genes was altered twofold or greater in placenta from ethanol-consuming dams compared with controls. About 76% of these genes were repressed in ethanol-exposed placentas. Gene expression changes involved proteins associated with central nervous system development; organ morphogenesis; immunological responses; endocrine function; ion homeostasis; and skeletal, cardiovascular, and cartilage development. To date, quantitative real-time polymerase chain reaction analysis has confirmed significant alterations in gene expression for 22 genes, including genes encoding for three calcium binding proteins, two matrix metalloproteinases, the cannabinoid 1, galanin 2 and toll-like receptor 4, iodothyronine deiodinase 2, 11-β hydroxysteroid dehydrogenase 2, placental growth factor, transforming growth factor alpha, gremlin 1, and epithelial growth factor (EGF)-containing extracellular matrix protein. These results suggest that the expression of a sufficiently large number of placental mRNAs is altered after moderate drinking during pregnancy to warrant more detailed investigation of the placenta as a biomarker system

  17. Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta-thalassemia affects beta- but not gamma-globin gene expression.

    PubMed Central

    Calzolari, R; McMorrow, T; Yannoutsos, N; Langeveld, A; Grosveld, F

    1999-01-01

    The analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch from human fetal gamma- to adult beta-globin gene expression. We have tested this hypothesis for an element that covers the minimal distance between the thalassemia and HPFH deletions and is thought to be responsible for the difference between a deletion HPFH and deltabeta-thalassemia, located 5' of the delta-globin gene. This element has been deleted from a yeast artificial chromosome (YAC) containing the complete human beta-globin locus. Analysis of this modified YAC in transgenic mice shows that early embryonic expression is unaffected, but in the fetal liver it is subject to position effects. In addition, the efficiency of transcription of the beta-globin gene is decreased, but the developmental silencing of the gamma-globin genes is unaffected by the deletion. These results show that the deleted element is involved in the activation of the beta-globin gene perhaps through the loss of a structural function required for gene activation by long-range interactions. PMID:10022837

  18. The Gene Expression Response of Chronic Lymphocytic Leukemia Cells to IL-4 Is Specific, Depends on ZAP-70 Status and Is Differentially Affected by an NFκB Inhibitor

    PubMed Central

    Sebastián-Ruiz, Silvia; Gómez-Espuch, Joaquín; Funes, Consuelo; Moraleda, José-María; García-Garay, María-Carmen; Montes-Barqueros, Natividad; Minguela, Alfredo; Álvarez-López, María-Rocío; Parrado, Antonio

    2014-01-01

    Interleukin 4 (IL-4), an essential mediator of B cell development, plays a role in survival of chronic lymphocytic leukemia (CLL) cells. To obtain new insights into the function of the IL-4 pathway in CLL, we analyzed the gene expression response to IL-4 in CLL and in normal B cells (NBC) by oligonucleotide microarrays, resulting in the identification of 232 non-redundant entities in CLL and 146 in NBC (95 common, 283 altogether), of which 189 were well-defined genes in CLL and 123 in NBC (83 common, 229 altogether) (p<0.05, 2-fold cut-off). To the best of our knowledge, most of them were novel IL-4 targets for CLL (98%), B cells of any source (83%), or any cell type (70%). Responses were significantly higher for 54 and 11 genes in CLL and NBC compared to each other, respectively. In CLL, ZAP-70 status had an impact on IL-4 response, since different sets of IL-4 targets correlated positively or negatively with baseline expression of ZAP-70. In addition, the NFκB inhibitor 6-Amino-4-(4-phenoxyphenethylamino)quinazoline, which reversed the anti-apoptotic effect of IL-4, preferentially blocked the response of genes positively correlated with ZAP-70 (e.g. CCR2, SUSD2), but enhanced the response of genes negatively correlated with ZAP-70 (e.g. AUH, BCL6, LY75, NFIL3). Dissection of the gene expression response to IL-4 in CLL and NBC contributes to the understanding of the anti-apoptotic response. Initial evidence of a connection between ZAP-70 and NFκB supports further exploration of targeting NFκB in the context of the assessment of inhibition of the IL-4 pathway as a therapeutic strategy in CLL, especially in patients expressing bad prognostic markers. PMID:25280001

  19. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    PubMed

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress.

  20. A R2R3-MYB transcription factor, GmMYB12B2, affects the expression levels of flavonoid biosynthesis genes encoding key enzymes in transgenic Arabidopsis plants.

    PubMed

    Li, Xiao-Wei; Li, Jing-Wen; Zhai, Ying; Zhao, Yan; Zhao, Xu; Zhang, Hai-Jun; Su, Lian-Tai; Wang, Ying; Wang, Qing-Yu

    2013-12-10

    Isoflavones play diverse roles in plant-microbe interactions and are potentially important for human nutrition and health. To study the regulation of isoflavonoid synthesis in soybean, the R2R3-MYB transcription factor GmMYB12B2 was isolated and characterized. Yeast expression experiments demonstrated that GmMYB12B2 showed transcriptional activity. GmMYB12B2 was localized in the nucleus when it was transiently expressed in onion epidermal cells. Real-time quantitative PCR analysis revealed that GmMYB12B2 transcription was increased in roots and mature seeds compared with other organs. The gene expression level in immature embryos was consistent with the accumulation of isoflavones. CHS8 is a key enzyme in plant flavonoid biosynthesis. Transient expression experiments in soybean calli demonstrated that CHS8 was regulated by GmMYB12B2 and produced more fluorescence. The expression levels of some key enzymes in flavonoid biosynthesis were examined in transgenic Arabidopsis lines. The results showed that the expression levels of PAL1, CHS and FLS in transgenic plants were significantly higher than those in wild type plants. However, the expression level of DFR was lower, and the expression levels of CHI, F3H and F3'H were the same in all lines. GmMYB12B2 expression caused a constitutive increase in the accumulation of flavonoids in transgenic Arabidopsis lines compared with wild type plants.

  1. Categorical Perception of Affective and Linguistic Facial Expressions

    ERIC Educational Resources Information Center

    McCullough, Stephen; Emmorey, Karen

    2009-01-01

    Two experiments investigated categorical perception (CP) effects for affective facial expressions and linguistic facial expressions from American Sign Language (ASL) for Deaf native signers and hearing non-signers. Facial expressions were presented in isolation (Experiment 1) or in an ASL verb context (Experiment 2). Participants performed ABX…

  2. Gene expression homeostasis and chromosome architecture

    PubMed Central

    Seshasayee, Aswin Sai Narain

    2014-01-01

    In rapidly growing populations of bacterial cells, including those of the model organism Escherichia coli, genes essential for growth - such as those involved in protein synthesis - are expressed at high levels; this is in contrast to many horizontally-acquired genes, which are maintained at low transcriptional levels.1 This balance in gene expression states between 2 distinct classes of genes is established by a galaxy of transcriptional regulators, including the so-called nucleoid associated proteins (NAP) that contribute to shaping the chromosome.2 Besides these active players in gene regulation, it is not too far-fetched to anticipate that genome organization in terms of how genes are arranged on the chromosome,3 which is the result of long-drawn transactions among genome rearrangement processes and selection, and the manner in which it is structured inside the cell, plays a role in establishing this balance. A recent study from our group has contributed to the literature investigating the interplay between global transcriptional regulators and genome organization in establishing gene expression homeostasis.4 In particular, we address a triangle of functional interactions among genome organization, gene expression homeostasis and horizontal gene transfer. PMID:25997086

  3. Unmasking ultradian rhythms in gene expression

    PubMed Central

    van der Veen, Daan R.; Gerkema, Menno P.

    2017-01-01

    Biological oscillations with an ultradian time scale of 1 to several hours include cycles in behavioral arousal, episodic glucocorticoid release, and gene expression. Ultradian rhythms are thought to have an extrinsic origin because of a perceived absence of ultradian rhythmicity in vitro and a lack of known molecular ultradian oscillators. We designed a novel, non–spectral-analysis method of separating ultradian from circadian components and applied it to a published gene expression dataset with an ultradian sampling resolution. Ultradian rhythms in mouse hepatocytes in vivo have been published, and we validated our approach using this control by confirming 175 of 323 ultradian genes identified in a prior study and found 862 additional ultradian genes. For the first time, we now report ultradian expression of >900 genes in vitro. Sixty genes exhibited ultradian transcriptional rhythmicity, both in vivo and in vitro, including 5 genes involved in the cell cycle. Within these 60 genes, we identified significant enrichment of specific DNA motifs in the 1000 bp proximal promotor, some of which associate with known transcriptional factors. These findings are in strong support of instrinsically driven ultradian rhythms and expose potential molecular mechanisms and functions underlying ultradian rhythms that remain unknown.—Van der Veen, D. R., Gerkema, M. P. Unmasking ultradian rhythms in gene expression. PMID:27871062

  4. Unification of Gene Expression Data for Comparable Analyses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Over the past decade, a vast amount of gene expression data has been generated but most data sets are not comparable due to a lack of reliable reference standards. This not only affects unbiased data assessment and clinical applications but also damages the invaluable creation of database resources...

  5. Microarray expression profiling identifies genes with altered expression in HDL-deficient mice

    SciTech Connect

    Callow, Matthew J.; Dudoit, Sandrine; Gong, Elaine L.; Speed, Terence P.; Rubin, Edward M.

    2000-05-05

    Based on the assumption that severe alterations in the expression of genes known to be involved in HDL metabolism may affect the expression of other genes we screened an array of over 5000 mouse expressed sequence tags (ESTs) for altered gene expression in the livers of two lines of mice with dramatic decreases in HDL plasma concentrations. Labeled cDNA from livers of apolipoprotein AI (apo AI) knockout mice, Scavenger Receptor BI (SR-BI) transgenic mice and control mice were co-hybridized to microarrays. Two-sample t-statistics were used to identify genes with altered expression levels in the knockout or transgenic mice compared with the control mice. In the SR-BI group we found 9 array elements representing at least 5 genes to be significantly altered on the basis of an adjusted p value of less than 0.05. In the apo AI knockout group 8 array elements representing 4 genes were altered compared with the control group (p < 0.05). Several of the genes identified in the SR-BI transgenic suggest altered sterol metabolism and oxidative processes. These studies illustrate the use of multiple-testing methods for the identification of genes with altered expression in replicated microarray experiments of apo AI knockout and SR-BI transgenic mice.

  6. Expression of polarity genes in human cancer.

    PubMed

    Lin, Wan-Hsin; Asmann, Yan W; Anastasiadis, Panos Z

    2015-01-01

    Polarity protein complexes are crucial for epithelial apical-basal polarity and directed cell migration. Since alterations of these processes are common in cancer, polarity proteins have been proposed to function as tumor suppressors or oncogenic promoters. Here, we review the current understanding of polarity protein functions in epithelial homeostasis, as well as tumor formation and progression. As most previous studies focused on the function of single polarity proteins in simplified model systems, we used a genomics approach to systematically examine and identify the expression profiles of polarity genes in human cancer. The expression profiles of polarity genes were distinct in different human tissues and classified cancer types. Additionally, polarity expression profiles correlated with disease progression and aggressiveness, as well as with identified cancer types, where specific polarity genes were commonly altered. In the case of Scribble, gene expression analysis indicated its common amplification and upregulation in human cancer, suggesting a tumor promoting function.

  7. Regulation of Gene Expression in Protozoa Parasites

    PubMed Central

    Gomez, Consuelo; Esther Ramirez, M.; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A.

    2010-01-01

    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis. PMID:20204171

  8. Dynamic modeling of gene expression data

    NASA Technical Reports Server (NTRS)

    Holter, N. S.; Maritan, A.; Cieplak, M.; Fedoroff, N. V.; Banavar, J. R.

    2001-01-01

    We describe the time evolution of gene expression levels by using a time translational matrix to predict future expression levels of genes based on their expression levels at some initial time. We deduce the time translational matrix for previously published DNA microarray gene expression data sets by modeling them within a linear framework by using the characteristic modes obtained by singular value decomposition. The resulting time translation matrix provides a measure of the relationships among the modes and governs their time evolution. We show that a truncated matrix linking just a few modes is a good approximation of the full time translation matrix. This finding suggests that the number of essential connections among the genes is small.

  9. Gene Expression in Adult Metafemales of Drosophila Melanogaster

    PubMed Central

    Birchler, J. A.; Hiebert, J. C.; Krietzman, M.

    1989-01-01

    The expression of selected X-linked and autosomal genes was examined in metafemales (3X:2A) compared to diploid sisters. Three enzyme activities (glucose-6-phosphate dehydrogenase, 6-phospho-gluconate dehydrogenase, β-hydroxyacid dehydrogenase) encoded by X-linked genes are not significantly different in the two classes of flies. In contrast, three autosomally encoded enzyme activities (alcohol dehydrogenase, α-glycerophosphate dehydrogenase, isocitrate dehydrogenase) are reduced in metafemales. Protein and DNA comparisons between metafemales and diploid sisters show a lowered level of total protein whereas the total DNA measurements are similar. Thus, the total cell number in metafemales is basically unchanged but gene expression is reduced. Phenotypic analysis of three autosomal loci, glass (gl), purple (pr) and pink-peach (p(p)), show that all three have lowered expression in metafemales while the X-linked loci, white-apricot (w(a)) and Bar (B), are dosage compensated. Quantitative dot blot analysis of messenger RNA levels of the second chromosomal locus, alcohol dehydrogenase (Adh), and the X chromosomal locus, rudimentary (r), show that Adh has reduced expression and r is partially compensated per total RNA in metafemales. It is proposed that the increased dosage of the X chromosome inversely affects both the X and autosomal gene expression but the simultaneous increased dosage of the structural genes on the X results in dosage compensation. The reduced levels of expression of autosomal genes could contribute to the great inviability of metafemales. PMID:2503426

  10. Screening for interaction effects in gene expression data

    PubMed Central

    Castaldi, Peter J.; Cho, Michael H.; Liang, Liming; Silverman, Edwin K.; Hersh, Craig P.; Rice, Kenneth

    2017-01-01

    Expression quantitative trait (eQTL) studies are a powerful tool for identifying genetic variants that affect levels of messenger RNA. Since gene expression is controlled by a complex network of gene-regulating factors, one way to identify these factors is to search for interaction effects between genetic variants and mRNA levels of transcription factors (TFs) and their respective target genes. However, identification of interaction effects in gene expression data pose a variety of methodological challenges, and it has become clear that such analyses should be conducted and interpreted with caution. Investigating the validity and interpretability of several interaction tests when screening for eQTL SNPs whose effect on the target gene expression is modified by the expression level of a transcription factor, we characterized two important methodological issues. First, we stress the scale-dependency of interaction effects and highlight that commonly applied transformation of gene expression data can induce or remove interactions, making interpretation of results more challenging. We then demonstrate that, in the setting of moderate to strong interaction effects on the order of what may be reasonably expected for eQTL studies, standard interaction screening can be biased due to heteroscedasticity induced by true interactions. Using simulation and real data analysis, we outline a set of reasonable minimum conditions and sample size requirements for reliable detection of variant-by-environment and variant-by-TF interactions using the heteroscedasticity consistent covariance-based approach. PMID:28301596

  11. Mining Gene Expression Data of Multiple Sclerosis

    PubMed Central

    Zhu, Zhenli; Huang, Zhengliang; Li, Ke

    2014-01-01

    Objectives Microarray produces a large amount of gene expression data, containing various biological implications. The challenge is to detect a panel of discriminative genes associated with disease. This study proposed a robust classification model for gene selection using gene expression data, and performed an analysis to identify disease-related genes using multiple sclerosis as an example. Materials and methods Gene expression profiles based on the transcriptome of peripheral blood mononuclear cells from a total of 44 samples from 26 multiple sclerosis patients and 18 individuals with other neurological diseases (control) were analyzed. Feature selection algorithms including Support Vector Machine based on Recursive Feature Elimination, Receiver Operating Characteristic Curve, and Boruta algorithms were jointly performed to select candidate genes associating with multiple sclerosis. Multiple classification models categorized samples into two different groups based on the identified genes. Models’ performance was evaluated using cross-validation methods, and an optimal classifier for gene selection was determined. Results An overlapping feature set was identified consisting of 8 genes that were differentially expressed between the two phenotype groups. The genes were significantly associated with the pathways of apoptosis and cytokine-cytokine receptor interaction. TNFSF10 was significantly associated with multiple sclerosis. A Support Vector Machine model was established based on the featured genes and gave a practical accuracy of ∼86%. This binary classification model also outperformed the other models in terms of Sensitivity, Specificity and F1 score. Conclusions The combined analytical framework integrating feature ranking algorithms and Support Vector Machine model could be used for selecting genes for other diseases. PMID:24932510

  12. Changes in Liver Metabolic Gene Expression from Radiation Exposure

    NASA Technical Reports Server (NTRS)

    Peters, C. P.; Wotring, V. E.

    2012-01-01

    Increased exposure to radiation is one physiological stressor associated with spaceflight. While known to alter normal physiological function, how radiation affects metabolism of administered medications is unclear. Crew health could be affected if the actions of medications used in spaceflight deviated from expectations formed during terrestrial medication use. Three different doses of gamma radiation (50 mGy - 6.05 Gy) and a sham were administered to groups of 6 mice each, and after various intervals of recovery time, liver gene expression was measured with RT-qPCR arrays for drug metabolism and DNA repair enzymes. Results indicated approx.65 genes of the 190 tested were significantly affected by at least one of the radiation doses. Many of the affected genes are involved in the metabolism of drugs with hydrophobic or steroid-like structures, maintenance of redox homeostasis and repair of DNA damage. Most affected genes returned to near control expression levels by 7 days post-treatment. With 6 Gy exposure, metallothionein expression was 132-fold more than control at the 4 hr time point, and fell at each later time point (11-fold at 24 hrs, and 8-fold at 7 days). In contrast, Cyp17a1 showed a 4-fold elevation at 4 hrs after exposure and remained constant for 7 days.

  13. Gene expression analysis of bud and leaf color in tea.

    PubMed

    Wei, Kang; Zhang, Yazhen; Wu, Liyun; Li, Hailin; Ruan, Li; Bai, Peixian; Zhang, Chengcai; Zhang, Fen; Xu, Liyi; Wang, Liyuan; Cheng, Hao

    2016-10-01

    Purple shoot tea attributing to the high anthocyanin accumulation is of great interest for its wide health benefits. To better understand potential mechanisms involved in purple buds and leaves formation in tea plants, we performed transcriptome analysis of six green or purple shoot tea individuals from a F1 population using the Illumina sequencing method. Totally 292 million RNA-Seq reads were obtained and assembled into 112,233 unigenes, with an average length of 759 bp and an N50 of 1081 bp. Moreover, totally 2193 unigenes showed significant differences in expression levels between green and purple tea samples, with 1143 up- and 1050 down-regulated in the purple teas. Further real time PCR analysis confirmed RNA-Seq results. Our study identified 28 differentially expressed transcriptional factors and A CsMYB gene was found to be highly similar to AtPAP1 in Arabidopsis. Further analysis of differentially expressed genes involved in anthocyanin biosynthesis and transportation showed that the late biosynthetic genes and genes involved in anthocyanin transportation were largely affected but the early biosynthetic genes were less or none affected. Overall, the identification of a large number of differentially expressed genes offers a global view of the potential mechanisms associated with purple buds and leaves formation, which will facilitate molecular breeding in tea plants.

  14. Validation of commonly used reference genes for sleep-related gene expression studies

    PubMed Central

    Lee, Kil S; Alvarenga, Tathiana A; Guindalini, Camila; Andersen, Monica L; Castro, Rosa MRPS; Tufik, Sergio

    2009-01-01

    Background Sleep is a restorative process and is essential for maintenance of mental and physical health. In an attempt to understand the complexity of sleep, multidisciplinary strategies, including genetic approaches, have been applied to sleep research. Although quantitative real time PCR has been used in previous sleep-related gene expression studies, proper validation of reference genes is currently lacking. Thus, we examined the effect of total or paradoxical sleep deprivation (TSD or PSD) on the expression stability of the following frequently used reference genes in brain and blood: beta-actin (b-actin), beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and hypoxanthine guanine phosphoribosyl transferase (HPRT). Results Neither TSD nor PSD affected the expression stability of all tested genes in both tissues indicating that b-actin, B2M, GAPDH and HPRT are appropriate reference genes for the sleep-related gene expression studies. In order to further verify these results, the relative expression of brain derived neurotrophic factor (BDNF) and glycerol-3-phosphate dehydrogenase1 (GPD1) was evaluated in brain and blood, respectively. The normalization with each of four reference genes produced similar pattern of expression in control and sleep deprived rats, but subtle differences in the magnitude of expression fold change were observed which might affect the statistical significance. Conclusion This study demonstrated that sleep deprivation does not alter the expression stability of commonly used reference genes in brain and blood. Nonetheless, the use of multiple reference genes in quantitative RT-PCR is required for the accurate results. PMID:19445681

  15. Imputing gene expression to maximize platform compatibility.

    PubMed

    Zhou, Weizhuang; Han, Lichy; Altman, Russ B

    2017-02-15

    Microarray measurements of gene expression constitute a large fraction of publicly shared biological data, and are available in the Gene Expression Omnibus (GEO). Many studies use GEO data to shape hypotheses and improve statistical power. Within GEO, the Affymetrix HG-U133A and HG-U133 Plus 2.0 are the two most commonly used microarray platforms for human samples; the HG-U133 Plus 2.0 platform contains 54 220 probes and the HG-U133A array contains a proper subset (21 722 probes). When different platforms are involved, the subset of common genes is most easily compared. This approach results in the exclusion of substantial measured data and can limit downstream analysis. To predict the expression values for the genes unique to the HG-U133 Plus 2.0 platform, we constructed a series of gene expression inference models based on genes common to both platforms. Our model predicts gene expression values that are within the variability observed in controlled replicate studies and are highly correlated with measured data. Using six previously published studies, we also demonstrate the improved performance of the enlarged feature space generated by our model in downstream analysis.

  16. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.

    PubMed

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  17. Caffeine exposure alters cardiac gene expression in embryonic cardiomyocytes.

    PubMed

    Fang, Xiefan; Mei, Wenbin; Barbazuk, William B; Rivkees, Scott A; Wendler, Christopher C

    2014-12-15

    Previous studies demonstrated that in utero caffeine treatment at embryonic day (E) 8.5 alters DNA methylation patterns, gene expression, and cardiac function in adult mice. To provide insight into the mechanisms, we examined cardiac gene and microRNA (miRNA) expression in cardiomyocytes shortly after exposure to physiologically relevant doses of caffeine. In HL-1 and primary embryonic cardiomyocytes, caffeine treatment for 48 h significantly altered the expression of cardiac structural genes (Myh6, Myh7, Myh7b, Tnni3), hormonal genes (Anp and BnP), cardiac transcription factors (Gata4, Mef2c, Mef2d, Nfatc1), and microRNAs (miRNAs; miR208a, miR208b, miR499). In addition, expressions of these genes were significantly altered in embryonic hearts exposed to in utero caffeine. For in utero experiments, pregnant CD-1 dams were treated with 20-60 mg/kg of caffeine, which resulted in maternal circulation levels of 37.3-65.3 μM 2 h after treatment. RNA sequencing was performed on embryonic ventricles treated with vehicle or 20 mg/kg of caffeine daily from E6.5-9.5. Differential expression (DE) analysis revealed that 124 genes and 849 transcripts were significantly altered, and differential exon usage (DEU) analysis identified 597 exons that were changed in response to prenatal caffeine exposure. Among the DE genes identified by RNA sequencing were several cardiac structural genes and genes that control DNA methylation and histone modification. Pathway analysis revealed that pathways related to cardiovascular development and diseases were significantly affected by caffeine. In addition, global cardiac DNA methylation was reduced in caffeine-treated cardiomyocytes. Collectively, these data demonstrate that caffeine exposure alters gene expression and DNA methylation in embryonic cardiomyocytes.

  18. Caffeine exposure alters cardiac gene expression in embryonic cardiomyocytes

    PubMed Central

    Fang, Xiefan; Mei, Wenbin; Barbazuk, William B.; Rivkees, Scott A.

    2014-01-01

    Previous studies demonstrated that in utero caffeine treatment at embryonic day (E) 8.5 alters DNA methylation patterns, gene expression, and cardiac function in adult mice. To provide insight into the mechanisms, we examined cardiac gene and microRNA (miRNA) expression in cardiomyocytes shortly after exposure to physiologically relevant doses of caffeine. In HL-1 and primary embryonic cardiomyocytes, caffeine treatment for 48 h significantly altered the expression of cardiac structural genes (Myh6, Myh7, Myh7b, Tnni3), hormonal genes (Anp and BnP), cardiac transcription factors (Gata4, Mef2c, Mef2d, Nfatc1), and microRNAs (miRNAs; miR208a, miR208b, miR499). In addition, expressions of these genes were significantly altered in embryonic hearts exposed to in utero caffeine. For in utero experiments, pregnant CD-1 dams were treated with 20–60 mg/kg of caffeine, which resulted in maternal circulation levels of 37.3–65.3 μM 2 h after treatment. RNA sequencing was performed on embryonic ventricles treated with vehicle or 20 mg/kg of caffeine daily from E6.5-9.5. Differential expression (DE) analysis revealed that 124 genes and 849 transcripts were significantly altered, and differential exon usage (DEU) analysis identified 597 exons that were changed in response to prenatal caffeine exposure. Among the DE genes identified by RNA sequencing were several cardiac structural genes and genes that control DNA methylation and histone modification. Pathway analysis revealed that pathways related to cardiovascular development and diseases were significantly affected by caffeine. In addition, global cardiac DNA methylation was reduced in caffeine-treated cardiomyocytes. Collectively, these data demonstrate that caffeine exposure alters gene expression and DNA methylation in embryonic cardiomyocytes. PMID:25354728

  19. Perspectives: Gene Expression in Fisheries Management

    USGS Publications Warehouse

    Nielsen, Jennifer L.; Pavey, Scott A.

    2010-01-01

    Functional genes and gene expression have been connected to physiological traits linked to effective production and broodstock selection in aquaculture, selective implications of commercial fish harvest, and adaptive changes reflected in non-commercial fish populations subject to human disturbance and climate change. Gene mapping using single nucleotide polymorphisms (SNPs) to identify functional genes, gene expression (analogue microarrays and real-time PCR), and digital sequencing technologies looking at RNA transcripts present new concepts and opportunities in support of effective and sustainable fisheries. Genomic tools have been rapidly growing in aquaculture research addressing aspects of fish health, toxicology, and early development. Genomic technologies linking effects in functional genes involved in growth, maturation and life history development have been tied to selection resulting from harvest practices. Incorporating new and ever-increasing knowledge of fish genomes is opening a different perspective on local adaptation that will prove invaluable in wild fish conservation and management. Conservation of fish stocks is rapidly incorporating research on critical adaptive responses directed at the effects of human disturbance and climate change through gene expression studies. Genomic studies of fish populations can be generally grouped into three broad categories: 1) evolutionary genomics and biodiversity; 2) adaptive physiological responses to a changing environment; and 3) adaptive behavioral genomics and life history diversity. We review current genomic research in fisheries focusing on those that use microarrays to explore differences in gene expression among phenotypes and within or across populations, information that is critically important to the conservation of fish and their relationship to humans.

  20. Distal chromatin structure influences local nucleosome positions and gene expression.

    PubMed

    Jansen, An; van der Zande, Elisa; Meert, Wim; Fink, Gerald R; Verstrepen, Kevin J

    2012-05-01

    The positions of nucleosomes across the genome influence several cellular processes, including gene transcription. However, our understanding of the factors dictating where nucleosomes are located and how this affects gene regulation is still limited. Here, we perform an extensive in vivo study to investigate the influence of the neighboring chromatin structure on local nucleosome positioning and gene expression. Using truncated versions of the Saccharomyces cerevisiae URA3 gene, we show that nucleosome positions in the URA3 promoter are at least partly determined by the local DNA sequence, with so-called 'anti-nucleosomal elements' like poly(dA:dT) tracts being key determinants of nucleosome positions. In addition, we show that changes in the nucleosome positions in the URA3 promoter strongly affect the promoter activity. Most interestingly, in addition to demonstrating the effect of the local DNA sequence, our study provides novel in vivo evidence that nucleosome positions are also affected by the position of neighboring nucleosomes. Nucleosome structure may therefore be an important selective force for conservation of gene order on a chromosome, because relocating a gene to another genomic position (where the positions of neighboring nucleosomes are different from the original locus) can have dramatic consequences for the gene's nucleosome structure and thus its expression.

  1. Control of gene expression in trypanosomes.

    PubMed Central

    Vanhamme, L; Pays, E

    1995-01-01

    Trypanosomes are protozoan agents of major parasitic diseases such as Chagas' disease in South America and sleeping sickness of humans and nagana disease of cattle in Africa. They are transmitted to mammalian hosts by specific insect vectors. Their life cycle consists of a succession of differentiation and growth phases requiring regulated gene expression to adapt to the changing extracellular environment. Typical of such stage-specific expression is that of the major surface antigens of Trypanosoma brucei, procyclin in the procyclic (insect) form and the variant surface glycoprotein (VSG) in the bloodstream (mammalian) form. In trypanosomes, the regulation of gene expression is effected mainly at posttranscriptional levels, since primary transcription of most of the genes occurs in long polycistronic units and is constitutive. The transcripts are processed by transsplicing and polyadenylation under the influence of intergenic polypyrimidine tracts. These events show some developmental regulation. Untranslated sequences of the mRNAs seem to play a prominent role in the stage-specific control of individual gene expression, through a modulation of mRNA abundance. The VSG and procyclin transcription units exhibit particular features that are probably related to the need for a high level of expression. The promoters and RNA polymerase driving the expression of these units resemble those of the ribosomal genes. Their mutually exclusive expression is ensured by controls operating at several levels, including RNA elongation. Antigenic variation in the bloodstream is achieved through DNA rearrangements or alternative activation of the telomeric VSG gene expression sites. Recent discoveries, such as the existence of a novel nucleotide in telomeric DNA and the generation of point mutations in VSG genes, have shed new light on the mechanisms and consequences of antigenic variation. PMID:7603410

  2. Effects of elevated peroxidase levels and corn earworm feeding on gene expression in tomato

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tomato gene arrays were used to investigate how high levels of transgenic peroxidase expression and feeding by the corn earworm, Helicoverpa zea, affected expression of defensive and other genes. High peroxidase activity significantly upregulated proteinase inhibitors and a few other defensive gene...

  3. Resource Sharing Controls Gene Expression Bursting.

    PubMed

    Caveney, Patrick M; Norred, S Elizabeth; Chin, Charles W; Boreyko, Jonathan B; Razooky, Brandon S; Retterer, Scott T; Collier, C Patrick; Simpson, Michael L

    2017-02-17

    Episodic gene expression, with periods of high expression separated by periods of no expression, is a pervasive biological phenomenon. This bursty pattern of expression draws from a finite reservoir of expression machinery in a highly time variant way, i.e., requiring no resources most of the time but drawing heavily on them during short intense bursts, that intimately links expression bursting and resource sharing. Yet, most recent investigations have focused on specific molecular mechanisms intrinsic to the bursty behavior of individual genes, while little is known about the interplay between resource sharing and global expression bursting behavior. Here, we confine Escherichia coli cell extract in both cell-sized microfluidic chambers and lipid-based vesicles to explore how resource sharing influences expression bursting. Interestingly, expression burst size, but not burst frequency, is highly sensitive to the size of the shared transcription and translation resource pools. The intriguing implication of these results is that expression bursts are more readily amplified than initiated, suggesting that burst formation occurs through positive feedback or cooperativity. When extrapolated to prokaryotic cells, these results suggest that large translational bursts may be correlated with large transcriptional bursts. This correlation is supported by recently reported transcription and translation bursting studies in E. coli. The results reported here demonstrate a strong intimate link between global expression burst patterns and resource sharing, and they suggest that bursting plays an important role in optimizing the use of limited, shared expression resources.

  4. Nonsyntenic Genes Drive Highly Dynamic Complementation of Gene Expression in Maize Hybrids[W

    PubMed Central

    Larson, Nick B.; Marcon, Caroline; Schnable, James C.; Yeh, Cheng-Ting; Lanz, Christa; Nettleton, Dan; Piepho, Hans-Peter; Schnable, Patrick S.

    2014-01-01

    Maize (Zea mays) displays an exceptional level of structural genomic diversity, which is likely unique among higher eukaryotes. In this study, we surveyed how the genetic divergence of two maize inbred lines affects the transcriptomic landscape in four different primary root tissues of their F1-hybrid progeny. An extreme instance of complementation was frequently observed: genes that were expressed in only one parent but in both reciprocal hybrids. This single-parent expression (SPE) pattern was detected for 2341 genes with up to 1287 SPE patterns per tissue. As a consequence, the number of active genes in hybrids exceeded that of their parents in each tissue by >400. SPE patterns are highly dynamic, as illustrated by their excessive degree of tissue specificity (80%). The biological significance of this type of complementation is underpinned by the observation that a disproportionally high number of SPE genes (75 to 82%) is nonsyntenic, as opposed to all expressed genes (36%). These genes likely evolved after the last whole-genome duplication and are therefore younger than the syntenic genes. In summary, SPE genes shape the remarkable gene expression plasticity between root tissues and complementation in maize hybrids, resulting in a tissue-specific increase of active genes in F1-hybrids compared with their inbred parents. PMID:25315323

  5. Application of multidisciplinary analysis to gene expression.

    SciTech Connect

    Wang, Xuefel; Kang, Huining; Fields, Chris; Cowie, Jim R.; Davidson, George S.; Haaland, David Michael; Sibirtsev, Valeriy; Mosquera-Caro, Monica P.; Xu, Yuexian; Martin, Shawn Bryan; Helman, Paul; Andries, Erik; Ar, Kerem; Potter, Jeffrey; Willman, Cheryl L.; Murphy, Maurice H.

    2004-01-01

    Molecular analysis of cancer, at the genomic level, could lead to individualized patient diagnostics and treatments. The developments to follow will signal a significant paradigm shift in the clinical management of human cancer. Despite our initial hopes, however, it seems that simple analysis of microarray data cannot elucidate clinically significant gene functions and mechanisms. Extracting biological information from microarray data requires a complicated path involving multidisciplinary teams of biomedical researchers, computer scientists, mathematicians, statisticians, and computational linguists. The integration of the diverse outputs of each team is the limiting factor in the progress to discover candidate genes and pathways associated with the molecular biology of cancer. Specifically, one must deal with sets of significant genes identified by each method and extract whatever useful information may be found by comparing these different gene lists. Here we present our experience with such comparisons, and share methods developed in the analysis of an infant leukemia cohort studied on Affymetrix HG-U95A arrays. In particular, spatial gene clustering, hyper-dimensional projections, and computational linguistics were used to compare different gene lists. In spatial gene clustering, different gene lists are grouped together and visualized on a three-dimensional expression map, where genes with similar expressions are co-located. In another approach, projections from gene expression space onto a sphere clarify how groups of genes can jointly have more predictive power than groups of individually selected genes. Finally, online literature is automatically rearranged to present information about genes common to multiple groups, or to contrast the differences between the lists. The combination of these methods has improved our understanding of infant leukemia. While the complicated reality of the biology dashed our initial, optimistic hopes for simple answers from

  6. Gene expression of a gene family in maize based on noncollinear haplotypes

    PubMed Central

    Song, Rentao; Messing, Joachim

    2003-01-01

    Genomic regions of nearly every species diverged into different haplotypes, mostly based on point mutations, small deletions, and insertions that do not affect the collinearity of genes within a species. However, the same genomic interval containing the z1C gene cluster of two inbred lines of Zea mays significantly lost their gene collinearity and also differed in the regulation of each remaining gene set. Furthermore, when inbreds were reciprocally crossed, hybrids exhibited an unexpected shift of expression patterns so that “overdominance” instead of “dominance complementation” of allelic and nonallelic gene expression occurred. The same interval also differed in length (360 vs. 263 kb). Segmental rearrangements led to sequence changes, which were further enhanced by the insertion of different transposable elements. Changes in gene order affected not only z1C genes but also three unrelated genes. However, the orthologous interval between two subspecies of rice (not rice cultivars) was conserved in length and gene order, whereas changes between two maize inbreds were as drastic as changes between maize and sorghum. Given that chromosomes could conceivably consist of intervals of haplotypes that are highly diverged, one could envision endless breeding opportunities because of their linear arrangement along a chromosome and their expression potential in hybrid combinations (“binary” systems). The implication of such a hypothesis for heterosis is discussed. PMID:12853580

  7. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  8. Modeling gene expression in time and space.

    PubMed

    Rué, Pau; Garcia-Ojalvo, Jordi

    2013-01-01

    Cell populations rarely exhibit gene-expression profiles that are homogeneous in time and space. In the temporal domain, dynamical behaviors such as oscillations and pulses of protein production pervade cell biology, underlying phenomena as diverse as circadian rhythmicity, cell cycle control, stress and damage responses, and stem-cell pluripotency. In multicellular populations, spatial heterogeneities are crucial for decision making and development, among many other functions. Cells need to exquisitely coordinate this temporal and spatial variation to survive. Although the spatiotemporal character of gene expression is challenging to quantify experimentally at the level of individual cells, it is beneficial from the modeling viewpoint, because it provides strong constraints that can be probed by theoretically analyzing mathematical models of candidate gene and protein circuits. Here, we review recent examples of temporal dynamics and spatial patterning in gene expression to show how modeling such phenomenology can help us unravel the molecular mechanisms of cellular function.

  9. Chemically regulated gene expression in plants.

    PubMed

    Padidam, Malla

    2003-04-01

    Chemically inducible systems that activate or inactivate gene expression have many potential applications in the determination of gene function and in plant biotechnology. The precise timing and control of gene expression are important aspects of chemically inducible systems. Several systems have been developed and used to analyze gene function, marker-free plant transformation, site-specific DNA excision, activation tagging, conditional genetic complementation, and restoration of male fertility. Chemicals that are used to regulate transgene expression include the antibiotic tetracycline, the steroids dexamethasone and estradiol, copper, ethanol, the inducer of pathogen-related proteins benzothiadiazol, herbicide safeners, and the insecticide methoxyfenozide. Systems that are suitable for field application are particularly useful for experimental systems and have potential applications in biotechnology.

  10. CIRCADIAN CLOCK AND CELL CYCLE GENE EXPRESSION

    PubMed Central

    Metz, Richard P.; Qu, Xiaoyu; Laffin, Brian; Earnest, David; Porter, Weston W.

    2009-01-01

    Mouse mammary epithelial cells (HC-11) and mammary tissues were analyzed for developmental changes in circadian clock, cellular proliferation and differentiation marker genes. Expression of the clock genes, Per1 and Bmal1, were elevated in differentiated HC-11 cells whereas Per2 mRNA levels were higher in undifferentiated cells. This differentiation-dependent profile of clock gene expression was consistent with that observed in mouse mammary glands as Per1 and Bmal1 mRNA levels were elevated in late pregnant and lactating mammary tissues, while Per2 expression was higher in proliferating virgin and early pregnant glands. In both HC-11 cells and mammary glands, elevated Per2 expression was positively correlated with c-Myc and Cyclin D1 mRNA levels while Per1 and Bmal1 expression changed in conjunction with ß-casein mRNA levels. Interestingly, developmental stage had differential effects on rhythms of clock gene expression in the mammary gland. These data suggest that circadian clock genes may play a role in mouse mammary gland development and differentiation. PMID:16261617

  11. Gene expression patterns associated with queen honey bee longevity.

    PubMed

    Corona, Miguel; Hughes, Kimberly A; Weaver, Daniel B; Robinson, Gene E

    2005-11-01

    The oxidative stress theory of aging proposes that accumulation of oxidative damage is the main proximate cause of aging and that lifespan is determined by the rate at which this damage occurs. Two predictions from this theory are that long-lived organisms produce fewer ROS or have increased antioxidant production. Based in these predictions, molecular mechanisms to promote longevity could include either changes in the regulation of mitochondrial genes that affect ROS production or elevated expression of antioxidant genes. We explored these possibilities in the honey bee, a good model for the study of aging because it has a caste system in which the same genome produces both a long-lived queen and a short-lived worker. We measured mRNA levels for genes encoding eight of the most prominent antioxidant enzymes and five mitochondrial proteins involved in respiration. The expression of antioxidant genes generally decreased with age in queens, but not in workers. Expression of most mitochondrial genes, in particular CytC, was higher in young queens, but these genes showed a faster age-related decline relative to workers. One exception to this trend was COX-I in thorax. This resulted in higher COX-I/CytC ratios in old queens compared to old workers, which suggests caste-specific differences in mitochondrial function that might be related to the caste-specific differences in longevity. Queen honey bee longevity appears to have evolved via mechanisms other than increased antioxidant gene expression.

  12. Methods of Combinatorial Optimization to Reveal Factors Affecting Gene Length

    PubMed Central

    Bolshoy, Alexander; Tatarinova, Tatiana

    2012-01-01

    In this paper we present a novel method for genome ranking according to gene lengths. The main outcomes described in this paper are the following: the formulation of the genome ranking problem, presentation of relevant approaches to solve it, and the demonstration of preliminary results from prokaryotic genomes ordering. Using a subset of prokaryotic genomes, we attempted to uncover factors affecting gene length. We have demonstrated that hyperthermophilic species have shorter genes as compared with mesophilic organisms, which probably means that environmental factors affect gene length. Moreover, these preliminary results show that environmental factors group together in ranking evolutionary distant species. PMID:23300345

  13. Methods of combinatorial optimization to reveal factors affecting gene length.

    PubMed

    Bolshoy, Alexander; Tatarinova, Tatiana

    2012-01-01

    In this paper we present a novel method for genome ranking according to gene lengths. The main outcomes described in this paper are the following: the formulation of the genome ranking problem, presentation of relevant approaches to solve it, and the demonstration of preliminary results from prokaryotic genomes ordering. Using a subset of prokaryotic genomes, we attempted to uncover factors affecting gene length. We have demonstrated that hyperthermophilic species have shorter genes as compared with mesophilic organisms, which probably means that environmental factors affect gene length. Moreover, these preliminary results show that environmental factors group together in ranking evolutionary distant species.

  14. Language and affective facial expression in children with perinatal stroke

    PubMed Central

    Lai, Philip T.; Reilly, Judy S.

    2015-01-01

    Children with perinatal stroke (PS) provide a unique opportunity to understand developing brain-behavior relations. Previous research has noted distinctive differences in behavioral sequelae between children with PS and adults with acquired stroke: children fare better, presumably due to the plasticity of the developing brain for adaptive reorganization. Whereas we are beginning to understand language development, we know little about another communicative domain, emotional expression. The current study investigates the use and integration of language and facial expression during an interview. As anticipated, the language performance of the five and six year old PS group is comparable to their typically developing (TD) peers, however, their affective profiles are distinctive: those with right hemisphere injury are less expressive with respect to affective language and affective facial expression than either those with left hemisphere injury or TD group. The two distinctive profiles for language and emotional expression in these children suggest gradients of neuroplasticity in the developing brain. PMID:26117314

  15. Paternally expressed genes predominate in the placenta.

    PubMed

    Wang, Xu; Miller, Donald C; Harman, Rebecca; Antczak, Douglas F; Clark, Andrew G

    2013-06-25

    The discovery of genomic imprinting through studies of manipulated mouse embryos indicated that the paternal genome has a major influence on placental development. However, previous research has not demonstrated paternal bias in imprinted genes. We applied RNA sequencing to trophoblast tissue from reciprocal hybrids of horse and donkey, where genotypic differences allowed parent-of-origin identification of most expressed genes. Using this approach, we identified a core group of 15 ancient imprinted genes, of which 10 were paternally expressed. An additional 78 candidate imprinted genes identified by RNA sequencing also showed paternal bias. Pyrosequencing was used to confirm the imprinting status of six of the genes, including the insulin receptor (INSR), which may play a role in growth regulation with its reciprocally imprinted ligand, histone acetyltransferase-1 (HAT1), a gene involved in chromatin modification, and lymphocyte antigen 6 complex, locus G6C, a newly identified imprinted gene in the major histocompatibility complex. The 78 candidate imprinted genes displayed parent-of-origin expression bias in placenta but not fetus, and most showed less than 100% silencing of the imprinted allele. Some displayed variability in imprinting status among individuals. This variability results in a unique epigenetic signature for each placenta that contributes to variation in the intrauterine environment and thus presents the opportunity for natural selection to operate on parent-of-origin differential regulation. Taken together, these features highlight the plasticity of imprinting in mammals and the central importance of the placenta as a target tissue for genomic imprinting.

  16. Hepatic Xenobiotic Metabolizing Enzyme Gene Expression ...

    EPA Pesticide Factsheets

    BACKGROUND: Differences in responses to environmental chemicals and drugs between life stages are likely due in part to differences in the expression of xenobiotic metabolizing enzymes and transporters (XMETs). No comprehensive analysis of the mRNA expression of XMETs has been carried out through life stages in any species. RESULTS: Using full-genome arrays, the mRNA expression of all XMETs and their regulatory proteins was examined during fetal (gestation day (GD) 19), neonatal (postnatal day (PND) 7), prepubescent (PND32), middle age (12 months), and old age (18 and 24 months) in the C57BL/6J (C57) mouse liver and compared to adults. Fetal and neonatal life stages exhibited dramatic differences in XMET mRNA expression compared to the relatively minor effects of old age. The total number of XMET probe sets that differed from adults was 636, 500, 84, 5, 43, and 102 for GD19, PND7, PND32, 12 months, 18 months and 24 months, respectively. At all life stages except PND32, under-expressed genes outnumbered over-expressed genes. The altered XMETs included those in all of the major metabolic and transport phases including introduction of reactive or polar groups (Phase I), conjugation (Phase II) and excretion (Phase III). In the fetus and neonate, parallel increases in expression were noted in the dioxin receptor, Nrf2 components and their regulated genes while nuclear receptors and regulated genes were generally down-regulated. Suppression of male-specific XMETs w

  17. Gene expression in cortex and hippocampus during acute pneumococcal meningitis

    PubMed Central

    Coimbra, Roney S; Voisin, Veronique; de Saizieu, Antoine B; Lindberg, Raija LP; Wittwer, Matthias; Leppert, David; Leib, Stephen L

    2006-01-01

    Background Pneumococcal meningitis is associated with high mortality (~30%) and morbidity. Up to 50% of survivors are affected by neurological sequelae due to a wide spectrum of brain injury mainly affecting the cortex and hippocampus. Despite this significant disease burden, the genetic program that regulates the host response leading to brain damage as a consequence of bacterial meningitis is largely unknown. We used an infant rat model of pneumococcal meningitis to assess gene expression profiles in cortex and hippocampus at 22 and 44 hours after infection and in controls at 22 h after mock-infection with saline. To analyze the biological significance of the data generated by Affymetrix DNA microarrays, a bioinformatics pipeline was used combining (i) a literature-profiling algorithm to cluster genes based on the vocabulary of abstracts indexed in MEDLINE (NCBI) and (ii) the self-organizing map (SOM), a clustering technique based on covariance in gene expression kinetics. Results Among 598 genes differentially regulated (change factor ≥ 1.5; p ≤ 0.05), 77% were automatically assigned to one of 11 functional groups with 94% accuracy. SOM disclosed six patterns of expression kinetics. Genes associated with growth control/neuroplasticity, signal transduction, cell death/survival, cytoskeleton, and immunity were generally upregulated. In contrast, genes related to neurotransmission and lipid metabolism were transiently downregulated on the whole. The majority of the genes associated with ionic homeostasis, neurotransmission, signal transduction and lipid metabolism were differentially regulated specifically in the hippocampus. Of the cell death/survival genes found to be continuously upregulated only in hippocampus, the majority are pro-apoptotic, while those continuously upregulated only in cortex are anti-apoptotic. Conclusion Temporal and spatial analysis of gene expression in experimental pneumococcal meningitis identified potential targets for therapy. PMID

  18. Changes in Liver Metabolic Gene Expression from Radiation Exposure

    NASA Technical Reports Server (NTRS)

    Peters, C. P.; Wotring, Virginia E.

    2011-01-01

    Radiation exposure is one of the unique physiological challenges of human spaceflight that is not encountered on earth. While radiation exposure is known to impart physiological stresses and alter normal function, it is unclear how it specifically affects drug metabolism. A major concern is that the actions of medications used in spaceflight may deviate from the expectations formed from terrestrial use. This concern was investigated at the molecular level by analyzing how gamma radiation exposure affected gene expression in the livers of mice. Three different doses of radiation were administered and after various intervals of recovery time, gene expression was measured with RT-qPCR screening arrays for drug metabolism and DNA repair. After examining the results of 192 genes total from each of 72 mice, 65 genes were found to be significantly affected by at least one of the doses of radiation. In general, the genes affected are involved in the metabolism of drugs with lipid or steroid hormone-like structures, as well as the maintenance of redox homeostasis and repair of DNA damage.

  19. Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.

    PubMed

    Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko

    2014-05-01

    Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering.

  20. Gene expression profiles in Finnish twins with multiple sclerosis

    PubMed Central

    Särkijärvi, Silja; Kuusisto, Hanna; Paalavuo, Raija; Levula, Mari; Airla, Nina; Lehtimäki, Terho; Kaprio, Jaakko; Koskenvuo, Markku; Elovaara, Irina

    2006-01-01

    Background Since genetic alterations influencing susceptibility to multiple sclerosis (MS), the most common autoimmune demyelinating disease of the central nervous system (CNS), are as yet poorly understood, the purpose of this study was to identify genes responsible for MS by studying monozygotic (MZ) twin pairs discordant for MS. Methods In order to identify genes involved in MS development, the gene expression profiles in blood mononuclear cells obtained from eight MZ twin pairs discordant for MS were analyzed by cDNA microarray technology detecting the expression of 8 300 genes. The twins were collected from the Finnish Twin Cohort Study and both affected subjects and their healthy siblings underwent neurological evaluation and cerebral and spinal magnetic resonance imaging. Gene expressions were confirmed by relative quantitative reverse transcription PCR. Results It appeared that 25 genes were at least two-fold up-regulated and 15 genes down-regulated in 25% (2/8) of twins with MS when compared to their healthy siblings. Moreover, 6/25 genes were up-regulated in 40% of MS twins and one gene, interferon alpha-inducible protein (clone IFI-6-16) (G1P3), in 50% of them. The six most constantly expressed genes are (1) G1P3, (2) POU domain, class 3, transcription factor 1, (3) myxovirus resistance 2, (4) lysosomal-associated multispanning membrane protein-5, (5) hemoglobin alpha 2 and (6) hemoglobin beta. Conclusion Over two-fold up-regulation of these six genes in almost half of MZ twins with MS suggests their role in MS pathogenesis. Studies using MZ MS twins obtained from genetically homogeneous population offer a unique opportunity to explore the genetic nature of MS. PMID:16504146

  1. Gene duplication and divergence affecting drug content in Cannabis sativa.

    PubMed

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency.

  2. How the Neanderthal in Your Genes Affects Your Health

    MedlinePlus

    ... medlineplus.gov/news/fullstory_163749.html How the Neanderthal in Your Genes Affects Your Health The DNA ... 23, 2017 THURSDAY, Feb. 23, 2017 (HealthDay News) -- Neanderthals were wiped out about 40,000 years ago, ...

  3. Expression of myriapod pair rule gene orthologs

    PubMed Central

    2011-01-01

    Background Segmentation is a hallmark of the arthropods; most knowledge about the molecular basis of arthropod segmentation comes from work on the fly Drosophila melanogaster. In this species a hierarchic cascade of segmentation genes subdivides the blastoderm stepwise into single segment wide regions. However, segmentation in the fly is a derived feature since all segments form virtually simultaneously. Conversely, in the vast majority of arthropods the posterior segments form one at a time from a posterior pre-segmental zone. The pair rule genes (PRGs) comprise an important level of the Drosophila segmentation gene cascade and are indeed the first genes that are expressed in typical transverse stripes in the early embryo. Information on expression and function of PRGs outside the insects, however, is scarce. Results Here we present the expression of the pair rule gene orthologs in the pill millipede Glomeris marginata (Myriapoda: Diplopoda). We find evidence that these genes are involved in segmentation and that components of the hierarchic interaction of the gene network as found in insects may be conserved. We further provide evidence that segments are formed in a single-segment periodicity rather than in pairs of two like in another myriapod, the centipede Strigamia maritima. Finally we show that decoupling of dorsal and ventral segmentation in Glomeris appears already at the level of the PRGs. Conclusions Although the pair rule gene network is partially conserved among insects and myriapods, some aspects of PRG interaction are, as suggested by expression pattern analysis, convergent, even within the Myriapoda. Conserved expression patterns of PRGs in insects and myriapods, however, may represent ancestral features involved in segmenting the arthropod ancestor. PMID:21352542

  4. The biocontrol bacterium Pseudomonas fluorescens Pf29Arp strain affects the pathogenesis-related gene expression of the take-all fungus Gaeumannomyces graminis var. tritici on wheat roots.

    PubMed

    Daval, Stéphanie; Lebreton, Lionel; Gazengel, Kévin; Boutin, Morgane; Guillerm-Erckelboudt, Anne-Yvonne; Sarniguet, Alain

    2011-12-01

    The main effects of antagonistic rhizobacteria on plant pathogenic fungi are antibiosis, fungistasis or an indirect constraint through the induction of a plant defence response. To explore different biocontrol mechanisms, an in vitro confrontation assay was conducted with the rhizobacterium Pseudomonas fluorescens Pf29Arp as a biocontrol agent of the fungus Gaeumannomyces graminis var. tritici (Ggt) on wheat roots. In parallel with the assessment of disease extension, together with the bacterial and fungal root colonization rates, the transcript levels of candidate fungal pathogenicity and plant-induced genes were monitored during the 10-day infection process. The bacterial inoculation of wheat roots with the Pf29Arp strain reduced the development of Ggt-induced disease expressed as attack frequency and necrosis length. The growth rates of Ggt and Pf29Arp, monitored through quantitative polymerase chain reaction of DNA amounts with a part of the Ggt 18S rDNA gene and a specific Pf29Arp strain detection probe, respectively, increased throughout the interactions. Bacterial antagonism and colonization had no significant effect on root colonization by Ggt. The expression of fungal and plant genes was quantified in planta by quantitative reverse transcription-polymerase chain reaction during the interactions thanks to the design of specific primers and an innovative universal reference system. During the early stages of the tripartite interaction, several of the fungal genes assayed were down-regulated by Pf29Arp, including two laccases, a β-1,3-exoglucanase and a mitogen-activated protein kinase. The plant host glutathione-S-transferase gene was induced by Ggt alone and up-regulated by Pf29Arp bacteria in interaction with the pathogen. We conclude that Pf29Arp antagonism acts through the alteration of fungal pathogenesis and probably through the activation of host defences.

  5. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  6. Rubisco gene expression in C4 plants.

    PubMed

    Patel, Minesh; Berry, James O

    2008-01-01

    In leaves of most C(4) plants, ribulose 1,5 bisphosphate carboxylase (Rubisco) accumulates only in bundle sheath (bs) cells that surround the vascular centres, and not in mesophyll (mp) cells. It has been shown previously that in the C(4) dicots amaranth and Flaveria bidentis, post-transcriptional control of mRNA translation and stability mediate the C(4) expression patterns of genes encoding the large and small Rubisco subunits (chloroplast rbcL and nuclear RbcS, respectively). Translational control appears to regulate bs cell-specific Rubisco gene expression during early dicot leaf development, while control of mRNA stability appears to mediate bs-specific accumulation of RbcS and rbcL transcripts in mature leaves. Post-transcriptional control is also involved in the regulation of Rubisco gene expression by light, and in response to photosynthetic activity. Transgenic and transient expression studies in F. bidentis provide direct evidence for post-transcriptional control of bs cell-specific RbcS expression, which is mediated by the 5' and 3' untranslated regions (UTRs) of the mRNA. Comparisons of Rubisco gene expression in these dicots and in the monocot maize indicates possible commonalities in the regulation of RbcS and rbcL genes in these divergent C(4) species. Now that the role of post-transcriptional regulation in C(4) gene expression has been established, it is likely that future studies of mRNA-protein interactions will address long-standing questions about the establishment and maintenance of cell type-specificity in these plants. Some of these regulatory mechanisms may have ancestral origins in C(3) species, through modification of pre-existing factors, or by the acquisition of novel C(4) processes.

  7. Alternative-splicing-mediated gene expression

    NASA Astrophysics Data System (ADS)

    Wang, Qianliang; Zhou, Tianshou

    2014-01-01

    Alternative splicing (AS) is a fundamental process during gene expression and has been found to be ubiquitous in eukaryotes. However, how AS impacts gene expression levels both quantitatively and qualitatively remains to be fully explored. Here, we analyze two common models of gene expression, each incorporating a simple splice mechanism that a pre-mRNA is spliced into two mature mRNA isoforms in a probabilistic manner. In the constitutive expression case, we show that the steady-state molecular numbers of two mature mRNA isoforms follow mutually independent Poisson distributions. In the bursting expression case, we demonstrate that the tail decay of the steady-state distribution for both mature mRNA isoforms that in general are not mutually independent can be characterized by the product of mean burst size and splicing probability. In both cases, we find that AS can efficiently modulate both the variability (measured by variance) and the noise level of the total mature mRNA, and in particular, the latter is always lower than the noise level of the pre-mRNA, implying that AS always reduces the noise. These results altogether reveal that AS is a mechanism of efficiently controlling the gene expression noise.

  8. VSG gene expression site control in insect form Trypanosoma brucei.

    PubMed

    Rudenko, G; Blundell, P A; Taylor, M C; Kieft, R; Borst, P

    1994-11-15

    When the African trypanosome Trypanosoma brucei is taken up from mammals by a tse-tse fly, it replaces its variant surface glycoprotein (VSG) coat by a procyclin coat. Transcription of VSG genes stops in the fly, but transcription of sequences derived from the promoter area of the VSG expression site(s) remains high. Whether this is due to continuing high activity of one promoter or to low activity of many promoters was unclear. We have used the small differences between the sequences of different expression sites to show that multiple expression site promoters are active in insect form trypanosomes. This is confirmed by the low expression of single copy marker genes introduced into the transcribed area. However, if the expression site promoter is removed from the genomic location of the expression site and inserted in the non-transcribed spacer of the ribosomal DNA (rDNA), it is derepressed. Derepression of transcription can also be accomplished by replacing the promoter of an expression site by an rDNA promoter. We conclude that the down-regulation of VSG gene expression site promoters in insect form trypanosomes is affected by both the DNA sequence of the promoter and the genomic context in which it resides.

  9. Naloxone treatment alters gene expression in the mesolimbic reward system in 'junk food' exposed offspring in a sex-specific manner but does not affect food preferences in adulthood.

    PubMed

    Gugusheff, J R; Ong, Z Y; Muhlhausler, B S

    2014-06-22

    We have previously reported that the opioid receptor blocker, naloxone, is less effective in reducing palatable food intake in offspring exposed to a maternal cafeteria diet during the perinatal period, implicating a desensitization of the central opioid pathway in the programming of food preferences. The present study aimed to investigate the effect of a maternal cafeteria diet and naloxone treatment on the development of the mesolimbic reward pathway and food choices in adulthood. We measured mRNA expression of key components of the reward pathway (mu-opioid receptor, proenkephalin, tyrosine hydroxylase, D1 and D2 receptors and the dopamine active transporter (DAT)) in the nucleus accumbens (NAc) and ventral tegmental area (VTA) of the offspring of control and cafeteria fed (JF) dams at weaning and after a 10-day naloxone treatment post-weaning and determined food preferences in adulthood in the remaining offspring. Naloxone treatment decreased the expression of DAT by 8.2 fold in female control offspring but increased it by 4.3 fold in female offspring of JF dams relative to the saline-injected reference groups. Proenkephalin mRNA expression was higher in the NAc of female JF offspring compared to controls, independent of naloxone treatment (P<0.05). There was no effect of naloxone treatment on food preferences in adulthood in either control or JF offspring. These data indicate that prenatal exposure to a cafeteria diet alters the impact of opioid signaling blockade in the early post-weaning period on gene expression in the central reward pathway in a sex specific manner, but that these changes in gene expression do not appear to have any persistent impact on food preferences in adulthood.

  10. Garlic Influences Gene Expression In Vivo and In Vitro.

    PubMed

    Charron, Craig S; Dawson, Harry D; Novotny, Janet A

    2016-02-01

    There is a large body of preclinical research aimed at understanding the roles of garlic and garlic-derived preparations in the promotion of human health. Most of this research has targeted the possible functions of garlic in maintaining cardiovascular health and in preventing and treating cancer. A wide range of outcome variables has been used to investigate the bioactivity of garlic, ranging from direct measures of health status such as cholesterol concentrations, blood pressure, and changes in tumor size and number, to molecular and biochemical measures such as mRNA gene expression, protein concentration, enzyme activity, and histone acetylation status. Determination of how garlic influences mRNA gene expression has proven to be a valuable approach to elucidating the mechanisms of garlic bioactivity. Preclinical studies investigating the health benefits of garlic far outnumber human studies and have made frequent use of mRNA gene expression measurement. There is an immediate need to understand mRNA gene expression in humans as well. Although safety and ethical constraints limit the types of available human tissue, peripheral whole blood is readily accessible, and measuring mRNA gene expression in whole blood may provide a unique window to understanding how garlic intake affects human health.

  11. Gene expression profiles in irradiated cancer cells

    NASA Astrophysics Data System (ADS)

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.

    2013-07-01

    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  12. Gene expression profiles in irradiated cancer cells

    SciTech Connect

    Minafra, L.; Bravatà, V.; Russo, G.; Ripamonti, M.; Gilardi, M. C.

    2013-07-26

    Knowledge of the molecular and genetic mechanisms underlying cellular response to radiation may provide new avenues to develop innovative predictive tests of radiosensitivity of tumours and normal tissues and to improve individual therapy. Nowadays very few studies describe molecular changes induced by hadrontherapy treatments, therefore this field has to be explored and clarified. High-throughput methodologies, such as DNA microarray, allow us to analyse mRNA expression of thousands of genes simultaneously in order to discover new genes and pathways as targets of response to hadrontherapy. Our aim is to elucidate the molecular networks involved in the sensitivity/resistance of cancer cell lines subjected to hadrontherapy treatments with a genomewide approach by using cDNA microarray technology to identify gene expression profiles and candidate genes responsible of differential cellular responses.

  13. Microgravity and immunity: Changes in lymphocyte gene expression.

    NASA Astrophysics Data System (ADS)

    Risin, D.; Ward, N. E.; Risin, S. A.; Pellis, N. R.

    Earlier studies had shown that modeled and true microgravity MG cause multiple direct effects on human lymphocytes MG inhibits lymphocyte locomotion suppresses polyclonal and antigen-specific activation affects signal transduction mechanisms as well as activation-induced apoptosis In this study we assessed changes in gene expression associated with lymphocyte exposure to microgravity in an attempt to identify microgravity-sensitive genes MGSG in general and specifically those genes that might be responsible for the functional and structural changes observed earlier Two sets of experiments targeting different goals were conducted In the first set T-lymphocytes from normal donors were activated with anti-CD3 and IL2 and then cultured in 1g static and modeled MG MMG conditions Rotating Wall Vessel bioreactor for 24 hours This setting allowed searching for MGSG by comparison of gene expression patterns in zero and 1 g gravity In the second set - activated T-cells after culturing for 24 hours in 1g and MMG were exposed three hours before harvesting to a secondary activation stimulus PHA thus triggering the apoptotic pathway Total RNA was extracted using the RNeasy isolation kit Qiagen Valencia CA Affymetrix Gene Chips U133A allowing testing for 18 400 human genes were used for microarray analysis The experiments were performed in triplicates with T-cells obtained from different blood donors to minimize the possible input of biological variation in gene expression and discriminate changes that are associated with the

  14. Visualizing Gene Expression In Situ

    SciTech Connect

    Burlage, R.S.

    1998-11-02

    Visualizing bacterial cells and describing their responses to the environment are difficult tasks. Their small size is the chief reason for the difficulty, which means that we must often use many millions of cells in a sample in order to determine what the average response of the bacteria is. However, an average response can sometimes mask important events in bacterial physiology, which means that our understanding of these organisms will suffer. We have used a variety of instruments to visualize bacterial cells, all of which tell us something different about the sample. We use a fluorescence activated cell sorter to sort cells based on the fluorescence provided by bioreporter genes, and these can be used to select for particular genetic mutations. Cells can be visualized by epifluorescent microscopy, and sensitive photodetectors can be added that allow us to find a single bacterial cell that is fluorescent or bioluminescent. We have also used standard photomultipliers to examine cell aggregates as field bioreporter microorganisms. Examples of each of these instruments show how our understanding of bacterial physiology has changed with the technology.

  15. Gene expression profile in pelvic organ prolapse†

    PubMed Central

    Brizzolara, S.S.; Killeen, J.; Urschitz, J.

    2009-01-01

    It was hypothesized that the processes contributing to pelvic organ prolapse (POP) may be identified by transcriptional profiling of pelvic connective tissue in conjunction with light microscopy. In order to test this, we performed a frequency-matched case–control study of women undergoing hysterectomy for POP and controls. Total RNA, extracted from uterosacral and round ligament samples used to generate labeled cRNA, was hybridized to microarrays and analyzed for the expression of 32 878 genes. Significance Analysis of Microarrays (Stanford University, CA, USA) identified differentially expressed genes used for ontoanalysis. Quantitative PCR (qPCR) confirmed results. Light microscopy confirmed the tissue type and assessed inflammatory infiltration. The analysis of 34 arrays revealed 249 differentially expressed genes with fold changes (FC) larger than 1.5 and false discovery rates ≤5.2%. Immunity and defense was the most significant biological process differentially expressed in POP. qPCR confirmed the elevated steady-state mRNA levels for four genes: interleukin-6 (FC 9.8), thrombospondin 1 (FC 3.5) and prostaglandin-endoperoxide synthase 2 (FC 2.4) and activating transcription factor 3 (FC 2.6). Light microscopy showed all the samples were composed of fibromuscular connective tissue with no inflammatory infiltrates. In conclusion, genes enriched for ‘immunity and defense’ contribute to POP independent of inflammatory infiltrates. PMID:19056808

  16. Clustering of High Throughput Gene Expression Data

    PubMed Central

    Pirim, Harun; Ekşioğlu, Burak; Perkins, Andy; Yüceer, Çetin

    2012-01-01

    High throughput biological data need to be processed, analyzed, and interpreted to address problems in life sciences. Bioinformatics, computational biology, and systems biology deal with biological problems using computational methods. Clustering is one of the methods used to gain insight into biological processes, particularly at the genomics level. Clearly, clustering can be used in many areas of biological data analysis. However, this paper presents a review of the current clustering algorithms designed especially for analyzing gene expression data. It is also intended to introduce one of the main problems in bioinformatics - clustering gene expression data - to the operations research community. PMID:23144527

  17. Facilitated diffusion buffers noise in gene expression.

    PubMed

    Schoech, Armin P; Zabet, Nicolae Radu

    2014-09-01

    Transcription factors perform facilitated diffusion [three-dimensional (3D) diffusion in the cytosol and 1D diffusion on the DNA] when binding to their target sites to regulate gene expression. Here, we investigated the influence of this binding mechanism on the noise in ge